Sample records for expressing mutant human

  1. Candidate genes for panhypopituitarism identified by gene expression profiling

    PubMed Central

    Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis

    2011-01-01

    Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248

  2. Expression of CALR mutants causes mpl-dependent thrombocytosis in zebrafish.

    PubMed

    Lim, K-H; Chang, Y-C; Chiang, Y-H; Lin, H-C; Chang, C-Y; Lin, C-S; Huang, L; Wang, W-T; Gon-Shen Chen, C; Chou, W-C; Kuo, Y-Y

    2016-10-07

    CALR mutations are identified in about 30% of JAK2/MPL-unmutated myeloproliferative neoplasms (MPNs) including essential thrombocythemia (ET) and primary myelofibrosis. Although the molecular pathogenesis of CALR mutations leading to MPNs has been studied using in vitro cell lines models, how mutant CALR may affect developmental hematopoiesis remains unknown. Here we took advantage of the zebrafish model to examine the effects of mutant CALR on early hematopoiesis and model human CALR-mutated MPNs. We identified three zebrafish genes orthologous to human CALR, referred to as calr, calr3a and calr3b. The expression of CALR-del52 and CALR-ins5 mutants caused an increase in the hematopoietic stem/progenitor cells followed by thrombocytosis without affecting normal angiogenesis. The expression of CALR mutants also perturbed early developmental hematopoiesis in zebrafish. Importantly, morpholino knockdown of mpl but not epor or csf3r could significantly attenuate the effects of mutant CALR. Furthermore, the expression of mutant CALR caused jak-stat signaling activation in zebrafish that could be blocked by JAK inhibitors (ruxolitinib and fedratinib). These findings showed that mutant CALR activates jak-stat signaling through an mpl-dependent mechanism to mediate pathogenic thrombopoiesis in zebrafish, and illustrated that the signaling machinery related to mutant CALR tumorigenesis are conserved between human and zebrafish.

  3. Cell Transformation by PTP1B Truncated Mutants Found in Human Colon and Thyroid Tumors.

    PubMed

    Mei, Wenhan; Wang, Kemin; Huang, Jian; Zheng, Xinmin

    2016-01-01

    Expression of wild-type protein tyrosine phosphatase (PTP) 1B may act either as a tumor suppressor by dysregulation of protein tyrosine kinases or a tumor promoter through Src dephosphorylation at Y527 in human breast cancer cells. To explore whether mutated PTP1B is involved in human carcinogenesis, we have sequenced PTP1B cDNAs from human tumors and found splice mutations in ~20% of colon and thyroid tumors. The PTP1BΔE6 mutant expressed in these two tumor types and another PTP1BΔE5 mutant expressed in colon tumor were studied in more detail. Although PTP1BΔE6 revealed no phosphatase activity compared with wild-type PTP1B and the PTP1BΔE5 mutant, its expression induced oncogenic transformation of rat fibroblasts without Src activation, indicating that it involved signaling pathways independent of Src. The transformed cells were tumourigenic in nude mice, suggesting that the PTP1BΔE6 affected other molecule(s) in the human tumors. These observations may provide a novel therapeutic target for colon and thyroid cancer.

  4. Human COQ9 Rescues a coq9 Yeast Mutant by Enhancing Coenzyme Q Biosynthesis from 4-Hydroxybenzoic Acid and Stabilizing the CoQ-Synthome

    PubMed Central

    He, Cuiwen H.; Black, Dylan S.; Allan, Christopher M.; Meunier, Brigitte; Rahman, Shamima; Clarke, Catherine F.

    2017-01-01

    Coq9 is required for the stability of a mitochondrial multi-subunit complex, termed the CoQ-synthome, and the deamination step of Q intermediates that derive from para-aminobenzoic acid (pABA) in yeast. In human, mutations in the COQ9 gene cause neonatal-onset primary Q10 deficiency. In this study, we determined whether expression of human COQ9 could complement yeast coq9 point or null mutants. We found that expression of human COQ9 rescues the growth of the temperature-sensitive yeast mutant, coq9-ts19, on a non-fermentable carbon source and increases the content of Q6, by enhancing Q biosynthesis from 4-hydroxybenzoic acid (4HB). To study the mechanism for the rescue by human COQ9, we determined the steady-state levels of yeast Coq polypeptides in the mitochondria of the temperature-sensitive yeast coq9 mutant expressing human COQ9. We show that the expression of human COQ9 significantly increased steady-state levels of yeast Coq4, Coq6, Coq7, and Coq9 at permissive temperature. Human COQ9 polypeptide levels persisted at non-permissive temperature. A small amount of the human COQ9 co-purified with tagged Coq6, Coq6-CNAP, indicating that human COQ9 interacts with the yeast Q-biosynthetic complex. These findings suggest that human COQ9 rescues the yeast coq9 temperature-sensitive mutant by stabilizing the CoQ-synthome and increasing Q biosynthesis from 4HB. This finding provides a powerful approach to studying the function of human COQ9 using yeast as a model. PMID:28736527

  5. Effects of mutant human Ki-ras{sup G12C} gene dosage on murine lung tumorigenesis and signaling to its downstream effectors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dance-Barnes, Stephanie T.; Kock, Nancy D.; Floyd, Heather S.

    2008-08-15

    Studies in cell culture have suggested that the level of RAS expression can influence the transformation of cells and the signaling pathways stimulated by mutant RAS expression. However, the levels of RAS expression in vivo appear to be subject to feedback regulation, limiting the total amount of RAS protein that can be expressed. We utilized a bitransgenic mouse lung tumor model that expressed the human Ki-ras{sup G12C} allele in a tetracycline-inducible, lung-specific manner. Treatment for 12 months with 500 {mu}g/ml of doxycycline (DOX) allowed for maximal expression of the human Ki-ras{sup G12C} allele in the lung, and resulted in themore » development of focal hyperplasia and adenomas. We determined if different levels of mutant RAS expression would influence the phenotype of the lung lesions. Treatment with 25, 100 and 500 {mu}g/ml of DOX resulted in dose-dependent increases in transgene expression and tumor multiplicity. Microscopic analysis of the lungs of mice treated with the 25 {mu}g/ml dose of DOX revealed infrequent foci of hyperplasia, whereas mice treated with the 100 and 500 {mu}g/ml doses exhibited numerous hyperplastic foci and also adenomas. Immunohistochemical and RNA analysis of the downstream effector pathways demonstrated that different levels of mutant RAS transgene expression resulted in differences in the expression and/or phosphorylation of specific signaling molecules. Our results suggest that the molecular alterations driving tumorigenesis may differ at different levels of mutant Ki-ras{sup G12C} expression, and this should be taken into consideration when inducible transgene systems are utilized to promote tumorigenesis in mouse models.« less

  6. Elevated expression of ribosomal protein genes L37, RPP-1, and S2 in the presence of mutant p53.

    PubMed

    Loging, W T; Reisman, D

    1999-11-01

    The wild-type p53 protein is a DNA-binding transcription factor that activates genes such as p21, MDM2, GADD45, and Bax that are required for the regulation of cell cycle progression or apoptosis in response to DNA damage. Mutant forms of p53, which are transforming oncogenes and are expressed at high levels in tumor cells, generally have a reduced binding affinity for the consensus DNA sequence. Interestingly, some p53 mutants that are no longer effective at binding to the consensus DNA sequence and transactivating promoters containing this target site have acquired the ability to transform cells in culture, in part through their ability to transactivate promoters of a number of genes that are not targets of the wild-type protein. Certain p53 mutants are therefore considered to be gain-of-function mutants and appear to be promoting proliferation or transforming cells through their ability to alter the expression of novel sets of genes. Our goal is to identify genes that have altered expression in the presence of a specific mutant p53 (Arg to Trp mutation at codon 248) protein. Through examining differential gene expression in cells devoid of p53 expression and in cells that express high levels of mutant p53 protein, we have identified three ribosomal protein genes that have elevated expression in response to mutant p53. Consistent with these findings, the overexpression of a number of ribosomal protein genes in human tumors and evidence for their contribution to oncogenic transformation have been reported previously, although the mechanism leading to this overexpression has remained elusive. We show results that indicate that expression of these specific ribosomal protein genes is increased in the presence of the R248W p53 mutant, which provides a mechanism for their overexpression in human tumors.

  7. Differential transcriptional activation by human T-cell leukemia virus type 1 Tax mutants is mediated by distinct interactions with CREB binding protein and p300.

    PubMed

    Bex, F; Yin, M J; Burny, A; Gaynor, R B

    1998-04-01

    The human T-cell leukemia virus type 1 Tax protein transforms human T lymphocytes, which can lead to the development of adult T-cell leukemia. Tax transformation is related to its ability to activate gene expression via the ATF/CREB and the NF-kappaB pathways. Transcriptional activation of these pathways is mediated by the actions of the related coactivators CREB binding protein (CBP) and p300. In this study, immunocytochemistry and confocal microscopy were used to localize CBP and p300 in cells expressing wild-type Tax or Tax mutants that are able to selectively activate gene expression from either the NF-kappaB or ATF/CREB pathway. Wild-type Tax colocalized with both CBP and p300 in nuclear bodies which also contained ATF-1 and the RelA subunit of NF-kappaB. However, a Tax mutant that selectively activates gene expression from only the ATF/CREB pathway colocalized with CBP but not p300, while a Tax mutant that selectively activates gene expression from only the NF-kappaB pathway colocalized with p300 but not CBP. In vitro and in vivo protein interaction studies indicated that the integrity of two independent domains of Tax delineated by these mutants was involved in the direct interaction of Tax with either CBP or p300. These studies are consistent with a model in which activation of either the NF-kappaB or the ATF/CREB pathway by specific Tax mutants is mediated by distinct interactions with related coactivator proteins.

  8. Expression of the Flp proteins by Haemophilus ducreyi is necessary for virulence in human volunteers.

    PubMed

    Janowicz, Diane M; Cooney, Sean A; Walsh, Jessica; Baker, Beth; Katz, Barry P; Fortney, Kate R; Zwickl, Beth W; Ellinger, Sheila; Munson, Robert S

    2011-09-22

    Haemophilus ducreyi, the causative agent of the sexually transmitted disease chancroid, contains a flp (fimbria like protein) operon that encodes proteins predicted to contribute to adherence and pathogenesis. H. ducreyi mutants that lack expression of Flp1 and Flp2 or TadA, which has homology to NTPases of type IV secretion systems, have decreased abilities to attach to and form microcolonies on human foreskin fibroblasts (HFF). A tadA mutant is attenuated in its ability to cause disease in human volunteers and in the temperature dependent rabbit model, but a flp1flp2 mutant is virulent in rabbits. Whether a flp deletion mutant would cause disease in humans is not clear. We constructed 35000HPΔflp1-3, a deletion mutant that lacks expression of all three Flp proteins but has an intact tad secretion system. 35000HPΔflp1-3 was impaired in its ability to form microcolonies and to attach to HFF in vitro when compared to its parent (35000HP). Complementation of the mutant with flp1-3 in trans restored the parental phenotype. To test whether expression of Flp1-3 was necessary for virulence in humans, ten healthy adult volunteers were experimentally infected with a fixed dose of 35000HP (ranging from 54 to 67 CFU) on one arm and three doses of 35000HPΔflp1-3 (ranging from 63 to 961 CFU) on the other arm. The overall papule formation rate for the parent was 80% (95% confidence interval, CI, 55.2%-99.9%) and for the mutant was 70.0% (95% CI, 50.5%-89.5%) (P = 0.52). Mutant papules were significantly smaller (mean, 11.2 mm2) than were parent papules (21.8 mm2) 24 h after inoculation (P = 0.018). The overall pustule formation rates were 46.7% (95% CI 23.7-69.7%) at 30 parent sites and 6.7% (95% CI, 0.1-19.1%) at 30 mutant sites (P = 0.001). These data suggest that production and secretion of the Flp proteins contributes to microcolony formation and attachment to HFF cells in vitro. Expression of flp1-3 is also necessary for H. ducreyi to initiate disease and progress to pustule formation in humans. Future studies will focus on how Flp proteins contribute to microcolony formation and attachment in vivo. © 2011 Janowicz et al; licensee BioMed Central Ltd.

  9. An efficient deletion mutant packaging system for defective herpes simplex virus vectors: Potential applications to human gene therapy and neuronal physiology

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Geller, A.I.; Keyomarsi, K.; Bryan, J.

    1990-11-01

    The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli {beta}-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; tsmore » mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses {beta}-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system.« less

  10. RNA interference-mediated silencing of mutant superoxide dismutase rescues cyclosporin A-induced death in cultured neuroblastoma cells

    PubMed Central

    Maxwell, Michele M.; Pasinelli, Piera; Kazantsev, Aleksey G.; Brown, Robert H.

    2004-01-01

    Amyotrophic lateral sclerosis (ALS) is a progressive and fatal neurodegenerative disorder resulting from selective death of motor neurons in the brain and spinal cord. In ≈25% of familial ALS cases, the disease is caused by dominantly acting point mutations in the gene encoding cytosolic Cu,Zn superoxide dismutase (SOD1). In cell culture and in rodent models of ALS, mutant SOD1 proteins exhibit dose-dependent toxicity; thus, agents that reduce mutant protein expression would be powerful therapeutic tools. A wealth of recent evidence has demonstrated that the mechanism of RNA-mediated interference (RNAi) can be exploited to achieve potent and specific gene silencing in vitro and in vivo. We have evaluated the utility of RNAi for selective silencing of mutant SOD1 expression in cultured cells and have identified small interfering RNAs capable of specifically inhibiting expression of ALS-linked mutant, but not wild-type, SOD1. We have investigated the functional effects of RNAi-mediated silencing of mutant SOD1 in cultured murine neuroblastoma cells. In this model, stable expression of mutant, but not wild-type, human SOD1 sensitizes cells to cytotoxic stimuli. We find that silencing of mutant SOD1 protects these cells against cyclosporin A-induced cell death. These results demonstrate a positive physiological effect caused by RNAi-mediated silencing of a dominant disease allele. The present study further supports the therapeutic potential of RNAi-based methods for the treatment of inherited human diseases, including ALS. PMID:14981234

  11. Inhibition of Excessive Monoamine Oxidase A/B Activity Protects Against Stress-induced Neuronal Death in Huntington Disease.

    PubMed

    Ooi, Jolene; Hayden, Michael R; Pouladi, Mahmoud A

    2015-12-01

    Monoamine oxidases (MAO) are important components of the homeostatic machinery that maintains the levels of monoamine neurotransmitters, including dopamine, in balance. Given the imbalance in dopamine levels observed in Huntington disease (HD), the aim of this study was to examine MAO activity in a mouse striatal cell model of HD and in human neural cells differentiated from control and HD patient-derived induced pluripotent stem cell (hiPSC) lines. We show that mouse striatal neural cells expressing mutant huntingtin (HTT) exhibit increased MAO expression and activity. We demonstrate using luciferase promoter assays that the increased MAO expression reflects enhanced epigenetic activation in striatal neural cells expressing mutant HTT. Using cellular stress paradigms, we further demonstrate that the increase in MAO activity in mutant striatal neural cells is accompanied by enhanced susceptibility to oxidative stress and impaired viability. Treatment of mutant striatal neural cells with MAO inhibitors ameliorated oxidative stress and improved cellular viability. Finally, we demonstrate that human HD neural cells exhibit increased MAO-A and MAO-B expression and activity. Altogether, this study demonstrates abnormal MAO expression and activity and suggests a potential use for MAO inhibitors in HD.

  12. Stromal deletion of the APC tumor suppressor in mice triggers development of endometrial cancer

    PubMed Central

    Tanwar, Pradeep S.; Zhang, LiHua; Roberts, Drucilla J.; Teixeira, Jose M.

    2011-01-01

    The contribution of the stromal microenvironment to the progression of endometrial cancer (EC) has not been well explored. We have conditionally expressed a mutant allele of adenomatous polyposis coli (APCcKO) in murine uterine stroma cells to study its effect on uterine development and function. In addition to metrorrhagia, the mice develop complex atypical endometrial gland hyperplasia that progresses to endometrial carcinoma in situ and endometrial adenocarcinoma as evidenced by myometrial invasion. Stromal cells subjacent to the carcinoma cells express αSMA with fewer cells expressing PDGFR-α compared to normal stromal cells suggesting that the mutant stromal cells have acquired a more myofibroblastic phenotype, which have been described as cancer-associated fibroblasts and have been shown to induce carcinogenesis in other organ systems. Analyses of human EC specimens showed substantial αSMA expression in the stroma compared with normal endometrial stroma cells. We also show that APCcKO mutant uteri and human EC have decreased stromal levels of TGFβ and BMP activities and that the mutant uteri failed to respond to exogenous estradiol stimulation. The mutant stroma cells also had higher levels of VEGF and SDF signaling components and diminished expression of ERα and PR which is common in advanced stages of human EC and is an indicator of poor prognosis. Our results indicate that de novo mutation or loss of heterozygosity in stromal APC is sufficient to induce endometrial hyperplasia and endometrial carcinogenesis by mechanisms that are consistent with unopposed estrogen signaling in the endometrial epithelium. PMID:21363919

  13. Keratitis-Ichthyosis-Deafness syndrome-associated Cx26 mutants produce nonfunctional gap junctions but hyperactive hemichannels when co-expressed with wild type Cx43

    PubMed Central

    García, Isaac E.; Maripillán, Jaime; Jara, Oscar; Ceriani, Ricardo; Palacios-Muñoz, Angelina; Ramachandran, Jayalakshimi; Olivero, Pablo; Pérez-Acle, Tomás; González, Carlos; Sáez, Juan C.; Contreras, Jorge E.; Martínez, Agustín D.

    2015-01-01

    Mutations in Cx26 gene are found in most cases of human genetic deafness. Some mutations produce syndromic deafness associated with skin disorders, like Keratitis Ichthyosis Deafness syndrome (KID). Because in the human skin Cx26 is co-expressed with other connexins, like Cx43 and Cx30, and since KID syndrome is inherited as autosomal dominant condition, it is possible that KID mutations change the way Cx26 interacts with other co-expressed connexins. Indeed, some Cx26 syndromic mutations showed gap junction dominant negative effect when co-expressed with wild type connexins, including Cx26 and Cx43. The nature of these interactions and the consequences on hemichannels and gap junction channels functions remain unknown. In this study we demonstrate that syndromic mutations at the N-terminus segment of Cx26, change connexin oligomerization compatibility, allowing aberrant interactions with Cx43. Strikingly, heteromeric oligomer formed by Cx43/Cx26 (syndromic mutants) show exacerbated hemichannel activity, but nonfunctional gap junction channels; this also occurs for those Cx26 KID mutants that do not show functional homomeric hemichannels. Heterologous expression of these hyperactive heteromeric hemichannels increases cell membrane permeability, favoring ATP release and Ca2+ overload. The functional paradox produced by oligomerization of Cx43 and Cx26 KID mutants could underlie the severe syndromic phenotype in human skin. PMID:25625422

  14. C-terminally truncated form of αB-crystallin is associated with IDH1 R132H mutation in anaplastic astrocytoma.

    PubMed

    Avliyakulov, Nuraly K; Rajavel, Kavitha S; Le, Khanh Minh T; Guo, Lea; Mirsadraei, Leili; Yong, William H; Liau, Linda M; Li, Sichen; Lai, Albert; Nghiemphu, Phioanh L; Cloughesy, Timothy F; Linetsky, Michael; Haykinson, Michael J; Pope, Whitney B

    2014-03-01

    Malignant gliomas are the most common human primary brain tumors. Point mutation of amino acid arginine 132 to histidine (R132H) in the IDH1 protein leads to an enzymatic gain-of-function and is thought to promote gliomagenesis. Little is known about the downstream effects of the IDH1 mutation on protein expression and how and whether changes in protein expression are involved in tumor formation or propagation. In the current study, we used 2D DIGE (difference gel electrophoresis) and mass spectrometry to analyze differences in protein expression between IDH1(R132H) mutant and wild type anaplastic (grade III) astrocytoma from human brain cancer tissues. We show that expression levels of many proteins are altered in IDH1(R132H) mutant anaplastic astrocytoma. Some of the most over-expressed proteins in the mutants include several forms of αB-crystallin, a small heat-shock and anti-apoptotic protein. αB-crystallin proteins are elevated up to 22-fold in IDH1(R132H) mutant tumors, and αB-crystallin expression appears to be controlled at the post-translational level. We identified the most abundant form of αB-crystallin as a low molecular weight species that is C-terminally truncated. We also found that overexpression of αB-crystallin can be induced by transfecting U251 human glioblastoma cell lines with the IDH1(R132H) mutation. In conclusion, the association of a C-terminally truncated form of αB-crystallin protein with the IDH1(R132H) mutation is a novel finding that could impact apoptosis and stress response in IDH1 mutant glioma.

  15. Dominant-negative action of disease-causing gonadotropin-releasing hormone receptor (GnRHR) mutants: a trait that potentially coevolved with decreased plasma membrane expression of GnRHR in humans.

    PubMed

    Leaños-Miranda, Alfredo; Ulloa-Aguirre, Alfredo; Ji, Tae H; Janovick, Jo Ann; Conn, P Michael

    2003-07-01

    Loss of function by 11 of 13 naturally occurring mutations in the human GnRH receptor (hGnRHR) was thought to result from impaired ligand binding or effector coupling, but actually results from receptor misrouting. Homo- or heterodimerization of mutant receptors with wild-type (WT) receptors occurs for other G protein-coupled receptors and may result in dominant-negative or -positive effects on the WT receptor. We tested the hypothesis that WT hGnRHR function was affected by misfolded hGnRHR mutants. hGnRHR mutants were found to inhibit the function of WT GnRHR (measured by activation of effector and ligand binding). Inhibition varied depending on the particular hGnRHR mutant coexpressed and the ratio of hGnRHR mutant to WT hGnRHR cDNA cotransfected. The hGnRHR mutants did not interfere with the function of genetically modified hGnRHRs bearing either a deletion of primate-specific Lys(191) or the carboxyl-terminal tail of the catfish GnRHR; these show intrinsically enhanced expression. Moreover, a peptidomimetic antagonist of GnRH enhanced the expression of WT hGnRHR, but not of genetically modified hGnRHR species. The dominant-negative effect of the naturally occurring receptor mutants occurred only for the WT hGnRHR, which has intrinsic low maturation efficiency. The data suggest that this dominant negative effect accompanies the diminished plasma membrane expression as a recent evolutionary event.

  16. Fused pulmonary lobes is a rat model of human Fraser syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kiyozumi, Daiji; Nakano, Itsuko; Takahashi, Ken L.

    Highlights: {yields} Fused pulmonary lobes (fpl) mutant rats exhibit similar phenotypes to Fraser syndrome. {yields} The fpl gene harbors a nonsense mutation in Fraser syndrome-associated gene Frem2. {yields} Fpl mutant is defined as a first model of human Fraser syndrome in rats. -- Abstract: Fused pulmonary lobes (fpl) is a mutant gene that is inherited in an autosomal recessive manner and causes various developmental defects, including fusion of pulmonary lobes, and eyelid and digit anomalies in rats. Since these developmental defects closely resemble those observed in patients with Fraser syndrome, a recessive multiorgan disorder, and its model animals, we investigatedmore » whether the abnormal phenotypes observed in fpl/fpl mutant rats are attributable to a genetic disorder similar to Fraser syndrome. At the epidermal basement membrane in fpl/fpl mutant neonates, the expression of QBRICK, a basement membrane protein whose expression is attenuated in Fraser syndrome model mice, was greatly diminished compared with control littermates. Quantitative RT-PCR analyses of Fraser syndrome-related genes revealed that Frem2 transcripts were markedly diminished in QBRICK-negative embryos. Genomic DNA sequencing of the fpl/fpl mutant identified a nonsense mutation that introduced a stop codon at serine 2005 in Frem2. These findings indicate that the fpl mutant is a rat model of human Fraser syndrome.« less

  17. Immunization with a Recombinant, Pseudomonas fluorescens-Expressed, Mutant Form of Bacillus anthracis-Derived Protective Antigen Protects Rabbits from Anthrax Infection.

    PubMed

    Reed, Matthew D; Wilder, Julie A; Mega, William M; Hutt, Julie A; Kuehl, Philip J; Valderas, Michelle W; Chew, Lawrence L; Liang, Bertrand C; Squires, Charles H

    2015-01-01

    Protective antigen (PA), one of the components of the anthrax toxin, is the major component of human anthrax vaccine (Biothrax). Human anthrax vaccines approved in the United States and Europe consist of an alum-adsorbed or precipitated (respectively) supernatant material derived from cultures of toxigenic, non-encapsulated strains of Bacillus anthracis. Approved vaccination schedules in humans with either of these vaccines requires several booster shots and occasionally causes adverse injection site reactions. Mutant derivatives of the protective antigen that will not form the anthrax toxins have been described. We have cloned and expressed both mutant (PA SNKE167-ΔFF-315-E308D) and native PA molecules recombinantly and purified them. In this study, both the mutant and native PA molecules, formulated with alum (Alhydrogel), elicited high titers of anthrax toxin neutralizing anti-PA antibodies in New Zealand White rabbits. Both mutant and native PA vaccine preparations protected rabbits from lethal, aerosolized, B. anthracis spore challenge subsequent to two immunizations at doses of less than 1 μg.

  18. Drosophila Torsin Protein Regulates Motor Control and Stress Sensitivity and Forms a Complex with Fragile-X Mental Retardation Protein

    PubMed Central

    Ahn, Hyo-Min; Koh, Young Ho

    2016-01-01

    We investigated unknown in vivo functions of Torsin by using Drosophila as a model. Downregulation of Drosophila Torsin (DTor) by DTor-specific inhibitory double-stranded RNA (RNAi) induced abnormal locomotor behavior and increased susceptibility to H2O2. In addition, altered expression of DTor significantly increased the numbers of synaptic boutons. One important biochemical consequence of DTor-RNAi expression in fly brains was upregulation of alcohol dehydrogenase (ADH). Altered expression of ADH has also been reported in Drosophila Fragile-X mental retardation protein (DFMRP) mutant flies. Interestingly, expression of DFMRP was altered in DTor mutant flies, and DTor and DFMRP were present in the same protein complexes. In addition, DTor and DFMRP immunoreactivities were partially colocalized in several cellular organelles in larval muscles. Furthermore, there were no significant differences between synaptic morphologies of dfmrp null mutants and dfmrp mutants expressing DTor-RNAi. Taken together, our evidences suggested that DTor and DFMRP might be present in the same signaling pathway regulating synaptic plasticity. In addition, we also found that human Torsin1A and human FMRP were present in the same protein complexes, suggesting that this phenomenon is evolutionarily conserved. PMID:27313903

  19. Schwann cell hyperplasia and tumors in transgenic mice expressing a naturally occurring mutant NF2 protein

    PubMed Central

    Giovannini, Marco; Robanus-Maandag, Els; Niwa-Kawakita, Michiko; van der Valk, Martin; Woodruff, James M.; Goutebroze, Laurence; Mérel, Philippe; Berns, Anton; Thomas, Gilles

    1999-01-01

    Specific mutations in some tumor suppressor genes such as p53 can act in a dominant fashion. We tested whether this mechanism may also apply for the neurofibromatosis type-2 gene (NF2) which, when mutated, leads to schwannoma development. Transgenic mice were generated that express, in Schwann cells, mutant NF2 proteins prototypic of natural mutants observed in humans. Mice expressing a NF2 protein with an interstitial deletion in the amino-terminal domain showed high prevalence of Schwann cell-derived tumors and Schwann cell hyperplasia, whereas those expressing a carboxy-terminally truncated protein were normal. Our results indicate that a subset of mutant NF2 alleles observed in patients may encode products with dominant properties when overexpressed in specific cell lineages. PMID:10215625

  20. Induction of diphtheria toxin-resistant mutants in human cells by ultraviolet light

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rocchi, P.; Ferreri, A.M.; Capucci, A.

    1981-01-01

    Stable spontaneous mutants resistant to the protein synthesis inhibitor diphtheria toxin (DT) have been selected in human cell line EUE at a very low frequency (less than 8 x 10(-6)). U.v.-induced mutation has been quantitatively measured: treatment of cells with u.v. light increased the frequencies of diphtheria toxin resistant (DTr) mutants up to 1000-fold. The maximum recovery of DTr mutants was observed after a short expression period, for all u.v. doses tested, and was followed by a decrease in mutation frequency on subsequent passages.

  1. Induction of diphtheria toxin-resistant mutants in human cells by ultraviolet light

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rocchi, P.; Ferreri, A.M.; Capucci, A.

    1981-01-01

    Stable spontaneous mutants resistant to the protein synthesis inhibitor diphtheria toxin (DT) have been selected in human cell line EUE at a very low frequency (< 8 x 10/sup -6/). U.v.-induced mutation has been quantitatively measured: treatment of cells with u.v. light increased the frequencies of diphtheria toxin resistant (DTsup(r)) mutants up to 1000-fold. The maximum recovery of DTsup(r) mutants was observed after a short expression period, for all u.v. doses tested, and was followed by a decrease in mutation frequency on subsequent passages.

  2. The role of dileucine in the expression and function of human organic anion transporter 1 (hOAT1)

    PubMed Central

    Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng

    2011-01-01

    Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1. PMID:21494320

  3. The Role of Dileucine in the Expression and Function of Human Organic Anion Transporter 1 (hOAT1).

    PubMed

    Zhang, Qiang; Wu, Jinwei; Pan, Zui; You, Guofeng

    2011-01-01

    Human organic anion transporter hOAT1 plays a critical role in the body disposition of environmental toxins and clinically important drugs including anti-HIV therapeutics, anti-tumor drugs, antibiotics, anti-hypertensives, and anti-inflammatories. In the current study, we investigated the role of dileucine (L6L7) at the amino terminus of hOAT1 in the expression and function of the transporter. We substituted L6L7 with alanine (A) simultaneously. The resulting mutant transporter L6A/L7A showed no transport activity due to its complete loss of expression at the cell surface. Such loss of surface expression of L6A/L7A was consistent with a complete loss of an 80 kDa mature form and a dramatic decrease in a 60 kDa immature form of the mutant transporter in the total cell lysates. Treatment of L6A/L7A-expressing cells with proteasomal inhibitor resulted in a significant increase in the immature form of hOAT1, but not its mature form, whereas treatment of these cells with lysosomal inhibitor had no effect on the expression of the mutant transporters, suggesting that the mutant transporter was degraded through proteasomal pathway. The accumulation of mutant transporter in the endoplasmic reticulum (ER) was confirmed by coimmunolocalization of L6L7 with calnexin, an ER marker. Furthermore, treatment of L6A/L7A-expressing cells with sodium 4-phenylbutyrate (4PBA) and glycerol, two chemical chaperones, could not promote the exit of the immature form of the mutant transporter from the ER. Our data suggest that L6L7 are critical for the stability and ER export of hOAT1.

  4. Sonic hedgehog: restricted expression and limb dysmorphologies

    PubMed Central

    Hill, Robert E; Heaney, Simon JH; Lettice, Laura A

    2003-01-01

    Sonic hedgehog, SHH, is required for patterning the limb. The array of skeletal elements that compose the hands and feet, and the ordered arrangement of these bones to form the pattern of fingers and toes are dependent on SHH. The mechanism of action of SHH in the limb is not fully understood; however, an aspect that appears to be important is the localized, asymmetric expression of Shh. Shh is expressed in the posterior margin of the limb bud in a region defined as the zone of polarizing activity (ZPA). Analysis of mouse mutants which have polydactyly (extra toes) shows that asymmetric expression of Shh is lost due to the appearance of an ectopic domain of expression in the anterior limb margin. One such polydactylous mouse mutant, sasquatch (Ssq), maps to the corresponding chromosomal region of the human condition pre-axial polydactyly (PPD) and thus represents a model for this condition. The mutation responsible for Ssq is located 1 Mb away from the Shh gene; however, the mutation disrupts a long-range cis-acting regulator of Shh expression. By inference, human pre-axial polydactyly results from a similar disruption of Shh expression. Other human congenital abnormalities also map near the pre-axial polydactyly locus, suggesting a major chromosomal region for limb dysmorphologies. The distinct phenotypes range from loss of all bones of the hands and feet to syndactyly of the soft tissue and fusion of the digits. We discuss the role played by Shh expression in mouse mutant phenotypes and the human limb dysmorphologies. PMID:12587915

  5. Spontaneous hepatic repopulation in transgenic mice expressing mutant human α1-antitrypsin by wild-type donor hepatocytes.

    PubMed

    Ding, Jianqiang; Yannam, Govardhana R; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I; Wong, Ronald J; Avsar, Yesim; Guha, Chandan; Perlmutter, David H; Fox, Ira J; Roy-Chowdhury, Jayanta

    2011-05-01

    α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z-expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%-98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z-expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals.

  6. Hematopoietic Colony Formation from Human Growth Factor-Dependent TF1 Cells and Human Cord Blood Myeloid Progenitor Cells Depends on SHP2 Phosphatase Function

    PubMed Central

    Etienne-Julan, Maryse; Gotoh, Akihiko; Braun, Stephen E.; Lu, Li; Cooper, Scott; Feng, Gen-Sheng; Li, Xing Jun

    2013-01-01

    The protein tyrosine phosphatase, SHP2, is widely expressed; however, previous studies demonstrated that hematopoietic cell development more stringently requires Shp2 expression compared to other tissues. Furthermore, somatic gain-of-function SHP2 mutants are commonly found in human myeloid leukemias. Given that pharmacologic inhibitors to SHP2 phosphatase activity are currently in development as putative antileukemic agents, we conducted a series of experiments examining the necessity of SHP2 phosphatase activity for human hematopoiesis. Anti-sense oligonucleotides to human SHP2 coding sequences reduced human cord blood- and human cell line, TF1-derived colony formation. Expression of truncated SHP2 bearing its Src homology 2 (SH2) domains, but lacking the phosphatase domain similarly reduced human cord blood- and TF1-derived colony formation. Mechanistically, expression of truncated SHP2 reduced the interaction between endogenous, full-length SHP2 with the adapter protein, Grb2. To verify the role of SHP2 phosphatase function in human hematopoietic cell development, human cord blood CD34+ cells were transduced with a leukemia-associated phosphatase gain-of-function SHP2 mutant or with a phosphatase dead SHP2 mutant, which indicated that increased phosphatase function enhanced, while decreased SHP2 phosphatase function reduced, human cord blood-derived colonies. Collectively, these findings indicate that SHP2 phosphatase function regulates human hematopoietic cell development and imply that the phosphatase component of SHP2 may serve as a pharmacologic target in human leukemias bearing increased SHP2 phosphatase activity. PMID:23082805

  7. Hematopoietic colony formation from human growth factor-dependent TF1 cells and human cord blood myeloid progenitor cells depends on SHP2 phosphatase function.

    PubMed

    Broxmeyer, Hal E; Etienne-Julan, Maryse; Gotoh, Akihiko; Braun, Stephen E; Lu, Li; Cooper, Scott; Feng, Gen-Sheng; Li, Xing Jun; Chan, Rebecca J

    2013-03-15

    The protein tyrosine phosphatase, SHP2, is widely expressed; however, previous studies demonstrated that hematopoietic cell development more stringently requires Shp2 expression compared to other tissues. Furthermore, somatic gain-of-function SHP2 mutants are commonly found in human myeloid leukemias. Given that pharmacologic inhibitors to SHP2 phosphatase activity are currently in development as putative antileukemic agents, we conducted a series of experiments examining the necessity of SHP2 phosphatase activity for human hematopoiesis. Anti-sense oligonucleotides to human SHP2 coding sequences reduced human cord blood- and human cell line, TF1-derived colony formation. Expression of truncated SHP2 bearing its Src homology 2 (SH2) domains, but lacking the phosphatase domain similarly reduced human cord blood- and TF1-derived colony formation. Mechanistically, expression of truncated SHP2 reduced the interaction between endogenous, full-length SHP2 with the adapter protein, Grb2. To verify the role of SHP2 phosphatase function in human hematopoietic cell development, human cord blood CD34+ cells were transduced with a leukemia-associated phosphatase gain-of-function SHP2 mutant or with a phosphatase dead SHP2 mutant, which indicated that increased phosphatase function enhanced, while decreased SHP2 phosphatase function reduced, human cord blood-derived colonies. Collectively, these findings indicate that SHP2 phosphatase function regulates human hematopoietic cell development and imply that the phosphatase component of SHP2 may serve as a pharmacologic target in human leukemias bearing increased SHP2 phosphatase activity.

  8. Gain and loss of function of ALS-related mutations of TARDBP (TDP-43) cause motor deficits in vivo.

    PubMed

    Kabashi, Edor; Lin, Li; Tradewell, Miranda L; Dion, Patrick A; Bercier, Valérie; Bourgouin, Patrick; Rochefort, Daniel; Bel Hadj, Samar; Durham, Heather D; Vande Velde, Christine; Rouleau, Guy A; Drapeau, Pierre

    2010-02-15

    TDP-43 has been found in inclusion bodies of multiple neurological disorders, including amyotrophic lateral sclerosis, frontotemporal dementia, Parkinson's disease and Alzheimer's disease. Mutations in the TDP-43 encoding gene, TARDBP, have been subsequently reported in sporadic and familial ALS patients. In order to investigate the pathogenic nature of these mutants, the effects of three consistently reported TARDBP mutations (A315T, G348C and A382T) were tested in cell lines, primary cultured motor neurons and living zebrafish embryos. Each of the three mutants and wild-type (WT) human TDP-43 localized to nuclei when expressed in COS1 and Neuro2A cells by transient transfection. However, when expressed in motor neurons from dissociated spinal cord cultures these mutant TARDBP alleles, but less so for WT TARDBP, were neurotoxic, concomitant with perinuclear localization and aggregation of TDP-43. Finally, overexpression of mutant, but less so of WT, human TARDBP caused a motor phenotype in zebrafish (Danio rerio) embryos consisting of shorter motor neuronal axons, premature and excessive branching as well as swimming deficits. Interestingly, knock-down of zebrafisfh tardbp led to a similar phenotype, which was rescued by co-expressing WT but not mutant human TARDBP. Together these approaches showed that TARDBP mutations cause motor neuron defects and toxicity, suggesting that both a toxic gain of function as well as a novel loss of function may be involved in the molecular mechanism by which mutant TDP-43 contributes to disease pathogenesis.

  9. Immunogenicity of a meningococcal native outer membrane vesicle vaccine with attenuated endotoxin and over-expressed factor H binding protein in infant rhesus monkeys

    PubMed Central

    Koeberling, Oliver; Seubert, Anja; Santos, George; Colaprico, Annalisa; Ugozzoli, Mildred; Donnelly, John; Granoff, Dan M.

    2011-01-01

    We previously investigated immunogenicity of meningococcal native outer membrane vesicle (NOMV) vaccines prepared from recombinant strains with attenuated endotoxin (ΔLpxL1) and over-expressed factor H binding protein (fHbp) in a mouse model. The vaccines elicited broad serum bactericidal antibody responses. While human toll-like receptor 4 (TLR-4) is mainly stimulated by wildtype meningococcal endotoxin, mouse TLR-4 is stimulated by both the wildtype and mutant endotoxin. An adjuvant effect in mice of the mutant endotoxin would be expected to be much less in humans, and may have contributed to the broad mouse bactericidal responses. Here we show that as previously reported for humans, rhesus primate peripheral blood mononuclear cells incubated with a NOMV vaccine from ΔLpxL1 recombinant strains had lower proinflammatory cytokine responses than with a control wildtype NOMV vaccine. The cytokine responses to the mutant vaccine were similar to those elicited by a detergent-treated, wildtype outer membrane vesicle vaccine that had been safely administered to humans. Monkeys (N=4) were immunized beginning at ages 2 to 3 months with three doses of a NOMV vaccine prepared from ΔLpxL1 recombinant strains with over-expressed fHbp in the variant 1 and 2 groups. The mutant NOMV vaccine elicited serum bactericidal titers ≥1:4 against all 10 genetically diverse strains tested, including 9 with heterologous PorA to those in the vaccine. Negative-control animals had serum bactericidal titers <1:4. Thus, the mutant NOMV vaccine elicited broadly protective serum antibodies in a non-human infant primate model that is more relevant for predicting human antibody responses than mice. PMID:21571025

  10. Capsule expression in Streptococcus mitis modulates interaction with oral keratinocytes and alters susceptibility to human antimicrobial peptides.

    PubMed

    Rukke, H V; Engen, S A; Schenck, K; Petersen, F C

    2016-08-01

    Streptococcus mitis is a colonizer of the oral cavity and the nasopharynx, and is closely related to Streptococcus pneumoniae. Both species occur in encapsulated and unencapsulated forms, but in S. mitis the role of the capsule in host interactions is mostly unknown. Therefore, the aim of this study was to examine how capsule expression in S. mitis can modulate interactions with the host with relevance for colonization. The S. mitis type strain, as well as two mutants of the type strain, an isogenic capsule deletion mutant, and a capsule switch mutant expressing the serotype 4 capsule of S. pneumoniae TIGR4, were used. Wild-type and capsule deletion strains of S. pneumoniae TIGR4 were included for comparison. We found that capsule production in S. mitis reduced adhesion to oral and lung epithelial cells. Further, exposure of oral epithelial cells to encapsulated S. mitis resulted in higher interleukin-6 and CXCL-8 transcription levels relative to the unencapsulated mutant. Capsule expression in S. mitis increased the sensitivity to human neutrophil peptide 1-3 but reduced the sensitivity to human β-defensin-3 and cathelicidin. This was in contrast with S. pneumoniae in which capsule expression has been generally associated with increased sensitivity to human antimicrobial peptides (AMPs). Collectively, these findings indicate that capsule expression in S. mitis is important in modulating interactions with epithelial cells, and is associated with increased or reduced susceptibility to AMPs depending on the nature of the AMP. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Mutant IDH1 Disrupts the Mouse Subventricular Zone and Alters Brain Tumor Progression

    PubMed Central

    Pirozzi, Christopher J.; Carpenter, Austin B.; Waitkus, Matthew S.; Wang, Catherine Y.; Zhu, Huishan; Hansen, Landon J.; Chen, Lee H.; Greer, Paula K.; Feng, Jie; Wang, Yu; Bock, Cheryl B.; Fan, Ping; Spasojevic, Ivan; McLendon, Roger E.; Bigner, Darell D.; He, Yiping; Yan, Hai

    2017-01-01

    IDH1 mutations occur in the majority of low-grade gliomas and lead to the production of the oncometabolite, D-2-hydroxyglutarate (D-2HG). To understand the effects of tumor-associated mutant IDH1 (IDH1-R132H) on both the neural stem cell (NSC) population and brain tumorigenesis, genetically faithful cell lines and mouse model systems were generated. Here, it is reported that mouse NSCs expressing Idh1-R132H displayed reduced proliferation due to p53-mediated cell cycle arrest as well as a decreased ability to undergo neuronal differentiation. In vivo, Idh1-R132H expression reduced proliferation of cells within the germinal zone of the subventricular zone (SVZ). The NSCs within this area were dispersed and disorganized in mutant animals, suggesting that Idh1-R132H perturbed the NSCs and the microenvironment from which gliomas arise. Additionally, tumor-bearing animals expressing mutant Idh1 displayed a prolonged survival and also overexpressed Olig2, features consistent with IDH1-mutated human gliomas. These data indicate that mutant Idh1 disrupts the NSC microenvironment and the candidate cell of origin for glioma; thus, altering the progression of tumorigenesis. Additionally, this study provides a mutant Idh1 brain tumor model that genetically recapitulates human disease, laying the foundation for future investigations on mutant IDH1-mediated brain tumorigenesis and targeted therapy. PMID:28148827

  12. Functions of transmembrane domain 3 of human melanocortin-4 receptor.

    PubMed

    Mo, Xiu-Lei; Yang, Rui; Tao, Ya-Xiong

    2012-12-01

    The melanocortin-4 receptor (MC4R) is a G protein-coupled receptor critical for maintaining energy homeostasis. Transmembrane domain 3 (TM3) of MC4R contains residues that were suggested to be essential in ligand binding and signaling. Several MC4R mutations in TM3 are associated with human obesity. To gain a better understanding of the functions of TM3, we analyzed the functions of 26 residues in TM3 using alanine-scanning mutagenesis. We showed that all mutants had normal cell-surface expression. Four mutants were defective in ligand binding and signaling and six mutants had normal ligand binding but impaired cAMP production. L140A had increased basal cAMP level. To further characterize the function of L140, we generated 17 additional L140 mutants. Fifteen L140 mutants had significantly decreased cell-surface expression, with L140R and L140V expressed normally. Ten L140 mutants had increased basal cAMP activities. Four L140 mutants were defective in ligand-stimulated cAMP generation. Interestingly, with the ERK1/2 pathway, we showed that nine constitutively active mutants had similar levels of basal pERK1/2 as that of WT, and two signaling defective mutants had similar levels of pERK1/2 as that of WT upon agonist stimulation, different from their cAMP signaling properties, suggesting biased signaling in these mutant receptors. In summary, we identified 13 residues in TM3 that were essential for ligand binding and/or signaling. Moreover, L140 was critical for locking MC4R in inactive conformation and several mutants showed biased signaling in cAMP and ERK1/2 signaling pathways.

  13. Probing the changes in gene expression due to α-crystallin mutations in mouse models of hereditary human cataract.

    PubMed

    Andley, Usha P; Tycksen, Eric; McGlasson-Naumann, Brittney N; Hamilton, Paul D

    2018-01-01

    The mammalian eye lens expresses a high concentration of crystallins (α, β and γ-crystallins) to maintain the refractive index essential for lens transparency. Crystallins are long-lived proteins that do not turnover throughout life. The structural destabilization of crystallins by UV exposure, glycation, oxidative stress and mutations in crystallin genes leads to protein aggregation and development of cataracts. Several destabilizing mutations in crystallin genes are linked with human autosomal dominant hereditary cataracts. To investigate the mechanism by which the α-crystallin mutations Cryaa-R49C and Cryab-R120G lead to cataract formation, we determined whether these mutations cause an altered expression of specific transcripts in the lens at an early postnatal age by RNA-seq analysis. Using knock-in mouse models previously generated in our laboratory, in the present work, we identified genes that exhibited altered abundance in the mutant lenses, including decreased transcripts for Clic5, an intracellular water channel in Cryaa-R49C heterozygous mutant lenses, and increased transcripts for Eno1b in Cryab-R120G heterozygous mutant lenses. In addition, RNA-seq analysis revealed increased histones H2B, H2A, and H4 gene expression in Cryaa-R49C mutant lenses, suggesting that the αA-crystallin mutation regulates histone expression via a transcriptional mechanism. Additionally, these studies confirmed the increased expression of histones H2B, H2A, and H4 by proteomic analysis of Cryaa-R49C knock-in and Cryaa;Cryab gene knockout lenses reported previously. Taken together, these findings offer additional insight into the early transcriptional changes caused by Cryaa and Cryab mutations associated with autosomal dominant human cataracts, and indicate that the transcript levels of certain genes are affected by the expression of mutant α-crystallin in vivo.

  14. Tyrosine Phosphorylation of the Human Serotonin Transporter: A Role in the Transporter Stability and Function

    PubMed Central

    Annamalai, Balasubramaniam; Mannangatti, Padmanabhan; Arapulisamy, Obulakshmi; Shippenberg, Toni S.; Jayanthi, Lankupalle D.

    2012-01-01

    The serotonin (5-HT) transporter (SERT) regulates serotoninergic neurotransmission by clearing 5-HT released into the synaptic space. Phosphorylation of SERT on serine and threonine mediates SERT regulation. Whether tyrosine phosphorylation regulates SERT is unknown. Here, we tested the hypothesis that tyrosine-phosphorylation of SERT regulates 5-HT transport. In support of this, alkali-resistant 32P-labeled SERT was found in rat platelets, and Src-tyrosine kinase inhibitor 4-amino-5-(4-chlorophenyl)-7-(t-butyl)pyrazolo [3,4,d]pyrimidine (PP2) decreased platelet SERT function and expression. In human placental trophoblast cells expressing SERT, PP2 reduced transporter function, expression, and stability. Although siRNA silencing of Src expression decreased SERT function and expression, coexpression of Src resulted in PP2-sensitive increases in SERT function and expression. PP2 treatment markedly decreased SERT protein stability. Compared with WT-SERT, SERT tyrosine mutants Y47F and Y142F exhibited reduced 5-HT transport despite their higher total and cell surface expression levels. Moreover, Src-coexpression increased total and cell surface expression of Y47F and Y142F SERT mutants without affecting their 5-HT transport capacity. It is noteworthy that Y47F and Y142F mutants exhibited higher protein stability compared with WT-SERT. However, similar to WT-SERT, PP2 treatment decreased the stability of Y47F and Y142F mutants. Furthermore, compared with WT-SERT, Y47F and Y142F mutants exhibited lower basal tyrosine phosphorylation and no further enhancement of tyrosine phosphorylation in response to Src coexpression. These results provide the first evidence that SERT tyrosine phosphorylation supports transporter protein stability and 5HT transport. PMID:21992875

  15. Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

    PubMed

    Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

    2015-07-16

    p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

  16. A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

    PubMed Central

    Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

    2015-01-01

    Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

  17. Spontaneous hepatic repopulation in transgenic mice expressing mutant human α1-antitrypsin by wild-type donor hepatocytes

    PubMed Central

    Ding, Jianqiang; Yannam, Govardhana R.; Roy-Chowdhury, Namita; Hidvegi, Tunda; Basma, Hesham; Rennard, Stephen I.; Wong, Ronald J.; Avsar, Yesim; Guha, Chandan; Perlmutter, David H.; Fox, Ira J.; Roy-Chowdhury, Jayanta

    2011-01-01

    α1-Antitrypsin deficiency is an inherited condition that causes liver disease and emphysema. The normal function of this protein, which is synthesized by the liver, is to inhibit neutrophil elastase, a protease that degrades connective tissue of the lung. In the classical form of the disease, inefficient secretion of a mutant α1-antitrypsin protein (AAT-Z) results in its accumulation within hepatocytes and reduced protease inhibitor activity, resulting in liver injury and pulmonary emphysema. Because mutant protein accumulation increases hepatocyte cell stress, we investigated whether transplanted hepatocytes expressing wild-type AAT might have a competitive advantage relative to AAT-Z–expressing hepatocytes, using transgenic mice expressing human AAT-Z. Wild-type donor hepatocytes replaced 20%–98% of mutant host hepatocytes, and repopulation was accelerated by injection of an adenovector expressing hepatocyte growth factor. Spontaneous hepatic repopulation with engrafted hepatocytes occurred in the AAT-Z–expressing mice even in the absence of severe liver injury. Donor cells replaced both globule-containing and globule-devoid cells, indicating that both types of host hepatocytes display impaired proliferation relative to wild-type hepatocytes. These results suggest that wild-type hepatocyte transplantation may be therapeutic for AAT-Z liver disease and may provide an alternative to protein replacement for treating emphysema in AAT-ZZ individuals. PMID:21505264

  18. KRAS-mutation status dependent effect of zoledronic acid in human non-small cell cancer preclinical models

    PubMed Central

    Kenessey, István; Kói, Krisztina; Horváth, Orsolya; Cserepes, Mihály; Molnár, Dávid; Izsák, Vera; Dobos, Judit; Hegedűs, Balázs

    2016-01-01

    Background In non-small cell lung cancer (NSCLC) KRAS-mutant status is a negative prognostic and predictive factor. Nitrogen-containing bisphosphonates inhibit prenylation of small G-proteins (e.g. Ras, Rac, Rho) and thus may affect proliferation and migration. In our preclinical work, we investigated the effect of an aminobisphosphonate compound (zoledronic acid) on mutant and wild type KRAS-expressing human NSCLC cell lines. Results We confirmed that zoledronic acid was unable to inhibit the prenylation of mutant K-Ras unlike in the case of wild type K-Ras. In case of in vitro proliferation, the KRAS-mutant human NSCLC cell lines showed resistance to zoledronic acid wild-type KRAS-cells proved to be sensitive. Combinatory application of zoledronic acid enhanced the cytostatic effect of cisplatin. Zoledronic acid did not induce significant apoptosis. In xenograft model, zoledronic acid significantly reduced the weight of wild type KRAS-EGFR-expressing xenograft tumor by decreasing the proliferative capacity. Futhermore, zoledronic acid induced VEGF expression and improved in vivo tumor vascularization. Materials and methods Membrane association of K-Ras was examined by Western-blot. In vitro cell viability, apoptotic cell death and migration were measured in NSCLC lines with different molecular background. The in vivo effect of zoledronic acid was investigated in a SCID mouse subcutaneous xenograft model. Conclusions The in vitro and in vivo inhibitory effect of zoledronic acid was based on the blockade of cell cycle in wild type KRAS-expressing human NSCLC cells. The zoledronic acid induced vascularization supported in vivo cytostatic effect. Our preclinical investigation suggests that patients with wild type KRAS-expressing NSCLC could potentially benefit from aminobisphosphonate therapy. PMID:27780929

  19. Generation and characterization of a human-mouse chimeric antibody against the extracellular domain of claudin-1 for cancer therapy using a mouse model.

    PubMed

    Hashimoto, Yosuke; Tada, Minoru; Iida, Manami; Nagase, Shotaro; Hata, Tomoyuki; Watari, Akihiro; Okada, Yoshiaki; Doi, Takefumi; Fukasawa, Masayoshi; Yagi, Kiyohito; Kondoh, Masuo

    2016-08-12

    Claudin-1 (CLDN-1), an integral transmembrane protein, is an attractive target for drug absorption, prevention of infection, and cancer therapy. Previously, we generated mouse anti-CLDN-1 monoclonal antibodies (mAbs) and found that they enhanced epidermal absorption of a drug and prevented hepatitis C virus infection in human hepatocytes. Here, we investigated anti-tumor activity of a human-mouse chimeric IgG1, xi-3A2, from one of the anti-CLDN-1 mAbs, clone 3A2. Xi-3A2 accumulated in the tumor tissues in mice bearing with human CLDN-1-expressing tumor cells. Xi-3A2 activated Fcγ receptor IIIa-expressing reporter cells in the presence of human CLDN-1-expressing cells, suggesting xi-3A2 has a potential to exhibit antibody-dependent cellular cytotoxicity against CLDN-1 expressing tumor cells. We also constructed a mutant xi-3A2 antibody with Gly, Ser, and Ile substituted with Ala, Asp, and Arg at positions 236, 239, and 332 of the Fc domain. This mutant antibody showed greater activation of Fcγ receptor IIIa and in vivo anti-tumor activity in mice bearing human CLDN-1-expressing tumors than xi-3A2 did. These findings indicate that the G236A/S239D/I332E mutant of xi-3A2 might be a promising lead for tumor therapy. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Altered Gag Polyprotein Cleavage Specificity of Feline Immunodeficiency Virus/Human Immunodeficiency Virus Mutant Proteases as Demonstrated in a Cell-Based Expression System

    PubMed Central

    Lin, Ying-Chuan; Brik, Ashraf; de Parseval, Aymeric; Tam, Karen; Torbett, Bruce E.; Wong, Chi-Huey; Elder, John H.

    2006-01-01

    We have used feline immunodeficiency virus (FIV) protease (PR) as a mutational system to study the molecular basis of substrate-inhibitor specificity for lentivirus PRs, with a focus on human immunodeficiency virus type 1 (HIV-1) PR. Our previous mutagenesis studies demonstrated that discrete substitutions in the active site of FIV PR with structurally equivalent residues of HIV-1 PR dramatically altered the specificity of the mutant PRs in in vitro analyses. Here, we have expanded these studies to analyze the specificity changes in each mutant FIV PR expressed in the context of the natural Gag-Pol polyprotein ex vivo. Expression mutants were prepared in which 4 to 12 HIV-1-equivalent substitutions were made in FIV PR, and cleavage of each Gag-Pol polyprotein was then assessed in pseudovirions from transduced cells. The findings demonstrated that, as with in vitro analyses, inhibitor specificities of the mutants showed increased HIV-1 PR character when analyzed against the natural substrate. In addition, all of the mutant PRs still processed the FIV polyprotein but the apparent order of processing was altered relative to that observed with wild-type FIV PR. Given the importance of the order in which Gag-Pol is processed, these findings likely explain the failure to produce infectious FIVs bearing these mutations. PMID:16873240

  1. MicroRNA-122 Influences the Development of Sperm Abnormalities from Human Induced Pluripotent Stem Cells by Regulating TNP2 Expression

    PubMed Central

    Huang, Yongyi; Liu, Jianjun; Zhao, Yanhui; Jiang, Lizhen; Huang, Qin

    2013-01-01

    Sperm abnormalities are one of the main factors responsible for male infertility; however, their pathogenesis remains unclear. The role of microRNAs in the development of sperm abnormalities in infertile men has not yet been investigated. Here, we used human induced pluripotent stem cells to investigate the influence of miR-122 expression on the differentiation of these cells into spermatozoa-like cells in vitro. After induction, mutant miR-122-transfected cells formed spermatozoa-like cells. Flow cytometry of DNA content revealed a significant increase in the haploid cell population in spermatozoa-like cells derived from mutant miR-122-transfected cells as compared to those derived from miR-122-transfected cells. During induction, TNP2 and protamine mRNA and protein levels were significantly higher in mutant miR-122-transfected cells than in miR-122-transfected cells. High-throughput isobaric tags for relative and absolute quantification were used to identify and quantify the different protein expression levels in miR-122- and mutant miR-122-transfected cells. Among all the proteins analyzed, the expression of lipoproteins, for example, APOB and APOA1, showed the most significant difference between the two groups. This study illustrates that miR-122 expression is associated with abnormal sperm development. MiR-122 may influence spermatozoa-like cells by suppressing TNP2 expression and inhibiting the expression of proteins associated with sperm development. PMID:23327642

  2. Expression of Mutant Human DISC1 in Mice Supports Abnormalities in Differentiation of Oligodendrocytes

    PubMed Central

    Katsel, Pavel; Tan, Weilun; Abazyan, Bagrat; Davis, Kenneth L; Ross, Christopher; Pletnikov, Mikhail V; Haroutunian, Vahram

    2011-01-01

    Abnormalities in oligodendrocyte (OLG) differentiation and OLG gene expression deficit have been described in schizophrenia (SZ). Recent studies revealed a critical requirement for Disrupted-in-Schizophrenia 1 (DISC1) in neural development. Transgenic mice with forebrain restricted expression of mutant human DISC1 (ΔhDISC1) are characterized by neuroanatomical and behavioral abnormalities reminiscent of some features of SZ. We sought to determine whether the expression of ΔhDISC1 may influence the development of OLGs in this mouse model. OLG- and cell cycle-associated gene and protein expression were characterized in the forebrain of ΔhDISC1 mice during different stages of neurodevelopment (E15 and P1 days) and in adulthood. The results suggest that the expression of ΔhDISC1 exerts a significant influence on oligodendrocyte differentiation and function, evidenced by premature OLG differentiation and increased proliferation of their progenitors. Additional findings showed that neuregulin 1 and its receptors may be contributing factors to the observed upregulation of OLG genes. Thus, OLG function may be perturbed by mutant hDISC1 in a model system that provides new avenues for studying aspects of the pathogenesis of SZ. PMID:21605958

  3. Functional Phenotypic Rescue of Caenorhabditis elegans Neuroligin-Deficient Mutants by the Human and Rat NLGN1 Genes

    PubMed Central

    Calahorro, Fernando; Ruiz-Rubio, Manuel

    2012-01-01

    Neuroligins are cell adhesion proteins that interact with neurexins at the synapse. This interaction may contribute to differentiation, plasticity and specificity of synapses. In humans, single mutations in neuroligin encoding genes lead to autism spectrum disorder and/or mental retardation. Caenorhabditis elegans mutants deficient in nlg-1, an orthologue of human neuroligin genes, have defects in different behaviors. Here we show that the expression of human NLGN1 or rat Nlgn1 cDNAs in C. elegans nlg-1 mutants rescues the fructose osmotic strength avoidance and gentle touch response phenotypes. Two specific point mutations in NLGN3 and NLGN4 genes, involved in autistic spectrum disorder, were further characterized in this experimental system. The R451C allele described in NLGN3, was analyzed with both human NLGN1 (R453C) and worm NLG-1 (R437C) proteins, and both were not functional in rescuing the osmotic avoidance behavior and the gentle touch response phenotype. The D396X allele described in NLGN4, which produces a truncated protein, was studied with human NLGN1 (D432X) and they did not rescue any of the behavioral phenotypes analyzed. In addition, RNAi feeding experiments measuring gentle touch response in wild type strain and worms expressing SID-1 in neurons (which increases the response to dsRNA), both fed with bacteria expressing dsRNA for nlg-1, provided evidence for a postsynaptic in vivo function of neuroligins both in muscle cells and neurons, equivalent to that proposed in mammals. This finding was further confirmed generating transgenic nlg-1 deficient mutants expressing NLG-1 under pan-neuronal (nrx-1) or pan-muscular (myo-3) specific promoters. All these results suggest that the nematode could be used as an in vivo model for studying particular synaptic mechanisms with proteins orthologues of humans involved in pervasive developmental disorders. PMID:22723984

  4. Functional phenotypic rescue of Caenorhabditis elegans neuroligin-deficient mutants by the human and rat NLGN1 genes.

    PubMed

    Calahorro, Fernando; Ruiz-Rubio, Manuel

    2012-01-01

    Neuroligins are cell adhesion proteins that interact with neurexins at the synapse. This interaction may contribute to differentiation, plasticity and specificity of synapses. In humans, single mutations in neuroligin encoding genes lead to autism spectrum disorder and/or mental retardation. Caenorhabditis elegans mutants deficient in nlg-1, an orthologue of human neuroligin genes, have defects in different behaviors. Here we show that the expression of human NLGN1 or rat Nlgn1 cDNAs in C. elegans nlg-1 mutants rescues the fructose osmotic strength avoidance and gentle touch response phenotypes. Two specific point mutations in NLGN3 and NLGN4 genes, involved in autistic spectrum disorder, were further characterized in this experimental system. The R451C allele described in NLGN3, was analyzed with both human NLGN1 (R453C) and worm NLG-1 (R437C) proteins, and both were not functional in rescuing the osmotic avoidance behavior and the gentle touch response phenotype. The D396X allele described in NLGN4, which produces a truncated protein, was studied with human NLGN1 (D432X) and they did not rescue any of the behavioral phenotypes analyzed. In addition, RNAi feeding experiments measuring gentle touch response in wild type strain and worms expressing SID-1 in neurons (which increases the response to dsRNA), both fed with bacteria expressing dsRNA for nlg-1, provided evidence for a postsynaptic in vivo function of neuroligins both in muscle cells and neurons, equivalent to that proposed in mammals. This finding was further confirmed generating transgenic nlg-1 deficient mutants expressing NLG-1 under pan-neuronal (nrx-1) or pan-muscular (myo-3) specific promoters. All these results suggest that the nematode could be used as an in vivo model for studying particular synaptic mechanisms with proteins orthologues of humans involved in pervasive developmental disorders.

  5. Phosphorylation at Ser-181 of oncogenic KRAS is required for tumor growth.

    PubMed

    Barceló, Carles; Paco, Noelia; Morell, Mireia; Alvarez-Moya, Blanca; Bota-Rabassedas, Neus; Jaumot, Montserrat; Vilardell, Felip; Capella, Gabriel; Agell, Neus

    2014-02-15

    KRAS phosphorylation has been reported recently to modulate the activity of mutant KRAS protein in vitro. In this study, we defined S181 as a specific phosphorylation site required to license the oncogenic function of mutant KRAS in vivo. The phosphomutant S181A failed to induce tumors in mice, whereas the phosphomimetic mutant S181D exhibited an enhanced tumor formation capacity, compared with the wild-type KRAS protein. Reduced growth of tumors composed of cells expressing the nonphosphorylatable KRAS S181A mutant was correlated with increased apoptosis. Conversely, increased growth of tumors composed of cells expressing the phosphomimetic KRAS S181D mutant was correlated with increased activation of AKT and ERK, two major downstream effectors of KRAS. Pharmacologic treatment with PKC inhibitors impaired tumor growth associated with reduced levels of phosphorylated KRAS and reduced effector activation. In a panel of human tumor cell lines expressing various KRAS isoforms, we showed that KRAS phosphorylation was essential for survival and tumorigenic activity. Furthermore, we identified phosphorylated KRAS in a panel of primary human pancreatic tumors. Taken together, our findings establish that KRAS requires S181 phosphorylation to manifest its oncogenic properties, implying that its inhibition represents a relevant target to attack KRAS-driven tumors. ©2013 AACR.

  6. CD4 molecules with a diversity of mutations encompassing the CDR3 region efficiently support human immunodeficiency virus type 1 envelope glycoprotein-mediated cell fusion.

    PubMed Central

    Broder, C C; Berger, E A

    1993-01-01

    The third complementarity-determining region (CDR3) within domain 1 of the human CD4 molecule has been suggested to play a critical role in membrane fusion mediated by the interaction of CD4 with the human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein. To analyze in detail the role of CDR3 and adjacent regions in the fusion process, we used cassette mutagenesis to construct a panel of 30 site-directed mutations between residues 79 and 96 of the full-length CD4 molecule. The mutant proteins were transiently expressed by using recombinant vaccinia virus vectors and were analyzed for cell surface expression, recombinant gp120-binding activity, and overall structural integrity as assessed by reactivity with a battery of anti-CD4 monoclonal antibodies. Cells expressing the CD4 mutants were assayed for their ability to form syncytia when mixed with cells expressing the HIV-1 envelope glycoprotein. Surprisingly in view of published data from others, most of the mutations had little effect on syncytium-forming activity. Normal fusion was observed in 21 mutants, including substitution of human residues 85 to 95 with the corresponding sequences from either chimpanzee, rhesus, or mouse CD4; a panel of Ser-Arg double insertions after each residue from 86 to 91; and a number of other charge, hydrophobic, and proline substitutions and insertions within this region. The nine mutants that showed impaired fusion all displayed defective gp120 binding and disruption of overall structural integrity. In further contrast with results of other workers, we observed that transformant human cell lines expressing native chimpanzee or rhesus CD4 efficiently formed syncytia when mixed with cells expressing the HIV-1 envelope glycoprotein. These data refute the conclusion that certain mutations in the CDR3 region of CD4 abolish cell fusion activity, and they suggest that a wide variety of sequences can be functionally tolerated in this region, including those from highly divergent mammalian species. Syncytium formation mediated by several of the CDR3 mutants was partially or completely resistant to inhibition by the CDR3-directed monoclonal antibody L71, suggesting that the corresponding epitope is not directly involved in the fusion process.(ABSTRACT TRUNCATED AT 400 WORDS) Images PMID:8419649

  7. CD4 molecules with a diversity of mutations encompassing the CDR3 region efficiently support human immunodeficiency virus type 1 envelope glycoprotein-mediated cell fusion.

    PubMed

    Broder, C C; Berger, E A

    1993-02-01

    The third complementarity-determining region (CDR3) within domain 1 of the human CD4 molecule has been suggested to play a critical role in membrane fusion mediated by the interaction of CD4 with the human immunodeficiency virus type 1 (HIV-1) envelope glycoprotein. To analyze in detail the role of CDR3 and adjacent regions in the fusion process, we used cassette mutagenesis to construct a panel of 30 site-directed mutations between residues 79 and 96 of the full-length CD4 molecule. The mutant proteins were transiently expressed by using recombinant vaccinia virus vectors and were analyzed for cell surface expression, recombinant gp120-binding activity, and overall structural integrity as assessed by reactivity with a battery of anti-CD4 monoclonal antibodies. Cells expressing the CD4 mutants were assayed for their ability to form syncytia when mixed with cells expressing the HIV-1 envelope glycoprotein. Surprisingly in view of published data from others, most of the mutations had little effect on syncytium-forming activity. Normal fusion was observed in 21 mutants, including substitution of human residues 85 to 95 with the corresponding sequences from either chimpanzee, rhesus, or mouse CD4; a panel of Ser-Arg double insertions after each residue from 86 to 91; and a number of other charge, hydrophobic, and proline substitutions and insertions within this region. The nine mutants that showed impaired fusion all displayed defective gp120 binding and disruption of overall structural integrity. In further contrast with results of other workers, we observed that transformant human cell lines expressing native chimpanzee or rhesus CD4 efficiently formed syncytia when mixed with cells expressing the HIV-1 envelope glycoprotein. These data refute the conclusion that certain mutations in the CDR3 region of CD4 abolish cell fusion activity, and they suggest that a wide variety of sequences can be functionally tolerated in this region, including those from highly divergent mammalian species. Syncytium formation mediated by several of the CDR3 mutants was partially or completely resistant to inhibition by the CDR3-directed monoclonal antibody L71, suggesting that the corresponding epitope is not directly involved in the fusion process.(ABSTRACT TRUNCATED AT 400 WORDS)

  8. Antiapoptotic property of human alpha-synuclein in neuronal cell lines is associated with the inhibition of caspase-3 but not caspase-9 activity.

    PubMed

    Li, Wenxue; Lee, Michael K

    2005-06-01

    Abnormalities of alpha-synuclein (alpha-Syn) are mechanistically linked to Parkinson's disease (PD) and other alpha-synucleinopathies. To gain additional insights into the relationships between alpha-Syn expression and cell death, we examined the effects of expressing human alpha-Syn (Hualpha-Syn) variants on the cellular vulnerability to apoptotic stimuli. We show that the expression of wild-type (WT) and A30P mutant, but not A53T mutant, Hualpha-Syn leads to the protection of neuronal cell lines from apoptosis but not necrosis. Significantly, Hualpha-Syn did not protect non-neuronal cell lines from apoptosis. We also show that A53T mutant is a loss of function in regards to the antiapoptotic property since the expression of WT Hualpha-Syn with an excess of A53T mutant Hualpha-Syn leads to protection of the cells from apoptosis. The antiapoptotic property is specific to human alpha-Syn as neither beta-Syn nor mouse alpha-Syn protected cells from apoptosis, and the carboxy-terminal 20 amino acids are required for the antiapoptotic property. Analyses of capase-3 and caspase-9 activation reveal that the antiapoptotic property of Hualpha-Syn in neuronal cell lines is associated with the attenuation of caspase-3 activity without affecting the caspase-9 activity or the levels of cleaved, active caspase-3. We conclude that Hualpha-Syn modulates the activity of cleaved caspase-3 product in neuronal cell lines.

  9. The Zebrafish Model Organism Database: new support for human disease models, mutation details, gene expression phenotypes and searching

    PubMed Central

    Howe, Douglas G.; Bradford, Yvonne M.; Eagle, Anne; Fashena, David; Frazer, Ken; Kalita, Patrick; Mani, Prita; Martin, Ryan; Moxon, Sierra Taylor; Paddock, Holly; Pich, Christian; Ramachandran, Sridhar; Ruzicka, Leyla; Schaper, Kevin; Shao, Xiang; Singer, Amy; Toro, Sabrina; Van Slyke, Ceri; Westerfield, Monte

    2017-01-01

    The Zebrafish Model Organism Database (ZFIN; http://zfin.org) is the central resource for zebrafish (Danio rerio) genetic, genomic, phenotypic and developmental data. ZFIN curators provide expert manual curation and integration of comprehensive data involving zebrafish genes, mutants, transgenic constructs and lines, phenotypes, genotypes, gene expressions, morpholinos, TALENs, CRISPRs, antibodies, anatomical structures, models of human disease and publications. We integrate curated, directly submitted, and collaboratively generated data, making these available to zebrafish research community. Among the vertebrate model organisms, zebrafish are superbly suited for rapid generation of sequence-targeted mutant lines, characterization of phenotypes including gene expression patterns, and generation of human disease models. The recent rapid adoption of zebrafish as human disease models is making management of these data particularly important to both the research and clinical communities. Here, we describe recent enhancements to ZFIN including use of the zebrafish experimental conditions ontology, ‘Fish’ records in the ZFIN database, support for gene expression phenotypes, models of human disease, mutation details at the DNA, RNA and protein levels, and updates to the ZFIN single box search. PMID:27899582

  10. A novel candidate gene for mouse and human preaxial polydactyly with altered expression in limbs of Hemimelic extra-toes mutant mice.

    PubMed

    Clark, R M; Marker, P C; Kingsley, D M

    2000-07-01

    Polydactyly is a common malformation of vertebrate limbs. In humans a major locus for nonsyndromic pre-axial polydactyly (PPD) has been mapped previously to 7q36. The mouse Hemimelic extra-toes (Hx) mutation maps to a homologous chromosome segment and has been proposed to affect a homologous gene. To understand the molecular changes underlying PPD, we used a positional cloning approach to identify the gene or genes disrupted by the Hx mutation and a closely linked limb mutation, Hammertoe (Hm). High resolution genetic mapping identified a small candidate interval for the mouse mutations located 1.2 cM distal to the Shh locus. The nonrecombinant interval was completely cloned in bacterial artificial chromosomes and searched for genes using a combination of exon trapping, sample sequencing, and mapping of known genes. Two novel genes, Lmbr1 and Lmbr2, are entirely within the candidate interval we defined genetically. The open reading frame of both genes is intact in mutant mice, but the expression of the Lmbr1 gene is dramatically altered in developing limbs of Hx mutant mice. The correspondence between the spatial and temporal changes in Lmbr1 expression and the embryonic onset of the Hx mutant phenotype suggests that the mouse Hx mutation may be a regulatory allele of Lmbr1. The human ortholog of Lmbr1 maps within the recently described interval for human PPD, strengthening the possibility that both mouse and human limb abnormalities are due to defects in the same highly conserved gene.

  11. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    PubMed

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  12. Zebrafish mab21l2 is specifically expressed in the presumptive eye and tectum from early somitogenesis onwards.

    PubMed

    Kudoh, T; Dawid, I B

    2001-11-01

    Random screening for tissue specific genes in zebrafish by in situ hybridization led us to isolate a gene which showed highly restricted expression in the developing eyes and midbrain at somitogenesis stages. This gene was very similar to mouse and human mab21l2. The characteristic expression pattern of mab21l2 facilitates a detailed description of the morphogenesis of the eyes and midbrain in the zebrafish. In the eye field, mab21l2 expression illustrates the transformation of the eye field to form two separate eyes in the anterior neural plate. Mab21l2 staining in the cyclopic mutants, cyc and oep, exhibited incomplete splitting of the eye primodium. In the midbrain, mab21l2 is expressed in the tectum, and its expression follows the expansion of the tectal region. In mutants affecting the mid-hindbrain boundary (MHB), mab21l2 expression is affected differentially. In the noi/pax2.1 mutant, mab21l2 is down-regulated and the size of the tectum remains small, whereas in the ace/fgf8 mutant, mab21l2 expression persists although the shape of the tectum is altered.

  13. Efficient protection from methotrexate toxicity and selection of transduced human hematopoietic cells following gene transfer of dihydrofolate reductase mutants.

    PubMed

    Meisel, Roland; Bardenheuer, Walter; Strehblow, Claudia; Sorg, Ursula Regina; Elmaagacli, Ahmet; Seeber, Siegfried; Flasshove, Michael; Moritz, Thomas

    2003-12-01

    While retrovirally mediated gene transfer of dihydrofolate reductase mutants (mutDHFR) has convincingly been demonstrated to confer methotrexate (MTX) resistance to murine hematopoietic cells, clinical application of this technology will require high efficacy in human cells. Therefore, we investigated retroviral constructs expressing various point mutants of human DHFR for their ability to confer MTX resistance to human clonogenic progenitor cells (CFU-C) and to allow for in vitro selection of transduced CFU-C. Primary human hematopoietic cells were retrovirally transduced using MMLV- and SFFV/MESV-based vectors expressing DHFR(Ser31), DHFR(Phe22/Ser31), or DHFR(Tyr22/Gly31). MTX resistance of unselected and in vitro-selected CFU-C was determined using MTX-supplemented methylcellulose cultures and gene transfer efficiency was assesed by single-colony PCR analysis. While less than 1% mock-transduced CFU-C survived the presence of > or =5 x 10(-8) M MTX, MMLV- and SFFV/MESV-based vectors expressing DHFR(Ser31) significantly protected CFU-C from MTX at doses ranging from 2.5 to 30 x 10(-8) M. Vectors expressing DHFR(Phe22/Ser31) or DHFR(Tyr22/Gly31) were even more protective and MTX-resistant CFU-C were observed up to 1 x 10(-5) M MTX. Three-day suspension cultures in the presence of 10-20 x 10(-8) M MTX resulted in significant selection of mutDHFR-transduced CFU-C. The percentage of CFU-C resistant to 10 x 10(-8) M MTX increased fourfold to 20-fold and provirus-containing CFU-C increased from 27% to 79-100%. Gene transfer of DHFR using suitable retroviral backbones and DHFR mutants significantly increases MTX resistance of human CFU-C and allows efficient in vitro selection of transduced cells using a short-term selection procedure.

  14. A 4-Nitroquinoleneoxide-Induced Pleurotus eryngii Mutant Variety Increases Pin1 Expression in Rat Brain.

    PubMed

    Jeong, Yoonhwa; Jung, Mina; Kim, Myeung Ju; Hwang, Cheol Ho

    2017-01-01

    To develop Pleurotus eryngii varieties with improved medicinal qualities, protoplasts of P. eryngii were mutagenized using 4-nitroquinoleneoxide. The effects of the resulting variant mushrooms on a human cell were evaluated by applying their aqueous extracts to the human hepatoma cell line, HepG2, in vitro and examining any alteration in the proteomes of the treated HepG2. The P. eryngii mutant, NQ2A-12, was selected for its effects on increasing the expression level of Pin1 in HepG2. Pin1 is one of the peptidyl-prolyl cis-trans isomerases known to play an important role in repressing Alzheimer's disease pathogenesis. Validity of NQ2A-12 related to Alzheimer's disease was shown with an enhanced expression of Pin1 in a mouse brain tissue by injecting the NQ2A-12 extract. The mutant mushroom, NQ2A-12, could be developed as a new variety of P. eryngii with potential to protect against Alzheimer's disease.

  15. Heterologous expression of the human Phosphoenol Pyruvate Carboxykinase (hPEPCK-M) improves hydrogen and ethanol synthesis in the Escherichia coli dcuD mutant when grown in a glycerol-based medium.

    PubMed

    Valle, Antonio; Cabrera, Gema; Cantero, Domingo; Bolivar, Jorge

    2017-03-25

    The production of biodiesel has emerged as an alternative to fossil fuels. However, this industry generates glycerol as a by-product in such large quantities that it has become an environmental problem. The biotransformation of this excess glycerol into other renewable bio-energy sources, like H 2 and ethanol, by microorganisms such as Escherichia coli is an interesting possibility that warrants investigation. In this work we hypothesized that the conversion of oxaloacetate (OAA) to phosphoenolpyruvate (PEP) could be improved by a controlled expression of the human mitochondrial GTP-dependent PEP carboxykinase. This heterologous expression was tested in several E. coli mutant backgrounds with increased availability of C4 intermediates. It was found that this metabolic rewiring improved the synthesis of the target products in several mutants, with the dcuD mutant being the most suitable background for hydrogen and ethanol specific productions and glycerol consumption. These factors increased by 2.46, 1.73 and 1.95 times, respectively, when compared to those obtained for the wild-type strain. Copyright © 2016 Elsevier B.V. All rights reserved.

  16. Chaperone-mediated autophagy degrades mutant p53

    PubMed Central

    Vakifahmetoglu-Norberg, Helin; Kim, Minsu; Xia, Hong-guang; Iwanicki, Marcin P.; Ofengeim, Dimitry; Coloff, Jonathan L.; Pan, Lifeng; Ince, Tan A.; Kroemer, Guido; Brugge, Joan S.; Yuan, Junying

    2013-01-01

    Missense mutations in the gene TP53, which encodes p53, one of the most important tumor suppressors, are common in human cancers. Accumulated mutant p53 proteins are known to actively contribute to tumor development and metastasis. Thus, promoting the removal of mutant p53 proteins in cancer cells may have therapeutic significance. Here we investigated the mechanisms that govern the turnover of mutant p53 in nonproliferating tumor cells using a combination of pharmacological and genetic approaches. We show that suppression of macroautophagy by multiple means promotes the degradation of mutant p53 through chaperone-mediated autophagy in a lysosome-dependent fashion. In addition, depletion of mutant p53 expression due to macroautophagy inhibition sensitizes the death of dormant cancer cells under nonproliferating conditions. Taken together, our results delineate a novel strategy for killing tumor cells that depend on mutant p53 expression by the activation of chaperone-mediated autophagy and potential pharmacological means to reduce the levels of accumulated mutant p53 without the restriction of mutant p53 conformation in quiescent tumor cells. PMID:23913924

  17. Expression of a Mutant kcnj2 Gene Transcript in Zebrafish

    PubMed Central

    Leong, Ivone U. S.; Skinner, Jonathan R.; Shelling, Andrew N.; Love, Donald R.

    2013-01-01

    Long QT 7 syndrome (LQT7, also known as Andersen-Tawil syndrome) is a rare autosomal-dominant disorder that causes cardiac arrhythmias, periodic paralysis, and dysmorphic features. Mutations in the human KCNJ2 gene, which encodes for the subunit of the potassium inwardly-rectifying channel (IK1), have been associated with the disorder. The majority of mutations are considered to be dominant-negative as mutant proteins interact to limit the function of wild type KCNJ2 proteins. Several LQT7 syndrome mouse models have been created that vary in the physiological similarity to the human disease. To complement the LQT7 mouse models, we investigated the usefulness of the zebrafish as an alternative model via a transient approach. Initial bioinformatic analysis identified the zebrafish orthologue of the human KCNJ2 gene, together with a spatial expression profile that was similar to that of human. The expression of a kcnj2-12 transcript carrying an in-frame deletion of critical amino acids identified in human studies resulted in embryos that exhibited defects in muscle development, thereby affecting movement, a decrease in jaw size, pupil-pupil distance, and signs of scoliosis. These defects correspond to some phenotypes expressed by human LQT7 patients. PMID:27335675

  18. Factors Supporting Cysteine Tolerance and Sulfite Production in Candida albicans

    PubMed Central

    Hennicke, Florian; Grumbt, Maria; Lermann, Ulrich; Ueberschaar, Nico; Palige, Katja; Böttcher, Bettina; Jacobsen, Ilse D.; Staib, Claudia; Morschhäuser, Joachim; Monod, Michel; Hube, Bernhard; Hertweck, Christian

    2013-01-01

    The amino acid cysteine has long been known to be toxic at elevated levels for bacteria, fungi, and humans. However, mechanisms of cysteine tolerance in microbes remain largely obscure. Here we show that the human pathogenic yeast Candida albicans excretes sulfite when confronted with increasing cysteine concentrations. Mutant construction and phenotypic analysis revealed that sulfite formation from cysteine in C. albicans relies on cysteine dioxygenase Cdg1, an enzyme with similar functions in humans. Environmental cysteine induced not only the expression of the CDG1 gene in C. albicans, but also the expression of SSU1, encoding a putative sulfite efflux pump. Accordingly, the deletion of SSU1 resulted in enhanced sensitivity of the fungal cells to both cysteine and sulfite. To study the regulation of sulfite/cysteine tolerance in more detail, we screened a C. albicans library of transcription factor mutants in the presence of sulfite. This approach and subsequent independent mutant analysis identified the zinc cluster transcription factor Zcf2 to govern sulfite/cysteine tolerance, as well as cysteine-inducible SSU1 and CDG1 gene expression. cdg1Δ and ssu1Δ mutants displayed reduced hypha formation in the presence of cysteine, indicating a possible role of the newly proposed mechanisms of cysteine tolerance and sulfite secretion in the pathogenicity of C. albicans. Moreover, cdg1Δ mutants induced delayed mortality in a mouse model of disseminated infection. Since sulfite is toxic and a potent reducing agent, its production by C. albicans suggests diverse roles during host adaptation and pathogenicity. PMID:23417561

  19. Synthetic Lethality of a Novel Small Molecule Against Mutant KRAS-Expressing Cancer Cells Involves AKT-Dependent ROS Production.

    PubMed

    Iskandar, Kartini; Rezlan, Majidah; Yadav, Sanjiv Kumar; Foo, Chuan Han Jonathan; Sethi, Gautam; Qiang, Yu; Bellot, Gregory L; Pervaiz, Shazib

    2016-05-10

    We recently reported the death-inducing activity of a small-molecule compound, C1, which triggered reactive oxygen species (ROS)-dependent autophagy-associated apoptosis in a variety of human cancer cell lines. In this study, we examine the ability of the compound to specifically target cancer cells harboring mutant KRAS with minimal activity against wild-type (WT) RAS-expressing cells. HCT116 cells expressing mutated KRAS are susceptible, while the WT-expressing HT29 cells are resistant. Interestingly, C1 triggers activation of mutant RAS, which results in the downstream phosphorylation and activation of AKT/PKB. Gene knockdown of KRAS or AKT or their pharmacological inhibition resulted in the abrogation of C1-induced ROS production and rescued tumor colony-forming ability. We also made use of HCT116 mutant KRAS knockout (KO) cells, which express only a single WT KRAS allele. Exposure of KO cells to C1 failed to increase mitochondrial ROS and cell death, unlike the parental cells harboring mutant KRAS. Similarly, mutant KRAS-transformed prostate epithelial cells (RWPE-1-RAS) were more sensitive to the ROS-producing and death-inducing effects of C1 than the vector only expressing RWPE-1 cells. An in vivo model of xenograft tumors generated with HCT116 KRAS(WT/MUT) or KRAS(WT/-) cells showed the efficacy of C1 treatment and its ability to affect the relative mitotic index in tumors harboring KRAS mutant. These data indicate a synthetic lethal effect against cells carrying mutant KRAS, which could have therapeutic implications given the paucity of KRAS-specific chemotherapeutic strategies. Antioxid. Redox Signal. 24, 781-794.

  20. Cellular and molecular mechanisms of autosomal dominant form of progressive hearing loss, DFNA2.

    PubMed

    Kim, Hyo Jeong; Lv, Ping; Sihn, Choong-Ryoul; Yamoah, Ebenezer N

    2011-01-14

    Despite advances in identifying deafness genes, determination of the underlying cellular and functional mechanisms for auditory diseases remains a challenge. Mutations of the human K(+) channel hKv7.4 lead to post-lingual progressive hearing loss (DFNA2), which affects world-wide population with diverse racial backgrounds. Here, we have generated the spectrum of point mutations in the hKv7.4 that have been identified as diseased mutants. We report that expression of five point mutations in the pore region, namely L274H, W276S, L281S, G285C, and G296S, as well as the C-terminal mutant G321S in the heterologous expression system, yielded non-functional channels because of endoplasmic reticulum retention of the mutant channels. We mimicked the dominant diseased conditions by co-expressing the wild-type and mutant channels. As compared with expression of wild-type channel alone, the blend of wild-type and mutant channel subunits resulted in reduced currents. Moreover, the combinatorial ratios of wild type:mutant and the ensuing current magnitude could not be explained by the predictions of a tetrameric channel and a dominant negative effect of the mutant subunits. The results can be explained by the dependence of cell surface expression of the mutant on the wild-type subunit. Surprisingly, a transmembrane mutation F182L, which has been identified in a pre-lingual progressive hearing loss patient in Taiwan, yielded cell surface expression and functional features that were similar to that of the wild type, suggesting that this mutation may represent redundant polymorphism. Collectively, these findings provide traces of the cellular mechanisms for DFNA2.

  1. notch3 is essential for oligodendrocyte development and vascular integrity in zebrafish

    PubMed Central

    Zaucker, Andreas; Mercurio, Sara; Sternheim, Nitzan; Talbot, William S.; Marlow, Florence L.

    2013-01-01

    SUMMARY Mutations in the human NOTCH3 gene cause CADASIL syndrome (cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy). CADASIL is an inherited small vessel disease characterized by diverse clinical manifestations including vasculopathy, neurodegeneration and dementia. Here we report two mutations in the zebrafish notch3 gene, one identified in a previous screen for mutations with reduced expression of myelin basic protein (mbp) and another caused by a retroviral insertion. Reduced mbp expression in notch3 mutant embryos is associated with fewer oligodendrocyte precursor cells (OPCs). Despite an early neurogenic phenotype, mbp expression recovered at later developmental stages and some notch3 homozygous mutants survived to adulthood. These mutants, as well as adult zebrafish carrying both mutant alleles together, displayed a striking stress-associated accumulation of blood in the head and fins. Histological analysis of mutant vessels revealed vasculopathy, including: an enlargement (dilation) of vessels in the telencephalon and fin, disorganization of the normal stereotyped arrangement of vessels in the fin, and an apparent loss of arterial morphological structure. Expression of hey1, a well-known transcriptional target of Notch signaling, was greatly reduced in notch3 mutant fins, suggesting that Notch3 acts via a canonical Notch signaling pathway to promote normal vessel structure. Ultrastructural analysis confirmed the presence of dilated vessels in notch3 mutant fins and revealed that the vessel walls of presumed arteries showed signs of deterioration. Gaps in the arterial wall and the presence of blood cells outside of vessels in mutants indicated that compromised vessel structure led to hemorrhage. In notch3 heterozygotes, we found elevated expression of both notch3 itself and target genes, indicating that specific alterations in gene expression due to partial loss of Notch3 function might contribute to the abnormalities observed in heterozygous larvae and adults. Our analysis of zebrafish notch3 mutants indicates that Notch3 regulates OPC development and mbp gene expression in larvae, and maintains vascular integrity in adults. PMID:23720232

  2. Alanine–glyoxylate aminotransferase-deficient mice, a model for primary hyperoxaluria that responds to adenoviral gene transfer

    PubMed Central

    Salido, Eduardo C.; Li, Xiao M.; Lu, Yang; Wang, Xia; Santana, Alfredo; Roy-Chowdhury, Namita; Torres, Armando; Shapiro, Larry J.; Roy-Chowdhury, Jayanta

    2006-01-01

    Mutations in the alanine–glyoxylate amino transferase gene (AGXT) are responsible for primary hyperoxaluria type I, a rare disease characterized by excessive hepatic oxalate production that leads to renal failure. We generated a null mutant mouse by targeted mutagenesis of the homologous gene, Agxt, in embryonic stem cells. Mutant mice developed normally, and they exhibited hyperoxaluria and crystalluria. Approximately half of the male mice in mixed genetic background developed calcium oxalate urinary stones. Severe nephrocalcinosis and renal failure developed after enhancement of oxalate production by ethylene glycol administration. Hepatic expression of human AGT1, the protein encoded by AGXT, by adenoviral vector-mediated gene transfer in Agxt−/− mice normalized urinary oxalate excretion and prevented oxalate crystalluria. Subcellular fractionation and immunofluorescence studies revealed that, as in the human liver, the expressed wild-type human AGT1 was predominantly localized in mouse hepatocellular peroxisomes, whereas the most common mutant form of AGT1 (G170R) was localized predominantly in the mitochondria. PMID:17110443

  3. Pharmacochaperoning in a Drosophila model system rescues human dopamine transporter variants associated with infantile/juvenile parkinsonism

    PubMed Central

    Asjad, H. M. Mazhar; Kasture, Ameya; El-Kasaby, Ali; Sackel, Michael; Hummel, Thomas; Freissmuth, Michael; Sucic, Sonja

    2017-01-01

    Point mutations in the gene encoding the human dopamine transporter (hDAT, SLC6A3) cause a syndrome of infantile/juvenile dystonia and parkinsonism. To unravel the molecular mechanism underlying these disorders and investigate possible pharmacological therapies, here we examined 13 disease-causing DAT mutants that were retained in the endoplasmic reticulum when heterologously expressed in HEK293 cells. In three of these mutants, i.e. hDAT-V158F, hDAT-G327R, and hDAT-L368Q, the folding deficit was remedied with the pharmacochaperone noribogaine or the heat shock protein 70 (HSP70) inhibitor pifithrin-μ such that endoplasmic reticulum export of and radioligand binding and substrate uptake by these DAT mutants were restored. In Drosophila melanogaster, DAT deficiency results in reduced sleep. We therefore exploited the power of targeted transgene expression of mutant hDAT in Drosophila to explore whether these hDAT mutants could also be pharmacologically rescued in an intact organism. Noribogaine or pifithrin-μ treatment supported hDAT delivery to the presynaptic terminals of dopaminergic neurons and restored sleep to normal length in DAT-deficient (fumin) Drosophila lines expressing hDAT-V158F or hDAT-G327R. In contrast, expression of hDAT-L368Q in the Drosophila DAT mutant background caused developmental lethality, indicating a toxic action not remedied by pharmacochaperoning. Our observations identified those mutations most likely amenable to pharmacological rescue in the affected children. In addition, our findings also highlight the challenges of translating insights from pharmacochaperoning in cell culture to the clinical situation. Because of the evolutionary conservation in dopaminergic neurotransmission between Drosophila and people, pharmacochaperoning of DAT in D. melanogaster may allow us to bridge that gap. PMID:28972153

  4. Dynamic nuclear envelope phenotype in rats overexpressing mutated human torsinA protein.

    PubMed

    Yu-Taeger, Libo; Gaiser, Viktoria; Lotzer, Larissa; Roenisch, Tina; Fabry, Benedikt Timo; Stricker-Shaver, Janice; Casadei, Nicolas; Walter, Michael; Schaller, Martin; Riess, Olaf; Nguyen, Huu Phuc; Ott, Thomas; Grundmann-Hauser, Kathrin

    2018-05-08

    A three-base-pair deletion in the human TOR1A gene is causative for the most common form of primary dystonia, the early-onset dystonia type 1 (DYT1 dystonia). The pathophysiological consequences of this mutation are still unknown.To study the pathology of the mutant torsinA (TOR1A) protein, we have generated a transgenic rat line that overexpresses the human mutant protein under the control of the human TOR1A promoter. This new animal model was phenotyped with several approaches, including behavioral tests and neuropathological analyses. A motor phenotype and cellular and ultrastructural key features of torsinA pathology were found in this new transgenic rat line supporting that it can be used as a model system for investigating the disease development. Analyses of mutant TOR1A protein expression in various brain regions also showed a dynamic expression pattern and a reversible nuclear envelope pathology. These findings suggest the differential vulnerabilities of distinct neuronal subpopulations. Furthermore the reversibility of the nuclear envelope pathology might be a therapeutic target to treat the disease. © 2018. Published by The Company of Biologists Ltd.

  5. Overexpression of mutant ataxin-3 in mouse cerebellum induces ataxia and cerebellar neuropathology.

    PubMed

    Nóbrega, Clévio; Nascimento-Ferreira, Isabel; Onofre, Isabel; Albuquerque, David; Conceição, Mariana; Déglon, Nicole; de Almeida, Luís Pereira

    2013-08-01

    Machado-Joseph disease (MJD), also known as spinocerebellar ataxia type 3 (SCA3), is a fatal, dominant neurodegenerative disorder caused by the polyglutamine-expanded protein ataxin-3. Clinical manifestations include cerebellar ataxia and pyramidal signs culminating in severe neuronal degeneration. Currently, there is no therapy able to modify disease progression. In the present study, we aimed at investigating one of the most severely affected brain regions in the disorder--the cerebellum--and the behavioral defects associated with the neuropathology in this region. For this purpose, we injected lentiviral vectors encoding full-length human mutant ataxin-3 in the mouse cerebellum of 3-week-old C57/BL6 mice. We show that circumscribed expression of human mutant ataxin-3 in the cerebellum mediates within a short time frame--6 weeks, the development of a behavioral phenotype including reduced motor coordination, wide-based ataxic gait, and hyperactivity. Furthermore, the expression of mutant ataxin-3 resulted in the accumulation of intranuclear inclusions, neuropathological abnormalities, and neuronal death. These data show that lentiviral-based expression of mutant ataxin-3 in the mouse cerebellum induces localized neuropathology, which is sufficient to generate a behavioral ataxic phenotype. Moreover, this approach provides a physiologically relevant, cost-effective and time-effective animal model to gain further insights into the pathogenesis of MJD and for the evaluation of experimental therapeutics of MJD.

  6. Sialylation of lipooligosaccharides is dispensable for the virulence of Haemophilus ducreyi in humans.

    PubMed

    Spinola, Stanley M; Li, Wei; Fortney, Kate R; Janowicz, Diane M; Zwickl, Beth; Katz, Barry P; Munson, Robert S

    2012-02-01

    Sialylated glycoconjugates on the surfaces of mammalian cells play important roles in intercellular communication and self-recognition. The sialic acid preferentially expressed in human tissues is N-acetylneuraminic acid (Neu5Ac). In a process called molecular mimicry, many bacterial pathogens decorate their cell surface glycolipids with Neu5Ac. Incorporation of Neu5Ac into bacterial glycolipids promotes bacterial interactions with host cell receptors called Siglecs. These interactions affect bacterial adherence, resistance to serum killing and phagocytosis, and innate immune responses. Haemophilus ducreyi, the etiologic agent of chancroid, expresses lipooligosaccharides (LOS) that are highly sialylated. However, an H. ducreyi sialyltransferase (lst) mutant, whose LOS contain reduced levels of Neu5Ac, is fully virulent in human volunteers. Recently, a second sialyltransferase gene (Hd0053) was discovered in H. ducreyi, raising the possibility that Hd0053 compensated for the loss of lst during human infection. CMP-Neu5Ac is the obligate nucleotide sugar donor for all bacterial sialyltransferases; LOS derived from an H. ducreyi CMP-Neu5Ac synthetase (neuA) mutant has no detectable Neu5Ac. Here, we compared an H. ducreyi neuA mutant to its wild-type parent in several models of pathogenesis. In human inoculation experiments, the neuA mutant formed papules and pustules at rates that were no different than those of its parent. When grown in media with and without Neu5Ac supplementation, the neuA mutant and its parent had similar phenotypes in bactericidal, macrophage uptake, and dendritic cell activation assays. Although we cannot preclude a contribution of LOS sialylation to ulcerative disease, these data strongly suggest that sialylation of LOS is dispensable for H. ducreyi pathogenesis in humans.

  7. Rescue of infectious rift valley fever virus entirely from cDNA, analysis of virus lacking the NSs gene, and expression of a foreign gene.

    PubMed

    Ikegami, Tetsuro; Won, Sungyong; Peters, C J; Makino, Shinji

    2006-03-01

    Rift Valley fever virus (RVFV) (genus Phlebovirus, family Bunyaviridae) has a tripartite negative-strand genome, causes a mosquito-borne disease that is endemic in sub-Saharan African countries and that also causes large epidemics among humans and livestock. Furthermore, it is a bioterrorist threat and poses a risk for introduction to other areas. In spite of its danger, neither veterinary nor human vaccines are available. We established a T7 RNA polymerase-driven reverse genetics system to rescue infectious clones of RVFV MP-12 strain entirely from cDNA, the first for any phlebovirus. Expression of viral structural proteins from the protein expression plasmids was not required for virus rescue, whereas NSs protein expression abolished virus rescue. Mutants of MP-12 partially or completely lacking the NSs open reading frame were viable. These NSs deletion mutants replicated efficiently in Vero and 293 cells, but not in MRC-5 cells. In the latter cell line, accumulation of beta interferon mRNA occurred after infection by these NSs deletion mutants, but not after infection by MP-12. The NSs deletion mutants formed larger plaques than MP-12 did in Vero E6 cells and failed to shut off host protein synthesis in Vero cells. An MP-12 mutant carrying a luciferase gene in place of the NSs gene replicated as efficiently as MP-12 did, produced enzymatically active luciferase during replication, and stably retained the luciferase gene after 10 virus passages, representing the first demonstration of foreign gene expression in any bunyavirus. This reverse genetics system can be used to study the molecular virology of RVFV, assess current vaccine candidates, produce new vaccines, and incorporate marker genes into animal vaccines.

  8. The Drosophila Neurally Altered Carbohydrate Mutant Has a Defective Golgi GDP-fucose Transporter*

    PubMed Central

    Geisler, Christoph; Kotu, Varshika; Sharrow, Mary; Rendić, Dubravko; Pöltl, Gerald; Tiemeyer, Michael; Wilson, Iain B. H.; Jarvis, Donald L.

    2012-01-01

    Studying genetic disorders in model organisms can provide insights into heritable human diseases. The Drosophila neurally altered carbohydrate (nac) mutant is deficient for neural expression of the HRP epitope, which consists of N-glycans with core α1,3-linked fucose residues. Here, we show that a conserved serine residue in the Golgi GDP-fucose transporter (GFR) is substituted by leucine in nac1 flies, which abolishes GDP-fucose transport in vivo and in vitro. This loss of function is due to a biochemical defect, not to destabilization or mistargeting of the mutant GFR protein. Mass spectrometry and HPLC analysis showed that nac1 mutants lack not only core α1,3-linked, but also core α1,6-linked fucose residues on their N-glycans. Thus, the nac1 Gfr mutation produces a previously unrecognized general defect in N-glycan core fucosylation. Transgenic expression of a wild-type Gfr gene restored the HRP epitope in neural tissues, directly demonstrating that the Gfr mutation is solely responsible for the neural HRP epitope deficiency in the nac1 mutant. These results validate the Drosophila nac1 mutant as a model for the human congenital disorder of glycosylation, CDG-IIc (also known as LAD-II), which is also the result of a GFR deficiency. PMID:22745127

  9. Functional Analysis of Human NF1 in Drosophila

    DTIC Science & Technology

    2008-12-01

    also have learning problem. Such learning phenotypes have been recapitulated in animal models, including in mouse and Drosophila mutants. This proposal...by examining the phenotypes of mutated human genes expressed in Drosophila NF1 null mutants. We also propose that Gsα/NF1 activated AC pathway...in both Drosophila and mouse NF1 models. Our previous work has shown that defective cAMP signaling leads to the learning phenotype in Drosophila Nf1

  10. Production of MPS VII mouse (Gustm(hE540A·mE536A)Sly) doubly tolerant to human and mouse β-glucuronidase

    PubMed Central

    Tomatsu, Shunji; Orii, Koji O.; Vogler, Carole; Grubb, Jeffrey H.; Snella, Elizabeth M.; Gutierrez, Monica; Dieter, Tatiana; Holden, Christopher C.; Sukegawa, Kazuko; Orii, Tadao; Kondo, Naomi; Sly, William S.

    2006-01-01

    Mucopolysaccharidosis VII (MPS VII, Sly syndrome) is an autosomal recessive lysosomal storage disease caused by β-glucuronidase (GUS) deficiency. A naturally occurring mouse model of that disease has been very useful for studying experimental approaches to therapy. However, immune responses can complicate evaluation of the long-term benefits of enzyme replacement or gene therapy delivered to adult MPS VII mice. To make this model useful for studying the long-term effectiveness and side effects of experimental therapies delivered to adult mice, we developed a new MPS VII mouse model, which is tolerant to both human and murine GUS. To achieve this, we used homologous recombination to introduce simultaneously a human cDNA transgene expressing inactive human GUS into intron 9 of the murine Gus gene and a targeted active site mutation (E536A) into the adjacent exon 10. When the heterozygote products of germline transmission were bred to homozygosity, the homozygous mice expressed no GUS enzyme activity but expressed inactive human GUS protein highly and were tolerant to immune challenge with human enzyme. Expression of the mutant murine Gus gene was reduced to about 10% of normal levels, but the inactive murine GUS enzyme also conferred tolerance to murine GUS. This MPS VII mouse model should be useful to evaluate therapeutic responses in adult mice receiving repetitive doses of enzyme or mice receiving gene therapy as adults. Heterozygotes expressed only 9.5–26% of wild-type levels of murine GUS instead of the expected 50%, indicating a dominant-negative effect of the mutant enzyme monomers on the activity of GUS tetramers in different tissues. Corrective gene therapy in this model should provide high enough levels of expression of normal GUS monomers to overcome the dominant negative effect of mutant monomers on newly synthesized GUS tetramers in most tissues. PMID:12700165

  11. Effect of single point mutations of the human tachykinin NK1 receptor on antagonist affinity.

    PubMed

    Lundstrom, K; Hawcock, A B; Vargas, A; Ward, P; Thomas, P; Naylor, A

    1997-10-15

    Molecular modelling and site-directed mutagenesis were used to identify eleven amino acid residues which may be involved in antagonist binding of the human tachykinin NK1 receptor. Recombinant receptors were expressed in mammalian cells using the Semliki Forest virus system. Wild type and mutant receptors showed similar expression levels in BHK and CHO cells, verified by metabolic labelling. Binding affinities were determined for a variety of tachykinin NK1 receptor antagonists in SFV-infected CHO cells. The binding affinity for GR203040, CP 99,994 and CP 96,345 was significantly reduced by mutant Q165A. The mutant F268A significantly reduced the affinity for GR203040 and CP 99,994 and the mutant H197A had reduced affinity for CP 96,345. All antagonists seemed to bind in a similar region of the receptor, but do not all rely on the same binding site interactions. Functional coupling to G-proteins was assayed by intracellular Ca2+ release in SFV-infected CHO cells. The wild type receptor and all mutants except A162L and F268A responded to substance P stimulation.

  12. phoP, SPI1, SPI2 and aroA mutants of Salmonella Enteritidis induce a different immune response in chickens.

    PubMed

    Elsheimer-Matulova, Marta; Varmuzova, Karolina; Kyrova, Kamila; Havlickova, Hana; Sisak, Frantisek; Rahman, Masudur; Rychlik, Ivan

    2015-09-17

    Poultry is the most frequent reservoir of non-typhoid Salmonella enterica for humans. Understanding the interactions between chickens and S. enterica is therefore important for vaccine design and subsequent decrease in the incidence of human salmonellosis. In this study we therefore characterized the interactions between chickens and phoP, aroA, SPI1 and SPI2 mutants of S. Enteritidis. First we tested the response of HD11 chicken macrophage-like cell line to S. Enteritidis infection monitoring the transcription of 36 genes related to immune response. All the mutants and the wild type strain induced inflammatory signaling in the HD11 cell line though the response to SPI1 mutant infection was different from the rest of the mutants. When newly hatched chickens were inoculated, the phoP as well as the SPI1 mutant did not induce an expression of any of the tested genes in the cecum. Despite this, such chickens were protected against challenge with wild-type S. Enteritidis. On the other hand, inoculation of chickens with the aroA or SPI2 mutant induced expression of 27 and 18 genes, respectively, including genes encoding immunoglobulins. Challenge of chickens inoculated with these two mutants resulted in repeated induction of 11 and 13 tested genes, respectively, including the genes encoding immunoglobulins. In conclusion, SPI1 and phoP mutants induced protective immunity without inducing an inflammatory response and antibody production. Inoculation of chickens with the SPI2 and aroA mutants also led to protective immunity but was associated with inflammation and antibody production. The differences in interaction between the mutants and chicken host can be used for a more detailed understanding of the chicken immune system.

  13. ALS mutations in FUS cause neuronal dysfunction and death in Caenorhabditis elegans by a dominant gain-of-function mechanism

    PubMed Central

    Murakami, Tetsuro; Yang, Seung-Pil; Xie, Lin; Kawano, Taizo; Fu, Donald; Mukai, Asuka; Bohm, Christopher; Chen, Fusheng; Robertson, Janice; Suzuki, Hiroshi; Tartaglia, Gian Gaetano; Vendruscolo, Michele; Kaminski Schierle, Gabriele S.; Chan, Fiona T.S.; Moloney, Aileen; Crowther, Damian; Kaminski, Clemens F.; Zhen, Mei; St George-Hyslop, Peter

    2012-01-01

    It is unclear whether mutations in fused in sarcoma (FUS) cause familial amyotrophic lateral sclerosis via a loss-of-function effect due to titrating FUS from the nucleus or a gain-of-function effect from cytoplasmic overabundance. To investigate this question, we generated a series of independent Caenorhabditis elegans lines expressing mutant or wild-type (WT) human FUS. We show that mutant FUS, but not WT-FUS, causes cytoplasmic mislocalization associated with progressive motor dysfunction and reduced lifespan. The severity of the mutant phenotype in C. elegans was directly correlated with the severity of the illness caused by the same mutation in humans, arguing that this model closely replicates key features of the human illness. Importantly, the mutant phenotype could not be rescued by overexpression of WT-FUS, even though WT-FUS had physiological intracellular localization, and was not recruited to the cytoplasmic mutant FUS aggregates. Our data suggest that FUS mutants cause neuronal dysfunction by a dominant gain-of-function effect related either to neurotoxic aggregates of mutant FUS in the cytoplasm or to dysfunction in its RNA-binding functions. PMID:21949354

  14. ALS mutations in FUS cause neuronal dysfunction and death in Caenorhabditis elegans by a dominant gain-of-function mechanism.

    PubMed

    Murakami, Tetsuro; Yang, Seung-Pil; Xie, Lin; Kawano, Taizo; Fu, Donald; Mukai, Asuka; Bohm, Christopher; Chen, Fusheng; Robertson, Janice; Suzuki, Hiroshi; Tartaglia, Gian Gaetano; Vendruscolo, Michele; Kaminski Schierle, Gabriele S; Chan, Fiona T S; Moloney, Aileen; Crowther, Damian; Kaminski, Clemens F; Zhen, Mei; St George-Hyslop, Peter

    2012-01-01

    It is unclear whether mutations in fused in sarcoma (FUS) cause familial amyotrophic lateral sclerosis via a loss-of-function effect due to titrating FUS from the nucleus or a gain-of-function effect from cytoplasmic overabundance. To investigate this question, we generated a series of independent Caenorhabditis elegans lines expressing mutant or wild-type (WT) human FUS. We show that mutant FUS, but not WT-FUS, causes cytoplasmic mislocalization associated with progressive motor dysfunction and reduced lifespan. The severity of the mutant phenotype in C. elegans was directly correlated with the severity of the illness caused by the same mutation in humans, arguing that this model closely replicates key features of the human illness. Importantly, the mutant phenotype could not be rescued by overexpression of WT-FUS, even though WT-FUS had physiological intracellular localization, and was not recruited to the cytoplasmic mutant FUS aggregates. Our data suggest that FUS mutants cause neuronal dysfunction by a dominant gain-of-function effect related either to neurotoxic aggregates of mutant FUS in the cytoplasm or to dysfunction in its RNA-binding functions.

  15. Heart-specific expression of laminopathic mutations in transgenic zebrafish.

    PubMed

    Verma, Ajay D; Parnaik, Veena K

    2017-07-01

    Lamins are key determinants of nuclear organization and function in the metazoan nucleus. Mutations in human lamin A cause a spectrum of genetic diseases that affect cardiac muscle and skeletal muscle as well as other tissues. A few laminopathies have been modeled using the mouse. As zebrafish is a well established model for the study of cardiac development and disease, we have investigated the effects of heart-specific lamin A mutations in transgenic zebrafish. We have developed transgenic lines of zebrafish expressing conserved lamin A mutations that cause cardiac dysfunction in humans. Expression of zlamin A mutations Q291P and M368K in the heart was driven by the zebrafish cardiac troponin T2 promoter. Homozygous mutant embryos displayed nuclear abnormalities in cardiomyocyte nuclei. Expression analysis showed the upregulation of genes involved in heart regeneration in transgenic mutant embryos and a cell proliferation marker was increased in adult heart tissue. At the physiological level, there was deviation of up to 20% from normal heart rate in transgenic embryos expressing mutant lamins. Adult homozygous zebrafish were fertile and did not show signs of early mortality. Our results suggest that transgenic zebrafish models of heart-specific laminopathies show cardiac regeneration and moderate deviations in heart rate during embryonic development. © 2017 International Federation for Cell Biology.

  16. Multidrug ATP-binding cassette transporters are essential for hepatic development of Plasmodium sporozoites.

    PubMed

    Rijpma, Sanna R; van der Velden, Maarten; González-Pons, Maria; Annoura, Takeshi; van Schaijk, Ben C L; van Gemert, Geert-Jan; van den Heuvel, Jeroen J M W; Ramesar, Jai; Chevalley-Maurel, Severine; Ploemen, Ivo H; Khan, Shahid M; Franetich, Jean-Francois; Mazier, Dominique; de Wilt, Johannes H W; Serrano, Adelfa E; Russel, Frans G M; Janse, Chris J; Sauerwein, Robert W; Koenderink, Jan B; Franke-Fayard, Blandine M

    2016-03-01

    Multidrug resistance-associated proteins (MRPs) belong to the C-family of ATP-binding cassette (ABC) transport proteins and are known to transport a variety of physiologically important compounds and to be involved in the extrusion of pharmaceuticals. Rodent malaria parasites encode a single ABC transporter subfamily C protein, whereas human parasites encode two: MRP1 and MRP2. Although associated with drug resistance, their biological function and substrates remain unknown. To elucidate the role of MRP throughout the parasite life cycle, Plasmodium berghei and Plasmodium falciparum mutants lacking MRP expression were generated. P. berghei mutants lacking expression of the single MRP as well as P. falciparum mutants lacking MRP1, MRP2 or both proteins have similar blood stage growth kinetics and drug-sensitivity profiles as wild type parasites. We show that MRP1-deficient parasites readily invade primary human hepatocytes and develop into mature liver stages. In contrast, both P. falciparum MRP2-deficient parasites and P. berghei mutants lacking MRP protein expression abort in mid to late liver stage development, failing to produce mature liver stages. The combined P. berghei and P. falciparum data are the first demonstration of a critical role of an ABC transporter during Plasmodium liver stage development. © 2015 John Wiley & Sons Ltd.

  17. DNase I hypersensitivity and epsilon-globin transcriptional enhancement are separable in locus control region (LCR) HS1 mutant human beta-globin YAC transgenic mice.

    PubMed

    Shimotsuma, Motoshi; Okamura, Eiichi; Matsuzaki, Hitomi; Fukamizu, Akiyoshi; Tanimoto, Keiji

    2010-05-07

    Expression of the five beta-like globin genes (epsilon, Ggamma, Agamma, delta, beta) in the human beta-globin locus depends on enhancement by the locus control region, which consists of five DNase I hypersensitive sites (5'HS1 through 5'HS5). We report here a novel enhancer activity in 5'HS1 that appears to be potent in transfected K562 cells. Deletion analyses identified a core activating element that bound to GATA-1, and a two-nucleotide mutation that disrupted GATA-1 binding in vitro abrogated 5'HS1 enhancer activity in transfection experiments. To determine the in vivo role of this GATA site, we generated multiple lines of human beta-globin YAC transgenic mice bearing the same two-nucleotide mutation. In the mutant mice, epsilon-, but not gamma-globin, gene expression in primitive erythroid cells was severely attenuated, while adult beta-globin gene expression in definitive erythroid cells was unaffected. Interestingly, DNaseI hypersensitivity near the 5'HS1 mutant sequence was eliminated in definitive erythroid cells, whereas it was only mildly affected in primitive erythroid cells. We therefore conclude that, although the GATA site in 5'HS1 is critical for efficient epsilon-globin gene expression, hypersensitive site formation per se is independent of 5'HS1 function, if any, in definitive erythroid cells.

  18. [Construction of FANCA mutant protein from Fanconi anemia patient and analysis of its function].

    PubMed

    Chen, Fei; Zhang, Ke-Jian; Zuo, Xue-Lan; Zeng, Xian-Chang

    2007-11-01

    To study FANCA protein expression in Fanconi anemia patient's (FA) cells and explore its function. FANCA protein expression was analyzed in 3 lymphoblast cell lines derived from 3 cases of type A FA (FA-A) patients using Western blot. Nucleus and cytoplasm localization of FANCA protein was analyzed in one case of FA-A which contained a truncated FANCA (exon 5 deletion). The FANCA mutant was constructed from the same patient and its interaction with FANCG was evaluated by mammalian two-hybrid (M2H) assay. FANCA protein was not detected in the 3 FA-A patients by rabbit anti-human MoAb, but a truncated FANCA protein was detected in 1 of them by mouse anti-human MoAb. The truncated FANCA could not transport from cytoplasm into nucleus. The disease-associated FANCA mutant was defective in binding to FANCG in M2H system. FANCA proteins are defective in the 3 FA-A patients. Disfunction of disease-associated FANCA mutant proved to be the pathogenic mutations in FANCA gene. Exon 5 of FANCA gene was involved in the interaction between FANCA and FANCG.

  19. FUS and TARDBP but Not SOD1 Interact in Genetic Models of Amyotrophic Lateral Sclerosis

    PubMed Central

    Kabashi, Edor; Bercier, Valérie; Lissouba, Alexandra; Liao, Meijiang; Brustein, Edna; Rouleau, Guy A.; Drapeau, Pierre

    2011-01-01

    Mutations in the SOD1 and TARDBP genes have been commonly identified in Amyotrophic Lateral Sclerosis (ALS). Recently, mutations in the Fused in sarcoma gene (FUS) were identified in familial (FALS) ALS cases and sporadic (SALS) patients. Similarly to TDP-43 (coded by TARDBP gene), FUS is an RNA binding protein. Using the zebrafish (Danio rerio), we examined the consequences of expressing human wild-type (WT) FUS and three ALS–related mutations, as well as their interactions with TARDBP and SOD1. Knockdown of zebrafish Fus yielded a motor phenotype that could be rescued upon co-expression of wild-type human FUS. In contrast, the two most frequent ALS–related FUS mutations, R521H and R521C, unlike S57Δ, failed to rescue the knockdown phenotype, indicating loss of function. The R521H mutation caused a toxic gain of function when expressed alone, similar to the phenotype observed upon knockdown of zebrafish Fus. This phenotype was not aggravated by co-expression of both mutant human TARDBP (G348C) and FUS (R521H) or by knockdown of both zebrafish Tardbp and Fus, consistent with a common pathogenic mechanism. We also observed that WT FUS rescued the Tardbp knockdown phenotype, but not vice versa, suggesting that TARDBP acts upstream of FUS in this pathway. In addition we observed that WT SOD1 failed to rescue the phenotype observed upon overexpression of mutant TARDBP or FUS or upon knockdown of Tardbp or Fus; similarly, WT TARDBP or FUS also failed to rescue the phenotype induced by mutant SOD1 (G93A). Finally, overexpression of mutant SOD1 exacerbated the motor phenotype caused by overexpression of mutant FUS. Together our results indicate that TARDBP and FUS act in a pathogenic pathway that is independent of SOD1. PMID:21829392

  20. FUS and TARDBP but not SOD1 interact in genetic models of amyotrophic lateral sclerosis.

    PubMed

    Kabashi, Edor; Bercier, Valérie; Lissouba, Alexandra; Liao, Meijiang; Brustein, Edna; Rouleau, Guy A; Drapeau, Pierre

    2011-08-01

    Mutations in the SOD1 and TARDBP genes have been commonly identified in Amyotrophic Lateral Sclerosis (ALS). Recently, mutations in the Fused in sarcoma gene (FUS) were identified in familial (FALS) ALS cases and sporadic (SALS) patients. Similarly to TDP-43 (coded by TARDBP gene), FUS is an RNA binding protein. Using the zebrafish (Danio rerio), we examined the consequences of expressing human wild-type (WT) FUS and three ALS-related mutations, as well as their interactions with TARDBP and SOD1. Knockdown of zebrafish Fus yielded a motor phenotype that could be rescued upon co-expression of wild-type human FUS. In contrast, the two most frequent ALS-related FUS mutations, R521H and R521C, unlike S57Δ, failed to rescue the knockdown phenotype, indicating loss of function. The R521H mutation caused a toxic gain of function when expressed alone, similar to the phenotype observed upon knockdown of zebrafish Fus. This phenotype was not aggravated by co-expression of both mutant human TARDBP (G348C) and FUS (R521H) or by knockdown of both zebrafish Tardbp and Fus, consistent with a common pathogenic mechanism. We also observed that WT FUS rescued the Tardbp knockdown phenotype, but not vice versa, suggesting that TARDBP acts upstream of FUS in this pathway. In addition we observed that WT SOD1 failed to rescue the phenotype observed upon overexpression of mutant TARDBP or FUS or upon knockdown of Tardbp or Fus; similarly, WT TARDBP or FUS also failed to rescue the phenotype induced by mutant SOD1 (G93A). Finally, overexpression of mutant SOD1 exacerbated the motor phenotype caused by overexpression of mutant FUS. Together our results indicate that TARDBP and FUS act in a pathogenic pathway that is independent of SOD1.

  1. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    PubMed Central

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  2. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

    PubMed

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

    2010-05-01

    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  3. Development and translational imaging of a TP53 porcine tumorigenesis model

    PubMed Central

    Sieren, Jessica C.; Meyerholz, David K.; Wang, Xiao-Jun; Davis, Bryan T.; Newell, John D.; Hammond, Emily; Rohret, Judy A.; Rohret, Frank A.; Struzynski, Jason T.; Goeken, J. Adam; Naumann, Paul W.; Leidinger, Mariah R.; Taghiyev, Agshin; Van Rheeden, Richard; Hagen, Jussara; Darbro, Benjamin W.; Quelle, Dawn E.; Rogers, Christopher S.

    2014-01-01

    Cancer is the second deadliest disease in the United States, necessitating improvements in tumor diagnosis and treatment. Current model systems of cancer are informative, but translating promising imaging approaches and therapies to clinical practice has been challenging. In particular, the lack of a large-animal model that accurately mimics human cancer has been a major barrier to the development of effective diagnostic tools along with surgical and therapeutic interventions. Here, we developed a genetically modified porcine model of cancer in which animals express a mutation in TP53 (which encodes p53) that is orthologous to one commonly found in humans (R175H in people, R167H in pigs). TP53R167H/R167H mutant pigs primarily developed lymphomas and osteogenic tumors, recapitulating the tumor types observed in mice and humans expressing orthologous TP53 mutant alleles. CT and MRI imaging data effectively detected developing tumors, which were validated by histopathological evaluation after necropsy. Molecular genetic analyses confirmed that these animals expressed the R167H mutant p53, and evaluation of tumors revealed characteristic chromosomal instability. Together, these results demonstrated that TP53R167H/R167H pigs represent a large-animal tumor model that replicates the human condition. Our data further suggest that this model will be uniquely suited for developing clinically relevant, noninvasive imaging approaches to facilitate earlier detection, diagnosis, and treatment of human cancers. PMID:25105366

  4. Mutant p53-associated myosin-X upregulation promotes breast cancer invasion and metastasis.

    PubMed

    Arjonen, Antti; Kaukonen, Riina; Mattila, Elina; Rouhi, Pegah; Högnäs, Gunilla; Sihto, Harri; Miller, Bryan W; Morton, Jennifer P; Bucher, Elmar; Taimen, Pekka; Virtakoivu, Reetta; Cao, Yihai; Sansom, Owen J; Joensuu, Heikki; Ivaska, Johanna

    2014-03-01

    Mutations of the tumor suppressor TP53 are present in many forms of human cancer and are associated with increased tumor cell invasion and metastasis. Several mechanisms have been identified for promoting dissemination of cancer cells with TP53 mutations, including increased targeting of integrins to the plasma membrane. Here, we demonstrate a role for the filopodia-inducing motor protein Myosin-X (Myo10) in mutant p53-driven cancer invasion. Analysis of gene expression profiles from 2 breast cancer data sets revealed that MYO10 was highly expressed in aggressive cancer subtypes. Myo10 was required for breast cancer cell invasion and dissemination in multiple cancer cell lines and murine models of cancer metastasis. Evaluation of a Myo10 mutant without the integrin-binding domain revealed that the ability of Myo10 to transport β₁ integrins to the filopodia tip is required for invasion. Introduction of mutant p53 promoted Myo10 expression in cancer cells and pancreatic ductal adenocarcinoma in mice, whereas suppression of endogenous mutant p53 attenuated Myo10 levels and cell invasion. In clinical breast carcinomas, Myo10 was predominantly expressed at the invasive edges and correlated with the presence of TP53 mutations and poor prognosis. These data indicate that Myo10 upregulation in mutant p53-driven cancers is necessary for invasion and that plasma-membrane protrusions, such as filopodia, may serve as specialized metastatic engines.

  5. Targeting of KRAS mutant tumors by HSP90 inhibitors involves degradation of STK33

    PubMed Central

    Azoitei, Ninel; Hoffmann, Christopher M.; Ellegast, Jana M.; Ball, Claudia R.; Obermayer, Kerstin; Gößele, Ulrike; Koch, Britta; Faber, Katrin; Genze, Felicitas; Schrader, Mark; Kestler, Hans A.; Döhner, Hartmut; Chiosis, Gabriela; Glimm, Hanno

    2012-01-01

    Previous efforts to develop drugs that directly inhibit the activity of mutant KRAS, the most commonly mutated human oncogene, have not been successful. Cancer cells driven by mutant KRAS require expression of the serine/threonine kinase STK33 for their viability and proliferation, identifying STK33 as a context-dependent therapeutic target. However, specific strategies for interfering with the critical functions of STK33 are not yet available. Here, using a mass spectrometry-based screen for STK33 protein interaction partners, we report that the HSP90/CDC37 chaperone complex binds to and stabilizes STK33 in human cancer cells. Pharmacologic inhibition of HSP90, using structurally divergent small molecules currently in clinical development, induced proteasome-mediated degradation of STK33 in human cancer cells of various tissue origin in vitro and in vivo, and triggered apoptosis preferentially in KRAS mutant cells in an STK33-dependent manner. Furthermore, HSP90 inhibitor treatment impaired sphere formation and viability of primary human colon tumor-initiating cells harboring mutant KRAS. These findings provide mechanistic insight into the activity of HSP90 inhibitors in KRAS mutant cancer cells, indicate that the enhanced requirement for STK33 can be exploited to target mutant KRAS-driven tumors, and identify STK33 depletion through HSP90 inhibition as a biomarker-guided therapeutic strategy with immediate translational potential. PMID:22451720

  6. FTY720/fingolimod increases NPC1 and NPC2 expression and reduces cholesterol and sphingolipid accumulation in Niemann-Pick type C mutant fibroblasts

    PubMed Central

    Newton, Jason; Hait, Nitai C.; Maceyka, Michael; Colaco, Alexandria; Maczis, Melissa; Wassif, Christopher A.; Cougnoux, Antony; Porter, Forbes D.; Milstien, Sheldon; Platt, Nicholas; Platt, Frances M.; Spiegel, Sarah

    2017-01-01

    Niemann-Pick type C (NPC) disease is a fatal neurodegenerative disorder caused by mutations in NPC1 or NPC2 with decreased functions leading to lysosomal accumulation of cholesterol and sphingolipids. FTY720/fingolimod, used for treatment of multiple sclerosis, is phosphorylated by nuclear sphingosine kinase 2, and its active phosphorylated form (FTY720-P) is an inhibitor of class I histone deacetylases. In this study, administration of clinically relevant doses of FTY720 to mice increased expression of NPC1 and -2 in brain and liver and decreased cholesterol in an SphK2-dependent manner. FTY720 greatly increased expression of NPC1 and -2 in human NPC1 mutant fibroblasts that correlated with formation of FTY720-P and significantly reduced the accumulation of cholesterol and glycosphingolipids. In agreement with this finding, FTY720 pretreatment of human NPC1 mutant fibroblasts restored transport of the cholera toxin B subunit, which binds ganglioside GM1, to the Golgi apparatus. Together, these findings suggest that FTY720 administration can ameliorate cholesterol and sphingolipid storage and trafficking defects in NPC1 mutant fibroblasts. Because neurodegeneration is the main clinical feature of NPC disease, and FTY720 accumulates in the CNS and has several advantages over available histone deacetylase inhibitors now in clinical trials, our work provides a potential opportunity for treatment of this incurable disease.—Newton, J., Hait, N. C., Maceyka, M., Colaco, A., Maczis, M., Wassif, C. A., Cougnoux, A., Porter, F. D., Milstien, S., Platt, N., Platt, F. M., Spiegel, S. FTY720/fingolimod increases NPC1 and NPC2 expression and reduces cholesterol and sphingolipid accumulation in Niemann-Pick type C mutant fibroblasts. PMID:28082351

  7. Human Papillomavirus E6E7-Mediated Adenovirus Cell Killing: Selectivity of Mutant Adenovirus Replication in Organotypic Cultures of Human Keratinocytes

    PubMed Central

    Balagué, Cristina; Noya, Francisco; Alemany, Ramon; Chow, Louise T.; Curiel, David T.

    2001-01-01

    Replication-competent adenoviruses are being investigated as potential anticancer agents. Exclusive virus replication in cancer cells has been proposed as a safety trait to be considered in the design of oncolytic adenoviruses. From this perspective, we have investigated several adenovirus mutants for their potential to conditionally replicate and promote the killing of cells expressing human papillomavirus (HPV) E6 and E7 oncoproteins, which are present in a high percentage of anogenital cancers. For this purpose, we have employed an organotypic model of human stratified squamous epithelium derived from primary keratinocytes that have been engineered to express HPV-18 oncoproteins stably. We show that, whereas wild-type adenovirus promotes a widespread cytopathic effect in all infected cells, E1A- and E1A/E1B-deleted adenoviruses cause no deleterious effect regardless of the coexpression of HPV18 E6E7. An adenovirus deleted in the CR2 domain of E1A, necessary for binding to the pRB family of pocket proteins, shows no selectivity of replication as it efficiently kills all normal and E6E7-expressing keratinocytes. Finally, an adenovirus mutant deleted in the CR1 and CR2 domains of E1A exhibits preferential replication and cell killing in HPV E6E7-expressing cultures. We conclude that the organotypic keratinocyte culture represents a distinct model to evaluate adenovirus selectivity and that, based on this model, further modifications of the adenovirus genome are required to restrict adenovirus replication to tumor cells. PMID:11462032

  8. BIG: a calossin-like protein required for polar auxin transport in Arabidopsis

    PubMed Central

    Gil, Pedro; Dewey, Elizabeth; Friml, Jiri; Zhao, Yunde; Snowden, Kimberley C.; Putterill, Jo; Palme, Klaus; Estelle, Mark; Chory, Joanne

    2001-01-01

    Polar auxin transport is crucial for the regulation of auxin action and required for some light-regulated responses during plant development. We have found that two mutants of Arabidopsis—doc1, which displays altered expression of light-regulated genes, and tir3, known for its reduced auxin transport—have similar defects and define mutations in a single gene that we have renamed BIG. BIG is very similar to the Drosophila gene Calossin/Pushover, a member of a gene family also present in Caenorhabditis elegans and human genomes. The protein encoded by BIG is extraordinary in size, 560 kD, and contains several putative Zn-finger domains. Expression-profiling experiments indicate that altered expression of multiple light-regulated genes in doc1 mutants can be suppressed by elevated levels of auxin caused by overexpression of an auxin biosynthetic gene, suggesting that normal auxin distribution is required to maintain low-level expression of these genes in the dark. Double mutants of tir3 with the auxin mutants pin1, pid, and axr1 display severe defects in auxin-dependent growth of the inflorescence. Chemical inhibitors of auxin transport change the intracellular localization of the auxin efflux carrier PIN1 in doc1/tir3 mutants, supporting the idea that BIG is required for normal auxin efflux. PMID:11485992

  9. An in vitro system for measuring genotoxicity mediated by human CYP3A4 in Saccharomyces cerevisiae.

    PubMed

    Fasullo, Michael; Freedland, Julian; St John, Nicholas; Cera, Cinzia; Egner, Patricia; Hartog, Matthew; Ding, Xinxin

    2017-05-01

    P450 activity is required to metabolically activate many chemical carcinogens, rendering them highly genotoxic. CYP3A4 is the most abundantly expressed P450 enzyme in the liver, accounting for most drug metabolism and constituting 50% of all hepatic P450 activity. CYP3A4 is also expressed in extrahepatic tissues, including the intestine. However, the role of CYP3A4 in activating chemical carcinogens into potent genotoxins is unclear. To facilitate efforts to determine whether CYP3A4, per se, can activate carcinogens into potent genotoxins, we expressed human CYP3A4 in the DNA-repair mutant (rad4 rad51) strain of budding yeast Saccharomyces cerevisiae and tested the novel, recombinant yeast strain for ability to report CYP3A4-mediated genotoxicity of a well-known genotoxin, aflatoxin B1 (AFB 1 ). Yeast microsomes containing human CYP3A4, but not those that do not contain CYP3A4, were active in hydroxylation of diclofenac, a known CYP3A4 substrate drug, a result confirming CYP3A4 activity in the recombinant yeast strain. In cells exposed to AFB 1 , the expression of CYP3A4 supported DNA adduct formation, chromosome rearrangements, cell death, and expression of the large subunit of ribonucleotide reductase, Rnr3, a marker of DNA damage. Expression of CYP3A4 also conferred sensitivity in rad4 rad51 mutants exposed to colon carcinogen, 2-amino-3,8-dimethylimidazo[4,5-f]quinoxaline (MeIQx). These data confirm the ability of human CYP3A4 to mediate the genotoxicity of AFB 1 , and illustrate the usefulness of the CYP3A4-expressing, DNA-repair mutant yeast strain for screening other chemical compounds that are CYP3A4 substrates, for potential genotoxicity. Environ. Mol. Mutagen. 58:217-227, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  10. Human Cytomegalovirus UL99-Encoded pp28 Is Required for the Cytoplasmic Envelopment of Tegument-Associated Capsids

    PubMed Central

    Silva, Maria C.; Yu, Qian-Chun; Enquist, Lynn; Shenk, Thomas

    2003-01-01

    The human cytomegalovirus UL99-encoded pp28 is a myristylated phosphoprotein that is a constituent of the virion. The pp28 protein is positioned within the tegument of the virus particle, a protein structure that resides between the capsid and envelope. In the infected cell, pp28 is found in a cytoplasmic compartment derived from the Golgi apparatus, where the virus buds into vesicles to acquire its final membrane. We have constructed two mutants of human cytomegalovirus that fail to produce the pp28 protein, a substitution mutant (BADsubUL99) and a point mutant (BADpmUL99), and we have propagated them by complementation in pp28-expressing fibroblasts. Both mutant viruses are profoundly defective for growth in normal fibroblasts; no infectious virus could be detected after infection. Whereas normal levels of viral DNA and late proteins were observed in mutant virus-infected cells, large numbers of tegument-associated capsids accumulated in the cytoplasm that failed to acquire an envelope. We conclude that pp28 is required for the final envelopment of the human cytomegalovirus virion in the cytoplasm. PMID:12970444

  11. Inactivation of the ATMIN/ATM pathway protects against glioblastoma formation

    PubMed Central

    Blake, Sophia M; Stricker, Stefan H; Halavach, Hanna; Poetsch, Anna R; Cresswell, George; Kelly, Gavin; Kanu, Nnennaya; Marino, Silvia; Luscombe, Nicholas M; Pollard, Steven M; Behrens, Axel

    2016-01-01

    Glioblastoma multiforme (GBM) is the most aggressive human primary brain cancer. Using a Trp53-deficient mouse model of GBM, we show that genetic inactivation of the Atm cofactor Atmin, which is dispensable for embryonic and adult neural development, strongly suppresses GBM formation. Mechanistically, expression of several GBM-associated genes, including Pdgfra, was normalized by Atmin deletion in the Trp53-null background. Pharmacological ATM inhibition also reduced Pdgfra expression, and reduced the proliferation of Trp53-deficient primary glioma cells from murine and human tumors, while normal neural stem cells were unaffected. Analysis of GBM datasets showed that PDGFRA expression is also significantly increased in human TP53-mutant compared with TP53-wild-type tumors. Moreover, combined treatment with ATM and PDGFRA inhibitors efficiently killed TP53-mutant primary human GBM cells, but not untransformed neural stem cells. These results reveal a new requirement for ATMIN-dependent ATM signaling in TP53-deficient GBM, indicating a pro-tumorigenic role for ATM in the context of these tumors. DOI: http://dx.doi.org/10.7554/eLife.08711.001 PMID:26984279

  12. Wild-Type U2AF1 Antagonizes the Splicing Program Characteristic of U2AF1-Mutant Tumors and Is Required for Cell Survival

    PubMed Central

    Fei, Dennis Liang; Motowski, Hayley; Chatrikhi, Rakesh; Gao, Shaojian; Kielkopf, Clara L.; Varmus, Harold

    2016-01-01

    We have asked how the common S34F mutation in the splicing factor U2AF1 regulates alternative splicing in lung cancer, and why wild-type U2AF1 is retained in cancers with this mutation. A human lung epithelial cell line was genetically modified so that U2AF1S34F is expressed from one of the two endogenous U2AF1 loci. By altering levels of mutant or wild-type U2AF1 in this cell line and by analyzing published data on human lung adenocarcinomas, we show that S34F-associated changes in alternative splicing are proportional to the ratio of S34F:wild-type gene products and not to absolute levels of either the mutant or wild-type factor. Preferential recognition of specific 3′ splice sites in S34F-expressing cells is largely explained by differential in vitro RNA-binding affinities of mutant versus wild-type U2AF1 for those same 3′ splice sites. Finally, we show that lung adenocarcinoma cell lines bearing U2AF1 mutations do not require the mutant protein for growth in vitro or in vivo. In contrast, wild-type U2AF1 is required for survival, regardless of whether cells carry the U2AF1S34F allele. Our results provide mechanistic explanations of the magnitude of splicing changes observed in U2AF1-mutant cells and why tumors harboring U2AF1 mutations always retain an expressed copy of the wild-type allele. PMID:27776121

  13. P01.29 Mutant (R132H) IDH1-driven cellular transformation makes cells dependent on continued wild type IDH1 expression in a model of in vitro gliomagenesis

    PubMed Central

    Johannessen, T.; Mukherjee, J.; Wood, M.; Viswanath, P.; Ohba, S.; Ronen, S.; Berkvig, R.; Pieper, R.

    2017-01-01

    Abstract Introduction: Missense R132H mutations in the active site of isocitrate dehydrogenase 1 (IDH1) biologically and diagnostically distinguish low-grade gliomas and secondary glioblastomas from primary glioblastomas. IDH1 mutations lead to the formation of the oncometabolite 2-hydroxyglutarate (2-HG) from the reduction of α-ketoglutarate (α-KG), which in turn facilitates tumorigenesis by modifying DNA and histone methylation as well blocking differentiation processes. We recently showed (Mol Cancer Res 14: 976–983, 2016) that although mutant IDH1 expression in hTERT-immortalized, p53/pRb-deficient astrocytes can drive cellular transformation and gliomagenesis, selective pharmacologic inhibition and elimination of 2-HG by the mutant IDH1 inhibitor AGI-5198 has little effect on the growth or clonagenicity of these transformed cells. To address the possible role of WT IDH1 in the growth of mutant IDH-driven tumor cells, we used a slightly different gliomagenesis model in which the transformation of TERT-deficient, p53/pRb-deficient astrocytes (pre-crisis cells) occurs only after prolonged expression of mutant IDH and passage through cellular crisis (post-crisis cells, Cancer Res 76:6680–6689, 2016). METHODS AND MATERIALS: Using this system we introduced AGI-5198, or siRNA targeting both WT and mutant forms of IDH1 into p53/pRb-deficient, mutant IDH1-expressing human astrocytes prior to or following their transformation, and compared the effects on cell growth and clonagenicity. Results: AGI-5198 exposure decreased levels of 2HG by greater than 90%, and as previously reported had no effect on the growth of either the pre-or post-crisis cell populations. A one-day exposure to a pan IDH1 siRNA resulted in a similar, prolonged (greater than 6 day), 80% inhibition of both WT and mutant IDH1 protein levels and 2HG in both cell groups. While the growth of the mutant IDH-expressing, non-transformed cells was similar to that of scramble siRNA controls, the growth of the mutant IDH-transformed cells was significantly reduced. This growth suppression was also accompanied by a four-fold increase in annexin V-positive apoptotic cells. Furthermore, the growth suppression in the cells transformed by mutant IDH1 expression could not be reversed by addition of a cell-permeable form of 2-HG. Conclusions: These results show that the in vitro transformative events driven by expression of mutant IDH1 make cells dependent not on continued mutant IDH1 expression, but rather on continued WT IDH1 expression. The data also support the development and testing of agents that can inhibit both the WT and mutant forms of IDH1.

  14. MEMO1 drives cranial endochondral ossification and palatogenesis

    PubMed Central

    Otterloo, Eric Van; Feng, Weiguo; Jones, Kenneth L; Hynes, Nancy E; Clouthier, David E; Niswander, Lee; Williams, Trevor

    2016-01-01

    The cranial base is a component of the neurocranium and has a central role in the structural integration of the face, brain and vertebral column. Consequently, alteration in the shape of the human cranial base has been intimately linked with primate evolution and defective development is associated with numerous human facial abnormalities. Here we describe a novel recessive mutant mouse strain that presented with a domed head and fully penetrant cleft secondary palate coupled with defects in the formation of the underlying cranial base. Mapping and non-complementation studies revealed a specific mutation in Memo1 - a gene originally associated with cell migration. Expression analysis of Memo1 identified robust expression in the perichondrium and periosteum of the developing cranial base, but only modest expression in the palatal shelves. Fittingly, although the palatal shelves failed to elevate in Memo1 mutants, expression changes were modest within the shelves themselves. In contrast, the cranial base, which forms via endochondral ossification had major reductions in the expression of genes responsible for bone formation, notably matrix metalloproteinases and markers of the osteoblast lineage, mirrored by an increase in markers of cartilage and extracellular matrix development. Concomitant with these changes, mutant cranial bases showed an increased zone of hypertrophic chondrocytes accompanied by a reduction in both vascular invasion and mineralization. Finally, neural crest cell-specific deletion of Memo1 caused a failure of anterior cranial base ossification indicating a cell autonomous role for MEMO1 in the development of these neural crest cell derived structures. However, palate formation was largely normal in these conditional mutants, suggesting a non-autonomous role for MEMO1 in palatal closure. Overall, these findings assign a new function to MEMO1 in driving endochondral ossification in the cranium, and also link abnormal development of the cranial base with more widespread effects on craniofacial shape relevant to human craniofacial dysmorphology. PMID:26746790

  15. Modulation of mutant Huntingtin aggregates and toxicity by human myeloid leukemia factors.

    PubMed

    Banerjee, Manisha; Datta, Moumita; Bhattacharyya, Nitai P

    2017-01-01

    Increased poly glutamine (polyQ) stretch at N-terminal of Huntingtin (HTT) causes Huntington's disease. HTT interacts with large number of proteins, although the preference for such interactions with wild type or mutated HTT protein remains largely unknown. HYPK, an intrinsically unstructured protein chaperone and interactor of mutant HTT was found to interact with myeloid leukemia factor 1 (MLF1) and 2 (MLF2). To identify the role of these two proteins in mutant HTT mediated aggregate formation and toxicity in a cell model, both the proteins were found to preferentially interact with the mutated N-terminal HTT. They significantly reduced the number of cells containing mutant HTT aggregates and subsequent apoptosis in Neuro2A cells. Additionally, in FRAP assay, mobile fraction of mutant HTT aggregates was increased in the presence of MLF1 or MLF2. Further, MLF1 could release transcription factors like p53, CBP and CREB from mutant HTT aggregates. Moreover, in HeLa cell co-expressing mutant HTT exon1 and full length MLF1, p53 was released from the aggregates, leading to the recovery of the expression of the GADD45A transcript, a p53 regulated gene. Taking together, these results showed that MLF1 and MLF2 modulated the formation of aggregates and induction of apoptosis as well as the expressions of genes indirectly. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Altered Expression of Retinal Molecular Markers in the Canine RPE65 Model of Leber Congenital Amaurosis

    PubMed Central

    Hernández, Maria; Pearce-Kelling, Susan E.; Rodriguez, F. David; Aguirre, Gustavo D.; Vecino, Elena

    2010-01-01

    Purpose. Leber congenital amaurosis (LCA) is a group of childhood-onset retinal diseases characterized by severe visual impairment or blindness. One form is caused by mutations in the RPE65 gene, which encodes the retinal pigment epithelium (RPE) isomerase. In this study, the retinal structure and expression of molecular markers for different retinal cell types were characterized, and differences between control and RPE65 mutant dogs during the temporal evolution of the disease were analyzed. Methods. Retinas from normal and mutant dogs of different ages were examined by immunofluorescence with a panel of 16 different antibodies. Results. Cones and rods were preserved in the mutant retinas, and the number of cones was normal. However, there was altered expression of cone arrestin and delocalization of rod opsin. The ON bipolar cells showed sprouting of the dendritic arbors toward the outer nuclear layer (ONL) and retraction of their axons in the inner nuclear layer (INL). A decreased expression of GABA, and an increased expression of intermediate filament glial markers was also found in the mutant retinas. These changes were more evident in the adult than the young mutant retinas. Conclusions. The structure of the retina is well preserved in the mutant retina, but several molecular changes take place in photoreceptors and in bipolar and amacrine cells. Some of these changes are structural, whereas others reflect a change in localization of the examined proteins. This study provides new information that can be applied to the interpretation of outcomes of retinal gene therapy in animal models and humans. PMID:20671290

  17. Processing of N-linked oligosaccharide depends on its location in the anion exchanger, AE1, membrane glycoprotein.

    PubMed

    Li, J; Quilty, J; Popov, M; Reithmeier, R A

    2000-07-01

    The human erythrocyte anion exchanger (AE)1 (Band 3) contains a single complex N-linked oligosaccharide that is attached to Asn(642) in the fourth extracellular loop of this polytopic membrane protein, while other isoforms (AE2, AE3 and trout AE1) are N-glycosylated on the preceding extracellular loop. Human AE1 expressed in transfected human embryonic kidney (HEK)-293 or COS-7 cells contained a high-mannose oligosaccharide. The lack of oligosaccharide processing was not due to retention of AE1 in the endoplasmic reticulum since biotinylation assays showed that approx. 30% of the protein was expressed at the cell surface. Moving the N-glycosylation site to the preceding extracellular loop in an AE1 glycosylation mutant (N555) resulted in processing of the oligosaccharide and production of a complex form of AE1. A double N-glycosylation mutant (N555/N642) contained both a high-mannose and a complex oligosaccharide chain. The complex form of the N555 mutant could be biotinylated showing that this form of the glycoprotein was at the cell surface. Pulse-chase experiments showed that the N555 mutant was efficiently converted from a high-mannose to a complex oligosaccharide with a half-time of approx. 4 h, which reflected the time course of trafficking of AE1 from the endoplasmic reticulum to the plasma membrane. The turnover of the complex form of the N555 mutant occurred with a half-life of approx. 15 h. The results show that the oligosaccharide attached to the endogenous site in extracellular loop 4 in human AE1 is not processed in HEK-293 or COS-7 cells, while the oligosaccharide attached to the preceding loop is converted into the complex form.

  18. Anti-replicative recombinant 5S rRNA molecules can modulate the mtDNA heteroplasmy in a glucose-dependent manner.

    PubMed

    Loutre, Romuald; Heckel, Anne-Marie; Jeandard, Damien; Tarassov, Ivan; Entelis, Nina

    2018-01-01

    Mutations in mitochondrial DNA are an important source of severe and incurable human diseases. The vast majority of these mutations are heteroplasmic, meaning that mutant and wild-type genomes are present simultaneously in the same cell. Only a very high proportion of mutant mitochondrial DNA (heteroplasmy level) leads to pathological consequences. We previously demonstrated that mitochondrial targeting of small RNAs designed to anneal with mutant mtDNA can decrease the heteroplasmy level by specific inhibition of mutant mtDNA replication, thus representing a potential therapy. We have also shown that 5S ribosomal RNA, partially imported into human mitochondria, can be used as a vector to deliver anti-replicative oligoribonucleotides into human mitochondria. So far, the efficiency of cellular expression of recombinant 5S rRNA molecules bearing therapeutic insertions remained very low. In the present study, we designed new versions of anti-replicative recombinant 5S rRNA targeting a large deletion in mitochondrial DNA which causes the KSS syndrome, analyzed their specific annealing to KSS mitochondrial DNA and demonstrated their import into mitochondria of cultured human cells. To obtain an increased level of the recombinant 5S rRNA stable expression, we created transmitochondrial cybrid cell line bearing a site for Flp-recombinase and used this system for the recombinase-mediated integration of genes coding for the anti-replicative recombinant 5S rRNAs into nuclear genome. We demonstrated that stable expression of anti-replicative 5S rRNA versions in human transmitochondrial cybrid cells can induce a shift in heteroplasmy level of KSS mutation in mtDNA. This shift was directly dependent on the level of the recombinant 5S rRNA expression and the sequence of the anti-replicative insertion. Quantification of mtDNA copy number in transfected cells revealed the absence of a non-specific effect on wild type mtDNA replication, indicating that the decreased proportion between mutant and wild type mtDNA molecules is not a consequence of a random repopulation of depleted pool of mtDNA genomes. The heteroplasmy change could be also modulated by cell growth conditions, namely increased by cells culturing in a carbohydrate-free medium, thus forcing them to use oxidative phosphorylation and providing a selective advantage for cells with improved respiration capacities. We discuss the advantages and limitations of this approach and propose further development of the anti-replicative strategy based on the RNA import into human mitochondria.

  19. Rapid Conversion of Mutant IDH1 from Driver to Passenger in a Model of Human Gliomagenesis

    PubMed Central

    Johannessen, Tor-Christian Aase; Mukherjee, Joydeep; Viswanath, Pavithra; Ohba, Shigeo; Ronen, Sabrina M.; Bjerkvig, Rolf; Pieper, Russell O.

    2016-01-01

    Missense mutations in the active site of isocitrate dehydrogenase 1 (IDH1) biologically and diagnostically distinguish low-grade gliomas and secondary glioblastomas from primary glioblastomas. IDH1 mutations lead to the formation of the oncometabolite 2-hydroxyglutarate (2-HG) from the reduction of α-ketoglutarate (α-KG), which in turn facilitates tumorigenesis by modifying DNA and histone methylation as well blocking differentiation processes. While mutant IDH1 expression is thought to drive the gliomagenesis process, the extent to which it remains a viable therapeutic target remains unknown. To address this question we exposed immortalized (p53/pRb-deficient), untransformed human astrocytes to the mutant IDH1 inhibitor AGI-5198 prior to, concomitant with, or at intervals after, introduction of transforming mutant IDH1, then measured effects on 2-HG levels, histone methylation (H3K4me3, H3K9me2, H3K9me3 or H3K27me3) and growth in soft-agar. Addition of AGI-5198 prior to, or concomitant with, introduction of mutant IDH1 blocked all mutant IDH1-driven changes including cellular transformation. Addition at time intervals as short as 4 days following introduction of mutant IDH1 also suppressed 2-HG levels, but had minimal effects on histone methylation, and lost the ability to suppress clonogenicity in a time-dependent manner. Furthermore, in two different models of mutant IDH1-driven gliomagenesis, AGI-5198 exposures that abolished production of 2-HG also failed to decrease histone methylation, adherent cell growth, or anchorage-independent growth in soft-agar over a prolonged period. These studies show although mutant IDH1 expression drives gliomagenesis, mutant IDH1 itself rapidly converts from driver to passenger. Implications Agents that target mutant IDH may be effective for a narrow time and may require further optimization or additional therapeutics in glioma. PMID:27430238

  20. Phylogenetic distribution and expression of a penicillin-binding protein homologue, Ear and its significance in virulence of Staphylococcus aureus.

    PubMed

    Singh, Vineet K; Ring, Robert P; Aswani, Vijay; Stemper, Mary E; Kislow, Jennifer; Ye, Zhan; Shukla, Sanjay K

    2017-12-01

    Staphylococcus aureus is an opportunistic human pathogen that can cause serious infections in humans. A plethora of known and putative virulence factors are produced by staphylococci that collectively orchestrate pathogenesis. Ear protein (Escherichia coli ampicillin resistance) in S. aureus is an exoprotein in COL strain, predicted to be a superantigen, and speculated to play roles in antibiotic resistance and virulence. The goal of this study was to determine if expression of ear is modulated by single nucleotide polymorphisms in its promoter and coding sequences and whether this gene plays roles in antibiotic resistance and virulence. Promoter, coding sequences and expression of the ear gene in clinical and carriage S. aureus strains with distinct genetic backgrounds were analysed. The JE2 strain and its isogenic ear mutant were used in a systemic infection mouse model to determine the competiveness of the ear mutant.Results/Key findings. The ear gene showed a variable expression, with USA300FPR3757 showing a high-level expression compared to many of the other strains tested including some showing negligible expression. Higher expression was associated with agr type 1 but not correlated with phylogenetic relatedness of the ear gene based upon single nucleotide polymorphisms in the promoter or coding regions suggesting a complex regulation. An isogenic JE2 (USA300 background) ear mutant showed no significant difference in its growth, antibiotic susceptibility or virulence in a mouse model. Our data suggests that despite being highly expressed in a USA300 genetic background, Ear is not a significant contributor to virulence in that strain.

  1. Expression of human cationic trypsinogen (PRSS1) in murine acinar cells promotes pancreatitis and apoptotic cell death

    PubMed Central

    Athwal, T; Huang, W; Mukherjee, R; Latawiec, D; Chvanov, M; Clarke, R; Smith, K; Campbell, F; Merriman, C; Criddle, D; Sutton, R; Neoptolemos, J; Vlatković, N

    2014-01-01

    Hereditary pancreatitis (HP) is an autosomal dominant disease that displays the features of both acute and chronic pancreatitis. Mutations in human cationic trypsinogen (PRSS1) are associated with HP and have provided some insight into the pathogenesis of pancreatitis, but mechanisms responsible for the initiation of pancreatitis have not been elucidated and the role of apoptosis and necrosis has been much debated. However, it has been generally accepted that trypsinogen, prematurely activated within the pancreatic acinar cell, has a major role in the initiation process. Functional studies of HP have been limited by the absence of an experimental system that authentically mimics disease development. We therefore developed a novel transgenic murine model system using wild-type (WT) human PRSS1 or two HP-associated mutants (R122H and N29I) to determine whether expression of human cationic trypsinogen in murine acinar cells promotes pancreatitis. The rat elastase promoter was used to target transgene expression to pancreatic acinar cells in three transgenic strains that were generated: Tg(Ela-PRSS1)NV, Tg(Ela-PRSS1*R122H)NV and Tg(Ela-PRSS1*N29I)NV. Mice were analysed histologically, immunohistochemically and biochemically. We found that transgene expression is restricted to pancreatic acinar cells and transgenic PRSS1 proteins are targeted to the pancreatic secretory pathway. Animals from all transgenic strains developed pancreatitis characterised by acinar cell vacuolisation, inflammatory infiltrates and fibrosis. Transgenic animals also developed more severe pancreatitis upon treatment with low-dose cerulein than controls, displaying significantly higher scores for oedema, inflammation and overall histopathology. Expression of PRSS1, WT or mutant, in acinar cells increased apoptosis in pancreatic tissues and isolated acinar cells. Moreover, studies of isolated acinar cells demonstrated that transgene expression promotes apoptosis rather than necrosis. We therefore conclude that expression of WT or mutant human PRSS1 in murine acinar cells induces apoptosis and is sufficient to promote spontaneous pancreatitis, which is enhanced in response to cellular insult. PMID:24722290

  2. Selection of Salmonella enterica Serovar Typhi Genes Involved during Interaction with Human Macrophages by Screening of a Transposon Mutant Library

    PubMed Central

    Sabbagh, Sébastien C.; Lepage, Christine; McClelland, Michael; Daigle, France

    2012-01-01

    The human-adapted Salmonella enterica serovar Typhi (S. Typhi) causes a systemic infection known as typhoid fever. This disease relies on the ability of the bacterium to survive within macrophages. In order to identify genes involved during interaction with macrophages, a pool of approximately 105 transposon mutants of S. Typhi was subjected to three serial passages of 24 hours through human macrophages. Mutants recovered from infected macrophages (output) were compared to the initial pool (input) and those significantly underrepresented resulted in the identification of 130 genes encoding for cell membrane components, fimbriae, flagella, regulatory processes, pathogenesis, and many genes of unknown function. Defined deletions in 28 genes or gene clusters were created and mutants were evaluated in competitive and individual infection assays for uptake and intracellular survival during interaction with human macrophages. Overall, 26 mutants had defects in the competitive assay and 14 mutants had defects in the individual assay. Twelve mutants had defects in both assays, including acrA, exbDB, flhCD, fliC, gppA, mlc, pgtE, typA, waaQGP, SPI-4, STY1867-68, and STY2346. The complementation of several mutants by expression of plasmid-borne wild-type genes or gene clusters reversed defects, confirming that the phenotypic impairments within macrophages were gene-specific. In this study, 35 novel phenotypes of either uptake or intracellular survival in macrophages were associated with Salmonella genes. Moreover, these results reveal several genes encoding molecular mechanisms not previously known to be involved in systemic infection by human-adapted typhoidal Salmonella that will need to be elucidated. PMID:22574205

  3. Defective membrane expression of human growth hormone (GH) receptor causes Laron-type GH insensitivity syndrome.

    PubMed Central

    Duquesnoy, P; Sobrier, M L; Amselem, S; Goossens, M

    1991-01-01

    Mutations in the growth hormone receptor (GHR) gene can cause growth hormone (GH) resistance. Given the sequence homology between the extracellular domain of the GHR and a soluble GH-binding protein (GH-BP), it is remarkable that GH-BP binding activity is absent from the serum of patients with Laron-type GH insensitivity, a hereditary form of severe dwarfism. We have previously identified a mutation within the extracellular domain of this receptor, replacing phenylalanine by serine at position 96 of the mature protein, in a patient with Laron syndrome. We have now investigated the effect of this Phe----Ser substitution on hormone binding activity by expressing the total human GHR cDNA and mutant form in eukaryotic cells. The wild-type protein expressed was able to bind GH but no plasma membrane binding was detectable on cells transfected with the mutant cDNA; this was also the case of cells transfected with a Phe96----Ala mutant cDNA, suggesting that the lack of binding activity is not due to a posttranslational modification of serine. Examination of the variant proteins in subcellular fractions revealed the presence of specific GH binding activity in the lysosomal fraction, whereas immunofluorescence studies located mutant proteins in the cytosol. Our findings suggest that these mutant GHRs fail to follow the correct intracellular transport pathway and underline the potential importance of this phenylalanine residue, which is conserved among the GH, prolactin, and erythropoietin receptors that belong to the same cytokine receptor superfamily. Images PMID:1719554

  4. Friend or Foe: MicroRNAs in the p53 network.

    PubMed

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

    2018-04-10

    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  5. Differential roles for the C-terminal hexapeptide domains of NS2 splice variants during MVM infection of murine cells.

    PubMed

    Ruiz, Zandra; D'Abramo, Anthony; Tattersall, Peter

    2006-06-05

    The MVM NS2 proteins are required for viral replication in cells of its normal murine host, but are dispensable in transformed human 324K cells. Alternate splicing at the minor intron controls synthesis of three forms of this protein, which differ in their C-terminal hexapeptides and in their relative abundance, with NS2P and NS2Y, the predominant isoforms, being expressed at a 5:1 ratio. Mutant genomes were constructed with premature termination codons in the C-terminal exons of either NS2P or NS2Y, which resulted in their failure to accumulate in vivo. To modulate their expression levels, we also introduced a mutation at the putative splice branch point of the large intron, dubbed NS2(lo), that reduced total NS2 expression in murine A9 cells such that NS2P accumulated to approximately half the level normally seen for NS2Y. All mutants replicated productively in human 324K cells. In A9 cells, NS2Y(-) mutants replicated like wildtype, and the NS2(lo) mutants expressed NS1 and replicated duplex viral DNA like wildtype, although their progeny single-strand DNA synthesis was reduced. However, while NS2P(-) and NS2-null viruses initiated infection efficiently in A9 cells, they gave diminished NS1 levels, and viral macromolecular synthesis appeared to become paralyzed shortly after the onset of viral duplex DNA amplification, such that no progeny single-strand DNA could be detected. Thus, the NS2P isoform, even when expressed at a level lower than that of NS2Y, performs a critical role in infection of A9 cells that cannot be accomplished by the NS2Y isoform alone.

  6. Recurrent rhinovirus infections in a child with inherited MDA5 deficiency

    PubMed Central

    Lamborn, Ian T.; Jing, Huie; Zhang, Yu; Munir, Shirin; Bade, Sangeeta; Murdock, Heardley M.; Santos, Celia P.; Brock, Linda G.; Masutani, Evan; Matthews, Helen F.; Collins, Peter L.; Subbarao, Kanta; Gelfand, Erwin W.

    2017-01-01

    MDA5 is a cytosolic sensor of double-stranded RNA (ds)RNA including viral byproducts and intermediates. We studied a child with life-threatening, recurrent respiratory tract infections, caused by viruses including human rhinovirus (HRV), influenza virus, and respiratory syncytial virus (RSV). We identified in her a homozygous missense mutation in IFIH1 that encodes MDA5. Mutant MDA5 was expressed but did not recognize the synthetic MDA5 agonist/(ds)RNA mimic polyinosinic-polycytidylic acid. When overexpressed, mutant MDA5 failed to drive luciferase activity from the IFNB1 promoter or promoters containing ISRE or NF-κB sequence motifs. In respiratory epithelial cells or fibroblasts, wild-type but not knockdown of MDA5 restricted HRV infection while increasing IFN-stimulated gene expression and IFN-β/λ. However, wild-type MDA5 did not restrict influenza virus or RSV replication. Moreover, nasal epithelial cells from the patient, or fibroblasts gene-edited to express mutant MDA5, showed increased replication of HRV but not influenza or RSV. Thus, human MDA5 deficiency is a novel inborn error of innate and/or intrinsic immunity that causes impaired (ds)RNA sensing, reduced IFN induction, and susceptibility to the common cold virus. PMID:28606988

  7. Induction of a massive endoplasmic reticulum and perinuclear space expansion by expression of lamin B receptor mutants and the related sterol reductases TM7SF2 and DHCR7.

    PubMed

    Zwerger, Monika; Kolb, Thorsten; Richter, Karsten; Karakesisoglou, Iakowos; Herrmann, Harald

    2010-01-15

    Lamin B receptor (LBR) is an inner nuclear membrane protein involved in tethering the nuclear lamina and the underlying chromatin to the nuclear envelope. In addition, LBR exhibits sterol reductase activity. Mutations in the LBR gene cause two different human diseases: Pelger-Huët anomaly and Greenberg skeletal dysplasia, a severe chrondrodystrophy causing embryonic death. Our study aimed at investigating the effect of five LBR disease mutants on human cultured cells. Three of the tested LBR mutants caused a massive compaction of chromatin coincidental with the formation of a large nucleus-associated vacuole (NAV) in several human cultured cell lines. Live cell imaging and electron microscopy revealed that this structure was generated by the separation of the inner and outer nuclear membrane. During NAV formation, nuclear pore complexes and components of the linker of nucleoskeleton and cytoskeleton complex were lost in areas of membrane separation. Concomitantly, a large number of smaller vacuoles formed throughout the cytoplasm. Notably, forced expression of the two structurally related sterol reductases transmembrane 7 superfamily member 2 and 7-dehydrocholesterol reductase caused, even in their wild-type form, a comparable phenotype in susceptible cell lines. Hence, LBR mutant variants and sterol reductases can severely interfere with the regular organization of the nuclear envelope and the endoplasmic reticulum.

  8. Disturbed neuronal ER-Golgi sorting of unassembled glycine receptors suggests altered subcellular processing is a cause of human hyperekplexia.

    PubMed

    Schaefer, Natascha; Kluck, Christoph J; Price, Kerry L; Meiselbach, Heike; Vornberger, Nadine; Schwarzinger, Stephan; Hartmann, Stephanie; Langlhofer, Georg; Schulz, Solveig; Schlegel, Nadja; Brockmann, Knut; Lynch, Bryan; Becker, Cord-Michael; Lummis, Sarah C R; Villmann, Carmen

    2015-01-07

    Recent studies on the pathogenic mechanisms of recessive hyperekplexia indicate disturbances in glycine receptor (GlyR) α1 biogenesis. Here, we examine the properties of a range of novel glycine receptor mutants identified in human hyperekplexia patients using expression in transfected cell lines and primary neurons. All of the novel mutants localized in the large extracellular domain of the GlyR α1 have reduced cell surface expression with a high proportion of receptors being retained in the ER, although there is forward trafficking of glycosylated subpopulations into the ER-Golgi intermediate compartment and cis-Golgi compartment. CD spectroscopy revealed that the mutant receptors have proportions of secondary structural elements similar to wild-type receptors. Two mutants in loop B (G160R, T162M) were functional, but none of those in loop D/β2-3 were. One nonfunctional truncated mutant (R316X) could be rescued by coexpression with the lacking C-terminal domain. We conclude that a proportion of GlyR α1 mutants can be transported to the plasma membrane but do not necessarily form functional ion channels. We suggest that loop D/β2-3 is an important determinant for GlyR trafficking and functionality, whereas alterations to loop B alter agonist potencies, indicating that residues here are critical elements in ligand binding. Copyright © 2015 the authors 0270-6474/15/350422-16$15.00/0.

  9. Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.

    PubMed

    He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu

    2015-02-10

    Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.

  10. Dominant-negative mutants of platelet-derived growth factor revert the transformed phenotype of human astrocytoma cells.

    PubMed Central

    Shamah, S M; Stiles, C D; Guha, A

    1993-01-01

    Malignant astrocytoma is the most common primary human brain tumor. Most astrocytomas express a combination of platelet-derived growth factor (PDGF) and PDGF receptor which could close an autocrine loop. It is not known whether these autocrine loops contribute to the transformed phenotype of astrocytoma cells or are incidental to that phenotype. Here we show that dominant-negative mutants of the PDGF ligand break the autocrine loop and revert the phenotype of BALB/c 3T3 cells transformed by the PDGF-A or PDGF-B (c-sis) gene. Then, we show that these mutants are selective in that they do not alter the phenotype of 3T3 cells transformed by an activated Ha-ras or v-src gene or by simian virus 40. Finally, we show that these mutants revert the transformed phenotype of two independent human astrocytoma cell lines. They have no effect on the growth of human medulloblastoma, bladder carcinoma, or colon carcinoma cell lines. These observations are consistent with the view that PDGF autocrine loops contribute to the transformed phenotype of at least some human astrocytomas. Images PMID:8246942

  11. Development of new mouse lung tumor models expressing EGFR T790M mutants associated with clinical resistance to kinase inhibitors.

    PubMed

    Regales, Lucia; Balak, Marissa N; Gong, Yixuan; Politi, Katerina; Sawai, Ayana; Le, Carl; Koutcher, Jason A; Solit, David B; Rosen, Neal; Zakowski, Maureen F; Pao, William

    2007-08-29

    The EGFR T790M mutation confers acquired resistance to kinase inhibitors in human EGFR mutant lung adenocarcinoma, is occasionally detected before treatment, and may confer genetic susceptibility to lung cancer. To study further its role in lung tumorigenesis, we developed mice with inducible expression in type II pneumocytes of EGFR(T790M) alone or together with a drug-sensitive L858R mutation. Both transgenic lines develop lung adenocarcinomas that require mutant EGFR for tumor maintenance but are resistant to an EGFR kinase inhibitor. EGFR(L858R+T790M)-driven tumors are transiently targeted by hsp90 inhibition. Notably, EGFR(T790M)-expressing animals develop tumors with longer latency than EGFR(L858R+T790M)-bearing mice and in the absence of additional kinase domain mutations. These new mouse models of mutant EGFR-dependent lung adenocarcinomas provide insight into clinical observations. The models should also be useful for developing improved therapies for patients with lung cancers harboring EGFR(T790M) alone or in conjunction with drug-sensitive EGFR kinase domain mutations.

  12. Structure-activity relations of successful pharmacologic chaperones for rescue of naturally occurring and manufactured mutants of the gonadotropin-releasing hormone receptor.

    PubMed

    Janovick, Jo Ann; Goulet, Mark; Bush, Eugene; Greer, Jonathan; Wettlaufer, David G; Conn, P Michael

    2003-05-01

    We expressed a test system of wild-type (WT) rat (r) and human (h) gonadotropin-releasing hormone (GnRH) receptors (GnRHRs), including naturally occurring (13) and manufactured (five) "loss-of-function" mutants of the GnRHR. These were used to assess the ability of different GnRH peptidomimetics to rescue defective GnRHR mutants and determine their effect on the level of membrane expression of the WT receptors. Among the manufactured mutants were the shortest rGnRHR C-terminal truncation mutant that resulted in receptor loss-of-function (des(325-327)-rGnRHR), two nonfunctional deletion mutants (des(237-241)-rGnRHR and des(260-265)-rGnRHR), two nonfunctional Cys mutants (C(229)A-rGnRHR and C(278)A-rGnRHR); the naturally occurring mutants included all 13 full-length GnRHR point mutations reported to date that result in full or partial human hypogonadotropic hypogonadism. The 10 peptidomimetics assessed as potential rescue molecules ("pharmacoperones") are from three differing chemical pedigrees (indoles, quinolones, and erythromycin-derived macrolides) and were originally developed as GnRH peptidomimetic antagonists. These structures were selected for this study because of their predicted ability to permeate the cell membrane and interact with a defined affinity with the GnRH receptor. All peptidomimetics studied with an IC(50) value (for hGnRHR)

  13. A murine model of autosomal dominant neurohypophyseal diabetes insipidus reveals progressive loss of vasopressin-producing neurons

    PubMed Central

    Russell, Theron A.; Ito, Masafumi; Ito, Mika; Yu, Richard N.; Martinson, Fred A.; Weiss, Jeffrey; Jameson, J. Larry

    2003-01-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is an autosomal dominant disorder caused by mutations in the arginine vasopressin (AVP) precursor. The pathogenesis of FNDI is proposed to involve mutant protein–induced loss of AVP-producing neurons. We established murine knock-in models of two different naturally occurring human mutations that cause FNDI. A mutation in the AVP signal sequence [A(–1)T] is associated with a relatively mild phenotype or delayed presentation in humans. This mutation caused no apparent phenotype in mice. In contrast, heterozygous mice expressing a mutation that truncates the AVP precursor (C67X) exhibited polyuria and polydipsia by 2 months of age and these features of DI progressively worsened with age. Studies of the paraventricular and supraoptic nuclei revealed induction of the chaperone protein BiP and progressive loss of AVP-producing neurons relative to oxytocin-producing neurons. In addition, Avp gene products were not detected in the neuronal projections, suggesting retention of WT and mutant AVP precursors within the cell bodies. In summary, this murine model of FNDI recapitulates many features of the human disorder and demonstrates that expression of the mutant AVP precursor leads to progressive neuronal cell loss. PMID:14660745

  14. Ubiquitin Ligase RNF138 Promotes Episodic Ataxia Type 2-Associated Aberrant Degradation of Human Cav2.1 (P/Q-Type) Calcium Channels.

    PubMed

    Fu, Ssu-Ju; Jeng, Chung-Jiuan; Ma, Chia-Hao; Peng, Yi-Jheng; Lee, Chi-Ming; Fang, Ya-Ching; Lee, Yi-Ching; Tang, Sung-Chun; Hu, Meng-Chun; Tang, Chih-Yung

    2017-03-01

    Voltage-gated Ca V 2.1 channels comprise a pore-forming α 1A subunit with auxiliary α 2 δ and β subunits. Ca V 2.1 channels play an essential role in regulating synaptic signaling. Mutations in the human gene encoding the Ca V 2.1 subunit are associated with the cerebellar disease episodic ataxia type 2 (EA2). Several EA2-causing mutants exhibit impaired protein stability and exert dominant-negative suppression of Ca V 2.1 wild-type (WT) protein expression via aberrant proteasomal degradation. Here, we set out to delineate the protein degradation mechanism of human Ca V 2.1 subunit by identifying RNF138, an E3 ubiquitin ligase, as a novel Ca V 2.1-binding partner. In neurons, RNF138 and Ca V 2.1 coexist in the same protein complex and display notable subcellular colocalization at presynaptic and postsynaptic regions. Overexpression of RNF138 promotes polyubiquitination and accelerates protein turnover of Ca V 2.1. Disrupting endogenous RNF138 function with a mutant (RNF138-H36E) or shRNA infection significantly upregulates the Ca V 2.1 protein level and enhances Ca V 2.1 protein stability. Disrupting endogenous RNF138 function also effectively rescues the defective protein expression of EA2 mutants, as well as fully reversing EA2 mutant-induced excessive proteasomal degradation of Ca V 2.1 WT subunits. RNF138-H36E coexpression only partially restores the dominant-negative effect of EA2 mutants on Ca V 2.1 WT functional expression, which can be attributed to defective membrane trafficking of Ca V 2.1 WT in the presence of EA2 mutants. We propose that RNF138 plays a critical role in the homeostatic regulation of Ca V 2.1 protein level and functional expression and that RNF138 serves as the primary E3 ubiquitin ligase promoting EA2-associated aberrant degradation of human Ca V 2.1 subunits. SIGNIFICANCE STATEMENT Loss-of-function mutations in the human Ca V 2.1 subunit are linked to episodic ataxia type 2 (EA2), a dominantly inherited disease characterized by paroxysmal attacks of ataxia and nystagmus. EA2-causing mutants may exert dominant-negative effects on the Ca V 2.1 wild-type subunit via aberrant proteasomal degradation. The molecular nature of the Ca V 2.1 ubiquitin-proteasome degradation pathway is currently unknown. The present study reports the first identification of an E3 ubiquitin ligase for Ca V 2.1, RNF138. Ca V 2.1 protein stability is dynamically regulated by RNF138 and auxiliary α 2 δ and β subunits. We provide a proof of concept that protecting the human Ca V 2.1 subunit from excessive proteasomal degradation with specific interruption of endogenous RNF138 function may partially contribute to the future development of a novel therapeutic strategy for EA2 patients. Copyright © 2017 the authors 0270-6474/17/372485-19$15.00/0.

  15. Human mutant huntingtin disrupts vocal learning in transgenic songbirds.

    PubMed

    Liu, Wan-Chun; Kohn, Jessica; Szwed, Sarah K; Pariser, Eben; Sepe, Sharon; Haripal, Bhagwattie; Oshimori, Naoki; Marsala, Martin; Miyanohara, Atsushi; Lee, Ramee

    2015-11-01

    Speech and vocal impairments characterize many neurological disorders. However, the neurogenetic mechanisms of these disorders are not well understood, and current animal models do not have the necessary circuitry to recapitulate vocal learning deficits. We developed germline transgenic songbirds, zebra finches (Taneiopygia guttata) expressing human mutant huntingtin (mHTT), a protein responsible for the progressive deterioration of motor and cognitive function in Huntington's disease (HD). Although generally healthy, the mutant songbirds had severe vocal disorders, including poor vocal imitation, stuttering, and progressive syntax and syllable degradation. Their song abnormalities were associated with HD-related neuropathology and dysfunction of the cortical-basal ganglia (CBG) song circuit. These transgenics are, to the best of our knowledge, the first experimentally created, functional mutant songbirds. Their progressive and quantifiable vocal disorder, combined with circuit dysfunction in the CBG song system, offers a model for genetic manipulation and the development of therapeutic strategies for CBG-related vocal and motor disorders.

  16. Akt mediated ROS-dependent selective targeting of mutant KRAS tumors.

    PubMed

    Iskandar, Kartini; Rezlan, Majidah; Pervaiz, Shazib

    2014-10-01

    Reactive oxygen species (ROS) play a critical role in a variety of cellular processes, ranging from cell survival and proliferation to cell death. Previously, we reported the ability of a small molecule compound, C1, to induce ROS dependent autophagy associated apoptosis in human cancer cell lines and primary tumor cells (Wong C. et al. 2010). Our ongoing investigations have unraveled a hitherto undefined novel signaling network involving hyper-phosphorylation of Akt and Akt-mediated ROS production in cancer cell lines. Interestingly, drug-induced Akt activation is selectively seen in cell lines that carry mutant KRAS; HCT116 cells that carry the V13D KRAS mutation respond favorably to C1 while HT29 cells expressing wild type KRAS are relatively resistant. Of note, not only does the compound target mutant KRAS expressing cells but also induces RAS activation as evidenced by the PAK pull down assay. Corroborating this, pharmacological inhibition as well as siRNA mediated silencing of KRAS or Akt, blocked C1-induced ROS production and rescued tumor colony forming ability in HCT116 cells. To further confirm the involvement of KRAS, we made use of mutant KRAS transformed RWPE-1 prostate epithelial cells. Notably, drug-induced ROS generation and death sensitivity was significantly higher in RWPE-1-KRAS cells than the RWPE-1-vector cells, thus confirming the results obtained with mutant KRAS colorectal carcinoma cell line. Lastly, we made use of HCT116 mutant KRAS knockout cells (KO) where the mutant KRAS allele had been deleted, thus expressing a single wild-type KRAS allele. Exposure of the KO cells to C1 failed to induce Akt activation and mitochondrial ROS production. Taken together, results show the involvement of activated Akt in ROS-mediated selective targeting of mutant KRAS expressing tumors, which could have therapeutic implications given the paucity of chemotherapeutic strategies specifically targeting KRAS mutant cancers. Copyright © 2014. Published by Elsevier Inc.

  17. Sensitivity of human cells expressing low-fidelity or weak-catalytic-activity variants of DNA polymerase ζ to genotoxic stresses.

    PubMed

    Suzuki, Tetsuya; Grúz, Petr; Honma, Masamitsu; Adachi, Noritaka; Nohmi, Takehiko

    2016-09-01

    Translesion DNA polymerases (TLS pols) play critical roles in defense mechanisms against genotoxic agents. The defects or mutations of TLS pols are predicted to result in hypersensitivity of cells to environmental mutagens. In this study, human cells expressing DNA polymerase ζ (Pol ζ) variants with low fidelity or weak catalytic activity have been established with Nalm-6-MSH+ cells and their sensitivity to mutagenicity and cytotoxicity of benzo[a]pyrene diol epoxide (BPDE) and ultraviolet-C light (UV-C) was examined. The low-fidelity mutants were engineered by knocking-in DNA sequences that direct changes of leucine 2618 to either phenylalanine (L2618F) or methionine (L2618M) of Pol ζ. The weak-catalytic-activity mutants were generated by knocking-in DNA sequences that direct changes of either tyrosine 2779 to phenylalanine (Y2779F) or aspartate 2781 to asparagine (D2781N). In addition, a +1 frameshift mutation, i.e., CCC to CCCC, was introduced in the coding region of the TK1 gene to measure the mutant frequencies. Doubling time and spontaneous TK mutant frequencies of the established cell lines were similar to those of the wild-type cells. The low-fidelity mutants displayed, however, higher sensitivity to the mutagenicity of BPDE and UV-C than the wild-type cells although their cytotoxic sensitivity was not changed. In contrast, the weak-catalytic-activity mutants were more sensitive to the cytotoxicity of BPDE and UV-C than the wild-type cells, and displayed much higher sensitivity to the clastogenicity of BPDE than the wild-type cells in an in vitro micronucleus assay. These results indicate that human Pol ζ is involved in TLS across DNA lesions induced by BPDE and UV-C and also that the TLS plays important roles in induction of mutations, clastogenicity and in cellular survival of the damaged human cells. Similarities and differences in in vivo roles of yeast and human Pol ζ in genome integrity are discussed. Copyright © 2016 Elsevier B.V. All rights reserved.

  18. DNAJB4 molecular chaperone distinguishes WT from mutant E-cadherin, determining their fate in vitro and in vivo.

    PubMed

    Simões-Correia, Joana; Silva, Diana I; Melo, Soraia; Figueiredo, Joana; Caldeira, Joana; Pinto, Marta T; Girão, Henrique; Pereira, Paulo; Seruca, Raquel

    2014-04-15

    E-cadherin (Ecad) is a well-known invasion suppressor and its loss of expression is common in invasive carcinomas. Germline Ecad mutations are the only known genetic cause of hereditary diffuse gastric cancer (HDGC), demonstrating the causative role of Ecad impairment in gastric cancer. HDGC-associated Ecad missense mutations can lead to folding defects and premature proteasome-dependent endoplasmic reticulum-associated degradation (ERAD), but the molecular determinants for this fate were unidentified. Using a Drosophila-based genetic screen, we found that Drosophila DnaJ-1 interacts with wild type (WT) and mutant human Ecad in vivo. DnaJ (Hsp40) homolog, subfamily B, member 4 (DNAJB4), the human homolog of DnaJ-1, influences Ecad localization and stability even in the absence of Ecad endogenous promoter, suggesting a post-transcriptional level of regulation. Increased expression of DNAJB4 leads to stabilization of WT Ecad in the plasma membrane, while it induces premature degradation of unfolded HDGC mutants in the proteasome. The interaction between DNAJB4 and Ecad is direct, and is increased in the context of the unfolded mutant E757K, especially when proteasome degradation is inhibited, suggesting that DNAJB4 is a molecular mediator of ERAD. Post-translational regulation of native Ecad by DNAJB4 molecular chaperone is sufficient to influence cell adhesion in vitro. Using a chick embryo chorioallantoic membrane assay with gastric cancer derived cells, we demonstrate that DNAJB4 stimulates the anti-invasive function of WT Ecad in vivo. Additionally, the expression of DNAJB4 and Ecad is concomitantly decreased in human gastric carcinomas. Altogether, we demonstrate that DNAJB4 is a sensor of Ecad structural features that might contribute to gastric cancer progression.

  19. PIK3CA mutant tumors depend on oxoglutarate dehydrogenase | Office of Cancer Genomics

    Cancer.gov

    Oncogenic PIK3CA mutations are found in a significant fraction of human cancers, but therapeutic inhibition of PI3K has only shown limited success in clinical trials. To understand how mutant PIK3CA contributes to cancer cell proliferation, we used genome scale loss-of-function screening in a large number of genomically annotated cancer cell lines. As expected, we found that PIK3CA mutant cancer cells require PIK3CA but also require the expression of the TCA cycle enzyme 2-oxoglutarate dehydrogenase (OGDH).

  20. Characterization of Haemophilus ducreyi cdtA, cdtB, and cdtC Mutants in In Vitro and In Vivo Systems

    PubMed Central

    Lewis, David A.; Stevens, Marla K.; Latimer, Jo L.; Ward, Christine K.; Deng, Kaiping; Blick, Robert; Lumbley, Sheryl R.; Ison, Catherine A.; Hansen, Eric J.

    2001-01-01

    Haemophilus ducreyi expresses a soluble cytolethal distending toxin (CDT) that is encoded by the cdtABC gene cluster and can be detected in culture supernatant fluid by its ability to kill HeLa cells. The cdtA, cdtB, and cdtC genes of H. ducreyi were cloned independently into plasmid vectors, and their encoded proteins expressed singly or in various combinations in an Escherichia coli background. All three gene products had to be expressed in order for E. coli-derived culture supernatant fluids to demonstrate cytotoxicity for HeLa cells. Isogenic H. ducreyi cdtA and cdtB mutants were constructed and used in combination with the wild-type parent strain and a previously described H. ducreyi cdtC mutant (M. K. Stevens, J. L. Latimer, S. R. Lumbley, C. K. Ward, L. D. Cope, T. Lagergard, and E. J. Hansen, Infect. Immun. 67:3900–3908, 1999) to determine the relative contributions of the CdtA, CdtB, and CdtC proteins to CDT activity. Expression of CdtA, CdtB, and CdtC appeared necessary for H. ducreyi-derived culture supernatant fluid to exhibit cytotoxicity for HeLa cells. Whole-cell sonicates and periplasmic extracts from the cdtB and cdtC mutants had no effect on HeLa cells, whereas these same fractions from a cdtA mutant had a very modest cytotoxic effect on these same human cells. CdtA appeared to be primarily associated with the H. ducreyi cell envelope, whereas both CdtB and CdtC were present primarily in the soluble fraction from sonicated cells. Both the cdtA mutant and the cdtB mutant were found to be fully virulent in the temperature-dependent rabbit model for experimental chancroid. PMID:11500438

  1. LMOf2365_0442 Encoding for a Fructose Specific PTS Permease IIA May Be Required for Virulence in L. monocytogenes Strain F2365

    PubMed Central

    Liu, Yanhong; Yoo, Brian B.; Hwang, Cheng-An; Suo, Yujuan; Sheen, Shiowshuh; Khosravi, Parvaneh; Huang, Lihan

    2017-01-01

    Listeria monocytogenes is a foodborne pathogen that causes listeriosis, which is a major public health concern due to the high fatality rate. LMOf2365_0442, 0443, and 0444 encode for fructose-specific EIIABC components of phosphotransferase transport system (PTS) permease that is responsible for sugar transport. In previous studies, in-frame deletion mutants of a putative fructose-specific PTS permease (LMOf2365_0442, 0443, and 0444) were constructed and analyzed. However, the virulence potential of these deletion mutants has not been studied. In this study, two in vitro methods were used to analyze the virulence potential of these L. monocytogenes deletion mutants. First, invasion assays were used to measure the invasion efficiencies to host cells using the human HT-29 cell line. Second, plaque forming assays were used to measure cell-to-cell spread in host cells. Our results showed that the deletion mutant ΔLMOf2365_0442 had reduced invasion and cell-to-cell spread efficiencies in human cell line compared to the parental strain LMOf2365, indicating that LMOf2365_0442 encoding for a fructose specific PTS permease IIA may be required for virulence in L. monocytogenes strain F2365. In addition, the gene expression levels of 15 virulence and stress-related genes were analyzed in the stationary phase cells of the deletion mutants using RT-PCR assays. Virulence-related gene expression levels were elevated in the deletion mutants ΔLMOf2365_0442-0444 compared to the wild type parental strain LMOf2365, indicating the down-regulation of virulence genes by this PTS permease in L. monocytogenes. Finally, stress-related gene clpC expression levels were also increased in all of the deletion mutants, suggesting the involvement of this PTS permease in stress response. Furthermore, these deletion mutants displayed the same pressure tolerance and the same capacity for biofilm formation compared to the wild-type parental strain LMOf2365. In summary, our findings suggest that the LMOf2365_0442 gene can be used as a potential target to develop inhibitors for new therapeutic and pathogen control strategies for public health. PMID:28900418

  2. Telomerase activation by the E6 gene product of human papillomavirus type 16.

    PubMed

    Klingelhutz, A J; Foster, S A; McDougall, J K

    1996-03-07

    Activation of telomerase, a ribonucleoprotein complex that synthesizes telomere repeat sequences, is linked to cell immortalization and is characteristic of most cell lines and tumours. Here we show that expression of the human papillomavirus type 16 (HPV-16) E6 protein activates telomerase in early-passage human keratinocytes and mammary epithelial cells. This activation was observed in cells pre-crisis, that is, before they became immortal, and occurred within one passage of retroviral infection with vectors expressing HPV-16 E6. Studies using HPV-16 E6 mutants showed that there was no correlation between the ability of the mutants to activate telomerase and their ability to target p53 for degradation, suggesting that telomerase activation by HPV-16 E6 is p53 independent. Keratinocytes expressing wild-type HPV-16 E6 have an extended lifespan, but do not become immortal, indicating that telomerase activation and E6-mediate degradation of p53 are insufficient for their immortalization. These results show that telomerase activation is an intrinsic, but insufficient, component of transformation by HPV.

  3. Induction of CD69 expression by cagPAI-positive Helicobacter pylori infection

    PubMed Central

    Mori, Naoki; Ishikawa, Chie; Senba, Masachika

    2011-01-01

    AIM: To investigate and elucidate the molecular mechanism that regulates inducible expression of CD69 by Helicobacter pylori (H. pylori) infection. METHODS: The expression levels of CD69 in a T-cell line, Jurkat, primary human peripheral blood mononuclear cells (PBMCs), and CD4+ T cells, were assessed by immunohistochemistry, reverse transcription polymerase chain reaction, and flow cytometry. Activation of CD69 promoter was detected by reporter gene. Nuclear factor (NF)-κB activation in Jurkat cells infected with H. pylori was evaluated by electrophoretic mobility shift assay. The role of NF-κB signaling in H. pylori-induced CD69 expression was analyzed using inhibitors of NF-κB and dominant-negative mutants. The isogenic mutants with disrupted cag pathogenicity island (cagPAI) and virD4 were used to elucidate the role of cagPAI-encoding type IV secretion system and CagA in CD69 expression. RESULTS: CD69 staining was detected in mucosal lymphocytes and macrophages in specimens of patients with H. pylori-positive gastritis. Although cagPAI-positive H. pylori and an isogenic mutant of virD4 induced CD69 expression, an isogenic mutant of cagPAI failed to induce this in Jurkat cells. H. pylori also induced CD69 expression in PBMCs and CD4+ T cells. The activation of the CD69 promoter by H. pylori was mediated through NF-κB. Transfection of dominant-negative mutants of IκBs, IκB kinases, and NF-κB-inducing kinase inhibited H. pylori-induced CD69 activation. Inhibitors of NF-κB suppressed H. pylori-induced CD69 mRNA expression. CONCLUSION: The results suggest that H. pylori induces CD69 expression through the activation of NF-κB. cagPAI might be relevant in the induction of CD69 expression in T cells. CD69 in T cells may play a role in H. pylori-induced gastritis. PMID:21990950

  4. Type 1 fimbriae contribute to catheter-associated urinary tract infections caused by Escherichia coli.

    PubMed

    Reisner, Andreas; Maierl, Mario; Jörger, Michael; Krause, Robert; Berger, Daniela; Haid, Andrea; Tesic, Dijana; Zechner, Ellen L

    2014-03-01

    Biofilm formation on catheters is thought to contribute to persistence of catheter-associated urinary tract infections (CAUTI), which represent the most frequent nosocomial infections. Knowledge of genetic factors for catheter colonization is limited, since their role has not been assessed using physicochemical conditions prevailing in a catheterized human bladder. The current study aimed to combine data from a dynamic catheterized bladder model in vitro with in vivo expression analysis for understanding molecular factors relevant for CAUTI caused by Escherichia coli. By application of the in vitro model that mirrors the physicochemical environment during human infection, we found that an E. coli K-12 mutant defective in type 1 fimbriae, but not isogenic mutants lacking flagella or antigen 43, was outcompeted by the wild-type strain during prolonged catheter colonization. The importance of type 1 fimbriae for catheter colonization was verified using a fimA mutant of uropathogenic E. coli strain CFT073 with human and artificial urine. Orientation of the invertible element (IE) controlling type 1 fimbrial expression in bacterial populations harvested from the colonized catheterized bladder in vitro suggested that the vast majority of catheter-colonizing cells (up to 88%) express type 1 fimbriae. Analysis of IE orientation in E. coli populations harvested from patient catheters revealed that a median level of ∼73% of cells from nine samples have switched on type 1 fimbrial expression. This study supports the utility of the dynamic catheterized bladder model for analyzing catheter colonization factors and highlights a role for type 1 fimbriae during CAUTI.

  5. Synergistic action of Smad4 and Pten in suppressing pancreatic ductal adenocarcinoma formation in mice.

    PubMed

    Xu, X; Ehdaie, B; Ohara, N; Yoshino, T; Deng, C-X

    2010-02-04

    Mutations of SMAD4/DPC4 are found in about 60% of human invasive pancreatic ductal adenocarcinomas (PDACs); yet, the manner in which SMAD4 deficiency enhances tumorigenesis remains elusive. Using a Cre-LoxP approach, we generated a mutant mouse carrying a targeted deletion of Smad4 in the pancreas. We showed that the absence of Smad4 alone did not trigger pancreas tumor formation; however, it increased the expression of an inactivated form of Pten, suggesting a role of Pten in preventing Smad4-/- cells from undergoing malignancy. To investigate this, we disrupted both Pten and Smad4. We showed that Pten deficiency initiated widespread premalignant lesions, and a low tumor incidence that was significantly accelerated by Smad4-deficiency. The absence of Smad4 in a Pten-mutant background enhanced cell proliferation and triggered transdifferentiation from acinar, centroacinar and islet cells, accompanied by activation of Notch1 signaling. We showed that all tumors developed in the Smad4/Pten-mutant pancreas exhibited high levels of pAKT and mTOR, and that about 50 and 83% of human pancreatic cancers examined showed increased pAKT and pmTOR, respectively. Besides the similarity in gene expression, the pAKT and/or pmTOR-positive human PDACs and mouse pancreatic tumors also shared some histopathological similarities. These observations indicate that Smad4/Pten-mutant mice mimic the tumor progression of human pancreatic cancers that are driven by activation of the AKT-mTOR pathway, and uncovered a synergistic action of Smad4 and Pten in repressing pancreatic tumorigenesis.

  6. Effects of ompA deletion on expression of type 1 fimbriae in Escherichia coli K1 strain RS218 and on the association of E. coli with human brain microvascular endothelial cells.

    PubMed

    Teng, Ching-Hao; Xie, Yi; Shin, Sooan; Di Cello, Francescopaolo; Paul-Satyaseela, Maneesh; Cai, Mian; Kim, Kwang Sik

    2006-10-01

    We have previously shown that outer membrane protein A (OmpA) and type 1 fimbriae are the bacterial determinants involved in Escherichia coli K1 binding to human brain microvascular endothelial cells (HBMEC), which constitute the blood-brain barrier. In investigating the role of OmpA in E. coli K1 binding to HBMEC, we showed for the first time that ompA deletion decreased the expression of type 1 fimbriae in E. coli K1. Decreased expression of type 1 fimbriae in the ompA deletion mutant was largely the result of driving the fim promoter toward the type 1 fimbrial phase-OFF orientation. mRNA levels of fimB and fimE were found to be decreased with the OmpA mutant compared to the parent strain. Of interest, the ompA deletion further decreased the abilities of E. coli K1 to bind to and invade HBMEC under the conditions of fixing type 1 fimbria expression in the phase-ON or phase-OFF status. These findings suggest that the decreased ability of the OmpA mutant to interact with HBMEC is not entirely due to its decreased type 1 fimbrial expression and that OmpA and type 1 fimbriae facilitate the interaction of E. coli K1 with HBMEC at least in an additive manner.

  7. [hHO-1 structure prediction and its mutant construct, expression, purification and activity analysis].

    PubMed

    Xia, Zhen Wei; Cui, Wen Jun; Zhou, Wen Pu; Zhang, Xue Hong; Shen, Qing Xiang; Li, Yun Zhu; Yu, Shan Chang

    2004-10-01

    Human Heme Oxygenase-1 (hHO-1) is the rate-limiting enzyme in the catabolism reaction of heme, which directly regulates the concentration of bilirubin in human body. The mutant structure was simulated by Swiss-pdbviewer procedure, which showed that the structure of active pocket was changed distinctly after Ala25 substituted for His25 in active domain, but the mutated enzyme still binded with heme. On the basis of the results, the expression vectors, pBHO-1 and pBHO-1(M), were constructed, induced by IPTG and expressed in E. coli DH5alpha strain. The expression products were purified with 30%-60% saturation (NH4)2SO4 and Q-Sepharose Fast Flow column chromatography. The concentration of hHO-1 in 30%-60% saturation (NH4)2SO4 components and in fractions through twice column chromatography was 3.6-fold and 30-fold higher than that in initial product, respectively. The activity of wild hHO-1 (whHO-1) and mutant hHO-1 (deltahHO-1) showed that the activity of deltahHO-1 was reduced 91.21% compared with that of whHO-1. The study shows that His25 is of importance for the mechanism of hHO-1, and provides the possibility for effectively regulating the activity to exert biological function.

  8. Disulfide bond exchanges in integrins αIIbβ3 and αvβ3 are required for activation and post-ligation signaling during clot retraction.

    PubMed

    Mor-Cohen, Ronit; Rosenberg, Nurit; Averbukh, Yulia; Seligsohn, Uri; Lahav, Judith

    2014-05-01

    Integrin αIIbβ3 mediates platelet adhesion, aggregation and fibrin clot retraction. These processes require activation of αIIbβ3 and post-ligation signaling. Disulfide bond exchanges are involved in αIIbβ3 and αvβ3 activation. In order to investigate the role of integrin activation and disulfide bond exchange during αIIbβ3- and αvβ3-mediated clot retraction, we co-expressed in baby hamster kidney cells wild-type (WT) human αIIb and WT or mutated human β3 that contain single or double cysteine substitutions disrupting C523-C544 or C560-C583 bonds. Flow cytometry was used to measure surface expression and activation state of the integrins. Time-course of fibrin clot retraction was examined. Cells expressed WT or mutated human αIIbβ3 as well as chimeric hamster/human αvβ3. The αIIbβ3 mutants were constitutively active and the thiol blocker dithiobisnitrobenzoic acid (DTNB) did not affect their activation state. WT cells retracted the clot and addition of αvβ3 inhibitors decreased the retraction rate. The active mutants and WT cells activated by anti-LIBS6 antibody retracted the clot faster than untreated WT cells, particularly in the presence of αvβ3 inhibitor. DTNB substantially inhibited clot retraction by WT or double C523S/C544S mutant expressing cells, but minimally affected single C523S, C544S or C560S mutants. Anti-LIBS6-enhanced clot retraction was significantly inhibited by DTNB when added prior to anti-LIBS6. Both αIIbβ3 and αvβ3 contribute to clot retraction without prior activation of the integrins. Activation of αIIbβ3, but not of αvβ3 enhances clot retraction. Both αIIbβ3 activation and post-ligation signaling during clot retraction require disulfide bond exchange. Copyright © 2014 Elsevier Ltd. All rights reserved.

  9. Human T-Cell Leukemia Virus Type 1 Tax Induction of NF-κB Involves Activation of the IκB Kinase α (IKKα) and IKKβ Cellular Kinases

    PubMed Central

    Geleziunas, Romas; Ferrell, Sharon; Lin, Xin; Mu, Yajun; Cunningham, Emmett T.; Grant, Mark; Connelly, Margery A.; Hambor, John E.; Marcu, Kenneth B.; Greene, Warner C.

    1998-01-01

    Tax corresponds to a 40-kDa transforming protein from the pathogenic retrovirus human T-cell leukemia virus type 1 (HTLV-1) that activates nuclear expression of the NF-κB/Rel family of transcription factors by an unknown mechanism. Tax expression promotes N-terminal phosphorylation and degradation of IκBα, a principal cytoplasmic inhibitor of NF-κB. Our studies now demonstrate that HTLV-1 Tax activates the recently identified cellular kinases IκB kinase α (IKKα) and IKKβ, which normally phosphorylate IκBα on both of its N-terminal regulatory serines in response to tumor necrosis factor alpha (TNF-α) and interleukin-1 (IL-1) stimulation. In contrast, a mutant of Tax termed M22, which does not induce NF-κB, fails to activate either IKKα or IKKβ. Furthermore, endogenous IKK enzymatic activity was significantly elevated in HTLV-1-infected and Tax-expressing T-cell lines. Transfection of kinase-deficient mutants of IKKα and IKKβ into either human Jurkat T or 293 cells also inhibits NF-κB-dependent reporter gene expression induced by Tax. Similarly, a kinase-deficient mutant of NIK (NF-κB-inducing kinase), which represents an upstream kinase in the TNF-α and IL-1 signaling pathways leading to IKKα and IKKβ activation, blocks Tax induction of NF-κB. However, plasma membrane-proximal elements in these proinflammatory cytokine pathways are apparently not involved since dominant negative mutants of the TRAF2 and TRAF6 adaptors, which effectively block signaling through the cytoplasmic tails of the TNF-α and IL-1 receptors, respectively, do not inhibit Tax induction of NF-κB. Together, these studies demonstrate that HTLV-1 Tax exploits a distal part of the proinflammatory cytokine signaling cascade leading to induction of NF-κB. The pathological alteration of this cytokine pathway leading to NF-κB activation by Tax may play a central role in HTLV-1-mediated transformation of human T cells, clinically manifested as the adult T-cell leukemia. PMID:9710600

  10. Role of Iron Uptake Systems in Pseudomonas aeruginosa Virulence and Airway Infection

    PubMed Central

    Minandri, Fabrizia; Imperi, Francesco; Frangipani, Emanuela; Bonchi, Carlo; Visaggio, Daniela; Facchini, Marcella; Pasquali, Paolo; Bragonzi, Alessandra

    2016-01-01

    Pseudomonas aeruginosa is a leading cause of hospital-acquired pneumonia and chronic lung infections in cystic fibrosis patients. Iron is essential for bacterial growth, and P. aeruginosa expresses multiple iron uptake systems, whose role in lung infection deserves further investigation. P. aeruginosa Fe3+ uptake systems include the pyoverdine and pyochelin siderophores and two systems for heme uptake, all of which are dependent on the TonB energy transducer. P. aeruginosa also has the FeoB transporter for Fe2+ acquisition. To assess the roles of individual iron uptake systems in P. aeruginosa lung infection, single and double deletion mutants were generated in P. aeruginosa PAO1 and characterized in vitro, using iron-poor media and human serum, and in vivo, using a mouse model of lung infection. The iron uptake-null mutant (tonB1 feoB) and the Fe3+ transport mutant (tonB1) did not grow aerobically under low-iron conditions and were avirulent in the mouse model. Conversely, the wild type and the feoB, hasR phuR (heme uptake), and pchD (pyochelin) mutants grew in vitro and caused 60 to 90% mortality in mice. The pyoverdine mutant (pvdA) and the siderophore-null mutant (pvdA pchD) grew aerobically in iron-poor media but not in human serum, and they caused low mortality in mice (10 to 20%). To differentiate the roles of pyoverdine in iron uptake and virulence regulation, a pvdA fpvR double mutant defective in pyoverdine production but expressing wild-type levels of pyoverdine-regulated virulence factors was generated. Deletion of fpvR in the pvdA background partially restored the lethal phenotype, indicating that pyoverdine contributes to the pathogenesis of P. aeruginosa lung infection by combining iron transport and virulence-inducing capabilities. PMID:27271740

  11. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Busch, Albert; Kiel, Tilman; Heupel, Wolfgang-M.

    Lamins, which form the nuclear lamina, not only constitute an important determinant of nuclear architecture, but additionally play essential roles in many nuclear functions. Mutations in A-type lamins cause a wide range of human genetic disorders (laminopathies). The importance of lamin A (LaA) in the spatial arrangement of nuclear pore complexes (NPCs) prompted us to study the role of LaA mutants in nuclear protein transport. Two mutants, causing prenatal skin disease restrictive dermopathy (RD) and the premature aging disease Hutchinson Gilford progeria syndrome, were used for expression in HeLa cells to investigate their impact on the subcellular localization of NPC-associatedmore » proteins and nuclear protein import. Furthermore, dynamics of the LaA mutants within the nuclear lamina were studied. We observed affected localization of NPC-associated proteins, diminished lamina dynamics for both LaA mutants and reduced nuclear import of representative cargo molecules. Intriguingly, both LaA mutants displayed similar effects on nuclear morphology and functions, despite their differences in disease severity. Reduced nuclear protein import was also seen in RD fibroblasts and impaired lamina dynamics for the nucleoporin Nup153. Our data thus represent the first study of a direct link between LaA mutant expression and reduced nuclear protein import.« less

  12. Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

    PubMed

    Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

    1992-05-15

    A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes.

  13. Let-7 Sensitizes KRAS Mutant Tumor Cells to Chemotherapy

    PubMed Central

    Dai, Xin; Jiang, Ying; Tan, Chalet

    2015-01-01

    KRAS is the most commonly mutated oncogene in human cancers and is associated with poor prognosis and drug resistance. Let-7 is a family of tumor suppressor microRNAs that are frequently suppressed in solid tumors, where KRAS mutations are highly prevalent. In this study, we investigated the potential use of let-7 as a chemosensitizer. We found that let-7b repletion selectively sensitized KRAS mutant tumor cells to the cytotoxicity of paclitaxel and gemcitabine. Transfection of let-7b mimic downregulated the expression of mutant but not wild-type KRAS. Combination of let-7b mimic with paclitaxel or gemcitabine diminished MEK/ERK and PI3K/AKT signaling concurrently, triggered the onset of apoptosis, and reverted the epithelial-mesenchymal transition in KRAS mutant tumor cells. In addition, let-7b repletion downregulated the expression of β-tubulin III and ribonucleotide reductase subunit M2, two proteins known to mediate tumor resistance to paclitaxel and gemcitabine, respectively. Let-7 may represent a new class of chemosensitizer for the treatment of KRAS mutant tumors. PMID:25946136

  14. Resistance to collagen-induced arthritis in SHPS-1 mutant mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Okuzawa, Chie; Kaneko, Yoriaki; Murata, Yoji

    SHPS-1 is a transmembrane protein that binds the protein tyrosine phosphatases SHP-1 and SHP-2 through its cytoplasmic region and is abundantly expressed on dendritic cells and macrophages. Here we show that mice expressing a mutant form of SHPS-1 fail to develop type-II collagen (CII)-induced arthritis (CIA), a model for rheumatoid arthritis in humans. Histological examinations of the arthritic paws from immunized wild-type mice revealed that cartilage was destroyed in association with marked mononuclear cell infiltration, while only mild cell infiltration was observed in immunized SHPS-1 mutant mice. Consistently, the serum levels of both IgG and IgG2a specific to CII andmore » of IL-1{beta} in immunized SHPS-1 mutant mice were markedly reduced compared with those apparent for wild-type mice. The CII-induced proliferation of, and production of cytokines by, T cells from immunized SHPS-1 mutant mice were reduced compared to wild-type cells. These results suggest that SHPS-1 is essential for development of CIA.« less

  15. Purification and detailed study of two clinically different human glucose 6-phosphate dehydrogenase variants, G6PD(Plymouth) and G6PD(Mahidol): Evidence for defective protein folding as the basis of disease.

    PubMed

    Huang, Yuxiang; Choi, Mei Yee; Au, Shannon Wing Ngor; Au, Deborah Man Yee; Lam, Veronica Min Sien; Engel, Paul C

    2008-01-01

    In an attempt to investigate the molecular mechanism underlying human glucose-6-phosphate dehydrogenase (G6PD) deficiency caused by two mutations, G6PD(Plymouth) (G163D) and G6PD(Mahidol) (G163S), the two variants were constructed by site-directed mutagenesis and expressed in G6PD-deficient E. coli DF 213 cells. A first indication of impaired folding came from problems in expressing these clinical mutants, which were only overcome by lowering the growth temperature or co-expressing with molecular chaperones (GroEL and GroES). Both strategies significantly increased soluble expression of recombinant G6PD(Plymouth) and G6PD(Mahidol), judged by both G6PD activity in extracts and the amount of immunoreactive protein. Using a modified 3-step protocol, the two mutant enzymes were successfully purified for the first time. Steady-state kinetic parameters (K(m) for NADP(+), K(m) for G6P and k(cat)) of the two mutants are very similar to the wild-type values, indicating that the catalytic efficiency of the two mutants remains unchanged. The two mutants are, however, markedly less stable than wild-type G6PD in both thermostability and urea-induced inactivation tests. In a typical experiment at 37 degrees C and pH 7.2 after 24h G6PD WT, G6PD(Mahidol) and G6PD(Plymouth) retained 58.3%, 27.0% and 3.9%, respectively, of their corresponding initial activity. The stability of all three enzymes is enhanced by addition of NADP(+). According to unfolding and refolding experiments, the two mutants are impaired in their folding properties. Thus structural instability appears to be the molecular basis of the clinical phenotype in G6PD(Plymouth) and G6PD(Mahidol) and in particular of the differing clinical severity of the two mutations. The 3-D structure solved for G6PD(Canton) allows an interpretation of these effects in terms of steric hindrance.

  16. Protective Role of the Capsule and Impact of Serotype 4 Switching on Streptococcus mitis

    PubMed Central

    Rukke, Håkon V.; Kalluru, Raja Sab; Repnik, Urska; Gerlini, Alice; José, Ricardo J.; Periselneris, Jimstan; Marshall, Helina; Griffiths, Gareth; Oggioni, Marco Rinaldo; Brown, Jeremy S.

    2014-01-01

    The polysaccharide capsule surrounding Streptococcus pneumoniae is essential for virulence. Recently, Streptococcus mitis, a human commensal and a close relative of S. pneumoniae, was also shown to have a capsule. In this study, the S. mitis type strain switched capsule by acquisition of the serotype 4 capsule locus of S. pneumoniae TIGR4, following induction of competence for natural transformation. Comparison of the wild type with the capsule-switching mutant and with a capsule deletion mutant showed that the capsule protected S. mitis against phagocytosis by RAW 264.7 macrophages. This effect was enhanced in the S. mitis strain expressing the S. pneumoniae capsule, which showed, in addition, increased resistance against early clearance in a mouse model of lung infection. Expression of both capsules also favored survival in human blood, and the effect was again more pronounced for the capsule-switching mutant. S. mitis survival in horse blood or in a mouse model of bacteremia was not significantly different between the wild type and the mutant strains. In all models, S. pneumoniae TIGR4 showed higher rates of survival than the S. mitis type strain or the capsule-switching mutant, except in the lung model, in which significant differences between S. pneumoniae TIGR4 and the capsule-switching mutant were not observed. Thus, we identified conditions that showed a protective function for the capsule in S. mitis. Under such conditions, S. mitis resistance to clearance could be enhanced by capsule switching to serotype 4, but it was enhanced to levels lower than those for the virulent strain S. pneumoniae TIGR4. PMID:24958712

  17. Protein expression profiling of the drosophila fragile X mutant brain reveals up-regulation of monoamine synthesis.

    PubMed

    Zhang, Yong Q; Friedman, David B; Wang, Zhe; Woodruff, Elvin; Pan, Luyuan; O'donnell, Janis; Broadie, Kendal

    2005-03-01

    Fragile X syndrome is the most common form of inherited mental retardation, associated with both cognitive and behavioral anomalies. The disease is caused by silencing of the fragile X mental retardation 1 (fmr1) gene, which encodes the mRNA-binding, translational regulator FMRP. Previously we established a disease model through mutation of Drosophila fmr1 (dfmr1) and showed that loss of dFMRP causes defects in neuronal structure, function, and behavioral output similar to the human disease state. To uncover molecular targets of dFMRP in the brain, we use here a proteomic approach involving two-dimensional difference gel electrophoresis analyses followed by mass spectrometry identification of proteins with significantly altered expression in dfmr1 null mutants. We then focus on two misregulated enzymes, phenylalanine hydroxylase (Henna) and GTP cyclohydrolase (Punch), both of which mediate in concert the synthetic pathways of two key monoamine neuromodulators, dopamine and serotonin. Brain enzymatic assays show a nearly 2-fold elevation of Punch activity in dfmr1 null mutants. Consistently brain neurochemical assays show that both dopamine and serotonin are significantly increased in dfmr1 null mutants. At a cellular level, dfmr1 null mutant neurons display a highly significant elevation of the dense core vesicles that package these monoamine neuromodulators for secretion. Taken together, these data indicate that dFMRP normally down-regulates the monoamine pathway, which is consequently up-regulated in the mutant condition. Elevated brain levels of dopamine and serotonin provide a plausible mechanistic explanation for aspects of cognitive and behavioral deficits in human patients.

  18. Elastase inhibitors as potential therapies for ELANE-associated neutropenia.

    PubMed

    Makaryan, Vahagn; Kelley, Merideth L; Fletcher, Breanna; Bolyard, Audrey Anna; Aprikyan, A Andrew; Dale, David C

    2017-10-01

    Mutations in ELANE , the gene for neutrophil elastase (NE), a protease expressed early in neutrophil development, are the most frequent cause of cyclic (CyN) and severe congenital neutropenia (SCN). We hypothesized that inhibitors of NE, acting either by directly inhibiting enzymatic activity or as chaperones for the mutant protein, might be effective as therapy for CyN and SCN. We investigated β-lactam-based inhibitors of human NE (Merck Research Laboratories, Kenilworth, NJ, USA), focusing on 1 inhibitor called MK0339, a potent, orally absorbed agent that had been tested in clinical trials and shown to have a favorable safety profile. Because fresh, primary bone marrow cells are rarely available in sufficient quantities for research studies, we used 3 cellular models: patient-derived, induced pluripotent stem cells (iPSCs); HL60 cells transiently expressing mutant NE; and HL60 cells with regulated expression of the mutant enzyme. In all 3 models, the cells expressing the mutant enzyme had reduced survival as measured with annexin V and FACS. Coincubation with the inhibitors, particularly MK0339, promoted cell survival and increased formation of mature neutrophils. These studies suggest that cell-permeable inhibitors of neutrophil elastase show promise as novel therapies for ELANE -associated neutropenia. © Society for Leukocyte Biology.

  19. Plant vegetative and animal cytoplasmic actins share functional competence for spatial development with protists.

    PubMed

    Kandasamy, Muthugapatti K; McKinney, Elizabeth C; Roy, Eileen; Meagher, Richard B

    2012-05-01

    Actin is an essential multifunctional protein encoded by two distinct ancient classes of genes in animals (cytoplasmic and muscle) and plants (vegetative and reproductive). The prevailing view is that each class of actin variants is functionally distinct. However, we propose that the vegetative plant and cytoplasmic animal variants have conserved functional competence for spatial development inherited from an ancestral protist actin sequence. To test this idea, we ectopically expressed animal and protist actins in Arabidopsis thaliana double vegetative actin mutants that are dramatically altered in cell and organ morphologies. We found that expression of cytoplasmic actins from humans and even a highly divergent invertebrate Ciona intestinalis qualitatively and quantitatively suppressed the root cell polarity and organ defects of act8 act7 mutants and moderately suppressed the root-hairless phenotype of act2 act8 mutants. By contrast, human muscle actins were unable to support prominently any aspect of plant development. Furthermore, actins from three protists representing Choanozoa, Archamoeba, and green algae efficiently suppressed all the phenotypes of both the plant mutants. Remarkably, these data imply that actin's competence to carry out a complex suite of processes essential for multicellular development was already fully developed in single-celled protists and evolved nonprogressively from protists to plants and animals.

  20. Plant Vegetative and Animal Cytoplasmic Actins Share Functional Competence for Spatial Development with Protists[W][OA

    PubMed Central

    Kandasamy, Muthugapatti K.; McKinney, Elizabeth C.; Roy, Eileen; Meagher, Richard B.

    2012-01-01

    Actin is an essential multifunctional protein encoded by two distinct ancient classes of genes in animals (cytoplasmic and muscle) and plants (vegetative and reproductive). The prevailing view is that each class of actin variants is functionally distinct. However, we propose that the vegetative plant and cytoplasmic animal variants have conserved functional competence for spatial development inherited from an ancestral protist actin sequence. To test this idea, we ectopically expressed animal and protist actins in Arabidopsis thaliana double vegetative actin mutants that are dramatically altered in cell and organ morphologies. We found that expression of cytoplasmic actins from humans and even a highly divergent invertebrate Ciona intestinalis qualitatively and quantitatively suppressed the root cell polarity and organ defects of act8 act7 mutants and moderately suppressed the root-hairless phenotype of act2 act8 mutants. By contrast, human muscle actins were unable to support prominently any aspect of plant development. Furthermore, actins from three protists representing Choanozoa, Archamoeba, and green algae efficiently suppressed all the phenotypes of both the plant mutants. Remarkably, these data imply that actin’s competence to carry out a complex suite of processes essential for multicellular development was already fully developed in single-celled protists and evolved nonprogressively from protists to plants and animals. PMID:22589468

  1. Increased Tau Phosphorylation and Tau Truncation, and Decreased Synaptophysin Levels in Mutant BRI2/Tau Transgenic Mice

    PubMed Central

    Garringer, Holly J.; Murrell, Jill; Sammeta, Neeraja; Gnezda, Anita; Ghetti, Bernardino; Vidal, Ruben

    2013-01-01

    Familial Danish dementia (FDD) is an autosomal dominant neurodegenerative disease caused by a 10-nucleotide duplication-insertion in the BRI2 gene. FDD is clinically characterized by loss of vision, hearing impairment, cerebellar ataxia and dementia. The main neuropathologic findings in FDD are the deposition of Danish amyloid (ADan) and the presence of neurofibrillary tangles (NFTs). Here we investigated tau accumulation and truncation in double transgenic (Tg-FDD-Tau) mice generated by crossing transgenic mice expressing human Danish mutant BRI2 (Tg-FDD) with mice expressing human 4-repeat mutant Tau-P301S (Tg-Tau). Compared to Tg-Tau mice, we observed a significant enhancement of tau deposition in Tg-FDD-Tau mice. In addition, a significant increase in tau cleaved at aspartic acid (Asp) 421 was observed in Tg-FDD-Tau mice. Tg-FDD-Tau mice also showed a significant decrease in synaptophysin levels, occurring before widespread deposition of fibrillar ADan and tau can be observed. Thus, the presence of soluble ADan/mutant BRI2 can lead to significant changes in tau metabolism and synaptic dysfunction. Our data provide new in vivo insights into the pathogenesis of FDD and the pathogenic pathway(s) by which amyloidogenic peptides, regardless of their primary amino acid sequence, can cause neurodegeneration. PMID:23418567

  2. Increased tau phosphorylation and tau truncation, and decreased synaptophysin levels in mutant BRI2/tau transgenic mice.

    PubMed

    Garringer, Holly J; Murrell, Jill; Sammeta, Neeraja; Gnezda, Anita; Ghetti, Bernardino; Vidal, Ruben

    2013-01-01

    Familial Danish dementia (FDD) is an autosomal dominant neurodegenerative disease caused by a 10-nucleotide duplication-insertion in the BRI(2) gene. FDD is clinically characterized by loss of vision, hearing impairment, cerebellar ataxia and dementia. The main neuropathologic findings in FDD are the deposition of Danish amyloid (ADan) and the presence of neurofibrillary tangles (NFTs). Here we investigated tau accumulation and truncation in double transgenic (Tg-FDD-Tau) mice generated by crossing transgenic mice expressing human Danish mutant BRI(2) (Tg-FDD) with mice expressing human 4-repeat mutant Tau-P301S (Tg-Tau). Compared to Tg-Tau mice, we observed a significant enhancement of tau deposition in Tg-FDD-Tau mice. In addition, a significant increase in tau cleaved at aspartic acid (Asp) 421 was observed in Tg-FDD-Tau mice. Tg-FDD-Tau mice also showed a significant decrease in synaptophysin levels, occurring before widespread deposition of fibrillar ADan and tau can be observed. Thus, the presence of soluble ADan/mutant BRI(2) can lead to significant changes in tau metabolism and synaptic dysfunction. Our data provide new in vivo insights into the pathogenesis of FDD and the pathogenic pathway(s) by which amyloidogenic peptides, regardless of their primary amino acid sequence, can cause neurodegeneration.

  3. Retinoblastoma protein (pRB) was significantly phosphorylated through a Ras-to-MAPK pathway in mutant K-ras stably transfected human adrenocortical cells.

    PubMed

    Chen, Y-F; Chiu, H-H; Wu, C-H; Wang, J-Y; Chen, F-M; Tzou, W-H; Shin, S-J; Lin, S-R

    2003-10-01

    Our previous studies have shown that the cell proliferation rate, mRNA levels of p450scc, p450c17, and 3betaHSD, and secretion of cortisol were significantly increased in human adrenocortical cells stably transfected with mutated K-ras expression plasmid "pK568MRSV" after being inducted with IPTG. In addition, the increased level was a time-dependent manner. However, the levels of p450, p450scc, p450c17, 3betaHSD, cortisol, and cell proliferation rate were inhibited by a MEK phospholation inhibitor, PD098059. The above results prove that mutated K-ras oncogene is able to regulate tumorigenesis and steroidogenesis through a Ras-RAF-MEK-MAPK signal transduction pathway. The aim of this study was to investigate regulated factors in this pathway and also examine whether the other signal transduction pathways or other moles involved in tumorigenesis or steroidogenesis. In the first year, we analyzed gene profiles of mutant K-ras-transfected adrenocortical cells by DNA microarray to determine the gene expression related to cell cycle, signal transduction, apoptosis, tumorigenesis, steroidogenesis, and other expressed sequence tag. After being affected by the K-ras mutant, gene expression was significantly increased in some upregulated genes. Human zinc-finger protein 22 increased by 28.5 times, Osteopontin increased by 5.8 times, LIM domain Kinase 2 (LIMK2) increased by 3.3 times, Homo sapiens dual-specificity tyrosine-(Y)-phosphorylation regulated Kinase 2 (DYRK2) increased by 2.2 times, and human syntaxin 3 increased by two times. On the other hand, significant decreases in gene expression were also observed in some downregulated genes. Retinoblastoma binding protein 1 (RBBP1) decreased by four times, Homo sapiens craniofacial development protein 1 (CFDP1) decreased by 2.4 times, DAP Kinase-related apoptosis-inducing protein Kinase 1 (DRAK1) decreased by 2.3 times, SKI-interacting protein (SKIP) decreased by 2.2 times, and human poly(A)-Binding protein (PABP) decreased by 2.1 times. In all significant differentially expressed genes, preliminary analysis by bioinformatics revealed that after induced K-ras mutant expression by isopropyl thiogalctoside (IPTG), the downregulation of RBBP1 gene was most correlated to cell proliferation. RBBP1 can bind with RB/E2F to form a mSIN3-HDAC complex, which induces cell cycle arrest in the G1/G0 stage by repressing transcription of E2F-regulated genes. The result of a Northern blot showed that RBBP1 were inhibited after an induction of IPTG for 36 h. Another Northern blot analysis proved that mRNA levels of cyclin D1 and c-myc increased in proportion to K-ras expression. Finally, Western blot was carried out, and the results showed that phosphorylated pRB also increased. Taken together, we infer that the mutant K-ras oncogene promoted the cells to proceed to the G1/S stage by the inhibiting the formation of RB/RBBP1-dependent repressor complex from binding with the SIN3-HDAC complex, which resulted in the acetylation of histone to active transcription of E2F-regulated genes. However, the roles of the other differentially expressed genes involved in cell proliferation, cell morphologic change, tumorigenesis, or steroidogenesis still need further investigation.

  4. Human T-Cell Leukemia Virus I Tax Protein Sensitizes p53-Mutant Cells to DNA Damage

    PubMed Central

    Mihaylova, Valia T.; Green, Allison M.; Khurgel, Moshe; Semmes, Oliver J.; Kupfer, Gary M.

    2018-01-01

    Mutations in p53 are a common cause of resistance of cancers to standard chemotherapy and, thus, treatment failure. Reports have shown that Tax, a human T-cell leukemia virus type I encoded protein that has been associated with genomic instability and perturbation of transcription and cell cycle, sensitizes HeLa cells to UV treatment. The extent to which Tax can sensitize cells and the mechanism by which it exerts its effect are unknown. In this study, we show that Tax sensitizes p53-mutant cells to a broad range of DNA-damaging agents, including mitomycin C, a bifunctional alkylator, etoposide, a topoisomerase II drug, and UV light, but not ionizing radiation, a double-strand break agent, or vinblastine, a tubulin poison. Tax caused hypersensitivity in all p53-deleted cell lines and several, but not all, mutant-expressed p53–containing cell lines, while unexpectedly being protective in p53 wild-type (wt) cells. The effect observed in p53-deleted lines could be reversed for this by transfection of wt p53. We also show that Tax activates a p53-independent proapoptotic program through decreased expression of the retinoblastoma protein and subsequent increased E2F1 expression. The expression of several proapoptotic proteins was also induced by Tax, including Puma and Noxa, culminating in a substantial increase in Bax dimerization. Our results show that Tax can sensitize p53-mutant cells to DNA damage while protecting p53 wt cells, a side benefit that might result in reduced toxicity in normal cells. Such studies hold the promise of a novel adjunctive therapy that could make cancer chemotherapy more effective. PMID:18559532

  5. Familial Amyotrophic Lateral Sclerosis-linked Mutations in Profilin 1 Exacerbate TDP-43-induced Degeneration in the Retina of Drosophila melanogaster through an Increase in the Cytoplasmic Localization of TDP-43.

    PubMed

    Matsukawa, Koji; Hashimoto, Tadafumi; Matsumoto, Taisei; Ihara, Ryoko; Chihara, Takahiro; Miura, Masayuki; Wakabayashi, Tomoko; Iwatsubo, Takeshi

    2016-11-04

    Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by progressive and selective loss of motor neurons. Causative genes for familial ALS (fALS), e.g. TARDBP or FUS/TLS, have been found, among which mutations within the profilin 1 (PFN1) gene have recently been identified in ALS18. To elucidate the mechanism whereby PFN1 mutations lead to neuronal death, we generated transgenic Drosophila melanogaster overexpressing human PFN1 in the retinal photoreceptor neurons. Overexpression of wild-type or fALS mutant PFN1 caused no degenerative phenotypes in the retina. Double overexpression of fALS mutant PFN1 and human TDP-43 markedly exacerbated the TDP-43-induced retinal degeneration, i.e. vacuolation and thinning of the retina, whereas co-expression of wild-type PFN1 did not aggravate the degenerative phenotype. Notably, co-expression of TDP-43 with fALS mutant PFN1 increased the cytoplasmic localization of TDP-43, the latter remaining in nuclei upon co-expression with wild-type PFN1, whereas co-expression of TDP-43 lacking the nuclear localization signal with the fALS mutant PFN1 did not aggravate the retinal degeneration. Knockdown of endogenous Drosophila PFN1 did not alter the degenerative phenotypes of the retina in flies overexpressing wild-type TDP-43 These data suggest that ALS-linked PFN1 mutations exacerbate TDP-43-induced neurodegeneration in a gain-of-function manner, possibly by shifting the localization of TDP-43 from nuclei to cytoplasm. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. [AVIAN RECOMBINANT VIRUS H5N1 INFLUENZA (A/VIETNAM/1203/04) AND ITS ESCAPE-MUTANT m13(13) INDUCE EARLY SIGNALING REACTIONS OF THE IMMUNITY IN HUMAN LYMPHOCYTES].

    PubMed

    Sokolova, T M; Poloskov, V V; Shuvalov, A N; Rudneva, I A; Ershov, F I

    2016-01-01

    The innate immune receptors TLR4, TLR7, TLR8, and RIG1 recognized the structures of the influenza viruses in human lymphocytes and were activated by the recombinant avian influenza virus A/Vietnam/1203/04 and its escape-mutant m13(13) during early period of interaction. The stimulated levels are not connected with viral reproduction. Donor cells with the low constitutive immune receptors gene expression levels showed higher stimulation. Inflammation virus effects resulted in. increasing production of TNF-alpha and IFN-gamma by lymphocytes. Signaling gene reactions of the parent and mutant viruses endosomal as well as cytoplasmic receptors are very similar. The mutant virus A/Vietnam/1203/04 (HA S145F), stimulated an increase in the transcription level of the membrane receptor gene TLR4 and a decrease in the level of activation of TNF-alpha gene. Further studies of natural influenza virus isolates are necessary to estimate the role of HA antigenic changes on immune reactions in humans.

  7. Phenotypic characterization of adenovirus type 12 temperature-sensitive mutants in productive infection and transformation.

    PubMed

    Hama, S; Kimura, G

    1980-01-01

    Eleven temperature-sensitive mutants of adenovirus type 12, capable of forming plaques in human cells at 33 C but not at 39.5 C, were isolated from a stock of a wild-type strain after treatment with either nitrous acid or hydroxylamine. Complementation tests in doubly infected human cells permitted a tentative assignment of eight of these mutants to six complementation groups. Temperature-shift experiments revealed that one mutant is affected early and most of the other mutants are affected late. Only the early mutant, H12ts505, was temperature sensitive in viral DNA replication. Infectious virions of all the mutants except H12ts505 and two of the late mutants produced at 33 C, appeared to be more heat labile than those of the wild type. Only H12ts505 was temperature sensitive for the establishment of transformation of rat 3Y1 cells. One of the late mutants (H12ts504) had an increased transforming ability at the permissive temperature. Results of temperature-shift transformation experiments suggest that a viral function affected in H12ts505 is required for "initiation" of transformation. Some of the growth properties of H12ts505-transformed cells were also temperature dependent, suggesting that a functional expression of a gene mutation in H12ts505 is required to maintain at least some aspects of the transformed state.

  8. First somatic mutation of E2F1 in a critical DNA binding residue discovered in well-differentiated papillary mesothelioma of the peritoneum

    PubMed Central

    2011-01-01

    Background Well differentiated papillary mesothelioma of the peritoneum (WDPMP) is a rare variant of epithelial mesothelioma of low malignancy potential, usually found in women with no history of asbestos exposure. In this study, we perform the first exome sequencing of WDPMP. Results WDPMP exome sequencing reveals the first somatic mutation of E2F1, R166H, to be identified in human cancer. The location is in the evolutionarily conserved DNA binding domain and computationally predicted to be mutated in the critical contact point between E2F1 and its DNA target. We show that the R166H mutation abrogates E2F1's DNA binding ability and is associated with reduced activation of E2F1 downstream target genes. Mutant E2F1 proteins are also observed in higher quantities when compared with wild-type E2F1 protein levels and the mutant protein's resistance to degradation was found to be the cause of its accumulation within mutant over-expressing cells. Cells over-expressing wild-type E2F1 show decreased proliferation compared to mutant over-expressing cells, but cell proliferation rates of mutant over-expressing cells were comparable to cells over-expressing the empty vector. Conclusions The R166H mutation in E2F1 is shown to have a deleterious effect on its DNA binding ability as well as increasing its stability and subsequent accumulation in R166H mutant cells. Based on the results, two compatible theories can be formed: R166H mutation appears to allow for protein over-expression while minimizing the apoptotic consequence and the R166H mutation may behave similarly to SV40 large T antigen, inhibiting tumor suppressive functions of retinoblastoma protein 1. PMID:21955916

  9. Seven mutations in the human insulin gene linked to permanent neonatal/infancy-onset diabetes mellitus

    PubMed Central

    Colombo, Carlo; Porzio, Ottavia; Liu, Ming; Massa, Ornella; Vasta, Mario; Salardi, Silvana; Beccaria, Luciano; Monciotti, Carla; Toni, Sonia; Pedersen, Oluf; Hansen, Torben; Federici, Luca; Pesavento, Roberta; Cadario, Francesco; Federici, Giorgio; Ghirri, Paolo; Arvan, Peter; Iafusco, Dario; Barbetti, Fabrizio

    2008-01-01

    Permanent neonatal diabetes mellitus (PNDM) is a rare disorder usually presenting within 6 months of birth. Although several genes have been linked to this disorder, in almost half the cases documented in Italy, the genetic cause remains unknown. Because the Akita mouse bearing a mutation in the Ins2 gene exhibits PNDM associated with pancreatic β cell apoptosis, we sequenced the human insulin gene in PNDM subjects with unidentified mutations. We discovered 7 heterozygous mutations in 10 unrelated probands. In 8 of these patients, insulin secretion was detectable at diabetes onset, but rapidly declined over time. When these mutant proinsulins were expressed in HEK293 cells, we observed defects in insulin protein folding and secretion. In these experiments, expression of the mutant proinsulins was also associated with increased Grp78 protein expression and XBP1 mRNA splicing, 2 markers of endoplasmic reticulum stress, and with increased apoptosis. Similarly transfected INS-1E insulinoma cells had diminished viability compared with those expressing WT proinsulin. In conclusion, we find that mutations in the insulin gene that promote proinsulin misfolding may cause PNDM. PMID:18451997

  10. Expression of a dominant allele of human ARF1 inhibits membrane traffic in vivo

    PubMed Central

    1994-01-01

    ADP-ribosylation factor (ARF) proteins and inhibitory peptides derived from ARFs have demonstrated activities in a number of in vitro assays that measure ER-to-Golgi and intra-Golgi transport and endosome fusion. To better understand the roles of ARF proteins in vivo, stable cell lines were obtained from normal rat kidney (NRK) cells transfected with either wild-type or a dominant activating allele ([Q71L]) of the human ARF1 gene under the control of the interferon-inducible mouse Mx1 promoter. Upon addition of interferon, expression of ARF1 proteins increased with a half-time of 7-8 h, as determined by immunoblot analysis. Induction of mutant ARF1, but not wild-type ARF1, led to an inhibition of protein secretion with kinetics similar to that observed for induction of protein expression. Examination of the Golgi apparatus and the ER by indirect immunofluorescence or transmission electron microscopy revealed that expression of low levels of mutant ARF1 protein correlated with a dramatic increase in vesiculation of the Golgi apparatus and expansion of the ER lumen, while expression of substantially higher levels of wild-type ARF1 had no discernible effect. Endocytosis was also inhibited by expression of mutant ARF1, but not by the wild-type protein. Finally, the expression of [Q71L]ARF1, but not wild-type ARF1, antagonized the actions of brefeldin A, as determined by the delayed loss of ARF and beta-COP from Golgi membranes and disruption of the Golgi apparatus. General models for the actions of ARF1 in membrane traffic events are discussed. PMID:8294513

  11. Mutant TDP-43 in motor neurons promotes the onset and progression of ALS in rats

    PubMed Central

    Huang, Cao; Tong, Jianbin; Bi, Fangfang; Zhou, Hongxia; Xia, Xu-Gang

    2011-01-01

    Amyotrophic lateral sclerosis (ALS) is characterized by progressive motor neuron degeneration, which ultimately leads to paralysis and death. Mutation of TAR DNA binding protein 43 (TDP-43) has been linked to the development of an inherited form of ALS. Existing TDP-43 transgenic animals develop a limited loss of motor neurons and therefore do not faithfully reproduce the core phenotype of ALS. Here, we report the creation of multiple lines of transgenic rats in which expression of ALS-associated mutant human TDP-43 is restricted to either motor neurons or other types of neurons and skeletal muscle and can be switched on and off. All of these rats developed progressive paralysis reminiscent of ALS when the transgene was switched on. Rats expressing mutant TDP-43 in motor neurons alone lost more spinal motor neurons than rats expressing the disease gene in varying neurons and muscle cells, although these rats all developed remarkable denervation atrophy of skeletal muscles. Intriguingly, progression of the disease was halted after transgene expression was switched off; in rats with limited loss of motor neurons, we observed a dramatic recovery of motor function, but in rats with profound loss of motor neurons, we only observed a moderate recovery of motor function. Our finding suggests that mutant TDP-43 in motor neurons is sufficient to promote the onset and progression of ALS and that motor neuron degeneration is partially reversible, at least in mutant TDP-43 transgenic rats. PMID:22156203

  12. Derivation of mouse embryonic stem cell lines from tyrosine hydroxylase reporter mice crossed with a human SNCA transgenic mouse model of Parkinson's disease.

    PubMed

    Chumarina, Margarita; Azevedo, Carla; Bigarreau, Julie; Vignon, Clémentine; Kim, Kwang-Soo; Li, Jia-Yi; Roybon, Laurent

    2017-03-01

    Mouse embryonic stem cell (mESC) lines were derived by crossing heterozygous transgenic (tg) mice expressing green fluorescent protein (GFP) under the control of the rat tyrosine hydroxylase (TH) promoter, with homozygous alpha-synuclein (aSYN) mice expressing human mutant SNCA A53T under the control of the mouse Prion promoter (MoPrP), or wildtype (WT) mice. The expression of GFP and human aSYN was validated by immunocytochemistry in midbrain neuron cultures upon differentiation of mESC lines using stromal cell-derived inducing activity. These mESC lines can help to study the impact of human aSYN expression in neurons and oligodendrocytes, and also trace GFP-expressing midbrain neurons. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

  13. Silencing expression of the catalytic subunit of DNA-dependent protein kinase by small interfering RNA sensitizes human cells for radiation-induced chromosome damage, cell killing, and mutation

    NASA Technical Reports Server (NTRS)

    Peng, Yuanlin; Zhang, Qinming; Nagasawa, Hatsumi; Okayasu, Ryuichi; Liber, Howard L.; Bedford, Joel S.

    2002-01-01

    Targeted gene silencing in mammalian cells by RNA interference (RNAi) using small interfering RNAs (siRNAs) was recently described by Elbashir et al. (S. M. Elbashir et al., Nature (Lond.), 411: 494-498, 2001). We have used this methodology in several human cell strains to reduce expression of the Prkdc (DNA-PKcs) gene coding for the catalytic subunit of the DNA-dependent protein kinase (DNA-PKcs) that is involved in the nonhomologous end joining of DNA double-strand breaks. We have also demonstrated a radiosensitization for several phenotypic endpoints of radiation damage. In low-passage normal human fibroblasts, siRNA knock-down of DNA-PKcs resulted in a reduced capacity for restitution of radiation-induced interphase chromosome breaks as measured by premature chromosome condensation, an increased yield of acentric chromosome fragments at the first postirradiation mitosis, and an increased radiosensitivity for cell killing. For three strains of related human lymphoblasts, DNA-PKcs-targeted siRNA transfection resulted in little or no increase in radiosensitivity with respect to cell killing, a 1.5-fold decrease in induced mutant yield in TK6- and p53-null NH32 cells, but about a 2-fold increase in induced mutant yield in p53-mutant WTK1 cells at both the hypoxanthine quanine phosphoribosyl transferase (hprt) and the thymidine kinase loci.

  14. Zebrafish enpp1 mutants exhibit pathological mineralization, mimicking features of generalized arterial calcification of infancy (GACI) and pseudoxanthoma elasticum (PXE).

    PubMed

    Apschner, Alexander; Huitema, Leonie F A; Ponsioen, Bas; Peterson-Maduro, Josi; Schulte-Merker, Stefan

    2014-07-01

    In recent years it has become clear that, mechanistically, biomineralization is a process that has to be actively inhibited as a default state. This inhibition must be released in a rigidly controlled manner in order for mineralization to occur in skeletal elements and teeth. A central aspect of this concept is the tightly controlled balance between phosphate, a constituent of the biomineral hydroxyapatite, and pyrophosphate, a physiochemical inhibitor of mineralization. Here, we provide a detailed analysis of a zebrafish mutant, dragonfish (dgf), which is mutant for ectonucleoside pyrophosphatase/phosphodiesterase 1 (Enpp1), a protein that is crucial for supplying extracellular pyrophosphate. Generalized arterial calcification of infancy (GACI) is a fatal human disease, and the majority of cases are thought to be caused by mutations in ENPP1. Furthermore, some cases of pseudoxanthoma elasticum (PXE) have recently been linked to ENPP1. Similar to humans, we show here that zebrafish enpp1 mutants can develop ectopic calcifications in a variety of soft tissues - most notably in the skin, cartilage elements, the heart, intracranial space and the notochord sheet. Using transgenic reporter lines, we demonstrate that ectopic mineralizations in these tissues occur independently of the expression of typical osteoblast or cartilage markers. Intriguingly, we detect cells expressing the osteoclast markers Trap and CathepsinK at sites of ectopic calcification at time points when osteoclasts are not yet present in wild-type siblings. Treatment with the bisphosphonate etidronate rescues aspects of the dgf phenotype, and we detected deregulated expression of genes that are involved in phosphate homeostasis and mineralization, such as fgf23, npt2a, entpd5 and spp1 (also known as osteopontin). Employing a UAS-GalFF approach, we show that forced expression of enpp1 in blood vessels or the floorplate of mutant embryos is sufficient to rescue the notochord mineralization phenotype. This indicates that enpp1 can exert its function in tissues that are remote from its site of expression. © 2014. Published by The Company of Biologists Ltd.

  15. Development of New Mouse Lung Tumor Models Expressing EGFR T790M Mutants Associated with Clinical Resistance to Kinase Inhibitors

    PubMed Central

    Regales, Lucia; Balak, Marissa N.; Gong, Yixuan; Politi, Katerina; Sawai, Ayana; Le, Carl; Koutcher, Jason A.; Solit, David B.; Rosen, Neal; Zakowski, Maureen F.; Pao, William

    2007-01-01

    Background The EGFR T790M mutation confers acquired resistance to kinase inhibitors in human EGFR mutant lung adenocarcinoma, is occasionally detected before treatment, and may confer genetic susceptibility to lung cancer. Methodology/Principal Findings To study further its role in lung tumorigenesis, we developed mice with inducible expression in type II pneumocytes of EGFRT790M alone or together with a drug-sensitive L858R mutation. Both transgenic lines develop lung adenocarcinomas that require mutant EGFR for tumor maintenance but are resistant to an EGFR kinase inhibitor. EGFRL858R+T790M-driven tumors are transiently targeted by hsp90 inhibition. Notably, EGFRT790M-expressing animals develop tumors with longer latency than EGFRL858R+T790M-bearing mice and in the absence of additional kinase domain mutations. Conclusions/Significance These new mouse models of mutant EGFR-dependent lung adenocarcinomas provide insight into clinical observations. The models should also be useful for developing improved therapies for patients with lung cancers harboring EGFRT790M alone or in conjunction with drug-sensitive EGFR kinase domain mutations. PMID:17726540

  16. Neoplasia Driven by Mutant c-KIT Is Mediated by Intracellular, Not Plasma Membrane, Receptor Signaling▿

    PubMed Central

    Xiang, Zhifu; Kreisel, Frederike; Cain, Jennifer; Colson, AnnaLynn; Tomasson, Michael H.

    2007-01-01

    Activating mutations in c-KIT are associated with gastrointestinal stromal tumors, mastocytosis, and acute myeloid leukemia. In attempting to establish a murine model of human KITD816V (hKITD816V)-mediated leukemia, we uncovered an unexpected relationship between cellular transformation and intracellular trafficking. We found that transport of hKITD816V protein was blocked at the endoplasmic reticulum in a species-specific fashion. We exploited these species-specific trafficking differences and a set of localization domain-tagged KIT mutants to explore the relationship between subcellular localization of mutant KIT and cellular transformation. The protein products of fully transforming KIT mutants localized to the Golgi apparatus and to a lesser extent the plasma membrane. Domain-tagged KITD816V targeted to the Golgi apparatus remained constitutively active and transforming. Chemical inhibition of intracellular transport demonstrated that Golgi localization is sufficient, but plasma membrane localization is dispensable, for downstream signaling mediated by KIT mutation. When expressed in murine bone marrow, endoplasmic reticulum-localized hKITD816V failed to induce disease in mice, while expression of either Golgi-localized HyKITD816V or cytosol-localized, ectodomain-deleted KITD816V uniformly caused fatal myeloproliferative diseases. Taken together, these data demonstrate that intracellular, non-plasma membrane receptor signaling is sufficient to drive neoplasia caused by mutant c-KIT and provide the first animal model of myelomonocytic neoplasia initiated by human KITD816V. PMID:17060458

  17. Role of the rttA gene in morphogenesis, stress response, and virulence in the human pathogenic fungus Penicillium marneffei.

    PubMed

    Suwunnakorn, Sumanun; Cooper, Chester R; Kummasook, Aksarakorn; Pongpom, Monsicha; Vanittanakom, Pramote; Vanittanakom, Nongnuch

    2015-02-01

    Penicillium marneffei is a human pathogenic fungus and the only thermally dimorphic species of the genus. At 25°C, P. marneffei grows as a mycelium that produces conidia in chains. However, when incubated at 37°C or following infection of host tissue, the fungus develops as a fission yeast. Previously, a mutant (strain I133) defective in morphogenesis was generated via Agrobacterium-mediated transformation. Specifically, the rtt109 gene (subsequently designated rttA) in this mutant was interrupted by T-DNA insertion. We characterized strain I133 and the possible roles of the mutated rttA gene in altered P. marneffei phenotypes. At 25°C, the rttA mutant produces fewer conidia than the wild type and a complemented mutant strain, as well as slower rates of conidial germination; however, strain I133 continued to grow as a yeast in 37°C-incubated cultures. Furthermore, whereas the wild type exhibited increased expression of rttA at 37°C in response to the DNA-damaging agent methyl methane sulfonate, strain I133 was hypersensitive to this and other genotoxic agents. Under similar conditions, the rttA mutant exhibited decreased expression of genes associated with carbohydrate metabolism and oxidative stress. Importantly, when compared with the wild-type and the complemented strain, I133 was significantly less virulent in a Galleria infection model when the larvae were incubated at 37°C. Moreover, the mutant exhibited inappropriate phase transition in vivo. In conclusion, the rttA gene plays important roles in morphogenesis, carbohydrate metabolism, stress response, and pathogenesis in P. marneffei, suggesting that this gene may be a potential target for the development of antifungal compounds. © The Author 2014. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  18. HSP90 Shapes the Consequences of Human Genetic Variation.

    PubMed

    Karras, Georgios I; Yi, Song; Sahni, Nidhi; Fischer, Máté; Xie, Jenny; Vidal, Marc; D'Andrea, Alan D; Whitesell, Luke; Lindquist, Susan

    2017-02-23

    HSP90 acts as a protein-folding buffer that shapes the manifestations of genetic variation in model organisms. Whether HSP90 influences the consequences of mutations in humans, potentially modifying the clinical course of genetic diseases, remains unknown. By mining data for >1,500 disease-causing mutants, we found a strong correlation between reduced phenotypic severity and a dominant (HSP90 ≥ HSP70) increase in mutant engagement by HSP90. Examining the cancer predisposition syndrome Fanconi anemia in depth revealed that mutant FANCA proteins engaged predominantly by HSP70 had severely compromised function. In contrast, the function of less severe mutants was preserved by a dominant increase in HSP90 binding. Reducing HSP90's buffering capacity with inhibitors or febrile temperatures destabilized HSP90-buffered mutants, exacerbating FA-related chemosensitivities. Strikingly, a compensatory FANCA somatic mutation from an "experiment of nature" in monozygotic twins both prevented anemia and reduced HSP90 binding. These findings provide one plausible mechanism for the variable expressivity and environmental sensitivity of genetic diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Suppression of RIP3-dependent Necroptosis by Human Cytomegalovirus

    PubMed Central

    Omoto, Shinya; Guo, Hongyan; Talekar, Ganesh R.; Roback, Linda; Kaiser, William J.; Mocarski, Edward S.

    2015-01-01

    Necroptosis is an alternate programmed cell death pathway that is unleashed by caspase-8 compromise and mediated by receptor-interacting protein kinase 3 (RIP3). Murine cytomegalovirus (CMV) and herpes simplex virus (HSV) encode caspase-8 inhibitors that prevent apoptosis together with competitors of RIP homotypic interaction motif (RHIM)-dependent signal transduction to interrupt the necroptosis. Here, we show that pro-necrotic murine CMV M45 mutant virus drives virus-induced necroptosis during nonproductive infection of RIP3-expressing human fibroblasts, whereas WT virus does not. Thus, M45-encoded RHIM competitor, viral inhibitor of RIP activation, sustains viability of human cells like it is known to function in infected mouse cells. Importantly, human CMV is shown to block necroptosis induced by either TNF or M45 mutant murine CMV in RIP3-expressing human cells. Human CMV blocks TNF-induced necroptosis after RIP3 activation and phosphorylation of the mixed lineage kinase domain-like (MLKL) pseudokinase. An early, IE1-regulated viral gene product acts on a necroptosis step that follows MLKL phosphorylation prior to membrane leakage. This suppression strategy is distinct from RHIM signaling competition by murine CMV or HSV and interrupts an execution process that has not yet been fully elaborated. PMID:25778401

  20. Can the silkworm (Bombyx mori) be used as a human disease model?

    PubMed

    Tabunoki, Hiroko; Bono, Hidemasa; Ito, Katsuhiko; Yokoyama, Takeshi

    2016-02-01

    Bombyx mori (silkworm) is the most famous lepidopteran in Japan. B. mori has long been used in the silk industry and also as a model insect for agricultural research. In recent years, B. mori has attracted interest in its potential for use in pathological analysis of model animals. For example, the human macular carotenoid transporter was discovered using information of B. mori carotenoid transporter derived from yellow-cocoon strain. The B. mori carotenoid transport system is useful in human studies. To develop a human disease model, we characterized the human homologs of B. mori, and by constructing KAIKO functional annotation pipeline, and to analyze gene expression profile of a unique B. mori mutant strain using microarray analysis. As a result, we identified a novel molecular network involved in Parkinson's disease. Here we describe the potential use of a spontaneous mutant silkworm strain as a human disease model. We also summarize recent progress in the application of genomic information for annotation of human homologs in B. mori. The B. mori mutant will provide a clue to pathological mechanisms, and the findings will be helpful for the development of therapies and for medical drug discovery.

  1. Genetic modification of adeno-associated viral vector type 2 capsid enhances gene transfer efficiency in polarized human airway epithelial cells.

    PubMed

    White, April F; Mazur, Marina; Sorscher, Eric J; Zinn, Kurt R; Ponnazhagan, Selvarangan

    2008-12-01

    Cystic fibrosis (CF) is a common genetic disease characterized by defects in the expression of the CF transmembrane conductance regulator (CFTR) gene. Gene therapy offers better hope for the treatment of CF. Adeno-associated viral (AAV) vectors are capable of stable expression with low immunogenicity. Despite their potential in CF gene therapy, gene transfer efficiency by AAV is limited because of pathophysiological barriers in these patients. Although a few AAV serotypes have shown better transduction compared with the AAV2-based vectors, gene transfer efficiency in human airway epithelium has still not reached therapeutic levels. To engineer better AAV vectors for enhanced gene delivery in human airway epithelium, we developed and characterized mutant AAV vectors by genetic capsid modification, modeling the well-characterized AAV2 serotype. We genetically incorporated putative high-affinity peptide ligands to human airway epithelium on the GH loop region of AAV2 capsid protein. Six independent mutant AAV were constructed, containing peptide ligands previously reported to bind with high affinity for known and unknown receptors on human airway epithelial cells. The vectors were tested on nonairway cells and nonpolarized and polarized human airway epithelial cells for enhanced infectivity. One of the mutant vectors, with the peptide sequence THALWHT, not only showed the highest transduction in undifferentiated human airway epithelial cells but also indicated significant transduction in polarized cells. Interestingly, this modified vector was also able to infect cells independently of the heparan sulfate proteoglycan receptor. Incorporation of this ligand on other AAV serotypes, which have shown improved gene transfer efficiency in the human airway epithelium, may enhance the application of AAV vectors in CF gene therapy.

  2. The parkin Mutant Phenotype in the Fly Is Largely Rescued by Metal-Responsive Transcription Factor (MTF-1) ▿ †

    PubMed Central

    Saini, Nidhi; Georgiev, Oleg; Schaffner, Walter

    2011-01-01

    The gene for Parkin, an E3 ubiquitin ligase, is mutated in some familial forms of Parkinson's disease, a severe neurodegenerative disorder. A homozygous mutant of the Drosophila ortholog of human parkin is viable but results in severe motoric impairment including an inability to fly, female and male sterility, and a decreased life span. We show here that a double mutant of the genes for Parkin and the metal-responsive transcription factor 1 (MTF-1) is not viable. MTF-1, which is conserved from insects to mammals, is a key regulator of heavy metal homeostasis and detoxification and plays additional roles in other stress conditions, notably oxidative stress. In contrast to the synthetic lethality of the double mutant, elevated expression of MTF-1 dramatically ameliorates the parkin mutant phenotype, as evidenced by a prolonged life span, motoric improvement including short flight episodes, and female fertility. At the cellular level, muscle and mitochondrial structures are substantially improved. A beneficial effect is also seen with a transgene encoding human MTF-1. We propose that Parkin and MTF-1 provide complementary functions in metal homeostasis, oxidative stress and other cellular stress responses. Our findings also raise the possibility that MTF-1 gene polymorphisms in humans could affect the severity of Parkinson's disease. PMID:21383066

  3. Forced Expression of Heat Shock Protein 27 (Hsp27) Reverses P-Glycoprotein (ABCB1)-mediated Drug Efflux and MDR1 Gene Expression in Adriamycin-resistant Human Breast Cancer Cells*

    PubMed Central

    Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J.; Ilangovan, Govindasamy

    2011-01-01

    Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G2/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer. PMID:21784846

  4. Forced expression of heat shock protein 27 (Hsp27) reverses P-glycoprotein (ABCB1)-mediated drug efflux and MDR1 gene expression in Adriamycin-resistant human breast cancer cells.

    PubMed

    Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J; Ilangovan, Govindasamy

    2011-09-23

    Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G(2)/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer.

  5. Identification of a human synaptotagmin-1 mutation that perturbs synaptic vesicle cycling

    PubMed Central

    Baker, Kate; Gordon, Sarah L.; Grozeva, Detelina; van Kogelenberg, Margriet; Roberts, Nicola Y.; Pike, Michael; Blair, Edward; Hurles, Matthew E.; Chong, W. Kling; Baldeweg, Torsten; Kurian, Manju A.; Boyd, Stewart G.; Cousin, Michael A.; Raymond, F. Lucy

    2015-01-01

    Synaptotagmin-1 (SYT1) is a calcium-binding synaptic vesicle protein that is required for both exocytosis and endocytosis. Here, we describe a human condition associated with a rare variant in SYT1. The individual harboring this variant presented with an early onset dyskinetic movement disorder, severe motor delay, and profound cognitive impairment. Structural MRI was normal, but EEG showed extensive neurophysiological disturbances that included the unusual features of low-frequency oscillatory bursts and enhanced paired-pulse depression of visual evoked potentials. Trio analysis of whole-exome sequence identified a de novo SYT1 missense variant (I368T). Expression of rat SYT1 containing the equivalent human variant in WT mouse primary hippocampal cultures revealed that the mutant form of SYT1 correctly localizes to nerve terminals and is expressed at levels that are approximately equal to levels of endogenous WT protein. The presence of the mutant SYT1 slowed synaptic vesicle fusion kinetics, a finding that agrees with the previously demonstrated role for I368 in calcium-dependent membrane penetration. Expression of the I368T variant also altered the kinetics of synaptic vesicle endocytosis. Together, the clinical features, electrophysiological phenotype, and in vitro neuronal phenotype associated with this dominant negative SYT1 mutation highlight presynaptic mechanisms that mediate human motor control and cognitive development. PMID:25705886

  6. Understanding the role of argininosuccinate lyase transcript variants in the clinical and biochemical variability of the urea cycle disorder argininosuccinic aciduria.

    PubMed

    Hu, Liyan; Pandey, Amit V; Eggimann, Sandra; Rüfenacht, Véronique; Möslinger, Dorothea; Nuoffer, Jean-Marc; Häberle, Johannes

    2013-11-29

    Argininosuccinic aciduria (ASA) is an autosomal recessive urea cycle disorder caused by deficiency of argininosuccinate lyase (ASL) with a wide clinical spectrum from asymptomatic to severe hyperammonemic neonatal onset life-threatening courses. We investigated the role of ASL transcript variants in the clinical and biochemical variability of ASA. Recombinant proteins for ASL wild type, mutant p.E189G, and the frequently occurring transcript variants with exon 2 or 7 deletions were (co-)expressed in human embryonic kidney 293T cells. We found that exon 2-deleted ASL forms a stable truncated protein with no relevant activity but a dose-dependent dominant negative effect on enzymatic activity after co-expression with wild type or mutant ASL, whereas exon 7-deleted ASL is unstable but seems to have, nevertheless, a dominant negative effect on mutant ASL. These findings were supported by structural modeling predictions for ASL heterotetramer/homotetramer formation. Illustrating the physiological relevance, the predominant occurrence of exon 7-deleted ASL was found in two patients who were both heterozygous for the ASL mutant p.E189G. Our results suggest that ASL transcripts can contribute to the highly variable phenotype in ASA patients if expressed at high levels. Especially, the exon 2-deleted ASL variant may form a heterotetramer with wild type or mutant ASL, causing markedly reduced ASL activity.

  7. Interplay Between Capsule Expression and Uracil Metabolism in Streptococcus pneumoniae D39

    PubMed Central

    Carvalho, Sandra M.; Kloosterman, Tomas G.; Manzoor, Irfan; Caldas, José; Vinga, Susana; Martinussen, Jan; Saraiva, Lígia M.; Kuipers, Oscar P.; Neves, Ana R.

    2018-01-01

    Pyrimidine nucleotides play an important role in the biosynthesis of activated nucleotide sugars (NDP-sugars). NDP-sugars are the precursors of structural polysaccharides in bacteria, including capsule, which is a major virulence factor of the human pathogen S. pneumoniae. In this work, we identified a spontaneous non-reversible mutant of strain D39 that displayed a non-producing capsule phenotype. Whole-genome sequencing analysis of this mutant revealed several non-synonymous single base modifications, including in genes of the de novo synthesis of pyrimidines and in the −10 box of capsule operon promoter (Pcps). By directed mutagenesis we showed that the point mutation in Pcps was solely responsible for the drastic decrease in capsule expression. We also demonstrated that D39 subjected to uracil deprivation shows increased biomass and decreased Pcps activity and capsule amounts. Importantly, Pcps expression is further decreased by mutating the first gene of the de novo synthesis of pyrimidines, carA. In contrast, the absence of uracil from the culture medium showed no effect on the spontaneous mutant strain. Co-cultivation of the wild-type and the mutant strain indicated a competitive advantage of the spontaneous mutant (non-producing capsule) in medium devoid of uracil. We propose a model in that uracil may act as a signal for the production of different capsule amounts in S. pneumoniae. PMID:29599757

  8. Interplay Between Capsule Expression and Uracil Metabolism in Streptococcus pneumoniae D39.

    PubMed

    Carvalho, Sandra M; Kloosterman, Tomas G; Manzoor, Irfan; Caldas, José; Vinga, Susana; Martinussen, Jan; Saraiva, Lígia M; Kuipers, Oscar P; Neves, Ana R

    2018-01-01

    Pyrimidine nucleotides play an important role in the biosynthesis of activated nucleotide sugars (NDP-sugars). NDP-sugars are the precursors of structural polysaccharides in bacteria, including capsule, which is a major virulence factor of the human pathogen S. pneumoniae . In this work, we identified a spontaneous non-reversible mutant of strain D39 that displayed a non-producing capsule phenotype. Whole-genome sequencing analysis of this mutant revealed several non-synonymous single base modifications, including in genes of the de novo synthesis of pyrimidines and in the -10 box of capsule operon promoter (P cps ). By directed mutagenesis we showed that the point mutation in P cps was solely responsible for the drastic decrease in capsule expression. We also demonstrated that D39 subjected to uracil deprivation shows increased biomass and decreased P cps activity and capsule amounts. Importantly, P cps expression is further decreased by mutating the first gene of the de novo synthesis of pyrimidines, carA . In contrast, the absence of uracil from the culture medium showed no effect on the spontaneous mutant strain. Co-cultivation of the wild-type and the mutant strain indicated a competitive advantage of the spontaneous mutant (non-producing capsule) in medium devoid of uracil. We propose a model in that uracil may act as a signal for the production of different capsule amounts in S. pneumoniae .

  9. The induction of heme oxygenase-1 suppresses heat shock protein 90 and the proliferation of human breast cancer cells through its byproduct carbon monoxide

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lee, Wen-Ying; Department of Pathology, School of Medicine, College of Medicine, Taipei Medical University, Taipei, Taiwan; Chen, Yen-Chou

    2014-01-01

    Heme oxygenase (HO)-1 is an oxidative stress-response enzyme which catalyzes the degradation of heme into bilirubin, ferric ion, and carbon monoxide (CO). Induction of HO-1 was reported to have antitumor activity; the inhibitory mechanism, however, is still unclear. In the present study, we found that treatment with [Ru(CO){sub 3}Cl{sub 2}]{sub 2} (RuCO), a CO-releasing compound, reduced the growth of human MCF7 and MDA-MB-231 breast cancer cells. Analysis of growth-related proteins showed that treatment with RuCO down-regulated cyclinD1, CDK4, and hTERT protein expressions. Interestingly, RuCO treatment resulted in opposite effects on wild-type and mutant p53 proteins. These results were similar tomore » those of cells treated with geldanamycin (a heat shock protein (HSP)90 inhibitor), suggesting that RuCO might affect HSP90 activity. Moreover, RuCO induced mutant p53 protein destabilization accompanied by promotion of ubiquitination and proteasome degradation. The induction of HO-1 by cobalt protoporphyrin IX (CoPP) showed consistent results, while the addition of tin protoporphyrin IX (SnPP), an HO-1 enzymatic inhibitor, diminished the RuCO-mediated effect. RuCO induction of HO-1 expression was reduced by a p38 mitogen-activated protein kinase inhibitor (SB203580). Additionally, treatment with a chemopreventive compound, curcumin, induced HO-1 expression accompanied with reduction of HSP90 client protein expression. The induction of HO-1 by curcumin inhibited 12-O-tetradecanoyl-13-acetate (TPA)-elicited matrix metalloproteinase-9 expression and tumor invasion. In conclusion, we provide novel evidence underlying HO-1's antitumor mechanism. CO, a byproduct of HO-1, suppresses HSP90 protein activity, and the induction of HO-1 may possess potential as a cancer therapeutic. - Highlights: • CO and HO-1 inhibited the growth of human breast cancer cells. • CO and HO-1 attenuated HSP90 and its client proteins expression. • CO induced mutant p53 protein ubiquitination and degradation. • Curcumin induced HO-1 expression and attenuated HSP90's client proteins expression.« less

  10. Intron retention and nuclear loss of SFPQ are molecular hallmarks of ALS.

    PubMed

    Luisier, Raphaelle; Tyzack, Giulia E; Hall, Claire E; Mitchell, Jamie S; Devine, Helen; Taha, Doaa M; Malik, Bilal; Meyer, Ione; Greensmith, Linda; Newcombe, Jia; Ule, Jernej; Luscombe, Nicholas M; Patani, Rickie

    2018-05-22

    Mutations causing amyotrophic lateral sclerosis (ALS) strongly implicate ubiquitously expressed regulators of RNA processing. To understand the molecular impact of ALS-causing mutations on neuronal development and disease, we analysed transcriptomes during in vitro differentiation of motor neurons (MNs) from human control and patient-specific VCP mutant induced-pluripotent stem cells (iPSCs). We identify increased intron retention (IR) as a dominant feature of the splicing programme during early neural differentiation. Importantly, IR occurs prematurely in VCP mutant cultures compared with control counterparts. These aberrant IR events are also seen in independent RNAseq data sets from SOD1- and FUS-mutant MNs. The most significant IR is seen in the SFPQ transcript. The SFPQ protein binds extensively to its retained intron, exhibits lower nuclear abundance in VCP mutant cultures and is lost from nuclei of MNs in mouse models and human sporadic ALS. Collectively, we demonstrate SFPQ IR and nuclear loss as molecular hallmarks of familial and sporadic ALS.

  11. Impaired trafficking of human kidney anion exchanger (kAE1) caused by hetero-oligomer formation with a truncated mutant associated with distal renal tubular acidosis.

    PubMed

    Quilty, Janne A; Cordat, Emmanuelle; Reithmeier, Reinhart A F

    2002-12-15

    Autosomal dominant distal renal tubular acidosis (dRTA) has been associated with several mutations in the anion exchanger AE1 gene. The effect of an 11-amino-acid C-terminal dRTA truncation mutation (901 stop) on the expression of kidney AE1 (kAE1) and erythroid AE1 was examined in transiently transfected HEK-293 cells. Unlike the wild-type proteins, kAE1 901 stop and AE1 901 stop mutants exhibited impaired trafficking from the endoplasmic reticulum to the plasma membrane as determined by immunolocalization, cell-surface biotinylation, oligosaccharide processing and pulse-chase experiments. The 901 stop mutants were able to bind to an inhibitor affinity resin, suggesting that these mutant membrane proteins were not grossly misfolded. Co-expression of wild-type and mutant kAE1 or AE1 resulted in intracellular retention of the wild-type proteins in a pre-medial Golgi compartment. This dominant negative effect was due to hetero-oligomer formation of the mutant and wild-type proteins. Intracellular retention of kAE1 in the alpha-intercalated cells of the kidney would account for the impaired acid secretion into the urine characteristic of dRTA.

  12. A missense mutation in Grm6 reduces but does not eliminate mGluR6 expression or rod depolarizing bipolar cell function.

    PubMed

    Peachey, Neal S; Hasan, Nazarul; FitzMaurice, Bernard; Burrill, Samantha; Pangeni, Gobinda; Karst, Son Yong; Reinholdt, Laura; Berry, Melissa L; Strobel, Marge; Gregg, Ronald G; McCall, Maureen A; Chang, Bo

    2017-08-01

    GRM6 encodes the metabotropic glutamate receptor 6 (mGluR6) used by retinal depolarizing bipolar cells (DBCs). Mutations in GRM6 lead to DBC dysfunction and underlie the human condition autosomal recessive complete congenital stationary night blindness. Mouse mutants for Grm6 are important models for this condition. Here we report a new Grm6 mutant, identified in an electroretinogram (ERG) screen of mice maintained at The Jackson Laboratory. The Grm6 nob8 mouse has a reduced-amplitude b-wave component of the ERG, which reflects light-evoked DBC activity. Sequencing identified a missense mutation that converts a highly conserved methionine within the ligand binding domain to leucine (p.Met66Leu). Consistent with prior studies of Grm6 mutant mice, the laminar size and structure in the Grm6 nob8 retina were comparable to control. The Grm6 nob8 phenotype is distinguished from other Grm6 mutants that carry a null allele by a reduced but not absent ERG b-wave, decreased but present expression of mGluR6 at DBC dendritic tips, and mislocalization of mGluR6 to DBC somas. Consistent with a reduced but not absent b-wave, there were a subset of retinal ganglion cells whose responses to light onset have times to peak within the range of those in control retinas. These data indicate that the p.Met66Leu mutant mGluR6 is trafficked less than control. However, the mGluR6 that is localized to the DBC dendritic tips is able to initiate DBC signal transduction. The Grm6 nob8 mouse extends the Grm6 allelic series and will be useful for elucidating the role of mGluR6 in DBC signal transduction and in human disease. NEW & NOTEWORTHY This article describes a mouse model of the human disease complete congenital stationary night blindness in which the mutation reduces but does not eliminate GRM6 expression and bipolar cell function, a distinct phenotype from that seen in other Grm6 mouse models.

  13. HDM2 promotes WIP1-mediated medulloblastoma growth

    PubMed Central

    Buss, Meghan C.; Read, Tracy-Ann; Schniederjan, Matthew J.; Gandhi, Khanjan; Castellino, Robert C.

    2012-01-01

    Medulloblastoma is the most common malignant childhood brain tumor. The protein phosphatase and oncogene WIP1 is over-expressed or amplified in a significant number of primary human medulloblastomas and cell lines. In the present study, we examine an important mechanism by which WIP1 promotes medulloblastoma growth using in vitro and in vivo models. Human cell lines and intracerebellar xenografted animal models were used to study the role of WIP1 and the major TP53 regulator, HDM2, in medulloblastoma growth. Stable expression of WIP1 enhances growth of TP53 wild-type medulloblastoma cells, compared with cells with stable expression of an empty-vector or mutant WIP1. In an animal model, WIP1 enhances proliferation and reduces the survival of immunodeficient mice bearing intracerebellar xenografted human medulloblastoma cells. Cells with increased WIP1 expression also exhibit increased expression of HDM2. HDM2 knockdown or treatment with the HDM2 inhibitor Nutlin-3a, the active enantomer of Nutlin-3, specifically inhibits the growth of medulloblastoma cells with increased WIP1 expression. Nutlin-3a does not affect growth of medulloblastoma cells with stable expression of an empty vector or of mutant WIP1. Knockdown of WIP1 or treatment with the WIP1 inhibitor CCT007093 results in increased phosphorylation of known WIP1 targets, reduced HDM2 expression, and reduced growth specifically in WIP1 wild-type and high-expressing medulloblastoma cells. Combined WIP1 and HDM2 inhibition is more effective than WIP1 inhibition alone in blocking growth of WIP1 high-expressing medulloblastoma cells. Our preclinical study supports a role for therapies that target WIP1 and HDM2 in the treatment of medulloblastoma. PMID:22379189

  14. Mutations of the central tyrosines of putative cholesterol recognition amino acid consensus (CRAC) sequences modify folding, activity, and sterol-sensing of the human ABCG2 multidrug transporter.

    PubMed

    Gál, Zita; Hegedüs, Csilla; Szakács, Gergely; Váradi, András; Sarkadi, Balázs; Özvegy-Laczka, Csilla

    2015-02-01

    Human ABCG2 is a plasma membrane glycoprotein causing multidrug resistance in cancer. Membrane cholesterol and bile acids are efficient regulators of ABCG2 function, while the molecular nature of the sterol-sensing sites has not been elucidated. The cholesterol recognition amino acid consensus (CRAC, L/V-(X)(1-5)-Y-(X)(1-5)-R/K) sequence is one of the conserved motifs involved in cholesterol binding in several proteins. We have identified five potential CRAC motifs in the transmembrane domain of the human ABCG2 protein. In order to define their roles in sterol-sensing, the central tyrosines of these CRACs (Y413, 459, 469, 570 and 645) were mutated to S or F and the mutants were expressed both in insect and mammalian cells. We found that mutation in Y459 prevented protein expression; the Y469S and Y645S mutants lost their activity; while the Y570S, Y469F, and Y645F mutants retained function as well as cholesterol and bile acid sensitivity. We found that in the case of the Y413S mutant, drug transport was efficient, while modulation of the ATPase activity by cholesterol and bile acids was significantly altered. We suggest that the Y413 residue within a putative CRAC motif has a role in sterol-sensing and the ATPase/drug transport coupling in the ABCG2 multidrug transporter. Copyright © 2014. Published by Elsevier B.V.

  15. A zebrafish model for Waardenburg syndrome type IV reveals diverse roles for Sox10 in the otic vesicle.

    PubMed

    Dutton, Kirsten; Abbas, Leila; Spencer, Joanne; Brannon, Claire; Mowbray, Catriona; Nikaido, Masataka; Kelsh, Robert N; Whitfield, Tanya T

    2009-01-01

    In humans, mutations in the SOX10 gene are a cause of the auditory-pigmentary disorder Waardenburg syndrome type IV (WS4) and related variants. SOX10 encodes an Sry-related HMG box protein essential for the development of the neural crest; deafness in WS4 and other Waardenburg syndromes is usually attributed to loss of neural-crest-derived melanocytes in the stria vascularis of the cochlea. However, SOX10 is strongly expressed in the developing otic vesicle and so direct roles for SOX10 in the otic epithelium might also be important. Here, we examine the otic phenotype of zebrafish sox10 mutants, a model for WS4. As a cochlea is not present in the fish ear, the severe otic phenotype in these mutants cannot be attributed to effects on this tissue. In zebrafish sox10 mutants, we see abnormalities in all otic placodal derivatives. Gene expression studies indicate deregulated expression of several otic genes, including fgf8, in sox10 mutants. Using a combination of mutant and morphant data, we show that the three sox genes belonging to group E (sox9a, sox9b and sox10) provide a link between otic induction pathways and subsequent otic patterning: they act redundantly to maintain sox10 expression throughout otic tissue and to restrict fgf8 expression to anterior macula regions. Single-cell labelling experiments indicate a small and transient neural crest contribution to the zebrafish ear during normal development, but this is unlikely to account for the strong defects seen in the sox10 mutant. We discuss the implication that the deafness in WS4 patients with SOX10 mutations might reflect a haploinsufficiency for SOX10 in the otic epithelium, resulting in patterning and functional abnormalities in the inner ear.

  16. Alteration in cellular acetylcholine influences dauer formation in Caenorhabditis elegans.

    PubMed

    Lee, Jeeyong; Kim, Kwang-Youl; Paik, Young-Ki

    2014-02-01

    Altered acetylcholine (Ach) homeostasis is associated with loss of viability in flies, developmental defects in mice, and cognitive deficits in human. Here, we assessed the importance of Ach in Caenorhabditis elegans development, focusing on the role of Ach during dauer formation. We found that dauer formation was disturbed in choline acetyltransferase (cha-1) and acetylcholinesterase (ace) mutants defective in Ach biosynthesis and degradation, respectively. When examined the potential role of G-proteins in dauer formation, goa-1 and egl-30 mutant worms, expressing mutated versions of mammalian G(o) and G(q) homolog, respectively, showed some abnormalities in dauer formation. Using quantitative mass spectrometry, we also found that dauer larvae had lower Ach content than did reproductively grown larvae. In addition, a proteomic analysis of acetylcholinesterase mutant worms, which have excessive levels of Ach, showed differential expression of metabolic genes. Collectively, these results indicate that alterations in Ach release may influence dauer formation in C. elegans.

  17. Transgenic mice overexpressing tyrosine-to-cysteine mutant human alpha-synuclein: a progressive neurodegenerative model of diffuse Lewy body disease.

    PubMed

    Zhou, Wenbo; Milder, Julie B; Freed, Curt R

    2008-04-11

    Abnormal aggregation of human alpha-synuclein in Lewy bodies and Lewy neurites is a pathological hallmark of Parkinson disease and dementia with Lewy bodies. Studies have shown that oxidation and nitration of alpha-synuclein lead to the formation of stable dimers and oligomers through dityrosine cross-linking. Previously we have reported that tyrosine-to-cysteine mutations, particularly at the tyrosine 39 residue (Y39C), significantly enhanced alpha-synuclein fibril formation and neurotoxicity. In the current study, we have generated transgenic mice expressing the Y39C mutant human alpha-synuclein gene controlled by the mouse Thy1 promoter. Mutant human alpha-synuclein was widely expressed in transgenic mouse brain, resulting in 150% overexpression relative to endogenous mouse alpha-synuclein. At age 9-12 months, transgenic mice began to display motor dysfunction in rotarod testing. Older animals aged 15-18 months showed progressive accumulation of human alpha-synuclein oligomers, associated with worse motor function and cognitive impairment in the Morris water maze. By age 21-24 months, alpha-synuclein aggregates were further increased, accompanied by severe behavioral deficits. At this age, transgenic mice developed neuropathology, such as Lewy body-like alpha-synuclein and ubiquitin-positive inclusions, phosphorylation at Ser(129) of human alpha-synuclein, and increased apoptotic cell death. In summary, Y39C human alpha-synuclein transgenic mice show age-dependent, progressive neuronal degeneration with motor and cognitive deficits similar to diffuse Lewy body disease. The time course of alpha-synuclein oligomer accumulation coincided with behavioral and pathological changes, indicating that these oligomers may initiate protein aggregation, disrupt cellular function, and eventually lead to neuronal death.

  18. Delayed Induction of Human NTE (PNPLA6) Rescues Neurodegeneration and Mobility Defects of Drosophila swiss cheese (sws) Mutants.

    PubMed

    Sujkowski, Alyson; Rainier, Shirley; Fink, John K; Wessells, Robert J

    2015-01-01

    Human PNPLA6 gene encodes Neuropathy Target Esterase protein (NTE). PNPLA6 gene mutations cause hereditary spastic paraplegia (SPG39 HSP), Gordon-Holmes syndrome, Boucher-Neuhäuser syndromes, Laurence-Moon syndrome, and Oliver-McFarlane syndrome. Mutations in the Drosophila NTE homolog swiss cheese (sws) cause early-onset, progressive behavioral defects and neurodegeneration characterized by vacuole formation. We investigated sws5 flies and show for the first time that this allele causes progressive vacuolar formation in the brain and progressive deterioration of negative geotaxis speed and endurance. We demonstrate that inducible, neuron-specific expression of full-length human wildtype NTE reduces vacuole formation and substantially rescues mobility. Indeed, neuron-specific expression of wildtype human NTE is capable of rescuing mobility defects after 10 days of adult life at 29°C, when significant degeneration has already occurred, and significantly extends longevity of mutants at 25°C. These results raise the exciting possibility that late induction of NTE function may reduce or ameliorate neurodegeneration in humans even after symptoms begin. In addition, these results highlight the utility of negative geotaxis endurance as a new assay for longitudinal tracking of degenerative phenotypes in Drosophila.

  19. Behavior of a cloned murine interferon alpha/beta receptor expressed in homospecific or heterospecific background.

    PubMed Central

    Uzé, G; Lutfalla, G; Bandu, M T; Proudhon, D; Mogensen, K E

    1992-01-01

    A murine interferon (IFN) alpha/beta receptor was cloned from the IFN-sensitive L1210 cell line on the basis of its homology with the human receptor. A combination of methods that includes the screening of random-primed and oligo(dT)-primed cDNA libraries and polymerase chain reactions with a single-side specificity was used. At the amino acid level, the murine IFN-alpha/beta shows 46% identity with its human counterpart. Both human WISH cells presenting a low sensitivity to mouse IFN and a murine L1210 mutant subline that does not express the receptor have been stably transfected with the murine IFN-alpha/beta receptor. Whereas transfected human cells became sensitive to a limited number of mouse IFN-alpha/beta subtypes, the transfected murine L1210 mutant was found to be fully complemented and became sensitive to all mouse IFN-alpha/beta subtypes tested, including those that were not active on transfected human cells. These results strongly suggest that the receptor described here is implicated in the mediation of the activities of all murine IFN-alpha/beta subtypes. Images PMID:1533935

  20. Disruption of DNA methylation-dependent long gene repression in Rett syndrome

    PubMed Central

    Gabel, Harrison W.; Kinde, Benyam Z.; Stroud, Hume; Gilbert, Caitlin S.; Harmin, David A.; Kastan, Nathaniel R.; Hemberg, Martin; Ebert, Daniel H.; Greenberg, Michael E.

    2015-01-01

    Disruption of the MECP2 gene leads to Rett syndrome (RTT), a severe neurological disorder with features of autism1. MECP2 encodes a methyl-DNA-binding protein2 that has been proposed to function as a transcriptional repressor, but despite numerous studies examining neuronal gene expression in Mecp2 mutants, no clear model has emerged for how MeCP2 regulates transcription3–9. Here we identify a genome-wide length-dependent increase in gene expression in MeCP2 mutant mouse models and human RTT brains. We present evidence that MeCP2 represses gene expression by binding to methylated CA sites within long genes, and that in neurons lacking MeCP2, decreasing the expression of long genes attenuates RTT-associated cellular deficits. In addition, we find that long genes as a population are enriched for neuronal functions and selectively expressed in the brain. These findings suggest that mutations in MeCP2 may cause neurological dysfunction by specifically disrupting long gene expression in the brain. PMID:25762136

  1. A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

    PubMed

    Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

    2002-08-22

    A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

  2. Mutant DD genotype of NFKB1 gene is associated with the susceptibility and severity of coronary artery disease.

    PubMed

    Luo, Jun-Yi; Li, Xiao-Mei; Zhou, Yun; Zhao, Qiang; Chen, Bang-Dang; Liu, Fen; Chen, Xiao-Cui; Zheng, Hong; Ma, Yi-Tong; Gao, Xiao-Ming; Yang, Yi-Ning

    2017-02-01

    Nuclear factor κappa B (NF-κB) is an important transcription factor in the development and progression of coronary artery disease (CAD). Recent evidence suggests that -94 ATTG ins/del mutant in the promoter of NFKB1 gene is an essential functional mutant. The present study demonstrated the frequencies of the del/del (DD) genotype and del (D) allele were significantly higher in CAD patients than in controls. CAD patients carrying mutant DD genotype had worse stenosis of diseased coronary arteries compared to those carrying ins/ins (II) or ins/del (ID) genotype. Plasma levels of endothelial nitric oxide synthase (eNOS) were lower, while inflammatory cytokine incnterlukin-6 (IL-6) was higher in CAD patients with DD genotype than those with II or ID genotype (both P<0.05). In vitro study showed that mutant human umbilical vein endothelial cells (DD genotype HUVECs) were more susceptible to H 2 O 2 -induced apoptosis, which was accompanied with a decreased Bcl-2 expression. Further, mutant HUVECs had lower eNOS but higher IL-6 mRNA levels and decreased phosphorylation of eNOS under H 2 O 2 -stimulation (both P<0.05). Compared to wild type cells (II genotype), significantly downregulated protein expression of total NF-κB p50 subunit were observed in mutant HUVECs with or without oxidative stress, and a lower expression of unclear p50 was associated with a decreased p50 nuclear translocation in mutant HUVECs versus wild type cells under H 2 O 2 -stimulation (both P<0.05). In conclusion, mutant DD genotype of NFKB1 gene is associated with the risk and severity of CAD. Dwonregulation of NF-κB p50 subunit leads to exacerbated endothelial dysfunction and apoptosis and enhanced inflammatory response that is the potential underlying mechanism. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Host range and cell cycle activation properties of polyomavirus large T-antigen mutants defective in pRB binding

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Freund, R.; Bauer, P.H.; Benjamin, T.L.

    1994-11-01

    The authors have examined the growth properties of polyomavirus large T-antigen mutants that ar unable to bind pRB, the product of the retinoblastoma tumor suppressor gene. These mutants grow poorly on primary mouse cells yet grow well on NIH 3T3 and other established mouse cell lines. Preinfection of primary baby mouse kidney (BMK) epithelial cells with wild-type simian virus 40 renders these cells permissive to growth of pRB-binding polyomavirus mutants. Conversely, NIH 3T3 cells transfected by and expressing wild-type human pRB become nonpermissive. Primary fibroblasts for mouse embryos that carry a homozygous knockout of the RB gene are permissive, whilemore » those from normal littermates are nonpermissive. The host range of polyomavirus pRB-binding mutants is thus determined by expression or lack of expression of functional pRB by the host. These results demonstrate the importance of pRB binding by large T antigen for productive viral infection in primary cells. Failure of pRB-binding mutants to grow well in BMK cells correlates with their failure to induce progression from G{sub 0} or G{sub 1} through the S phase of the cell cycle. Time course studies show delayed synthesis and lower levels of accumulation of large T antigen, viral DNA, and VP1 in mutant compared with wild-type virus-infected BMK cells. These results support a model in which productive infection by polyomavirus in normal mouse cells is tightly coupled to the induction and progression of the cell cycle. 48 refs., 6 figs., 5 tabs.« less

  4. Pathogenic Cx31 is un/misfolded to cause skin abnormality via a Fos/JunB-mediated mechanism.

    PubMed

    Tang, Chengyuan; Chen, Xiang; Chi, Jingwei; Yang, Dawei; Liu, Shu; Liu, Mujun; Pan, Qian; Fan, Jianbing; Wang, Danling; Zhang, Zhuohua

    2015-11-01

    Mutations in connexin-31 (Cx31) are associated with multiple human diseases, including familial erythrokeratodermia variabilis (EKV). The pathogenic mechanism of EKV-associated Cx31 mutants remains largely elusive. Here, we show that EKV-pathogenic Cx31 mutants are un/misfolded and temperature sensitive. In Drosophila, expression of pathogenic Cx31, but not wild-type Cx31, causes depigmentation and degeneration of ommatidia that are rescued by expression of either dBip or dHsp70. Ectopic expression of Cx31 in mouse skin results in skin abnormalities resembling human EKV. The affected tissues show remarkable disrupted gap junction formation and significant upregulation of chaperones Bip and Hsp70 as well as AP-1 proteins c-Fos and JunB, in addition to molecular signatures of skin diseases. Consistently, c-Fos, JunB, Bip and Hsp70 are strikingly higher in keratinocytes of EKV patients than their matched control individuals. Furthermore, a druggable AP-1 inhibitory small molecule suppresses skin phenotype and pathological abnormalities of transgenic Cx31 mice. The study suggests that Cx31 mutant proteins are un/misfolded to cause EKV likely via an AP-1-mediated mechanism and identifies a small molecule with therapeutic potential of the disease. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. Type I human T cell leukemia virus tax protein transforms rat fibroblasts through the cyclic adenosine monophosphate response element binding protein/activating transcription factor pathway.

    PubMed Central

    Smith, M R; Greene, W C

    1991-01-01

    The Tax oncoprotein of the type I human T cell leukemia virus (HTLV-I) activates transcription of cellular and viral genes through at least two different transcription factor pathways. Tax activates transcription of the c-fos proto-oncogene by a mechanism that appears to involve members of the cAMP response element binding protein (CREB) and activating transcription factor (ATF) family of DNA-binding proteins. Tax also induces the nuclear expression of the NF-kappa B family of rel oncogene-related enhancer-binding proteins. We have investigated the potential role of these CREB/ATF and NF-kappa B/Rel transcription factors in Tax-mediated transformation by analyzing the oncogenic potential of Tax mutants that functionally segregate these two pathways of transactivation. Rat fibroblasts (Rat2) stably expressing either the wild-type Tax protein or a Tax mutant selectively deficient in the ability to induce NF-kappa B/Rel demonstrated marked changes in morphology and growth characteristics including the ability to form tumors in athymic mice. In contrast, Rat2 cells stably expressing a Tax mutant selectively deficient in the ability to activate transcription through CREB/ATF demonstrated no detectable changes in morphology or growth characteristics. These results suggest that transcriptional activation through the CREB/ATF pathway may play an important role in Tax-mediated cellular transformation. Images PMID:1832173

  6. Leucine-Rich Repeat Kinase 2 interacts with Parkin, DJ-1 and PINK-1 in a Drosophila melanogaster model of Parkinson's disease.

    PubMed

    Venderova, Katerina; Kabbach, Ghassan; Abdel-Messih, Elizabeth; Zhang, Yi; Parks, Robin J; Imai, Yuzuru; Gehrke, Stephan; Ngsee, Johnny; Lavoie, Matthew J; Slack, Ruth S; Rao, Yong; Zhang, Zhuohua; Lu, Bingwei; Haque, M Emdadul; Park, David S

    2009-11-15

    Mutations in the LRRK2 gene are the most common genetic cause of familial Parkinson's disease (PD). However, its physiological and pathological functions are unknown. Therefore, we generated several independent Drosophila lines carrying WT or mutant human LRRK2 (mutations in kinase, COR or LRR domains, resp.). Ectopic expression of WT or mutant LRRK2 in dopaminergic neurons caused their significant loss accompanied by complex age-dependent changes in locomotor activity. Overall, the ubiquitous expression of LRRK2 increased lifespan and fertility of the flies. However, these flies were more sensitive to rotenone. LRRK2 expression in the eye exacerbated retinal degeneration. Importantly, in double transgenic flies, various indices of the eye and dopaminergic survival were modified in a complex fashion by a concomitant expression of PINK1, DJ-1 or Parkin. This evidence suggests a genetic interaction between these PD-relevant genes.

  7. Human hepatocytes apoptosis induced by replication of hepatitis B virus subgenotypes F1b and F4: Role of basal core promoter and preCore mutations.

    PubMed

    Elizalde, María Mercedes; Sevic, Ina; González López Ledesma, María Mora; Campos, Rodolfo Héctor; Barbini, Luciana; Flichman, Diego Martin

    2018-01-01

    In the context of pathogenesis of HBV infection, HBV genotypes and mutants have been shown to affect the natural course of chronic infection and treatment outcomes. In this work, we studied the induction of apoptosis by the replication of HBV subgenotypes F1b and F4, and the naturally occurring mutants BCP and preCore. Both subgenotypes F1b and F4 HBV genome transfections induced cell death by apoptosis in human hepatocytes. The BCPdm (A1762T/G1764A) and preCore (G1896A) mutants induced higher levels of apoptosis than the wt virus. This increase in apoptosis was not associated with the enhanced viral replication of the variants. HBV-mediated apoptosis was independent of viral subgenotypes, and associated with the modulation of members of the regulatory Bcl-2 family proteins expression in the mitochondrial apoptotic pathway. Finally, the apoptosis induction increase observed for the preCore mutants suggests that HBeAg might have an anti-apoptotic effect in human hepatocytes. Copyright © 2017 Elsevier Inc. All rights reserved.

  8. Expression of recombinant CD59 with an N-terminal peptide epitope facilitates analysis of residues contributing to its complement-inhibitory function.

    PubMed

    Zhou, Q; Zhao, J; Hüsler, T; Sims, P J

    1996-10-01

    CD59 is a plasma membrane-anchored glycoprotein that serves to protect human cells from lysis by the C5b-9 complex of complement. The immunodominant epitopes of CD59 are known to be sensitive to disruption of native tertiary structure, complicating immunological measurement of expressed mutant constructs for structure function analysis. In order to quantify cell-surface expression of wild-type and mutant forms of this complement inhibitor, independent of CD59 antigen, an 11-residue peptide (TAG) recognized by monoclonal antibody (mAb) 9E10 was inserted before the N-terminal codon (L1) of mature CD59, in a pcDNA3 expression plasmid. SV-T2 cells were transfected with this plasmid, yielding cell lines expressing 0 to > 10(5) CD59/cell. The TAG-CD59 fusion protein was confirmed to be GPI-anchored, N-glycosylated and showed identical complement-inhibitory function to wild-type CD59, lacking the TAG peptide sequence. Using this construct, the contribution of each of four surface-localized aromatic residues (4Y, 47F, 61Y, and 62Y) to CD59's complement-inhibitory function was examined. These assays revealed normal surface expression with complete loss of complement-inhibitory function in the 4Y --> S, 47F --> G and 61Y --> S mutants. By contrast, 62Y --> S mutants retained approximately 40% of function of wild-type CD59. These studies confirmed the utility of the TAG-CD59 construct for quantifying CD59 surface expression and activity, and implicate surface aromatic residues 4Y, 47F, 61Y and 62Y as essential to maintenance of CD59's normal complement-regulatory function.

  9. A herpes simplex virus 2 glycoprotein D mutant generated by bacterial artificial chromosome mutagenesis is severely impaired for infecting neuronal cells and infects only Vero cells expressing exogenous HVEM.

    PubMed

    Wang, Kening; Kappel, Justin D; Canders, Caleb; Davila, Wilmer F; Sayre, Dean; Chavez, Mayra; Pesnicak, Lesley; Cohen, Jeffrey I

    2012-12-01

    We constructed a herpes simplex virus 2 (HSV-2) bacterial artificial chromosome (BAC) clone, bHSV2-BAC38, which contains full-length HSV-2 inserted into a BAC vector. Unlike previously reported HSV-2 BAC clones, the virus genome inserted into this BAC clone has no known gene disruptions. Virus derived from the BAC clone had a wild-type phenotype for growth in vitro and for acute infection, latency, and reactivation in mice. HVEM, expressed on epithelial cells and lymphocytes, and nectin-1, expressed on neurons and epithelial cells, are the two principal receptors used by HSV to enter cells. We used the HSV-2 BAC clone to construct an HSV-2 glycoprotein D mutant (HSV2-gD27) with point mutations in amino acids 215, 222, and 223, which are critical for the interaction of gD with nectin-1. HSV2-gD27 infected cells expressing HVEM, including a human epithelial cell line. However, the virus lost the ability to infect cells expressing only nectin-1, including neuronal cell lines, and did not infect ganglia in mice. Surprisingly, we found that HSV2-gD27 could not infect Vero cells unless we transduced the cells with a retrovirus expressing HVEM. High-level expression of HVEM in Vero cells also resulted in increased syncytia and enhanced cell-to-cell spread in cells infected with wild-type HSV-2. The inability of the HSV2-gD27 mutant to infect neuronal cells in vitro or sensory ganglia in mice after intramuscular inoculation suggests that this HSV-2 mutant might be an attractive candidate for a live attenuated HSV-2 vaccine.

  10. A Herpes Simplex Virus 2 Glycoprotein D Mutant Generated by Bacterial Artificial Chromosome Mutagenesis Is Severely Impaired for Infecting Neuronal Cells and Infects Only Vero Cells Expressing Exogenous HVEM

    PubMed Central

    Kappel, Justin D.; Canders, Caleb; Davila, Wilmer F.; Sayre, Dean; Chavez, Mayra; Pesnicak, Lesley; Cohen, Jeffrey I.

    2012-01-01

    We constructed a herpes simplex virus 2 (HSV-2) bacterial artificial chromosome (BAC) clone, bHSV2-BAC38, which contains full-length HSV-2 inserted into a BAC vector. Unlike previously reported HSV-2 BAC clones, the virus genome inserted into this BAC clone has no known gene disruptions. Virus derived from the BAC clone had a wild-type phenotype for growth in vitro and for acute infection, latency, and reactivation in mice. HVEM, expressed on epithelial cells and lymphocytes, and nectin-1, expressed on neurons and epithelial cells, are the two principal receptors used by HSV to enter cells. We used the HSV-2 BAC clone to construct an HSV-2 glycoprotein D mutant (HSV2-gD27) with point mutations in amino acids 215, 222, and 223, which are critical for the interaction of gD with nectin-1. HSV2-gD27 infected cells expressing HVEM, including a human epithelial cell line. However, the virus lost the ability to infect cells expressing only nectin-1, including neuronal cell lines, and did not infect ganglia in mice. Surprisingly, we found that HSV2-gD27 could not infect Vero cells unless we transduced the cells with a retrovirus expressing HVEM. High-level expression of HVEM in Vero cells also resulted in increased syncytia and enhanced cell-to-cell spread in cells infected with wild-type HSV-2. The inability of the HSV2-gD27 mutant to infect neuronal cells in vitro or sensory ganglia in mice after intramuscular inoculation suggests that this HSV-2 mutant might be an attractive candidate for a live attenuated HSV-2 vaccine. PMID:22993162

  11. Contributions of arginines-43 and -94 of human choriogonadotropin. beta. to receptor binding and activation as determined by oligonucleotide-based mutagenesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fang Chen; Puett, D.

    1991-10-22

    Members of the glycoprotein hormone family contain a common {alpha} subunit and a hormone-specific {beta} subunit. Human choriogonadotropin (hCG) {beta} is a 145 amino acid residue protein glycosylated at 6 positions (2 N-linked and 4 O-linked oligosaccharides). In an effort to elucidate receptor determinants on hCG{beta}, the authors have used site-directed mutagenesis to prepare and express several mutant cDNAs with replacements at arginines-43 and -94. Arg-43 is invariant in all known mammalian CG/lutropin {beta} amino acid sequences, and Arg-94 is conserved in 10 of the 12 sequences. Moreover, various studies involving synthetic peptides and enzymatic digestions of intact {beta} chainsmore » suggest that these residues may be important in hCG receptor binding. Point mutants were made in which these two arginines were replaced with the corresponding residues in human follitropin {beta}, Leu-43 and Asp-94. The wild-type and mutant {beta} chains were expressed in CHO cells containing a stably integrated gene for bovine {alpha}, and heterodimer formation occurred. These heterologous gonadotropins were active in assays using transformed Leydig cells, competitive binding with standard {sup 125}I-hCG, and cAMP and progesterone production, but the potency was considerably less than that associated with the hCG{beta} wild-type-containing gonadotropin. The double-mutant protein Arg-43 to Leu/Arg-94 to Asp also associated with bovine {alpha}, but the resultant heterodimer exhibited only low activity. Replacement but the Lys-43-containing {beta} chain appeared to exhibit a low degree of subunit association or reduced stability relative to the expressed hCG{beta} wild type. These results demonstrate that arginines-43 and -94 contribute to receptor binding through a positive charge.« less

  12. Activation of Stat1 by mutant fibroblast growth-factor receptor in thanatophoric dysplasia type II dwarfism.

    PubMed

    Su, W C; Kitagawa, M; Xue, N; Xie, B; Garofalo, S; Cho, J; Deng, C; Horton, W A; Fu, X Y

    1997-03-20

    The achondroplasia class of chondrodysplasias comprises the most common genetic forms of dwarfism in humans and includes achondroplasia, hypochondroplasia and thanatophoric dysplasia types I and II (TDI and TDII), which are caused by different mutations in a fibroblast growth-factor receptor FGFR3 (ref. 1). The molecular mechanism and the mediators of these FGFR3-related growth abnormalities are not known. Here we show that mutant TDII FGFR3 has a constitutive tyrosine kinase activity which can specifically activate the transcription factor Stat1 (for signal transducer and activator of transcription). Furthermore, expression of TDII FGFR3 induced nuclear translocation of Stat1, expression of the cell-cycle inhibitor p21(WAF1/CIP1), and growth arrest of the cell. Thus, TDII FGFR3 may use Stat1 as a mediator of growth retardation in bone development. Consistent with this, Stat1 activation and increased p21(WAF1/CIP1) expression was found in the cartilage cells from the TDII fetus, but not in those from the normal fetus. Thus, abnormal STAT activation and p21(WAF1/CIP1) expression by the TDII mutant receptor may be responsible for this FGFR3-related bone disease.

  13. Whole-exome sequencing in a single proband reveals a mutation in the CHST8 gene in autosomal recessive peeling skin syndrome

    PubMed Central

    Cabral, Rita M.; Kurban, Mazen; Wajid, Muhammad; Shimomura, Yutaka; Petukhova, Lynn; Christiano, Angela M.

    2015-01-01

    Generalized peeling skin syndrome (PSS) is an autosomal recessive genodermatosis characterized by lifelong, continuous shedding of the upper epidermis. Using whole-genome homozygozity mapping and whole-exome sequencing, we identified a novel homozygous missense mutation (c.229C>T, R77W) within the CHST8 gene, in a large consanguineous family with non-inflammatory PSS type A. CHST8 encodes a Golgi transmembrane N-acetylgalactosamine-4-O-sulfotransferase (GalNAc4-ST1), which we show by immunofluorescence staining to be expressed throughout normal epidermis. A colorimetric assay for total sulfated glycosaminoglycan (GAG) quantification, comparing human keratinocytes (CCD1106 KERTr) expressing wild type and mutant recombinant GalNAc4-ST1, revealed decreased levels of total sulfated GAGs in cells expressing mutant GalNAc4-ST1, suggesting loss of function. Western blotting revealed lower expression levels of mutant recombinant GalNAc4-ST1 compared to wild type, suggesting that accelerated degradation may result in loss of function, leading to PSS type A. This is the first report describing a mutation as the cause of PSS type A. PMID:22289416

  14. Whole-exome sequencing in a single proband reveals a mutation in the CHST8 gene in autosomal recessive peeling skin syndrome.

    PubMed

    Cabral, Rita M; Kurban, Mazen; Wajid, Muhammad; Shimomura, Yutaka; Petukhova, Lynn; Christiano, Angela M

    2012-04-01

    Generalized peeling skin syndrome (PSS) is an autosomal recessive genodermatosis characterized by lifelong, continuous shedding of the upper epidermis. Using whole-genome homozygozity mapping and whole-exome sequencing, we identified a novel homozygous missense mutation (c.229C>T, R77W) within the CHST8 gene, in a large consanguineous family with non-inflammatory PSS type A. CHST8 encodes a Golgi transmembrane N-acetylgalactosamine-4-O-sulfotransferase (GalNAc4-ST1), which we show by immunofluorescence staining to be expressed throughout normal epidermis. A colorimetric assay for total sulfated glycosaminoglycan (GAG) quantification, comparing human keratinocytes (CCD1106 KERTr) expressing wild type and mutant recombinant GalNAc4-ST1, revealed decreased levels of total sulfated GAGs in cells expressing mutant GalNAc4-ST1, suggesting loss of function. Western blotting revealed lower expression levels of mutant recombinant GalNAc4-ST1 compared to wild type, suggesting that accelerated degradation may result in loss of function, leading to PSS type A. This is the first report describing a mutation as the cause of PSS type A. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Establishment of an immortalized cell line derived from the prairie vole via lentivirus-mediated transduction of mutant cyclin-dependent kinase 4, cyclin D, and telomerase reverse transcriptase

    PubMed Central

    Katayama, Masafumi; Kiyono, Tohru; Horie, Kengo; Hirayama, Takashi; Eitsuka, Takahiro; Kuroda, Kengo; Donai, Kenichiro; Hidema, Shizu; Nishimori, Katsuhiko; Fukuda, Tomokazu

    2015-01-01

    The prairie vole (Microtus ochrogaster) shows social behaviors such as monogamy and parenting of infants with pair bonding. These social behaviors are specific to the prairie vole and have not been observed in other types of voles, such as mountain voles. Although the prairie vole has several unique characteristics, an in vitro cell culture system has not been established for this species. Furthermore, establishment of cultured cells derived from the prairie vole may be beneficial based on the three Rs (i.e., Replacement, Reduction, and Refinement) concept. Therefore, in this study, we attempted to establish an immortalized cell line derived from the prairie vole. Our previous research has shown that transduction with mutant forms of cyclin-dependent kinase 4 (CDK4), cyclin D, and telomerase reverse transcriptase (TERT) could efficiently immortalize cells from multiple species, including humans, cattle, pigs, and monkeys. Here, we introduced these three genes into prairie vole-derived muscle fibroblasts. The expression of mutant CDK4 and cyclin D proteins was confirmed by western blotting, and telomerase activity was detected in immortalized vole muscle-derived fibroblasts (VMF-K4DT cells or VMFs) by stretch PCR. Population doubling analysis showed that the introduction of mutant CDK4, cyclin D, and TERT extended the lifespan of VMFs. To the best of our knowledge, this is the first report describing the establishment of an immortalized cell line derived from the prairie vole through the expression of mutant CDK4, cyclin D, and human TERT. PMID:26496927

  16. Establishment of an immortalized cell line derived from the prairie vole via lentivirus-mediated transduction of mutant cyclin-dependent kinase 4, cyclin D, and telomerase reverse transcriptase.

    PubMed

    Katayama, Masafumi; Kiyono, Tohru; Horie, Kengo; Hirayama, Takashi; Eitsuka, Takahiro; Kuroda, Kengo; Donai, Kenichiro; Hidema, Shizu; Nishimori, Katsuhiko; Fukuda, Tomokazu

    2016-01-01

    The prairie vole (Microtus ochrogaster) shows social behaviors such as monogamy and parenting of infants with pair bonding. These social behaviors are specific to the prairie vole and have not been observed in other types of voles, such as mountain voles. Although the prairie vole has several unique characteristics, an in vitro cell culture system has not been established for this species. Furthermore, establishment of cultured cells derived from the prairie vole may be beneficial based on the three Rs (i.e., Replacement, Reduction, and Refinement) concept. Therefore, in this study, we attempted to establish an immortalized cell line derived from the prairie vole. Our previous research has shown that transduction with mutant forms of cyclin-dependent kinase 4 (CDK4), cyclin D, and telomerase reverse transcriptase (TERT) could efficiently immortalize cells from multiple species, including humans, cattle, pigs, and monkeys. Here, we introduced these three genes into prairie vole-derived muscle fibroblasts. The expression of mutant CDK4 and cyclin D proteins was confirmed by western blotting, and telomerase activity was detected in immortalized vole muscle-derived fibroblasts (VMF-K4DT cells or VMFs) by stretch PCR. Population doubling analysis showed that the introduction of mutant CDK4, cyclin D, and TERT extended the lifespan of VMFs. To the best of our knowledge, this is the first report describing the establishment of an immortalized cell line derived from the prairie vole through the expression of mutant CDK4, cyclin D, and human TERT.

  17. Metabolic pathway profiling of mitochondrial respiratory chain mutants in C. elegans

    PubMed Central

    MJ, Falk; Z, Zhang; Rosenjack; Nissim; E, Daikhin; Nissim; MM, Sedensky; M, Yudkoff; PG, Morgan

    2008-01-01

    C. elegans affords a model of primary mitochondrial dysfunction that provides insight into cellular adaptations which accompany mutations in nuclear gene that encode mitochondrial proteins. To this end, we characterized genome-wide expression profiles of C. elegans strains with mutations in nuclear-encoded subunits of respiratory chain complexes. Our goal was to detect concordant changes among clusters of genes that comprise defined metabolic pathways. Results indicate that respiratory chain mutants significantly upregulate a variety of basic cellular metabolic pathways involved in carbohydrate, amino acid, and fatty acid metabolism, as well as cellular defense pathways such as the metabolism of P450 and glutathione. To further confirm and extend expression analysis findings, quantitation of whole worm free amino acid levels was performed in C. elegans mitochondrial mutants for subunits of complexes I, II, and III. Significant differences were seen for 13 of 16 amino acid levels in complex I mutants compared with controls, as well as overarching similarities among profiles of complex I, II, and III mutants compared with controls. The specific pattern of amino acid alterations observed provides novel evidence to suggest that an increase in glutamate-linked transamination reactions caused by the failure of NAD+ dependent oxidation of ketoacids occurs in primary mitochondrial respiratory chain mutants. Recognition of consistent alterations among patterns of nuclear gene expression for multiple biochemical pathways and in quantitative amino acid profiles in a translational genetic model of mitochondrial dysfunction allows insight into the complex pathogenesis underlying primary mitochondrial disease. Such knowledge may enable the development of a metabolomic profiling diagnostic tool applicable to human mitochondrial disease. PMID:18178500

  18. Genetic Correction of SOD1 Mutant iPSCs Reveals ERK and JNK Activated AP1 as a Driver of Neurodegeneration in Amyotrophic Lateral Sclerosis.

    PubMed

    Bhinge, Akshay; Namboori, Seema C; Zhang, Xiaoyu; VanDongen, Antonius M J; Stanton, Lawrence W

    2017-04-11

    Although mutations in several genes with diverse functions have been known to cause amyotrophic lateral sclerosis (ALS), it is unknown to what extent causal mutations impinge on common pathways that drive motor neuron (MN)-specific neurodegeneration. In this study, we combined induced pluripotent stem cells-based disease modeling with genome engineering and deep RNA sequencing to identify pathways dysregulated by mutant SOD1 in human MNs. Gene expression profiling and pathway analysis followed by pharmacological screening identified activated ERK and JNK signaling as key drivers of neurodegeneration in mutant SOD1 MNs. The AP1 complex member JUN, an ERK/JNK downstream target, was observed to be highly expressed in MNs compared with non-MNs, providing a mechanistic insight into the specific degeneration of MNs. Importantly, investigations of mutant FUS MNs identified activated p38 and ERK, indicating that network perturbations induced by ALS-causing mutations converge partly on a few specific pathways that are drug responsive and provide immense therapeutic potential. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  19. Characterization of a spontaneous avirulent mutant of Legionella pneumophila Serogroup 6: evidence of DotA and flagellin involvement in the loss of virulence.

    PubMed

    Scaturro, Maria; Meschini, Stefania; Arancia, Giuseppe; Stefano, Fontana; Ricci, Maria Luisa

    2009-12-01

    The pathogenesis of Legionella pneumophila mainly resides in its ability to inhibit the phagosome-lysosome fusion, which normally prevents the killing of the host cells. In order to characterize the molecular alterations that occurred in a spontaneous avirulent mutant of Legionella pneumophila serogroup 6, named Vir-, we investigated the ability of the mutant to adhere to and multiply in the WI26VA4 alveolar epithelial cell line and in human macrophages, when compared to its parental strain, Vir+. We also determined the colocalization of bacteria with LAMP-1 to gain an insight into the phagosome-lysosome fusion process. Additionally, we determined the flagellin expression and dotA nucleotide sequencing. We observed a lack of expression of flagellin and an in-frame mutation in the dotA. gene. The data obtained strongly suggest the loss of virulence of the mutant could probably be due to the absence of flagellin and the dysfunctional type IV secretion System, resulting from the DotA protein being severely compromised.

  20. Dysregulated human Tyrosyl-DNA phosphodiesterase I acts as cellular toxin

    PubMed Central

    Cuya, Selma M.; Comeaux, Evan Q.; Wanzeck, Keith; Yoon, Karina J.; van Waardenburg, Robert C.A.M.

    2016-01-01

    Tyrosyl-DNA phosphodiesterase I (TDP1) hydrolyzes the drug-stabilized 3’phospho-tyrosyl bond formed between DNA topoisomerase I (TOPO1) and DNA. TDP1-mediated hydrolysis uses a nucleophilic histidine (Hisnuc) and a general acid/base histidine (Hisgab). A Tdp1Hisgab to Arg mutant identified in patients with the autosomal recessive neurodegenerative disease SCAN1 causes stabilization of the TDP1-DNA intermediate. Based on our previously reported Hisgab-substitutions inducing yeast toxicity (Gajewski et al. J. Mol. Biol. 415, 741-758, 2012), we propose that converting TDP1 into a cellular poison by stabilizing the covalent enzyme-DNA intermediate is a novel therapeutic strategy for cancer treatment. Here, we analyzed the toxic effects of two TDP1 catalytic mutants in HEK293 cells. Expression of human Tdp1HisnucAla and Tdp1HisgabAsn mutants results in stabilization of the covalent TDP1-DNA intermediate and induces cytotoxicity. Moreover, these mutants display reduced in vitro catalytic activity compared to wild type. Co-treatment of Tdp1mutant with topotecan shows more than additive cytotoxicity. Overall, these results support the hypothesis that stabilization of the TDP1-DNA covalent intermediate is a potential anti-cancer therapeutic strategy. PMID:27893431

  1. A Novel Molecular Targeting of a Tumor-Specific Oncogenic Mutant Receptor in Human Prostate Cancer

    DTIC Science & Technology

    2005-02-01

    in cells and can generate dominant negative mutant (15). Hammerhead ribozymes are self-cleaving RNAs whose catalytic activity has been mapped to a...specific ribozyme targeted at the fusion junction of EGFRvIII. This specific EGFRvIII ribozyme is able to effectively cleave EGFRvIII mRNA under...physiological conditions in a cell-free system. While expressing this EGFRvIII- ribozyme in 32D/EGFRvIII cell, EGFRvIII- ribozyme is capable of down-regulating

  2. Identification and characterization of a HeLa nuclear protein that specifically binds to the trans-activation-response (TAR) element of human immunodeficiency virus.

    PubMed Central

    Marciniak, R A; Garcia-Blanco, M A; Sharp, P A

    1990-01-01

    Human immunodeficiency virus type 1 RNAs contain a sequence, trans-activation-response (TAR) element, which is required for tat protein-mediated trans-activation of viral gene expression. We have identified a nuclear protein from extracts of HeLa cells that binds to the TAR element RNA in a sequence-specific manner. The binding of this 68-kDa polypeptide was detected by UV cross-linking proteins to TAR element RNA transcribed in vitro. Competition experiments were performed by using a partially purified preparation of the protein to quantify the relative binding affinities of TAR element RNA mutants. The binding affinity of the TAR mutants paralleled the reported ability of those mutants to support tat trans-activation in vivo. We propose that this cellular protein moderates TAR activity in vivo. Images PMID:2333305

  3. TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain

    PubMed Central

    Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A.; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

    2014-01-01

    Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology. PMID:24381309

  4. TDP-43 causes differential pathology in neuronal versus glial cells in the mouse brain.

    PubMed

    Yan, Sen; Wang, Chuan-En; Wei, Wenjie; Gaertig, Marta A; Lai, Liangxue; Li, Shihua; Li, Xiao-Jiang

    2014-05-15

    Mutations in TAR DNA-binding protein 43 (TDP-43) are associated with familial forms of amyotrophic lateral sclerosis and frontotemporal lobar degeneration. Although recent studies have revealed that mutant TDP-43 in neuronal and glial cells is toxic, how mutant TDP-43 causes primarily neuronal degeneration in an age-dependent manner remains unclear. Using adeno-associated virus (AAV) that expresses mutant TDP-43 (M337V) ubiquitously, we found that mutant TDP-43 accumulates preferentially in neuronal cells in the postnatal mouse brain. We then ubiquitously or selectively expressed mutant TDP-43 in neuronal and glial cells in the striatum of adult mouse brains via stereotaxic injection of AAV vectors and found that it also preferentially accumulates in neuronal cells. Expression of mutant TDP-43 in neurons in the striatum causes more severe degeneration, earlier death and more robust symptoms in mice than expression of mutant TDP-43 in glial cells; however, aging increases the expression of mutant TDP-43 in glial cells, and expression of mutant TDP-43 in older mice caused earlier onset of phenotypes and more severe neuropathology than that in younger mice. Although expression of mutant TDP-43 in glial cells via stereotaxic injection does not lead to robust neurological phenotypes, systemic inhibition of the proteasome activity via MG132 in postnatal mice could exacerbate glial TDP-43-mediated toxicity and cause mice to die earlier. Consistently, this inhibition increases the expression of mutant TDP-43 in glial cells in mouse brains. Thus, the differential accumulation of mutant TDP-43 in neuronal versus glial cells contributes to the preferential toxicity of mutant TDP-43 in neuronal cells and age-dependent pathology.

  5. Structure prediction and activity analysis of human heme oxygenase-1 and its mutant.

    PubMed

    Xia, Zhen-Wei; Zhou, Wen-Pu; Cui, Wen-Jun; Zhang, Xue-Hong; Shen, Qing-Xiang; Li, Yun-Zhu; Yu, Shan-Chang

    2004-08-15

    To predict wild human heme oxygenase-1 (whHO-1) and hHO-1 His25Ala mutant (delta hHO-1) structures, to clone and express them and analyze their activities. Swiss-PdbViewer and Antheprot 5.0 were used for the prediction of structure diversity and physical-chemical changes between wild and mutant hHO-1. hHO-1 His25Ala mutant cDNA was constructed by site-directed mutagenesis in two plasmids of E. coli DH5alpha. Expression products were purified by ammonium sulphate precipitation and Q-Sepharose Fast Flow column chromatography, and their activities were measured. rHO-1 had the structure of a helical fold with the heme sandwiched between heme-heme oxygenase-1 helices. Bond angle, dihedral angle and chemical bond in the active pocket changed after Ala25 was replaced by His25, but Ala25 was still contacting the surface and the electrostatic potential of the active pocket was negative. The mutated enzyme kept binding activity to heme. Two vectors pBHO-1 and pBHO-1(M) were constructed and expressed. Ammonium sulphate precipitation and column chromatography yielded 3.6-fold and 30-fold higher purities of whHO-1, respectively. The activity of delta hHO-1 was reduced 91.21% after mutation compared with whHO-1. Proximal His25 ligand is crucial for normal hHO-1 catalytic activity. delta hHO-1 is deactivated by mutation but keeps the same binding site as whHO-1. delta hHO-1 might be a potential inhibitor of whHO-1 for preventing neonatal hyperbilirubinemia.

  6. Structure prediction and activity analysis of human heme oxygenase-1 and its mutant

    PubMed Central

    Xia, Zhen-Wei; Zhou, Wen-Pu; Cui, Wen-Jun; Zhang, Xue-Hong; Shen, Qing-Xiang; Li, Yun-Zhu; Yu, Shan-Chang

    2004-01-01

    AIM: To predict wild human heme oxygenase-1 (whHO-1) and hHO-1 His25Ala mutant (△hHO-1) structures, to clone and express them and analyze their activities. METHODS: Swiss-PdbViewer and Antheprot 5.0 were used for the prediction of structure diversity and physical-chemical changes between wild and mutant hHO-1. hHO-1 His25Ala mutant cDNA was constructed by site-directed mutagenesis in two plasmids of E. coli DH5α . Expression products were purified by ammonium sulphate precipitation and Q-Sepharose Fast Flow column chromatography, and their activities were measured. RESULTS: rHO-1 had the structure of a helical fold with the heme sandwiched between heme-heme oxygenase-1 helices. Bond angle, dihedral angle and chemical bond in the active pocket changed after Ala25 was replaced by His25, but Ala25 was still contacting the surface and the electrostatic potential of the active pocket was negative. The mutated enzyme kept binding activity to heme. Two vectors pBHO-1 and pBHO-1(M) were constructed and expressed. Ammonium sulphate precipitation and column chromatography yielded 3.6-fold and 30-fold higher purities of whHO-1, respectively. The activity of △hHO-1 was reduced 91.21% after mutation compared with whHO-1. CONCLUSION: Proximal His25 ligand is crucial for normal hHO-1 catalytic activity. △hHO-1 is deactivated by mutation but keeps the same binding site as whHO-1. △hHO-1 might be a potential inhibitor of whHO-1 for preventing neonatal hyperbilirubinemia. PMID:15285018

  7. [Construction and expression of six deletion mutants of human astrovirus C-terminal nsP1a/4 protein].

    PubMed

    Zhao, Wei; Niu, Ke; Zhao, Jian; Jin, Yi-ming; Sui, Ting-ting; Wang, Wen

    2013-09-01

    Human astrovirus (HAstV) is one of the leading causes of actue virual diarrhea in infants. HAstV-induced epithdlial cell apoptosis plays an important role in the pathogenesis of HAstV infection. Our previous study indicated that HAstV non-structural protein nsPla C-terminal protein nsPla/4 was the major apoptosis functional protein and probably contained the main apoptosis domains. In order to screen for astrovirus encoded apoptotic protien, nsPla/4 and six turncated proteins, which possessed nsPla/4 protein different function domain ,were cloned into green fluorescent protein (GFP) vector pEG-FP-N3. After 24-72 h transfection, the fusion protein expression in BHK21 cells, was analysis by fluorescence microscope and Western blot. The results indicated seven fusion proteins were observed successfully in BHK21 cell after transfected for 24 h. Western blot analysis showed that the level of fusion protein expressed in BHK21 cells was increased significantly at 72h compared to 48h in transfected cells. The successful expression of deletion mutants of nsPla/4 protein was an important foundation to gain further insights into the function of apoptosis domains of nsPla/4 protein and it would also provide research platform to further confirm the molecule pathogenic mechanism of human astrovirus.

  8. [Studies on fermentation conditions and purification of mutant human interleukin-2 expressed in Pichia pastoris].

    PubMed

    Liu, Yan; Su, Chang; Hu, Ying-He; Ouyang, Ke-Qing; Cai, Shao-Xi

    2005-05-01

    Interleukin-2 (IL-2) was initially isolated as a T cell growth factor and had been shown to direct the expansion and differentiation of several hematopoietic cell types. Clinical studies using IL-2 in the treatment of AIDS have been encouraging, due to its critical role as a proliferative signal for activated T-lymphocytes. IL-2 has also undergone trials in the treatment of several types of cancer, based on its stimulation of cytotoxic, antitumor cells. Today, human IL-2 is produced completely by genetically engineered method, and it has been proved that genetically engineered recombinant human IL-2 has almost the same function and clinical effect as wild IL-2. In the former study, recombinant human IL-2 usually comes from E. coli, in this paper the mutant IL-2 was successfully expressed and purified in Pichia pastoris for the first time. As a eukaryote, Pichia pastoris has many of the advantages of higher eukaryotic expression systems such as protein processing, protein folding, and posttranslational modification, while being as easy to manipulate as E. coli or Saccharomyces cerevisiae. It is faster, easier, and less expensive to use than other eukaryotic expression systems such as baculovirus or mammalian tissue culture, and generally gives higher expression level. Expression conditions of human mutant interleukin-2(the codon for cysteine-125 of human IL-2 with alanine; the codon for leucine-18 with methionine; the codon for leucine-19 with serine) in the recombinant Pichia pastoris strain were optimized via test of some factors such as the rate of aeration, the inductive duration, the initial pH and the concentration of methanol. The results from tests showed that the most important parameter for efficient expression of interleukin-2 in recombinant Pichia pastoris strain is adequate aeration during methanol induction, and the optimum inductive condition for interleukin-2 expression was: more than 80% aeration, 2 days for induction, the initial pH of 6.0, the final methanol concentration of 1.0%. With this condition, the expressed IL-2 was secreted into fermentation broth and reached a yield of 30%, approximately 200 mg/L. Expressed interleutin-2 (MvIL-2) was isolated and purified by centrifugation, millipore filtration to concentration, Econo-PacS strongly acidic cation exchanger cartridge and molecular sieve chromatography and the yield of MvIL-2 was 27%. MvIL-2 was purified to electrophoretic purity by SDS-PAGE and only one peak being loaded on HPLC. Purified MvIL-2 protein had stimulating activity similar to the wild type of IL-2 as assayed by IL-2-dependent CTLL-2 cells. However, the stability of MvIL-2 was superior than that of IL-2 at different temperatures. The activity of obtained MvIL-2 was 4 - 5 times of the wild type of IL-2, So MvIL-2 had an advantage over wild type of rhIL-2 in storage stability and activity.

  9. Different mechanisms of radiation-induced loss of heterozygosity in two human lymphoid cell lines from a single donor

    NASA Technical Reports Server (NTRS)

    Wiese, C.; Gauny, S. S.; Liu, W. C.; Cherbonnel-Lasserre, C. L.; Kronenberg, A.

    2001-01-01

    Allelic loss is an important mutational mechanism in human carcinogenesis. Loss of heterozygosity (LOH) at an autosomal locus is one outcome of the repair of DNA double-strand breaks (DSBs) and can occur by deletion or by mitotic recombination. We report that mitotic recombination between homologous chromosomes occurred in human lymphoid cells exposed to densely ionizing radiation. We used cells derived from the same donor that express either normal TP53 (TK6 cells) or homozygous mutant TP53 (WTK1 cells) to assess the influence of TP53 on radiation-induced mutagenesis. Expression of mutant TP53 (Met 237 Ile) was associated with a small increase in mutation frequencies at the hemizygous HPRT (hypoxanthine phosphoribosyl transferase) locus, but the mutation spectra were unaffected at this locus. In contrast, WTK1 cells (mutant TP53) were 30-fold more susceptible than TK6 cells (wild-type TP53) to radiation-induced mutagenesis at the TK1 (thymidine kinase) locus. Gene dosage analysis combined with microsatellite marker analysis showed that the increase in TK1 mutagenesis in WTK1 cells could be attributed, in part, to mitotic recombination. The microsatellite marker analysis over a 64-cM region on chromosome 17q indicated that the recombinational events could initiate at different positions between the TK1 locus and the centromere. Virtually all of the recombinational LOH events extended beyond the TK1 locus to the most telomeric marker. In general, longer LOH tracts were observed in mutants from WTK1 cells than in mutants from TK6 cells. Taken together, the results demonstrate that the incidence of radi-ation-induced mutations is dependent on the genetic background of the cell at risk, on the locus examined, and on the mechanisms for mutation available at the locus of interest.

  10. Absence of cell surface expression of human ACE leads to perinatal death

    PubMed Central

    Michaud, Annie; Acharya, K. Ravi; Masuyer, Geoffrey; Quenech'du, Nicole; Gribouval, Olivier; Morinière, Vincent; Gubler, Marie-Claire; Corvol, Pierre

    2014-01-01

    Renal tubular dysgenesis (RTD) is a recessive autosomal disease characterized most often by perinatal death. It is due to the inactivation of any of the major genes of the renin-angiotensin system (RAS), one of which is the angiotensin I-converting enzyme (ACE). ACE is present as a tissue-bound enzyme and circulates in plasma after its solubilization. In this report, we present the effect of different ACE mutations associated with RTD on ACE intracellular trafficking, secretion and enzymatic activity. One truncated mutant, R762X, responsible for neonatal death was found to be an enzymatically active, secreted form, not inserted in the plasma membrane. In contrast, another mutant, R1180P, was compatible with life after transient neonatal renal insufficiency. This mutant was located at the plasma membrane and rapidly secreted. These results highlight the importance of tissue-bound ACE versus circulating ACE and show that the total absence of cell surface expression of ACE is incompatible with life. In addition, two missense mutants (W594R and R828H) and two truncated mutants (Q1136X and G1145AX) were also studied. These mutants were neither inserted in the plasma membrane nor secreted. Finally, the structural implications of these ACE mutations were examined by molecular modelling, which suggested some important structural alterations such as disruption of intra-molecular non-covalent interactions (e.g. salt bridges). PMID:24163131

  11. Knockdown of Oncogenic KRAS in Non-Small Cell Lung Cancers Suppresses Tumor Growth and Sensitizes Tumor Cells to Targeted Therapy

    PubMed Central

    Sunaga, Noriaki; Shames, David S.; Girard, Luc; Peyton, Michael; Larsen, Jill E.; Imai, Hisao; Soh, Junichi; Sato, Mitsuo; Yanagitani, Noriko; Kaira, Kyoichi; Xie, Yang; Gazdar, Adi F.; Mori, Masatomo; Minna, John D.

    2011-01-01

    Oncogenic KRAS is found in >25% of lung adenocarcinomas, the major histologic subtype of non-small cell lung cancer (NSCLC), and is an important target for drug development. To this end, we generated four NSCLC lines with stable knockdown selective for oncogenic KRAS. As expected, stable knockdown of oncogenic KRAS led to inhibition of in vitro and in vivo tumor growth in the KRAS mutant NSCLC cells, but not in NSCLC cells that have wild-type KRAS (but mutant NRAS). Surprisingly, we did not see large-scale induction of cell death and the growth inhibitory effect was not complete. To further understand the ability of NSCLCs to grow despite selective removal of mutant KRAS expression, we performed microarray expression profiling of NSCLC cell lines with or without mutant KRAS knockdown and isogenic human bronchial epithelial cell lines (HBECs) with and without oncogenic KRAS. We found that while the MAPK pathway is significantly down-regulated after mutant KRAS knockdown, these NSCLCs showed increased levels of phospho-STAT3 and phospho-EGFR, and variable changes in phospho-Akt. In addition, mutant KRAS knockdown sensitized the NSCLCs to p38 and EGFR inhibitors. Our findings suggest that targeting oncogenic KRAS by itself will not be sufficient treatment but may offer possibilities of combining anti-KRAS strategies with other targeted drugs. PMID:21306997

  12. Effect of microculture on cell metabolism and biochemistry: do cells get stressed in microchannels?

    PubMed

    Su, Xiaojing; Theberge, Ashleigh B; January, Craig T; Beebe, David J

    2013-02-05

    Microfluidics is emerging as a promising platform for cell culture, enabling increased microenvironment control and potential for integrated analysis compared to conventional macroculture systems such as well plates and Petri dishes. To advance the use of microfluidic devices for cell culture, it is necessary to better understand how miniaturization affects cell behavior. In particular, microfluidic devices have significantly higher surface-area-to-volume ratios than conventional platforms, resulting in lower volumes of media per cell, which can lead to cell stress. We investigated cell stress under a variety of culture conditions using three cell lines: parental HEK (human embryonic kidney) cells and transfected HEK cells that stably express wild-type (WT) and mutant (G601S) human ether-a-go-go related gene (hERG) potassium channel protein. These three cell lines provide a unique model system through which to study cell-type-specific responses in microculture because mutant hERG is known to be sensitive to environmental conditions, making its expression a particularly sensitive readout through which to compare macro- and microculture. While expression of WT-hERG was similar in microchannel and well culture, the expression of mutant G601S-hERG was reduced in microchannels. Expression of the endoplasmic reticulum (ER) stress marker immunoglobulin binding protein (BiP) was upregulated in all three cell lines in microculture. Using BiP expression, glucose consumption, and lactate accumulation as readouts we developed methods for reducing ER stress including properly increasing the frequency of media replacement, reducing cell seeding density, and adjusting the serum concentration and buffering capacity of culture medium. Indeed, increasing the buffering capacity of culture medium or frequency of media replacement partially restored the expression of the G601S-hERG in microculture. This work illuminates how biochemical properties of cells differ in macro- and microculture and suggests strategies that can be used to modify cell culture protocols for future studies involving miniaturized culture platforms.

  13. Reconstituting development of pancreatic intraepithelial neoplasia from primary human pancreas duct cells

    PubMed Central

    Lee, Jonghyeob; Snyder, Emily R.; Liu, Yinghua; Gu, Xueying; Wang, Jing; Flowers, Brittany M.; Kim, Yoo Jung; Park, Sangbin; Szot, Gregory L.; Hruban, Ralph H.; Longacre, Teri A.; Kim, Seung K.

    2017-01-01

    Development of systems that reconstitute hallmark features of human pancreatic intraepithelial neoplasia (PanINs), the precursor to pancreatic ductal adenocarcinoma, could generate new strategies for early diagnosis and intervention. However, human cell-based PanIN models with defined mutations are unavailable. Here, we report that genetic modification of primary human pancreatic cells leads to development of lesions resembling native human PanINs. Primary human pancreas duct cells harbouring oncogenic KRAS and induced mutations in CDKN2A, SMAD4 and TP53 expand in vitro as epithelial spheres. After pancreatic transplantation, mutant clones form lesions histologically similar to native PanINs, including prominent stromal responses. Gene expression profiling reveals molecular similarities of mutant clones with native PanINs, and identifies potential PanIN biomarker candidates including Neuromedin U, a circulating peptide hormone. Prospective reconstitution of human PanIN development from primary cells provides experimental opportunities to investigate pancreas cancer development, progression and early-stage detection. PMID:28272465

  14. Mutants in the mouse NuRD/Mi2 component P66alpha are embryonic lethal.

    PubMed

    Marino, Susan; Nusse, Roel

    2007-06-13

    The NuRD/Mi2 chromatin complex is involved in histone modifications and contains a large number of subunits, including the p66 protein. There are two mouse and human p66 paralogs, p66alpha and p66beta. The functions of these genes are not clear, in part because there are no mutants available, except in invertebrate model systems. We made loss of function mutants in the mouse p66alpha gene (mp66alpha, official name Gatad2a, MGI:2384585). We found that mp66alpha is essential for development, as mutant embryos die around day 10 of embryogenesis. The gene is not required for normal blastocyst development or for implantation. The phenotype of mutant embryos and the pattern of gene expression in mutants are consistent with a role of mp66alpha in gene silencing. mp66alpha is an essential gene, required for early mouse development. The lethal phenotype supports a role in execution of methylated DNA silencing.

  15. Spatial and temporal localization during embryonic and fetal human development of the transcription factor SIM2 in brain regions altered in Down syndrome.

    PubMed

    Rachidi, Mohammed; Lopes, Carmela; Charron, Giselle; Delezoide, Anne-Lise; Paly, Evelyne; Bloch, Bernard; Delabar, Jean-Maurice

    2005-08-01

    Human SIM2 is the ortholog of Drosophila single-minded (sim), a master regulator of neurogenesis and transcriptional factor controlling midline cell fate determination. We previously localized SIM2 in a chromosome 21 critical region for Down syndrome (DS). Here, we studied SIM2 gene using a new approach to provide insights in understanding of its potential role in human development. For the first time, we showed SIM2 spatial and temporal expression pattern during human central nervous system (CNS) development, from embryonic to fetal stages. Additional investigations were performed using a new optic microscopy technology to compare signal intensity and cell density [M. Rachidi, C. Lopes, S. Gassanova, P.M. Sinet, M. Vekemans, T. Attie, A.L. Delezoide, J.M. Delabar, Regional and cellular specificity of the expression of TPRD, the tetratricopeptide Down syndrome gene, during human embryonic development, Mech. Dev. 93 (2000) 189--193]. In embryonic stages, SIM2 was identified predominantly in restricted regions of CNS, in ventral part of D1/D2 diencephalic neuroepithelium, along the neural tube and in a few cell subsets of dorsal root ganglia. In fetal stages, SIM2 showed differential expression in pyramidal and granular cell layers of hippocampal formation, in cortical cells and in cerebellar external granular and Purkinje cell layers. SIM2 expression in embryonic and fetal brain could suggest a potential role in human CNS development, in agreement with Drosophila and mouse Sim mutant phenotypes and with the conservation of the Sim function in CNS development from Drosophila to Human. SIM2 expression in human fetal brain regions, which correspond to key structures for cognitive processes, correlates well with the behavioral phenotypes of Drosophila Sim mutants and transgenic mice overexpressing Sim2. In addition, SIM2-expressing brain regions correspond to the altered structures in DS patients. All together, these findings suggest a potential role of SIM2 in CNS development and indicate that SIM2 overexpression could participate to the pathogenesis of mental retardation in Down syndrome patients.

  16. The archetypal R90C CADASIL-NOTCH3 mutation retains NOTCH3 function in vivo.

    PubMed

    Monet, Marie; Domenga, Valérie; Lemaire, Barbara; Souilhol, Céline; Langa, Francina; Babinet, Charles; Gridley, Thomas; Tournier-Lasserve, Elisabeth; Cohen-Tannoudji, Michel; Joutel, Anne

    2007-04-15

    Cerebral Autosomal Dominant Arteriopathy with Subcortical infarcts and Leukoencephalopathy (CADASIL) is the most prominent known cause of inherited stroke and vascular dementia in human adult. The disease gene, NOTCH3, encodes a transmembrane receptor primarily expressed in arterial smooth muscle cells (SMC). Pathogenic mutations lead to an odd number of cysteine residues within the NOTCH3 extracellular domain (NOTCH3(ECD)), and are associated with progressive accumulation of NOTCH3(ECD) at the SMC plasma membrane. The murine homolog, Notch3, is dispensable for viability but required post-natally for the elaboration and maintenance of arteries. How CADASIL-associated mutations impact NOTCH3 function remains a fundamental, yet unresolved issue. Particularly, whether NOTCH3(ECD) accumulation may titrate the ligand and inhibit the normal pathway is unknown. Herein, using genetic analyses in the mouse, we assessed the functional significance of an archetypal CADASIL-associated mutation (R90C), in vivo, in brain arteries. We show that transgenic mouse lines expressing either the wild-type human NOTCH3 or the mutant R90C human NOTCH3, at comparable and physiological levels, can rescue the arterial defects of Notch3-/- mice to similar degrees. In vivo assessment of NOTCH3/RBP-Jk activity provides evidence that the mutant NOTCH3 protein exhibits normal level of activity in brain arteries. Remarkably, the mutant NOTCH3 protein remains functional and does not exhibit dominant negative interfering activity, even when NOTCH3(ECD) accumulates. Collectively, these data suggest a model that invokes novel pathogenic roles for the mutant NOTCH3 protein rather than compromised NOTCH3 function as the primary determinant of the CADASIL arteriopathy.

  17. Functional Rescue of a Misfolded Drosophila melanogaster Dopamine Transporter Mutant Associated with a Sleepless Phenotype by Pharmacological Chaperones.

    PubMed

    Kasture, Ameya; El-Kasaby, Ali; Szöllősi, Daniel; Asjad, H M Mazhar; Grimm, Alexandra; Stockner, Thomas; Hummel, Thomas; Freissmuth, Michael; Sucic, Sonja

    2016-09-30

    Folding-defective mutants of the human dopamine transporter (DAT) cause a syndrome of infantile dystonia/parkinsonism. Here, we provide a proof-of-principle that the folding deficit is amenable to correction in vivo by two means, the cognate DAT ligand noribogaine and the HSP70 inhibitor, pifithrin-μ. We examined the Drosophila melanogaster (d) mutant dDAT-G108Q, which leads to a sleepless phenotype in flies harboring this mutation. Molecular dynamics simulations suggested an unstable structure of dDAT-G108Q consistent with a folding defect. This conjecture was verified; heterologously expressed dDAT-G108Q and the human (h) equivalent hDAT-G140Q were retained in the endoplasmic reticulum in a complex with endogenous folding sensors (calnexin and HSP70-1A). Incubation of the cells with noribogaine (a DAT ligand selective for the inward-facing state) and/or pifithrin-μ (an HSP70 inhibitor) restored folding of, and hence dopamine transport by, dDAT-G108Q and hDAT-G140Q. The mutated versions of DAT were confined to the cell bodies of the dopaminergic neurons in the fly brain and failed to reach the axonal compartments. Axonal delivery was restored, and sleep time was increased to normal length (from 300 to 1000 min/day) if the dDAT-G108Q-expressing flies were treated with noribogaine and/or pifithrin-μ. Rescuing misfolded versions of DAT by pharmacochaperoning is of therapeutic interest; it may provide opportunities to remedy disorders arising from folding-defective mutants of human DAT and of other related SLC6 transporters. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Functional Rescue of a Misfolded Drosophila melanogaster Dopamine Transporter Mutant Associated with a Sleepless Phenotype by Pharmacological Chaperones*♦

    PubMed Central

    Kasture, Ameya; El-Kasaby, Ali; Szöllősi, Daniel; Asjad, H. M. Mazhar; Grimm, Alexandra; Stockner, Thomas; Hummel, Thomas; Freissmuth, Michael; Sucic, Sonja

    2016-01-01

    Folding-defective mutants of the human dopamine transporter (DAT) cause a syndrome of infantile dystonia/parkinsonism. Here, we provide a proof-of-principle that the folding deficit is amenable to correction in vivo by two means, the cognate DAT ligand noribogaine and the HSP70 inhibitor, pifithrin-μ. We examined the Drosophila melanogaster (d) mutant dDAT-G108Q, which leads to a sleepless phenotype in flies harboring this mutation. Molecular dynamics simulations suggested an unstable structure of dDAT-G108Q consistent with a folding defect. This conjecture was verified; heterologously expressed dDAT-G108Q and the human (h) equivalent hDAT-G140Q were retained in the endoplasmic reticulum in a complex with endogenous folding sensors (calnexin and HSP70-1A). Incubation of the cells with noribogaine (a DAT ligand selective for the inward-facing state) and/or pifithrin-μ (an HSP70 inhibitor) restored folding of, and hence dopamine transport by, dDAT-G108Q and hDAT-G140Q. The mutated versions of DAT were confined to the cell bodies of the dopaminergic neurons in the fly brain and failed to reach the axonal compartments. Axonal delivery was restored, and sleep time was increased to normal length (from 300 to 1000 min/day) if the dDAT-G108Q-expressing flies were treated with noribogaine and/or pifithrin-μ. Rescuing misfolded versions of DAT by pharmacochaperoning is of therapeutic interest; it may provide opportunities to remedy disorders arising from folding-defective mutants of human DAT and of other related SLC6 transporters. PMID:27481941

  19. Bcl-2 Blocks a Caspase-Dependent Pathway of Apoptosis Activated by Herpes Simplex Virus 1 Infection in HEp-2 Cells

    PubMed Central

    Galvan, Veronica; Brandimarti, Renato; Munger, Joshua; Roizman, Bernard

    2000-01-01

    Earlier reports have shown that herpes simplex virus 1 (HSV-1) mutants induce programmed cell death and that wild-type virus blocks the execution of the cell death program triggered by expression of viral genes, by the Fas and tumor necrosis factor pathways, or by nonspecific stress agents. In particular, an earlier report from this laboratory showed that the mutant virus d120 lacking the genes encoding infected cell protein 4 (ICP4), the major regulatory protein of the virus, induces a caspase-3-independent pathway of apoptosis in human SK-N-SH cells. Here we report that the pathway of apoptosis induced by the d120 mutant in human HEp-2 cells is caspase dependent. Specifically, in HEp-2 cells infected with d120, (i) a broad-range inhibitor of caspase activity, z-vad-FMK, efficiently blocked DNA fragmentation, (ii) cytochrome c was released into the cytoplasm, (iii) caspase-3 was activated inasmuch as poly(ADP-ribose) polymerase was cleaved, and (iv) chromatin condensation and fragmentation of cellular DNA were observed. In parallel studies, HEp-2 cells were transfected with a plasmid encoding human Bcl-2 and a clone (VAX-3) expressing high levels of Bcl-2 was selected. This report shows that Bcl-2 blocked all of the manifestations associated with programmed cell death caused by infection with the d120 mutant. Consistent with their resistance to programmed cell death, VAX-3 cells overproduced infected cell protein 0 (ICP0). An unexpected observation was that ICP0 encoded by the d120 mutant accumulated late in infection in small, quasi-uniform vesicle-like structures in all cell lines tested. Immunofluorescence-based colocalization studies indicated that these structures were not mitochondria or components of the endoplasmic reticulum or the late endosomal compartment. These studies affirm the conclusion that HSV can induce programmed cell death at multiple steps in the course of its replication, that the d120 mutant can induce both caspase-dependent and -independent pathways of programmed cell death, and that virus-induced stimuli of programmed cell death may differ with respect to the pathway that they activate. PMID:10644366

  20. Native Mutant Huntingtin in Human Brain

    PubMed Central

    Sapp, Ellen; Valencia, Antonio; Li, Xueyi; Aronin, Neil; Kegel, Kimberly B.; Vonsattel, Jean-Paul; Young, Anne B.; Wexler, Nancy; DiFiglia, Marian

    2012-01-01

    Huntington disease (HD) is caused by polyglutamine expansion in the N terminus of huntingtin (htt). Analysis of human postmortem brain lysates by SDS-PAGE and Western blot reveals htt as full-length and fragmented. Here we used Blue Native PAGE (BNP) and Western blots to study native htt in human postmortem brain. Antisera against htt detected a single band broadly migrating at 575–850 kDa in control brain and at 650–885 kDa in heterozygous and Venezuelan homozygous HD brains. Anti-polyglutamine antisera detected full-length mutant htt in HD brain. There was little htt cleavage even if lysates were pretreated with trypsin, indicating a property of native htt to resist protease cleavage. A soluble mutant htt fragment of about 180 kDa was detected with anti-htt antibody Ab1 (htt-(1–17)) and increased when lysates were treated with denaturants (SDS, 8 m urea, DTT, or trypsin) before BNP. Wild-type htt was more resistant to denaturants. Based on migration of in vitro translated htt fragments, the 180-kDa segment terminated ≈htt 670–880 amino acids. If second dimension SDS-PAGE followed BNP, the 180-kDa mutant htt was absent, and 43–50 kDa htt fragments appeared. Brain lysates from two HD mouse models expressed native full-length htt; a mutant fragment formed if lysates were pretreated with 8 m urea + DTT. Native full-length mutant htt in embryonic HD140Q/140Q mouse primary neurons was intact during cell death and when cell lysates were exposed to denaturants before BNP. Thus, native mutant htt occurs in brain and primary neurons as a soluble full-length monomer. PMID:22375012

  1. Chromosomal mutations and chromosome loss measured in a new human-hamster hybrid cell line, ALC: studies with colcemid, ultraviolet irradiation, and 137Cs gamma-rays

    NASA Technical Reports Server (NTRS)

    Kraemer, S. M.; Waldren, C. A.; Chatterjee, A. (Principal Investigator)

    1997-01-01

    Small mutations, megabase deletions, and aneuploidy are involved in carcinogenesis and genetic defects, so it is important to be able to quantify these mutations and understand mechanisms of their creation. We have previously quantified a spectrum of mutations, including megabase deletions, in human chromosome 11, the sole human chromosome in a hamster-human hybrid cell line AL. S1- mutants have lost expression of a human cell surface antigen, S1, which is encoded by the M1C1 gene at 11p13 so that mutants can be detected via a complement-mediated cytotoxicity assay in which S1+ cells are killed and S1- cells survive. But loss of genes located on the tip of the short arm of 11 (11p15.5) is lethal to the AL hybrid, so that mutants that have lost the entire chromosome 11 die and escape detection. To circumvent this, we fused AL with Chinese hamster ovary (CHO) cells to produce a new hybrid, ALC, in which the requirement for maintaining 11p15.5 is relieved, allowing us to detect mutations events involving loss of 11p15.5. We evaluated the usefulness of this hybrid by conducting mutagenesis studies with colcemid, 137Cs gamma-radiation and UV 254 nm light. Colcemid induced 1000 more S1- mutants per unit dose in ALC than in AL; the increase for UV 254 nm light was only two-fold; and the increase for 137Cs gamma-rays was 12-fold. The increase in S1- mutant fraction in ALC cells treated with colcemid and 137Cs gamma-rays were largely due to chromosome loss and 11p deletions often containing a breakpoint within the centromeric region.

  2. The SaeRS Two-Component System Controls Survival of Staphylococcus aureus in Human Blood through Regulation of Coagulase

    PubMed Central

    Guo, Haiyong; Hall, Jeffrey W.; Yang, Junshu; Ji, Yinduo

    2017-01-01

    The SaeRS two-component system plays important roles in regulation of key virulence factors and pathogenicity. In this study, however, we found that the deletion mutation of saeRS enhanced bacterial survival in human blood, whereas complementation of the mutant with SaeRS returned survival to wild-type levels. Moreover, these phenomena were observed in different MRSA genetic background isolates, including HA-MRSA WCUH29, CA-MRSA 923, and MW2. To elucidate which gene(s) regulated by SaeRS contribute to the effect, we conducted a series of complementation studies with selected known SaeRS target genes in trans. We found coagulase complementation abolished the enhanced survival of the SaeRS mutant in human blood. The coa and saeRS deletion mutants exhibited a similar survival phenotype in blood. Intriguingly, heterologous expression of coagulase decreased survival of S. epidermidis in human blood. Further, the addition of recombinant coagulase to blood significantly decreased the survival of S. aureus. Further, analysis revealed staphylococcal resistance to killing by hydrogen peroxide was partially dependent on the presence or absence of coagulase. Furthermore, complementation with coagulase, but not SaeRS, returned saeRS/coa double mutant survival in blood to wild-type levels. These data indicate SaeRS modulates bacterial survival in blood in coagulase-dependent manner. Our results provide new insights into the role of staphylococcal SaeRS and coagulase on bacterial survival in human blood. PMID:28611950

  3. The role played by the group A streptococcal negative regulator Nra on bacterial interactions with epithelial cells.

    PubMed

    Molinari, G; Rohde, M; Talay, S R; Chhatwal, G S; Beckert, S; Podbielski, A

    2001-04-01

    Group A streptococci (GAS) specifically attach to and internalize into human epithelial host cells. In some GAS isolates, fibronectin-binding proteins were identified as being responsible for these virulence traits. In the present study, the previously identified global negative regulator Nra was shown to control the binding of soluble fibronectin probably via regulation of protein F2 and/or SfbII expression in the serotype M49 strain 591. According to results from a conventional invasion assay based on the recovery of viable intracellular bacteria, the increased fibronectin binding did not affect bacterial adherence to HEp-2 epithelial cells, but was associated with a reduction in the internalization rates. However, when examined by confocal and electron microscopy techniques, the nra-mutant bacteria were shown to exhibit higher adherence and internalization rates than the corresponding wild type. The mutant bacteria escaped from the phagocytic vacuoles much faster, promoting consistent morphological changes which resulted in severe host cell damage. The apoptotic and lytic processes observed in nra-mutant infected host cells were correlated with an increased expression of the genes encoding superantigen SpeA, the cysteine protease SpeB, and streptolysin S in the nra-mutant bacteria. Adherence and internalization rates of a nra/speB-double mutant at wild-type levels indicated that the altered speB expression in the nra mutant contributed to the observed changes in both processes. The Nra-dependent effects on bacterial virulence were confined to infections carried out with stationary growth phase bacteria. In conclusion, the obtained results demonstrated that the global GAS regulator Nra modulates virulence genes, which are involved in host cell damage. Thus, by helping to achieve a critical balance of virulence factor expression that avoids the injury of target cells, Nra may facilitate GAS persistence in a safe intracellular niche.

  4. Phosphorylation on Ser-279 and Ser-282 of connexin43 regulates endocytosis and gap junction assembly in pancreatic cancer cells

    PubMed Central

    Johnson, Kristen E.; Mitra, Shalini; Katoch, Parul; Kelsey, Linda S.; Johnson, Keith R.; Mehta, Parmender P.

    2013-01-01

    The molecular mechanisms regulating the assembly of connexins (Cxs) into gap junctions are poorly understood. Using human pancreatic tumor cell lines BxPC3 and Capan-1, which express Cx26 and Cx43, we show that, upon arrival at the cell surface, the assembly of Cx43 is impaired. Connexin43 fails to assemble, because it is internalized by clathrin-mediated endocytosis. Assembly is restored upon expressing a sorting-motif mutant of Cx43, which does not interact with the AP2 complex, and by expressing mutants that cannot be phosphorylated on Ser-279 and Ser-282. The mutants restore assembly by preventing clathrin-mediated endocytosis of Cx43. Our results also document that the sorting-motif mutant is assembled into gap junctions in cells in which the expression of endogenous Cx43 has been knocked down. Remarkably, Cx43 mutants that cannot be phosphorylated on Ser-279 or Ser-282 are assembled into gap junctions only when connexons are composed of Cx43 forms that can be phosphorylated on these serines and forms in which phosphorylation on these serines is abolished. Based on the subcellular fate of Cx43 in single and contacting cells, our results document that the endocytic itinerary of Cx43 is altered upon cell–cell contact, which causes Cx43 to traffic by EEA1-negative endosomes en route to lysosomes. Our results further show that gap-junctional plaques formed of a sorting motif–deficient mutant of Cx43, which is unable to be internalized by the clathrin-mediated pathway, are predominantly endocytosed in the form of annular junctions. Thus the differential phosphorylation of Cx43 on Ser-279 and Ser-282 is fine-tuned to control Cx43’s endocytosis and assembly into gap junctions. PMID:23363606

  5. Inactivation of NMB0419, Encoding a Sel1-Like Repeat (SLR) Protein, in Neisseria meningitidis Is Associated with Differential Expression of Genes Belonging to the Fur Regulon and Reduced Intraepithelial Replication

    PubMed Central

    Li, Ming-Shi

    2017-01-01

    ABSTRACT Neisseria meningitidis is a commensal microbe that colonizes the human nasopharynx but occasionally invades the bloodstream to cause life-threatening infection. N. meningitidis MC58 NMB0419 encodes a Sel1-like repeat (SLR)-containing protein, previously implicated in invasion of epithelial cells. A gene-regulatory function was revealed in Escherichia coli expressing plasmid-borne NMB0419 and showing significantly increased epithelial adherence compared to the wild type, due to increased expression of mannose-sensitive type 1 pili. While a meningococcal NMB0419 mutant did not have altered epithelial adherence, in a transcriptome-wide comparison of the wild type and an NMB0419 mutant, a large proportion of genes differentially regulated in the mutant were involved in iron acquisition and metabolism. Fifty-one percent and 38% of genes, respectively, up- and downregulated in the NMB0419 mutant had previously been identified as being induced and repressed by meningococcal Fur. An in vitro growth defect of the NMB0419 mutant under iron restriction was consistent with the downregulation of tbpAB and hmbR, while an intraepithelial replication defect was consistent with the downregulation of tonB, exbB, and exbD, based on a known phenotype of a meningococcal tonB mutant. Disruption of the N-terminal NMB0419 signal peptide, predicted to export the protein beyond the cytoplasmic membrane, resulted in loss of functional traits in N. meningitidis and E. coli. Our study indicates that the expression of NMB0419 is associated with transcriptional changes counterbalancing the regulatory function of Fur, offering a new perspective on regulatory mechanisms involved in meningococcal interaction with epithelial cells, and suggests new insights into the roles of SLR-containing genes in other bacteria. PMID:28264906

  6. Functional analysis of potassium channels in Kv7.2 G271V mutant causing early onset familial epilepsy.

    PubMed

    Wang, Juanjuan; Li, Yuan; Hui, Zhiyan; Cao, Min; Shi, Ruiming; Zhang, Wei; Geng, Limeng; Zhou, Xihui

    2015-08-07

    Kv7 (KCNQ) channels underlying a class of voltage-gated K+ current are best known for regulating neuronal excitability. The first glycine (G) residue in the pore helix of Kv7.2 (KCNQ2) subunit is highly conserved among different classes of Kv7 channel family. A missense mutation causing the replacement of the corresponding G residues with a valine (p.G271V) in Kv7.2 was found in a large, four-generation pedigree. Here, we set out to examine the molecular pathomechanism of G271V mutants using patch clamp technology combined with biochemical and immunocytochemical techniques in transiently transfected human embryonic kidney (HEK) 293 cells. The expression of Kv7.2 protein had the same intensity for both wild type (WT) and G271V. In transfected HEK cells, G271V mutants induced large depolarizing shifts of the conductance-voltage relationships and marked slowing of current activation kinetics compared to WT. In addition, G271V mutants abolished currents in homomeric channels, and resulted in about 50% reduction of current in Kv7.2/G271V/Kv7.3 heteromultimeric condition, indicating a more severe functional defect. To test for G271V mutant channel expression in surface membrane, we performed fluorescence confocal microscopy imaging, which revealed no differences between the mutant and WT, suggesting that G271V channels fail to open in response to depolarization even though they are present in the membrane. Furthermore, pharmacologic intervention experiments revealed that upon specific incubation of transfected HEK 293 cells expressing G271V heteromultimeric channels in presence of Kv7 channel enhancer retigabine (ezogabine), the potassium currents increased significantly, suggesting the potential of retigabine as gene-specific therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. [6]-Gingerol Induces Cell Cycle Arrest and Cell Death of Mutant p53-expressing Pancreatic Cancer Cells

    PubMed Central

    Park, Yon Jung; Wen, Jing; Bang, Seungmin; Park, Seung Woo

    2006-01-01

    [6]-Gingerol, a major phenolic compound derived from ginger, has anti-bacterial, anti-inflammatory and anti-tumor activities. While several molecular mechanisms have been described to underlie its effects on cells in vitro and in vivo, the underlying mechanisms by which [6]-gingerol exerts anti-tumorigenic effects are largely unknown. The purpose of this study was to investigate the action of [6]-gingerol on two human pancreatic cancer cell lines, HPAC expressing wild-type (wt) p53 and BxPC-3 expressing mutated p53. We found that [6]-gingerol inhibited the cell growth through cell cycle arrest at G1 phase in both cell lines. Western blot analyses indicated that [6]-gingerol decreased both Cyclin A and Cyclin-dependent kinase (Cdk) expression. These events led to reduction in Rb phosphorylation followed by blocking of S phase entry. p53 expression was decreased by [6]-gingerol treatment in both cell lines suggesting that the induction of Cyclin-dependent kinase inhibitor, p21cip1, was p53-independent. [6]-Gingerol induced mostly apoptotic death in the mutant p53-expressing cells, while no signs of early apoptosis were detected in wild type p53-expressing cells and this was related to the increased phosphorylation of AKT. These results suggest that [6]-gingerol can circumvent the resistance of mutant p53-expressing cells towards chemotherapy by inducing apoptotic cell death while it exerts cytostatic effect on wild type p53-expressing cells by inducing temporal growth arrest. PMID:17066513

  8. Yeast Cells Expressing the Human Mitochondrial DNA Polymerase Reveal Correlations between Polymerase Fidelity and Human Disease Progression*

    PubMed Central

    Qian, Yufeng; Kachroo, Aashiq H.; Yellman, Christopher M.; Marcotte, Edward M.; Johnson, Kenneth A.

    2014-01-01

    Mutations in the human mitochondrial polymerase (polymerase-γ (Pol-γ)) are associated with various mitochondrial disorders, including mitochondrial DNA (mtDNA) depletion syndrome, Alpers syndrome, and progressive external opthamalplegia. To correlate biochemically quantifiable defects resulting from point mutations in Pol-γ with their physiological consequences, we created “humanized” yeast, replacing the yeast mtDNA polymerase (MIP1) with human Pol-γ. Despite differences in the replication and repair mechanism, we show that the human polymerase efficiently complements the yeast mip1 knockouts, suggesting common fundamental mechanisms of replication and conserved interactions between the human polymerase and other components of the replisome. We also examined the effects of four disease-related point mutations (S305R, H932Y, Y951N, and Y955C) and an exonuclease-deficient mutant (D198A/E200A). In haploid cells, each mutant results in rapid mtDNA depletion, increased mutation frequency, and mitochondrial dysfunction. Mutation frequencies measured in vivo equal those measured with purified enzyme in vitro. In heterozygous diploid cells, wild-type Pol-γ suppresses mutation-associated growth defects, but continuous growth eventually leads to aerobic respiration defects, reduced mtDNA content, and depolarized mitochondrial membranes. The severity of the Pol-γ mutant phenotype in heterozygous diploid humanized yeast correlates with the approximate age of disease onset and the severity of symptoms observed in humans. PMID:24398692

  9. Fragile X mental retardation protein has a unique, evolutionarily conserved neuronal function not shared with FXR1P or FXR2P

    PubMed Central

    Coffee, R. Lane; Tessier, Charles R.; Woodruff, Elvin A.; Broadie, Kendal

    2010-01-01

    SUMMARY Fragile X syndrome (FXS), resulting solely from the loss of function of the human fragile X mental retardation 1 (hFMR1) gene, is the most common heritable cause of mental retardation and autism disorders, with syndromic defects also in non-neuronal tissues. In addition, the human genome encodes two closely related hFMR1 paralogs: hFXR1 and hFXR2. The Drosophila genome, by contrast, encodes a single dFMR1 gene with close sequence homology to all three human genes. Drosophila that lack the dFMR1 gene (dfmr1 null mutants) recapitulate FXS-associated molecular, cellular and behavioral phenotypes, suggesting that FMR1 function has been conserved, albeit with specific functions possibly sub-served by the expanded human gene family. To test evolutionary conservation, we used tissue-targeted transgenic expression of all three human genes in the Drosophila disease model to investigate function at (1) molecular, (2) neuronal and (3) non-neuronal levels. In neurons, dfmr1 null mutants exhibit elevated protein levels that alter the central brain and neuromuscular junction (NMJ) synaptic architecture, including an increase in synapse area, branching and bouton numbers. Importantly, hFMR1 can, comparably to dFMR1, fully rescue both the molecular and cellular defects in neurons, whereas hFXR1 and hFXR2 provide absolutely no rescue. For non-neuronal requirements, we assayed male fecundity and testes function. dfmr1 null mutants are effectively sterile owing to disruption of the 9+2 microtubule organization in the sperm tail. Importantly, all three human genes fully and equally rescue mutant fecundity and spermatogenesis defects. These results indicate that FMR1 gene function is evolutionarily conserved in neural mechanisms and cannot be compensated by either FXR1 or FXR2, but that all three proteins can substitute for each other in non-neuronal requirements. We conclude that FMR1 has a neural-specific function that is distinct from its paralogs, and that the unique FMR1 function is responsible for regulating neuronal protein expression and synaptic connectivity. PMID:20442204

  10. Impact of cysteine variants on the structure, activity, and stability of recombinant human α-galactosidase A

    PubMed Central

    Qiu, Huawei; Honey, Denise M; Kingsbury, Jonathan S; Park, Anna; Boudanova, Ekaterina; Wei, Ronnie R; Pan, Clark Q; Edmunds, Tim

    2015-01-01

    Recombinant human α-galactosidase A (rhαGal) is a homodimeric glycoprotein deficient in Fabry disease, a lysosomal storage disorder. In this study, each cysteine residue in rhαGal was replaced with serine to understand the role each cysteine plays in the enzyme structure, function, and stability. Conditioned media from transfected HEK293 cells were assayed for rhαGal expression and enzymatic activity. Activity was only detected in the wild type control and in mutants substituting the free cysteine residues (C90S, C174S, and the C90S/C174S). Cysteine-to-serine substitutions at the other sites lead to the loss of expression and/or activity, consistent with their involvement in the disulfide bonds found in the crystal structure. Purification and further characterization confirmed that the C90S, C174S, and the C90S/C174S mutants are enzymatically active, structurally intact and thermodynamically stable as measured by circular dichroism and thermal denaturation. The purified inactive C142S mutant appeared to have lost part of its alpha-helix secondary structure and had a lower apparent melting temperature. Saturation mutagenesis study on Cys90 and Cys174 resulted in partial loss of activity for Cys174 mutants but multiple mutants at Cys90 with up to 87% higher enzymatic activity (C90T) compared to wild type, suggesting that the two free cysteines play differential roles and that the activity of the enzyme can be modulated by side chain interactions of the free Cys residues. These results enhanced our understanding of rhαGal structure and function, particularly the critical roles that cysteines play in structure, stability, and enzymatic activity. PMID:26044846

  11. Select human cancer mutants of NRMT1 alter its catalytic activity and decrease N-terminal trimethylation.

    PubMed

    Shields, Kaitlyn M; Tooley, John G; Petkowski, Janusz J; Wilkey, Daniel W; Garbett, Nichola C; Merchant, Michael L; Cheng, Alan; Schaner Tooley, Christine E

    2017-08-01

    A subset of B-cell lymphoma patients have dominant mutations in the histone H3 lysine 27 (H3K27) methyltransferase EZH2, which change it from a monomethylase to a trimethylase. These mutations occur in aromatic resides surrounding the active site and increase growth and alter transcription. We study the N-terminal trimethylase NRMT1 and the N-terminal monomethylase NRMT2. They are 50% identical, but differ in key aromatic residues in their active site. Given how these residues affect EZH2 activity, we tested whether they are responsible for the distinct catalytic activities of NRMT1/2. Additionally, NRMT1 acts as a tumor suppressor in breast cancer cells. Its loss promotes oncogenic phenotypes but sensitizes cells to DNA damage. Mutations of NRMT1 naturally occur in human cancers, and we tested a select group for altered activity. While directed mutation of the aromatic residues had minimal catalytic effect, NRMT1 mutants N209I (endometrial cancer) and P211S (lung cancer) displayed decreased trimethylase and increased monomethylase/dimethylase activity. Both mutations are located in the peptide-binding channel and indicate a second structural region impacting enzyme specificity. The NRMT1 mutants demonstrated a slower rate of trimethylation and a requirement for higher substrate concentration. Expression of the mutants in wild type NRMT backgrounds showed no change in N-terminal methylation levels or growth rates, demonstrating they are not acting as dominant negatives. Expression of the mutants in cells lacking endogenous NRMT1 resulted in minimal accumulation of N-terminal trimethylation, indicating homozygosity could help drive oncogenesis or serve as a marker for sensitivity to DNA damaging chemotherapeutics or γ-irradiation. © 2017 The Protein Society.

  12. Staphylococcus aureus CymR Is a New Thiol-based Oxidation-sensing Regulator of Stress Resistance and Oxidative Response

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ji, Quanjiang; Zhang, Liang; Sun, Fei

    As a human pathogen, Staphylococcus aureus must cope with oxidative stress generated by the human immune system. Here, we report that CymR utilizes its sole Cys-25 to sense oxidative stress. Oxidation followed by thiolation of this cysteine residue leads to dissociation of CymR from its cognate promoter DNA. In contrast, the DNA binding of the CymRC25S mutant was insensitive to oxidation and thiolation, suggesting that CymR senses oxidative stress through oxidation of its sole cysteine to form a mixed disulfide with low molecular weight thiols. The determined crystal structures of the reduced and oxidized forms of CymR revealed that Cys-25more » is oxidized to Cys-25-SOH in the presence of H{sub 2}O{sub 2}. Deletion of cymR reduced the resistance of S. aureus to oxidative stresses, and the resistance was restored by expressing a C25S mutant copy of cymR. In a C25S substitution mutant, the expression of two genes, tcyP and mccB, was constitutively repressed and did not respond to hydrogen peroxide stress, whereas the expression of the genes were highly induced under oxidative stress in a wild-type strain, indicating the critical role of Cys-25 in redox signaling in vivo. Thus, CymR is another master regulator that senses oxidative stress and connects stress responses to virulence regulation in S. aureus.« less

  13. Identification of Critical Residues Involved in Ligand Binding and G Protein Signaling in Human Somatostatin Receptor Subtype 2

    PubMed Central

    Parry, Jesse J.; Chen, Ronald; Andrews, Rebecca; Lears, Kimberly A.

    2012-01-01

    G protein signaling through human somatostatin receptor subtype 2 (SSTR2) is well known, but the amino acids involved in stimulation of intracellular responses upon ligand binding have not been characterized. We constructed a series of point mutants in SSTR2 at amino acid positions 89, 139, and 140 in attempts to disrupt G protein signaling upon ligand binding. The aspartic acid changes at position 89 to either Ala, Leu, or Arg generated mutant receptors with varying expression profiles and a complete inability to bind somatostatin-14 (SST). Mutations to Asp 139 and Arg 140 also led to varying expression profiles with some mutants maintaining their affinity for SST. Mutation of Arg 140 to Ala resulted in a mutated receptor that had a Bmax and dissociation constant (Kd) similar to wild-type receptor but was still coupled to the G protein as determined in both a cAMP assay and a calcium-release assay. In contrast, mutation of Asp 139 to Asn resulted in a mutated receptor with Bmax and Kd values that were similar to wild type but was uncoupled from G protein-mediated cAMP signaling, but not calcium release. Thus, we identified mutations in SSTR2 that result in either receptor expression levels that are similar to wild type but is completely ablated for ligand binding or a receptor that maintains affinity for SST and is uncoupled from G protein-mediated cAMP signaling. PMID:22495673

  14. Expression of Haemophilus ducreyi Collagen Binding Outer Membrane Protein NcaA Is Required for Virulence in Swine and Human Challenge Models of Chancroid

    PubMed Central

    Fulcher, Robert A.; Cole, Leah E.; Janowicz, Diane M.; Toffer, Kristen L.; Fortney, Kate R.; Katz, Barry P.; Orndorff, Paul E.; Spinola, Stanley M.; Kawula, Thomas H.

    2006-01-01

    Haemophilus ducreyi, the etiologic agent of the sexually transmitted genital ulcer disease chancroid, has been shown to associate with dermal collagen fibers within infected skin lesions. Here we describe NcaA, a previously uncharacterized outer membrane protein that is important for H. ducreyi collagen binding and host colonization. An H. ducreyi strain lacking the ncaA gene was impaired in adherence to type I collagen but not fibronectin (plasma or cellular form) or heparin. The mutation had no effect on serum resistance or binding to HaCaT keratinocytes or human foreskin fibroblasts in vitro. Escherichia coli expressing H. ducreyi NcaA bound to type I collagen, demonstrating that NcaA is sufficient to confer collagen attachment. The importance of NcaA in H. ducreyi pathogenesis was assessed using both swine and human experimental models of chancroid. In the swine model, 20% of lesions from sites inoculated with the ncaA mutant were culture positive for H. ducreyi 7 days after inoculation, compared to 73% of wild-type-inoculated sites. The average number of CFU recovered from mutant-inoculated lesions was also significantly reduced compared to that recovered from wild-type-inoculated sites at both 2 and 7 days after inoculation. In the human challenge model, 8 of 30 sites inoculated with wild-type H. ducreyi progressed to the pustular stage, compared to 0 of 30 sites inoculated with the ncaA mutant. Together these results demonstrate that the collagen binding protein NcaA is required for H. ducreyi infection. PMID:16622201

  15. Expression of Haemophilus ducreyi collagen binding outer membrane protein NcaA is required for virulence in swine and human challenge models of chancroid.

    PubMed

    Fulcher, Robert A; Cole, Leah E; Janowicz, Diane M; Toffer, Kristen L; Fortney, Kate R; Katz, Barry P; Orndorff, Paul E; Spinola, Stanley M; Kawula, Thomas H

    2006-05-01

    Haemophilus ducreyi, the etiologic agent of the sexually transmitted genital ulcer disease chancroid, has been shown to associate with dermal collagen fibers within infected skin lesions. Here we describe NcaA, a previously uncharacterized outer membrane protein that is important for H. ducreyi collagen binding and host colonization. An H. ducreyi strain lacking the ncaA gene was impaired in adherence to type I collagen but not fibronectin (plasma or cellular form) or heparin. The mutation had no effect on serum resistance or binding to HaCaT keratinocytes or human foreskin fibroblasts in vitro. Escherichia coli expressing H. ducreyi NcaA bound to type I collagen, demonstrating that NcaA is sufficient to confer collagen attachment. The importance of NcaA in H. ducreyi pathogenesis was assessed using both swine and human experimental models of chancroid. In the swine model, 20% of lesions from sites inoculated with the ncaA mutant were culture positive for H. ducreyi 7 days after inoculation, compared to 73% of wild-type-inoculated sites. The average number of CFU recovered from mutant-inoculated lesions was also significantly reduced compared to that recovered from wild-type-inoculated sites at both 2 and 7 days after inoculation. In the human challenge model, 8 of 30 sites inoculated with wild-type H. ducreyi progressed to the pustular stage, compared to 0 of 30 sites inoculated with the ncaA mutant. Together these results demonstrate that the collagen binding protein NcaA is required for H. ducreyi infection.

  16. The myosin chaperone UNC45B is involved in lens development and autosomal dominant juvenile cataract

    PubMed Central

    Hansen, Lars; Comyn, Sophie; Mang, Yuan; Lind-Thomsen, Allan; Myhre, Layne; Jean, Francesca; Eiberg, Hans; Tommerup, Niels; Rosenberg, Thomas; Pilgrim, David

    2014-01-01

    Genome-wide linkage analysis, followed by targeted deep sequencing, in a Danish multigeneration family with juvenile cataract revealed a region of chromosome 17 co-segregating with the disease trait. Affected individuals were heterozygous for two potentially protein-disrupting alleles in this region, in ACACA and UNC45B. As alterations of the UNC45B protein have been shown to affect eye development in model organisms, effort was focused on the heterozygous UNC45B missense mutation. UNC45B encodes a myosin-specific chaperone that, together with the general heat shock protein HSP90, is involved in myosin assembly. The mutation changes p.Arg805 to Trp in the UCS domain, an amino acid that is highly conserved from yeast to human. UNC45B is strongly expressed in the heart and skeletal muscle tissue, but here we show expression in human embryo eye and zebrafish lens. The zebrafish mutant steif, carrying an unc45b nonsense mutation, has smaller eyes than wild-type embryos and shows accumulation of nuclei in the lens. Injection of RNA encoding the human wild-type UNC45B protein into the steif homozygous embryo reduced the nuclei accumulation and injection of human mutant UNC45B cDNA in wild-type embryos resulted in development of a phenotype similar to the steif mutant. The p.Arg805Trp alteration in the mammalian UNC45B gene suggests that developmental cataract may be caused by a defect in non-muscle myosin assembly during maturation of the lens fiber cells. PMID:24549050

  17. The myosin chaperone UNC45B is involved in lens development and autosomal dominant juvenile cataract.

    PubMed

    Hansen, Lars; Comyn, Sophie; Mang, Yuan; Lind-Thomsen, Allan; Myhre, Layne; Jean, Francesca; Eiberg, Hans; Tommerup, Niels; Rosenberg, Thomas; Pilgrim, David

    2014-11-01

    Genome-wide linkage analysis, followed by targeted deep sequencing, in a Danish multigeneration family with juvenile cataract revealed a region of chromosome 17 co-segregating with the disease trait. Affected individuals were heterozygous for two potentially protein-disrupting alleles in this region, in ACACA and UNC45B. As alterations of the UNC45B protein have been shown to affect eye development in model organisms, effort was focused on the heterozygous UNC45B missense mutation. UNC45B encodes a myosin-specific chaperone that, together with the general heat shock protein HSP90, is involved in myosin assembly. The mutation changes p.Arg805 to Trp in the UCS domain, an amino acid that is highly conserved from yeast to human. UNC45B is strongly expressed in the heart and skeletal muscle tissue, but here we show expression in human embryo eye and zebrafish lens. The zebrafish mutant steif, carrying an unc45b nonsense mutation, has smaller eyes than wild-type embryos and shows accumulation of nuclei in the lens. Injection of RNA encoding the human wild-type UNC45B protein into the steif homozygous embryo reduced the nuclei accumulation and injection of human mutant UNC45B cDNA in wild-type embryos resulted in development of a phenotype similar to the steif mutant. The p.Arg805Trp alteration in the mammalian UNC45B gene suggests that developmental cataract may be caused by a defect in non-muscle myosin assembly during maturation of the lens fiber cells.

  18. Human Granuloma In Vitro Model, for TB Dormancy and Resuscitation

    PubMed Central

    Kapoor, Nidhi; Pawar, Santosh; Sirakova, Tatiana D.; Deb, Chirajyoti; Warren, William L.; Kolattukudy, Pappachan E.

    2013-01-01

    Tuberculosis (TB) is responsible for death of nearly two million people in the world annually. Upon infection, Mycobacterium tuberculosis (Mtb) causes formation of granuloma where the pathogen goes into dormant state and can live for decades before resuscitation to develop active disease when the immune system of the host is weakened and/or suppressed. In an attempt to better understand host-pathogen interactions, several groups have been developing in vitro models of human tuberculosis granuloma. However, to date, an in vitro granuloma model in which Mtb goes into dormancy and can subsequently resuscitate under conditions that mimic weakening of the immune system has not been reported. We describe the development of a biomimetic in vitro model of human tuberculosis granuloma using human primary leukocytes, in which the Mtb exhibited characteristics of dormant mycobacteria as demonstrated by (1) loss of acid-fastness, (2) accumulation of lipid bodies (3) development of rifampicin-tolerance and (4) gene expression changes. Further, when these micro granulomas were treated with immunosuppressant anti-tumor necrosis factor-alpha monoclonal antibodies (anti-TNFα mAbs), resuscitation of Mtb was observed as has been found in humans. In this human in vitro granuloma model triacylglycerol synthase 1deletion mutant (Δtgs1) with impaired ability to accumulate triacylglycerides (TG), but not the complemented mutant, could not go into dormancy. Deletion mutant of lipY, with compromised ability to mobilize the stored TG, but not the complemented mutant, was unable to come out of dormancy upon treatment with anti-TNFα mAbs. In conclusion, we have developed an in vitro human tuberculosis granuloma model that largely exhibits functional features of dormancy and resuscitation observed in human tuberculosis. PMID:23308269

  19. Increased phospho-adducin immunoreactivity in a murine model of amyotrophic lateral sclerosis.

    PubMed

    Shan, X; Hu, J H; Cayabyab, F S; Krieger, C

    2005-01-01

    Adducins alpha, beta and gamma are proteins that link spectrin and actin in the regulation of cytoskeletal architecture and are substrates for protein kinase C and other signaling molecules. Previous studies have shown that expressions of phosphorylated adducin (phospho-adducin) and protein kinase C are increased in spinal cord tissue from patients who died with amyotrophic lateral sclerosis, a neurodegenerative disorder of motoneurons and other cells. However, the distribution of phospho-adducin immunoreactivity has not been described in the mammalian spinal cord. We have evaluated the distribution of immunoreactivity to serine/threonine-dependent phospho-adducin at a region corresponding to the myristoylated alanine-rich C kinase substrate-related domain of adducin in spinal cords of mice over-expressing mutant human superoxide dismutase, an animal model of amyotrophic lateral sclerosis, and in control littermates. We find phospho-adducin immunoreactivity in control spinal cord in ependymal cells surrounding the central canal, neurons and astrocytes. Phospho-adducin immunoreactivity is localized to the cell bodies, dendrites and axons of some motoneurons, as well as to astrocytes in the gray and white matter. Spinal cords of mutant human superoxide dismutase mice having motoneuron loss exhibit significantly increased phospho-adducin immunoreactivity in ventral and dorsal horn spinal cord regions, but not in ependyma surrounding the central canal, compared with control animals. Increased phospho-adducin immunoreactivity localizes predominantly to astrocytes and likely increases as a consequence of the astrogliosis that occurs in the mutant human superoxide dismutase mouse with disease progression. These findings demonstrate increased immunoreactivity against phosphorylated adducin at the myristoylated alanine-rich C kinase substrate domain in a murine model of amyotrophic lateral sclerosis. As adducin is a substrate for protein kinase C at the myristoylated alanine-rich C kinase substrate domain, the increased phospho-adducin immunoreactivity is likely a consequence of protein kinase C activation in neurons and astrocytes of the spinal cord and evidence for aberrant phosphorylation events in mutant human superoxide dismutase mice that may affect neuron survival.

  20. Genetic Regulation of Charged Particle Mutagenesis in Human Cells

    NASA Technical Reports Server (NTRS)

    Kronenberg, Amy; Gauny, S.; Cherbonnel-Lasserre, C.; Liu, W.; Wiese, C.

    1999-01-01

    Our studies use a series of syngeneic, and where possible, isogenic human B-lymphoblastoid cell lines to assess the genetic factors that modulate susceptibility apoptosis and their impact on the mutagenic risks of low fluence exposures to 1 GeV Fe ions and 55 MeV protons. These ions are representative of the types of charged particle radiation that are of particular significance for human health in the space radiation environment. The model system employs cell lines derived from the male donor WIL-2. These cells have a single X chromosome and they are hemizygous for one mutation marker, hypoxanthine phosphoribosyltransferase (HPRT). TK6 and WTK1 cells were each derived from descendants of WIL-2 and were each selected as heterozygotes for a second mutation marker, the thymidine kinase (TK) gene located on chromosome 17q. The HPRT and TK loci can detect many different types of mutations, from single basepair substitutions up to large scale loss of heterozygosity (LOH). The single expressing copy of TK in the TK6 and WTKI cell lines is found on the same copy of chromosome 17, and this allele can be identified by a restriction fragment length polymorphism (RFLP) identified when high molecular weight DNA is digested by the SacI restriction endonuclease and hybridized against the cDNA probe for TK. A large series of polymorphic linked markers has been identified that span more than 60 cM of DNA (approx. 60 megabasepairs) and distinguish the copy of chromosome 17 bearing the initially active TK allele from the copy of chromosome 17 bearing the silent TK allele in both TK6 and WTKI cells. TK6 cells express normal p53 protein while WTKI cells express homozygous mutant p53. Expression of mutant p53 can increase susceptibility to x-ray-induced mutations. It's been suggested that the increased mutagenesis in p53 mutant cells might be due to reduced apoptosis.

  1. Functional Mutation of SMAC/DIABLO, Encoding a Mitochondrial Proapoptotic Protein, Causes Human Progressive Hearing Loss DFNA64

    PubMed Central

    Cheng, Jing; Zhu, Yuhua; He, Sudan; Lu, Yanping; Chen, Jing; Han, Bing; Petrillo, Marco; Wrzeszczynski, Kazimierz O.; Yang, Shiming; Dai, Pu; Zhai, Suoqiang; Han, Dongyi; Zhang, Michael Q.; Li, Wei; Liu, Xuezhong; Li, Huawei; Chen, Zheng-Yi; Yuan, Huijun

    2011-01-01

    SMAC/DIABLO is a mitochondrial proapoptotic protein that is released from mitochondria during apoptosis and counters the inhibitory activities of inhibitor of apoptosis proteins, IAPs. By linkage analysis and candidate screening, we identified a heterozygous SMAC/DIABLO mutation, c.377C>T (p.Ser126Leu, refers to p.Ser71Leu in the mature protein) in a six-generation Chinese kindred characterized by dominant progressive nonsyndromic hearing loss, designated as DFNA64. SMAC/DIABLO is highly expressed in human embryonic ears and is enriched in the developing mouse inner-ear hair cells, suggesting it has a role in the development and homeostasis of hair cells. We used a functional study to demonstrate that the SMAC/DIABLOS71L mutant, while retaining the proapoptotic function, triggers significant degradation of both wild-type and mutant SMAC/DIABLO and renders host mitochondria susceptible to calcium-induced loss of the membrane potential. Our work identifies DFNA64 as the human genetic disorder associated with SMAC/DIABLO malfunction and suggests that mutant SMAC/DIABLOS71L might cause mitochondrial dysfunction. PMID:21722859

  2. High Efficiency CRISPR/Cas9-mediated Gene Editing in Primary Human T-cells Using Mutant Adenoviral E4orf6/E1b55k "Helper" Proteins.

    PubMed

    Gwiazda, Kamila S; Grier, Alexandra E; Sahni, Jaya; Burleigh, Stephen M; Martin, Unja; Yang, Julia G; Popp, Nicholas A; Krutein, Michelle C; Khan, Iram F; Jacoby, Kyle; Jensen, Michael C; Rawlings, David J; Scharenberg, Andrew M

    2016-09-29

    Many future therapeutic applications of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 and related RNA-guided nucleases are likely to require their use to promote gene targeting, thus necessitating development of methods that provide for delivery of three components-Cas9, guide RNAs and recombination templates-to primary cells rendered proficient for homology-directed repair. Here, we demonstrate an electroporation/transduction codelivery method that utilizes mRNA to express both Cas9 and mutant adenoviral E4orf6 and E1b55k helper proteins in association with adeno-associated virus (AAV) vectors expressing guide RNAs and recombination templates. By transiently enhancing target cell permissiveness to AAV transduction and gene editing efficiency, this novel approach promotes efficient gene disruption and/or gene targeting at multiple loci in primary human T-cells, illustrating its broad potential for application in translational gene editing.

  3. Late-onset of spinal neurodegeneration in knock-in mice expressing a mutant BiP.

    PubMed

    Jin, Hisayo; Mimura, Naoya; Kashio, Makiko; Koseki, Haruhiko; Aoe, Tomohiko

    2014-01-01

    Most human neurodegenerative diseases are sporadic, and appear later in life. While the underlying mechanisms of the progression of those diseases are still unclear, investigations into the familial forms of comparable diseases suggest that endoplasmic reticulum (ER) stress is involved in the pathogenesis. Binding immunoglobulin protein (BiP) is an ER chaperone that is central to ER function. We produced knock-in mice expressing a mutant BiP that lacked the retrieval sequence in order to evaluate the effect of a functional defect in an ER chaperone in multi-cellular organisms. Here we report that heterozygous mutant BiP mice revealed motor disabilities in aging. We found a degeneration of some motoneurons in the spinal cord accompanied by accumulations of ubiquitinated proteins. The defect in retrieval of BiP by the KDEL receptor leads to impaired activities in quality control and autophagy, suggesting that functional defects in the ER chaperones may contribute to the late onset of neurodegenerative diseases.

  4. Differentially expressed genes in the ovary of the sixth day of pupal "Ming" lethal egg mutant of silkworm, Bombyx mori.

    PubMed

    Gao, Peng; Chen, An-Li; Zhao, Qiao-Ling; Shen, Xing-Jia; Qiu, Zhi-Yong; Xia, Ding-Guo; Tang, Shun-Ming; Zhang, Guo-Zheng

    2013-09-15

    The "Ming" lethal egg mutant (l-em) is a vitelline membrane mutant in silkworm, Bombyx mori. The eggs laid by the l-em mutant lose water, ultimately causing death within an hour. Previous studies have shown that the deletion of BmEP80 is responsible for the l-em mutation in silkworm, B. mori. In the current study, digital gene expression (DGE) was performed to investigate the difference of gene expression in ovaries between wild type and l-em mutant on the sixth day of the pupal stage to obtain a global view of gene expression profiles using the ovaries of three l-em mutants and three wild types. The results showed a total of 3,463,495 and 3,607,936 clean tags in the wild type and the l-em mutant libraries, respectively. Compared with those of wild type, 239 differentially expressed genes were detected in the l-em mutant, wherein 181 genes are up-regulated and 58 genes are down-regulated in the mutant strain. The Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis results showed that no pathway was significantly enriched and three pathways are tightly related to protein synthesis among the five leading pathways. Moreover, the expression profiles of eight important differentially expressed genes related to oogenesis changed. These results provide a comprehensive gene expression analysis of oogenesis and vitellogenesis in B. mori which facilitates understanding of both the specific molecular mechanism of the 1-em mutant and Lepidopteran oogenesis in general. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Pharmacogenetic Features of Inhibitors to Cathepsin B that Improve Memory Deficit and Reduce Beta-Amyloid Related to Alzheimer’s Disease

    PubMed Central

    Hook, Vivian; Hook, Gregory; Kindy, Mark

    2015-01-01

    Beta-amyloid (Aβ) in brain is a major factor involved in Alzheimer’s disease (AD) that results in severe memory deficit. Our recent studies demonstrate pharmacogenetic differences in the effects of inhibitors of cathepsin B to improve memory and reduce Aβ in different mouse models of AD. The inhibitors improve memory and reduce brain Aβ in mice expressing the wild-type (WT) β-secretase site of human APP, expressed in most AD patients. However, these inhibitors have no effect in mice expressing the rare Swedish (Swe) mutant APP. Knockout of the cathepsin B decreased brain Aβ in mice expressing WT APP, validating cathepsin B as the target. The specificity of cathepsin B to cleave the WT β-secretase site, but not the Swe mutant site, of APP for Aβ production explains the distinct inhibitor responses in the different AD mouse models. In contrast to cathepsin B, the BACE1 β-secretase prefers to cleave the Swe mutant site. Discussion of BACE1 data in the field indicate that they do not preclude cathepsin B as also being a β-secretase. Cathepsin B and BACE1 may participate jointly as β-secretases. Significantly, the majority of AD patients express WT APP and, therefore, inhibitors of cathepsin B represent candidate drugs for AD. PMID:20536395

  6. Differential regulation of insulin-like growth factor-I receptor gene expression by wild type and mutant androgen receptor in prostate cancer cells.

    PubMed

    Schayek, Hagit; Seti, Hila; Greenberg, Norman M; Sun, Shihua; Werner, Haim; Plymate, Stephen R

    2010-07-29

    The progression of prostate cancer from an organ-confined, androgen-sensitive disease to a metastatic one is associated with dysregulation of androgen receptor (AR)-regulated target genes and with a decrease in insulin-like growth factor-I receptor (IGF-IR) expression. To investigate the differential effects of wild type (wt) and mutant AR on IGF-IR levels we employed a series of isogenic prostate-derived cell lines and human xenografts. We show that basal and phosphorylated IGF-IR levels progressively decreased as prostate cancer cells became more tumorigenic and metastatic. In addition, we show that wt, but not mutant, AR along with dihydrotestosterone treatment increased IGF-IR promoter activity and endogenous IGF-IR levels. ChIP analysis show enhanced AR binding to the IGF-IR promoter in AR-overexpressing cells. Finally, wt AR-overexpressing cells display an enhanced proliferation rate. In summary, we provide evidence that activated wt AR enhances IGF-IR transcription in prostate cancer cells via a mechanism that involves AR binding to the IGF-IR promoter. AR mutations alter the ability of the mutated protein to regulate IGF-IR expression. Our results suggest that prostate cancer progression is associated with a decrease in IGF-IR expression that could be the result of impaired ability of AR to stimulate IGF-IR gene expression. 2010 Elsevier Ireland Ltd. All rights reserved.

  7. Differential regulation of insulin-like growth factor-I receptor gene expression by wild type and mutant androgen receptor in prostate cancer cells

    PubMed Central

    Schayek, Hagit; Seti, Hila; Greenberg, Norman M.; Sun, Shihua; Werner, Haim; Plymate, Stephen R.

    2010-01-01

    The progression of prostate cancer from an organ-confined, androgen-sensitive disease to a metastatic one is associated with dysregulation of androgen receptor (AR)-regulated target genes and with a decrease in insulin-like growth factor-I receptor (IGF-IR) expression. To investigate the differential effects of wild type (wt) and mutant AR on IGF-IR levels we employed a series of isogenic prostate-derived cell lines and human xenografts. We show that basal and phosphorylated IGF-IR levels progressively decreased as prostate cancer cells became more tumorigenic and metastatic. In addition, we show that wt, but not mutant, AR along with dihydrotestosterone treatment increased IGF-IR promoter activity and endogenous IGF-IR levels. ChIP analysis show enhanced AR binding to the IGF-IR promoter in AR-overexpressing cells. Finally, wt AR-overexpressing cells display an enhanced proliferation rate. In summary, we provide evidence that activated wt AR enhances IGF-IR transcription in prostate cancer cells via a mechanism that involves AR binding to the IGF-IR promoter. AR mutations alter the ability of the mutated protein to regulate IGF-IR expression. Our results suggest that prostate cancer progression is associated with a decrease in IGF-IR expression that could be the result of impaired ability of AR to stimulate IGF-IR gene expression. PMID:20417685

  8. The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21.

    PubMed

    Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin

    2014-03-18

    Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.

  9. Lack of hormone binding in COS-7 cells expressing a mutated growth hormone receptor found in Laron dwarfism.

    PubMed Central

    Edery, M; Rozakis-Adcock, M; Goujon, L; Finidori, J; Lévi-Meyrueis, C; Paly, J; Djiane, J; Postel-Vinay, M C; Kelly, P A

    1993-01-01

    A single point mutation in the growth hormone (GH) receptor gene generating a Phe-->Ser substitution in the extracellular binding domain of the receptor has been identified in one family with Laron type dwarfism. The mutation was introduced by site-directed mutagenesis into cDNAs encoding the full-length rabbit GH receptor and the extracellular domain or binding protein (BP) of the human and rabbit GH receptor, and also in cDNAs encoding the full length and the extracellular domain of the related rabbit prolactin (PRL) receptor. All constructs were transiently expressed in COS-7 cells. Both wild type and mutant full-length rabbit GH and PRL receptors, as well as GH and prolactin BPs (wild type and mutant), were detected by Western blot in cell membranes and concentrated culture media, respectively. Immunofluorescence studies showed that wild type and mutant full-length GH receptors had the same cell surface and intracellular distribution and were expressed with comparable intensities. In contrast, all mutant forms (full-length receptors or BPs), completely lost their modify the synthesis ligand. These results clearly demonstrate that this point mutation (patients with Laron syndrome) does not modify the synthesis or the intracellular pathway of receptor proteins, but rather abolishes ability of the receptor or BP to bind GH and is thus responsible for the extreme GH resistance in these patients. Images PMID:8450064

  10. Disease-Causing Mutations in BEST1 Gene Are Associated with Altered Sorting of Bestrophin-1 Protein

    PubMed Central

    Doumanov, Jordan A.; Zeitz, Christina; Gimenez, Paloma Dominguez; Audo, Isabelle; Krishna, Abhay; Alfano, Giovanna; Diaz, Maria Luz Bellido; Moskova-Doumanova, Veselina; Lancelot, Marie-Elise; Sahel, José-Alain; Nandrot, Emeline F.; Bhattacharya, Shomi S.

    2013-01-01

    Mutations in BEST1 gene, encoding the bestrophin-1 (Best1) protein are associated with macular dystrophies. Best1 is predominantly expressed in the retinal pigment epithelium (RPE), and is inserted in its basolateral membrane. We investigated the cellular localization in polarized MDCKII cells of disease-associated Best1 mutant proteins to study specific sorting motifs of Best1. Real-time PCR and western blots for endogenous expression of BEST1 in MDCK cells were performed. Best1 mutant constructs were generated using site-directed mutagenesis and transfected in MDCK cells. For protein sorting, confocal microscopy studies, biotinylation assays and statistical methods for quantification of mislocalization were used. Analysis of endogenous expression of BEST1 in MDCK cells revealed the presence of BEST1 transcript but no protein. Confocal microscopy and quantitative analyses indicate that transfected normal human Best1 displays a basolateral localization in MDCK cells, while cell sorting of several Best1 mutants (Y85H, Q96R, L100R, Y227N, Y227E) was altered. In contrast to constitutively active Y227E, constitutively inactive Y227F Best1 mutant localized basolaterally similar to the normal Best1 protein. Our data suggest that at least three basolateral sorting motifs might be implicated in proper Best1 basolateral localization. In addition, non-phosphorylated tyrosine 227 could play a role for basolateral delivery. PMID:23880862

  11. Estrogen Receptor Mutants/Variants in Human Breast Cancer.

    DTIC Science & Technology

    1996-12-01

    average 1 hour per response, including the time for reviewing instructions, searching existing data sources,gathering and maintaining the data needed...Jefferson Davis Highway, Suite 1204, Arlington, VA 22202-4302, and to the Office of Management and Budget, Paperwork Reduction Project (0704-0188...we identified, for the first time , the expression of exon deleted progesterone receptor (PR) mRNAs in both normal and neoplastic human breast tissues

  12. Oral treatment with Cu(II)(atsm) increases mutant SOD1 in vivo but protects motor neurons and improves the phenotype of a transgenic mouse model of amyotrophic lateral sclerosis.

    PubMed

    Roberts, Blaine R; Lim, Nastasia K H; McAllum, Erin J; Donnelly, Paul S; Hare, Dominic J; Doble, Philip A; Turner, Bradley J; Price, Katherine A; Lim, Sin Chun; Paterson, Brett M; Hickey, James L; Rhoads, Timothy W; Williams, Jared R; Kanninen, Katja M; Hung, Lin W; Liddell, Jeffrey R; Grubman, Alexandra; Monty, Jean-Francois; Llanos, Roxana M; Kramer, David R; Mercer, Julian F B; Bush, Ashley I; Masters, Colin L; Duce, James A; Li, Qiao-Xin; Beckman, Joseph S; Barnham, Kevin J; White, Anthony R; Crouch, Peter J

    2014-06-04

    Mutations in the metallo-protein Cu/Zn-superoxide dismutase (SOD1) cause amyotrophic lateral sclerosis (ALS) in humans and an expression level-dependent phenotype in transgenic rodents. We show that oral treatment with the therapeutic agent diacetyl-bis(4-methylthiosemicarbazonato)copper(II) [Cu(II)(atsm)] increased the concentration of mutant SOD1 (SOD1G37R) in ALS model mice, but paradoxically improved locomotor function and survival of the mice. To determine why the mice with increased levels of mutant SOD1 had an improved phenotype, we analyzed tissues by mass spectrometry. These analyses revealed most SOD1 in the spinal cord tissue of the SOD1G37R mice was Cu deficient. Treating with Cu(II)(atsm) decreased the pool of Cu-deficient SOD1 and increased the pool of fully metallated (holo) SOD1. Tracking isotopically enriched (65)Cu(II)(atsm) confirmed the increase in holo-SOD1 involved transfer of Cu from Cu(II)(atsm) to SOD1, suggesting the improved locomotor function and survival of the Cu(II)(atsm)-treated SOD1G37R mice involved, at least in part, the ability of the compound to improve the Cu content of the mutant SOD1. This was supported by improved survival of SOD1G37R mice that expressed the human gene for the Cu uptake protein CTR1. Improving the metal content of mutant SOD1 in vivo with Cu(II)(atsm) did not decrease levels of misfolded SOD1. These outcomes indicate the metal content of SOD1 may be a greater determinant of the toxicity of the protein in mutant SOD1-associated forms of ALS than the mutations themselves. Improving the metal content of SOD1 therefore represents a valid therapeutic strategy for treating ALS caused by SOD1. Copyright © 2014 the authors 0270-6474/14/348021-11$15.00/0.

  13. Reversal of a full-length mutant huntingtin neuronal cell phenotype by chemical inhibitors of polyglutamine-mediated aggregation

    PubMed Central

    Wang, Jin; Gines, Silvia; MacDonald, Marcy E; Gusella, James F

    2005-01-01

    Background Huntington's disease (HD) is an inherited neurodegenerative disorder triggered by an expanded polyglutamine tract in huntingtin that is thought to confer a new conformational property on this large protein. The propensity of small amino-terminal fragments with mutant, but not wild-type, glutamine tracts to self-aggregate is consistent with an altered conformation but such fragments occur relatively late in the disease process in human patients and mouse models expressing full-length mutant protein. This suggests that the altered conformational property may act within the full-length mutant huntingtin to initially trigger pathogenesis. Indeed, genotype-phenotype studies in HD have defined genetic criteria for the disease initiating mechanism, and these are all fulfilled by phenotypes associated with expression of full-length mutant huntingtin, but not amino-terminal fragment, in mouse models. As the in vitro aggregation of amino-terminal mutant huntingtin fragment offers a ready assay to identify small compounds that interfere with the conformation of the polyglutamine tract, we have identified a number of aggregation inhibitors, and tested whether these are also capable of reversing a phenotype caused by endogenous expression of mutant huntingtin in a striatal cell line from the HdhQ111/Q111 knock-in mouse. Results We screened the NINDS Custom Collection of 1,040 FDA approved drugs and bioactive compounds for their ability to prevent in vitro aggregation of Q58-htn 1–171 amino terminal fragment. Ten compounds were identified that inhibited aggregation with IC50 < 15 μM, including gossypol, gambogic acid, juglone, celastrol, sanguinarine and anthralin. Of these, both juglone and celastrol were effective in reversing the abnormal cellular localization of full-length mutant huntingtin observed in mutant HdhQ111/Q111 striatal cells. Conclusions At least some compounds identified as aggregation inhibitors also prevent a neuronal cellular phenotype caused by full-length mutant huntingtin, suggesting that in vitro fragment aggregation can act as a proxy for monitoring the disease-producing conformational property in HD. Thus, identification and testing of compounds that alter in vitro aggregation is a viable approach for defining potential therapeutic compounds that may act on the deleterious conformational property of full-length mutant huntingtin. PMID:15649316

  14. Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.

    PubMed

    Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin

    2017-12-15

    TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.

  15. Dopamine induces soluble α-synuclein oligomers and nigrostriatal degeneration

    PubMed Central

    Mor, Danielle E.; Tsika, Elpida; Mazzulli, Joseph R.; Gould, Neal S.; Kim, Hanna; Daniels, Malcolm J.; Doshi, Shachee; Gupta, Preetika; Grossman, Jennifer L.; Tan, Victor X.; Kalb, Robert G.; Caldwell, Kim A.; Caldwell, Guy A.; Wolfe, John H.; Ischiropoulos, Harry

    2018-01-01

    Parkinson’s disease is defined by the loss of dopaminergic neurons in the substantia nigra and formation of Lewy body inclusions containing aggregated α-synuclein. Efforts to explain dopamine neuron vulnerability are hindered by the lack of dopaminergic cell death in α-synuclein transgenic mice. To address this, we manipulated dopamine levels in addition to α-synuclein expression. Nigra-targeted expression of mutant tyrosine hydroxylase with enhanced catalytic activity increased dopamine without damaging neurons in non-transgenic mice. In contrast, raising dopamine in mice expressing human A53T mutant α-synuclein induced progressive nigrostriatal degeneration and reduced locomotion. Dopamine elevation in A53T mice increased levels of potentially toxic α-synuclein oligomers, resulting in conformationally and functionally modified species. Moreover, in genetically tractable C. elegans models expression of α-synuclein mutated at the site of interaction with dopamine prevented dopamine-induced toxicity. The data suggest a unique mechanism linking two cardinal features of Parkinson’s disease, dopaminergic cell death and α-synuclein aggregation. PMID:28920936

  16. Dopamine induces soluble α-synuclein oligomers and nigrostriatal degeneration.

    PubMed

    Mor, Danielle E; Tsika, Elpida; Mazzulli, Joseph R; Gould, Neal S; Kim, Hanna; Daniels, Malcolm J; Doshi, Shachee; Gupta, Preetika; Grossman, Jennifer L; Tan, Victor X; Kalb, Robert G; Caldwell, Kim A; Caldwell, Guy A; Wolfe, John H; Ischiropoulos, Harry

    2017-11-01

    Parkinson's disease (PD) is defined by the loss of dopaminergic neurons in the substantia nigra and the formation of Lewy body inclusions containing aggregated α-synuclein. Efforts to explain dopamine neuron vulnerability are hindered by the lack of dopaminergic cell death in α-synuclein transgenic mice. To address this, we manipulated both dopamine levels and α-synuclein expression. Nigrally targeted expression of mutant tyrosine hydroxylase with enhanced catalytic activity increased dopamine levels without damaging neurons in non-transgenic mice. In contrast, raising dopamine levels in mice expressing human A53T mutant α-synuclein induced progressive nigrostriatal degeneration and reduced locomotion. Dopamine elevation in A53T mice increased levels of potentially toxic α-synuclein oligomers, resulting in conformationally and functionally modified species. Moreover, in genetically tractable Caenorhabditis elegans models, expression of α-synuclein mutated at the site of interaction with dopamine prevented dopamine-induced toxicity. These data suggest that a unique mechanism links two cardinal features of PD: dopaminergic cell death and α-synuclein aggregation.

  17. Mycobacterium tuberculosis inhibits human innate immune responses via the production of TLR2 antagonist glycolipids.

    PubMed

    Blanc, Landry; Gilleron, Martine; Prandi, Jacques; Song, Ok-Ryul; Jang, Mi-Seon; Gicquel, Brigitte; Drocourt, Daniel; Neyrolles, Olivier; Brodin, Priscille; Tiraby, Gérard; Vercellone, Alain; Nigou, Jérôme

    2017-10-17

    Mycobacterium tuberculosis is a major human pathogen that is able to survive inside host cells and resist immune clearance. Most particularly, it inhibits several arms of the innate immune response, including phagosome maturation or cytokine production. To better understand the molecular mechanisms by which M. tuberculosis circumvents host immune defenses, we used a transposon mutant library generated in a virulent clinical isolate of M. tuberculosis of the W/Beijing family to infect human macrophages, utilizing a cell line derivative of THP-1 cells expressing a reporter system for activation of the transcription factor NF-κB, a key regulator of innate immunity. We identified several M. tuberculosis mutants inducing a NF-κB activation stronger than that of the wild-type strain. One of these mutants was found to be deficient for the synthesis of cell envelope glycolipids, namely sulfoglycolipids, suggesting that the latter can interfere with innate immune responses. Using natural and synthetic molecular variants, we determined that sulfoglycolipids inhibit NF-κB activation and subsequent cytokine production or costimulatory molecule expression by acting as competitive antagonists of Toll-like receptor 2, thereby inhibiting the recognition of M. tuberculosis by this receptor. Our study reveals that producing glycolipid antagonists of pattern recognition receptors is a strategy used by M. tuberculosis to undermine innate immune defense. Sulfoglycolipids are major and specific lipids of M. tuberculosis , considered for decades as virulence factors of the bacilli. Our study uncovers a mechanism by which they may contribute to M. tuberculosis virulence.

  18. Defining redox centers in human electron transfer flavoprotein: ubiquinone oxidoreductase (ETF:QO) by expression in Saccharomyces cerevisiae

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Frerman, F.E.; Beard, S.; Goodman, S.I.

    Mutations in ETF or ETC:QO cause glutaric acidemia type II (GA2). ETF:QO is an iron-sulfur flavoprotein in the inner mitochondrial membrane which transfers electrons from ETF in the mitochondrial matrix to ubiquinone (Q). The human ETF:QO gene is on chromosome 4q32{r_arrow}qter, and encodes a 617 amino acid precursor which is processed to the 64 kDa mature form in the mitochondrion. One ETF:QO mutation in GA2 is a G{r_arrow}T transversion in a donor splice site, deleting the 222 bp upstream exon from the transcript. The deleted 74 amino acids are near the carboxyl terminus just beyond a predicted membrane helix, andmore » include C561, one of four cysteine residues predicted to ligate the 4Fe4S cluster. The mutant protein is not stable in patient fibroblasts. We have expressed cDNAs encoding wild type (wt) ETF:QO, ETF:QO with the 74 amino acid deletion, and ETFF:QO with only a C561A mutation, in S cerevisiae. In all instances, precursor and mature ETF:QOs were stably inserted into the mitochondrial membrane. ETF:QO (C561A) is extracted from the membrane under the same conditions as wt ETF:QO, but ETF:QO with the deletion is much more difficult to extract. Wt ETF:QO accepts electrons from ETF and reduces Q but, while both mutant proteins accept electrons from ETF, neither of them reduces Q. This work demonstrates that C561 in human ETF:QO is essential for Q reduction (probably because it ligands the 4Fe4S cluster), that mutant proteins that are unstable in man may be stable in other systems, that cleavage of signal peptide from precursor proteins can occur within the inner mitochondrial membrane, and the general usefulness of expressing human mitochondrial proteins in yeast.« less

  19. Characterization of an ntrX mutant of Neisseria gonorrhoeae reveals a response regulator that controls expression of respiratory enzymes in oxidase-positive proteobacteria.

    PubMed

    Atack, John M; Srikhanta, Yogitha N; Djoko, Karrera Y; Welch, Jessica P; Hasri, Norain H M; Steichen, Christopher T; Vanden Hoven, Rachel N; Grimmond, Sean M; Othman, Dk Seti Maimonah Pg; Kappler, Ulrike; Apicella, Michael A; Jennings, Michael P; Edwards, Jennifer L; McEwan, Alastair G

    2013-06-01

    NtrYX is a sensor-histidine kinase/response regulator two-component system that has had limited characterization in a small number of Alphaproteobacteria. Phylogenetic analysis of the response regulator NtrX showed that this two-component system is extensively distributed across the bacterial domain, and it is present in a variety of Betaproteobacteria, including the human pathogen Neisseria gonorrhoeae. Microarray analysis revealed that the expression of several components of the respiratory chain was reduced in an N. gonorrhoeae ntrX mutant compared to that in the isogenic wild-type (WT) strain 1291. These included the cytochrome c oxidase subunit (ccoP), nitrite reductase (aniA), and nitric oxide reductase (norB). Enzyme activity assays showed decreased cytochrome oxidase and nitrite reductase activities in the ntrX mutant, consistent with microarray data. N. gonorrhoeae ntrX mutants had reduced capacity to survive inside primary cervical cells compared to the wild type, and although they retained the ability to form a biofilm, they exhibited reduced survival within the biofilm compared to wild-type cells, as indicated by LIVE/DEAD staining. Analyses of an ntrX mutant in a representative alphaproteobacterium, Rhodobacter capsulatus, showed that cytochrome oxidase activity was also reduced compared to that in the wild-type strain SB1003. Taken together, these data provide evidence that the NtrYX two-component system may be a key regulator in the expression of respiratory enzymes and, in particular, cytochrome c oxidase, across a wide range of proteobacteria, including a variety of bacterial pathogens.

  20. Functionomics of NCC mutations in Gitelman syndrome using a novel mammalian cell-based activity assay.

    PubMed

    Valdez-Flores, Marco A; Vargas-Poussou, Rosa; Verkaart, Sjoerd; Tutakhel, Omar A Z; Valdez-Ortiz, Angel; Blanchard, Anne; Treard, Cyrielle; Hoenderop, Joost G J; Bindels, René J M; Jeleń, Sabina

    2016-12-01

    Gitelman syndrome (GS) is an autosomal recessive salt-wasting tubular disorder resulting from loss-of-function mutations in the thiazide-sensitive NaCl cotransporter (NCC). Functional analysis of these mutations has been limited to the use of Xenopus laevis oocytes. The aim of the present study was, therefore, to analyze the functional consequences of NCC mutations in a mammalian cell-based assay, followed by analysis of mutated NCC protein expression as well as glycosylation and phosphorylation profiles using human embryonic kidney (HEK) 293 cells. NCC activity was assessed with a novel assay based on thiazide-sensitive iodide uptake in HEK293 cells expressing wild-type or mutant NCC (N59I, R83W, I360T, C421Y, G463R, G731R, L859P, or R861C). All mutations caused a significantly lower NCC activity. Immunoblot analysis of the HEK293 cells revealed that 1) all NCC mutants have decreased NCC protein expression; 2) mutant N59I, R83W, I360T, C421Y, G463R, and L859P have decreased NCC abundance at the plasma membrane; 3) mutants C421Y and L859P display impaired NCC glycosylation; and 4) mutants N59I, R83W, C421Y, C731R, and L859P show affected NCC phosphorylation. In conclusion, we developed a mammalian cell-based assay in which NCC activity assessment together with a profiling of mutated protein processing aid our understanding of the pathogenic mechanism of the NCC mutations. Copyright © 2016 the American Physiological Society.

  1. The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.

    Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair ismore » suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.« less

  2. Comparative analysis of KRAS codon 12, 13, 18, 61, and 117 mutations using human MCF10A isogenic cell lines

    PubMed Central

    Stolze, Britta; Reinhart, Stefanie; Bulllinger, Lars; Fröhling, Stefan; Scholl, Claudia

    2015-01-01

    KRAS mutations occur in one third of human cancers and cluster in several hotspots, with codons 12 and 13 being most commonly affected. It has been suggested that the position and type of amino acid exchange influence the transforming capacity of mutant KRAS proteins. We used MCF10A human mammary epithelial cells to establish isogenic cell lines that express different cancer-associated KRAS mutations (G12C, G12D, G12V, G13C, G13D, A18D, Q61H, K117N) at physiological or elevated levels, and investigated the biochemical and functional consequences of the different variants. The overall effects of low-expressing mutants were moderate compared to overexpressed variants, but allowed delineation of biological functions that were related to specific alleles rather than KRAS expression level. None of the mutations induced morphological changes, migratory abilities, or increased phosphorylation of ERK, PDK1, and AKT. KRAS-G12D, G12V, G13D, and K117N mediated EGF-independent proliferation, whereas anchorage-independent growth was primarily induced by K117N and Q61H. Both codon 13 mutations were associated with increased EGFR expression. Finally, global gene expression analysis of MCF10A-G13D versus MCF10A-G12D revealed distinct transcriptional changes. Together, we describe a useful resource for investigating the function of multiple KRAS mutations and provide insights into the differential effects of these variants in MCF10A cells. PMID:25705018

  3. Use of Heme Compounds as Iron Sources by Pathogenic Neisseriae Requires the Product of the hemO Gene

    PubMed Central

    Zhu, Wenming; Hunt, Desiree J.; Richardson, Anthony R.; Stojiljkovic, Igor

    2000-01-01

    Heme compounds are an important source of iron for neisseriae. We have identified a neisserial gene, hemO, that is essential for heme, hemoglobin (Hb), and haptoglobin-Hb utilization. The hemO gene is located 178 bp upstream of the hmbR Hb receptor gene in Neisseria meningitidis isolates. The product of the hemO gene is homologous to enzymes that degrade heme; 21% of its amino acid residues are identical, and 44% are similar, to those of the human heme oxygenase-1. DNA sequences homologous to hemO were ubiquitous in commensal and pathogenic neisseriae. HemO genetic knockout strains of Neisseria gonorrhoeae and N. meningitidis were unable to use any heme source, while the assimilation of transferrin-iron and iron-citrate complexes was unaffected. A phenotypic characterization of a conditional hemO mutant, constructed by inserting an isopropyl-β-d-thiogalactopyranoside (IPTG)-regulated promoter upstream of the ribosomal binding site of hemO, confirmed the indispensability of the HemO protein in heme utilization. The expression of HemO also protected N. meningitidis cells against heme toxicity. hemO mutants were still able to transport heme into the cell, since both heme and Hb could complement an N. meningitidis hemA hemO double mutant for growth. The expression of the HmbR receptor was reduced significantly by the inactivation of the hemO gene, suggesting that hemO and hmbR are transcriptionally linked. The expression of the unlinked Hb receptor, HpuAB, was not altered. Comparison of the polypeptide patterns of the wild type and the hemO mutant led to detection of six protein spots with an altered expression pattern, suggesting a more general role of HemO in the regulation of gene expression in Neisseriae. PMID:10629191

  4. Leiomyoma-derived transforming growth factor-β impairs bone morphogenetic protein-2-mediated endometrial receptivity.

    PubMed

    Doherty, Leo F; Taylor, Hugh S

    2015-03-01

    To determine whether transforming growth factor (TGF)-β3 is a paracrine signal secreted by leiomyoma that inhibits bone morphogenetic protein (BMP)-mediated endometrial receptivity and decidualization. Experimental. Laboratory. Women with symptomatic leiomyomas. Endometrial stromal cells (ESCs) and leiomyoma cells were isolated from surgical specimens. Leiomyoma-conditioned media (LCM) was applied to cultured ESC. The TGF-β was blocked by two approaches: TGF-β pan-specific antibody or transfection with a mutant TGF-β receptor type II. Cells were then treated with recombinant human BMP-2 to assess BMP responsiveness. Expression of BMP receptor types 1A, 1B, 2, as well as endometrial receptivity mediators HOXA10 and leukemia inhibitory factor (LIF). Enzyme-linked immunosorbent assay showed elevated TGF-β levels in LCM. LCM treatment of ESC reduced expression of BMP receptor types 1B and 2 to approximately 60% of pretreatment levels. Preincubation of LCM with TGF-β neutralizing antibody or mutant TGF receptor, but not respective controls, prevented repression of BMP receptors. HOXA10 and LIF expression was repressed in recombinant human BMP-2 treated, LCM exposed ESC. Pretreatment of LCM with TGF-β antibody or transfection with mutant TGF receptor prevented HOXA10 and LIF repression. Leiomyoma-derived TGF-β was necessary and sufficient to alter endometrial BMP-2 responsiveness. Blockade of TGF-β prevents repression of BMP-2 receptors and restores BMP-2-stimulated expression of HOXA10 and LIF. Blockade of TGF signaling is a potential strategy to improve infertility and pregnancy loss associated with uterine leiomyoma. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  5. A Yeast Model of FUS/TLS-Dependent Cytotoxicity

    PubMed Central

    Ju, Shulin; Tardiff, Daniel F.; Han, Haesun; Divya, Kanneganti; Zhong, Quan; Maquat, Lynne E.; Bosco, Daryl A.; Hayward, Lawrence J.; Brown, Robert H.; Lindquist, Susan; Ringe, Dagmar; Petsko, Gregory A.

    2011-01-01

    FUS/TLS is a nucleic acid binding protein that, when mutated, can cause a subset of familial amyotrophic lateral sclerosis (fALS). Although FUS/TLS is normally located predominantly in the nucleus, the pathogenic mutant forms of FUS/TLS traffic to, and form inclusions in, the cytoplasm of affected spinal motor neurons or glia. Here we report a yeast model of human FUS/TLS expression that recapitulates multiple salient features of the pathology of the disease-causing mutant proteins, including nuclear to cytoplasmic translocation, inclusion formation, and cytotoxicity. Protein domain analysis indicates that the carboxyl-terminus of FUS/TLS, where most of the ALS-associated mutations are clustered, is required but not sufficient for the toxicity of the protein. A genome-wide genetic screen using a yeast over-expression library identified five yeast DNA/RNA binding proteins, encoded by the yeast genes ECM32, NAM8, SBP1, SKO1, and VHR1, that rescue the toxicity of human FUS/TLS without changing its expression level, cytoplasmic translocation, or inclusion formation. Furthermore, hUPF1, a human homologue of ECM32, also rescues the toxicity of FUS/TLS in this model, validating the yeast model and implicating a possible insufficiency in RNA processing or the RNA quality control machinery in the mechanism of FUS/TLS mediated toxicity. Examination of the effect of FUS/TLS expression on the decay of selected mRNAs in yeast indicates that the nonsense-mediated decay pathway is probably not the major determinant of either toxicity or suppression. PMID:21541368

  6. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  7. Mutant p53-Expressing Cells Undergo Necroptosis via Cell Competition with the Neighboring Normal Epithelial Cells.

    PubMed

    Watanabe, Hirotaka; Ishibashi, Kojiro; Mano, Hiroki; Kitamoto, Sho; Sato, Nanami; Hoshiba, Kazuya; Kato, Mugihiko; Matsuzawa, Fumihiko; Takeuchi, Yasuto; Shirai, Takanobu; Ishikawa, Susumu; Morioka, Yuka; Imagawa, Toshiaki; Sakaguchi, Kazuyasu; Yonezawa, Suguru; Kon, Shunsuke; Fujita, Yasuyuki

    2018-06-26

    p53 is a tumor suppressor protein, and its missense mutations are frequently found in human cancers. During the multi-step progression of cancer, p53 mutations generally accumulate at the mid or late stage, but not in the early stage, and the underlying mechanism is still unclear. In this study, using mammalian cell culture and mouse ex vivo systems, we demonstrate that when p53R273H- or p53R175H-expressing cells are surrounded by normal epithelial cells, mutant p53 cells undergo necroptosis and are basally extruded from the epithelial monolayer. When mutant p53 cells alone are present, cell death does not occur, indicating that necroptosis results from cell competition with the surrounding normal cells. Furthermore, when p53R273H mutation occurs within RasV12-transformed epithelia, cell death is strongly suppressed and most of the p53R273H-expressing cells remain intact. These results suggest that the order of oncogenic mutations in cancer development could be dictated by cell competition. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  8. The role of the cytoplasmic domain of the L1 cell adhesion molecule in brain development

    PubMed Central

    Nakamura, Yukiko; Lee, Suni; Haddox, Candace L.; Weaver, Eli J.; Lemmon, Vance P.

    2011-01-01

    Mutations in the human L1CAM gene cause X-linked Hydrocephalus and MASA syndrome. In vitro studies have shown the L1 cytoplasmic domain (L1CD) is involved in L1 trafficking, neurite branching, signaling, and interactions with the cytoskeleton. L1cam knock-out (L1KO) mice have hydrocephalus, a small cerebellum, hyperfasciculation of corticothalamic tracts and abnormal peripheral nerves. To explore the function of the L1CD, we made three new mice lines in which different parts of the L1CD have been altered. In all mutant lines L1 protein is expressed and transported into the axon. Interestingly, these new L1CD mutant lines display normal brain morphology. However, the expression of L1 protein in the adult is dramatically reduced in the two L1CD mutant lines that lack the ankyrin-binding region and they show defects in motor function. Therefore, the L1CD is not responsible for the major defects observed in L1KO mice, yet it is required for continued L1 protein expression and motor function in the adult. PMID:20127821

  9. Abnormal N-Glycosylation of a Novel Missense Creatine Transporter Mutant, G561R, Associated with Cerebral Creatine Deficiency Syndromes Alters Transporter Activity and Localization.

    PubMed

    Uemura, Tatsuki; Ito, Shingo; Ohta, Yusuke; Tachikawa, Masanori; Wada, Takahito; Terasaki, Tetsuya; Ohtsuki, Sumio

    2017-01-01

    Cerebral creatine deficiency syndromes (CCDSs) are caused by loss-of-function mutations in creatine transporter (CRT, SLC6A8), which transports creatine at the blood-brain barrier and into neurons of the central nervous system (CNS). This results in low cerebral creatine levels, and patients exhibit mental retardation, poor language skills and epilepsy. We identified a novel human CRT gene missense mutation (c.1681 G>C, G561R) in Japanese CCDSs patients. The purpose of the present study was to evaluate the reduction of creatine transport in G561R-mutant CRT-expressing 293 cells, and to clarify the mechanism of its functional attenuation. G561R-mutant CRT exhibited greatly reduced creatine transport activity compared to wild-type CRT (WT-CRT) when expressed in 293 cells. Also, the mutant protein is localized mainly in intracellular membrane fraction, while WT-CRT is localized in plasma membrane. Western blot analysis revealed a 68 kDa band of WT-CRT protein in plasma membrane fraction, while G561R-mutant CRT protein predominantly showed bands at 55, 110 and 165 kDa in crude membrane fraction. The bands of both WT-CRT and G561R-mutant CRT were shifted to 50 kDa by N-glycosidase treatment. Our results suggest that the functional impairment of G561R-mutant CRT was probably caused by incomplete N-linked glycosylation due to misfolding during protein maturation, leading to oligomer formation and changes of cellular localization.

  10. Agonist-dependent consequences of proline to alanine substitution in the transmembrane helices of the calcitonin receptor

    PubMed Central

    Bailey, R J; Hay, D L

    2007-01-01

    Background and purpose: Transmembrane proline (P) residues in family A G protein-coupled receptors (GPCRs) form functionally important kinks in their helices. These residues are little studied in family B GPCRs but experiments with the VPAC1 receptor and calcitonin receptor-like receptor (CL) show parallels with family A receptors. We sought to determine the function of these residues in the insert negative form of the human calcitonin receptor, a close relative of CL. Experimental approach: Proline residues within the transmembrane domains of the calcitonin receptor (P246, P249, P280, P326, P336) were individually mutated to alanine (A) using site-directed mutagenesis. Receptors were transiently transfected into Cos-7 cells using polyethylenimine and salmon and human calcitonin-induced cAMP responses measured. Salmon and human calcitonin competition binding experiments were also performed and receptor cell-surface expression assessed by whole cell ELISA. Key results: P246A, P249A and P280A were wild-type in terms of human calcitonin-induced cAMP activation. P326A and P336A had reduced function (165 and 12-fold, respectively). In membranes, human calcitonin binding was not detectable for any mutant receptor but in whole cells, binding was detected for all mutants apart from P326A. Salmon calcitonin activated mutant and wild-type receptors equally, although Bmax values were reduced for all mutants apart from P326A. Conclusions and Implications: P326 and P336 are important for the function of human calcitonin receptors and are likely to be involved in generating receptor conformations appropriate for agonist binding and receptor activation. However, agonist-specific effects were observed , implying distinct conformations of the human calcitonin receptor. PMID:17486143

  11. Fumonisin-nonproducing mutants exhibit differential expression of putative polyketide biosynthetic gene clusters in Fusarium verticillioides

    USDA-ARS?s Scientific Manuscript database

    The maize pathogen Fusarium verticillioides produces a group of polyketide derived secondary metabolites called fumonisins. Fumonisins can cause diseases in animals, and have been correlated epidemiologically with esophageal cancer and birth defects in humans. The fumonisin biosynthetic gene clust...

  12. Altered expression of polyketide biosynthetic gene clusters in fumonisin-deficient mutants of Fusarium verticillioides

    USDA-ARS?s Scientific Manuscript database

    Fusarium verticillioides is a pathogen of maize and produces fumonisins, a group of polyketide derived secondary metabolites. Fumonisins cause diseases in animals, and they have been correlated epidemiologically with esophageal cancer and birth defects in humans. Fumonisin biosynthetic genes are c...

  13. Release of Severe Acute Respiratory Syndrome Coronavirus Nuclear Import Block Enhances Host Transcription in Human Lung Cells

    PubMed Central

    Tilton, Susan C.; Menachery, Vineet D.; Gralinski, Lisa E.; Schäfer, Alexandra; Matzke, Melissa M.; Webb-Robertson, Bobbie-Jo M.; Chang, Jean; Luna, Maria L.; Long, Casey E.; Shukla, Anil K.; Bankhead, Armand R.; Burkett, Susan E.; Zornetzer, Gregory; Tseng, Chien-Te Kent; Metz, Thomas O.; Pickles, Raymond; McWeeney, Shannon; Smith, Richard D.; Katze, Michael G.; Waters, Katrina M.; Baric, Ralph S.

    2013-01-01

    The severe acute respiratory syndrome coronavirus accessory protein ORF6 antagonizes interferon signaling by blocking karyopherin-mediated nuclear import processes. Viral nuclear import antagonists, expressed by several highly pathogenic RNA viruses, likely mediate pleiotropic effects on host gene expression, presumably interfering with transcription factors, cytokines, hormones, and/or signaling cascades that occur in response to infection. By bioinformatic and systems biology approaches, we evaluated the impact of nuclear import antagonism on host expression networks by using human lung epithelial cells infected with either wild-type virus or a mutant that does not express ORF6 protein. Microarray analysis revealed significant changes in differential gene expression, with approximately twice as many upregulated genes in the mutant virus samples by 48 h postinfection, despite identical viral titers. Our data demonstrated that ORF6 protein expression attenuates the activity of numerous karyopherin-dependent host transcription factors (VDR, CREB1, SMAD4, p53, EpasI, and Oct3/4) that are critical for establishing antiviral responses and regulating key host responses during virus infection. Results were confirmed by proteomic and chromatin immunoprecipitation assay analyses and in parallel microarray studies using infected primary human airway epithelial cell cultures. The data strongly support the hypothesis that viral antagonists of nuclear import actively manipulate host responses in specific hierarchical patterns, contributing to the viral pathogenic potential in vivo. Importantly, these studies and modeling approaches not only provide templates for evaluating virus antagonism of nuclear import processes but also can reveal candidate cellular genes and pathways that may significantly influence disease outcomes following severe acute respiratory syndrome coronavirus infection in vivo. PMID:23365422

  14. Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Santhanam, U.; Ray, A.; Sehgal, P.B.

    1991-09-01

    The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriatemore » chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.« less

  15. Expression of Human CTP Synthetase in Saccharomyces cerevisiae Reveals Phosphorylation by Protein Kinase A*

    PubMed Central

    Han, Gil-Soo; Sreenivas, Avula; Choi, Mal-Gi; Chang, Yu-Fang; Martin, Shelley S.; Baldwin, Enoch P.; Carman, George M.

    2005-01-01

    CTP synthetase (EC 6.3.4.2, UTP: ammonia ligase (ADP-forming)) is an essential enzyme in all organisms; it generates the CTP required for the synthesis of nucleic acids and membrane phospholipids. In this work we showed that the human CTP synthetase genes, CTPS1 and CTPS2, were functional in Saccharomyces cerevisiae and complemented the lethal phenotype of the ura7Δ ura8Δ mutant lacking CTP synthetase activity. The expression of the CTPS1-and CTPS2-encoded human CTP synthetase enzymes in the ura7Δ ura8Δ mutant was shown by immunoblot analysis of CTP synthetase proteins, the measurement of CTP synthetase activity, and the synthesis of CTP in vivo. Phosphoamino acid and phosphopeptide mapping analyses of human CTP synthetase 1 isolated from 32Pi-labeled cells revealed that the enzyme was phosphorylated on multiple serine residues in vivo. Activation of protein kinase A activity in yeast resulted in transient increases (2-fold) in the phosphorylation of human CTP synthetase 1 and the cellular level of CTP. Human CTP synthetase 1 was also phosphorylated by mammalian protein kinase A in vitro. Using human CTP synthetase 1 purified from Escherichia coli as a substrate, protein kinase A activity was dose- and time-dependent, and dependent on the concentrations of CTP synthetase1 and ATP. These studies showed that S. cerevisiae was useful for the analysis of human CTP synthetase phosphorylation. PMID:16179339

  16. A Family with Severe Insulin Resistance and Diabetes Mellitus due to a Missense Mutation in AKT2

    PubMed Central

    George, Stella; Rochford, Justin J.; Wolfrum, Christian; Gray, Sarah L.; Schinner, Sven; Wilson, Jenny C.; Soos, Maria A.; Murgatroyd, Peter R.; Williams, Rachel M.; Acerini, Carlo L.; Dunger, David B.; Barford, David; Umpleby, A. Margot; Wareham, Nicholas J.; Davies, Huw Alban; Schafer, Alan J.; Stoffel, Markus; O’Rahilly, Stephen; Barroso, Ines

    2008-01-01

    Inherited defects in signaling pathways downstream of the insulin receptor have long been suggested to contribute to human Type 2 diabetes mellitus. Here we describe a mutation in the gene encoding the protein kinase AKT2/PKBβ in a family that shows autosomal dominant inheritance of severe insulin resistance and diabetes mellitus. Expression of the mutant kinase in cultured cells disrupted insulin signaling to metabolic end-points and inhibited the function of co-expressed, wild type AKT. These findings demonstrate the central importance of AKT signaling to insulin sensitivity in humans. PMID:15166380

  17. Deletion of the Snord116/SNORD116 Alters Sleep in Mice and Patients with Prader-Willi Syndrome.

    PubMed

    Lassi, Glenda; Priano, Lorenzo; Maggi, Silvia; Garcia-Garcia, Celina; Balzani, Edoardo; El-Assawy, Nadia; Pagani, Marco; Tinarelli, Federico; Giardino, Daniela; Mauro, Alessandro; Peters, Jo; Gozzi, Alessandro; Grugni, Graziano; Tucci, Valter

    2016-03-01

    Sleep-wake disturbances are often reported in Prader-Willi syndrome (PWS), a rare neurodevelopmental syndrome that is associated with paternally-expressed genomic imprinting defects within the human chromosome region 15q11-13. One of the candidate genes, prevalently expressed in the brain, is the small nucleolar ribonucleic acid-116 (SNORD116). Here we conducted a translational study into the sleep abnormalities of PWS, testing the hypothesis that SNORD116 is responsible for sleep defects that characterize the syndrome. We studied sleep in mutant mice that carry a deletion of Snord116 at the orthologous locus (mouse chromosome 7) of the human PWS critical region (PWScr). In particular, we assessed EEG and temperature profiles, across 24-h, in PWScr (m+/p-) heterozygous mutants compared to wild-type littermates. High-resolution magnetic resonance imaging (MRI) was performed to explore morphoanatomical differences according to the genotype. Moreover, we complemented the mouse work by presenting two patients with a diagnosis of PWS and characterized by atypical small deletions of SNORD116. We compared the individual EEG parameters of patients with healthy subjects and with a cohort of obese subjects. By studying the mouse mutant line PWScr(m+/p-), we observed specific rapid eye movement (REM) sleep alterations including abnormal electroencephalograph (EEG) theta waves. Remarkably, we observed identical sleep/EEG defects in the two PWS cases. We report brain morphological abnormalities that are associated with the EEG alterations. In particular, mouse mutants have a bilateral reduction of the gray matter volume in the ventral hippocampus and in the septum areas, which are pivotal structures for maintaining theta rhythms throughout the brain. In PWScr(m+/p-) mice we also observed increased body temperature that is coherent with REM sleep alterations in mice and human patients. Our study indicates that paternally expressed Snord116 is involved in the 24-h regulation of sleep physiological measures, suggesting that it is a candidate gene for the sleep disturbances that most individuals with PWS experience. © 2016 Associated Professional Sleep Societies, LLC.

  18. Identification of bovine leukemia virus tax function associated with host cell transcription, signaling, stress response and immune response pathway by microarray-based gene expression analysis

    PubMed Central

    2012-01-01

    Background Bovine leukemia virus (BLV) is associated with enzootic bovine leukosis and is closely related to human T-cell leukemia virus type I. The Tax protein of BLV is a transcriptional activator of viral replication and a key contributor to oncogenic potential. We previously identified interesting mutant forms of Tax with elevated (TaxD247G) or reduced (TaxS240P) transactivation effects on BLV replication and propagation. However, the effects of these mutations on functions other than transcriptional activation are unknown. In this study, to identify genes that play a role in the cascade of signal events regulated by wild-type and mutant Tax proteins, we used a large-scale host cell gene-profiling approach. Results Using a microarray containing approximately 18,400 human mRNA transcripts, we found several alterations after the expression of Tax proteins in genes involved in many cellular functions such as transcription, signal transduction, cell growth, apoptosis, stress response, and immune response, indicating that Tax protein has multiple biological effects on various cellular environments. We also found that TaxD247G strongly regulated more genes involved in transcription, signal transduction, and cell growth functions, contrary to TaxS240P, which regulated fewer genes. In addition, the expression of genes related to stress response significantly increased in the presence of TaxS240P as compared to wild-type Tax and TaxD247G. By contrast, the largest group of downregulated genes was related to immune response, and the majority of these genes belonged to the interferon family. However, no significant difference in the expression level of downregulated genes was observed among the Tax proteins. Finally, the expression of important cellular factors obtained from the human microarray results were validated at the RNA and protein levels by real-time quantitative reverse transcription-polymerase chain reaction and western blotting, respectively, after transfecting Tax proteins into bovine cells and human HeLa cells. Conclusion A comparative analysis of wild-type and mutant Tax proteins indicates that Tax protein exerts a significant impact on cellular functions as diverse as transcription, signal transduction, cell growth, stress response and immune response. Importantly, our study is the first report that shows the extent to which BLV Tax regulates the innate immune response. PMID:22455445

  19. Establishment of Homozygote Mutant Human Embryonic Stem Cells by Parthenogenesis.

    PubMed

    Epsztejn-Litman, Silvina; Cohen-Hadad, Yaara; Aharoni, Shira; Altarescu, Gheona; Renbaum, Paul; Levy-Lahad, Ephrat; Schonberger, Oshrat; Eldar-Geva, Talia; Zeligson, Sharon; Eiges, Rachel

    2015-01-01

    We report on the derivation of a diploid 46(XX) human embryonic stem cell (HESC) line that is homozygous for the common deletion associated with Spinal muscular atrophy type 1 (SMA) from a pathenogenetic embryo. By characterizing the methylation status of three different imprinted loci (MEST, SNRPN and H19), monitoring the expression of two parentally imprinted genes (SNRPN and H19) and carrying out genome-wide SNP analysis, we provide evidence that this cell line was established from the activation of a mutant oocyte by diploidization of the entire genome. Therefore, our SMA parthenogenetic HESC (pHESC) line provides a proof-of-principle for the establishment of diseased HESC lines without the need for gene manipulation. As mutant oocytes are easily obtained and readily available during preimplantation genetic diagnosis (PGD) cycles, this approach should provide a powerful tool for disease modelling and is especially advantageous since it can be used to induce large or complex mutations in HESCs, including gross DNA alterations and chromosomal rearrangements, which are otherwise hard to achieve.

  20. Methylene blue protects against TDP-43 and FUS neuronal toxicity in C. elegans and D. rerio.

    PubMed

    Vaccaro, Alexandra; Patten, Shunmoogum A; Ciura, Sorana; Maios, Claudia; Therrien, Martine; Drapeau, Pierre; Kabashi, Edor; Parker, J Alex

    2012-01-01

    The DNA/RNA-binding proteins TDP-43 and FUS are found in protein aggregates in a growing number of neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and related dementia, but little is known about the neurotoxic mechanisms. We have generated Caenorhabditis elegans and zebrafish animal models expressing mutant human TDP-43 (A315T or G348C) or FUS (S57Δ or R521H) that reflect certain aspects of ALS including motor neuron degeneration, axonal deficits, and progressive paralysis. To explore the potential of our humanized transgenic C. elegans and zebrafish in identifying chemical suppressors of mutant TDP-43 and FUS neuronal toxicity, we tested three compounds with potential neuroprotective properties: lithium chloride, methylene blue and riluzole. We identified methylene blue as a potent suppressor of TDP-43 and FUS toxicity in both our models. Our results indicate that methylene blue can rescue toxic phenotypes associated with mutant TDP-43 and FUS including neuronal dysfunction and oxidative stress.

  1. Methylene Blue Protects against TDP-43 and FUS Neuronal Toxicity in C. elegans and D. rerio

    PubMed Central

    Vaccaro, Alexandra; Patten, Shunmoogum A.; Ciura, Sorana; Maios, Claudia; Therrien, Martine; Drapeau, Pierre; Kabashi, Edor; Parker, J. Alex

    2012-01-01

    The DNA/RNA-binding proteins TDP-43 and FUS are found in protein aggregates in a growing number of neurodegenerative diseases, including amyotrophic lateral sclerosis (ALS) and related dementia, but little is known about the neurotoxic mechanisms. We have generated Caenorhabditis elegans and zebrafish animal models expressing mutant human TDP-43 (A315T or G348C) or FUS (S57Δ or R521H) that reflect certain aspects of ALS including motor neuron degeneration, axonal deficits, and progressive paralysis. To explore the potential of our humanized transgenic C. elegans and zebrafish in identifying chemical suppressors of mutant TDP-43 and FUS neuronal toxicity, we tested three compounds with potential neuroprotective properties: lithium chloride, methylene blue and riluzole. We identified methylene blue as a potent suppressor of TDP-43 and FUS toxicity in both our models. Our results indicate that methylene blue can rescue toxic phenotypes associated with mutant TDP-43 and FUS including neuronal dysfunction and oxidative stress. PMID:22848727

  2. Genetic manipulation of Treponema denticola.

    PubMed

    Kuramitsu, Howard K; Chi, Bo; Ikegami, Akihiko

    2005-07-01

    The oral anaerobic spirochete, Treponema denticola, has been implicated in the etiology of human periodontal diseases; however, the molecular basis for the virulence of these organisms is still unclear. Potential pathogenic factors expressed by T. denticola have recently begun to be identified through the development of gene transfer approaches in this organism following electroporetic transformation. Several antibiotic resistance markers have been developed for use in the construction of monospecific mutants in these organisms. In addition, these antibiotic resistance cassettes have been more recently utilized to construct shuttle plasmids for complementation analysis of the mutants. These plasmids were also used to express heterologous spirochete genes in T. denticola. The transformation of other spirochetes such as T. phagedenis with these plasmids further suggests that it should be possible to develop similar gene transfer systems in other cultivable treponemes.

  3. Skewed segregation of the mtDNA nt 8993 (T-->G) mutation in human oocytes.

    PubMed Central

    Blok, R B; Gook, D A; Thorburn, D R; Dahl, H H

    1997-01-01

    Rapid changes in mtDNA variants between generations have led to the bottleneck theory, which proposes a dramatic reduction in mtDNA numbers during early oogenesis. We studied oocytes from a woman with heteroplasmic expression of the mtDNA nt 8993 (T-->G) mutation. Of seven oocytes analyzed, one showed no evidence of the mutation, and the remaining six had a mutant load > 95%. This skewed expression of the mutation in oocytes is not compatible with the conventional bottleneck theory. A possible explanation is that, during amplification of mtDNA in the developing oocyte, mtDNA from one mitochondrion is preferentially amplified. Thus, subsequent mature oocytes may contain predominantly wild-type or mutant mitochondrial genomes. Images Figure 2 Figure 3 PMID:9199572

  4. Active site mutant transgene confers tolerance to human β-glucuronidase without affecting the phenotype of MPS VII mice

    PubMed Central

    Sly, William S.; Vogler, Carole; Grubb, Jeffrey H.; Zhou, Mi; Jiang, Jinxing; Zhou, Xiao Yan; Tomatsu, Shunji; Bi, Yanhua; Snella, Elizabeth M.

    2001-01-01

    Mucopolysaccharidosis type VII (MPS VII; Sly syndrome) is an autosomal recessive lysosomal storage disorder due to an inherited deficiency of β-glucuronidase. A naturally occurring mouse model for this disease was discovered at The Jackson Laboratory and shown to be due to homozygosity for a 1-bp deletion in exon 10 of the gus gene. The murine model MPS VII (gusmps/mps) has been very well characterized and used extensively to evaluate experimental strategies for lysosomal storage diseases, including bone marrow transplantation, enzyme replacement therapy, and gene therapy. To enhance the value of this model for enzyme and gene therapy, we produced a transgenic mouse expressing the human β-glucuronidase cDNA with an amino acid substitution at the active site nucleophile (E540A) and bred it onto the MPS VII (gusmps/mps) background. We demonstrate here that the mutant mice bearing the active site mutant human transgene retain the clinical, morphological, biochemical, and histopathological characteristics of the original MPS VII (gusmps/mps) mouse. However, they are now tolerant to immune challenge with human β-glucuronidase. This “tolerant MPS VII mouse model” should be useful for preclinical trials evaluating the effectiveness of enzyme and/or gene therapy with the human gene products likely to be administered to human patients with MPS VII. PMID:11226217

  5. Disparate requirements for the Walker A and B ATPase motifs of human RAD51D in homologous recombination.

    PubMed

    Wiese, Claudia; Hinz, John M; Tebbs, Robert S; Nham, Peter B; Urbin, Salustra S; Collins, David W; Thompson, Larry H; Schild, David

    2006-01-01

    In vertebrates, homologous recombinational repair (HRR) requires RAD51 and five RAD51 paralogs (XRCC2, XRCC3, RAD51B, RAD51C and RAD51D) that all contain conserved Walker A and B ATPase motifs. In human RAD51D we examined the requirement for these motifs in interactions with XRCC2 and RAD51C, and for survival of cells in response to DNA interstrand crosslinks (ICLs). Ectopic expression of wild-type human RAD51D or mutants having a non-functional A or B motif was used to test for complementation of a rad51d knockout hamster CHO cell line. Although A-motif mutants complement very efficiently, B-motif mutants do not. Consistent with these results, experiments using the yeast two- and three-hybrid systems show that the interactions between RAD51D and its XRCC2 and RAD51C partners also require a functional RAD51D B motif, but not motif A. Similarly, hamster Xrcc2 is unable to bind to the non-complementing human RAD51D B-motif mutants in co-immunoprecipitation assays. We conclude that a functional Walker B motif, but not A motif, is necessary for RAD51D's interactions with other paralogs and for efficient HRR. We present a model in which ATPase sites are formed in a bipartite manner between RAD51D and other RAD51 paralogs.

  6. Mutants in the Mouse NuRD/Mi2 Component P66α Are Embryonic Lethal

    PubMed Central

    Marino, Susan; Nusse, Roel

    2007-01-01

    Background The NuRD/Mi2 chromatin complex is involved in histone modifications and contains a large number of subunits, including the p66 protein. There are two mouse and human p66 paralogs, p66α and p66β. The functions of these genes are not clear, in part because there are no mutants available, except in invertebrate model systems. Methodology We made loss of function mutants in the mouse p66α gene (mp66α, official name Gatad2a, MGI:2384585). We found that mp66α is essential for development, as mutant embryos die around day 10 of embryogenesis. The gene is not required for normal blastocyst development or for implantation. The phenotype of mutant embryos and the pattern of gene expression in mutants are consistent with a role of mp66α in gene silencing. Conclusion mp66α is an essential gene, required for early mouse development. The lethal phenotype supports a role in execution of methylated DNA silencing. PMID:17565372

  7. The human Cx26-D50A and Cx26-A88V mutations causing keratitis-ichthyosis-deafness syndrome display increased hemichannel activity

    PubMed Central

    Mhaske, Pallavi V.; Levit, Noah A.; Li, Leping; Wang, Hong-Zhan; Lee, Jack R.; Shuja, Zunaira; Brink, Peter R.

    2013-01-01

    Mutations in the human gene encoding connexin 26 (Cx26 or GJB2) cause either nonsyndromic deafness or syndromic deafness associated with skin diseases. That distinct clinical disorders can be caused by different mutations within the same gene suggests that different channel activities influence the ear and skin. Here we use three different expression systems to examine the functional characteristics of two Cx26 mutations causing either mild (Cx26-D50A) or lethal (Cx26-A88V) keratitis-ichthyosis-deafness (KID) syndrome. In either cRNA-injected Xenopus oocytes, transfected HeLa cells, or transfected primary human keratinocytes, we show that both Cx26-D50A and Cx26-A88V form active hemichannels that significantly increase membrane current flow compared with wild-type Cx26. This increased membrane current accelerated cell death in low extracellular calcium solutions and was not due to increased mutant protein expression. Elevated mutant hemichannel currents could be blocked by increased extracellular calcium concentration. These results show that these two mutations exhibit a shared gain of functional activity and support the hypothesis that increased hemichannel activity is a common feature of human Cx26 mutations responsible for KID syndrome. PMID:23447037

  8. The E1 Protein of Human Papillomavirus Type 16 Is Dispensable for Maintenance Replication of the Viral Genome

    PubMed Central

    Egawa, Nagayasu; Nakahara, Tomomi; Ohno, Shin-ichi; Narisawa-Saito, Mako; Yugawa, Takashi; Fujita, Masatoshi; Yamato, Kenji; Natori, Yukikazu

    2012-01-01

    Papillomavirus genomes are thought to be amplified to about 100 copies per cell soon after infection, maintained constant at this level in basal cells, and amplified for viral production upon keratinocyte differentiation. To determine the requirement for E1 in viral DNA replication at different stages, an E1-defective mutant of the human papillomavirus 16 (HPV16) genome featuring a translation termination mutation in the E1 gene was used. The ability of the mutant HPV16 genome to replicate as nuclear episomes was monitored with or without exogenous expression of E1. Unlike the wild-type genome, the E1-defective HPV16 genome became established in human keratinocytes only as episomes in the presence of exogenous E1 expression. Once established, it could replicate with the same efficiency as the wild-type genome, even after the exogenous E1 was removed. However, upon calcium-induced keratinocyte differentiation, once again amplification was dependent on exogenous E1. These results demonstrate that the E1 protein is dispensable for maintenance replication but not for initial and productive replication of HPV16. PMID:22238312

  9. Site-specific PEGylation of human thyroid stimulating hormone to prolong duration of action.

    PubMed

    Qiu, Huawei; Boudanova, Ekaterina; Park, Anna; Bird, Julie J; Honey, Denise M; Zarazinski, Christine; Greene, Ben; Kingsbury, Jonathan S; Boucher, Susan; Pollock, Julie; McPherson, John M; Pan, Clark Q

    2013-03-20

    Recombinant human thyroid stimulating hormone (rhTSH or Thyrogen) has been approved for thyroid cancer diagnostics and treatment under a multidose regimen due to its short circulating half-life. To reduce dosing frequency, PEGylation strategies were explored to increase the duration of action of rhTSH. Lysine and N-terminal PEGylation resulted in heterogeneous product profiles with 40% or lower reaction yields of monoPEGylated products. Eleven cysteine mutants were designed based on a structure model of the TSH-TSH receptor (TSHR) complex to create unique conjugation sites on both α and β subunits for site-specific conjugation. Sequential screening of mutant expression level, oligomerization tendency, and conjugation efficiency resulted in the identification of the αG22C rhTSH mutant for stable expression and scale-up PEGylation. The introduced cysteine in the αG22C rhTSH mutant was partially blocked when isolated from conditioned media and could only be effectively PEGylated after mild reduction with cysteine. This produced a higher reaction yield, ~85%, for the monoPEGylated product. Although the mutation had no effect on receptor binding, PEGylation of αG22C rhTSH led to a PEG size-dependent decrease in receptor binding. Nevertheless, the 40 kDa PEG αG22C rhTSH showed a prolonged duration of action compared to rhTSH in a rat pharmacodynamics model. Reverse-phase HPLC and N-terminal sequencing experiments confirmed site-specific modification at the engineered Cys 22 position on the α-subunit. This work is another demonstration of successful PEGylation of a cysteine-knot protein by an engineered cysteine mutation.

  10. Hypogonadotropic hypogonadism due to a novel missense mutation in the first extracellular loop of the neurokinin B receptor.

    PubMed

    Guran, Tulay; Tolhurst, Gwen; Bereket, Abdullah; Rocha, Nuno; Porter, Keith; Turan, Serap; Gribble, Fiona M; Kotan, L Damla; Akcay, Teoman; Atay, Zeynep; Canan, Husniye; Serin, Ayse; O'Rahilly, Stephen; Reimann, Frank; Semple, Robert K; Topaloglu, A Kemal

    2009-10-01

    The neurokinin B (NKB) receptor, encoded by TACR3, is widely expressed within the central nervous system, including hypothalamic nuclei involved in regulating GnRH release. We have recently reported two mutations in transmembrane segments of the receptor and a missense mutation in NKB in patients with normosmic isolated hypogonadotropic hypogonadism (nIHH). We sequenced the TACR3 gene in a family in which three siblings had nIHH. The novel mutant receptor thus identified was studied in a heterologous expression system using calcium flux as the functional readout. All affected siblings were homozygous for the His148Leu mutation, in the first extracellular loop of the NKB receptor. The His148Leu mutant receptor exhibited profoundly impaired signaling in response to NKB (EC(50) = 3 +/- 0.1 nm and >5 microm for wild-type and His148Leu, respectively). The location of the mutation in an extracellular part of the receptor led us also to test whether senktide, a synthetic NKB analog, may retain ability to stimulate the mutant receptor. However, the signaling activity of the His148Leu receptor in response to senktide was also severely impaired (EC(50) = 1 +/- 1 nm for wild-type and no significant response of His148Leu to 10 microm). Homozygosity for the TACR3 His148Leu mutation leads to failure of sexual maturation in humans, whereas signaling by the mutant receptor in vitro in response to either NKB or senktide is severely impaired. These observations further strengthen the link between NKB, the NKB receptor, and regulation of human reproductive function.

  11. Bilirubin UDP-Glucuronosyltransferase 1A1 (UGT1A1) Gene Promoter Polymorphisms and HPRT, Glycophorin A, and Micronuclei Mutant Frequencies in Human Blood

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grant, D; Hall, I J; Eastmond, D

    2004-10-06

    A dinucleotide repeat polymorphism (5-, 6-, 7-, or 8-TA units) has been identified within the promoter region of UDP-glucuronosyltransferase 1A1 gene (UGT1A1). The 7-TA repeat allele has been associated with elevated serum bilirubin levels that cause a mild hyperbilirubinemia (Gilbert's syndrome). Studies suggest that promoter transcriptional activity of UGT1A1 is inversely related to the number of TA repeats and that unconjugated bilirubin concentration increases directly with the number of TA repeat elements. Because bilirubin is a known antioxidant, we hypothesized that UGT1A1 repeats associated with higher bilirubin may be protective against oxidative damage. We examined the effect of UGT1A1 genotypemore » on somatic mutant frequency in the hypoxanthine-guanine phosphoribosyl-transferase (HPRT) gene in human lymphocytes and the glycophorin A (GPA) gene of red blood cells (both N0, NN mutants), and the frequency of lymphocyte micronuclei (both kinetochore (K) positive or micronuclei K negative) in 101 healthy smoking and nonsmoking individuals. As hypothesized, genotypes containing 7-TA and 8-TA displayed marginally lower GPA{_}NN mutant frequency relative to 5/5, 5/6, 6/6 genotypes (p<0.05). In contrast, our analysis showed that lower expressing UGT1A1 alleles (7-TA and 8-TA) were associated with modestly increased HPRT mutation frequency (p<0.05) while the same low expression genotypes were not significantly associated with micronuclei frequencies (K-positive or K-negative) when compared to high expression genotypes (5-TA and 6-TA). We found weak evidence that UGT1A1 genotypes containing 7-TA and 8-TA were associated with increased GPA{_}N0 mutant frequency relative to 5/5, 5/6, 6/6 genotypes (p<0.05). These data suggest that UGT1A1 genotype may modulate somatic mutation of some types, in some cell lineages, by a mechanism not involving bilirubin antioxidant activity. More detailed studies examining UGT1A1 promoter variation, oxidant/antioxidant balance and genetic damage will be needed.« less

  12. The Role of Zic Genes in Inner Ear Development in the Mouse: Exploring Mutant Mouse Phenotypes

    PubMed Central

    Chervenak, Andrew P.; Bank, Lisa M.; Thomsen, Nicole; Glanville-Jones, Hannah C; Skibo, Jonathan; Millen, Kathleen J.; Arkell, Ruth M.; Barald, Kate F.

    2014-01-01

    Background Murine Zic genes (Zic1-5) are expressed in the dorsal hindbrain and in periotic mesenchyme (POM) adjacent to the developing inner ear. Zic genes are involved in developmental signaling pathways in many organ systems, including the ear, although their exact roles haven't been fully elucidated. This report examines the role of Zic1, Zic2, and Zic4 during inner ear development in mouse mutants in which these Zic genes are affected Results Zic1/Zic4 double mutants don't exhibit any apparent defects in inner ear morphology. By contrast, inner ears from Zic2kd/kd and Zic2Ku/Ku mutants have severe but variable morphological defects in endolymphatic duct/sac and semicircular canal formation and in cochlear extension in the inner ear. Analysis of otocyst patterning in the Zic2Ku/Ku mutants by in situ hybridization showed changes in the expression patterns of Gbx2 and Pax2. Conclusions The experiments provide the first genetic evidence that the Zic genes are required for morphogenesis of the inner ear. Zic2 loss-of-function doesn't prevent initial otocyst patterning but leads to molecular abnormalities concomitant with morphogenesis of the endolymphatic duct. Functional hearing deficits often accompany inner ear dysmorphologies, making Zic2 a novel candidate gene for ongoing efforts to identify the genetic basis of human hearing loss. PMID:25178196

  13. Aspirin increases metabolism through germline signalling to extend the lifespan of Caenorhabditis elegans

    PubMed Central

    Huang, Xiao-Bing; Mu, Xiao-Hui; Wan, Qin-Li; He, Xiao-Ming; Wu, Gui-Sheng

    2017-01-01

    Aspirin is a prototypic cyclooxygenase inhibitor with a variety of beneficial effects on human health. It prevents age-related diseases and delays the aging process. Previous research has shown that aspirin might act through a dietary restriction-like mechanism to extend lifespan. To explore the mechanism of action of aspirin on aging, we determined the whole-genome expression profile of Caenorhabditis elegans treated with aspirin. Transcriptome analysis revealed the RNA levels of genes involved in metabolism were primarily increased. Reproduction has been reported to be associated with metabolism. We found that aspirin did not extend the lifespan or improve the heat stress resistance of germline mutants of glp-1. Furthermore, Oil Red O staining showed that aspirin treatment decreased lipid deposition and increased expression of lipid hydrolysis and fatty acid β-oxidation-related genes. The effect of germline ablation on lifespan was mainly mediated by DAF-12 and DAF-16. Next, we performed genetic analysis with a series of worm mutants and found that aspirin did not further extend the lifespans of daf-12 and daf-16 single mutants, glp-1;daf-12 and glp-1;daf-16 double mutants, or glp-1;daf-12;daf-16 triple mutants. The results suggest that aspirin increase metabolism and regulate germline signalling to activate downstream DAF-12 and DAF-16 to extend lifespan. PMID:28910305

  14. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  15. Mutant HNF-1{alpha} and mutant HNF-1{beta} identified in MODY3 and MODY5 downregulate DPP-IV gene expression in Caco-2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gu Ning; Laboratory of Neurochemistry, Graduate School of Human and Environmental Studies, Kyoto University, Kyoto; Adachi, Tetsuya

    2006-08-04

    Dipeptidylpeptidase IV (DPP-IV) is a well-documented drug target for the treatment of type 2 diabetes. Hepatocyte nuclear factors (HNF)-1{alpha} and HNF-1{beta}, known as the causal genes of MODY3 and MODY5, respectively, have been reported to be involved in regulation of DPP-IV gene expression. But, it is not completely clear (i) that they play roles in regulation of DPP-IV gene expression, and (ii) whether DPP-IV gene activity is changed by mutant HNF-1{alpha} and mutant HNF-1{beta} in MODY3 and MODY5. To explore these questions, we investigated transactivation effects of wild HNF-1{alpha} and 13 mutant HNF-1{alpha}, as well as wild HNF-1{beta} and 2more » mutant HNF-1{beta}, on DPP-IV promoter luciferase gene in Caco-2 cells by means of a transient experiment. Both wild HNF-1{alpha} and wild HNF-1{beta} significantly transactivated DPP-IV promoter, but mutant HNF-1{alpha} and mutant HNF-1{beta} exhibited low transactivation activity. Moreover, to study whether mutant HNF-1{alpha} and mutant HNF-1{beta} change endogenous DPP-IV enzyme activity, we produced four stable cell lines from Caco-2 cells, in which wild HNF-1{alpha} or wild HNF-1{beta}, or else respective dominant-negative mutant HNF-1{alpha}T539fsdelC or dominant-negative mutant HNF-1{beta}R177X, was stably expressed. We found that DPP-IV gene expression and enzyme activity were significantly increased in wild HNF-1{alpha} cells and wild HNF-1{beta} cells, whereas they decreased in HNF-1{alpha}T539fsdelC cells and HNF-1{beta}R177X cells, compared with DPP-IV gene expression and enzyme activity in Caco-2 cells. These results suggest that both wild HNF-1{alpha} and wild HNF-1{beta} have a stimulatory effect on DPP-IV gene expression, but that mutant HNF-1{alpha} and mutant HNF-1{beta} attenuate the stimulatory effect.« less

  16. Stimulation of 5-HT2C Receptors Improves Cognitive Deficits Induced by Human Tryptophan Hydroxylase 2 Loss of Function Mutation

    PubMed Central

    Del'Guidice, Thomas; Lemay, Francis; Lemasson, Morgane; Levasseur-Moreau, Jean; Manta, Stella; Etievant, Adeline; Escoffier, Guy; Doré, François Y; Roman, François S; Beaulieu, Jean-Martin

    2014-01-01

    Polymorphisms in the gene encoding the serotonin synthesis enzyme Tph2 have been identified in mental illnesses, including bipolar disorder, major depression, autism, schizophrenia, and ADHD. Deficits in cognitive flexibility and perseverative behaviors are shared common symptoms in these disorders. However, little is known about the impact of Tph2 gene variants on cognition. Mice expressing a human TPH2 variant (Tph2-KI) were used to investigate cognitive consequences of TPH2 loss of function and pharmacological treatments. We applied a recently developed behavioral assay, the automated H-maze, to study cognitive functions in Tph2-KI mice. This assay involves the consecutive discovery of three different rules: a delayed alternation task, a non-alternation task, and a delayed reversal task. Possible contribution of locomotion, reward, and sensory perception were also investigated. The expression of loss-of-function mutant Tph2 in mice was associated with impairments in reversal learning and cognitive flexibility, accompanied by perseverative behaviors similar to those observed in human clinical studies. Pharmacological restoration of 5-HT synthesis with 5-hydroxytryptophan or treatment with the 5-HT2C receptor agonist CP809.101 reduced cognitive deficits in Tph2-KI mice and abolished perseveration. In contrast, treatment with the psychostimulant methylphenidate exacerbated cognitive deficits in mutant mice. Results from this study suggest a contribution of TPH2 in the regulation of cognition. Furthermore, identification of a role for a 5-HT2 receptor agonist as a cognition-enhancing agent in mutant mice suggests a potential avenue to explore for the personalized treatment of cognitive symptoms in humans with reduced 5-HT synthesis and TPH2 polymorphisms. PMID:24196946

  17. Design and Characterization of a Human Monoclonal Antibody that Modulates Mutant Connexin 26 Hemichannels Implicated in Deafness and Skin Disorders

    PubMed Central

    Xu, Liang; Carrer, Andrea; Zonta, Francesco; Qu, Zhihu; Ma, Peixiang; Li, Sheng; Ceriani, Federico; Buratto, Damiano; Crispino, Giulia; Zorzi, Veronica; Ziraldo, Gaia; Bruno, Francesca; Nardin, Chiara; Peres, Chiara; Mazzarda, Flavia; Salvatore, Anna M.; Raspa, Marcello; Scavizzi, Ferdinando; Chu, Youjun; Xie, Sichun; Yang, Xuemei; Liao, Jun; Liu, Xiao; Wang, Wei; Wang, Shanshan; Yang, Guang; Lerner, Richard A.; Mammano, Fabio

    2017-01-01

    Background: Mutations leading to changes in properties, regulation, or expression of connexin-made channels have been implicated in 28 distinct human hereditary diseases. Eight of these result from variants of connexin 26 (Cx26), a protein critically involved in cell-cell signaling in the inner ear and skin. Lack of non-toxic drugs with defined mechanisms of action poses a serious obstacle to therapeutic interventions for diseases caused by mutant connexins. In particular, molecules that specifically modulate connexin hemichannel function without affecting gap junction channels are considered of primary importance for the study of connexin hemichannel role in physiological as well as pathological conditions. Monoclonal antibodies developed in the last three decades have become the most important class of therapeutic biologicals. Recombinant methods permit rapid selection and improvement of monoclonal antibodies from libraries with large diversity. Methods: By screening a combinatorial library of human single-chain fragment variable (scFv) antibodies expressed in phage, we identified a candidate that binds an extracellular epitope of Cx26. We characterized antibody action using a variety of biochemical and biophysical assays in HeLa cells, organotypic cultures of mouse cochlea and human keratinocyte-derived cells. Results: We determined that the antibody is a remarkably efficient, non-toxic, and completely reversible inhibitor of hemichannels formed by connexin 26 and does not affect direct cell-cell communication via gap junction channels. Importantly, we also demonstrate that the antibody efficiently inhibits hyperative mutant Cx26 hemichannels implicated in autosomal dominant non-syndromic hearing impairment accompanied by keratitis and hystrix-like ichthyosis-deafness (KID/HID) syndrome. We solved the crystal structure of the antibody, identified residues that are critical for binding and used molecular dynamics to uncover its mechanism of action. Conclusions: Although further studies will be necessary to validate the effect of the antibody in vivo, the methodology described here can be extended to select antibodies against hemichannels composed by other connexin isoforms and, consequently, to target other pathologies associated with hyperactive hemichannels. Our study highlights the potential of this approach and identifies connexins as therapeutic targets addressable by screening phage display libraries expressing human randomized antibodies. PMID:29018324

  18. Phosphorodiamidate morpholino oligomers suppress mutant huntingtin expression and attenuate neurotoxicity

    PubMed Central

    Sun, Xin; Marque, Leonard O.; Cordner, Zachary; Pruitt, Jennifer L.; Bhat, Manik; Li, Pan P.; Kannan, Geetha; Ladenheim, Ellen E.; Moran, Timothy H.; Margolis, Russell L.; Rudnicki, Dobrila D.

    2014-01-01

    Huntington's disease (HD) is a neurodegenerative disorder caused by a CAG trinucleotide repeat expansion in the huntingtin (HTT) gene. Disease pathogenesis derives, at least in part, from the long polyglutamine tract encoded by mutant HTT. Therefore, considerable effort has been dedicated to the development of therapeutic strategies that significantly reduce the expression of the mutant HTT protein. Antisense oligonucleotides (ASOs) targeted to the CAG repeat region of HTT transcripts have been of particular interest due to their potential capacity to discriminate between normal and mutant HTT transcripts. Here, we focus on phosphorodiamidate morpholino oligomers (PMOs), ASOs that are especially stable, highly soluble and non-toxic. We designed three PMOs to selectively target expanded CAG repeat tracts (CTG22, CTG25 and CTG28), and two PMOs to selectively target sequences flanking the HTT CAG repeat (HTTex1a and HTTex1b). In HD patient–derived fibroblasts with expanded alleles containing 44, 77 or 109 CAG repeats, HTTex1a and HTTex1b were effective in suppressing the expression of mutant and non-mutant transcripts. CTGn PMOs also suppressed HTT expression, with the extent of suppression and the specificity for mutant transcripts dependent on the length of the targeted CAG repeat and on the CTG repeat length and concentration of the PMO. PMO CTG25 reduced HTT-induced cytotoxicity in vitro and suppressed mutant HTT expression in vivo in the N171-82Q transgenic mouse model. Finally, CTG28 reduced mutant HTT expression and improved the phenotype of HdhQ7/Q150 knock-in HD mice. These data demonstrate the potential of PMOs as an approach to suppressing the expression of mutant HTT. PMID:25035419

  19. Characterization of Staphylococcus aureus mutants expressing reduced susceptibility to common house-cleaners

    PubMed Central

    Davis, A.O.; O’Leary, J.O.; Muthaiyan, A.; Langevin, M.J.; Delgado, A.; Abalos, A.T.; Fajardo, A.R.; Marek, J.; Wilkinson, B.J.; Gustafson, J.E.

    2013-01-01

    Aims To characterize mutants of Staphylococcus aureus expressing reduced susceptibility to house cleaners (HC), assess the impact of the alternative sigma factor SigB on HC susceptibility, and determine the MIC of clinical methicillin-resistant S. aureus (MRSA) to a HC. Methods and Results Susceptibility to HC, HC components, H2O2, vancomycin and oxacillin and physiological parameters were determined for HC-reduced susceptibility (HCRS) mutants, parent strain COL and COLsigB::kan. HCRS mutants selected with three HC expressed reduced susceptibility to multiple HC, HC components, H2O2 and vancomycin. Two unique HCRS mutants also lost the methicillin resistance determinant. In addition, all HCRS mutants exhibited better growth at two temperatures, and one HCRS mutant expressed reduced carotenoid production. COLsigB::kan demonstrated increased susceptibility to all HC and many HC components. sigB operon mutations were not detected in one HCRS mutant background. Of 76 clinical MRSA, 20 exhibited reduced susceptibility to a HC. Conclusions HCRS mutants demonstrate altered susceptibility to multiple antimicrobials. While sigB is required for full HC resistance, one HCRS mechanism does not involve sigB operon mutations. Clinical MRSA expressing reduced susceptibility to a common HC were detected. Significance and Impact of the Study This study suggests that HCRS mutants are not protected against, nor selected by, practical HC concentrations. PMID:15659191

  20. Sen1, the homolog of human Senataxin, is critical for cell survival through regulation of redox homeostasis, mitochondrial function, and the TOR pathway in Saccharomyces cerevisiae.

    PubMed

    Sariki, Santhosh Kumar; Sahu, Pushpendra Kumar; Golla, Upendarrao; Singh, Vikash; Azad, Gajendra Kumar; Tomar, Raghuvir S

    2016-11-01

    Mutations in the Senataxin gene, SETX are known to cause the neurodegenerative disorders, ataxia with oculomotor apraxia type 2 (AOA2), and amyotrophic lateral sclerosis 4 (ALS4). However, the mechanism underlying disease pathogenesis is still unclear. The Senataxin N-terminal protein-interaction and C-terminal RNA/DNA helicase domains are conserved in the Saccharomyces cerevisiae homolog, Sen1p. Using genome-wide expression analysis, we first show alterations in key cellular pathways such as: redox, unfolded protein response, and TOR in the yeast sen1 ΔN mutant (N-terminal truncation). This mutant exhibited growth defects on nonfermentable carbon sources, was sensitive to oxidative stress, and showed severe loss of mitochondrial DNA. The growth defect could be partially rescued upon supplementation with reducing agents and antioxidants. Furthermore, the mutant showed higher levels of reactive oxygen species, lower UPR activity, and alterations in mitochondrial membrane potential, increase in vacuole acidity, free calcium ions in the cytosol, and resistance to rapamycin treatment. Notably, the sen1 ∆N mutant showed increased cell death and shortened chronological life span. Given the strong similarity of the yeast and human Sen1 proteins, our study thus provides a mechanism for the progressive neurological disorders associated with mutations in human senataxin. © 2016 Federation of European Biochemical Societies.

  1. Dysregulation of gene expression in the striatum of BACHD rats expressing full-length mutant huntingtin and associated abnormalities on molecular and protein levels.

    PubMed

    Yu-Taeger, Libo; Bonin, Michael; Stricker-Shaver, Janice; Riess, Olaf; Nguyen, Hoa Huu Phuc

    2017-05-01

    Huntington disease (HD) is an autosomal dominantly inherited neurodegenerative disorder caused by a CAG repeat expansion in the gene coding for the huntingtin protein (HTT). Mutant HTT (mHTT) has been proposed to cause neuronal dysfunction and neuronal loss through multiple mechanisms. Transcriptional changes may be a core pathogenic feature of HD. Utilizing the Affymetrix platform we performed a genome-wide RNA expression analysis in two BACHD transgenic rat lines (TG5 and TG9) at 12 months of age, both of which carry full-length human mHTT but with different expression levels. By defining the threshold of significance at p < 0.01, we found 1608 genes and 871 genes differentially expressed in both TG5 and TG9 rats when compared to the wild type littermates, respectively. We only chose the highly up-/down-regulated genes for further analysis by setting an additional threshold of 1.5 fold change. Comparing gene expression profiles of human HD brains and BACHD rats revealed a high concordance in both functional and IPA (Ingenuity Pathway Analysis) canonical pathways relevant to HD. In addition, we investigated the causes leading to gene expression changes at molecular and protein levels in BACHD rats including the involvement of polyQ-containing transcription factors TATA box-binding protein (TBP), Sp1 and CBP as well as the chromatin structure. We demonstrate that the BACHD rat model recapitulates the gene expression changes of the human disease supporting its role as a preclinical research animal model. We also show for the first time that TFIID complex formation is reduced, while soluble TBP is increased in an HD model. This finding suggests that mHTT is a competitor instead of a recruiter of polyQ-containing transcription factors in the transcription process in HD. Copyright © 2017 Elsevier Ltd. All rights reserved.

  2. Nppa and Nppb act redundantly during zebrafish cardiac development to confine AVC marker expression and reduce cardiac jelly volume.

    PubMed

    Grassini, Daniela R; Lagendijk, Anne K; De Angelis, Jessica E; Da Silva, Jason; Jeanes, Angela; Zettler, Nicole; Bower, Neil I; Hogan, Benjamin M; Smith, Kelly A

    2018-05-11

    Atrial natriuretic peptide ( nppa/anf ) and brain natriuretic peptide ( nppb/bnp ) form a gene cluster with expression in the chambers of the developing heart. Despite restricted expression, a function in cardiac development has not been demonstrated by mutant analysis. This is attributed to functional redundancy however their genomic location in cis has impeded formal analysis. Using genome-editing, we generated mutants for nppa and nppb and found single mutants indistinguishable from wildtype whereas nppa / nppb double mutants display heart morphogenesis defects and pericardial oedema. Analysis of atrioventricular canal (AVC) markers show expansion of bmp4 , tbx2b, has2 and versican expression into the atrium of double mutants. This expanded expression correlates with increased extracellular matrix in the atrium. Using a biosensor for Hyaluronic acid to measure the cardiac jelly (cardiac extracellular matrix), we confirm cardiac jelly expansion in nppa / nppb double mutants. Finally, bmp4 knockdown rescues the expansion of has2 expression and cardiac jelly in double mutants. This definitively shows that nppa and nppb function redundantly during cardiac development to restrict gene expression to the AVC, preventing excessive cardiac jelly synthesis in the atrial chamber. © 2018. Published by The Company of Biologists Ltd.

  3. A mutation in the mitochondrial protein UQCRB promotes angiogenesis through the generation of mitochondrial reactive oxygen species

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chang, Junghwa; Jung, Hye Jin; Jeong, Seung Hun

    2014-12-12

    Highlights: • We constructed mitochondrial protein UQCRB mutant stable cell lines on the basis of a human case report. • These mutant cell lines exhibit pro-angiogenic activity with enhanced VEGF expression. • Proliferation of mutant cell lines was regulated by UQCRB inhibitors. • UQCRB may have a functional role in angiogenesis. - Abstract: Ubiquinol-cytochrome c reductase binding protein (UQCRB) is one of the subunits of mitochondrial complex III and is a target protein of the natural anti-angiogenic small molecule terpestacin. Previously, the biological role of UQCRB was thought to be limited to the maintenance of complex III. However, the identificationmore » and validation of UQCRB as a target protein of terpestacin enabled the role of UQCRB in oxygen sensing and angiogenesis to be elucidated. To explore the biological role of this protein further, UQCRB mutant stable cell lines were generated on the basis of a human case report. We demonstrated that these cell lines exhibited glycolytic and pro-angiogenic activities via mitochondrial reactive oxygen species (mROS)-mediated HIF1 signal transduction. Furthermore, a morphological abnormality in mitochondria was detected in UQCRB mutant stable cell lines. In addition, the proliferative effect of the UQCRB mutants was significantly regulated by the UQCRB inhibitors terpestacin and A1938. Collectively, these results provide a molecular basis for UQCRB-related biological processes and reveal potential key roles of UQCRB in angiogenesis and mitochondria-mediated metabolic disorders.« less

  4. Virulence gene regulation by CvfA, a putative RNase: the CvfA-enolase complex in Streptococcus pyogenes links nutritional stress, growth-phase control, and virulence gene expression.

    PubMed

    Kang, Song Ok; Caparon, Michael G; Cho, Kyu Hong

    2010-06-01

    Streptococcus pyogenes, a multiple-auxotrophic human pathogen, regulates virulence gene expression according to nutritional availability during various stages in the infection process or in different infection sites. We discovered that CvfA influenced the expression of virulence genes according to growth phase and nutritional status. The influence of CvfA in C medium, rich in peptides and poor in carbohydrates, was most pronounced at the stationary phase. Under these conditions, up to 30% of the transcriptome exhibited altered expression; the levels of expression of multiple virulence genes were altered, including the genes encoding streptokinase, CAMP factor, streptolysin O, M protein (more abundant in the CvfA(-) mutant), SpeB, mitogenic factor, and streptolysin S (less abundant). The increase of carbohydrates or peptides in media restored the levels of expression of the virulence genes in the CvfA(-) mutant to wild-type levels (emm, ska, and cfa by carbohydrates; speB by peptides). Even though the regulation of gene expression dependent on nutritional stress is commonly linked to the stringent response, the levels of ppGpp were not altered by deletion of cvfA. Instead, CvfA interacted with enolase, implying that CvfA, a putative RNase, controls the transcript decay rates of virulence factors or their regulators according to nutritional status. The virulence of CvfA(-) mutants was highly attenuated in murine models, indicating that CvfA-mediated gene regulation is necessary for the pathogenesis of S. pyogenes. Taken together, the CvfA-enolase complex in S. pyogenes is involved in the regulation of virulence gene expression by controlling RNA degradation according to nutritional stress.

  5. Nav1.7-A1632G Mutation from a Family with Inherited Erythromelalgia: Enhanced Firing of Dorsal Root Ganglia Neurons Evoked by Thermal Stimuli.

    PubMed

    Yang, Yang; Huang, Jianying; Mis, Malgorzata A; Estacion, Mark; Macala, Lawrence; Shah, Palak; Schulman, Betsy R; Horton, Daniel B; Dib-Hajj, Sulayman D; Waxman, Stephen G

    2016-07-13

    Voltage-gated sodium channel Nav1.7 is a central player in human pain. Mutations in Nav1.7 produce several pain syndromes, including inherited erythromelalgia (IEM), a disorder in which gain-of-function mutations render dorsal root ganglia (DRG) neurons hyperexcitable. Although patients with IEM suffer from episodes of intense burning pain triggered by warmth, the effects of increased temperature on DRG neurons expressing mutant Nav1.7 channels have not been well documented. Here, using structural modeling, voltage-clamp, current-clamp, and multielectrode array recordings, we have studied a newly identified Nav1.7 mutation, Ala1632Gly, from a multigeneration family with IEM. Structural modeling suggests that Ala1632 is a molecular hinge and that the Ala1632Gly mutation may affect channel gating. Voltage-clamp recordings revealed that the Nav1.7-A1632G mutation hyperpolarizes activation and depolarizes fast-inactivation, both gain-of-function attributes at the channel level. Whole-cell current-clamp recordings demonstrated increased spontaneous firing, lower current threshold, and enhanced evoked firing in rat DRG neurons expressing Nav1.7-A1632G mutant channels. Multielectrode array recordings further revealed that intact rat DRG neurons expressing Nav1.7-A1632G mutant channels are more active than those expressing Nav1.7 WT channels. We also showed that physiologically relevant thermal stimuli markedly increase the mean firing frequencies and the number of active rat DRG neurons expressing Nav1.7-A1632G mutant channels, whereas the same thermal stimuli only increase these parameters slightly in rat DRG neurons expressing Nav1.7 WT channels. The response of DRG neurons expressing Nav1.7-A1632G mutant channels upon increase in temperature suggests a cellular basis for warmth-triggered pain in IEM. Inherited erythromelalgia (IEM), a severe pain syndrome characterized by episodes of intense burning pain triggered by warmth, is caused by mutations in sodium channel Nav1.7, which are preferentially expressed in sensory and sympathetic neurons. More than 20 gain-of-function Nav1.7 mutations have been identified from IEM patients, but the question of how warmth triggers episodes of pain in IEM has not been well addressed. Combining multielectrode array, voltage-clamp, and current-clamp recordings, we assessed a newly identified IEM mutation (Nav1.7-A1632G) from a multigeneration family. Our data demonstrate gain-of-function attributes at the channel level and differential effects of physiologically relevant thermal stimuli on the excitability of DRG neurons expressing mutant and WT Nav1.7 channels, suggesting a cellular mechanism for warmth-triggered pain episodes in IEM patients. Copyright © 2016 the authors 0270-6474/16/367512-12$15.00/0.

  6. Maternal topoisomerase II alpha, not topoisomerase II beta, enables embryonic development of zebrafish top2a-/- mutants

    PubMed Central

    2011-01-01

    Background Genetic alterations in human topoisomerase II alpha (TOP2A) are linked to cancer susceptibility. TOP2A decatenates chromosomes and thus is necessary for multiple aspects of cell division including DNA replication, chromosome condensation and segregation. Topoisomerase II alpha is also required for embryonic development in mammals, as mouse Top2a knockouts result in embryonic lethality as early as the 4-8 cell stage. The purpose of this study was to determine whether the extended developmental capability of zebrafish top2a mutants arises from maternal expression of top2a or compensation from its top2b paralogue. Results Here, we describe bloody minded (blm), a novel mutant of zebrafish top2a. In contrast to mouse Top2a nulls, zebrafish top2a mutants survive to larval stages (4-5 day post fertilization). Developmental analyses demonstrate abundant expression of maternal top2a but not top2b. Inhibition or poisoning of maternal topoisomerase II delays embryonic development by extending the cell cycle M-phase. Zygotic top2a and top2b are co-expressed in the zebrafish CNS, but endogenous or ectopic top2b RNA appear unable to prevent the blm phenotype. Conclusions We conclude that maternal top2a enables zebrafish development before the mid-zygotic transition (MZT) and that zebrafish top2a and top2b are not functionally redundant during development after activation of the zygotic genome. PMID:22111588

  7. Decreased seed oil production in FUSCA3 Brassica napus mutant plants.

    PubMed

    Elahi, Nosheen; Duncan, Robert W; Stasolla, Claudio

    2015-11-01

    Canola (Brassica napus L.) oil is extensively utilized for human consumption and industrial applications. Among the genes regulating seed development and participating in oil accumulation is FUSCA3 (FUS3), a member of the plant-specific B3-domain family of transcription factors. To evaluate the role of this gene during seed storage deposition, three BnFUSCA3 (BnFUS3) TILLING mutants were generated. Mutations occurring downstream of the B3 domain reduced silique number and repressed seed oil level resulting in increased protein content in developing seeds. BnFUS3 mutant seeds also had increased levels of linoleic acid, possibly due to the reduced expression of ω-3 FA DESATURASE (FAD3). These observed phenotypic alterations were accompanied by the decreased expression of genes encoding transcription factors stimulating fatty acid (FA) synthesis: LEAFY COTYLEDON1 and 2 (LEC1 and 2) ABSCISIC ACID-INSENSITIVE 3 (BnABI3) and WRINKLED1 (WRI1). Additionally, expression of genes encoding enzymes involved in sucrose metabolism, glycolysis, and FA modifications were down-regulated in developing seeds of the mutant plants. Collectively, these transcriptional changes support altered sucrose metabolism and reduced glycolytic activity, diminishing the carbon pool available for the synthesis of FA and ultimately seed oil production. Based on these observations, it is suggested that targeted manipulations of BnFUS3 can be used as a tool to influence oil accumulation in the economically important species B. napus. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  8. Constitutive activation of MEK1 in chondrocytes causes Stat1-independent achondroplasia-like dwarfism and rescues the Fgfr3-deficient mouse phenotype

    PubMed Central

    Murakami, Shunichi; Balmes, Gener; McKinney, Sandra; Zhang, Zhaoping; Givol, David; de Crombrugghe, Benoit

    2004-01-01

    We generated transgenic mice that express a constitutively active mutant of MEK1 in chondrocytes. These mice showed a dwarf phenotype similar to achondroplasia, the most common human dwarfism, caused by activating mutations in FGFR3. These mice displayed incomplete hypertrophy of chondrocytes in the growth plates and a general delay in endochondral ossification, whereas chondrocyte proliferation was unaffected. Immunohistochemical analysis of the cranial base in transgenic embryos showed reduced staining for collagen type X and persistent expression of Sox9 in chondrocytes. These observations indicate that the MAPK pathway inhibits hypertrophic differentiation of chondrocytes and negatively regulates bone growth without inhibiting chondrocyte proliferation. Expression of a constitutively active mutant of MEK1 in chondrocytes of Fgfr3-deficient mice inhibited skeletal overgrowth, strongly suggesting that regulation of bone growth by FGFR3 is mediated at least in part by the MAPK pathway. Although loss of Stat1 restored the reduced chondrocyte proliferation in mice expressing an achondroplasia mutant of Fgfr3, it did not rescue the reduced hypertrophic zone, the delay in formation of secondary ossification centers, and the achondroplasia-like phenotype. These observations suggest a model in which Fgfr3 signaling inhibits bone growth by inhibiting chondrocyte differentiation through the MAPK pathway and by inhibiting chondrocyte proliferation through Stat1. PMID:14871928

  9. Evidence for a functional link between Dd-STATa and Dd-PIAS, a Dictyostelium PIAS homologue.

    PubMed

    Kawata, Takefumi; Hirano, Tatsunori; Ogasawara, Shun; Aoshima, Ryota; Yachi, Ayako

    2011-09-01

    Several mammalian protein families inhibit the activity of signal transducer and activator of transcription (STAT) proteins. The protein inhibitor of activated STAT (PIAS) was initially identified through its ability to interact with human STAT proteins. We isolated a gene (pisA) encoding a Dictyostelium orthologue of PIAS, Dd-PIAS, which possesses almost all the representative motifs and domains of mammalian PIAS proteins. A Dd-PIAS null mutant strain displays a normal terminal morphology but with accelerated development once cells are aggregated. In contrast, Dd-PIAS overexpressor strains demonstrate delayed aggregation, almost no slug phototaxis, impaired slug motility, and a prolonged slug migration period. This strain is a near phenocopy of the Dd-STATa null mutant, although it eventually forms a fruiting body, albeit inefficiently. The expression of several Dd-STATa-activated genes is upregulated in the Dd-PIAS null mutant and there is ectopic expression of pstAB makers. The concentration of a PIAS-green fluorescent protein (GFP) fusion protein, expressed under the PIAS promoter, is greatest in the pstO cells and gradually decreases with proximity to the tip of the slug and culminant: a pattern diametrically opposite to that of Dd-STATa. Our results suggest a functional interrelationship between Dd-PIAS and Dd-STATa that influences gene expression and development. © 2011 The Authors. Development, Growth & Differentiation © 2011 Japanese Society of Developmental Biologists.

  10. Characterization of neuronal cell death in the spiral ganglia of a mouse model of endolymphatic hydrops.

    PubMed

    Semaan, Maroun T; Zheng, Qing Y; Han, Fengchan; Zheng, Yuxi; Yu, Heping; Heaphy, John C; Megerian, Cliff A

    2013-04-01

    Spiral ganglion neurons (SGN) in the Phex male mouse, a murine model of postnatal endolymphatic hydrops (ELH) undergo progressive deterioration reminiscent of human and other animal models of ELH with features suggesting apoptosis as an important mechanism. Histologic analysis of the mutant's cochlea demonstrates ELH by postnatal Day (P) 21 and SGN loss by P90. The SGN loss seems to occur in a consistent topographic pattern beginning at the cochlear apex. SGN were counted at P60, P90, and P120. Semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR), quantitative PCR, and immunohistochemical analyses of activated caspase-3, caspase-8, and caspase-9 were performed on cochlear sections obtained from mutants and controls. Terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labeling assay (TUNEL) was carried out on 2 mutants and 2 controls. Corrected SGN counts in control mice were greater in the apical turn of the cochleae at P90 and P120, respectively (p < 0.01). Increased expression of activated caspase-3, caspase-8, and caspase-9 was seen in the mutant. At later time points, activated caspase expression gradually declined in the apical turns and increased in basal turns of the cochlea. Quantitative and semiquantitative PCR analysis confirmed increased expression of caspase-3, caspase-8, and caspase-9 at P21 and P40. TUNEL staining demonstrated apoptosis at P90 in the apical and basal turns of the mutant cochleae. SGN degeneration in the Phex /Y mouse seems to mimic patterns observed in other animals with ELH. Apoptosis plays an important role in the degeneration of the SGN in the Phex male mouse.

  11. New VMD2 gene mutations identified in patients affected by Best vitelliform macular dystrophy

    PubMed Central

    Marchant, D; Yu, K; Bigot, K; Roche, O; Germain, A; Bonneau, D; Drouin‐Garraud, V; Schorderet, D F; Munier, F; Schmidt, D; Neindre, P Le; Marsac, C; Menasche, M; Dufier, J L; Fischmeister, R; Hartzell, C; Abitbol, M

    2007-01-01

    Purpose The mutations responsible for Best vitelliform macular dystrophy (BVMD) are found in a gene called VMD2. The VMD2 gene encodes a transmembrane protein named bestrophin‐1 (hBest1) which is a Ca2+‐sensitive chloride channel. This study was performed to identify disease‐specific mutations in 27 patients with BVMD. Because this disease is characterised by an alteration in Cl− channel function, patch clamp analysis was used to test the hypothesis that one of the VMD2 mutated variants causes the disease. Methods Direct sequencing analysis of the 11 VMD2 exons was performed to detect new abnormal sequences. The mutant of hBest1 was expressed in HEK‐293 cells and the associated Cl− current was examined using whole‐cell patch clamp analysis. Results Six new VMD2 mutations were identified, located exclusively in exons four, six and eight. One of these mutations (Q293H) was particularly severe. Patch clamp analysis of human embryonic kidney cells expressing the Q293H mutant showed that this mutant channel is non‐functional. Furthermore, the Q293H mutant inhibited the function of wild‐type bestrophin‐1 channels in a dominant negative manner. Conclusions This study provides further support for the idea that mutations in VMD2 are a necessary factor for Best disease. However, because variable expressivity of VMD2 was observed in a family with the Q293H mutation, it is also clear that a disease‐linked mutation in VMD2 is not sufficient to produce BVMD. The finding that the Q293H mutant does not form functional channels in the membrane could be explained either by disruption of channel conductance or gating mechanisms or by improper trafficking of the protein to the plasma membrane. PMID:17287362

  12. Implications of fALS Mutations on Sod1 Function and Oligomerization in Cell Models.

    PubMed

    Brasil, Aline A; Magalhães, Rayne S S; De Carvalho, Mariana D C; Paiva, Isabel; Gerhardt, Ellen; Pereira, Marcos D; Outeiro, Tiago F; Eleutherio, Elis C A

    2018-06-01

    Among the familial forms of amyotrophic lateral sclerosis (fALS), 20% are associated with the Cu,Zn-superoxide dismutase (Sod1). fALS is characterized by the accumulation of aggregated proteins and the increase in oxidative stress markers. Here, we used the non-invasive bimolecular fluorescence complementation (BiFC) assay in human H4 cells to investigate the kinetics of aggregation and subcellular localization of Sod1 mutants. We also studied the effect of the different Sod1 mutants to respond against oxidative stress by following the levels of reactive oxygen species (ROS) after treatment with hydrogen peroxide. Our results showed that only 30% of cells transfected with A4VSod1 showed no inclusions while for the other Sod1 mutants tested (L38V, G93A and G93C), this percentage was at least 70%. In addition, we found that 10% of cells transfected with A4VSod1 displayed more than five inclusions per cell and that A4V and G93A Sod1 formed inclusions more rapidly than L38V and G93C Sod1. Expression of WTSod1 significantly decreased the intracellular oxidation levels in comparison with expression of fALS Sod1 mutants, suggesting the mutations induce a functional impairment. All fALS mutations impaired nuclear localization of Sod1, which is important for maintaining genomic stability. Consistently, expression of WTSod1, but not of fALS Sod1 mutants, reduced DNA damage, as measured by the comet assay. Altogether, our study sheds light into the effects of fALS Sod1 mutations on inclusion formation, dynamics, and localization as well as on antioxidant response, opening novel avenues for investigating the role of fALS Sod1 mutations in pathogenesis.

  13. Dental and Cranial Pathologies in Mice Lacking the Cl−/H+-Exchanger ClC-7

    PubMed Central

    WEN, Xin; LACRUZ, Rodrigo S.; PAINE, Michael L.

    2015-01-01

    ClC-7 is a 2Cl−/1H+-exchanger expressed at late endosomes and lysosomes, as well as the ruffled border of osteoclasts. ClC-7 deficiencies in mice and humans lead to impaired osteoclast function and therefore osteopetrosis. Failure of tooth eruption is also apparent in ClC-7 mutant animals, and this has been attributed to the osteoclast dysfunction and the subsequent defect in alveolar bone resorptive activity surrounding tooth roots. Ameloblasts also express ClC-7, and this study aims to determine the significance of ClC-7 in enamel formation by examining the dentitions of ClC-7 mutant mice. Micro-CT analysis revealed that the molar teeth of 3-week old ClC-7 mutant mice had no roots, and the incisors were smaller than their age-matched controls. Despite these notable developmental differences, the enamel and dentin densities of the mutant mice were comparable to those of the wild type littermates. Scanning electron microscopy (SEM) showed normal enamel crystallite and prismatic organization in the ClC-7 mutant mice, although the enamel was thinner (hypoplastic) than in controls. These results suggested that ClC-7 was not critical to enamel and dentin formation, and the observed tooth defects may be related more to a resulting alveolar bone phenotype. Micro-CT analysis also revealed abnormal features in the calvarial bones of the mutant mice. The cranial sutures in ClC-7 mutant mice remained open compared to the closed sutures seen in the control mice at 3 weeks. These data demonstrate that ClC-7 deficiency impacts the development of the dentition and calvaria, but does not significantly disrupt amelogenesis. PMID:25663454

  14. Amyloid precursor protein-induced axonopathies are independent of amyloid-beta peptides.

    PubMed

    Stokin, Gorazd B; Almenar-Queralt, Angels; Gunawardena, Shermali; Rodrigues, Elizabeth M; Falzone, Tomás; Kim, Jungsu; Lillo, Concepción; Mount, Stephanie L; Roberts, Elizabeth A; McGowan, Eileen; Williams, David S; Goldstein, Lawrence S B

    2008-11-15

    Overexpression of amyloid precursor protein (APP), as well as mutations in the APP and presenilin genes, causes rare forms of Alzheimer's disease (AD). These genetic changes have been proposed to cause AD by elevating levels of amyloid-beta peptides (Abeta), which are thought to be neurotoxic. Since overexpression of APP also causes defects in axonal transport, we tested whether defects in axonal transport were the result of Abeta poisoning of the axonal transport machinery. Because directly varying APP levels also alters APP domains in addition to Abeta, we perturbed Abeta generation selectively by combining APP transgenes in Drosophila and mice with presenilin-1 (PS1) transgenes harboring mutations that cause familial AD (FAD). We found that combining FAD mutant PS1 with FAD mutant APP increased Abeta42/Abeta40 ratios and enhanced amyloid deposition as previously reported. Surprisingly, however, this combination suppressed rather than increased APP-induced axonal transport defects in both Drosophila and mice. In addition, neuronal apoptosis induced by expression of FAD mutant human APP in Drosophila was suppressed by co-expressing FAD mutant PS1. We also observed that directly elevating Abeta with fusions to the Familial British and Danish Dementia-related BRI protein did not enhance axonal transport phenotypes in APP transgenic mice. Finally, we observed that perturbing Abeta ratios in the mouse by combining FAD mutant PS1 with FAD mutant APP did not enhance APP-induced behavioral defects. A potential mechanism to explain these findings was suggested by direct analysis of axonal transport in the mouse, which revealed that axonal transport or entry of APP into axons is reduced by FAD mutant PS1. Thus, we suggest that APP-induced axonal defects are not caused by Abeta.

  15. Oncolytic reovirus preferentially induces apoptosis in KRAS mutant colorectal cancer cells, and synergizes with irinotecan

    PubMed Central

    Maitra, Radhashree; Seetharam, Raviraja; Tesfa, Lydia; Augustine, Titto A.; Klampfer, Lidija; Coffey, Matthew C.; Mariadason, John M.; Goel, Sanjay

    2014-01-01

    Reovirus is a double stranded RNA virus, with an intrinsic preference for replication in KRAS mutant cells. As 45% of human colorectal cancers (CRC) harbor KRAS mutations, we sought to investigate its efficacy in KRAS mutant CRC cells, and examine its impact in combination with the topoisimerase-1 inhibitor, irinotecan. Reovirus efficacy was examined in the KRAS mutant HCT116, and the isogenic KRAS WT Hke3 cell line, and in the non-malignant rat intestinal epithelial cell line. Apoptosis was determined by flow cytometry and TUNEL staining. Combination treatment with reovirus and irintoecan was investigated in 15 CRC cell lines, including the HCT116 p21 isogenic cell lines. Reovirus preferentially induced apoptosis in KRAS mutant HCT116 cells compared to its isogenic KRAS WT derivative, and in KRAS mutant IEC cells. Reovirus showed a greater degree of caspase 3 activation with PARP 1 cleavage, and preferential inhibition of p21 protein expression in KRAS mutant cells. Reovirus synergistically induced growth inhibition when combined with irinotecan. This synergy was lost upon p21 gene knock out. Reovirus preferentially induces apoptosis in KRAS mutant colon cancer cells. Reovirus and irinotecan combination therapy is synergistic, p21 mediated, and represents a novel potential treatment for patients with CRC. PMID:24798549

  16. FoxP2 regulates neurogenesis during embryonic cortical development.

    PubMed

    Tsui, David; Vessey, John P; Tomita, Hideaki; Kaplan, David R; Miller, Freda D

    2013-01-02

    The transcription factor FoxP2 has been associated with the development of human speech but the underlying cellular function of FoxP2 is still unclear. Here we provide evidence that FoxP2 regulates genesis of some intermediate progenitors and neurons in the mammalian cortex, one of the key centers for human speech. Specifically, knockdown of FoxP2 in embryonic cortical precursors inhibits neurogenesis, at least in part by inhibiting the transition from radial glial precursors to neurogenic intermediate progenitors. Moreover, overexpression of human, but not mouse, FoxP2 enhances the genesis of intermediate progenitors and neurons. In contrast, expression of a human FoxP2 mutant that causes vocalization deficits decreases neurogenesis, suggesting that in the murine system human FoxP2 acts as a gain-of-function protein, while a human FoxP2 mutant acts as a dominant-inhibitory protein. These results support the idea that FoxP2 regulates the transition from neural precursors to transit-amplifying progenitors and ultimately neurons, and shed light upon the molecular changes that might contribute to evolution of the mammalian cortex.

  17. Ras-GTP dimers activate the mitogen-activated protein kinase (MAPK) pathway

    DOE PAGES

    Nan, Xiaolin; Tamgüney, Tanja M.; Collisson, Eric A.; ...

    2015-06-16

    Rat sarcoma (Ras) GTPases regulate cell proliferation and survival through effector pathways including Raf-MAPK, and are the most frequently mutated genes in human cancer. Although it is well established that Ras activity requires binding to both GTP and the membrane, details of how Ras operates on the cell membrane to activate its effectors remain elusive. Efforts to target mutant Ras in human cancers to therapeutic benefit have also been largely unsuccessful. Here we show that Ras-GTP forms dimers to activate MAPK. We used quantitative photoactivated localization microscopy (PALM) to analyze the nanoscale spatial organization of PAmCherry1-tagged KRas 4B (hereafter referredmore » to KRas) on the cell membrane under various signaling conditions. We found that at endogenous expression levels KRas forms dimers, and KRas G12D, a mutant that constitutively binds GTP, activates MAPK. Overexpression of KRas leads to formation of higher order Ras nanoclusters. Conversely, at lower expression levels, KRas G12D is monomeric and activates MAPK only when artificially dimerized. Moreover, dimerization and signaling of KRas are both dependent on an intact CAAX (C, cysteine; A, aliphatic; X, any amino acid) motif that is also known to mediate membrane localization. These results reveal a new, dimerization-dependent signaling mechanism of Ras, and suggest Ras dimers as a potential therapeutic target in mutant Ras-driven tumors.« less

  18. Ras-GTP dimers activate the Mitogen-Activated Protein Kinase (MAPK) pathway

    PubMed Central

    Nan, Xiaolin; Tamgüney, Tanja M.; Collisson, Eric A.; Lin, Li-Jung; Pitt, Cameron; Galeas, Jacqueline; Lewis, Sophia; Gray, Joe W.; McCormick, Frank; Chu, Steven

    2015-01-01

    Rat sarcoma (Ras) GTPases regulate cell proliferation and survival through effector pathways including Raf-MAPK, and are the most frequently mutated genes in human cancer. Although it is well established that Ras activity requires binding to both GTP and the membrane, details of how Ras operates on the cell membrane to activate its effectors remain elusive. Efforts to target mutant Ras in human cancers to therapeutic benefit have also been largely unsuccessful. Here we show that Ras-GTP forms dimers to activate MAPK. We used quantitative photoactivated localization microscopy (PALM) to analyze the nanoscale spatial organization of PAmCherry1-tagged KRas 4B (hereafter referred to KRas) on the cell membrane under various signaling conditions. We found that at endogenous expression levels KRas forms dimers, and KRasG12D, a mutant that constitutively binds GTP, activates MAPK. Overexpression of KRas leads to formation of higher order Ras nanoclusters. Conversely, at lower expression levels, KRasG12D is monomeric and activates MAPK only when artificially dimerized. Moreover, dimerization and signaling of KRas are both dependent on an intact CAAX (C, cysteine; A, aliphatic; X, any amino acid) motif that is also known to mediate membrane localization. These results reveal a new, dimerization-dependent signaling mechanism of Ras, and suggest Ras dimers as a potential therapeutic target in mutant Ras-driven tumors. PMID:26080442

  19. Long noncoding RNA Hoxb3os is dysregulated in autosomal dominant polycystic kidney disease and regulates mTOR signaling.

    PubMed

    Aboudehen, Karam; Farahani, Shayan; Kanchwala, Mohammed; Chan, Siu Chiu; Avdulov, Svetlana; Mickelson, Alan; Lee, Dayeon; Gearhart, Micah D; Patel, Vishal; Xing, Chao; Igarashi, Peter

    2018-06-15

    Autosomal dominant polycystic kidney disease (ADPKD) is a debilitating disease that is characterized by the accumulation of numerous fluid-filled cysts in the kidney. ADPKD is primarily caused by mutations in two genes, PKD1 and PKD2 Long noncoding RNAs (lncRNA), defined by a length >200 nucleotides and absence of a long ORF, have recently emerged as epigenetic regulators of development and disease; however, their involvement in PKD has not been explored previously. Here, we performed deep RNA-Seq to identify lncRNAs that are dysregulated in two orthologous mouse models of ADPKD (kidney-specific Pkd1 and Pkd2 mutant mice). We identified a kidney-specific, evolutionarily conserved lncRNA called Hoxb3os that was down-regulated in cystic kidneys from Pkd1 and Pkd2 mutant mice. The human ortholog HOXB3-AS1 was down-regulated in cystic kidneys from ADPKD patients. Hoxb3os was highly expressed in renal tubules in adult WT mice, whereas its expression was lost in the cyst epithelium of mutant mice. To investigate the function of Hoxb3os , we utilized CRISPR/Cas9 to knock out its expression in mIMCD3 cells. Deletion of Hoxb3os resulted in increased phosphorylation of mTOR and its downstream targets, including p70 S6 kinase, ribosomal protein S6, and the translation repressor 4E-BP1. Consistent with activation of mTORC1 signaling, Hoxb3os mutant cells displayed increased mitochondrial respiration. The Hoxb3os mutant phenotype was partially rescued upon re-expression of Hoxb3os in knockout cells. These findings identify Hoxb3os as a novel lncRNA that is down-regulated in ADPKD and regulates mTOR signaling and mitochondrial respiration. © 2018 Aboudehen et al.

  20. Interferon β induces clearance of mutant ataxin 7 and improves locomotion in SCA7 knock-in mice.

    PubMed

    Chort, Alice; Alves, Sandro; Marinello, Martina; Dufresnois, Béatrice; Dornbierer, Jean-Gabriel; Tesson, Christelle; Latouche, Morwena; Baker, Darren P; Barkats, Martine; El Hachimi, Khalid H; Ruberg, Merle; Janer, Alexandre; Stevanin, Giovanni; Brice, Alexis; Sittler, Annie

    2013-06-01

    We showed previously, in a cell model of spinocerebellar ataxia 7, that interferon beta induces the expression of PML protein and the formation of PML protein nuclear bodies that degrade mutant ataxin 7, suggesting that the cytokine, used to treat multiple sclerosis, might have therapeutic value in spinocerebellar ataxia 7. We now show that interferon beta also induces PML-dependent clearance of ataxin 7 in a preclinical model, SCA7(266Q/5Q) knock-in mice, and improves motor function. Interestingly, the presence of mutant ataxin 7 in the mice induces itself the expression of endogenous interferon beta and its receptor. Immunohistological studies in brains from two patients with spinocerebellar ataxia 7 confirmed that these modifications are also caused by the disease in humans. Interferon beta, administered intraperitoneally three times a week in the knock-in mice, was internalized with its receptor in Purkinje and other cells and translocated to the nucleus. The treatment induced PML protein expression and the formation of PML protein nuclear bodies and decreased mutant ataxin 7 in neuronal intranuclear inclusions, the hallmark of the disease. No reactive gliosis or other signs of toxicity were observed in the brain or internal organs. The performance of the SCA7(266Q/5Q) knock-in mice was significantly improved on two behavioural tests sensitive to cerebellar function: the Locotronic® Test of locomotor function and the Beam Walking Test of balance, motor coordination and fine movements, which are affected in patients with spinocerebellar ataxia 7. In addition to motor dysfunction, SCA7(266Q/5Q) mice present abnormalities in the retina as in patients: ataxin 7-positive neuronal intranuclear inclusions that were reduced by interferon beta treatment. Finally, since neuronal death does not occur in the cerebellum of SCA7(266Q/5Q) mice, we showed in primary cell cultures expressing mutant ataxin 7 that interferon beta treatment improves Purkinje cell survival.

  1. Alternative Splicing and Tissue-specific Elastin Misassembly Act as Biological Modifiers of Human Elastin Gene Frameshift Mutations Associated with Dominant Cutis Laxa*

    PubMed Central

    Sugitani, Hideki; Hirano, Eiichi; Knutsen, Russell H.; Shifren, Adrian; Wagenseil, Jessica E.; Ciliberto, Christopher; Kozel, Beth A.; Urban, Zsolt; Davis, Elaine C.; Broekelmann, Thomas J.; Mecham, Robert P.

    2012-01-01

    Elastin is the extracellular matrix protein in vertebrates that provides elastic recoil to blood vessels, the lung, and skin. Because the elastin gene has undergone significant changes in the primate lineage, modeling elastin diseases in non-human animals can be problematic. To investigate the pathophysiology underlying a class of elastin gene mutations leading to autosomal dominant cutis laxa, we engineered a cutis laxa mutation (single base deletion) into the human elastin gene contained in a bacterial artificial chromosome. When expressed as a transgene in mice, mutant elastin was incorporated into elastic fibers in the skin and lung with adverse effects on tissue function. In contrast, only low levels of mutant protein incorporated into aortic elastin, which explains why the vasculature is relatively unaffected in this disease. RNA stability studies found that alternative exon splicing acts as a modifier of disease severity by influencing the spectrum of mutant transcripts that survive nonsense-mediated decay. Our results confirm the critical role of the C-terminal region of tropoelastin in elastic fiber assembly and suggest tissue-specific differences in the elastin assembly pathway. PMID:22573328

  2. The Drosophila mitochondrial translation elongation factor G1 contains a nuclear localization signal and inhibits growth and DPP signaling.

    PubMed

    Trivigno, Catherine; Haerry, Theodor E

    2011-02-25

    Mutations in the human mitochondrial elongation factor G1 (EF-G1) are recessive lethal and cause death shortly after birth. We have isolated mutations in iconoclast (ico), which encodes the highly conserved Drosophila orthologue of EF-G1. We find that EF-G1 is essential during fly development, but its function is not required in every tissue. In contrast to null mutations, missense mutations exhibit stronger, possibly neomorphic phenotypes that lead to premature death during embryogenesis. Our experiments show that EF-G1 contains a secondary C-terminal nuclear localization signal. Expression of missense mutant forms of EF-G1 can accumulate in the nucleus and cause growth and patterning defects and animal lethality. We find that transgenes that encode mutant human EF-G1 proteins can rescue ico mutants, indicating that the underlying problem of the human disease is not just the loss of enzymatic activity. Our results are consistent with a model where EF-G1 acts as a retrograde signal from mitochondria to the nucleus to slow down cell proliferation if mitochondrial energy output is low.

  3. The Drosophila Mitochondrial Translation Elongation Factor G1 Contains a Nuclear Localization Signal and Inhibits Growth and DPP Signaling

    PubMed Central

    Trivigno, Catherine; Haerry, Theodor E.

    2011-01-01

    Mutations in the human mitochondrial elongation factor G1 (EF-G1) are recessive lethal and cause death shortly after birth. We have isolated mutations in iconoclast (ico), which encodes the highly conserved Drosophila orthologue of EF-G1. We find that EF-G1 is essential during fly development, but its function is not required in every tissue. In contrast to null mutations, missense mutations exhibit stronger, possibly neomorphic phenotypes that lead to premature death during embryogenesis. Our experiments show that EF-G1 contains a secondary C-terminal nuclear localization signal. Expression of missense mutant forms of EF-G1 can accumulate in the nucleus and cause growth and patterning defects and animal lethality. We find that transgenes that encode mutant human EF-G1 proteins can rescue ico mutants, indicating that the underlying problem of the human disease is not just the loss of enzymatic activity. Our results are consistent with a model where EF-G1 acts as a retrograde signal from mitochondria to the nucleus to slow down cell proliferation if mitochondrial energy output is low. PMID:21364917

  4. A conserved histidine in human DNLZ/HEP is required for stimulation of HSPA9 ATPase activity.

    PubMed

    Zhai, Peng; Vu, Michael T; Hoff, Kevin G; Silberg, Jonathan J

    2011-05-20

    The DNL-type zinc-finger protein DNLZ regulates the activity and solubility of the human mitochondrial chaperone HSPA9. To identify DNLZ residues that are critical for chaperone regulation, we carried out an alanine mutagenesis scan of charged residues in a W115I mutant of human DNLZ and assessed the effect of each mutation on interactions with HSPA9. All mutants analyzed promote the solubility of HSPA9 upon expression in Escherichia coli. However, binding studies examining the effect of DNLZ mutants on chaperone tryptophan fluorescence identified three mutations (R81A, H107A, and D111A) that decrease DNLZ binding affinity for nucleotide-free chaperone. In addition, ATPase measurements revealed that DNLZ-R81A and DNLZ-D111A both stimulate the catalytic activity HSPA9, whereas DNLZ-H107A does not elicit an increase in activity even when present at a concentration that is 10-fold higher than the level required for half-maximal stimulation by DNLZ. These findings implicate a conserved histidine as critical for DNLZ regulation of mitochondrial HSPA9 catalytic activity. Copyright © 2011 Elsevier Inc. All rights reserved.

  5. Molecular evolution of Theta-class glutathione transferase for enhanced activity with the anticancer drug 1,3-bis-(2-chloroethyl)-1-nitrosourea and other alkylating agents.

    PubMed

    Larsson, Anna-Karin; Shokeer, Abeer; Mannervik, Bengt

    2010-05-01

    Glutathione transferase (GST) displaying enhanced activity with the cytostatic drug 1,3-bis-(2-chloroethyl)-1-nitrosourea (BCNU) and structurally related alkylating agents was obtained by molecular evolution. Mutant libraries created by recursive recombination of cDNA coding for human and rodent Theta-class GSTs were heterologously expressed in Escherichia coli and screened with the surrogate substrate 4-nitrophenethyl bromide (NPB) for enhanced alkyltransferase activity. A mutant with a 70-fold increased catalytic efficiency with NPB, compared to human GST T1-1, was isolated. The efficiency in degrading BCNU had improved 170-fold, significantly more than with the model substrate NPB. The enhanced catalytic activity of the mutant GST was also 2-fold higher with BCNU than wild-type mouse GST T1-1, which is 80-fold more efficient than wild-type human GST T1-1. We propose that GSTs catalyzing inactivation of anticancer drugs may find clinical use in protecting sensitive normal tissues to toxic side-effects in treated patients, and as selectable markers in gene therapy. Copyright 2010 Elsevier Inc. All rights reserved.

  6. Tyrosine kinase receptor c-ros-oncogene 1 inhibition alleviates aberrant bone formation of TWIST-1 haploinsufficient calvarial cells from Saethre-Chotzen syndrome patients.

    PubMed

    Camp, Esther; Anderson, Peter J; Zannettino, Andrew C W; Glackin, Carlotta A; Gronthos, Stan

    2018-09-01

    Saethre-Chotzen syndrome (SCS), associated with TWIST-1 mutations, is characterized by premature fusion of cranial sutures. TWIST-1 haploinsufficiency, leads to alterations in suture mesenchyme cellular gene expression patterns, resulting in aberrant osteogenesis and craniosynostosis. We analyzed the expression of the TWIST-1 target, Tyrosine kinase receptor c-ros-oncogene 1 (C-ROS-1) in TWIST-1 haploinsufficient calvarial cells derived from SCS patients and calvaria of Twist-1 del/+ mutant mice and found it to be highly expressed when compared to TWIST-1 wild-type controls. Knock-down of C-ROS-1 expression in TWIST-1 haploinsufficient calvarial cells derived from SCS patients was associated with decreased capacity for osteogenic differentiation in vitro. Furthermore, treatment of human SCS calvarial cells with the tyrosine kinase chemical inhibitor, Crizotinib, resulted in reduced C-ROS-1 activity and the osteogenic potential of human SCS calvarial cells with minor effects on cell viability or proliferation. Cultured human SCS calvarial cells treated with Crizotinib exhibited a dose-dependent decrease in alkaline phosphatase activity and mineral deposition, with an associated decrease in expression levels of Runt-related transcription factor 2 and OSTEOPONTIN, with reduced PI3K/Akt signalling in vitro. Furthermore, Crizotinib treatment resulted in reduced BMP-2 mediated bone formation potential of whole Twist-1 del/+ mutant mouse calvaria organotypic cultures. Collectively, these results suggest that C-ROS-1 promotes osteogenic differentiation of TWIST-1 haploinsufficient calvarial osteogenic progenitor cells. Furthermore, the aberrant osteogenic potential of these cells is inhibited by the reduction of C-ROS-1. Therefore, targeting C-ROS-1 with a pharmacological agent, such as Crizotinib, may serve as a novel therapeutic strategy to alleviate craniosynostosis associated with aberrant TWIST-1 function. © 2018 Wiley Periodicals, Inc.

  7. Role of the XIAP-Cooper Axis in Prostate Cancer

    DTIC Science & Technology

    2011-04-01

    growing yeast transformed with a plasmid encoding human XIAP in Cu-free selective medium. Supplemental Cu was added to the medium 1-2 hours before...human XIAP into yeast deletion strains. We selected 16 deletion strains from the same background as our wild-type control (BY4741) for analysis. These...transformed with the XIAP expression plasmid. This objective is complete. Assess yeast deletion mutants for delivery of copper to XIAP. After

  8. ICBP90 Regulation of DNA Methylation, Histone Ubiquitination, and Tumor Suppressor Gene Expression in Breast Cancer Cells

    DTIC Science & Technology

    2013-09-01

    accomplishments include creation of relevant plant lines, development of in vitro assays, and profiling of mRNA expression in null mutants. 15. SUBJECT TERMS...DNA methylation, UHRF1, VIM1, ubiquitination, epigenetics, chromatin 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF...Molecular Basis of Human Disease ,” which covered several weeks’ worth of material specifically related to the molecular and epigenetic basis of cancer

  9. Connexins in Prostate Cancer Initiation and Progression

    DTIC Science & Technology

    2012-09-01

    Isoleucine and A=alanine. In L212A/I213A the leucine at position 212 and isoleucine at position 213 were mutated to alanine. Similar strategy was used to...and isoleucine at the indicated amino acid residues were mutated to alanine using site-directed mutagenesis (Figure 3). Expression of Cx32 and...Its Mutants and Gap Junction Assembly Human LNCaP cells neither express Cx32 nor form functional GJs [23]. We introduced WT-Cx32 and various

  10. Bivalent Carbohydrate Binding Is Required for Biological Activity of Clitocybe nebularis Lectin (CNL), the N,N′-Diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc)-specific Lectin from Basidiomycete C. nebularis*

    PubMed Central

    Pohleven, Jure; Renko, Miha; Magister, Špela; Smith, David F.; Künzler, Markus; Štrukelj, Borut; Turk, Dušan; Kos, Janko; Sabotič, Jerica

    2012-01-01

    Lectins are carbohydrate-binding proteins that exert their biological activity by binding to specific cell glycoreceptors. We have expressed CNL, a ricin B-like lectin from the basidiomycete Clitocybe nebularis in Escherichia coli. The recombinant lectin, rCNL, agglutinates human blood group A erythrocytes and is specific for the unique glycan N,N′-diacetyllactosediamine (GalNAcβ1–4GlcNAc, LacdiNAc) as demonstrated by glycan microarray analysis. We here describe the crystal structures of rCNL in complex with lactose and LacdiNAc, defining its interactions with the sugars. CNL is a homodimeric lectin, each of whose monomers consist of a single ricin B lectin domain with its β-trefoil fold and one carbohydrate-binding site. To study the mode of CNL action, a nonsugar-binding mutant and nondimerizing monovalent CNL mutants that retain carbohydrate-binding activity were prepared. rCNL and the mutants were examined for their biological activities against Jurkat human leukemic T cells and the hypersensitive nematode Caenorhabditis elegans mutant strain pmk-1. rCNL was toxic against both, although the mutants were inactive. Thus, the bivalent carbohydrate-binding property of homodimeric CNL is essential for its activity, providing one of the rare pieces of evidence that certain activities of lectins are associated with their multivalency. PMID:22298779

  11. Ligand stimulation of ErbB4 and a constitutively-active ErbB4 mutant result in different biological responses in human pancreatic tumor cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mill, Christopher P.; Auburn University Harrison School of Pharmacy, Auburn, AL 36849-5501; Gettinger, Kathleen L.

    2011-02-15

    Pancreatic cancer is the fourth leading cause of cancer death in the United States. Indeed, it has been estimated that 37,000 Americans will die from this disease in 2010. Late diagnosis, chemoresistance, and radioresistance of these tumors are major reasons for poor patient outcome, spurring the search for pancreatic cancer early diagnostic and therapeutic targets. ErbB4 (HER4) is a member of the ErbB family of receptor tyrosine kinases (RTKs), a family that also includes the Epidermal Growth Factor Receptor (EGFR/ErbB1/HER1), Neu/ErbB2/HER2, and ErbB3/HER3. These RTKs play central roles in many human malignancies by regulating cell proliferation, survival, differentiation, invasiveness, motility,more » and apoptosis. In this report we demonstrate that human pancreatic tumor cell lines exhibit minimal ErbB4 expression; in contrast, these cell lines exhibit varied and in some cases abundant expression and basal tyrosine phosphorylation of EGFR, ErbB2, and ErbB3. Expression of a constitutively-dimerized and -active ErbB4 mutant inhibits clonogenic proliferation of CaPan-1, HPAC, MIA PaCa-2, and PANC-1 pancreatic tumor cell lines. In contrast, expression of wild-type ErbB4 in pancreatic tumor cell lines potentiates stimulation of anchorage-independent colony formation by the ErbB4 ligand Neuregulin 1{beta}. These results illustrate the multiple roles that ErbB4 may be playing in pancreatic tumorigenesis and tumor progression.« less

  12. Selective reconstitution of liver cholesterol biosynthesis promotes lung maturation but does not prevent neonatal lethality in Dhcr7 null mice.

    PubMed

    Yu, Hongwei; Li, Man; Tint, G Stephen; Chen, Jianliang; Xu, Guorong; Patel, Shailendra B

    2007-04-04

    Targeted disruption of the murine 3beta-hydroxysterol-Delta7-reductase gene (Dhcr7), an animal model of Smith-Lemli-Opitz syndrome, leads to loss of cholesterol synthesis and neonatal death that can be partially rescued by transgenic replacement of DHCR7 expression in brain during embryogenesis. To gain further insight into the role of non-brain tissue cholesterol deficiency in the pathophysiology, we tested whether the lethal phenotype could be abrogated by selective transgenic complementation with DHCR7 expression in the liver. We generated mice that carried a liver-specific human DHCR7 transgene whose expression was driven by the human apolipoprotein E (ApoE) promoter and its associated liver-specific enhancer. These mice were then crossed with Dhcr7+/- mutants to generate Dhcr7-/- mice bearing a human DHCR7 transgene. Robust hepatic transgene expression resulted in significant improvement of cholesterol homeostasis with cholesterol concentrations increasing to 80~90 % of normal levels in liver and lung. Significantly, cholesterol deficiency in brain was not altered. Although late gestational lung sacculation defect reported previously was significantly improved, there was no parallel increase in postnatal survival in the transgenic mutant mice. The reconstitution of DHCR7 function selectively in liver induced a significant improvement of cholesterol homeostasis in non-brain tissues, but failed to rescue the neonatal lethality of Dhcr7 null mice. These results provided further evidence that CNS defects caused by Dhcr7 null likely play a major role in the lethal pathogenesis of Dhcr7-/- mice, with the peripheral organs contributing the morbidity.

  13. Defective phagosome motility and degradation in cell nonautonomous RPE pathogenesis of a dominant macular degeneration.

    PubMed

    Esteve-Rudd, Julian; Hazim, Roni A; Diemer, Tanja; Paniagua, Antonio E; Volland, Stefanie; Umapathy, Ankita; Williams, David S

    2018-05-22

    Stargardt macular dystrophy 3 (STGD3) is caused by dominant mutations in the ELOVL4 gene. Like other macular degenerations, pathogenesis within the retinal pigment epithelium (RPE) appears to contribute to the loss of photoreceptors from the central retina. However, the RPE does not express ELOVL4 , suggesting photoreceptor cell loss in STGD3 occurs through two cell nonautonomous events: mutant photoreceptors first affect RPE cell pathogenesis, and then, second, RPE dysfunction leads to photoreceptor cell death. Here, we have investigated how the RPE pathology occurs, using a STGD3 mouse model in which mutant human ELOVL4 is expressed in the photoreceptors. We found that the mutant protein was aberrantly localized to the photoreceptor outer segment (POS), and that resulting POS phagosomes were degraded more slowly in the RPE. In cell culture, the mutant POSs are ingested by primary RPE cells normally, but the phagosomes are processed inefficiently, even by wild-type RPE. The mutant phagosomes excessively sequester RAB7A and dynein, and have impaired motility. We propose that the abnormal presence of ELOVL4 protein in POSs results in phagosomes that are defective in recruiting appropriate motor protein linkers, thus contributing to slower degradation because their altered motility results in slower basal migration and fewer productive encounters with endolysosomes. In the transgenic mouse retinas, the RPE accumulated abnormal-looking phagosomes and oxidative stress adducts; these pathological changes were followed by pathology in the neural retina. Our results indicate inefficient phagosome degradation as a key component of the first cell nonautonomous event underlying retinal degeneration due to mutant ELOVL4.

  14. Oral Exposure to Paraquat Triggers Earlier Expression of Phosphorylated α-Synuclein in the Enteric Nervous System of A53T Mutant Human α-Synuclein Transgenic Mice

    PubMed Central

    Naudet, Nicolas; Antier, Emilie; Gaillard, Damien; Morignat, Eric; Lakhdar, Latifa; Baron, Thierry; Bencsik, Anna

    2017-01-01

    Abstract The misfolded α-synuclein protein, phosphorylated at serine 129 (pSer129 α-syn), is the hallmark of Parkinson disease (PD). Detected also in the enteric nervous system (ENS), it supports the recent theory that PD could start in the gut, rather than the brain. In a previous study, using a transgenic mouse model of human synucleinopathies expressing the A53T mutant α-synuclein (TgM83), in which a neurodegenerative process associated with α-synuclein occurs spontaneously in the brain, we have shown earlier onset of pSer129 α-syn in the ENS. Here, we used this model to study the impact of paraquat (PQ) a neurotoxic herbicide incriminated in PD in agricultural workers) on the enteric pSer129 α-syn expression in young mice. Orally delivered in the drinking water at 10 mg/kg/day for 6–8 weeks, the impact of PQ was measured in a time-dependent manner on weight, locomotor abilities, pSer129 α-syn, and glial fibrillary acidic protein (GFAP) expression levels in the ENS. Remarkably, pSer129 α-syn was detected in ENS earlier under PQ oral exposure and enteric GFAP expression was also increased. These findings bring additional support to the theory that neurotoxic agents such as PQ initiate idiopathic PD after oral delivery. PMID:29040593

  15. Oral Exposure to Paraquat Triggers Earlier Expression of Phosphorylated α-Synuclein in the Enteric Nervous System of A53T Mutant Human α-Synuclein Transgenic Mice.

    PubMed

    Naudet, Nicolas; Antier, Emilie; Gaillard, Damien; Morignat, Eric; Lakhdar, Latifa; Baron, Thierry; Bencsik, Anna

    2017-12-01

    The misfolded α-synuclein protein, phosphorylated at serine 129 (pSer129 α-syn), is the hallmark of Parkinson disease (PD). Detected also in the enteric nervous system (ENS), it supports the recent theory that PD could start in the gut, rather than the brain. In a previous study, using a transgenic mouse model of human synucleinopathies expressing the A53T mutant α-synuclein (TgM83), in which a neurodegenerative process associated with α-synuclein occurs spontaneously in the brain, we have shown earlier onset of pSer129 α-syn in the ENS. Here, we used this model to study the impact of paraquat (PQ) a neurotoxic herbicide incriminated in PD in agricultural workers) on the enteric pSer129 α-syn expression in young mice. Orally delivered in the drinking water at 10 mg/kg/day for 6-8 weeks, the impact of PQ was measured in a time-dependent manner on weight, locomotor abilities, pSer129 α-syn, and glial fibrillary acidic protein (GFAP) expression levels in the ENS. Remarkably, pSer129 α-syn was detected in ENS earlier under PQ oral exposure and enteric GFAP expression was also increased. These findings bring additional support to the theory that neurotoxic agents such as PQ initiate idiopathic PD after oral delivery. © 2017 American Association of Neuropathologists, Inc.

  16. SAS-6 engineering reveals interdependence between cartwheel and microtubules in determining centriole architecture.

    PubMed

    Hilbert, Manuel; Noga, Akira; Frey, Daniel; Hamel, Virginie; Guichard, Paul; Kraatz, Sebastian H W; Pfreundschuh, Moritz; Hosner, Sarah; Flückiger, Isabelle; Jaussi, Rolf; Wieser, Mara M; Thieltges, Katherine M; Deupi, Xavier; Müller, Daniel J; Kammerer, Richard A; Gönczy, Pierre; Hirono, Masafumi; Steinmetz, Michel O

    2016-04-01

    Centrioles are critical for the formation of centrosomes, cilia and flagella in eukaryotes. They are thought to assemble around a nine-fold symmetric cartwheel structure established by SAS-6 proteins. Here, we have engineered Chlamydomonas reinhardtii SAS-6-based oligomers with symmetries ranging from five- to ten-fold. Expression of a SAS-6 mutant that forms six-fold symmetric cartwheel structures in vitro resulted in cartwheels and centrioles with eight- or nine-fold symmetries in vivo. In combination with Bld10 mutants that weaken cartwheel-microtubule interactions, this SAS-6 mutant produced six- to eight-fold symmetric cartwheels. Concurrently, the microtubule wall maintained eight- and nine-fold symmetries. Expressing SAS-6 with analogous mutations in human cells resulted in nine-fold symmetric centrioles that exhibited impaired length and organization. Together, our data suggest that the self-assembly properties of SAS-6 instruct cartwheel symmetry, and lead us to propose a model in which the cartwheel and the microtubule wall assemble in an interdependent manner to establish the native architecture of centrioles.

  17. Increased intracellular proteolysis reduces disease severity in an ER stress-associated dwarfism.

    PubMed

    Mullan, Lorna A; Mularczyk, Ewa J; Kung, Louise H; Forouhan, Mitra; Wragg, Jordan Ma; Goodacre, Royston; Bateman, John F; Swanton, Eileithyia; Briggs, Michael D; Boot-Handford, Raymond P

    2017-10-02

    The short-limbed dwarfism metaphyseal chondrodysplasia type Schmid (MCDS) is linked to mutations in type X collagen, which increase ER stress by inducing misfolding of the mutant protein and subsequently disrupting hypertrophic chondrocyte differentiation. Here, we show that carbamazepine (CBZ), an autophagy-stimulating drug that is clinically approved for the treatment of seizures and bipolar disease, reduced the ER stress induced by 4 different MCDS-causing mutant forms of collagen X in human cell culture. Depending on the nature of the mutation, CBZ application stimulated proteolysis of misfolded collagen X by either autophagy or proteasomal degradation, thereby reducing intracellular accumulation of mutant collagen. In MCDS mice expressing the Col10a1.pN617K mutation, CBZ reduced the MCDS-associated expansion of the growth plate hypertrophic zone, attenuated enhanced expression of ER stress markers such as Bip and Atf4, increased bone growth, and reduced skeletal dysplasia. CBZ produced these beneficial effects by reducing the MCDS-associated abnormalities in hypertrophic chondrocyte differentiation. Stimulation of intracellular proteolysis using CBZ treatment may therefore be a clinically viable way of treating the ER stress-associated dwarfism MCDS.

  18. Elevated free nitrotyrosine levels, but not protein-bound nitrotyrosine or hydroxyl radicals, throughout amyotrophic lateral sclerosis (ALS)-like disease implicate tyrosine nitration as an aberrant in vivo property of one familial ALS-linked superoxide dismutase 1 mutant.

    PubMed

    Bruijn, L I; Beal, M F; Becher, M W; Schulz, J B; Wong, P C; Price, D L; Cleveland, D W

    1997-07-08

    Mutations in superoxide dismutase 1 (SOD1; EC 1.15.1.1) are responsible for a proportion of familial amyotrophic lateral sclerosis (ALS) through acquisition of an as-yet-unidentified toxic property or properties. Two proposed possibilities are that toxicity may arise from imperfectly folded mutant SOD1 catalyzing the nitration of tyrosines [Beckman, J. S., Carson, M., Smith, C. D. & Koppenol, W. H. (1993) Nature (London) 364, 584] through use of peroxynitrite or from peroxidation arising from elevated production of hydroxyl radicals through use of hydrogen peroxide as a substrate [Wiedau-Pazos, M., Goto, J. J., Rabizadeh, S., Gralla, E. D., Roe, J. A., Valentine, J. S. & Bredesen, D. E. (1996) Science 271, 515-518]. To test these possibilities, levels of nitrotyrosine and markers for hydroxyl radical formation were measured in two lines of transgenic mice that develop progressive motor neuron disease from expressing human familial ALS-linked SOD1 mutation G37R. Relative to normal mice or mice expressing high levels of wild-type human SOD1, 3-nitrotyrosine levels were elevated by 2- to 3-fold in spinal cords coincident with the earliest pathological abnormalities and remained elevated in spinal cord throughout progression of disease. However, no increases in protein-bound nitrotyrosine were found during any stage of SOD1-mutant-mediated disease in mice or at end stage of sporadic or SOD1-mediated familial human ALS. When salicylate trapping of hydroxyl radicals and measurement of levels of malondialdehyde were used, there was no evidence throughout disease progression in mice for enhanced production of hydroxyl radicals or lipid peroxidation, respectively. The presence of elevated nitrotyrosine levels beginning at the earliest stages of cellular pathology and continuing throughout progression of disease demonstrates that tyrosine nitration is one in vivo aberrant property of this ALS-linked SOD1 mutant.

  19. Human SLC4A11-C functions as a DIDS-stimulatable H+(OH−) permeation pathway: partial correction of R109H mutant transport

    PubMed Central

    Kao, Liyo; Azimov, Rustam; Abuladze, Natalia; Newman, Debra

    2014-01-01

    The SLC4A11 gene mutations cause a variety of genetic corneal diseases, including congenital hereditary endothelial dystrophy 2 (CHED2), Harboyan syndrome, some cases of Fuchs' endothelial dystrophy (FECD), and possibly familial keratoconus. Three NH2-terminal variants of the human SLC4A11 gene, named SLC4A11-A, -B, and -C are known. The SLC4A11-B variant has been the focus of previous studies. Both the expression of the SLC4A11-C variant in the cornea and its functional properties have not been characterized, and therefore its potential pathophysiological role in corneal diseases remains to be explored. In the present study, we demonstrate that SLC4A11-C is the predominant SLC4A11 variant expressed in human corneal endothelial mRNA and that the transporter functions as an electrogenic H+(OH−) permeation pathway. Disulfonic stilbenes, including 4,4′-diisothiocyano-2,2′-stilbenedisulfonate (DIDS), 4,4′-diisothiocyanatodihydrostilbene-2,2′-disulfonate (H2DIDS), and 4-acetamido-4′-isothiocyanato-stilbene-2,2′-disulfonate (SITS), which are known to bind covalently, increased SLC4A11-C-mediated H+(OH−) flux by 150–200% without having a significant effect in mock-transfected cells. Noncovalently interacting 4,4′-diaminostilbene-2,2′-disulfonate (DADS) was without effect. We tested the efficacy of DIDS on the functionally impaired R109H mutant (SLC4A11-C numbering) that causes CHED2. DIDS (1 mM) increased H+(OH−) flux through the mutant transporter by ∼40–90%. These studies provide a basis for future testing of more specific chemically modified dilsulfonic stilbenes as potential therapeutic agents to improve the functional impairment of specific SLC4A11 mutant transporters. PMID:25394471

  20. Microbiota-derived short-chain fatty acids modulate expression of Campylobacter jejuni determinants required for commensalism and virulence

    USDA-ARS?s Scientific Manuscript database

    Campylobacter jejuni effectively promotes commensalism in the intestinal tract of avian hosts and diarrheal disease in humans, yet components of intestinal environments sensed by the bacterium in either host to initiate interactions are mostly unknown. By analyzing a C. jejuni acetogenesis mutant th...

  1. Porcine, murine and human sialoadhesin (Sn/Siglec-1/CD169): portals for porcine reproductive and respiratory syndrome virus entry into target cells.

    PubMed

    Van Breedam, Wander; Verbeeck, Mieke; Christiaens, Isaura; Van Gorp, Hanne; Nauwynck, Hans J

    2013-09-01

    Porcine sialoadhesin (pSn; a sialic acid-binding lectin) and porcine CD163 (pCD163) are molecules that facilitate infectious entry of porcine reproductive and respiratory syndrome virus (PRRSV) into alveolar macrophages. In this study, it was shown that murine Sn (mSn) and human Sn (hSn), like pSn, can promote PRRSV infection of pCD163-expressing cells. Intact sialic acid-binding domains are crucial, since non-sialic acid-binding mutants of pSn, mSn and hSn did not promote infection. Endodomain-deletion mutants of pSn, mSn and hSn promoted PRRSV infection less efficiently, but also showed markedly reduced expression levels, making further research into the potential role of the Sn endodomain in PRRSV receptor activity necessary. These data further complement our knowledge on Sn as an important PRRSV receptor, and suggest - in combination with other published data - that species differences in the main PRRSV entry mediators Sn and CD163 do not account for the strict host species specificity displayed by the virus.

  2. The Neuron-specific Chromatin Regulatory Subunit BAF53b is Necessary for Synaptic Plasticity and Memory

    PubMed Central

    Vogel-Ciernia, Annie; Matheos, Dina P.; Barrett, Ruth M.; Kramár, Enikö; Azzawi, Soraya; Chen, Yuncai; Magnan, Christophe N.; Zeller, Michael; Sylvain, Angelina; Haettig, Jakob; Jia, Yousheng; Tran, Anthony; Dang, Richard; Post, Rebecca J.; Chabrier, Meredith; Babayan, Alex; Wu, Jiang I.; Crabtree, Gerald R.; Baldi, Pierre; Baram, Tallie Z.; Lynch, Gary; Wood, Marcelo A.

    2013-01-01

    Recent exome sequencing studies have implicated polymorphic BAF complexes (mammalian SWI/SNF chromatin remodeling complexes) in several human intellectual disabilities and cognitive disorders. However, it is currently unknown how mutations in BAF complexes result in impaired cognitive function. Post mitotic neurons express a neuron specific assembly, nBAF, characterized by the neuron-specific subunit BAF53b. Mice harboring selective genetic manipulations of BAF53b have severe defects in longterm memory and long-lasting forms of hippocampal synaptic plasticity. We rescued memory impairments in BAF53b mutant mice by reintroducing BAF53b in the adult hippocampus, indicating a role for BAF53b beyond neuronal development. The defects in BAF53b mutant mice appear to derive from alterations in gene expression that produce abnormal postsynaptic components, such as spine structure and function, and ultimately lead to deficits in synaptic plasticity. Our studies provide new insight into the role of dominant mutations in subunits of BAF complexes in human intellectual and cognitive disorders. PMID:23525042

  3. The Campylobacter jejuni MarR-like transcriptional regulators RrpA and RrpB both influence bacterial responses to oxidative and aerobic stresses.

    PubMed

    Gundogdu, Ozan; da Silva, Daiani T; Mohammad, Banaz; Elmi, Abdi; Mills, Dominic C; Wren, Brendan W; Dorrell, Nick

    2015-01-01

    The ability of the human intestinal pathogen Campylobacter jejuni to respond to oxidative stress is central to bacterial survival both in vivo during infection and in the environment. Re-annotation of the C. jejuni NCTC11168 genome revealed the presence of two MarR-type transcriptional regulators Cj1546 and Cj1556, originally annotated as hypothetical proteins, which we have designated RrpA and RrpB (regulator of response to peroxide) respectively. Previously we demonstrated a role for RrpB in both oxidative and aerobic (O2) stress and that RrpB was a DNA binding protein with auto-regulatory activity, typical of MarR-type transcriptional regulators. In this study, we show that RrpA is also a DNA binding protein and that a rrpA mutant in strain 11168H exhibits increased sensitivity to hydrogen peroxide oxidative stress. Mutation of either rrpA or rrpB reduces catalase (KatA) expression. However, a rrpAB double mutant exhibits higher levels of resistance to hydrogen peroxide oxidative stress, with levels of KatA expression similar to the wild-type strain. Mutation of either rrpA or rrpB also results in a reduction in the level of katA expression, but this reduction was not observed in the rrpAB double mutant. Neither the rrpA nor rrpB mutant exhibits any significant difference in sensitivity to either cumene hydroperoxide or menadione oxidative stresses, but both mutants exhibit a reduced ability to survive aerobic (O2) stress, enhanced biofilm formation and reduced virulence in the Galleria mellonella infection model. The rrpAB double mutant exhibits wild-type levels of biofilm formation and wild-type levels of virulence in the G mellonella infection model. Together these data indicate a role for both RrpA and RrpB in the C. jejuni peroxide oxidative and aerobic (O2) stress responses, enhancing bacterial survival in vivo and in the environment.

  4. Articular cartilage endurance and resistance to osteoarthritic changes require transcription factor Erg.

    PubMed

    Ohta, Yoichi; Okabe, Takahiro; Larmour, Colleen; Di Rocco, Agnese; Maijenburg, Marijke W; Phillips, Amanda; Speck, Nancy A; Wakitani, Shigeyuki; Nakamura, Takashi; Yamada, Yoshihiko; Enomoto-Iwamoto, Motomi; Pacifici, Maurizio; Iwamoto, Masahiro

    2015-10-01

    To determine whether and how the transcription factor Erg participates in the genesis, establishment, and maintenance of articular cartilage. Floxed Erg mice were mated with Gdf5-Cre mice to generate conditional mutants lacking Erg in their joints. Joints of mutant and control mice were subjected to morphologic and molecular characterization and also to experimental surgically induced osteoarthritis (OA). Gene expression, promoter reporter assays, and gain- and loss-of-function in vitro tests were used to characterize molecular mechanisms of Erg action. Conditional Erg ablation did not elicit obvious changes in limb joint development and overall phenotype in juvenile mice. However, as mice aged, joints of mutant mice degenerated spontaneously and exhibited clear OA-like phenotypic defects. Joints in juvenile mutant mice were more sensitive to surgically induced OA and became defective sooner than operated joints in control mice. Global gene expression data and other studies identified parathyroid hormone-related protein (PTHrP) and lubricin as possible downstream effectors and mediators of Erg action in articular chondrocytes. Reporter assays using control and mutated promoter-enhancer constructs indicated that Erg acted on Ets DNA binding sites to stimulate PTHrP expression. Erg was up-regulated in severely affected areas in human OA articular cartilage but remained barely appreciable in areas of less affected cartilage. The study shows for the first time that Erg is a critical molecular regulator of the endurance of articular cartilage during postnatal life and that Erg can mitigate spontaneous and experimental OA. Erg appears to do this through regulating expression of PTHrP and lubricin, factors known for their protective roles in joints. © 2015, American College of Rheumatology.

  5. Metal Tolerance Protein 8 Mediates Manganese Homeostasis and Iron Reallocation during Seed Development and Germination.

    PubMed

    Eroglu, Seckin; Giehl, Ricardo F H; Meier, Bastian; Takahashi, Michiko; Terada, Yasuko; Ignatyev, Konstantin; Andresen, Elisa; Küpper, Hendrik; Peiter, Edgar; von Wirén, Nicolaus

    2017-07-01

    Metal accumulation in seeds is a prerequisite for germination and establishment of plants but also for micronutrient delivery to humans. To investigate metal transport processes and their interactions in seeds, we focused on METAL TOLERANCE PROTEIN8 (MTP8), a tonoplast transporter of the manganese (Mn) subclade of cation diffusion facilitators, which in Arabidopsis ( Arabidopsis thaliana ) is expressed in embryos of seeds. The x-ray fluorescence imaging showed that expression of MTP8 was responsible for Mn localization in subepidermal cells on the abaxial side of the cotyledons and in cortical cells of the hypocotyl. Accordingly, under low Mn availability, MTP8 increased seed stores of Mn, required for efficient seed germination. In mutant embryos lacking expression of VACUOLAR IRON TRANSPORTER1 ( VIT1 ), MTP8 built up iron (Fe) hotspots in MTP8 -expressing cells types, suggesting that MTP8 transports Fe in addition to Mn. In mtp8 vit1 double mutant seeds, Mn and Fe were distributed in all cell types of the embryo. An Fe transport function of MTP8 was confirmed by its ability to complement Fe hypersensitivity of a yeast mutant defective in vacuolar Fe transport. Imbibing mtp8-1 mutant seeds in the presence of Mn or subjecting seeds to wet-dry cycles showed that MTP8 conferred Mn tolerance. During germination, MTP8 promoted reallocation of Fe from the vasculature. These results indicate that cell type-specific accumulation of Mn and Fe in seeds depends on MTP8 and that this transporter plays an important role in the generation of seed metal stores as well as for metal homeostasis and germination efficiency under challenging environmental conditions. © 2017 American Society of Plant Biologists. All Rights Reserved.

  6. Metal Tolerance Protein 8 Mediates Manganese Homeostasis and Iron Reallocation during Seed Development and Germination1[OPEN

    PubMed Central

    Takahashi, Michiko; Terada, Yasuko

    2017-01-01

    Metal accumulation in seeds is a prerequisite for germination and establishment of plants but also for micronutrient delivery to humans. To investigate metal transport processes and their interactions in seeds, we focused on METAL TOLERANCE PROTEIN8 (MTP8), a tonoplast transporter of the manganese (Mn) subclade of cation diffusion facilitators, which in Arabidopsis (Arabidopsis thaliana) is expressed in embryos of seeds. The x-ray fluorescence imaging showed that expression of MTP8 was responsible for Mn localization in subepidermal cells on the abaxial side of the cotyledons and in cortical cells of the hypocotyl. Accordingly, under low Mn availability, MTP8 increased seed stores of Mn, required for efficient seed germination. In mutant embryos lacking expression of VACUOLAR IRON TRANSPORTER1 (VIT1), MTP8 built up iron (Fe) hotspots in MTP8-expressing cells types, suggesting that MTP8 transports Fe in addition to Mn. In mtp8 vit1 double mutant seeds, Mn and Fe were distributed in all cell types of the embryo. An Fe transport function of MTP8 was confirmed by its ability to complement Fe hypersensitivity of a yeast mutant defective in vacuolar Fe transport. Imbibing mtp8-1 mutant seeds in the presence of Mn or subjecting seeds to wet-dry cycles showed that MTP8 conferred Mn tolerance. During germination, MTP8 promoted reallocation of Fe from the vasculature. These results indicate that cell type-specific accumulation of Mn and Fe in seeds depends on MTP8 and that this transporter plays an important role in the generation of seed metal stores as well as for metal homeostasis and germination efficiency under challenging environmental conditions. PMID:28461400

  7. The antiandrogenic effect of finasteride against a mutant androgen receptor

    PubMed Central

    Chhipa, Rishi Raj; Zhang, Haitao; Ip, Clement

    2011-01-01

    Finasteride is known to inhibit Type 2 5α-reductase and thus block the conversion of testosterone to dihydrotestosterone (DHT). The structural similarity of finasteride to DHT raises the possibility that finasteride may also interfere with the function of the androgen receptor (AR). Experiments were carried out to evaluate the antiandrogenic effect of finasteride in LNCaP, C4-2 and VCaP human prostate cancer cells. Finasteride decreased DHT binding to AR, and DHT-stimulated AR activity and cell growth in LNCaP and C4-2 cells, but not in VCaP cells. LNCaP and C4-2 (derived from castration-resistant LNCaP) cells express the T877A mutant AR, while VCaP cells express the wild-type AR. When PC-3 cells, which are AR-null, were transfected with either the wild-type or the T877A mutant AR, only the mutant AR-expressing cells were sensitive to finasteride inhibition of DHT binding. Peroxiredoxin-1 (Prx1) is a novel endogenous facilitator of AR binding to DHT. In Prx1-rich LNCaP cells, the combination of Prx1 knockdown and finasteride was found to produce a greater inhibitory effect on AR activity and cell growth than either treatment alone. The observation suggests that cells with a low expression of Prx1 are likely to be more responsive to the antiandrogenic effect of finasteride. Additional studies showed that the efficacy of finasteride was comparable to that of bicalutamide (a widely used non-steroidal antiandrogen). The implication of the above findings is discussed in the context of developing strategies to improve the outcome of androgen deprivation therapy. PMID:21386657

  8. Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor.

    PubMed

    Ryan, J J; McReynolds, L J; Keegan, A; Wang, L H; Garfein, E; Rothman, P; Nelms, K; Paul, W E

    1996-02-01

    IL-4 causes hematopoietic cells to proliferate and express a series of genes, including CD23. We examined whether IL-4-mediated growth, as measured by 4PS phosphorylation, and gene induction were similarly controlled. Studies of M12.4.1 cells expressing human IL-4R truncation mutants indicated that the region between amino acids 557-657 is necessary for full gene expression, which correlated with Stat6 DNA binding activity. This region was not required for 4PS phosphorylation. Tyrosine-to-phenylalanine mutations in the interval between amino acids 557-657 revealed that as long as one tyrosine remained unmutated, CD23 was fully induced. When all three tyrosines were mutated, the receptor was unable to induce CD23. The results indicate that growth regulation and gene expression are principally controlled by distinct regions of IL-4R.

  9. Differential expression of the TWEAK receptor Fn14 in IDH1 wild-type and mutant gliomas.

    PubMed

    Hersh, David S; Peng, Sen; Dancy, Jimena G; Galisteo, Rebeca; Eschbacher, Jennifer M; Castellani, Rudy J; Heath, Jonathan E; Legesse, Teklu; Kim, Anthony J; Woodworth, Graeme F; Tran, Nhan L; Winkles, Jeffrey A

    2018-06-01

    The TNF receptor superfamily member Fn14 is overexpressed by many solid tumor types, including glioblastoma (GBM), the most common and lethal form of adult brain cancer. GBM is notable for a highly infiltrative growth pattern and several groups have reported that high Fn14 expression levels can increase tumor cell invasiveness. We reported previously that the mesenchymal and proneural GBM transcriptomic subtypes expressed the highest and lowest levels of Fn14 mRNA, respectively. Given the recent histopathological re-classification of human gliomas by the World Health Organization based on isocitrate dehydrogenase 1 (IDH1) gene mutation status, we extended this work by comparing Fn14 gene expression in IDH1 wild-type (WT) and mutant (R132H) gliomas and in cell lines engineered to overexpress the IDH1 R132H enzyme. We found that both low-grade and high-grade (i.e., GBM) IDH1 R132H gliomas exhibit low Fn14 mRNA and protein levels compared to IDH1 WT gliomas. Forced overexpression of the IDH1 R132H protein in glioma cells reduced Fn14 expression, while treatment of IDH1 R132H-overexpressing cells with the IDH1 R132H inhibitor AGI-5198 or the DNA demethylating agent 5-aza-2'-deoxycytidine increased Fn14 expression. These results support a role for Fn14 in the more aggressive and invasive phenotype associated with IDH1 WT tumors and indicate that the low levels of Fn14 gene expression noted in IDH1 R132H mutant gliomas may be due to epigenetic regulation via changes in DNA methylation.

  10. Reduced mycorrhizal colonization (rmc) tomato mutant lacks expression of SymRK signaling pathway genes

    PubMed Central

    Nair, Aswathy; Bhargava, Sujata

    2012-01-01

    Comparison of the expression of 13 genes involved in arbuscular mycorrhizal (AM) symbiosis was performed in a wild type tomato (Solanum lycopersicum cv 76R) and its reduced mycorrhizal colonization mutant rmc in response to colonization with Glomus fasiculatum. Four defense-related genes were induced to a similar extent in the mutant and wild type AM colonized plants, indicating a systemic response to AM colonization. Genes related to nutrient exchange between the symbiont partners showed higher expression in the AM roots of wild type plants than the mutant plants, which correlated with their arbuscular frequency. A symbiosis receptor kinase that is involved in both nodulation and AM symbiosis was not expressed in the rmc mutant. The fact that some colonization was observed in rmc was suggestive of the existence of an alternate colonization signaling pathway for AM symbiosis in this mutant. PMID:23221680

  11. Induction of HER2 Immunity in Outbred Domestic Cats by DNA Electrovaccination

    PubMed Central

    Gibson, Heather; Veenstra, Jesse; Jones, Richard; Vaishampayan, Ulka; Sauerbrey, Michele; Bepler, Gerold; Lum, Lawrence; Reyes, Joyce; Weise, Amy; Wei, Wei-Zen

    2015-01-01

    Domestic cats share human living environments and genetic traits. They develop spontaneous feline mammary carcinoma (FMC) with histopathology similar to human breast cancer. HER2 and AKT phosphorylation was demonstrated in primary FMC by immunoblot, indicating HER2 as a therapeutic target. FMC lines K12 and K248 expressing HER1, HER2 and HER3 were sensitive to receptor tyrosine kinase (RTK) inhibitors gefitinib and lapatinib. To test HER2 vaccine response in cats, purpose-bred, healthy cats were electrovaccinated with heterologous (xenogeneic) or point-mutated feline HER2 DNA. T-cell reactivity to feline self-HER2 was detected in 4 of 10 cats that received bear HER2, human/rat fusion HER2 (E2Neu) or mutant feline HER2 (feHER2-K) which contains a single amino acid substitution. The variable T-cell responses may resemble that in the genetically heterogeneous human population. All immune sera to heterologous HER2 recognized feline HER2 expressed in 3T3 cells (3T3/HER2), but not that in FMC K12 or K248. Immune sera to mutant pfeHER2-K bound 3T3/HER2 cells weakly, but they demonstrated better recognition of K12 and K248 cells that also express HER1 and HER3, suggesting distinct HER2 epitopes displayed by FMC that may be simulated by feHER2-K. In summary, HER2 DNA electroporation overcomes T-cell immune tolerance in ~40% healthy cats and induces antibodies with distinct specificity. Vaccination studies in domestic cats can expedite vaccine iteration to guide human vaccine design and better predict outcome, with the added benefit of helping feline mammary tumor patients. PMID:25711535

  12. The NOTCH3 score: a pre-clinical CADASIL biomarker in a novel human genomic NOTCH3 transgenic mouse model with early progressive vascular NOTCH3 accumulation.

    PubMed

    Rutten, Julie W; Klever, Roselin R; Hegeman, Ingrid M; Poole, Dana S; Dauwerse, Hans G; Broos, Ludo A M; Breukel, Cor; Aartsma-Rus, Annemieke M; Verbeek, J Sjef; van der Weerd, Louise; van Duinen, Sjoerd G; van den Maagdenberg, Arn M J M; Lesnik Oberstein, Saskia A J

    2015-12-29

    CADASIL (Cerebral Autosomal Dominant Arteriopathy with Subcortical Infarcts and Leukoencephalopathy) is a hereditary small vessel disease caused by mutations in the NOTCH3 gene, leading to toxic NOTCH3 protein accumulation in the small- to medium sized arterioles. The accumulation is systemic but most pronounced in the brain vasculature where it leads to clinical symptoms of recurrent stroke and dementia. There is no therapy for CADASIL, and therapeutic development is hampered by a lack of feasible clinical outcome measures and biomarkers, both in mouse models and in CADASIL patients. To facilitate pre-clinical therapeutic interventions for CADASIL, we aimed to develop a novel, translational CADASIL mouse model. We generated transgenic mice in which we overexpressed the full length human NOTCH3 gene from a genomic construct with the archetypal c.544C > T, p.Arg182Cys mutation. The four mutant strains we generated have respective human NOTCH3 RNA expression levels of 100, 150, 200 and 350 % relative to endogenous mouse Notch3 RNA expression. Immunohistochemistry on brain sections shows characteristic vascular human NOTCH3 accumulation in all four mutant strains, with human NOTCH3 RNA expression levels correlating with age at onset and progression of NOTCH3 accumulation. This finding was the basis for developing the 'NOTCH3 score', a quantitative measure for the NOTCH3 accumulation load. This score proved to be a robust and sensitive method to assess the progression of NOTCH3 accumulation, and a feasible biomarker for pre-clinical therapeutic testing. This novel, translational CADASIL mouse model is a suitable model for pre-clinical testing of therapeutic strategies aimed at delaying or reversing NOTCH3 accumulation, using the NOTCH3 score as a biomarker.

  13. A point mutation in the [2Fe–2S] cluster binding region of the NAF-1 protein (H114C) dramatically hinders the cluster donor properties

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tamir, Sagi; Eisenberg-Domovich, Yael; Conlan, Andrea R.

    2014-06-01

    NAF-1 has been shown to be related with human health and disease, is upregulated in epithelial breast cancer and suppression of its expression significantly suppresses tumor growth. It is shown that replacement of the single His ligand with Cys resulted in dramatic changes to the properties of its 2Fe-2S clusters without any global crystal structural changes. NAF-1 is an important [2Fe–2S] NEET protein associated with human health and disease. A mis-splicing mutation in NAF-1 results in Wolfram Syndrome type 2, a lethal childhood disease. Upregulation of NAF-1 is found in epithelial breast cancer cells, and suppression of NAF-1 expression bymore » knockdown significantly suppresses tumor growth. Key to NAF-1 function is the NEET fold with its [2Fe–2S] cluster. In this work, the high-resolution structure of native NAF-1 was determined to 1.65 Å resolution (R factor = 13.5%) together with that of a mutant in which the single His ligand of its [2Fe–2S] cluster, His114, was replaced by Cys. The NAF-1 H114C mutant structure was determined to 1.58 Å resolution (R factor = 16.0%). All structural differences were localized to the cluster binding site. Compared with native NAF-1, the [2Fe–2S] clusters of the H114C mutant were found to (i) be 25-fold more stable, (ii) have a redox potential that is 300 mV more negative and (iii) have their cluster donation/transfer function abolished. Because no global structural differences were found between the mutant and the native (wild-type) NAF-1 proteins, yet significant functional differences exist between them, the NAF-1 H114C mutant is an excellent tool to decipher the underlying biological importance of the [2Fe–2S] cluster of NAF-1 in vivo.« less

  14. Bioluminescence Resonance Energy Transfer Studies Reveal Constitutive Dimerization of the Human Lutropin Receptor and a Lack of Correlation between Receptor Activation and the Propensity for Dimerization*

    PubMed Central

    Guan, Rongbin; Feng, Xiuyan; Wu, Xueqing; Zhang, Meilin; Zhang, Xuesen; Hébert, Terence E.; Segaloff, Deborah L.

    2009-01-01

    Previous studies from our laboratory using co-immunoprecipitation techniques suggested that the human lutropin receptor (hLHR) constitutively self-associates into dimers/oligomers and that agonist treatment of cells either increased hLHR dimerization/oligomerization and/or stabilized hLHR dimers/oligomers to detergent solubilization (Tao, Y. X., Johnson, N. B., and Segaloff, D. L. (2004) J. Biol. Chem. 279, 5904–5914). In this study, bioluminescence resonance energy transfer (BRET2) analyses confirmed that the hLHR constitutively self-associates in living cells. After subcellular fractionation, hLHR dimers/oligomers were detected in both the plasma membrane and endoplasmic reticulum (ER). Further evidence supporting the constitutive formation of hLHR dimer/oligomers in the ER is provided by data showing homodimerization of misfolded hLHR mutants that are retained in the ER. These mutants, when co-expressed with wild-type receptor, are shown by BRET2 to heterodimerize, accounting for their dominant-negative effects on cell surface receptor expression. Hormone desorption assays using intact cells demonstrate allosterism between hLHR protomers, indicating functional cell surface hLHR dimers. However, quantitative BRET2 analyses in intact cells indicate a lack of effect of agonist on the propensity of the hLHR to dimerize. Using purified plasma membranes, human chorionic gonadotropin was similarly observed to have no effect on the BRET2 signal. An examination of the propensity for constitutively active and signaling inactive hLHR mutants to dimerize further showed no correlation between dimerization and the activation state of the hLHR. Taken altogether, our data suggest that hLHR dimers/oligomers are formed early in the biosynthetic pathway in the ER, are constitutively expressed on the plasma membrane, and are not affected by the activation state of the hLHR. PMID:19147490

  15. In vitro synthesis of oncogenic human papillomaviruses requires episomal genomes for differentiation-dependent late expression.

    PubMed Central

    Frattini, M G; Lim, H B; Laimins, L A

    1996-01-01

    Human papillomavirus (HPV) types 16, 18, 31, and 51 are the etiologic agents of many anogenital cancers including those of the cervix. These "high risk" HPVs specifically target genital squamous epithelia, and their lytic life cycle is closely linked to epithelial differentiation. We have developed a genetic assay for HPV functions during pathogenesis using recircularized cloned HPV 31 genomes that were transfected together with a drug resistance marker into monolayer cultures of normal human foreskin keratinocytes, the natural host cell. After drug selection, cell lines were isolated that stably maintained HPV 31 DNA as episomes and underwent terminal differentiation when grown in organotypic raft cultures. In differentiated rafts, the expression of late viral genes, amplification of viral DNA, and production of viral particles were detected in suprabasal cells. This demonstrated the ability to synthesize HPV 31 virions from transfected DNA templates and allowed an examination of HPV functions during the vegetative viral life cycle. We then used this system to investigate whether an episomal genome was required for the induction of late viral gene expression. When an HPV 31 genome (31E1*) containing a missense mutation in the E1 open reading frame was transfected into normal human keratinocytes, the mutant viral sequences were found to integrate into the host cell chromosomal DNA with both early and late regions intact. While high levels of early viral gene transcription were observed, no late gene expression was detected in rafts of cell lines containing the mutant viral genome despite evidence of terminal differentiation. Therefore, the induction of late viral gene expression required that the viral genomes be maintained as extrachromosomal elements, and terminal differentiation alone was not sufficient. These studies provide the basis for a detailed examination of HPV functions during viral pathogenesis. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8610168

  16. Independent regulation of the two Pax5 alleles during B-cell development.

    PubMed

    Nutt, S L; Vambrie, S; Steinlein, P; Kozmik, Z; Rolink, A; Weith, A; Busslinger, M

    1999-04-01

    The developmental control genes of the Pax family are frequently associated with mouse mutants and human disease syndromes. The function of these transcription factors is sensitive to gene dosage, as mutation of one allele or a modest increase in gene number results in phenotypic abnormalities. Pax5 has an important role in B-cell and midbrain development. By following the expression of individual Pax5 alleles at the single-cell level, we demonstrate here that Pax5 is subject to allele-specific regulation during B-lymphopoiesis. Pax5 is predominantly transcribed from only one allele in early progenitors and mature B cells, whereas it switches to a biallelic transcription mode in immature B cells. The allele-specific regulation of Pax5 is stochastic, reversible, independent of parental origin and correlates with synchronous replication, in contrast with imprinted and other monoallelically expressed genes. As a consequence, B-lymphoid tissues are mosaics with respect to the transcribed Pax5 allele, and thus mutation of one allele in heterozygous mice results in deletion of the cell population expressing the mutant allele due to loss of Pax5 function at the single-cell level. Similar allele-specific regulation may be a common mechanism causing the haploinsufficiency and frequent association of other Pax genes with human disease.

  17. Mutations in the Nucleolar Phosphoprotein, Nucleophosmin, Promote the Expression of the Oncogenic Transcription Factor MEF/ELF4 in Leukemia Cells and Potentiates Transformation*

    PubMed Central

    Ando, Koji; Tsushima, Hideki; Matsuo, Emi; Horio, Kensuke; Tominaga-Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Iwanaga, Masako; Itonaga, Hidehiro; Yoshida, Shinichiro; Hata, Tomoko; Moriuchi, Ryozo; Kiyoi, Hitoshi; Nimer, Stephen; Mano, Hiroyuki; Naoe, Tomoki; Tomonaga, Masao; Miyazaki, Yasushi

    2013-01-01

    Myeloid ELF1-like factor (MEF/ELF4), a member of the ETS transcription factors, can function as an oncogene in murine cancer models and is overexpressed in various human cancers. Here, we report a mechanism by which MEF/ELF4 may be activated by a common leukemia-associated mutation in the nucleophosmin gene. By using a tandem affinity purification assay, we found that MEF/ELF4 interacts with multifactorial protein nucleophosmin (NPM1). Coimmunoprecipitation and GST pull-down experiments demonstrated that MEF/ELF4 directly forms a complex with NPM1 and also identified the region of NPM1 that is responsible for this interaction. Functional analyses showed that wild-type NPM1 inhibited the DNA binding and transcriptional activity of MEF/ELF4 on the HDM2 promoter, whereas NPM1 mutant protein (Mt-NPM1) enhanced these activities of MEF/ELF4. Induction of Mt-NPM1 into MEF/ELF4-overexpressing NIH3T3 cells facilitated malignant transformation. In addition, clinical leukemia samples with NPM1 mutations had higher human MDM2 (HDM2) mRNA expression. Our data suggest that enhanced HDM2 expression induced by mutant NPM1 may have a role in MEF/ELF4-dependent leukemogenesis. PMID:23393136

  18. Mutations in the nucleolar phosphoprotein, nucleophosmin, promote the expression of the oncogenic transcription factor MEF/ELF4 in leukemia cells and potentiates transformation.

    PubMed

    Ando, Koji; Tsushima, Hideki; Matsuo, Emi; Horio, Kensuke; Tominaga-Sato, Shinya; Imanishi, Daisuke; Imaizumi, Yoshitaka; Iwanaga, Masako; Itonaga, Hidehiro; Yoshida, Shinichiro; Hata, Tomoko; Moriuchi, Ryozo; Kiyoi, Hitoshi; Nimer, Stephen; Mano, Hiroyuki; Naoe, Tomoki; Tomonaga, Masao; Miyazaki, Yasushi

    2013-03-29

    Myeloid ELF1-like factor (MEF/ELF4), a member of the ETS transcription factors, can function as an oncogene in murine cancer models and is overexpressed in various human cancers. Here, we report a mechanism by which MEF/ELF4 may be activated by a common leukemia-associated mutation in the nucleophosmin gene. By using a tandem affinity purification assay, we found that MEF/ELF4 interacts with multifactorial protein nucleophosmin (NPM1). Coimmunoprecipitation and GST pull-down experiments demonstrated that MEF/ELF4 directly forms a complex with NPM1 and also identified the region of NPM1 that is responsible for this interaction. Functional analyses showed that wild-type NPM1 inhibited the DNA binding and transcriptional activity of MEF/ELF4 on the HDM2 promoter, whereas NPM1 mutant protein (Mt-NPM1) enhanced these activities of MEF/ELF4. Induction of Mt-NPM1 into MEF/ELF4-overexpressing NIH3T3 cells facilitated malignant transformation. In addition, clinical leukemia samples with NPM1 mutations had higher human MDM2 (HDM2) mRNA expression. Our data suggest that enhanced HDM2 expression induced by mutant NPM1 may have a role in MEF/ELF4-dependent leukemogenesis.

  19. Human cathepsin L rescues the neurodegeneration and lethality incathepsin B/L double deficient mice

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sevenich, Lisa; Pennacchio, Len A.; Peters, Christoph

    2006-01-09

    Cathepsin B (CTSB) and cathepsin L (CTSL) are two widelyexpressed cysteine proteases thought to predominantly reside withinlysosomes. Functional analysis of CTSL in humans is complicated by theexistence of two CTSL-like homologues (CTSL and CTSL2), in contrast tomice which contain only one CTSL enzyme. Thus transgenic expression ofhuman CTSL in CTSL deficient mice provides an opportunity to study the invivo functions of this human protease without interference by its highlyrelated homologue. While mice with single gene deficiencies for murineCTSB or CTSL survive without apparent neuromuscular impairment, murineCTSB/CTSL double deficient mice display degeneration of cerebellarPurkinje cells and neurons of the cerebral cortex,more » resulting in severehypotrophy, motility defects, and lethality during their third to fourthweek of life. Here we show that expression of human CTSL through agenomic transgene results in widespread expression of human CTSL in themouse which is capable of rescuing the lethality found in CTSB/CTSLdouble-deficient animals. Human CTSL is expressed in the brain of thesecompound mutants predominantly in neurons of the cerebral cortex and inPurkinje cells of the cerebellum, where it appears to prevent neuronalcell death.« less

  20. Carboxy-terminal cleavage of the human foamy virus Gag precursor molecule is an essential step in the viral life cycle.

    PubMed Central

    Enssle, J; Fischer, N; Moebes, A; Mauer, B; Smola, U; Rethwilm, A

    1997-01-01

    Foamy viruses (FVs) express the Gag protein as a precursor with a molecular mass of 74 kDa (pr74) from which a 70-kDa protein (p70) is cleaved by the viral protease. To gain a better understanding of FV Gag protein processing and function, we have generated and analyzed mutants in the C-terminal gag region of an infectious molecular clone. Our results show that p70 is an N-terminal cleavage product of pr74. However, we were unable to identify a p4 molecule. A virus mutant expressing p70 only was found to be replication competent, albeit at very low titers compared to those of wild-type virus. A strong tendency to synthesize and cleave a pr74 molecule was deduced from the occurrence of revertants upon transfection of this mutant. Substitution of the p6gag domain of human immunodeficiency virus type 1 for the p4 domain of FV resulted in a stable chimeric virus which replicated to titers 10 times lower than those of wild-type virus. FV Gag protein was found to be phosphorylated at serine residues. Mutagenesis of serines conserved in the p4 domain had no influence on viral replication in cell culture. The p70/p74 Gag cleavage was found to be required for viral infectivity, since mutagenesis of the putative cleavage site led to replication-incompetent virus. Interestingly, the cleavage site mutants were defective in the intracellular cDNA synthesis of virion DNA, which indicates that correct FV particle formation and the generation of virion DNA are functionally linked. PMID:9311808

  1. Lipotoxin F of Pseudomonas aeruginosa is an AlgU-dependent and alginate-independent outer membrane protein involved in resistance to oxidative stress and adhesion to A549 human lung epithelia.

    PubMed

    Damron, F Heath; Napper, Jennifer; Teter, M Allison; Yu, Hongwei D

    2009-04-01

    Chronic lung infection with P. aeruginosa and excessive neutrophil-associated inflammation are major causes of morbidity and mortality in patients with cystic fibrosis (CF). Overproduction of an exopolysaccharide known as alginate leads to the formation of mucoid biofilms that are resistant to antibiotics and host defences. Alginate overproduction or mucoidy is controlled by a stress-related ECF sigma factor AlgU/T. Mutation in the anti-sigma factor MucA is a known mechanism for conversion to mucoidy. Recently, we showed that inactivation of a kinase (KinB) in nonmucoid strain PAO1 results in overproduction of alginate. Here, we report the initial characterization of lipotoxin F (LptF, PA3692), an OmpA-like outer membrane protein that exhibited increased expression in the mucoid PAO1kinB mutant. The lipotoxin family of proteins has been previously shown to induce inflammation in lung epithelia, which may play a role in CF disease progression. Expression of LptF was observed to be AlgU-dependent and upregulated in CF isolates. Deletion of lptF from the kinB mutant had no effect on alginate production. Deletion of lptF from PAO1 caused a differential susceptibility to oxidants that can be generated by phagocytes. The lptF and algU mutants were more sensitive to hypochlorite than PAO1. However, the lptF mutant displayed increased resistance to hydrogen peroxide. LptF also contributed to adhesion to A549 human lung epithelial cells. Our data suggest that LptF is an outer membrane protein that may be important for P. aeruginosa survival in harsh environments, including lung colonization in CF.

  2. Lipotoxin F of Pseudomonas aeruginosa is an AlgU-dependent and alginate-independent outer membrane protein involved in resistance to oxidative stress and adhesion to A549 human lung epithelia

    PubMed Central

    Damron, F. Heath; Napper, Jennifer; Teter, M. Allison; Yu, Hongwei D.

    2009-01-01

    Chronic lung infection with P. aeruginosa and excessive neutrophil-associated inflammation are major causes of morbidity and mortality in patients with cystic fibrosis (CF). Overproduction of an exopolysaccharide known as alginate leads to the formation of mucoid biofilms that are resistant to antibiotics and host defences. Alginate overproduction or mucoidy is controlled by a stress-related ECF sigma factor AlgU/T. Mutation in the anti-sigma factor MucA is a known mechanism for conversion to mucoidy. Recently, we showed that inactivation of a kinase (KinB) in nonmucoid strain PAO1 results in overproduction of alginate. Here, we report the initial characterization of lipotoxin F (LptF, PA3692), an OmpA-like outer membrane protein that exhibited increased expression in the mucoid PAO1kinB mutant. The lipotoxin family of proteins has been previously shown to induce inflammation in lung epithelia, which may play a role in CF disease progression. Expression of LptF was observed to be AlgU-dependent and upregulated in CF isolates. Deletion of lptF from the kinB mutant had no effect on alginate production. Deletion of lptF from PAO1 caused a differential susceptibility to oxidants that can be generated by phagocytes. The lptF and algU mutants were more sensitive to hypochlorite than PAO1. However, the lptF mutant displayed increased resistance to hydrogen peroxide. LptF also contributed to adhesion to A549 human lung epithelial cells. Our data suggest that LptF is an outer membrane protein that may be important for P. aeruginosa survival in harsh environments, including lung colonization in CF. PMID:19332805

  3. Phosphorylation of Nanog is Essential to Regulate Bmi1 and Promote Tumorigenesis

    PubMed Central

    Xie, Xiujie; Piao, Longzhu; Cavey, Greg S.; Old, Matthew; Teknos, Theodoros N.; Mapp, Anna K; Pan, Quintin

    2014-01-01

    Emerging evidence indicates that Nanog is intimately involved in tumorigenesis in part through regulation of the cancer initiating cell population. However, the regulation and role of Nanog in tumorigenesis are still poorly understood. In this study, human Nanog was identified to be phosphorylated by human PKCε at multiple residues including T200 and T280. Our work indicated that phosphorylation at T200 and T280 modulates Nanog function through several regulatory mechanisms. Results with phosphorylation-insensitive and phosphorylation-mimetic mutant Nanog revealed that phosphorylation at T200 and T280 enhance Nanog protein stability. Moreover, phosphorylation-insensitive T200A and T280A mutant Nanog had a dominant-negative function to inhibit endogenous Nanog transcriptional activity. Inactivation of Nanog was due to impaired homodimerization, DNA binding, promoter occupancy, and p300, a transcriptional co-activator, recruitment resulting in a defect in target gene promoter activation. Ectopic expression of phosphorylation-insensitive T200A or T280A mutant Nanog reduced cell proliferation, colony formation, invasion, migration, and the cancer initiating cell population in head and neck squamous cell carcinoma (HNSCC) cells. The in vivo cancer initiating ability was severely compromised in HNSCC cells expressing phosphorylation-insensitive T200A or T280A mutant Nanog; 87.5% (14/16), 12.5% (1/8), and 0% (0/8) for control, T200A, and T280A, respectively. Nanog occupied the Bmi1 promoter to directly transactivate and regulate Bmi1. Genetic ablation and rescue experiments demonstrated that Bmi1 is a critical downstream signaling node for the pleiotropic, pro-oncogenic effects of Nanog. Taken together, our study revealed, for the first time, that post-translational phosphorylation of Nanog is essential to regulate Bmi1 and promote tumorigenesis. PMID:23708658

  4. Using yeast to determine the functional consequences of mutations in the human p53 tumor suppressor gene: An introductory course-based undergraduate research experience in molecular and cell biology.

    PubMed

    Hekmat-Scafe, Daria S; Brownell, Sara E; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S; Stearns, Tim

    2017-03-04

    The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course-based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students' high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA-binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161-178, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.

  5. Using yeast to determine the functional consequences of mutations in the human p53 tumor suppressor gene: An introductory course‐based undergraduate research experience in molecular and cell biology

    PubMed Central

    Brownell, Sara E.; Seawell, Patricia Chandler; Malladi, Shyamala; Imam, Jamie F. Conklin; Singla, Veena; Bradon, Nicole; Cyert, Martha S.; Stearns, Tim

    2016-01-01

    Abstract The opportunity to engage in scientific research is an important, but often neglected, component of undergraduate training in biology. We describe the curriculum for an innovative, course‐based undergraduate research experience (CURE) appropriate for a large, introductory cell and molecular biology laboratory class that leverages students′ high level of interest in cancer. The course is highly collaborative and emphasizes the analysis and interpretation of original scientific data. During the course, students work in teams to characterize a collection of mutations in the human p53 tumor suppressor gene via expression and analysis in yeast. Initially, student pairs use both qualitative and quantitative assays to assess the ability of their p53 mutant to activate expression of reporter genes, and they localize their mutation within the p53 structure. Through facilitated discussion, students suggest possible molecular explanations for the transactivation defects displayed by their p53 mutants and propose experiments to test these hypotheses that they execute during the second part of the course. They use a western blot to determine whether mutant p53 levels are reduced, a DNA‐binding assay to test whether recognition of any of three p53 target sequences is compromised, and fluorescence microscopy to assay nuclear localization. Students studying the same p53 mutant periodically convene to discuss and interpret their combined data. The course culminates in a poster session during which students present their findings to peers, instructors, and the greater biosciences community. Based on our experience, we provide recommendations for the development of similar large introductory lab courses. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(2):161–178, 2017. PMID:27873457

  6. Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant

    PubMed Central

    Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A.; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K.; Altenbach, Christian; Hong, Yuan; Hanson, Susan M.; Palazzo, Maria C.; Chen, Jeannie; Hubbell, Wayne L.; Gurevich, Eugenia V.; Gurevich, Vsevolod V.

    2013-01-01

    Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. PMID:24012956

  7. Rapid degeneration of rod photoreceptors expressing self-association-deficient arrestin-1 mutant.

    PubMed

    Song, Xiufeng; Seo, Jungwon; Baameur, Faiza; Vishnivetskiy, Sergey A; Chen, Qiuyan; Kook, Seunghyi; Kim, Miyeon; Brooks, Evan K; Altenbach, Christian; Hong, Yuan; Hanson, Susan M; Palazzo, Maria C; Chen, Jeannie; Hubbell, Wayne L; Gurevich, Eugenia V; Gurevich, Vsevolod V

    2013-12-01

    Arrestin-1 binds light-activated phosphorhodopsin and ensures timely signal shutoff. We show that high transgenic expression of an arrestin-1 mutant with enhanced rhodopsin binding and impaired oligomerization causes apoptotic rod death in mice. Dark rearing does not prevent mutant-induced cell death, ruling out the role of arrestin complexes with light-activated rhodopsin. Similar expression of WT arrestin-1 that robustly oligomerizes, which leads to only modest increase in the monomer concentration, does not affect rod survival. Moreover, WT arrestin-1 co-expressed with the mutant delays retinal degeneration. Thus, arrestin-1 mutant directly affects cell survival via binding partner(s) other than light-activated rhodopsin. Due to impaired self-association of the mutant its high expression dramatically increases the concentration of the monomer. The data suggest that monomeric arrestin-1 is cytotoxic and WT arrestin-1 protects rods by forming mixed oligomers with the mutant and/or competing with it for the binding to non-receptor partners. Thus, arrestin-1 self-association likely serves to keep low concentration of the toxic monomer. The reduction of the concentration of harmful monomer is an earlier unappreciated biological function of protein oligomerization. © 2013.

  8. Calorimetric study of mutant human lysozymes with partially introduced Ca2+ binding sites and its efficient refolding system from inclusion bodies.

    PubMed

    Koshiba, T; Tsumoto, K; Masaki, K; Kawano, K; Nitta, K; Kumagai, I

    1998-08-01

    During the process of evolution, ancestral lysozymes evolved into calcium-binding lysozymes by acquiring three critical aspartate residues at positions 86, 91 and 92. To investigate the process of the acquisition of calcium-binding ability, two of the aspartates were partially introduced into human lysozyme at positions 86, 91 and 92. These mutants (HLQ86D, HLA92D and HLQ86D/D91Q/A92D), having two critical aspartates in calcium-binding sites, were expressed in Escherichia coli as non-active inclusion bodies. For the preparation of lysozyme samples, a refolding system using thioredoxin was established. This system allowed for effective refolding of wild-type and mutant lysozymes, and 100% of activity was recovered within 4 days. The calcium ion dependence of the melting temperature (Tm) of wild-type and mutant lysozymes was investigated by differential scanning calorimetry at pH 4.5. The Tm values of wild-type, HLQ86D and HLA92D mutants were not dependent on calcium ion concentration. However, the Tm of HLQ86D/D91Q/A92D was 4 degrees higher in the presence of 50 mM CaCl2 than in its absence, and the calcium-binding constant of this mutant was estimated to be 2.25(+/-0.25)x10(2) M(-1) at pH 4.5. Moreover, the calcium-binding ability of this mutant was confirmed by the result using Sephadex G-25 gel chromatography. These results indicate that it is indispensable to have at least two aspartates at positions 86 and 92 for acquisition of calcium-binding ability. The process of the acquisition of calcium-binding site during evolution of calcium-binding lysozyme is discussed.

  9. Congenital Heart Disease–Causing Gata4 Mutation Displays Functional Deficits In Vivo

    PubMed Central

    Misra, Chaitali; Sachan, Nita; McNally, Caryn Rothrock; Koenig, Sara N.; Nichols, Haley A.; Guggilam, Anuradha; Lucchesi, Pamela A.; Pu, William T.; Srivastava, Deepak; Garg, Vidu

    2012-01-01

    Defects of atrial and ventricular septation are the most frequent form of congenital heart disease, accounting for almost 50% of all cases. We previously reported that a heterozygous G296S missense mutation of GATA4 caused atrial and ventricular septal defects and pulmonary valve stenosis in humans. GATA4 encodes a cardiac transcription factor, and when deleted in mice it results in cardiac bifida and lethality by embryonic day (E)9.5. In vitro, the mutant GATA4 protein has a reduced DNA binding affinity and transcriptional activity and abolishes a physical interaction with TBX5, a transcription factor critical for normal heart formation. To characterize the mutation in vivo, we generated mice harboring the same mutation, Gata4 G295S. Mice homozygous for the Gata4 G295S mutant allele have normal ventral body patterning and heart looping, but have a thin ventricular myocardium, single ventricular chamber, and lethality by E11.5. While heterozygous Gata4 G295S mutant mice are viable, a subset of these mice have semilunar valve stenosis and small defects of the atrial septum. Gene expression studies of homozygous mutant mice suggest the G295S protein can sufficiently activate downstream targets of Gata4 in the endoderm but not in the developing heart. Cardiomyocyte proliferation deficits and decreased cardiac expression of CCND2, a member of the cyclin family and a direct target of Gata4, were found in embryos both homozygous and heterozygous for the Gata4 G295S allele. To further define functions of the Gata4 G295S mutation in vivo, compound mutant mice were generated in which specific cell lineages harbored both the Gata4 G295S mutant and Gata4 null alleles. Examination of these mice demonstrated that the Gata4 G295S protein has functional deficits in early myocardial development. In summary, the Gata4 G295S mutation functions as a hypomorph in vivo and leads to defects in cardiomyocyte proliferation during embryogenesis, which may contribute to the development of congenital heart defects in humans. PMID:22589735

  10. A zebrafish sox9 gene required for cartilage morphogenesis.

    PubMed

    Yan, Yi-Lin; Miller, Craig T; Nissen, Robert M; Singer, Amy; Liu, Dong; Kirn, Anette; Draper, Bruce; Willoughby, John; Morcos, Paul A; Amsterdam, Adam; Chung, Bon-Chu; Westerfield, Monte; Haffter, Pascal; Hopkins, Nancy; Kimmel, Charles; Postlethwait, John H; Nissen, Robert

    2002-11-01

    The molecular genetic mechanisms of cartilage construction are incompletely understood. Zebrafish embryos homozygous for jellyfish (jef) mutations show craniofacial defects and lack cartilage elements of the neurocranium, pharyngeal arches, and pectoral girdle similar to humans with campomelic dysplasia. We show that two alleles of jef contain mutations in sox9a, one of two zebrafish orthologs of the human transcription factor SOX9. A mutation induced by ethyl nitrosourea changed a conserved nucleotide at a splice junction and severely reduced splicing of sox9a transcript. A retrovirus insertion into sox9a disrupted its DNA-binding domain. Inhibiting splicing of the sox9a transcript in wild-type embryos with splice site-directed morpholino antisense oligonucleotides produced a phenotype like jef mutant larvae, and caused sox9a transcript to accumulate in the nucleus; this accumulation can serve as an assay for the efficacy of a morpholino independent of phenotype. RNase-protection assays showed that in morpholino-injected animals, the percent of splicing inhibition decreased from 80% at 28 hours post fertilization to 45% by 4 days. Homozygous mutant embryos had greatly reduced quantities of col2a1 message, the major collagen of cartilage. Analysis of dlx2 expression showed that neural crest specification and migration was normal in jef (sox9a) embryos. Confocal images of living embryos stained with BODIPY-ceramide revealed at single-cell resolution the formation of precartilage condensations in mutant embryos. Besides the lack of overt cartilage differentiation, pharyngeal arch condensations in jef (sox9a) mutants lacked three specific morphogenetic behaviors: the stacking of chondrocytes into orderly arrays, the individuation of pharyngeal cartilage organs and the proper shaping of individual cartilages. Despite the severe reduction of cartilages, analysis of titin expression showed normal muscle patterning in jef (sox9a) mutants. Likewise, calcein labeling revealed that early bone formation was largely unaffected in jef (sox9a) mutants. These studies show that jef (sox9a) is essential for both morphogenesis of condensations and overt cartilage differentiation.

  11. Correlating levels of type III secretion and secreted proteins with fecal shedding of Escherichia coli O157:H7 in cattle.

    PubMed

    Sharma, V K; Sacco, R E; Kunkle, R A; Bearson, S M D; Palmquist, D E

    2012-04-01

    The locus of enterocyte effacement (LEE) of Escherichia coli O157:H7 (O157) encodes a type III secretion system (T3SS) for secreting LEE-encoded and non-LEE-encoded virulence proteins that promote the adherence of O157 to intestinal epithelial cells and the persistence of this food-borne human pathogen in bovine intestines. In this study, we compared hha sepB and hha mutants of O157 for LEE transcription, T3SS activity, adherence to HEp-2 cells, persistence in bovine intestines, and the ability to induce changes in the expression of proinflammatory cytokines. LEE transcription was upregulated in the hha sepB and hha mutant strains compared to that in the wild-type strain, but the secretion of virulence proteins in the hha sepB mutant was severely compromised. This reduced secretion resulted in reduced adherence of the hha sepB mutant to Hep-2 cells, correlating with a significantly shorter duration and lower magnitude of fecal shedding in feces of weaned (n = 4 per group) calves inoculated with this mutant strain. The levels of LEE transcription, T3SS activity, and adherence to HEp-2 cells were much lower in the wild-type strain than in the hha mutant, but no significant differences were observed in the duration or the magnitude of fecal shedding in calves inoculated with these strains. Examination of the rectoanal junction (RAJ) tissues from three groups of calves showed no adherent O157 bacteria and similar proinflammatory cytokine gene expression, irrespective of the inoculated strain, with the exception that interleukin-1β was upregulated in calves inoculated with the hha sepB mutant. These results indicate that the T3SS is essential for intestinal colonization and prolonged shedding, but increased secretion of virulence proteins did not enhance the duration and magnitude of fecal shedding of O157 in cattle or have any significant impact on the cytokine gene expression in RAJ tissue compared with that in small intestinal tissue from the same calves.

  12. Roles of brca2 (fancd1) in oocyte nuclear architecture, gametogenesis, gonad tumors, and genome stability in zebrafish.

    PubMed

    Rodríguez-Marí, Adriana; Wilson, Catherine; Titus, Tom A; Cañestro, Cristian; BreMiller, Ruth A; Yan, Yi-Lin; Nanda, Indrajit; Johnston, Adam; Kanki, John P; Gray, Erin M; He, Xinjun; Spitsbergen, Jan; Schindler, Detlev; Postlethwait, John H

    2011-03-01

    Mild mutations in BRCA2 (FANCD1) cause Fanconi anemia (FA) when homozygous, while severe mutations cause common cancers including breast, ovarian, and prostate cancers when heterozygous. Here we report a zebrafish brca2 insertional mutant that shares phenotypes with human patients and identifies a novel brca2 function in oogenesis. Experiments showed that mutant embryos and mutant cells in culture experienced genome instability, as do cells in FA patients. In wild-type zebrafish, meiotic cells expressed brca2; and, unexpectedly, transcripts in oocytes localized asymmetrically to the animal pole. In juvenile brca2 mutants, oocytes failed to progress through meiosis, leading to female-to-male sex reversal. Adult mutants became sterile males due to the meiotic arrest of spermatocytes, which then died by apoptosis, followed by neoplastic proliferation of gonad somatic cells that was similar to neoplasia observed in ageing dead end (dnd)-knockdown males, which lack germ cells. The construction of animals doubly mutant for brca2 and the apoptotic gene tp53 (p53) rescued brca2-dependent sex reversal. Double mutants developed oocytes and became sterile females that produced only aberrant embryos and showed elevated risk for invasive ovarian tumors. Oocytes in double-mutant females showed normal localization of brca2 and pou5f1 transcripts to the animal pole and vasa transcripts to the vegetal pole, but had a polarized rather than symmetrical nucleus with the distribution of nucleoli and chromosomes to opposite nuclear poles; this result revealed a novel role for Brca2 in establishing or maintaining oocyte nuclear architecture. Mutating tp53 did not rescue the infertility phenotype in brca2 mutant males, suggesting that brca2 plays an essential role in zebrafish spermatogenesis. Overall, this work verified zebrafish as a model for the role of Brca2 in human disease and uncovered a novel function of Brca2 in vertebrate oocyte nuclear architecture.

  13. Roles of brca2 (fancd1) in Oocyte Nuclear Architecture, Gametogenesis, Gonad Tumors, and Genome Stability in Zebrafish

    PubMed Central

    Rodríguez-Marí, Adriana; Wilson, Catherine; Titus, Tom A.; Cañestro, Cristian; BreMiller, Ruth A.; Yan, Yi-Lin; Nanda, Indrajit; Johnston, Adam; Kanki, John P.; Gray, Erin M.; He, Xinjun; Spitsbergen, Jan; Schindler, Detlev; Postlethwait, John H.

    2011-01-01

    Mild mutations in BRCA2 (FANCD1) cause Fanconi anemia (FA) when homozygous, while severe mutations cause common cancers including breast, ovarian, and prostate cancers when heterozygous. Here we report a zebrafish brca2 insertional mutant that shares phenotypes with human patients and identifies a novel brca2 function in oogenesis. Experiments showed that mutant embryos and mutant cells in culture experienced genome instability, as do cells in FA patients. In wild-type zebrafish, meiotic cells expressed brca2; and, unexpectedly, transcripts in oocytes localized asymmetrically to the animal pole. In juvenile brca2 mutants, oocytes failed to progress through meiosis, leading to female-to-male sex reversal. Adult mutants became sterile males due to the meiotic arrest of spermatocytes, which then died by apoptosis, followed by neoplastic proliferation of gonad somatic cells that was similar to neoplasia observed in ageing dead end (dnd)-knockdown males, which lack germ cells. The construction of animals doubly mutant for brca2 and the apoptotic gene tp53 (p53) rescued brca2-dependent sex reversal. Double mutants developed oocytes and became sterile females that produced only aberrant embryos and showed elevated risk for invasive ovarian tumors. Oocytes in double-mutant females showed normal localization of brca2 and pou5f1 transcripts to the animal pole and vasa transcripts to the vegetal pole, but had a polarized rather than symmetrical nucleus with the distribution of nucleoli and chromosomes to opposite nuclear poles; this result revealed a novel role for Brca2 in establishing or maintaining oocyte nuclear architecture. Mutating tp53 did not rescue the infertility phenotype in brca2 mutant males, suggesting that brca2 plays an essential role in zebrafish spermatogenesis. Overall, this work verified zebrafish as a model for the role of Brca2 in human disease and uncovered a novel function of Brca2 in vertebrate oocyte nuclear architecture. PMID:21483806

  14. Mutant Huntingtin Causes a Selective Decrease in the Expression of Synaptic Vesicle Protein 2C.

    PubMed

    Peng, Chaohua; Zhu, Gaochun; Liu, Xiangqian; Li, He

    2018-04-30

    Huntington's disease (HD) is a neurodegenerative disease caused by a polyglutamine expansion in the huntingtin (Htt) protein. Mutant Htt causes synaptic transmission dysfunctions by interfering in the expression of synaptic proteins, leading to early HD symptoms. Synaptic vesicle proteins 2 (SV2s), a family of synaptic vesicle proteins including 3 members, SV2A, SV2B, and SV2C, plays important roles in synaptic physiology. Here, we investigated whether the expression of SV2s is affected by mutant Htt in the brains of HD transgenic (TG) mice and Neuro2a mouse neuroblastoma cells (N2a cells) expressing mutant Htt. Western blot analysis showed that the protein levels of SV2A and SV2B were not significantly changed in the brains of HD TG mice expressing mutant Htt with 82 glutamine repeats. However, in the TG mouse brain there was a dramatic decrease in the protein level of SV2C, which has a restricted distribution pattern in regions particularly vulnerable in HD. Immunostaining revealed that the immunoreactivity of SV2C was progressively weakened in the basal ganglia and hippocampus of TG mice. RT-PCR demonstrated that the mRNA level of SV2C progressively declined in the TG mouse brain without detectable changes in the mRNA levels of SV2A and SV2B, indicating that mutant Htt selectively inhibits the transcriptional expression of SV2C. Furthermore, we found that only SV2C expression was progressively inhibited in N2a cells expressing a mutant Htt containing 120 glutamine repeats. These findings suggest that the synaptic dysfunction in HD results from the mutant Htt-mediated inhibition of SV2C transcriptional expression. These data also imply that the restricted distribution and decreased expression of SV2C contribute to the brain region-selective pathology of HD.

  15. Mechanistically Distinct Mouse Models for CRX-Associated Retinopathy

    PubMed Central

    Tran, Nicholas M.; Zhang, Alan; Zhang, Xiaodong; Huecker, Julie B.; Hennig, Anne K.; Chen, Shiming

    2014-01-01

    Cone-rod homeobox (CRX) protein is a “paired-like” homeodomain transcription factor that is essential for regulating rod and cone photoreceptor transcription. Mutations in human CRX are associated with the dominant retinopathies Retinitis Pigmentosa (RP), Cone-Rod Dystrophy (CoRD) and Leber Congenital Amaurosis (LCA), with variable severity. Heterozygous Crx Knock-Out (KO) mice (“+/−”) have normal vision as adults and fail to model the dominant human disease. To investigate how different mutant CRX proteins produce distinct disease pathologies, we generated two Crx Knock-IN (K-IN) mouse models: CrxE168d2 (“E168d2”) and CrxR90W (“R90W”). E168d2 mice carry a frameshift mutation in the CRX activation domain, Glu168del2, which is associated with severe dominant CoRD or LCA in humans. R90W mice carry a substitution mutation in the CRX homeodomain, Arg90Trp, which is associated with dominant mild late-onset CoRD and recessive LCA. As seen in human patients, heterozygous E168d2 (“E168d2/+”) but not R90W (“R90W/+”) mice show severely impaired retinal function, while mice homozygous for either mutation are blind and undergo rapid photoreceptor degeneration. E168d2/+ mice also display abnormal rod/cone morphology, greater impairment of CRX target gene expression than R90W/+ or +/− mice, and undergo progressive photoreceptor degeneration. Surprisingly, E168d2/+ mice express more mutant CRX protein than wild-type CRX. E168d2neo/+, a subline of E168d2 with reduced mutant allele expression, displays a much milder retinal phenotype, demonstrating the impact of Crx expression level on disease severity. Both CRX[E168d2] and CRX[R90W] proteins fail to activate transcription in vitro, but CRX[E168d2] interferes more strongly with the function of wild type (WT) CRX, supporting an antimorphic mechanism. E168d2 and R90W are mechanistically distinct mouse models for CRX-associated disease that will allow the elucidation of molecular mechanisms and testing of novel therapeutic approaches for different forms of CRX-associated disease. PMID:24516401

  16. Identification of Homeotic Target Genes in Drosophila Melanogaster Including Nervy, a Proto-Oncogene Homologue

    PubMed Central

    Feinstein, P. G.; Kornfeld, K.; Hogness, D. S.; Mann, R. S.

    1995-01-01

    In Drosophila, the specific morphological characteristics of each segment are determined by the homeotic genes that regulate the expression of downstream target genes. We used a subtractive hybridization procedure to isolate activated target genes of the homeotic gene Ultrabithorax (Ubx). In addition, we constructed a set of mutant genotypes that measures the regulatory contribution of individual homeotic genes to a complex target gene expression pattern. Using these mutants, we demonstrate that homeotic genes can regulate target gene expression at the start of gastrulation, suggesting a previously unknown role for the homeotic genes at this early stage. We also show that, in abdominal segments, the levels of expression for two target genes increase in response to high levels of Ubx, demonstrating that the normal down-regulation of Ubx in these segments is functional. Finally, the DNA sequence of cDNAs for one of these genes predicts a protein that is similar to a human proto-oncogene involved in acute myeloid leukemias. These results illustrate potentially general rules about the homeotic control of target gene expression and suggest that subtractive hybridization can be used to isolate interesting homeotic target genes. PMID:7498738

  17. Insertion and deletion mutagenesis of the human cytomegalovirus genome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spaete, R.R.; Mocarski, E.S.

    1987-10-01

    Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less

  18. SYN2 is an autism predisposing gene: loss-of-function mutations alter synaptic vesicle cycling and axon outgrowth

    PubMed Central

    Corradi, Anna; Fadda, Manuela; Piton, Amélie; Patry, Lysanne; Marte, Antonella; Rossi, Pia; Cadieux-Dion, Maxime; Gauthier, Julie; Lapointe, Line; Mottron, Laurent; Valtorta, Flavia; Rouleau, Guy A.; Fassio, Anna; Benfenati, Fabio; Cossette, Patrick

    2014-01-01

    An increasing number of genes predisposing to autism spectrum disorders (ASDs) has been identified, many of which are implicated in synaptic function. This ‘synaptic autism pathway’ notably includes disruption of SYN1 that is associated with epilepsy, autism and abnormal behavior in both human and mice models. Synapsins constitute a multigene family of neuron-specific phosphoproteins (SYN1-3) present in the majority of synapses where they are implicated in the regulation of neurotransmitter release and synaptogenesis. Synapsins I and II, the major Syn isoforms in the adult brain, display partially overlapping functions and defects in both isoforms are associated with epilepsy and autistic-like behavior in mice. In this study, we show that nonsense (A94fs199X) and missense (Y236S and G464R) mutations in SYN2 are associated with ASD in humans. The phenotype is apparent in males. Female carriers of SYN2 mutations are unaffected, suggesting that SYN2 is another example of autosomal sex-limited expression in ASD. When expressed in SYN2  knockout neurons, wild-type human Syn II fully rescues the SYN2 knockout phenotype, whereas the nonsense mutant is not expressed and the missense mutants are virtually unable to modify the SYN2 knockout phenotype. These results identify for the first time SYN2  as a novel predisposing gene for ASD and strengthen the hypothesis that a disturbance of synaptic homeostasis underlies ASD. PMID:23956174

  19. HMG CoA Lyase (HL): Mutation detection and development of a bacterial expression system for screening the activity of mutant alleles from HL-deficient patients

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robert, M.F.; Ashmarina, L.; Poitier, E.

    1994-09-01

    HL catalyzes the last step of ketogenesis, and autosomal recessive HL deficiency in humans can cause episodes of hypoglycemia and coma. Structurally, HL is a dimer of identical 325-residue peptides which requires a reducing environment to maintain activity. We cloned the human and mouse HL cDNAs and genes and have performed mutation analysis on cells from 30 HL-deficient probands. Using SSCP and also genomic Southern analysis we have identified putative mutations on 53/60 alleles of these patients (88%). To date, we have found 20 mutations: 3 large deletions, 4 termination mutations, 5 frameshift mutations, and 8 missense mutations which wemore » suspect to be pathogenic based on evolutionary conservation and/or our previous studies on purified HL protein. We have also identified 3 polymorphic variants. In order to directly test the activity of the missense mutations, we established a pGEX-based system, using a glutathione S transferase (GST)-HL fusion protein. Expressed wild-type GST-HL was insoluble. We previously located a reactive Cys at the C-terminus of chicken HL which is conserved in human HL. We produced a mutant HL peptide, C323S, which replaced Cys323 with Ser. Purified C323S is soluble and has similar kinetics to wild-type HL. C323S-containing GST-HL is soluble and enzymatically active. We are cloning and expressing the 8 missense mutations.« less

  20. A novel human pain insensitivity disorder caused by a point mutation in ZFHX2

    PubMed Central

    Habib, Abdella M; Matsuyama, Ayako; Okorokov, Andrei L; Santana-Varela, Sonia; Bras, Jose T; Aloisi, Anna Maria; Emery, Edward C; Bogdanov, Yury D; Follenfant, Maryne; Gossage, Sam J; Gras, Mathilde; Humphrey, Jack; Kolesnikov, Anna; Le Cann, Kim; Li, Shengnan; Minett, Michael S; Pereira, Vanessa; Ponsolles, Clara; Sikandar, Shafaq; Torres, Jesus M; Yamaoka, Kenji; Zhao, Jing; Komine, Yuriko; Yamamori, Tetsuo; Maniatis, Nikolas; Panov, Konstantin I; Houlden, Henry; Ramirez, Juan D; Bennett, David L H; Marsili, Letizia; Bachiocco, Valeria; Wood, John N; Cox, James J

    2018-01-01

    Abstract Chronic pain is a major global public health issue causing a severe impact on both the quality of life for sufferers and the wider economy. Despite the significant clinical burden, little progress has been made in terms of therapeutic development. A unique approach to identifying new human-validated analgesic drug targets is to study rare families with inherited pain insensitivity. Here we have analysed an otherwise normal family where six affected individuals display a pain insensitive phenotype that is characterized by hyposensitivity to noxious heat and painless bone fractures. This autosomal dominant disorder is found in three generations and is not associated with a peripheral neuropathy. A novel point mutation in ZFHX2, encoding a putative transcription factor expressed in small diameter sensory neurons, was identified by whole exome sequencing that segregates with the pain insensitivity. The mutation is predicted to change an evolutionarily highly conserved arginine residue 1913 to a lysine within a homeodomain. Bacterial artificial chromosome (BAC) transgenic mice bearing the orthologous murine p.R1907K mutation, as well as Zfhx2 null mutant mice, have significant deficits in pain sensitivity. Gene expression analyses in dorsal root ganglia from mutant and wild-type mice show altered expression of genes implicated in peripheral pain mechanisms. The ZFHX2 variant and downstream regulated genes associated with a human pain-insensitive phenotype are therefore potential novel targets for the development of new analgesic drugs. PMID:29253101

  1. The cell cycle regulator ecdysoneless cooperates with H-Ras to promote oncogenic transformation of human mammary epithelial cells.

    PubMed

    Bele, Aditya; Mirza, Sameer; Zhang, Ying; Ahmad Mir, Riyaz; Lin, Simon; Kim, Jun Hyun; Gurumurthy, Channabasavaiah Basavaraju; West, William; Qiu, Fang; Band, Hamid; Band, Vimla

    2015-01-01

    The mammalian ortholog of Drosophila ecdysoneless (Ecd) gene product regulates Rb-E2F interaction and is required for cell cycle progression. Ecd is overexpressed in breast cancer and its overexpression predicts shorter survival in patients with ErbB2-positive tumors. Here, we demonstrate Ecd knock down (KD) in human mammary epithelial cells (hMECs) induces growth arrest, similar to the impact of Ecd Knock out (KO) in mouse embryonic fibroblasts. Furthermore, whole-genome mRNA expression analysis of control vs. Ecd KD in hMECs demonstrated that several of the top 40 genes that were down-regulated were E2F target genes. To address the role of Ecd in mammary oncogenesis, we overexpressed Ecd and/or mutant H-Ras in hTERT-immortalized hMECs. Cell cycle analyses revealed hMECs overexpressing Ecd+Ras showed incomplete arrest in G1 phase upon growth factor deprivation, and more rapid cell cycle progression in growth factor-containing medium. Analyses of cell migration, invasion, acinar structures in 3-D Matrigel and anchorage-independent growth demonstrated that Ecd+Ras-overexpressing cells exhibit substantially more dramatic transformed phenotype as compared to cells expressing vector, Ras or Ecd. Under conditions of nutrient deprivation, Ecd+Ras-overexpressing hMECs exhibited better survival, with substantial upregulation of the autophagy marker LC3 both at the mRNA and protein levels. Significantly, while hMECs expressing Ecd or mutant Ras alone did not form tumors in NOD/SCID mice, Ecd+Ras-overexpressing hMECs formed tumors, clearly demonstrating oncogenic cooperation between Ecd and mutant Ras. Collectively, we demonstrate an important co-oncogenic role of Ecd in the progression of mammary oncogenesis through promoting cell survival.

  2. A modified acetylcholine receptor δ-subunit enables a null mutant to survive beyond sexual maturation

    PubMed Central

    Epley, Kimberly E.; Urban, Jason M.; Ikenaga, Takanori; Ono, Fumihito

    2008-01-01

    The contraction of skeletal muscle is dependent upon synaptic transmission through acetylcholine receptors (AChRs) at the neuromuscular junction (NMJ). The lack of an AChR subunit causes a fetal akinesia in humans, leading to death in the first trimester and characteristic features of Fetal Akinesia Deformation Sequences (FADS). A corresponding null mutation of the δ-subunit in zebrafish (sofa potato; sop−/−) leads to the death of embryos around 5 days post-fertilization (dpf). In sop−/− mutants, we expressed modified δ-subunits, with one (δ1YFP) or two yellow fluorescent protein (δ2YFP) molecules fused at the intracellular loop, under the control of an α-actin promoter. AChRs containing these fusion proteins are fluorescent, assemble on the plasma membrane, make clusters under motor neuron endings, and generate synaptic current. We screened for germ-line transmission of the transgene and established a line of sop−/− fish stably expressing the δ2YFP. These δ2YFP/sop−/− embryos can mount escape behavior close to that of their wild type siblings. Synaptic currents in these embryos had a smaller amplitude, slower rise time, and slower decay when compared to wild type fish. Remarkably, these embryos grow to adulthood and display complex behaviors such as feeding and breeding. To the best of our knowledge, this is the first case of a mutant animal corresponding to first trimester lethality in human that has been rescued by a transgene and survived to adulthood. In the rescued fish, a foreign promoter drove the transgene expression and the NMJ had altered synaptic strength. The survival of the transgenic animal delineates requirements for gene therapies of NMJ. PMID:19052214

  3. The cell cycle regulator ecdysoneless cooperates with H-Ras to promote oncogenic transformation of human mammary epithelial cells

    PubMed Central

    Bele, Aditya; Mirza, Sameer; Zhang, Ying; Ahmad Mir, Riyaz; Lin, Simon; Kim, Jun Hyun; Gurumurthy, Channabasavaiah Basavaraju; West, William; Qiu, Fang; Band, Hamid; Band, Vimla

    2015-01-01

    The mammalian ortholog of Drosophila ecdysoneless (Ecd) gene product regulates Rb-E2F interaction and is required for cell cycle progression. Ecd is overexpressed in breast cancer and its overexpression predicts shorter survival in patients with ErbB2-positive tumors. Here, we demonstrate Ecd knock down (KD) in human mammary epithelial cells (hMECs) induces growth arrest, similar to the impact of Ecd Knock out (KO) in mouse embryonic fibroblasts. Furthermore, whole-genome mRNA expression analysis of control vs. Ecd KD in hMECs demonstrated that several of the top 40 genes that were down-regulated were E2F target genes. To address the role of Ecd in mammary oncogenesis, we overexpressed Ecd and/or mutant H-Ras in hTERT-immortalized hMECs. Cell cycle analyses revealed hMECs overexpressing Ecd+Ras showed incomplete arrest in G1 phase upon growth factor deprivation, and more rapid cell cycle progression in growth factor-containing medium. Analyses of cell migration, invasion, acinar structures in 3-D Matrigel and anchorage-independent growth demonstrated that Ecd+Ras-overexpressing cells exhibit substantially more dramatic transformed phenotype as compared to cells expressing vector, Ras or Ecd. Under conditions of nutrient deprivation, Ecd+Ras-overexpressing hMECs exhibited better survival, with substantial upregulation of the autophagy marker LC3 both at the mRNA and protein levels. Significantly, while hMECs expressing Ecd or mutant Ras alone did not form tumors in NOD/SCID mice, Ecd+Ras-overexpressing hMECs formed tumors, clearly demonstrating oncogenic cooperation between Ecd and mutant Ras. Collectively, we demonstrate an important co-oncogenic role of Ecd in the progression of mammary oncogenesis through promoting cell survival. PMID:25616580

  4. General anesthetic octanol and related compounds activate wild-type and delF508 cystic fibrosis chloride channels

    PubMed Central

    Marcet, Brice; Becq, Frédéric; Norez, Caroline; Delmas, Patrick; Verrier, Bernard

    2004-01-01

    Cystic fibrosis transmembrane conductance regulator (CFTR) Cl− channel is defective during cystic fibrosis (CF). Activators of the CFTR Cl− channel may be useful for therapy of CF. Here, we demonstrate that a range of general anesthetics like normal-alkanols (n-alkanols) and related compounds can stimulate the Cl− channel activity of wild-type CFTR and delF508-CFTR mutant. The effects of n-alkanols like octanol on CFTR activity were measured by iodide (125I) efflux and patch-clamp techniques on three distinct cellular models: (1) CFTR-expressing Chinese hamster ovary cells, (2) human airway Calu-3 epithelial cells and (3) human airway JME/CF15 epithelial cells which express the delF508-CFTR mutant. Our data show for the first time that n-alkanols activate both wild-type CFTR and delF508-CFTR mutant. Octanol stimulated 125I efflux in a dose-dependent manner in CFTR-expressing cells (wild-type and delF508) but not in cell lines lacking CFTR. 125I efflux and Cl− currents induced by octanol were blocked by glibenclamide but insensitive to 4,4′-diisothiocyanatostilbene-2,2′-disulfonic acid, as expected for a CFTR Cl− current. CFTR activation by octanol was neither due to cell-to-cell uncoupling properties of octanol nor to an intracellular cAMP increase. CFTR activation by octanol requires phosphorylation by protein kinase-A (PKA) since it was prevented by H-89, a PKA inhibitor. n-Alkanols chain length was an important determinant for channel activation, with rank order of potencies: 1-heptanol<1-octanol<2-octanol<1-decanol. Our findings may be of valuable interest for developing novel therapeutic strategies for CF. PMID:14967738

  5. General anesthetic octanol and related compounds activate wild-type and delF508 cystic fibrosis chloride channels.

    PubMed

    Marcet, Brice; Becq, Frédéric; Norez, Caroline; Delmas, Patrick; Verrier, Bernard

    2004-03-01

    1. Cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel is defective during cystic fibrosis (CF). Activators of the CFTR Cl(-) channel may be useful for therapy of CF. Here, we demonstrate that a range of general anesthetics like normal-alkanols (n-alkanols) and related compounds can stimulate the Cl(-) channel activity of wild-type CFTR and delF508-CFTR mutant. 2. The effects of n-alkanols like octanol on CFTR activity were measured by iodide ((125)I) efflux and patch-clamp techniques on three distinct cellular models: (1). CFTR-expressing Chinese hamster ovary cells, (2). human airway Calu-3 epithelial cells and (3). human airway JME/CF15 epithelial cells which express the delF508-CFTR mutant. 3. Our data show for the first time that n-alkanols activate both wild-type CFTR and delF508-CFTR mutant. Octanol stimulated (125)I efflux in a dose-dependent manner in CFTR-expressing cells (wild-type and delF508) but not in cell lines lacking CFTR. (125)I efflux and Cl(-) currents induced by octanol were blocked by glibenclamide but insensitive to 4,4'-diisothiocyanatostilbene-2,2'-disulfonic acid, as expected for a CFTR Cl(-) current. 4. CFTR activation by octanol was neither due to cell-to-cell uncoupling properties of octanol nor to an intracellular cAMP increase. CFTR activation by octanol requires phosphorylation by protein kinase-A (PKA) since it was prevented by H-89, a PKA inhibitor. 5. n-Alkanols chain length was an important determinant for channel activation, with rank order of potencies: 1-heptanol<1-octanol<2-octanol<1-decanol. Our findings may be of valuable interest for developing novel therapeutic strategies for CF.

  6. Natural human apoA-I mutations L141RPisa and L159RFIN alter HDL structure and functionality and promote atherosclerosis development in mice.

    PubMed

    Tiniakou, Ioanna; Kanaki, Zoi; Georgopoulos, Spiros; Chroni, Angeliki; Van Eck, Miranda; Fotakis, Panagiotis; Zannis, Vassilis I; Kardassis, Dimitris

    2015-11-01

    Mutations in human apolipoprotein A-I (apoA-I) are associated with low high-density lipoprotein (HDL) cholesterol levels and pathological conditions such as premature atherosclerosis and amyloidosis. In this study we functionally characterized two natural human apoA-I mutations, L141RPisa and L159RFIN, in vivo. We generated transgenic mice expressing either wild-type (WT) or the two mutant forms of human apoA-I on a mouse apoA-I(-/-) background and analyzed for abnormalities in their lipid and lipoprotein profiles. HDL structure and functionality, as well as atherosclerosis development following a 14-week high-fat diet were assessed in these mice. The expression of either apoA-I mutant was associated with markedly reduced serum apoA-I (<10% of WT apoA-I), total and HDL-cholesterol levels (∼20% and ∼7% of WT apoA-I, respectively) and the formation of few small size HDL particles with preβ2 and α3, α4 electrophoretic mobility. HDL particles containing either of the two apoA-I mutants exhibited attenuated anti-oxidative properties as indicated by their inability to prevent low-density lipoprotein oxidation, and by decreased activities of paraoxonase-1 and platelet-activating factor acetylhydrolase. However, the apoA-I(L141R)Pisa or apoA-I(L159R)FIN-containing HDL particles demonstrated increased capacity to promote ATP-Binding Cassette Transporter A1-mediated cholesterol efflux from macrophages. Expression of apoA-I(L141R)Pisa or apoA-I(L159R)FIN mutations in mice was associated with increased diet-induced atherosclerosis compared to either WT apoA-I transgenic or apoA-I(-/-) mice. These findings suggest that natural apoA-I mutations L141RPisa and L159RFIN affect the biogenesis and the functionality of HDL in vivo and predispose to diet-induced atherosclerosis in the absence of any other genetic defect. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  7. Expression of the voltage-gated potassium channel KCNQ1 in mammalian taste bud cells and the effect of its null-mutation on taste preferences.

    PubMed

    Wang, Hong; Iguchi, Naoko; Rong, Qi; Zhou, Minliang; Ogunkorode, Martina; Inoue, Masashi; Pribitkin, Edmund A; Bachmanov, Alexander A; Margolskee, Robert F; Pfeifer, Karl; Huang, Liquan

    2009-01-20

    Vertebrate taste buds undergo continual cell turnover. To understand how the gustatory progenitor cells in the stratified lingual epithelium migrate and differentiate into different types of mature taste cells, we sought to identify genes that were selectively expressed in taste cells at different maturation stages. Here we report the expression of the voltage-gated potassium channel KCNQ1 in mammalian taste buds of mouse, rat, and human. Immunohistochemistry and nuclear staining showed that nearly all rodent and human taste cells express this channel. Double immunostaining with antibodies against type II and III taste cell markers validated the presence of KCNQ1 in these two types of cells. Co-localization studies with cytokeratin 14 indicated that KCNQ1 is also expressed in type IV basal precursor cells. Null mutation of the kcnq1 gene in mouse, however, did not alter the gross structure of taste buds or the expression of taste signaling molecules. Behavioral assays showed that the mutant mice display reduced preference to some umami substances, but not to any other taste compounds tested. Gustatory nerve recordings, however, were unable to detect any significant change in the integrated nerve responses of the mutant mice to umami stimuli. These results suggest that although it is expressed in nearly all taste bud cells, the function of KCNQ1 is not required for gross taste bud development or peripheral taste transduction pathways, and the reduced preference of kcnq1-null mice in the behavioral assays may be attributable to the deficiency in the central nervous system or other organs.

  8. MiR-142-3p is downregulated in aggressive p53 mutant mouse models of pancreatic ductal adenocarcinoma by hypermethylation of its locus.

    PubMed

    Godfrey, Jack D; Morton, Jennifer P; Wilczynska, Ania; Sansom, Owen J; Bushell, Martin D

    2018-05-29

    Pancreatic ductal adenocarcinoma (PDAC) is an extremely aggressive disease with poor prognostic implications. This is partly due to a large proportion of PDACs carrying mutations in TP53, which impart gain-of-function characteristics that promote metastasis. There is evidence that microRNAs (miRNAs) may play a role in both gain-of-function TP53 mutations and metastasis, but this has not been fully explored in PDAC. Here we set out to identify miRNAs which are specifically dysregulated in metastatic PDAC. To achieve this, we utilised established mouse models of PDAC to profile miRNA expression in primary tumours expressing the metastasis-inducing mutant p53 R172H and compared these to two control models carrying mutations, which promote tumour progression but do not induce metastasis. We show that a subset of miRNAs are dysregulated in mouse PDAC tumour tissues expressing mutant p53 R172H , primary cell lines derived from mice with the same mutations and in TP53 null cells with ectopic expression of the orthologous human mutation, p53 R175H . Specifically, miR-142-3p is downregulated in all of these experimental models. We found that DNA methyltransferase 1 (Dnmt1) is upregulated in tumour tissue and cell lines, which express p53 R172H . Inhibition or depletion of Dnmt1 restores miR-142-3p expression. Overexpression of miR-142-3p attenuates the invasive capacity of p53 R172H -expressing tumour cells. MiR-142-3p dysregulation is known to be associated with cancer progression, metastasis and the miRNA is downregulated in patients with PDAC. Here we link TP53 gain-of-function mutations to Dnmt1 expression and in turn miR-142-3p expression. Additionally, we show a correlation between expression of these genes and patient survival, suggesting that they may have potential to be therapeutic targets.

  9. Pharmacological chaperones facilitate the post-ER transport of recombinant N370S mutant β-glucocerebrosidase in plant cells: Evidence that N370S is a folding mutant

    PubMed Central

    Babajani, Gholamreza; Tropak, Michael B.; Mahuran, Don J.; Kermode, Allison R.

    2012-01-01

    Gaucher disease is a prevalent lysosomal storage disease in which affected individuals inherit mutations in the gene (GBA1) encoding lysosomal acid β-glucosidase (glucocerebrosidase, GCase, EC 3.2.1.45). One of the most prevalent disease-causing mutations in humans is a N370S missense mutation in the GCase protein. As part of a larger endeavor to study the fate of mutant human proteins expressed in plant cells, the N370S mutant protein along with the wild-type- (WT)-GCase, both equipped with a signal peptide, were synthesized in transgenic tobacco BY2 cells, which do not possess lysosomes. The enzymatic activity of plant-recombinant N370S GCase lines was significantly lower (by 81–95%) than that of the WT-GCase lines. In contrast to the WT-GCase protein, which was efficiently secreted from tobacco BY2 cells, and detected in large amounts in the culture medium, only a small proportion of the N370S GCase was secreted. Pharmacological chaperones such as N-(n-nonyl) deoxynojirimycin and ambroxol increased the steady-state mutant protein levels both inside the plant cells and in the culture medium. These findings contradict the assertion that small molecule chaperones increase N370S GCase activity (as assayed in treated patient cell lysates) by stabilizing the enzyme in the lysosome, and suggest that the mutant protein is impaired in its ability to obtain its functional folded conformation, which is a requirement for exiting the lumen of the ER. PMID:22592100

  10. Functional analysis of human foamy virus accessory reading frames.

    PubMed Central

    Baunach, G; Maurer, B; Hahn, H; Kranz, M; Rethwilm, A

    1993-01-01

    Foamy viruses belong to the retroviruses which possess a complex genome structure. The human foamy virus (HFV) isolate bears three open reading frames (the so-called bel genes) in the 3' region of the genome which have been reported to give rise to possibly six different proteins via alternative splicing (W. Muranyi and R. M. Flügel, J. Virol. 65:727-735, 1991). In order to analyze the requirements of these proteins for HFV replication in vitro, we constructed a set of single and combinatory bel gene mutants of an infectious molecular clone of HFV. The mutant which lacked the transacting activator, bel-1, was found to be replication incompetent. All other mutants replicated equally well and gave rise to comparable titers of infectious cell-free virus. When HFV proviruses were put under the control of a heterologous promoter (simian virus 40), none of the accessory gene products was found to be required for expression of structural (gag) proteins. There was no evidence for a posttranscriptional regulatory protein that is present in other complex retroviruses. Images PMID:8394455

  11. Mutational analysis of the reverse transcriptase and ribonuclease H domains of the human foamy virus.

    PubMed Central

    Kögel, D; Aboud, M; Flügel, R M

    1995-01-01

    Human foamy or spuma virus (HFV) codes for a distinct set of pol gen products. To determine the minimal requirements for the HFV enzymatic activities, defined residues of the reverse transcriptase (RT) and ribo-nuclease H (RNase H) domain of the HFV pol gene were mutated by site-specific PCR mutagenesis. The mutant gene products were bacterially expressed, purified by Ni2+ chelate affinity chromatography and characterised by Western blotting. The enzymatic activities of the individual recombinant HFV pol mutant proteins were characterised by the situ RT, RNase H and RNase H assays. Two substitution mutants reached RT activity levels higher than that of the intact recombinant HFV RT-RH-His. When the catalytically essential D508 was substituted by A508, 5% of RNase H activity was retained while DNA polymerase activity increased 2-fold. A deletion of 11 amino acid residues in the hinge region completely abolished DNA polymerase while RNase H activity decreased 2-fold. A deletion mutant in the C-terminal RH domain showed no RNase H but retained RNase H activity indicating that the activities are genetically separable. The combined data reveal that the HFV DNA polymerase and RNase H activities are interdependent. Images PMID:7544460

  12. Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

    PubMed Central

    Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

    2008-01-01

    Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

  13. SigCH, an extracytoplasmic function sigma factor of Porphyromonas gingivalis regulates the expression of cdhR and hmuYR.

    PubMed

    Ota, Koki; Kikuchi, Yuichiro; Imamura, Kentaro; Kita, Daichi; Yoshikawa, Kouki; Saito, Atsushi; Ishihara, Kazuyuki

    2017-02-01

    Extracytoplasmic function (ECF) sigma factors play an important role in the bacterial response to various environmental stresses. Porphyromonas gingivalis, a prominent etiological agent in human periodontitis, possesses six putative ECF sigma factors. So far, information is limited on the ECF sigma factor, PGN_0319. The aim of this study was to investigate the role of PGN_0319 (SigCH) of P. gingivalis, focusing on the regulation of hmuY and hmuR, which encode outer-membrane proteins involved in hemin utilization, and cdhR, a transcriptional regulator of hmuYR. First, we evaluated the gene expression profile of the sigCH mutant by DNA microarray. Among the genes with altered expression levels, those involved in hemin utilization were downregulated in the sigCH mutant. To verify the microarray data, quantitative reverse transcription PCR analysis was performed. The RNA samples used were obtained from bacterial cells grown to early-log phase, in which sigCH expression in the wild type was significantly higher than that in mid-log and late-log phases. The expression levels of hmuY, hmuR, and cdhR were significantly decreased in the sigCH mutant compared to wild type. Transcription of these genes was restored in a sigCH complemented strain. Compared to the wild type, the sigCH mutant showed reduced growth in log phase under hemin-limiting conditions. Electrophoretic mobility shift assays showed that recombinant SigCH protein bound to the promoter region of hmuY and cdhR. These results suggest that SigCH plays an important role in the early growth of P. gingivalis, and directly regulates cdhR and hmuYR, thereby playing a potential role in the mechanisms of hemin utilization by P. gingivalis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. Oat consumption reduced intestinal fat deposition and improved health span in Caenorhabditis elegans model

    PubMed Central

    Gao, Chenfei; Gao, Zhanguo; Greenway, Frank L.; Burton, Jeffrey H.; Johnson, William D.; Keenan, Michael J.; Enright, Frederick M.; Martin, Roy J.; Chu, YiFang; Zheng, Jolene

    2015-01-01

    In addition to their fermentable dietary fiber and the soluble β-glucan fiber, oats have unique avenanthramides that have anti-inflammatory and antioxidant properties that reduce coronary heart disease in human clinical trials. We hypothesized that oat consumption will increase insulin sensitivity, reduce body fat, and improve health span in Caenorhabditis elegans through a mechanism involving the daf-2 gene, which codes for the insulin/insulin-like growth factor-1–like receptor, and that hyperglycemia will attenuate these changes. Caenorhabditis elegans wild type (N2) and the null strains sir-2.1, daf-16, and daf-16/daf-2 were fed Escherichia coli (OP50) and oat flakes (0.5%, 1.0%, or 3%) with and without 2% glucose. Oat feeding decreased intestinal fat deposition in N2, daf-16, or daf-16/daf-2 strains (P < .05); and glucose did not affect intestinal fat deposition response. The N2, daf-16, or sir-2.1 mutant increased the pharyngeal pumping rate (P < .05), a surrogate marker of life span, following oat consumption. Oat consumption increased ckr-1, gcy-8, cpt-1, and cpt-2 mRNA expression in both the N2 and the sir-2.1 mutant, with significantly higher expression in sir-2.1 than in N2 (P < .01). Additional glucose further increased expression 1.5-fold of the 4 genes in N2 (P < .01), decreased the expression of all except cpt-1 in the daf-16 mutant, and reduced mRNA expression of the 4 genes in the daf-16/daf-2 mutant (P < .01). These data suggest that oat consumption reduced fat storage and increased ckr-1, gcy-8, cpt-1, or cpt-2 through the sir-2.1 genetic pathway. Oat consumption may be a beneficial dietary intervention for reducing fat accumulation, augmenting health span, and improving hyperglycemia-impaired lipid metabolism. PMID:26253816

  15. Staphylococcus aureus golden pigment impairs neutrophil killing and promotes virulence through its antioxidant activity.

    PubMed

    Liu, George Y; Essex, Anthony; Buchanan, John T; Datta, Vivekanand; Hoffman, Hal M; Bastian, John F; Fierer, Joshua; Nizet, Victor

    2005-07-18

    Golden color imparted by carotenoid pigments is the eponymous feature of the human pathogen Staphylococcus aureus. Here we demonstrate a role of this hallmark phenotype in virulence. Compared with the wild-type (WT) bacterium, a S. aureus mutant with disrupted carotenoid biosynthesis is more susceptible to oxidant killing, has impaired neutrophil survival, and is less pathogenic in a mouse subcutaneous abscess model. The survival advantage of WT S. aureus over the carotenoid-deficient mutant is lost upon inhibition of neutrophil oxidative burst or in human or murine nicotinamide adenine dinucleotide phosphate oxidase-deficient hosts. Conversely, heterologous expression of the S. aureus carotenoid in the nonpigmented Streptococcus pyogenes confers enhanced oxidant and neutrophil resistance and increased animal virulence. Blocking S. aureus carotenogenesis increases oxidant sensitivity and decreases whole-blood survival, suggesting a novel target for antibiotic therapy.

  16. Quantitative evaluation of his-tag purification and immunoprecipitation of tristetraprolin and its mutant proteins from transfected human cells

    USDA-ARS?s Scientific Manuscript database

    Histidine (His)-tag is widely used for affinity purification of recombinant proteins, but the yield and purity of expressed proteins are quite different. Little information is available about quantitative evaluation of this procedure. The objective of the current study was to evaluate the His-tag pr...

  17. Transcriptional and proteomic analysis of the Aspergillus fumigatus ΔprtT protease-deficient mutant.

    PubMed

    Hagag, Shelly; Kubitschek-Barreira, Paula; Neves, Gabriela W P; Amar, David; Nierman, William; Shalit, Itamar; Shamir, Ron; Lopes-Bezerra, Leila; Osherov, Nir

    2012-01-01

    Aspergillus fumigatus is the most common opportunistic mold pathogen of humans, infecting immunocompromised patients. The fungus invades the lungs and other organs, causing severe damage. Penetration of the pulmonary epithelium is a key step in the infectious process. A. fumigatus produces extracellular proteases to degrade the host structural barriers. The A. fumigatus transcription factor PrtT controls the expression of multiple secreted proteases. PrtT shows similarity to the fungal Gal4-type Zn(2)-Cys(6) DNA-binding domain of several transcription factors. In this work, we further investigate the function of this transcription factor by performing a transcriptional and a proteomic analysis of the ΔprtT mutant. Unexpectedly, microarray analysis revealed that in addition to the expected decrease in protease expression, expression of genes involved in iron uptake and ergosterol synthesis was dramatically decreased in the ΔprtT mutant. A second finding of interest is that deletion of prtT resulted in the upregulation of four secondary metabolite clusters, including genes for the biosynthesis of toxic pseurotin A. Proteomic analysis identified reduced levels of three secreted proteases (ALP1 protease, TppA, AFUA_2G01250) and increased levels of three secreted polysaccharide-degrading enzymes in the ΔprtT mutant possibly in response to its inability to derive sufficient nourishment from protein breakdown. This report highlights the complexity of gene regulation by PrtT, and suggests a potential novel link between the regulation of protease secretion and the control of iron uptake, ergosterol biosynthesis and secondary metabolite production in A. fumigatus.

  18. Functional domains of the poliovirus receptor

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Koike, Satoshi; Ise, Iku; Nomoto, Akio

    1991-05-15

    A number of mutant cDNAs of the human poliovirus receptor were constructed to identify essential regions of the molecule as the receptor. All mutant cDNAs carrying the sequence coding for the entire N-terminal immunoglobulin-like domain (domain I) confer permissiveness for poliovirus to mouse L cells, but a mutant cDNA lacking the sequence for domain I does not. The transformants permissive for poliovirus were able to bind the virus and were also recognized by monoclonal antibody D171, which competes with poliovirus for the cellular receptor. These results strongly suggest that the poliovirus binding site resides in domain I of the receptor.more » Mutant cDNAs for the sequence encoding the intracellular peptide were also constructed and expressed in mouse L cells. Susceptibility of these cells to poliovirus revealed that the entire putative cytoplasmic domain is not essential for virus infection. Thus, the cytoplasmic domain of the molecule appears not to play a role in the penetration of poliovirus.« less

  19. Pilot study of large-scale production of mutant pigs by ENU mutagenesis.

    PubMed

    Hai, Tang; Cao, Chunwei; Shang, Haitao; Guo, Weiwei; Mu, Yanshuang; Yang, Shulin; Zhang, Ying; Zheng, Qiantao; Zhang, Tao; Wang, Xianlong; Liu, Yu; Kong, Qingran; Li, Kui; Wang, Dayu; Qi, Meng; Hong, Qianlong; Zhang, Rui; Wang, Xiupeng; Jia, Qitao; Wang, Xiao; Qin, Guosong; Li, Yongshun; Luo, Ailing; Jin, Weiwu; Yao, Jing; Huang, Jiaojiao; Zhang, Hongyong; Li, Menghua; Xie, Xiangmo; Zheng, Xuejuan; Guo, Kenan; Wang, Qinghua; Zhang, Shibin; Li, Liang; Xie, Fei; Zhang, Yu; Weng, Xiaogang; Yin, Zhi; Hu, Kui; Cong, Yimei; Zheng, Peng; Zou, Hailong; Xin, Leilei; Xia, Jihan; Ruan, Jinxue; Li, Hegang; Zhao, Weiming; Yuan, Jing; Liu, Zizhan; Gu, Weiwang; Li, Ming; Wang, Yong; Wang, Hongmei; Yang, Shiming; Liu, Zhonghua; Wei, Hong; Zhao, Jianguo; Zhou, Qi; Meng, Anming

    2017-06-22

    N-ethyl-N-nitrosourea (ENU) mutagenesis is a powerful tool to generate mutants on a large scale efficiently, and to discover genes with novel functions at the whole-genome level in Caenorhabditis elegans, flies, zebrafish and mice, but it has never been tried in large model animals. We describe a successful systematic three-generation ENU mutagenesis screening in pigs with the establishment of the Chinese Swine Mutagenesis Consortium. A total of 6,770 G1 and 6,800 G3 pigs were screened, 36 dominant and 91 recessive novel pig families with various phenotypes were established. The causative mutations in 10 mutant families were further mapped. As examples, the mutation of SOX10 (R109W) in pig causes inner ear malfunctions and mimics human Mondini dysplasia, and upregulated expression of FBXO32 is associated with congenital splay legs. This study demonstrates the feasibility of artificial random mutagenesis in pigs and opens an avenue for generating a reservoir of mutants for agricultural production and biomedical research.

  20. An integrative approach unveils FOSL1 as an oncogene vulnerability in KRAS-driven lung and pancreatic cancer.

    PubMed

    Vallejo, Adrian; Perurena, Naiara; Guruceaga, Elisabet; Mazur, Pawel K; Martinez-Canarias, Susana; Zandueta, Carolina; Valencia, Karmele; Arricibita, Andrea; Gwinn, Dana; Sayles, Leanne C; Chuang, Chen-Hua; Guembe, Laura; Bailey, Peter; Chang, David K; Biankin, Andrew; Ponz-Sarvise, Mariano; Andersen, Jesper B; Khatri, Purvesh; Bozec, Aline; Sweet-Cordero, E Alejandro; Sage, Julien; Lecanda, Fernando; Vicent, Silve

    2017-02-21

    KRAS mutated tumours represent a large fraction of human cancers, but the vast majority remains refractory to current clinical therapies. Thus, a deeper understanding of the molecular mechanisms triggered by KRAS oncogene may yield alternative therapeutic strategies. Here we report the identification of a common transcriptional signature across mutant KRAS cancers of distinct tissue origin that includes the transcription factor FOSL1. High FOSL1 expression identifies mutant KRAS lung and pancreatic cancer patients with the worst survival outcome. Furthermore, FOSL1 genetic inhibition is detrimental to both KRAS-driven tumour types. Mechanistically, FOSL1 links the KRAS oncogene to components of the mitotic machinery, a pathway previously postulated to function orthogonally to oncogenic KRAS. FOSL1 targets include AURKA, whose inhibition impairs viability of mutant KRAS cells. Lastly, combination of AURKA and MEK inhibitors induces a deleterious effect on mutant KRAS cells. Our findings unveil KRAS downstream effectors that provide opportunities to treat KRAS-driven cancers.

  1. Complementation between polymerase- and exonuclease-deficient mitochondrial DNA polymerase mutants in genomically engineered flies

    PubMed Central

    Bratic, Ana; Kauppila, Timo E. S.; Macao, Bertil; Grönke, Sebastian; Siibak, Triinu; Stewart, James B.; Baggio, Francesca; Dols, Jacqueline; Partridge, Linda; Falkenberg, Maria; Wredenberg, Anna; Larsson, Nils-Göran

    2015-01-01

    Replication errors are the main cause of mitochondrial DNA (mtDNA) mutations and a compelling approach to decrease mutation levels would therefore be to increase the fidelity of the catalytic subunit (POLγA) of the mtDNA polymerase. Here we genomically engineer the tamas locus, encoding fly POLγA, and introduce alleles expressing exonuclease- (exo−) and polymerase-deficient (pol−) POLγA versions. The exo− mutant leads to accumulation of point mutations and linear deletions of mtDNA, whereas pol− mutants cause mtDNA depletion. The mutant tamas alleles are developmentally lethal but can complement each other in trans resulting in viable flies with clonally expanded mtDNA mutations. Reconstitution of human mtDNA replication in vitro confirms that replication is a highly dynamic process where POLγA goes on and off the template to allow complementation during proofreading and elongation. The created fly models are valuable tools to study germ line transmission of mtDNA and the pathophysiology of POLγA mutation disease. PMID:26554610

  2. A METABOLIC SIGNATURE FOR LONG-LIFE IN THE C. ELEGANS MIT MUTANTS

    PubMed Central

    Butler, Jeffrey A.; Mishur, Robert J.; Bhaskaran, Shylesh; Rea, Shane L.

    2012-01-01

    SUMMARY Mit mutations that disrupt function of the mitochondrial electron transport chain can, inexplicably, prolong Caenorhabditis elegans lifespan. In this study we use a metabolomics approach to identify an ensemble of mitochondrial-derived α-ketoacids and α-hydroxyacids that are produced by long-lived Mit mutants but not by other long-lived mutants or by short-lived mitochondrial mutants. We show that accumulation of these compounds is dependent upon concerted inhibition of three α-ketoacid dehydrogenases that share dihydrolipoamide dehydrogenase (DLD) as a common subunit, a protein previously linked in humans with increased risk of Alzheimer’s disease. When the expression of DLD in wild type animals was reduced using RNA interference we observed an unprecedented effect on lifespan - as RNAi dosage was increased lifespan was significantly shortened but, at higher doses, it was significantly lengthened, suggesting DLD plays a unique role in modulating length of life. Our findings provide novel insight into the origin of the Mit phenotype. PMID:23173729

  3. The role of crumbs genes in the vertebrate cornea.

    PubMed

    Beyer, Jill; Zhao, Xinping C; Yee, Richard; Khaliq, Shagufta; McMahon, Timothy T; Ying, Hongyu; Yue, Beatrice Y J T; Malicki, Jarema J

    2010-09-01

    To evaluate the role of crumbs genes and related epithelial polarity loci in the vertebrate cornea. The authors used histologic analysis and electron microscopy to evaluate the corneas of zebrafish mutant for a crumbs locus oko meduzy (ome) and in mutants of four other loci, nagie oko (nok), heart and soul (has), mosaic eyes (moe), and ncad (formerly glass onion), that function in the same or related genetic pathways. In parallel, they performed an evaluation of corneas in human carriers of a crumbs gene, CRB1, and mutations using topography and biomicroscopy. The expression of the CRB1 gene in the normal human cornea was examined by polymerase chain reaction (PCR) and immunohistochemical staining. The corneas of zebrafish mutants display severe abnormalities of the epithelial and stromal layers. The epithelial cells do not properly adhere to each other, and fluid-filled spaces form between them. In addition, the layering of the corneal stroma is poorly formed or absent. The corneas of human carriers of CRB1 mutations display shape deviations compared with what has been observed in normal individuals. A PCR product of the correct size was obtained from normal human corneal samples. Sequence analyses confirmed its identity to be the human CRB1 gene. Immunohistochemical staining using anti-CRB1 yielded positive brown deposits in the human cornea. crumbs genes play a role in the differentiation of the vertebrate cornea. Corneal defects associated with crumbs gene mutations are very severe in the zebrafish model and, in comparison, appear clinically less pronounced in the human eye.

  4. Nontransgenic Genome Modification in Plant Cells1[W][OA

    PubMed Central

    Marton, Ira; Zuker, Amir; Shklarman, Elena; Zeevi, Vardit; Tovkach, Andrey; Roffe, Suzy; Ovadis, Marianna; Tzfira, Tzvi; Vainstein, Alexander

    2010-01-01

    Zinc finger nucleases (ZFNs) are a powerful tool for genome editing in eukaryotic cells. ZFNs have been used for targeted mutagenesis in model and crop species. In animal and human cells, transient ZFN expression is often achieved by direct gene transfer into the target cells. Stable transformation, however, is the preferred method for gene expression in plant species, and ZFN-expressing transgenic plants have been used for recovery of mutants that are likely to be classified as transgenic due to the use of direct gene-transfer methods into the target cells. Here we present an alternative, nontransgenic approach for ZFN delivery and production of mutant plants using a novel Tobacco rattle virus (TRV)-based expression system for indirect transient delivery of ZFNs into a variety of tissues and cells of intact plants. TRV systemically infected its hosts and virus ZFN-mediated targeted mutagenesis could be clearly observed in newly developed infected tissues as measured by activation of a mutated reporter transgene in tobacco (Nicotiana tabacum) and petunia (Petunia hybrida) plants. The ability of TRV to move to developing buds and regenerating tissues enabled recovery of mutated tobacco and petunia plants. Sequence analysis and transmission of the mutations to the next generation confirmed the stability of the ZFN-induced genetic changes. Because TRV is an RNA virus that can infect a wide range of plant species, it provides a viable alternative to the production of ZFN-mediated mutants while avoiding the use of direct plant-transformation methods. PMID:20876340

  5. The NS2 polypeptide of parvovirus MVM is required for capsid assembly in murine cells.

    PubMed

    Cotmore, S F; D'Abramo, A M; Carbonell, L F; Bratton, J; Tattersall, P

    1997-05-12

    Mutants of minute virus of mice (MVM) which express truncated forms of the NS2 polypeptide are known to exhibit a host range defect, replicating productively in transformed human cells but not in cells from their normal murine host. To explore this deficiency we generated viruses with translation termination codons at various positions in the second exon of NS2. In human cells these mutants were viable, but showed a late defect in progeny virion release which put them at a selective disadvantage compared to the wildtype. In murine cells, however, duplex viral DNA amplification was reduced to 5% of wildtype levels and single-strand DNA synthesis was undetectable. These deficiencies could not be attributed to a failure to initiate infection or to a generalized defect in viral gene expression, since the viral replicator protein NS1 was expressed to normal or elevated levels early in infection. In contrast, truncated NS2 gene products failed to accumulate, so that each mutant exhibited a similar NS2-null phenotype. Expression of the capsid polypeptides VP1 and VP2 and their subsequent assembly into intact particles were examined in detail. Synchronized infected cell populations labeled under pulse-chase conditions were analyzed by differential immunoprecipitation of native or denatured extracts using antibodies which discriminated between intact particles and isolated polypeptide chains. These analyses showed that at early times in infection, capsid protein synthesis and stability were normal, but particle assembly was impaired. Unassembled VP proteins were retained in the cell for several hours, but as the unprocessed material accumulated, capsid protein synthesis progressively diminished, so that at later times relatively few VP molecules were synthesized. Thus in NS2-null infections of mouse cells there is a major primary defect in the folding or assembly processes required for effective capsid production.

  6. Mutant p53 dictates the oncogenic activity of c-Abl in triple-negative breast cancers

    PubMed Central

    Morrison, Chevaun D; Chang, Jenny C; Keri, Ruth A; Schiemann, William P

    2017-01-01

    We recently established c-Abl as a potent suppressor of triple-negative breast cancer (TNBC) progression through its reactivation of a p53:p21 signaling axis coupled to senescence. Moreover, we observed co-expression of p53 and c-Abl to be essential for normal mammary epithelial cell physiology, as this relationship is lost upon breast cancer progression. Cytoplasmic c-Abl activity is markedly increased in some TNBCs and contributes to disease progression; however, the mechanisms underlying these events remain largely unknown. In addressing this question, we show here that c-Abl is predominantly restricted to the cytoplasm of human MDA-MB-231 TNBC cells, and to the nucleus of human MCF-7 luminal A cells. TTK is a mitotic protein kinase that phosphorylates c-Abl on Thr735, thereby creating a recognition binding motif for 14-3-3 adaptor proteins in response to oxidative stress. By interrogating the METABRIC database, we observed a significant correlation between p53 expression and that of c-Abl and TTK in basal-like breast cancers. Moreover, heterologous expression of TTK in MCF-7 cells significantly stimulated their growth in part via a c-Abl-dependent mechanism. Conversely, depleting TTK expression in MDA-MB-231 cells not only inhibited their organoid growth in 3D-cultures, but also sensitized them to the tumor suppressing activities of c-Abl independent of its subcellular localization. Moreover, we show that mutant p53 forms cytoplasmic complexes with c-Abl, thereby dictating the subcellular localization of c-Abl and the sensitivity of MDA-MB-231 cells to Imatinib. In response to nutrient deprivation, c-Abl:p53 complexes readily accumulate in the nucleus, resulting in the hyperactivation of c-Abl and initiation of its anti-tumor activities. Collectively, we identified a novel mutant p53:c-Abl cytoplasmic signaling complex that promotes MDA-MB-231 cell growth and highlights the contextual cues that confer oncogenic activity to c-Abl in breast cancer. PMID:28661474

  7. New Aspects of RpoE in Uropathogenic Proteus mirabilis

    PubMed Central

    Liu, Ming-Che; Kuo, Kuan-Ting; Chien, Hsiung-Fei; Tsai, Yi-Lin

    2014-01-01

    Proteus mirabilis is a common human pathogen causing recurrent or persistent urinary tract infections (UTIs). The underlying mechanisms for P. mirabilis to establish UTIs are not fully elucidated. In this study, we showed that loss of the sigma factor E (RpoE), mediating extracytoplasmic stress responses, decreased fimbria expression, survival in macrophages, cell invasion, and colonization in mice but increased the interleukin-8 (IL-8) expression of urothelial cells and swarming motility. This is the first study to demonstrate that RpoE modulated expression of MR/P fimbriae by regulating mrpI, a gene encoding a recombinase controlling the orientation of MR/P fimbria promoter. By real-time reverse transcription-PCR, we found that the IL-8 mRNA amount of urothelial cells was induced significantly by lipopolysaccharides extracted from rpoE mutant but not from the wild type. These RpoE-associated virulence factors should be coordinately expressed to enhance the fitness of P. mirabilis in the host, including the avoidance of immune attacks. Accordingly, rpoE mutant-infected mice displayed more immune cell infiltration in bladders and kidneys during early stages of infection, and the rpoE mutant had a dramatically impaired ability of colonization. Moreover, it is noteworthy that urea (the major component in urine) and polymyxin B (a cationic antimicrobial peptide) can induce expression of rpoE by the reporter assay, suggesting that RpoE might be activated in the urinary tract. Altogether, our results indicate that RpoE is important in sensing environmental cues of the urinary tract and subsequently triggering the expression of virulence factors, which are associated with the fitness of P. mirabilis, to build up a UTI. PMID:25547796

  8. New aspects of RpoE in uropathogenic Proteus mirabilis.

    PubMed

    Liu, Ming-Che; Kuo, Kuan-Ting; Chien, Hsiung-Fei; Tsai, Yi-Lin; Liaw, Shwu-Jen

    2015-03-01

    Proteus mirabilis is a common human pathogen causing recurrent or persistent urinary tract infections (UTIs). The underlying mechanisms for P. mirabilis to establish UTIs are not fully elucidated. In this study, we showed that loss of the sigma factor E (RpoE), mediating extracytoplasmic stress responses, decreased fimbria expression, survival in macrophages, cell invasion, and colonization in mice but increased the interleukin-8 (IL-8) expression of urothelial cells and swarming motility. This is the first study to demonstrate that RpoE modulated expression of MR/P fimbriae by regulating mrpI, a gene encoding a recombinase controlling the orientation of MR/P fimbria promoter. By real-time reverse transcription-PCR, we found that the IL-8 mRNA amount of urothelial cells was induced significantly by lipopolysaccharides extracted from rpoE mutant but not from the wild type. These RpoE-associated virulence factors should be coordinately expressed to enhance the fitness of P. mirabilis in the host, including the avoidance of immune attacks. Accordingly, rpoE mutant-infected mice displayed more immune cell infiltration in bladders and kidneys during early stages of infection, and the rpoE mutant had a dramatically impaired ability of colonization. Moreover, it is noteworthy that urea (the major component in urine) and polymyxin B (a cationic antimicrobial peptide) can induce expression of rpoE by the reporter assay, suggesting that RpoE might be activated in the urinary tract. Altogether, our results indicate that RpoE is important in sensing environmental cues of the urinary tract and subsequently triggering the expression of virulence factors, which are associated with the fitness of P. mirabilis, to build up a UTI. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  9. The β-Hemolysin and Intracellular Survival of Streptococcus agalactiae in Human Macrophages

    PubMed Central

    Sagar, Anubha; Klemm, Carolin; Hartjes, Lara; Mauerer, Stefanie; van Zandbergen, Ger; Spellerberg, Barbara

    2013-01-01

    S. agalactiae (group B streptococci, GBS) is a major microbial pathogen in human neonates and causes invasive infections in pregnant women and immunocompromised individuals. The S. agalactiae β-hemolysin is regarded as an important virulence factor for the development of invasive disease. To examine the role of β-hemolysin in the interaction with professional phagocytes, the THP-1 monocytic cell line and human granulocytes were infected with a serotype Ia S. agalactiae wild type strain and its isogenic nonhemolytic mutant. We could show that the nonhemolytic mutants were able to survive in significantly higher numbers than the hemolytic wild type strain, in THP-1 macrophage-like cells and in assays with human granulocytes. Intracellular bacterial multiplication, however, could not be observed. The hemolytic wild type strain stimulated a significantly higher release of Tumor Necrosis Factor-α than the nonhemolytic mutant in THP-1 cells, while similar levels of the chemokine Interleukin-8 were induced. In order to investigate bacterial mediators of IL-8 release in this setting, purified cell wall preparations from both strains were tested and found to exert a potent proinflammatory stimulus on THP-1 cells. In conclusion, our results indicate that the β-hemolysin has a strong influence on the intracellular survival of S. agalactiae and that a tightly controlled regulation of β-hemolysin expression is required for the successful establishment of S. agalactiae in different host niches. PMID:23593170

  10. The β-hemolysin and intracellular survival of Streptococcus agalactiae in human macrophages.

    PubMed

    Sagar, Anubha; Klemm, Carolin; Hartjes, Lara; Mauerer, Stefanie; van Zandbergen, Ger; Spellerberg, Barbara

    2013-01-01

    S. agalactiae (group B streptococci, GBS) is a major microbial pathogen in human neonates and causes invasive infections in pregnant women and immunocompromised individuals. The S. agalactiae β-hemolysin is regarded as an important virulence factor for the development of invasive disease. To examine the role of β-hemolysin in the interaction with professional phagocytes, the THP-1 monocytic cell line and human granulocytes were infected with a serotype Ia S. agalactiae wild type strain and its isogenic nonhemolytic mutant. We could show that the nonhemolytic mutants were able to survive in significantly higher numbers than the hemolytic wild type strain, in THP-1 macrophage-like cells and in assays with human granulocytes. Intracellular bacterial multiplication, however, could not be observed. The hemolytic wild type strain stimulated a significantly higher release of Tumor Necrosis Factor-α than the nonhemolytic mutant in THP-1 cells, while similar levels of the chemokine Interleukin-8 were induced. In order to investigate bacterial mediators of IL-8 release in this setting, purified cell wall preparations from both strains were tested and found to exert a potent proinflammatory stimulus on THP-1 cells. In conclusion, our results indicate that the β-hemolysin has a strong influence on the intracellular survival of S. agalactiae and that a tightly controlled regulation of β-hemolysin expression is required for the successful establishment of S. agalactiae in different host niches.

  11. CASK regulates CaMKII autophosphorylation in neuronal growth, calcium signaling, and learning

    PubMed Central

    Gillespie, John M.; Hodge, James J. L.

    2013-01-01

    Calcium (Ca2+)/calmodulin (CaM)-dependent kinase II (CaMKII) activity plays a fundamental role in learning and memory. A key feature of CaMKII in memory formation is its ability to be regulated by autophosphorylation, which switches its activity on and off during synaptic plasticity. The synaptic scaffolding protein CASK (calcium (Ca2+)/calmodulin (CaM) associated serine kinase) is also important for learning and memory, as mutations in CASK result in intellectual disability and neurological defects in humans. We show that in Drosophila larvae, CASK interacts with CaMKII to control neuronal growth and calcium signaling. Furthermore, deletion of the CaMK-like and L27 domains of CASK (CASK β null) or expression of overactive CaMKII (T287D) produced similar effects on synaptic growth and Ca2+ signaling. CASK overexpression rescues the effects of CaMKII overactivity, consistent with the notion that CASK and CaMKII act in a common pathway that controls these neuronal processes. The reduction in Ca2+ signaling observed in the CASK β null mutant caused a decrease in vesicle trafficking at synapses. In addition, the decrease in Ca2+ signaling in CASK mutants was associated with an increase in Ether-à-go-go (EAG) potassium (K+) channel localization to synapses. Reducing EAG restored the decrease in Ca2+ signaling observed in CASK mutants to the level of wildtype, suggesting that CASK regulates Ca2+ signaling via EAG. CASK knockdown reduced both appetitive associative learning and odor evoked Ca2+ responses in Drosophila mushroom bodies, which are the learning centers of Drosophila. Expression of human CASK in Drosophila rescued the effect of CASK deletion on the activity state of CaMKII, suggesting that human CASK may also regulate CaMKII autophosphorylation. PMID:24062638

  12. SMA-Causing Missense Mutations in Survival motor neuron (Smn) Display a Wide Range of Phenotypes When Modeled in Drosophila

    PubMed Central

    Praveen, Kavita; Wen, Ying; Gray, Kelsey M.; Noto, John J.; Patlolla, Akash R.; Van Duyne, Gregory D.; Matera, A. Gregory

    2014-01-01

    Mutations in the human survival motor neuron 1 (SMN) gene are the primary cause of spinal muscular atrophy (SMA), a devastating neuromuscular disorder. SMN protein has a well-characterized role in the biogenesis of small nuclear ribonucleoproteins (snRNPs), core components of the spliceosome. Additional tissue-specific and global functions have been ascribed to SMN; however, their relevance to SMA pathology is poorly understood and controversial. Using Drosophila as a model system, we created an allelic series of twelve Smn missense mutations, originally identified in human SMA patients. We show that animals expressing these SMA-causing mutations display a broad range of phenotypic severities, similar to the human disease. Furthermore, specific interactions with other proteins known to be important for SMN's role in RNP assembly are conserved. Intragenic complementation analyses revealed that the three most severe mutations, all of which map to the YG box self-oligomerization domain of SMN, display a stronger phenotype than the null allele and behave in a dominant fashion. In support of this finding, the severe YG box mutants are defective in self-interaction assays, yet maintain their ability to heterodimerize with wild-type SMN. When expressed at high levels, wild-type SMN is able to suppress the activity of the mutant protein. These results suggest that certain SMN mutants can sequester the wild-type protein into inactive complexes. Molecular modeling of the SMN YG box dimer provides a structural basis for this dominant phenotype. These data demonstrate that important structural and functional features of the SMN YG box are conserved between vertebrates and invertebrates, emphasizing the importance of self-interaction to the proper functioning of SMN. PMID:25144193

  13. SMA-causing missense mutations in survival motor neuron (Smn) display a wide range of phenotypes when modeled in Drosophila.

    PubMed

    Praveen, Kavita; Wen, Ying; Gray, Kelsey M; Noto, John J; Patlolla, Akash R; Van Duyne, Gregory D; Matera, A Gregory

    2014-08-01

    Mutations in the human survival motor neuron 1 (SMN) gene are the primary cause of spinal muscular atrophy (SMA), a devastating neuromuscular disorder. SMN protein has a well-characterized role in the biogenesis of small nuclear ribonucleoproteins (snRNPs), core components of the spliceosome. Additional tissue-specific and global functions have been ascribed to SMN; however, their relevance to SMA pathology is poorly understood and controversial. Using Drosophila as a model system, we created an allelic series of twelve Smn missense mutations, originally identified in human SMA patients. We show that animals expressing these SMA-causing mutations display a broad range of phenotypic severities, similar to the human disease. Furthermore, specific interactions with other proteins known to be important for SMN's role in RNP assembly are conserved. Intragenic complementation analyses revealed that the three most severe mutations, all of which map to the YG box self-oligomerization domain of SMN, display a stronger phenotype than the null allele and behave in a dominant fashion. In support of this finding, the severe YG box mutants are defective in self-interaction assays, yet maintain their ability to heterodimerize with wild-type SMN. When expressed at high levels, wild-type SMN is able to suppress the activity of the mutant protein. These results suggest that certain SMN mutants can sequester the wild-type protein into inactive complexes. Molecular modeling of the SMN YG box dimer provides a structural basis for this dominant phenotype. These data demonstrate that important structural and functional features of the SMN YG box are conserved between vertebrates and invertebrates, emphasizing the importance of self-interaction to the proper functioning of SMN.

  14. Hepatitis B Virus Core Gene Mutations Which Block Nucleocapsid Envelopment

    PubMed Central

    Koschel, Matthias; Oed, Daniela; Gerelsaikhan, Tudevdagwa; Thomssen, Reiner; Bruss, Volker

    2000-01-01

    Recently we generated a panel of hepatitis B virus core gene mutants carrying single insertions or deletions which allowed efficient expression of the core protein in bacteria and self-assembly of capsids. Eleven of these mutations were introduced into a eukaryotic core gene expression vector and characterized by trans complementation of a core-negative HBV genome in cotransfected human hepatoma HuH7 cells. Surprisingly, four mutants (two insertions [EFGA downstream of A11 and LDTASALYR downstream of R39] and two deletions [Y38-R39-E40 and L42]) produced no detectable capsids. The other seven mutants supported capsid formation and pregenome packaging/viral minus- and plus-strand-DNA synthesis but to different levels. Four of these seven mutants (two insertions [GA downstream of A11 and EHCSP downstream of P50] and two deletions [S44 and A80]) allowed virion morphogenesis and secretion. The mutant carrying a deletion of A80 at the tip of the spike protruding from the capsid was hepatitis B virus core antigen negative but wild type with respect to virion formation, indicating that this site might not be crucial for capsid-surface protein interactions during morphogenesis. The other three nucleocapsid-forming mutants (one insertion [LS downstream of S141] and two deletions [T12 and P134]) were strongly blocked in virion formation. The corresponding sites are located in the part of the protein forming the body of the capsid and not in the spike. These mutations may alter sites on the particle which contact surface proteins during envelopment, or they may block the appearance of a signal for the transport or the maturation of the capsid which is linked to viral DNA synthesis and required for envelopment. PMID:10590084

  15. Biochemical Characterization of Mutants in Chaperonin Proteins CCT4 and CCT5 Associated with Hereditary Sensory Neuropathy*

    PubMed Central

    Sergeeva, Oksana A.; Tran, Meme T.; Haase-Pettingell, Cameron; King, Jonathan A.

    2014-01-01

    Hereditary sensory neuropathies are a class of disorders marked by degeneration of the nerve fibers in the sensory periphery neurons. Recently, two mutations were identified in the subunits of the eukaryotic cytosolic chaperonin TRiC, a protein machine responsible for folding actin and tubulin in the cell. C450Y CCT4 was identified in a stock of Sprague-Dawley rats, whereas H147R CCT5 was found in a human Moroccan family. As with many genetically identified mutations associated with neuropathies, the underlying molecular basis of the mutants was not defined. We investigated the biochemical properties of these mutants using an expression system in Escherichia coli that produces homo-oligomeric rings of CCT4 and CCT5. Full-length versions of both mutant protein chains were expressed in E. coli at levels approaching that of the WT chains. Sucrose gradient centrifugation revealed chaperonin-sized complexes of both WT and mutant chaperonins, but with reduced recovery of C450Y CCT4 soluble subunits. Electron microscopy of negatively stained samples of C450Y CCT4 revealed few ring-shaped species, whereas WT CCT4, H147R CCT5, and WT CCT5 revealed similar ring structures. CCT5 complexes were assayed for their ability to suppress aggregation of and refold the model substrate γd-crystallin, suppress aggregation of mutant huntingtin, and refold the physiological substrate β-actin in vitro. H147R CCT5 was not as efficient in chaperoning these substrates as WT CCT5. The subtle effects of these mutations are consistent with the homozygous disease phenotype, in which most functions are carried out during development and adulthood, but some selective function is lost or reduced. PMID:25124038

  16. BvrR/BvrS-Controlled Outer Membrane Proteins Omp3a and Omp3b Are Not Essential for Brucella abortus Virulence▿

    PubMed Central

    Manterola, Lorea; Guzmán-Verri, Caterina; Chaves-Olarte, Esteban; Barquero-Calvo, Elías; de Miguel, María-Jesús; Moriyón, Ignacio; Grilló, María-Jesús; López-Goñi, Ignacio; Moreno, Edgardo

    2007-01-01

    The Brucella abortus two-component regulatory system BvrR/BvrS controls the expression of outer membrane proteins (Omp) Omp3a (Omp25) and Omp3b (Omp22). Disruption of bvrS or bvrR generates avirulent mutants with altered cell permeability, higher sensitivity to microbicidal peptides, and complement. Consequently, the role of Omp3a and Omp3b in virulence was examined. Similar to bvrS or bvrR mutants, omp3a and omp3b mutants displayed increased attachment to cells, indicating surface alterations. However, they showed unaltered permeability; normal expression of Omp10, Omp16, Omp19, Omp2b, and Omp1; native hapten polysaccharide; and lipopolysaccharide and were resistant to complement and polymyxin B at ranges similar to those of the wild-type (WT) counterpart. Likewise, omp3a and omp3b mutants were able to replicate in murine macrophages and in HeLa cells, were resistant to the killing action of human neutrophils, and persisted in mice, like the WT strain. Murine macrophages infected with the omp3a mutant generated slightly higher levels of tumor necrosis factor alpha than the WT, whereas the bvrS mutant induced lower levels of this cytokine. Since the absence of Omp3a or Omp3b does not result in attenuation, it can be concluded that BvrR/BvrS influences additional Brucella properties involved in virulence. Our results are discussed in the light of previous works suggesting that disruption of omp3a generates attenuated Brucella strains, and we speculate on the role of group 3 Omps. PMID:17664262

  17. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus.

    PubMed

    Coleman, Stewart; Choi, K Yeon; Root, Matthew; McGregor, Alistair

    2016-07-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107-179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model.

  18. A Homolog Pentameric Complex Dictates Viral Epithelial Tropism, Pathogenicity and Congenital Infection Rate in Guinea Pig Cytomegalovirus

    PubMed Central

    McGregor, Alistair

    2016-01-01

    In human cytomegalovirus (HCMV), tropism to epithelial and endothelial cells is dependent upon a pentameric complex (PC). Given the structure of the placenta, the PC is potentially an important neutralizing antibody target antigen against congenital infection. The guinea pig is the only small animal model for congenital CMV. Guinea pig cytomegalovirus (GPCMV) potentially encodes a UL128-131 HCMV PC homolog locus (GP128-GP133). In transient expression studies, GPCMV gH and gL glycoproteins interacted with UL128, UL130 and UL131 homolog proteins (designated GP129 and GP131 and GP133 respectively) to form PC or subcomplexes which were determined by immunoprecipitation reactions directed to gH or gL. A natural GP129 C-terminal deletion mutant (aa 107–179) and a chimeric HCMV UL128 C-terminal domain swap GP129 mutant failed to form PC with other components. GPCMV infection of a newly established guinea pig epithelial cell line required a complete PC and a GP129 mutant virus lacked epithelial tropism and was attenuated in the guinea pig for pathogenicity and had a low congenital transmission rate. Individual knockout of GP131 or 133 genes resulted in loss of viral epithelial tropism. A GP128 mutant virus retained epithelial tropism and GP128 was determined not to be a PC component. A series of GPCMV mutants demonstrated that gO was not strictly essential for epithelial infection whereas gB and the PC were essential. Ectopic expression of a GP129 cDNA in a GP129 mutant virus restored epithelial tropism, pathogenicity and congenital infection. Overall, GPCMV forms a PC similar to HCMV which enables evaluation of PC based vaccine strategies in the guinea pig model. PMID:27387220

  19. Mutant SOD1 in cell types other than motor neurons and oligodendrocytes accelerates onset of disease in ALS mice

    PubMed Central

    Yamanaka, Koji; Boillee, Severine; Roberts, Elizabeth A.; Garcia, Michael L.; McAlonis-Downes, Melissa; Mikse, Oliver R.; Cleveland, Don W.; Goldstein, Lawrence S. B.

    2008-01-01

    Dominant mutations in ubiquitously expressed superoxide dismutase (SOD1) cause familial ALS by provoking premature death of adult motor neurons. To test whether mutant damage to cell types beyond motor neurons is required for the onset of motor neuron disease, we generated chimeric mice in which all motor neurons and oligodendrocytes expressed mutant SOD1 at a level sufficient to cause fatal, early-onset motor neuron disease when expressed ubiquitously, but did so in a cellular environment containing variable numbers of non-mutant, non-motor neurons. Despite high-level mutant expression within 100% of motor neurons and oligodendrocytes, in most of these chimeras, the presence of WT non-motor neurons substantially delayed onset of motor neuron degeneration, increasing disease-free life by 50%. Disease onset is therefore non-cell autonomous, and mutant SOD1 damage within cell types other than motor neurons and oligodendrocytes is a central contributor to initiation of motor neuron degeneration. PMID:18492803

  20. Human AZU-1 gene, variants thereof and expressed gene products

    DOEpatents

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  1. Expression of Idh1R132H in the Murine Subventricular Zone Stem Cell Niche Recapitulates Features of Early Gliomagenesis.

    PubMed

    Bardella, Chiara; Al-Dalahmah, Osama; Krell, Daniel; Brazauskas, Pijus; Al-Qahtani, Khalid; Tomkova, Marketa; Adam, Julie; Serres, Sébastien; Lockstone, Helen; Freeman-Mills, Luke; Pfeffer, Inga; Sibson, Nicola; Goldin, Robert; Schuster-Böeckler, Benjamin; Pollard, Patrick J; Soga, Tomoyoshi; McCullagh, James S; Schofield, Christopher J; Mulholland, Paul; Ansorge, Olaf; Kriaucionis, Skirmantas; Ratcliffe, Peter J; Szele, Francis G; Tomlinson, Ian

    2016-10-10

    Isocitrate dehydrogenase 1 mutations drive human gliomagenesis, probably through neomorphic enzyme activity that produces D-2-hydroxyglutarate. To model this disease, we conditionally expressed Idh1 R132H in the subventricular zone (SVZ) of the adult mouse brain. The mice developed hydrocephalus and grossly dilated lateral ventricles, with accumulation of 2-hydroxyglutarate and reduced α-ketoglutarate. Stem and transit amplifying/progenitor cell populations were expanded, and proliferation increased. Cells expressing SVZ markers infiltrated surrounding brain regions. SVZ cells also gave rise to proliferative subventricular nodules. DNA methylation was globally increased, while hydroxymethylation was decreased. Mutant SVZ cells overexpressed Wnt, cell-cycle and stem cell genes, and shared an expression signature with human gliomas. Idh1 R132H mutation in the major adult neurogenic stem cell niche causes a phenotype resembling gliomagenesis. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  2. In vivo analysis of replication and immunogenicity of proviral clones of human T-lymphotropic virus type 1 with selective envelope surface-unit mutations

    PubMed Central

    Silverman, Lee R.; Phipps, Andrew J.; Montgomery, Andy; Fernandez, Soledad; Tsukahara, Tomonori; Ratner, Lee; Lairmore, Michael D.

    2005-01-01

    Human T-cell leukemia virus type 1 (HTLV-1) is the causative agent of adult T-cell lymphoma/leukemia (ATL). The HTLV-1 envelope gene exhibits limited variability when examined from infected individuals, but has not been tested using infectious clones of the virus in animal models. In vitro assays indicate that HTLV-1 envelope (Env) Ser75Ile, Asn95Asp, and Asn195Asp surface unit (SU) mutants are able to replicate in and immortalize lymphocytes. Herein, we examined the effects of these Env mutants in rabbits inoculated with HTLV-1 immortalized ACH.75, ACH.95, or ACH.195 cell lines (expressing full-length molecular clones with the SU mutations) or the ACH.1 cell line (expressing wild-type SU). All rabbits became infected, and the fidelity of the mutations was maintained throughout the 8-week study. However, SU point mutations resulted in decreased antibody responses to viral group-associated antigen (Gag) and Env antigens. ACH.195 rabbits had a selective decreased antibody response to SU, and one ACH.195 rabbit had an antibody response to both HTLV-1 and HTLV-2 SUs. Some mutant inoculation groups had altered proviral loads. However, peripheral-blood mononuclear cell (PBMC) proviral loads did not correlate with antibody responses. Our data are the first to demonstrate that mutations in critical determinants of HTLV-1 Env SU altered antibody responses and proviral loads, but do not prevent viral replication in vivo. PMID:16046523

  3. Golgi targeting of human guanylate-binding protein-1 requires nucleotide binding, isoprenylation, and an IFN-γ-inducible cofactor

    PubMed Central

    Modiano, Nir; Lu, Yanping E.; Cresswell, Peter

    2005-01-01

    Human guanylate-binding protein-1 (hGBP-1) is a large GTPase, similar in structure to the dynamins. Like many smaller GTPases of the Ras/Rab family, it is farnesylated, suggesting it may dock into membranes and perhaps play a role in intracellular trafficking. To date, however, hGBP-1 has never been associated with a specific intracellular compartment. Here we present evidence that hGBP-1 can associate with the Golgi apparatus. Redistribution from the cytosol to the Golgi was observed by immunofluorescence and subcellular fractionation after aluminum fluoride treatment, suggesting that it occurs when hGBP-1 is in its GTP-bound state. Relocalization was blocked by a farnesyl transferase inhibitor. The C589S mutant of hGBP-1, which cannot be farnesylated, and the previously uncharacterized R48P mutant, which cannot bind GTP, both failed to localize to the Golgi. These two mutants had a dominant-negative effect, preventing endogenous wild-type hGBP-1 from efficiently redistributing after aluminum fluoride treatment. Furthermore, hGBP-1 requires another IFN-γ-induced factor to be targeted to the Golgi, because constitutively expressed hGBP-1 remained cytosolic in cells treated with aluminum fluoride unless the cells were preincubated with IFN-γ. Finally, two nonhydrolyzing mutants of hGBP-1, corresponding to active mutants of Ras family proteins, failed to constitutively associate with the Golgi; we propose three possible explanations for this surprising result. PMID:15937107

  4. Golgi targeting of human guanylate-binding protein-1 requires nucleotide binding, isoprenylation, and an IFN-gamma-inducible cofactor.

    PubMed

    Modiano, Nir; Lu, Yanping E; Cresswell, Peter

    2005-06-14

    Human guanylate-binding protein-1 (hGBP-1) is a large GTPase, similar in structure to the dynamins. Like many smaller GTPases of the Ras/Rab family, it is farnesylated, suggesting it may dock into membranes and perhaps play a role in intracellular trafficking. To date, however, hGBP-1 has never been associated with a specific intracellular compartment. Here we present evidence that hGBP-1 can associate with the Golgi apparatus. Redistribution from the cytosol to the Golgi was observed by immunofluorescence and subcellular fractionation after aluminum fluoride treatment, suggesting that it occurs when hGBP-1 is in its GTP-bound state. Relocalization was blocked by a farnesyl transferase inhibitor. The C589S mutant of hGBP-1, which cannot be farnesylated, and the previously uncharacterized R48P mutant, which cannot bind GTP, both failed to localize to the Golgi. These two mutants had a dominant-negative effect, preventing endogenous wild-type hGBP-1 from efficiently redistributing after aluminum fluoride treatment. Furthermore, hGBP-1 requires another IFN-gamma-induced factor to be targeted to the Golgi, because constitutively expressed hGBP-1 remained cytosolic in cells treated with aluminum fluoride unless the cells were preincubated with IFN-gamma. Finally, two nonhydrolyzing mutants of hGBP-1, corresponding to active mutants of Ras family proteins, failed to constitutively associate with the Golgi; we propose three possible explanations for this surprising result.

  5. Mutant p53 protein in serum could be used as a molecular marker in human breast cancer.

    PubMed

    Balogh, G A; Mailo, D A; Corte, M M; Roncoroni, P; Nardi, H; Vincent, E; Martinez, D; Cafasso, M E; Frizza, A; Ponce, G; Vincent, E; Barutta, E; Lizarraga, P; Lizarraga, G; Monti, C; Paolillo, E; Vincent, R; Quatroquio, R; Grimi, C; Maturi, H; Aimale, M; Spinsanti, C; Montero, H; Santiago, J; Shulman, L; Rivadulla, M; Machiavelli, M; Salum, G; Cuevas, M A; Picolini, J; Gentili, A; Gentili, R; Mordoh, J

    2006-04-01

    p53 wild-type is a tumor suppressor gene involved in DNA gene transcription or DNA repair mechanisms. When damage to DNA is unrepairable, p53 induces programmed cell death (apoptosis). The mutant p53 gene is the most frequent molecular alteration in human cancer, including breast cancer. Here, we analyzed the genetic alterations in p53 oncogene expression in 55 patients with breast cancer at different stages and in 8 normal women. We measured by ELISA assay the serum levels of p53 mutant protein and p53 antibodies. Immunohistochemistry and RT-PCR using specific p53 primers as well as mutation detection by DNA sequencing were also evaluated in breast tumor tissue. Serological p53 antibody analysis detected 0/8 (0%), 0/4 (0%) and 9/55 (16.36%) positive cases in normal women, in patients with benign breast disease and in breast carcinoma, respectively. We found positive p53 mutant in the sera of 0/8 (0.0%) normal women, 0/4 (0%) with benign breast disease and 29/55 (52.72%) with breast carcinoma. Immunohistochemistry evaluation was positive in 29/55 (52.73%) with mammary carcinoma and 0/4 (0%) with benign breast disease. A very good correlation between p53 mutant protein detected in serum and p53 accumulation by immunohistochemistry (83.3% positive in both assays) was found in this study. These data suggest that detection of mutated p53 could be a useful serological marker for diagnostic purposes.

  6. Comparison of the crystal structure and function to wild-type and His25Ala mutant human heme oxygenase-1.

    PubMed

    Zhou, Wen-Pu; Zhong, Wen-Wei; Zhang, Xue-Hong; Ding, Jian-Ping; Zhang, Zi-Li; Xia, Zhen-Wei

    2009-03-01

    Human heme oxygenase-1 (hHO-1) is a rate-limiting enzyme in heme metabolism. It regulates serum bilirubin level. Site-directed mutagenesis studies indicate that the proximal residue histidine 25 (His25) plays a key role in hHO-1 activity. A highly purified hHO-1 His25Ala mutant was generated and crystallized with a new expression system. The crystal structure of the mutant was determined by X-ray diffraction technology and molecular replacement at the resolution of 2.8 A, and the model of hHO-1 His25Ala mutant was refined. The final crystallographic and free R factors were 0.245 and 0.283, respectively. The standard bond length deviation was 0.007 A, and the standard bond angle deviation was 1.3 degrees . The mutation of His25 to Ala led to an empty pocket underneath the ferric ion in the heme, leading to loss of binding iron ligand. Although this did not cause an overall structural change, the enzymatic activity of the mutant hHO-1 was reduced by 90%. By supplementing imidazole, the HO-1 activity was restored approximately 90% to its normal level. These data suggest that Ala25 remains unchanged in the structure compared to His25, but the important catalytic function of hHO-1 is lost. Thus, it appears that His25 is a crucial residue for proper hHO-1 catalysis.

  7. A bacterial model for expression of mutations in the human ornithine transcarbamylase (OTC) gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tuchman, M.; McCann, M.T.; Qureshi, A.A.

    1994-09-01

    OTC is a mitochondrial enzyme catalyzing the formation of citrulline from carbamyl phosphate and ornithine. X-linked deficiency of OTC is the most prevalent genetic defect of ureagenesis. Mutations and polymorphisms in the OTC gene identified in deficient patients have indicated the occurrence of many family-specific, unique alleles. Due to the low frequency of recurrent mutations, distinguishing between deleterious mutations and polymorphisms is difficult. Using a human OTC gene containing plasmid driven by a tac promoter, we have devised a simple and efficient method for expressing mutations in the mature human OTC enzyme. To demonstrate this method, PCR engineered site-directed mutagenesismore » was employed to generated cDNA fragments which contained either the R151Q or R277W known mutations found in patients with neonatal and late-onset OTC deficiency, respectively. The normal allele for each mutation was also generated by an identical PCR procedure. Digestion with Bgl II- and Sty I-generated mutant and normal replacement cassettes containing the respective mutant and wild type sequences. Upon transformation of JM109 E.coli cells, OTC enzymatic activity was measured at log and stationary phases of growth using a radiochromatographic method. The R141Q mutation abolished enzymatic activity (<0.02% of normal), whereas the R277W mutation expressed partial activity (2.3% of normal). In addition, a PCR-generated mutation, A280V, resulted in 73% loss of catalytic activity. This OTC expression system is clinically applicable for distinguishing between mutations and polymorphisms, and it can be used to investigate the effects of mutations on various domains of the OTC gene.« less

  8. A novel angiotensin II type 1 receptor-associated protein induces cellular hypertrophy in rat vascular smooth muscle and renal proximal tubular cells.

    PubMed

    Guo, Deng-Fu; Tardif, Valerie; Ghelima, Karin; Chan, John S D; Ingelfinger, Julie R; Chen, XiangMei; Chenier, Isabelle

    2004-05-14

    Angiotensin II stimulates cellular hypertrophy in cultured vascular smooth muscle and renal proximal tubular cells. This effect is believed to be one of earliest morphological changes of heart and renal failure. However, the precise molecular mechanism involved in angiotensin II-induced hypertrophy is poorly understood. In the present study we report the isolation of a novel angiotensin II type 1 receptor-associated protein. It encodes a 531-amino acid protein. Its mRNA is detected in all human tissues examined but highly expressed in the human kidney, pancreas, heart, and human embryonic kidney cells as well as rat vascular smooth muscle and renal proximal tubular cells. Protein synthesis and relative cell size analyzed by flow cytometry studies indicate that overexpression of the novel angiotensin II type 1 receptor-associated protein induces cellular hypertrophy in cultured rat vascular smooth muscle and renal proximal tubular cells. In contrast, the hypertrophic effects was reversed in renal proximal tubular cell lines expressing the novel gene in the antisense orientation and its dominant negative mutant, which lacks the last 101 amino acids in its carboxyl-terminal tail. The hypertrophic effects are at least in part mediated via protein kinase B activation or cyclin-dependent kinase inhibitor, p27(kip1) protein expression level in vascular smooth muscle, and renal proximal tubular cells. Moreover, angiotensin II could not stimulate cellular hypertrophy in renal proximal tubular cells expressing the novel gene in the antisense orientation and its mutant. These findings may provide new molecular mechanisms to understand hypertrophic agents such as angiotensin II-induced cellular hypertrophy.

  9. Purkinje Cell Compartmentation in the Cerebellum of the Lysosomal Acid Phosphatase 2 Mutant Mouse (Nax - Naked-Ataxia Mutant Mouse)

    PubMed Central

    Bailey, Karen; Rahimi Balaei, Maryam; Mannan, Ashraf; Del Bigio, Marc R.; Marzban, Hassan

    2014-01-01

    The Acp2 gene encodes the beta subunit of lysosomal acid phosphatase, which is an isoenzyme that hydrolyzes orthophosphoric monoesters. In mice, a spontaneous mutation in Acp2 results in severe cerebellar defects. These include a reduced size, abnormal lobulation, and an apparent anterior cerebellar disorder with an absent or hypoplastic vermis. Based on differential gene expression in the cerebellum, the mouse cerebellar cortex can normally be compartmentalized anteroposteriorly into four transverse zones and mediolaterally into parasagittal stripes. In this study, immunohistochemistry was performed using various Purkinje cell compartmentation markers to examine their expression patterns in the Acp2 mutant. Despite the abnormal lobulation and anterior cerebellar defects, zebrin II and PLCβ4 showed similar expression patterns in the nax mutant and wild type cerebellum. However, fewer stripes were found in the anterior zone of the nax mutant, which could be due to a lack of Purkinje cells or altered expression of the stripe markers. HSP25 expression was uniform in the central zone of the nax mutant cerebellum at around postnatal day (P) 18–19, suggesting that HSP25 immunonegative Purkinje cells are absent or delayed in stripe pattern expression compared to the wild type. HSP25 expression became heterogeneous around P22–23, with twice the number of parasagittal stripes in the nax mutant compared to the wild type. Aside from reduced size and cortical disorganization, both the posterior zone and nodular zone in the nax mutant appeared less abnormal than the rest of the cerebellum. From these results, it is evident that the anterior zone of the nax mutant cerebellum is the most severely affected, and this extends beyond the primary fissure into the rostral central zone/vermis. This suggests that ACP2 has critical roles in the development of the anterior cerebellum and it may regulate anterior and central zone compartmentation. PMID:24722417

  10. Accumulation of Mutant Neuroserpin Precedes Development of Clinical Symptoms in Familial Encephalopathy with Neuroserpin Inclusion Bodies

    PubMed Central

    Galliciotti, Giovanna; Glatzel, Markus; Kinter, Jochen; Kozlov, Serguei V.; Cinelli, Paolo; Rülicke, Thomas; Sonderegger, Peter

    2007-01-01

    Intracellular protein deposition due to aggregation caused by conformational alteration is the hallmark of a number of neurodegenerative disorders, including Parkinson’s disease, tauopathies, Huntington’s disease, and familial encephalopathy with neuroserpin inclusion bodies. The latter is an autosomal dominant disorder caused by point mutations in neuroserpin resulting in its destabilization. Mutant neuroserpin polymerizes and forms intracellular aggregates that eventually lead to neurodegeneration. We generated genetically modified mice expressing the late-onset S49P-Syracuse or the early-onset S52R-Portland mutation of neuroserpin in central nervous system neurons. Mice exhibited morphological, biochemical, and clinical features resembling those found in the human disease. Analysis of brains revealed large intraneuronal inclusions composed exclusively of mutant neuroserpin, accumulating long before the development of clinical symptoms in a time-dependent manner. Clinical symptoms and amount of neuroserpin inclusions correlated with the predicted instability of the protein. The presence of inclusion bodies in subclinical mice indicates that in humans the prevalence of the disease could be higher than anticipated. In addition to shedding light on the pathophysiology of the human disorder, these mice provide an excellent model to study mechanisms of neurodegeneration or establish novel therapies for familial encephalopathy with neuroserpin inclusion bodies and other neurodegenerative diseases with intracellular protein deposition. PMID:17392169

  11. Inhibition of Shp2 suppresses mutant EGFR-induced lung tumors in transgenic mouse model of lung adenocarcinoma

    PubMed Central

    Schneeberger, Valentina E.; Ren, Yuan; Luetteke, Noreen; Huang, Qingling; Chen, Liwei; Lawrence, Harshani R.; Lawrence, Nicholas J.; Haura, Eric B.; Koomen, John M.; Coppola, Domenico; Wu, Jie

    2015-01-01

    Epidermal growth factor receptor (EGFR) mutants drive lung tumorigenesis and are targeted for therapy. However, resistance to EGFR inhibitors has been observed, in which the mutant EGFR remains active. Thus, it is important to uncover mediators of EGFR mutant-driven lung tumors to develop new treatment strategies. The protein tyrosine phosphatase (PTP) Shp2 mediates EGF signaling. Nevertheless, it is unclear if Shp2 is activated by oncogenic EGFR mutants in lung carcinoma or if inhibiting the Shp2 PTP activity can suppress EGFR mutant-induced lung adenocarcinoma. Here, we generated transgenic mice containing a doxycycline (Dox)-inducible PTP-defective Shp2 mutant (tetO-Shp2CSDA). Using the rat Clara cell secretory protein (CCSP)-rtTA-directed transgene expression in the type II lung pneumocytes of transgenic mice, we found that the Gab1-Shp2 pathway was activated by EGFRL858R in the lungs of transgenic mice. Consistently, the Gab1-Shp2 pathway was activated in human lung adenocarcinoma cells containing mutant EGFR. Importantly, Shp2CSDA inhibited EGFRL858R-induced lung adenocarcinoma in transgenic animals. Analysis of lung tissues showed that Shp2CSDA suppressed Gab1 tyrosine phosphorylation and Gab1-Shp2 association, suggesting that Shp2 modulates a positive feedback loop to regulate its own activity. These results show that inhibition of the Shp2 PTP activity impairs mutant EGFR signaling and suppresses EGFRL858R-driven lung adenocarcinoma. PMID:25730908

  12. Identification of a Novel GJA8 (Cx50) Point Mutation Causes Human Dominant Congenital Cataracts

    NASA Astrophysics Data System (ADS)

    Ge, Xiang-Lian; Zhang, Yilan; Wu, Yaming; Lv, Jineng; Zhang, Wei; Jin, Zi-Bing; Qu, Jia; Gu, Feng

    2014-02-01

    Hereditary cataracts are clinically and genetically heterogeneous lens diseases that cause a significant proportion of visual impairment and blindness in children. Human cataracts have been linked with mutations in two genes, GJA3 and GJA8, respectively. To identify the causative mutation in a family with hereditary cataracts, family members were screened for mutations by PCR for both genes. Sequencing the coding regions of GJA8, coding for connexin 50, revealed a C > A transversion at nucleotide 264, which caused p.P88T mutation. To dissect the molecular consequences of this mutation, plasmids carrying wild-type and mutant mouse ORFs of Gja8 were generated and ectopically expressed in HEK293 cells and human lens epithelial cells, respectively. The recombinant proteins were assessed by confocal microscopy and Western blotting. The results demonstrate that the molecular consequences of the p.P88T mutation in GJA8 include changes in connexin 50 protein localization patterns, accumulation of mutant protein, and increased cell growth.

  13. Activation of translation complex eIF4F is essential for the genesis and maintenance of the malignant phenotype in human mammary epithelial cells.

    PubMed

    Avdulov, Svetlana; Li, Shunan; Michalek, Van; Burrichter, David; Peterson, Mark; Perlman, David M; Manivel, J Carlos; Sonenberg, Nahum; Yee, Douglas; Bitterman, Peter B; Polunovsky, Vitaly A

    2004-06-01

    Common human malignancies acquire derangements of the translation initiation complex, eIF4F, but their functional significance is unknown. Hypophosphorylated 4E-BP proteins negatively regulate eIF4F assembly by sequestering its mRNA cap binding component eIF4E, whereas hyperphosphorylation abrogates this function. We found that breast carcinoma cells harbor increases in the eIF4F constituent eIF4GI and hyperphosphorylation of 4E-BP1 which are two alterations that activate eIF4F assembly. Ectopic expression of eIF4E in human mammary epithelial cells enabled clonal expansion and anchorage-independent growth. Transfer of 4E-BP1 phosphorylation site mutants into breast carcinoma cells suppressed their tumorigenicity, whereas loss of these 4E-BP1 phosphorylation site mutants accompanied spontaneous reversion to a malignant phenotype. Thus, eIF4F activation is an essential component of the malignant phenotype in breast carcinoma.

  14. Role of Myofibril-Inducing RNA in cardiac TnT expression in developing Mexican axolotl

    PubMed Central

    Sferrazza, Gian-Franco; Zhang, Chi; Jia, Pingping; Lemanski, Sharon L.; Athauda, Gagani; Stassi, Alyssa; Halager, Kristine; Maier, Jennifer A.; Rueda-de-Leon, Elena; Gupta, Amit; Dube, Syamalima; Huang, Xupei; Prentice, Howard M.; Dube, Dipak K.; Lemanski, Larry F.

    2007-01-01

    The Mexican axolotl, Ambystoma mexicanum, has been a useful animal model to study heart development and cardiac myofibrillogenesis. A naturally-occurring recessive mutant, gene “c”, for cardiac non-function in the Mexican axolotl causes a failure of myofibrillogenesis due to a lack of tropomyosin expression in homozygous mutant (c/c) embryonic hearts.. Myofibril-Inducing RNA (MIR) rescues mutant hearts in vitro by promoting tropomyosin expression and myofibril formation thereafter. We have studied the effect of MIR on the expression of various isoforms of cardiac Troponin-T (cTnT), a component of the thin filament that binds with tropomyosin. Four alternatively spliced cTnT isoforms have been characterized from developing axolotl heart. The expression of various cTnT isoforms in normal, mutant, and mutant hearts corrected with MIR, is evaluated by real-time RT-PCR using isoform specific primer pairs; MIR affects the total transcription as well as the splicing of the cTnT in axolotl heart PMID:17408593

  15. Secreted aspartic proteases are not required for invasion of reconstituted human epithelia by Candida albicans.

    PubMed

    Lermann, Ulrich; Morschhäuser, Joachim

    2008-11-01

    A well-known virulence attribute of the human-pathogenic yeast Candida albicans is the secretion of aspartic proteases (Saps), which may contribute to colonization and infection of different host niches by degrading tissue barriers, destroying host defence molecules, or digesting proteins for nutrient supply. The role of individual Sap isoenzymes, which are encoded by a large gene family, for the pathogenicity of C. albicans has been investigated by assessing the virulence of mutants lacking specific SAP genes and by studying the expression pattern of the SAP genes in various models of superficial and systemic infections. We used a recombination-based genetic reporter system to detect the induction of the SAP1-SAP6 genes during infection of reconstituted human vaginal epithelium. Only SAP5, but none of the other tested SAP genes, was detectably activated in this in vitro infection model. To directly address the importance of the SAP1-SAP6 genes for invasion of reconstituted human epithelia (RHE), we constructed a set of mutants of the wild-type C. albicans model strain SC5314 in which either single or multiple SAP genes were specifically deleted. Even mutants lacking all of the SAP1-SAP3 or the SAP4-SAP6 genes displayed the same capacity to invade and damage both oral and vaginal RHE as their wild-type parental strain, in contrast to a nonfilamentous efg1Delta mutant that was avirulent under these conditions. We therefore conclude from these results that the secreted aspartic proteases Sap1p-Sap6p are not required for invasion of RHE by C. albicans.

  16. Streptococcal inhibitor of complement promotes innate immune resistance phenotypes of invasive M1T1 group A Streptococcus.

    PubMed

    Pence, Morgan A; Rooijakkers, Suzan H M; Cogen, Anna L; Cole, Jason N; Hollands, Andrew; Gallo, Richard L; Nizet, Victor

    2010-01-01

    Streptococcal inhibitor of complement (SIC) is a highly polymorphic extracellular protein and putative virulence factor secreted by M1 and M57 strains of group A Streptococcus (GAS). The sic gene is highly upregulated in invasive M1T1 GAS isolates following selection of mutations in the covR/S regulatory locus in vivo. Previous work has shown that SIC (allelic form 1.01) binds to and inactivates complement C5b67 and human cathelicidin LL-37. We examined the contribution of SIC to innate immune resistance phenotypes of GAS in the intact organism, using (1) targeted deletion of sic in wild-type and animal-passaged (covS mutant) M1T1 GAS harboring the sic 1.84 allele and (2) heterologous expression of sic in M49 GAS, which does not possess the sic genein its genome. We find that M1T1 SIC production is strongly upregulated upon covS mutation but that the sic gene is not required for generation and selection of covS mutants in vivo. SIC 1.84 bound both human and murine cathelicidins and was necessary and sufficient to promote covS mutant M1T1 GAS resistance to LL-37, growth in human whole blood and virulence in a murine model of systemic infection. Finally, the sic knockout mutant M1T1 GAS strain was deficient in growth in human serum and intracellular macrophage survival. We conclude that SIC contributes to M1T1 GAS immune resistance and virulence phenotypes. Copyright © 2010 S. Karger AG, Basel.

  17. The BRAF inhibitor vemurafenib activates mitochondrial metabolism and inhibits hyperpolarized pyruvate-lactate exchange in BRAF mutant human melanoma cells

    PubMed Central

    Delgado-Goni, Teresa; Falck Miniotis, Maria; Wantuch, Slawomir; Parkes, Harold G.; Marais, Richard; Workman, Paul; Leach, Martin O.; Beloueche-Babari, Mounia

    2016-01-01

    Understanding the impact of BRAF signaling inhibition in human melanoma on key disease mechanisms is important for developing biomarkers of therapeutic response and combination strategies to improve long term disease control. This work investigates the downstream metabolic consequences of BRAF inhibition with vemurafenib, the molecular and biochemical processes that underpin them, their significance for antineoplastic activity and potential as non-invasive imaging response biomarkers.1H NMR spectroscopy showed that vemurafenib decreases the glycolytic activity of BRAF mutant (WM266.4 and SKMEL28) but not BRAFWT (CHL-1 and D04) human melanoma cells. In WM266.4 cells, this was associated with increased acetate, glycine and myo-inositol levels and decreased fatty acyl signals, while the bioenergetic status was maintained. 13C NMR metabolic flux analysis of treated WM266.4 cells revealed inhibition of de novo lactate synthesis and glucose utilization, associated with increased oxidative and anaplerotic pyruvate carboxylase mitochondrial metabolism and decreased lipid synthesis. This metabolic shift was associated with depletion of HKII, acyl-CoA dehydrogenase 9, 3-phosphoglycerate dehydrogenase and monocarboxylate transporter (MCT) 1 and 4 in BRAF mutant but not BRAFWT cells and, interestingly, decreased BRAF mutant cell dependency on glucose and glutamine for growth. Further, the reduction in MCT1 expression observed led to inhibition of hyperpolarized 13C-pyruvate-lactate exchange, a parameter that is translatable to in vivo imaging studies, in live WM266.4 cells. In conclusion, our data provide new insights into the molecular and metabolic consequences of BRAF inhibition in BRAF-driven human melanoma cells that may have potential for combinatorial therapeutic targeting as well as non-invasive imaging of response. PMID:27765851

  18. Mechanisms of Transient Signaling via Short and Long Prolactin Receptor Isoforms in Female and Male Sensory Neurons*

    PubMed Central

    Belugin, Sergei; Diogenes, Anibal R.; Patil, Mayur J.; Ginsburg, Erika; Henry, Michael A.; Akopian, Armen N.

    2013-01-01

    Prolactin (PRL) regulates activity of nociceptors and causes hyperalgesia in pain conditions. PRL enhances nociceptive responses by rapidly modulating channels in nociceptors. The molecular mechanisms underlying PRL-induced transient signaling in neurons are not well understood. Here we use a variety of cell biology and pharmacological approaches to show that PRL transiently enhanced capsaicin-evoked responses involve protein kinase C ϵ (PKCϵ) or phosphatidylinositol 3-kinase (PI3K) pathways in female rat trigeminal (TG) neurons. We next reconstituted PRL-induced signaling in a heterologous expression system and TG neurons from PRL receptor (PRLR)-null mutant mice by expressing rat PRLR-long isoform (PRLR-L), PRLR-short isoform (PRLR-S), or a mix of both. Results show that PRLR-S, but not PRLR-L, is capable of mediating PRL-induced transient enhancement of capsaicin responses in both male and female TG neurons. However, co-expression of PRLR-L with PRLR-S (1:1 ratio) leads to the inhibition of the transient PRL actions. Co-expression of PRLR-L deletion mutants with PRLR-S indicated that the cytoplasmic site adjacent to the trans-membrane domain of PRLR-L was responsible for inhibitory effects of PRLR-L. Furthermore, in situ hybridization and immunohistochemistry data indicate that in normal conditions, PRLR-L is expressed mainly in glia with little expression in rat sensory neurons (3–5%) and human nerves. The predominant PRLR form in TG neurons/nerves from rats and humans is PRLR-S. Altogether, PRL-induced transient signaling in sensory neurons is governed by PI3K or PKCϵ, mediated via the PRLR-S isoform, and transient effects mediated by PRLR-S are inhibited by presence of PRLR-L in these cells. PMID:24142695

  19. Transcriptional regulation of human retinoic acid receptor-alpha (RAR-{alpha}) by Wilms` tumour gene product

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Goodyer, P.R.; Torban, E.; Dehbi, M.

    1994-09-01

    The Wilms` tumor gene encodes a 47-49 kDa transcription factor expressed in kidney, gonads and mesothelium during embryogenesis. Inherited mutations of WT1 lead to aberrant urogenital development and Wilms` tumor, but the role of WT1 in development is not fully understood. Since the human RAR-{alpha} gene contains a potential WT1 binding site at its 5{prime} end, we studied the effect of WT1 co-transfection on expression of an RAR-{alpha} promoter/CAT reporter construct in COS cells. COS cells were plated at 5X10{sup 5} cells/dish in DMEM with 10% FBS and transfected by the Ca/PO4 method with an expression plasmid containing the full-lengthmore » WT1 (-/-) cDNA under the control of the CMV promoter, plasmid containing the RAR-{alpha} promoter (-519 to +36)/CAT reporter and TK/growth hormone plasmid to control for efficiency of transfection. CAT/GH activity at 48 hours was inhibited by co-transfection with increasing amounts of WT1 (-/-); maximum inhibition = 5% of control. WT1 co-transfection did not affect expression of TKGH, nor of a CMV-CAT vector. Expression of WT1 protein in tranfected COS cells was demonstrated by Western blotting. Minimal inhibiton of RAR-{alpha}/CAT activity was seen when cells were co-transfected with vectors containing WT1 deletion mutants, alternate WT1 splicing variants, or WT1 (-/-) cDNA bearing a mutation identified in a patient with Drash syndrome. Gel shift assays indicated binding of WT1 to RAR-{alpha} cDNA but not to an RAR-{alpha} deletion mutant lacking the GCGGGGGGCG site. These observations suggest that WT1 may function to regulate RAR-{alpha} expression during normal development.« less

  20. AIP mutations impair AhR signaling in pituitary adenoma patients fibroblasts and in GH3 cells.

    PubMed

    Lecoq, Anne-Lise; Viengchareun, Say; Hage, Mirella; Bouligand, Jérôme; Young, Jacques; Boutron, Audrey; Zizzari, Philippe; Lombès, Marc; Chanson, Philippe; Kamenický, Peter

    2016-05-01

    Germline mutations in the aryl hydrocarbon receptor-interacting protein (AIP) gene predispose humans to pituitary adenomas through unknown molecular mechanisms. The best-known interacting partner of AIP is the aryl hydrocarbon receptor (AhR), a transcription factor that mediates the effects of xenobiotics implicated in carcinogenesis. As 75% of AIP mutations disrupt the physical and/or functional interaction with AhR, we postulated that the tumorigenic potential of AIP mutations might result from altered AhR signaling. We evaluated the impact of AIP mutations on the AhR signaling pathway, first in fibroblasts from AIP-mutated patients with pituitary adenomas, by comparison with fibroblasts from healthy subjects, then in transfected pituitary GH3 cells. The AIP protein level in mutated fibroblasts was about half of that in cells from healthy subjects, but AhR expression was unaffected. Gene expression analyses showed significant modifications in the expression of the AhR target genes CYP1B1 and AHRR in AIP-mutated fibroblasts, both before and after stimulation with the endogenous AhR ligand kynurenine. Kynurenine increased Cyp1b1 expression to a greater extent in GH3 cells overexpressing wild type compared with cells expressing mutant AIP Knockdown of endogenous Aip in these cells attenuated Cyp1b1 induction by the AhR ligand. Both mutant AIP expression and knockdown of endogenous Aip affected the kynurenine-dependent GH secretion of GH3 cells. This study of human fibroblasts bearing endogenous heterozygous AIP mutations and transfected pituitary GH3 cells shows that AIP mutations affect the AIP protein level and alter AhR transcriptional activity in a gene- and tissue-dependent manner. © 2016 Society for Endocrinology.

  1. Transcription Factors Responding to Pb Stress in Maize

    PubMed Central

    Zhang, Yanling; Ge, Fei; Hou, Fengxia; Sun, Wenting; Zheng, Qi; Zhang, Xiaoxiang; Ma, Langlang; Fu, Jun; He, Xiujing; Peng, Huanwei; Pan, Guangtang; Shen, Yaou

    2017-01-01

    Pb can damage the physiological function of human organs by entering the human body via food-chain enrichment. Revealing the mechanisms of maize tolerance to Pb is critical for preventing this. In this study, a Pb-tolerant maize inbred line, 178, was used to analyse transcription factors (TFs) expressed under Pb stress based on RNA sequencing data. A total of 464 genes expressed in control check (CK) or Pb treatment samples were annotated as TFs. Among them, 262 differentially expressed transcription factors (DETs) were identified that responded to Pb treatment. Furthermore, the DETs were classified into 4 classes according to their expression patterns, and 17, 12 and 2 DETs were significantly annotated to plant hormone signal transduction, basal transcription factors and base excision repair, respectively. Seventeen DETs were found to participate in the plant hormone signal transduction pathway, where basic leucine zippers (bZIPs) were the most significantly enriched TFs, with 12 members involved. We further obtained 5 Arabidopsis transfer DNA (T-DNA) mutants for 6 of the maize bZIPs, among which the mutants atbzip20 and atbzip47, representing ZmbZIP54 and ZmbZIP107, showed obviously inhibited growth of roots and above-ground parts, compared with wild type. Five highly Pb-tolerant and 5 highly Pb-sensitive in maize lines were subjected to DNA polymorphism and expression level analysis of ZmbZIP54 and ZmbZIP107. The results suggested that differences in bZIPs expression partially accounted for the differences in Pb-tolerance among the maize lines. Our results contribute to the understanding of the molecular regulation mechanisms of TFs in maize under Pb stress. PMID:28927013

  2. Mechanisms of transient signaling via short and long prolactin receptor isoforms in female and male sensory neurons.

    PubMed

    Belugin, Sergei; Diogenes, Anibal R; Patil, Mayur J; Ginsburg, Erika; Henry, Michael A; Akopian, Armen N

    2013-11-29

    Prolactin (PRL) regulates activity of nociceptors and causes hyperalgesia in pain conditions. PRL enhances nociceptive responses by rapidly modulating channels in nociceptors. The molecular mechanisms underlying PRL-induced transient signaling in neurons are not well understood. Here we use a variety of cell biology and pharmacological approaches to show that PRL transiently enhanced capsaicin-evoked responses involve protein kinase C ε (PKCε) or phosphatidylinositol 3-kinase (PI3K) pathways in female rat trigeminal (TG) neurons. We next reconstituted PRL-induced signaling in a heterologous expression system and TG neurons from PRL receptor (PRLR)-null mutant mice by expressing rat PRLR-long isoform (PRLR-L), PRLR-short isoform (PRLR-S), or a mix of both. Results show that PRLR-S, but not PRLR-L, is capable of mediating PRL-induced transient enhancement of capsaicin responses in both male and female TG neurons. However, co-expression of PRLR-L with PRLR-S (1:1 ratio) leads to the inhibition of the transient PRL actions. Co-expression of PRLR-L deletion mutants with PRLR-S indicated that the cytoplasmic site adjacent to the trans-membrane domain of PRLR-L was responsible for inhibitory effects of PRLR-L. Furthermore, in situ hybridization and immunohistochemistry data indicate that in normal conditions, PRLR-L is expressed mainly in glia with little expression in rat sensory neurons (3-5%) and human nerves. The predominant PRLR form in TG neurons/nerves from rats and humans is PRLR-S. Altogether, PRL-induced transient signaling in sensory neurons is governed by PI3K or PKCε, mediated via the PRLR-S isoform, and transient effects mediated by PRLR-S are inhibited by presence of PRLR-L in these cells.

  3. A gain-of-function mutation of plastidic invertase alters nuclear gene expression with sucrose treatment partially via GENOMES UNCOUPLED1-mediated signaling.

    PubMed

    Maruta, Takanori; Miyazaki, Nozomi; Nosaka, Ryota; Tanaka, Hiroyuki; Padilla-Chacon, Daniel; Otori, Kumi; Kimura, Ayako; Tanabe, Noriaki; Yoshimura, Kazuya; Tamoi, Masahiro; Shigeoka, Shigeru

    2015-05-01

    Plastid gene expression (PGE) is one of the signals that regulate the expression of photosynthesis-associated nuclear genes (PhANGs) via GENOMES UNCOUPLED1 (GUN1)-dependent retrograde signaling. We recently isolated Arabidopsis sugar-inducible cotyledon yellow-192 (sicy-192), a gain-of-function mutant of plastidic invertase, and showed that following the treatment of this mutant with sucrose, the expression of PhANGs as well as PGE decreased, suggesting that the sicy-192 mutation activates a PGE-evoked and GUN1-mediated retrograde pathway. To clarify the relationship between the sicy-192 mutation, PGE, and GUN1-mediated pathway, plastid and nuclear gene expression in a double mutant of sicy-192 and gun1-101, a null mutant of GUN1 was studied. Plastid-encoded RNA polymerase (PEP)-dependent PGE was markedly suppressed in the sicy-192 mutant by the sucrose treatment, but the suppression as well as cotyledon yellow phenotype was not mitigated by GUN1 disruption. Microarray analysis revealed that the altered expression of nuclear genes such as PhANG in the sucrose-treated sicy-192 mutant was largely dependent on GUN1. The present findings demonstrated that the sicy-192 mutation alters nuclear gene expression with sucrose treatment via GUN1, which is possibly followed by inhibiting PEP-dependent PGE, providing a new insight into the role of plastid sugar metabolism in nuclear gene expression. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  4. Overexpression of p62/SQSTM1 promotes the degradations of abnormally accumulated PrP mutants in cytoplasm and relieves the associated cytotoxicities via autophagy-lysosome-dependent way.

    PubMed

    Xu, Yin; Zhang, Jin; Tian, Chan; Ren, Ke; Yan, Yu-E; Wang, Ke; Wang, Hui; Chen, Cao; Wang, Jing; Shi, Qi; Dong, Xiao-Ping

    2014-04-01

    The protein of p62/sequestosome 1 (SQSTM1), a key cargo adaptor protein involved in autophagy-lysosome degradation, exhibits inclusion bodies structure in cytoplasm and plays a protective role in some models of neurodegenerative diseases. Some PrP mutants, such as PrP-CYTO and PrP-PG14, also form cytosolic inclusion bodies and trigger neuronal apoptosis either in cultured cells or in transgenic mice. Here, we demonstrated that the cellular p62/SQSTM1 incorporated into the inclusion bodies formed by expressing the abnormal PrP mutants, PrP-CYTO and PrP-PG14, in human embryonic kidney 293 cells. Overexpression of p62/SQSTM1 efficiently relieved the cytosolic aggregations and cell apoptosis induced by the abnormal PrPs. Autophagy-lysosome inhibitors instead of proteasome inhibitor sufficiently blocked the p62/SQSTM1-mediated degradations of abnormal PrPs. Overexpression of p62/SQSTM1 did not alter the levels of light chain 3 (LC3) in the cells expressing various PrPs. However, more complexes of p62/SQSTM1 with LC3 were detected in the cells expressing the misfolded PrPs. These data imply that p62/SQSTM1 plays an important role in the homeostasis of abnormal PrPs via autophagy-lysosome-dependent way.

  5. E2-EPF UCP regulates stability and functions of missense mutant pVHL via ubiquitin mediated proteolysis.

    PubMed

    Park, Kyeong-Su; Kim, Ju Hee; Shin, Hee Won; Chung, Kyung-Sook; Im, Dong-Soo; Lim, Jung Hwa; Jung, Cho-Rok

    2015-10-26

    Missense mutation of VHL gene is frequently detected in type 2 VHL diseases and linked to a wide range of pVHL functions and stability. Certain mutant pVHLs retain ability to regulate HIFs but lose their function by instability. In this case, regulating of degradation of mutant pVHLs, can be postulated as therapeutic method. The stability and cellular function of missense mutant pVHLs were determine in HEK293T transient expressing cell and 786-O stable cell line. Ubiquitination assay of mutant VHL proteins was performed in vitro system. Anticancer effect of adenovirus mediated shUCP expressing was evaluated using ex vivo mouse xenograft assay. Three VHL missense mutants (V155A, L158Q, and Q164R) are directly ubiquitinated by E2-EPF UCP (UCP) in vitro. Mutant pVHLs are more unstable than wild type in cell. Missense mutant pVHLs interact with UCP directly in both in vitro and cellular systems. Lacking all of lysine residues of pVHL result in resistance to ubiquitination thereby increase its stability. Missense mutant pVHLs maintained the function of E3 ligase to ubiquitinate HIF-1α in vitro. In cells expressing mutant pVHLs, Glut-1 and VEGF were relatively upregulated compared to their levels in cells expressing wild-type. Depletion of UCP restored missense mutant pVHLs levels and inhibited cell growth. Adenovirus-mediated shUCP RNA delivery inhibited tumor growth in ex vivo mouse xenograft model. These data suggest that targeting of UCP can be one of therapeutic method in type 2 VHL disease caused by unstable but functional missense mutant pVHL.

  6. HFE genotype affects exosome phenotype in cancer.

    PubMed

    Mrowczynski, Oliver D; Madhankumar, A B; Slagle-Webb, Becky; Lee, Sang Y; Zacharia, Brad E; Connor, James R

    2017-08-01

    Neuroblastoma is the third most common childhood cancer, and timely diagnosis and sensitive therapeutic monitoring remain major challenges. Tumor progression and recurrence is common with little understanding of mechanisms. A major recent focus in cancer biology is the impact of exosomes on metastatic behavior and the tumor microenvironment. Exosomes have been demonstrated to contribute to the oncogenic effect on the surrounding tumor environment and also mediate resistance to therapy. The effect of genotype on exosomal phenotype has not yet been explored. We interrogated exosomes from human neuroblastoma cells that express wild-type or mutant forms of the HFE gene. HFE, one of the most common autosomal recessive polymorphisms in the Caucasian population, originally associated with hemochromatosis, has also been associated with increased tumor burden, therapeutic resistance boost, and negative impact on patient survival. Herein, we demonstrate that changes in genotype cause major differences in the molecular and functional properties of exosomes; specifically, HFE mutant derived exosomes have increased expression of proteins relating to invasion, angiogenesis, and cancer therapeutic resistance. HFE mutant derived exosomes were also shown to transfer this cargo to recipient cells and cause an increased oncogenic functionality in those recipient cells. Copyright © 2017. Published by Elsevier B.V.

  7. Interaction between DMRT1 function and genetic background modulates signaling and pluripotency to control tumor susceptibility in the fetal germ line

    PubMed Central

    Krentz, Anthony D.; Murphy, Mark W.; Zhang, Teng; Sarver, Aaron L.; Jain, Sanjay; Griswold, Michael D.; Bardwell, Vivian J.; Zarkower, David

    2013-01-01

    Dmrt1(doublesex and mab-3 related transcription factor 1) is a regulator of testis development in vertebrates that has been implicated in testicular germ cell tumors of mouse and human. In the fetal mouse testis Dmrt1 regulates germ cell pluripotency in a strain-dependent manner. Loss of Dmrt1 in 129Sv strain mice results in a >90% incidence of testicular teratomas, tumors consisting cells of multiple germ layers; by contrast, these tumors have never been observed in Dmrt1 mutants of C57BL/6J (B6) or mixed genetic backgrounds. To further investigate the interaction between Dmrt1 and genetic background we compared mRNA expression in wild type and Dmrt1 mutant fetal testes of 129Sv and B6 mice at embryonic day 15.5 (E15.5), prior to overt tumorigenesis. Loss of Dmrt1 caused misexpression of overlapping but distinct sets of mRNAs in the two strains. The mRNAs that were selectively affected included some that changed expression only in one strain or the other and some that changed in both strains but to a greater degree in one versus the other. In particular, loss of Dmrt1 in 129Sv testes caused a more severe failure to silence regulators of pluripotency than in B6 testes. A number of genes misregulated in 129Sv mutant testes also are misregulated in human testicular germ cell tumors (TGCTs), suggesting similar etiology between germ cell tumors in mouse and man. Expression profiling showed that DMRT1 also regulates pluripotency genes in the fetal ovary, although Dmrt1 mutant females do not develop teratomas. Pathway analysis indicated disruption of several signaling pathways in Dmrt1 mutant fetal testes, including Nodal, Notch, and GDNF. We used a Nanos3-cre knock-in allele to perform conditional gene targeting, testing the GDNF coreceptors Gfra1 and Ret for effects on teratoma susceptibility. Conditional deletion of Gfra1 but not Ret in fetal germ cells of animals outcrossed to 129Sv caused a modest but significant elevation in tumor incidence. Despite some variability in genetic background in these crosses, this result is consistent with previous genetic mapping of teratoma susceptibility loci to the region containing Gfra1. Using Nanos3-cre we also uncovered a strong genetic interaction between Dmrt1 and Nanos3, suggesting parallel functions for these two genes in fetal germ cells. Finally, we used chromatin immunoprecipitation (ChIP-seq) analysis to identify a number of potentially direct DMRT1 targets. This analysis suggested that DMRT1 controls pluripotency via transcriptional repression of Esrrb, Nr5a2/Lrh1, and Sox2. Given the strong evidence for involvement of DMRT1 in human TGCT, the downstream genes and pathways identified in this study provide potentially useful candidates for roles in the human disease. PMID:23473982

  8. Evaluation of the effects of sdiA, a luxR homologue, on adherence and motility of Escherichia coli O157 : H7.

    PubMed

    Sharma, Vijay K; Bearson, Shawn M D; Bearson, Bradley L

    2010-05-01

    Quorum-sensing (QS) signalling pathways are important regulatory networks for controlling the expression of genes promoting adherence of enterohaemorrhagic Escherichia coli (EHEC) O157 : H7 to epithelial cells. A recent study has shown that EHEC O157 : H7 encodes a luxR homologue, called sdiA, which upon overexpression reduces the expression of genes encoding flagellar and locus of enterocyte effacement (LEE) proteins, thus negatively impacting on the motility and intimate adherence phenotypes, respectively. Here, we show that the deletion of sdiA from EHEC O157 : H7 strain 86-24, and from a hha (a negative regulator of ler) mutant of this strain, enhanced bacterial adherence to HEp-2 epithelial cells of the sdiA mutant strains relative to the strains containing a wild-type copy of sdiA. Quantitative reverse transcription PCR showed that the expression of LEE-encoded genes ler, espA and eae in strains with the sdiA deletions was not significantly different from that of the strains wild-type for sdiA. Similarly, no additional increases in the expression of LEE genes were observed in a sdiA hha double mutant strain relative to that observed in the hha deletion mutant. While the expression of fliC, which encodes flagellin, was enhanced in the sdiA mutant strain, the expression of fliC was reduced by several fold in the hha mutant strain, irrespective of the presence or absence of sdiA, indicating that the genes sdiA and hha exert opposing effects on the expression of fliC. The strains with deletions in sdiA or hha showed enhanced expression of csgA, encoding curlin of the curli fimbriae, with the expression of csgA highest in the sdiA hha double mutant, suggesting an additive effect of these two gene deletions on the expression of csgA. No significant differences were observed in the expression of the genes lpfA and fimA of the operons encoding long polar and type 1 fimbriae in the sdiA mutant strain. These data indicate that SdiA has no significant effect on the expression of LEE genes, but that it appears to act as a strong repressor of genes encoding flagella and curli fimbriae, and the alleviation of the SdiA-mediated repression of these genes in an EHEC O157 : H7 sdiA mutant strain contributes to enhanced bacterial motility and increased adherence to HEp-2 epithelial cells.

  9. Familial CJD Associated PrP Mutants within Transmembrane Region Induced Ctm-PrP Retention in ER and Triggered Apoptosis by ER Stress in SH-SY5Y Cells

    PubMed Central

    Wang, Xin; Shi, Qi; Xu, Kun; Gao, Chen; Chen, Cao; Li, Xiao-Li; Wang, Gui-Rong; Tian, Chan; Han, Jun; Dong, Xiao-Ping

    2011-01-01

    Background Genetic prion diseases are linked to point and inserted mutations in the prion protein (PrP) gene that are presumed to favor conversion of the cellular isoform of PrP (PrPC) to the pathogenic one (PrPSc). The pathogenic mechanisms and the subcellular sites of the conversion are not completely understood. Here we introduce several PRNP gene mutations (such as, PrP-KDEL, PrP-3AV, PrP-A117V, PrP-G114V, PrP-P102L and PrP-E200K) into the cultured cells in order to explore the pathogenic mechanism of familial prion disease. Methodology/Principal Findings To address the roles of aberrant retention of PrP in endoplasmic reticulum (ER), the recombinant plasmids expressing full-length human PrP tailed with an ER signal peptide at the COOH-terminal (PrP-KDEL) and PrP with three amino acids exchange in transmembrane region (PrP-3AV) were constructed. In the preparations of transient transfections, 18-kD COOH-terminal proteolytic resistant fragments (Ctm-PrP) were detected in the cells expressing PrP-KDEL and PrP-3AV. Analyses of the cell viabilities in the presences of tunicamycin and brefeldin A revealed that expressions of PrP-KDEL and PrP-3AV sensitized the transfected cells to ER stress stimuli. Western blots and RT-PCR identified the clear alternations of ER stress associated events in the cells expressing PrP-KDEL and PrP-3AV that induced ER mediated apoptosis by CHOP and capase-12 apoptosis pathway. Moreover, several familial CJD related PrP mutants were transiently introduced into the cultured cells. Only the mutants within the transmembrane region (G114V and A117V) induced the formation of Ctm-PrP and caused the ER stress, while the mutants outside the transmembrane region (P102L and E200K) failed. Conclusions/Significance The data indicate that the retention of PrP in ER through formation of Ctm-PrP results in ER stress and cell apoptosis. The cytopathic activities caused by different familial CJD associated PrP mutants may vary, among them the mutants within the transmembrane region undergo an ER-stress mediated cell apoptosis. PMID:21298055

  10. In Vivo Analysis of Lrig Genes Reveals Redundant and Independent Functions in the Inner Ear

    PubMed Central

    del Rio, Tony; Nishitani, Allison M.; Yu, Wei-Ming; Goodrich, Lisa V.

    2013-01-01

    Lrig proteins are conserved transmembrane proteins that modulate a variety of signaling pathways from worm to humans. In mammals, there are three family members – Lrig1, Lrig2, and Lrig3 – that are defined by closely related extracellular domains with a similar arrangement of leucine rich repeats and immunoglobulin domains. However, the intracellular domains show little homology. Lrig1 inhibits EGF signaling through internalization and degradation of ErbB receptors. Although Lrig3 can also bind ErbB receptors in vitro, it is unclear whether Lrig2 and Lrig3 exhibit similar functions to Lrig1. To gain insights into Lrig gene functions in vivo, we compared the expression and function of the Lrigs in the inner ear, which offers a sensitive system for detecting effects on morphogenesis and function. We find that all three family members are expressed in the inner ear throughout development, with Lrig1 and Lrig3 restricted to subsets of cells and Lrig2 expressed more broadly. Lrig1 and Lrig3 overlap prominently in the developing vestibular apparatus and simultaneous removal of both genes disrupts inner ear morphogenesis. This suggests that these two family members act redundantly in the otic epithelium. In contrast, although Lrig1 and Lrig2 are frequently co-expressed, Lrig1−/−;Lrig2−/− double mutant ears show no enhanced structural abnormalities. At later stages, Lrig1 expression is sustained in non-sensory tissues, whereas Lrig2 levels are enhanced in neurons and sensory epithelia. Consistent with these distinct expression patterns, Lrig1 and Lrig2 mutant mice exhibit different forms of impaired auditory responsiveness. Notably, Lrig1−/−;Lrig2−/− double mutant mice display vestibular deficits and suffer from a more severe auditory defect that is accompanied by a cochlear innervation phenotype not present in single mutants. Thus, Lrig genes appear to act both redundantly and independently, with Lrig2 emerging as the most functionally distinct family member. PMID:24086156

  11. BRCA1 regulation on β-hCG: a mechanism for tumorigenicity in BRCA1 defective breast cancer.

    PubMed

    Sengodan, S K; Nadhan, R; Nair, R S; Hemalatha, S K; Somasundaram, V; Sushama, R R; Rajan, A; Latha, N R; Varghese, G R; Thankappan, R K; Kumar, J M; Chil, A; Anilkumar, T V; Srinivas, P

    2017-09-04

    Human chorionic gonadotropin β (β-hCG) has been implicated in breast tumorigenesis. However, the role of this hormone is highly controversial as certain studies suggest it has anti-tumor properties while others have found it to be pro-tumorigenic. To unveil the truth, we have analyzed the expression of β-hCG in breast cancer. We identified for the first time that β-hCG expression is linked to BRCA1 status and its overexpression is seen in BRCA1 mutated breast cancer cells, BRCA1 conditional knockout mouse breast cancer tissues and BRCA1 floxed basal cell carcinoma (BCC) tissues. An analysis of three large, transcriptomic data sets from TCGA (The Cancer Genome Atlas) expression profile confirmed the inverse correlation between BRCA1 and β-hCG in human breast cancer. Using ChIP and luciferase assays, we also demonstrated that the cancer cells with wild-type but not mutant BRCA1 directly repress the expression of β-hCG by binding to its promoter. Further, β-hCG promotes migration and invasion predominantly in BRCA1 mutant breast cancer cells. Interestingly, stable overexpression of β-hCG in BRCA1 mutant but not wild-type breast cancer cells results in the formation of spheres even on monolayer cultures. The cells of these spheres show high expression of both EMT and stem cell markers. Since β-hCG belongs to a cysteine knot family of proteins like TGFβ and TGFβ signaling is deregulated in BRCA1 defective tumors, we checked whether β-hCG can mediate signaling through TGFβRII in BRCA1 mutated cells. We found for the first time that β-hCG can bind and phosphorylate TGFβRII, irrespective of LHCGR status and induce proliferation in BRCA1 defective cells. Our results confirmed that there exists a transcriptional regulation of BRCA1 on β-hCG and BRCA1 mutation promotes β-hCG mediated tumorigenesis through TGFβRII signaling. Thus inhibiting β-hCG-TGFβRII could prove an effective treatment strategy for BRCA1 mutated tumors.

  12. BRCA1 regulation on β-hCG: a mechanism for tumorigenicity in BRCA1 defective breast cancer

    PubMed Central

    Sengodan, S K; Nadhan, R; Nair, R S; Hemalatha, S K; Somasundaram, V; Sushama, R R; Rajan, A; Latha, N R; Varghese, G R; Thankappan, R k; Kumar, J M; Chil, A; Anilkumar, T V; Srinivas, P

    2017-01-01

    Human chorionic gonadotropin β (β-hCG) has been implicated in breast tumorigenesis. However, the role of this hormone is highly controversial as certain studies suggest it has anti-tumor properties while others have found it to be pro-tumorigenic. To unveil the truth, we have analyzed the expression of β-hCG in breast cancer. We identified for the first time that β-hCG expression is linked to BRCA1 status and its overexpression is seen in BRCA1 mutated breast cancer cells, BRCA1 conditional knockout mouse breast cancer tissues and BRCA1 floxed basal cell carcinoma (BCC) tissues. An analysis of three large, transcriptomic data sets from TCGA (The Cancer Genome Atlas) expression profile confirmed the inverse correlation between BRCA1 and β-hCG in human breast cancer. Using ChIP and luciferase assays, we also demonstrated that the cancer cells with wild-type but not mutant BRCA1 directly repress the expression of β-hCG by binding to its promoter. Further, β-hCG promotes migration and invasion predominantly in BRCA1 mutant breast cancer cells. Interestingly, stable overexpression of β-hCG in BRCA1 mutant but not wild-type breast cancer cells results in the formation of spheres even on monolayer cultures. The cells of these spheres show high expression of both EMT and stem cell markers. Since β-hCG belongs to a cysteine knot family of proteins like TGFβ and TGFβ signaling is deregulated in BRCA1 defective tumors, we checked whether β-hCG can mediate signaling through TGFβRII in BRCA1 mutated cells. We found for the first time that β-hCG can bind and phosphorylate TGFβRII, irrespective of LHCGR status and induce proliferation in BRCA1 defective cells. Our results confirmed that there exists a transcriptional regulation of BRCA1 on β-hCG and BRCA1 mutation promotes β-hCG mediated tumorigenesis through TGFβRII signaling. Thus inhibiting β-hCG-TGFβRII could prove an effective treatment strategy for BRCA1 mutated tumors. PMID:28869585

  13. Mutant type glutathione S-transferase theta 1 gene homologue to mTOR in myelodysplastic syndrome: possible clinical application of rapamycin.

    PubMed

    Maeda, Yasuhiro; Yamaguchi, Terufumi; Ueda, Satomi; Matsuo, Koki; Morita, Yasuyoshi; Naiki, Yoshito; Miyazato, Hajime; Shimada, Takahiro; Miyatake, Jun-Ichi; Matsuda, Mitsuhiro; Kanamaru, Akihisa

    2003-07-01

    In this study, we observed the expression of the GSTT-1 gene in patients with myelodysplastic syndrome (MDS) at the messenger RNA level. Reverse transcription-polymerase chain reaction (RT-PCR) for GSTT-1 was performed with a pair of primers complementary to the 5' coding section and the 3' coding section of the GSTT-1 cDNA for amplifying the 623-bp band. Among 20 patients with MDS, 8 patients showed the expected 623-bp band on RT-PCR, and 12 patients showed a 500-bp band on RT-PCR, indicating that a 123-bp sequence was deleted as a mutant of the GSTT-1 gene. Furthermore, a BLAST DNA search showed that the deletion of a 123 bp sequence creates a sequence that is 63% homologous to human FKBP-rapamycin associated protein (FRAP); this protein has been termed a mammalian target of rapamycin (mTOR). We respectively transfected the wild type and the mutant type GSTT-1 gene in an expression vector to two cell lines (K562 and HL-60). The stable transformants for the wild type and the mutant type GSTT-1 genes were made by G418 selection. Interestingly, rapamycin could induce significant growth inhibition of the stable transformants for mutant type GSTT-1, which was indicative of apoptosis, but not that of those for wild type GSTT-1. These results suggest that rapamycin could be included in the therapeutic modality for the patients with MDS who have the mTOR sequences in GSTT-1 gene.

  14. Specificity of prohormone convertase endoproteolysis of progastrin in AtT-20 cells.

    PubMed Central

    Dickinson, C J; Sawada, M; Guo, Y J; Finniss, S; Yamada, T

    1995-01-01

    Biologically active peptide hormones are synthesized from larger precursor proteins by a variety of posttranslational processing reactions. Endoproteolytic cleavage at the Lys74-Lys75 dibasic processing site of progastrin is the major determinant for the relative distribution of gastrin heptadecapeptide and tetratriacontapeptide in tissues. Thus, we explored the ability of two prohormone convertases, PC1/PC3 and PC2, to cleave this important site within progastrin. We expressed wild-type human gastrin cDNA and mutant cDNAs in which the Lys74Lys75 site was changed to Lys74Arg75, Arg74Arg75, and Arg74Lys75 residues in AtT-20 cells. Because AtT-20 cells express Pc1/PC3 but not PC2, we also coexpressed a cDNA encoding PC2 in both wild-type and mutant gastrin-producing AtT-20 cells. Wild-type Lys74Lys75 and mutant Arg74Arg75 progastrin processing sites were efficiently cleaved in AtT-20 cells only after coexpression of PC2. Mutant Lys74Arg75 progastrin was readily processed in cells in the presence or absence of PC2 coexpression, but, in contrast, mutant Arg74Lys75 progastrin was inefficiently cleaved regardless of PC2 coexpression. Northern analysis revealed the presence of PC2 but not PC1/ PC3 in canine antral gastrin-producing G cells. These data suggest that PC2 but not PC1/PC3 is responsible for the cleavage of the Lys74Lys75 site in wild-type progastrin. Images PMID:7657815

  15. Involvement of the pituitary-specific transcription factor pit-1 in somatolactotrope cell growth and death: an approach using dominant-negative pit-1 mutants.

    PubMed

    Pellegrini, Isabelle; Roche, Cathy; Quentien, Marie-Helene; Ferrand, Mireille; Gunz, Ginette; Thirion, Sylvie; Bagnis, Claude; Enjalbert, Alain; Franc, Jean-Louis

    2006-12-01

    The anterior pituitary-specific transcription factor Pit-1 was initially identified and cloned as a transactivator of the prolactin (PRL) and GH genes and later as a regulator of the TSHb gene. It was found to be a major developmental regulator, because natural Pit-1 gene mutations cause a dwarf phenotype in mice and cause combined pituitary hormone deficiency associated with pituitary hypoplasia in humans. To further investigate the growth-promoting effects of Pit-1, we used a strategy based on the use of dominant-negative Pit-1 mutants as an alternative means of inactivating endogenous Pit-1 functions. R271W, a Pit-1 mutant identified in one allele in patients with severe combined pituitary hormone deficiency, and Pit-1Delta1-123, a deletion mutant in which only the DNA binding domain of Pit-1 is conserved, were generated, and their ability to abolish the effects of the endogenous native Pit-1 in the differentiated proliferating somatolactotrope GH4C1 cell line was investigated. Enforced expression of the dominant-negative mutants in GH4C1 cells using recombinant lentiviral vectors decreased the levels of expression of known Pit-1 target genes such as PRL and GH, abolished the hormone release, and reduced cell viability by decreasing the growth rate and inducing apoptosis via a caspase-independent pathway. These results show for the first time that the growth-promoting effects of Pit-1 are at least partly due to the fact that this transcription factor prevents apoptotic cell death.

  16. Alanine scanning of the rabies virus glycoprotein antigenic site III using recombinant rabies virus: implication for post-exposure treatment.

    PubMed

    Papaneri, Amy B; Wirblich, Christoph; Marissen, Wilfred E; Schnell, Matthias J

    2013-12-02

    The safety and availability of the human polyclonal sera that is currently utilized for post-exposure treatment (PET) of rabies virus (RABV) infection remain a concern. Recombinant monoclonal antibodies have been postulated as suitable alternatives by WHO. To this extent, CL184, the RABV human antibody combination comprising monoclonal antibodies (mAbs) CR57 and CR4098, has been developed and has delivered promising clinical data to support its use for RABV PET. For this fully human IgG1 cocktail, mAbs CR57 and CR4098 are produced in the PER.C6 human cell line and combined in equal amounts in the final product. During preclinical evaluation, CR57 was shown to bind to antigenic site I whereas CR4098 neutralization was influenced by a mutation of position 336 (N336) located within antigenic site III. Here, alanine scanning was used to analyze the influence of mutations within the potential binding site for CR4098, antigenic site III, in order to evaluate the possibility of mutated rabies viruses escaping neutralization. For this approach, twenty flanking amino acids (10 upstream and 10 downstream) of the RABV glycoprotein (G) asparagine (N336) were exchanged to alanine (or serine, if already alanine) by site-directed mutagenesis. Analysis of G expression revealed four of the twenty mutant Gs to be non-functional, as shown by their lack of cell surface expression, which is a requirement for the production of infectious RABV. Therefore, these mutants were excluded from further study. The remaining sixteen mutants were introduced in an infectious clone of RABV, and recombinant RABVs (rRABVs) were recovered and utilized for in vitro neutralization assays. All of the viruses were effectively neutralized by CR4098 as well as by CR57, indicating that single amino acid exchanges in this region does not affect the broad neutralizing capability of the CL184 mAb combination. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Cellular conservation of endangered midget buffalo (Lowland Anoa, Bubalus quarlesi) by establishment of primary cultured cell, and its immortalization with expression of cell cycle regulators.

    PubMed

    Fukuda, Tomokazu; Iino, Yuuka; Eitsuka, Takahiro; Onuma, Manabu; Katayama, Masafumi; Murata, Koichi; Inoue-Murayama, Miho; Hara, Kumiko; Isogai, Emiko; Kiyono, Tohru

    2016-10-01

    Lowland Anoa has become endangered due to hunting and human activity. Protection and breeding of endangered species in a controlled environment is the best way of conservation. However, it is not possible to adopt this approach for all endangered species because of the cost involved and the ever-increasing number of critically endangered species. In consideration of these limitations to the conventional conservation methods, we established a primary cell culture of endangered buffalo (Lowland Anoa, Bubalus quarlesi), for the preservation of this biological resource. In addition, we introduced human derived, mutant cyclin dependent kinase 4 (CDK4), Cyclin D, and telomerase reverse transcriptase (TERT) into the primary cells. The successful introduction of these three genes was confirmed by western blot with specific antibodies, and enzymatic activity. We also showed that the expression of mutant CDK4, Cyclin D, and TERT allows us to efficiently establish an immortalized cell line, with an intact chromosome pattern, from Lowland Anoa. To the best of our knowledge, this study is the first investigation that established an immortalized cell line of an endangered wild animal species.

  18. Altered Regulation of the Diguanylate Cyclase YaiC Reduces Production of Type 1 Fimbriae in a Pst Mutant of Uropathogenic Escherichia coli CFT073

    PubMed Central

    Crépin, Sébastien; Porcheron, Gaëlle; Houle, Sébastien; Harel, Josée

    2017-01-01

    ABSTRACT The pst gene cluster encodes the phosphate-specific transport (Pst) system. Inactivation of the Pst system constitutively activates the two-component regulatory system PhoBR and attenuates the virulence of pathogenic bacteria. In uropathogenic Escherichia coli strain CFT073, attenuation by inactivation of pst is predominantly attributed to the decreased expression of type 1 fimbriae. However, the molecular mechanisms connecting the Pst system and type 1 fimbriae are unknown. To address this, a transposon library was constructed in the pst mutant, and clones were tested for a regain in type 1 fimbrial production. Among them, the diguanylate cyclase encoded by yaiC (adrA in Salmonella) was identified to connect the Pst system and type 1 fimbrial expression. In the pst mutant, the decreased expression of type 1 fimbriae is connected by the induction of yaiC. This is predominantly due to altered expression of the FimBE-like recombinase genes ipuA and ipbA, affecting at the same time the inversion of the fim promoter switch (fimS). In the pst mutant, inactivation of yaiC restored fim-dependent adhesion to bladder cells and virulence. Interestingly, the expression of yaiC was activated by PhoB, since transcription of yaiC was linked to the PhoB-dependent phoA-psiF operon. As YaiC is involved in cyclic di-GMP (c-di-GMP) biosynthesis, an increased accumulation of c-di-GMP was observed in the pst mutant. Hence, the results suggest that one mechanism by which deletion of the Pst system reduces the expression of type 1 fimbriae is through PhoBR-mediated activation of yaiC, which in turn increases the accumulation of c-di-GMP, represses the fim operon, and, consequently, attenuates virulence in the mouse urinary tract infection model. IMPORTANCE Urinary tract infections (UTIs) are common bacterial infections in humans. They are mainly caused by uropathogenic Escherichia coli (UPEC). We previously showed that interference with phosphate homeostasis decreases the expression of type 1 fimbriae and attenuates UPEC virulence. Herein, we identified that alteration of the phosphate metabolism increases production of the signaling molecule c-di-GMP, which in turn decreases the expression of type 1 fimbriae. We also determine the regulatory cascade leading to the accumulation of c-di-GMP and identify the Pho regulon as new players in c-di-GMP-mediated cell signaling. By understanding the molecular mechanisms leading to the expression of virulence factors, we will be in a better position to develop new therapeutics. PMID:28924030

  19. Altered Regulation of the Diguanylate Cyclase YaiC Reduces Production of Type 1 Fimbriae in a Pst Mutant of Uropathogenic Escherichia coli CFT073.

    PubMed

    Crépin, Sébastien; Porcheron, Gaëlle; Houle, Sébastien; Harel, Josée; Dozois, Charles M

    2017-12-15

    The pst gene cluster encodes the phosphate-specific transport (Pst) system. Inactivation of the Pst system constitutively activates the two-component regulatory system PhoBR and attenuates the virulence of pathogenic bacteria. In uropathogenic Escherichia coli strain CFT073, attenuation by inactivation of pst is predominantly attributed to the decreased expression of type 1 fimbriae. However, the molecular mechanisms connecting the Pst system and type 1 fimbriae are unknown. To address this, a transposon library was constructed in the pst mutant, and clones were tested for a regain in type 1 fimbrial production. Among them, the diguanylate cyclase encoded by yaiC ( adrA in Salmonella ) was identified to connect the Pst system and type 1 fimbrial expression. In the pst mutant, the decreased expression of type 1 fimbriae is connected by the induction of yaiC This is predominantly due to altered expression of the FimBE-like recombinase genes ipuA and ipbA , affecting at the same time the inversion of the fim promoter switch ( fimS ). In the pst mutant, inactivation of yaiC restored fim -dependent adhesion to bladder cells and virulence. Interestingly, the expression of yaiC was activated by PhoB, since transcription of yaiC was linked to the PhoB-dependent phoA-psiF operon. As YaiC is involved in cyclic di-GMP (c-di-GMP) biosynthesis, an increased accumulation of c-di-GMP was observed in the pst mutant. Hence, the results suggest that one mechanism by which deletion of the Pst system reduces the expression of type 1 fimbriae is through PhoBR-mediated activation of yaiC , which in turn increases the accumulation of c-di-GMP, represses the fim operon, and, consequently, attenuates virulence in the mouse urinary tract infection model. IMPORTANCE Urinary tract infections (UTIs) are common bacterial infections in humans. They are mainly caused by uropathogenic Escherichia coli (UPEC). We previously showed that interference with phosphate homeostasis decreases the expression of type 1 fimbriae and attenuates UPEC virulence. Herein, we identified that alteration of the phosphate metabolism increases production of the signaling molecule c-di-GMP, which in turn decreases the expression of type 1 fimbriae. We also determine the regulatory cascade leading to the accumulation of c-di-GMP and identify the Pho regulon as new players in c-di-GMP-mediated cell signaling. By understanding the molecular mechanisms leading to the expression of virulence factors, we will be in a better position to develop new therapeutics. Copyright © 2017 American Society for Microbiology.

  20. Rational site-directed mutations of the LLP-1 and LLP-2 lentivirus lytic peptide domains in the intracytoplasmic tail of human immunodeficiency virus type 1 gp41 indicate common functions in cell-cell fusion but distinct roles in virion envelope incorporation.

    PubMed

    Kalia, Vandana; Sarkar, Surojit; Gupta, Phalguni; Montelaro, Ronald C

    2003-03-01

    Two highly conserved cationic amphipathic alpha-helical motifs, designated lentivirus lytic peptides 1 and 2 (LLP-1 and LLP-2), have been characterized in the carboxyl terminus of the transmembrane (TM) envelope glycoprotein (Env) of lentiviruses. Although various properties have been attributed to these domains, their structural and functional significance is not clearly understood. To determine the specific contributions of the Env LLP domains to Env expression, processing, and incorporation and to viral replication and syncytium induction, site-directed LLP mutants of a primary dualtropic infectious human immunodeficiency virus type 1 (HIV-1) isolate (ME46) were examined. Substitutions were made for highly conserved arginine residues in either the LLP-1 or LLP-2 domain (MX1 or MX2, respectively) or in both domains (MX4). The HIV-1 mutants with altered LLP domains demonstrated distinct phenotypes. The LLP-1 mutants (MX1 and MX4) were replication defective and showed an average of 85% decrease in infectivity, which was associated with an evident decrease in gp41 incorporation into virions without a significant decrease in Env expression or processing in transfected 293T cells. In contrast, MX2 virus was replication competent and incorporated a full complement of Env into its virions, indicating a differential role for the LLP-1 domain in Env incorporation. Interestingly, the replication-competent MX2 virus was impaired in its ability to induce syncytia in T-cell lines. This defect in cell-cell fusion did not correlate with apparent defects in the levels of cell surface Env expression, oligomerization, or conformation. The lack of syncytium formation, however, correlated with a decrease of about 90% in MX2 Env fusogenicity compared to that of wild-type Env in quantitative luciferase-based cell-cell fusion assays. The LLP-1 mutant MX1 and MX4 Envs also exhibited an average of 80% decrease in fusogenicity. Altogether, these results demonstrate for the first time that the highly conserved LLP domains perform critical but distinct functions in Env incorporation and fusogenicity.

  1. Synergistic Toxicity of Polyglutamine-Expanded TATA-Binding Protein in Glia and Neuronal Cells: Therapeutic Implications for Spinocerebellar Ataxia 17

    PubMed Central

    Yang, Yang; Cui, Yiting; Tang, Beisha

    2017-01-01

    Spinocerebellar ataxia 17 (SCA17) is caused by polyglutamine (polyQ) repeat expansion in the TATA-binding protein (TBP) and is among a family of neurodegenerative diseases in which polyQ expansion leads to preferential neuronal loss in the brain. Although previous studies have demonstrated that expression of polyQ-expanded proteins in glial cells can cause neuronal injury via noncell-autonomous mechanisms, these studies investigated animal models that overexpress transgenic mutant proteins. Since glial cells are particularly reactive to overexpressed mutant proteins, it is important to investigate the in vivo role of glial dysfunction in neurodegeneration when mutant polyQ proteins are endogenously expressed. In the current study, we generated two conditional TBP-105Q knock-in mouse models that specifically express mutant TBP at the endogenous level in neurons or in astrocytes. We found that mutant TBP expression in neuronal cells or astrocytes alone only caused mild neurodegeneration, whereas severe neuronal toxicity requires the expression of mutant TBP in both neuronal and glial cells. Coculture of neurons and astrocytes further validated that mutant TBP in astrocytes promoted neuronal injury. We identified activated inflammatory signaling pathways in mutant TBP-expressing astrocytes, and blocking nuclear factor κB (NF-κB) signaling in astrocytes ameliorated neurodegeneration. Our results indicate that the synergistic toxicity of mutant TBP in neuronal and glial cells plays a critical role in SCA17 pathogenesis and that targeting glial inflammation could be a potential therapeutic approach for SCA17 treatment. SIGNIFICANCE STATEMENT Mutant TBP with polyglutamine expansion preferentially affects neuronal viability in SCA17 patients. Whether glia, the cells that support and protect neurons, contribute to neurodegeneration in SCA17 remains mostly unexplored. In this study, we provide both in vivo and in vitro evidence arguing that endogenous expression of mutant TBP in neurons and glia synergistically impacts neuronal survival. Hyperactivated inflammatory signaling pathways, particularly the NF-κB pathway, underlie glia-mediated neurotoxicity. Moreover, blocking NF-κB activity with small chemical inhibitors alleviated such neurotoxicity. Our study establishes glial dysfunction as an important component of SCA17 pathogenesis and suggests targeting glial inflammation as a potential therapeutic approach for SCA17 treatment. PMID:28821675

  2. Root-expressed maize lipoxygenase 3 negatively regulates induced systemic resistance to Colletotrichum graminicola in shoots

    PubMed Central

    Constantino, Nasie N.; Mastouri, Fatemeh; Damarwinasis, Ramadhika; Borrego, Eli J.; Moran-Diez, Maria E.; Kenerley, Charley M.; Gao, Xiquan; Kolomiets, Michael V.

    2013-01-01

    We have previously reported that disruption of a maize root-expressed 9-lipoxygenase (9-LOX) gene, ZmLOX3, results in dramatic increase in resistance to diverse leaf and stalk pathogens. Despite evident economic significance of these findings, the mechanism behind this increased resistance remained elusive. In this study, we found that increased resistance of the lox3-4 mutants is due to constitutive activation of induced systemic resistance (ISR) signaling. We showed that ZmLOX3 lacked expression in leaves in response to anthracnose leaf blight pathogen Colletotrichum graminicola, but was expressed constitutively in the roots, thus, prompting our hypothesis: the roots of lox3-4 mutants are the source of increased resistance in leaves. Supporting this hypothesis, treatment of wild-type plants (WT) with xylem sap of lox3-4 mutant induced resistance to C. graminicola to the levels comparable to those observed in lox3-4 mutant. Moreover, treating mutants with the sap collected from WT plants partially restored the susceptibility to C. graminicola. lox3-4 mutants showed primed defense responses upon infection, which included earlier and greater induction of defense-related PAL and GST genes compared to WT. In addition to the greater expression of the octadecanoid pathway genes, lox3-4 mutant responded earlier and with a greater accumulation of H2O2 in response to C. graminicola infection or treatment with alamethicin. These findings suggest that lox3-4 mutants display constitutive ISR-like signaling. In support of this idea, root colonization by Trichoderma virens strain GV29-8 induced the same level of disease resistance in WT as the treatment with the mutant sap, but had no additional resistance effect in lox3-4 mutant. While treatment with T. virens GV29 strongly and rapidly suppressed ZmLOX3 expression in hydroponically grown WT roots, T. virens Δsml mutant, which is deficient in ISR induction, was unable to suppress expression of ZmLOX3, thus, providing genetic evidence that SM1 function in ISR, at least in part, by suppressing host ZmLOX3 gene. This study and the genetic tools generated herein will allow the identification of the signals regulating the induction of resistance to aboveground attackers by beneficial soil microorganisms in the future. PMID:24391653

  3. The Drosophila homolog of Down's syndrome critical region 1 gene regulates learning: Implications for mental retardation

    PubMed Central

    Chang, Karen T.; Shi, Yi-Jun; Min, Kyung-Tai

    2003-01-01

    Mental retardation is the most common phenotypic abnormality seen in Down's syndrome (DS) patients, yet the underlying mechanism remains mysterious. DS critical region 1 (DSCR1), located on chromosome 21, is overexpressed in the brain of DS fetus and encodes an inhibitor of calcineurin, but its physiological significance is unknown. To study its functional importance and role in mental retardation in DS, we generated Drosophila mutants of nebula, an ortholog of human DSCR1. Here, we report that both nebula loss-of-function and overexpression mutants exhibit severe learning defects that are attributed by biochemical perturbations rather than maldevelopment of the brain. These results, combined with our data showing that the same biochemical signaling pathway is altered in human DS fetal brain tissue overexpressing DSCR1, suggest that alteration of DSCR1 expression could contribute to mental retardation in DS. PMID:14668437

  4. The Identification of Zebrafish Mutants Showing Alterations in Senescence-Associated Biomarkers

    PubMed Central

    Uchiyama, Junzo; Koshimizu, Eriko; Qi, Jie; Nanjappa, Purushothama; Imamura, Shintaro; Islam, Asiful; Neuberg, Donna; Amsterdam, Adam; Roberts, Thomas M.

    2008-01-01

    There is an interesting overlap of function in a wide range of organisms between genes that modulate the stress responses and those that regulate aging phenotypes and, in some cases, lifespan. We have therefore screened mutagenized zebrafish embryos for the altered expression of a stress biomarker, senescence-associated β-galactosidase (SA-β-gal) in our current study. We validated the use of embryonic SA-β-gal production as a screening tool by analyzing a collection of retrovirus-insertional mutants. From a pool of 306 such mutants, we identified 11 candidates that showed higher embryonic SA-β-gal activity, two of which were selected for further study. One of these mutants is null for a homologue of Drosophila spinster, a gene known to regulate lifespan in flies, whereas the other harbors a mutation in a homologue of the human telomeric repeat binding factor 2 (terf2) gene, which plays roles in telomere protection and telomere-length regulation. Although the homozygous spinster and terf2 mutants are embryonic lethal, heterozygous adult fish are viable and show an accelerated appearance of aging symptoms including lipofuscin accumulation, which is another biomarker, and shorter lifespan. We next used the same SA-β-gal assay to screen chemically mutagenized zebrafish, each of which was heterozygous for lesions in multiple genes, under the sensitizing conditions of oxidative stress. We obtained eight additional mutants from this screen that, when bred to homozygosity, showed enhanced SA-β-gal activity even in the absence of stress, and further displayed embryonic neural and muscular degenerative phenotypes. Adult fish that are heterozygous for these mutations also showed the premature expression of aging biomarkers and the accelerated onset of aging phenotypes. Our current strategy of mutant screening for a senescence-associated biomarker in zebrafish embryos may thus prove to be a useful new tool for the genetic dissection of vertebrate stress response and senescence mechanisms. PMID:18704191

  5. Transgenic mice expressing mutant Pinin exhibit muscular dystrophy, nebulin deficiency and elevated expression of slow-type muscle fiber genes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Hsu-Pin; Hsu, Shu-Yuan; Wu, Wen-Ai

    Highlights: •Pnn CCD domain functions as a dominant negative mutant regulating Pnn expression and function. •Pnn CCD mutant Tg mice have a muscle wasting phenotype during development and show dystrophic histological features. •Pnn mutant muscles are susceptible to slow fiber type gene transition and NEB reduction. •The Tg mouse generated by overexpression of the Pnn CCD domain displays many characteristics resembling NEB{sup +/−} mice. -- Abstract: Pinin (Pnn) is a nuclear speckle-associated SR-like protein. The N-terminal region of the Pnn protein sequence is highly conserved from mammals to insects, but the C-terminal RS domain-containing region is absent in lower species.more » The N-terminal coiled-coil domain (CCD) is, therefore, of interest not only from a functional point of view, but also from an evolutionarily standpoint. To explore the biological role of the Pnn CCD in a physiological context, we generated transgenic mice overexpressing Pnn mutant in skeletal muscle. We found that overexpression of the CCD reduces endogenous Pnn expression in cultured cell lines as well as in transgenic skeletal muscle fibers. Pnn mutant mice exhibited reduced body mass and impaired muscle function during development. Mutant skeletal muscles show dystrophic histological features with muscle fibers heavily loaded with centrally located myonuclei. Expression profiling and pathway analysis identified over-representation of genes in gene categories associated with muscle contraction, specifically those related to slow type fiber. In addition nebulin (NEB) expression level is repressed in Pnn mutant skeletal muscle. We conclude that Pnn downregulation in skeletal muscle causes a muscular dystrophic phenotype associated with NEB deficiency and the CCD domain is incapable of replacing full length Pnn in terms of functional capacity.« less

  6. Hedgehog Is a Positive Regulator of FGF Signalling during Embryonic Tracheal Cell Migration

    PubMed Central

    Butí, Elisenda; Mesquita, Duarte; Araújo, Sofia J.

    2014-01-01

    Cell migration is a widespread and complex process that is crucial for morphogenesis and for the underlying invasion and metastasis of human cancers. During migration, cells are steered toward target sites by guidance molecules that induce cell direction and movement through complex intracellular mechanisms. The spatio-temporal regulation of the expression of these guidance molecules is of extreme importance for both normal morphogenesis and human disease. One way to achieve this precise regulation is by combinatorial inputs of different transcription factors. Here we used Drosophila melanogaster mutants with migration defects in the ganglionic branches of the tracheal system to further clarify guidance regulation during cell migration. By studying the cellular consequences of overactivated Hh signalling, using ptc mutants, we found that Hh positively regulates Bnl/FGF levels during embryonic stages. Our results show that Hh modulates cell migration non-autonomously in the tissues surrounding the action of its activity. We further demonstrate that the Hh signalling pathway regulates bnl expression via Stripe (Sr), a zinc-finger transcription factor with homology to the Early Growth Response (EGR) family of vertebrate transcription factors. We propose that Hh modulates embryonic cell migration by participating in the spatio-temporal regulation of bnl expression in a permissive mode. By doing so, we provide a molecular link between the activation of Hh signalling and increased chemotactic responses during cell migration. PMID:24651658

  7. Hedgehog is a positive regulator of FGF signalling during embryonic tracheal cell migration.

    PubMed

    Butí, Elisenda; Mesquita, Duarte; Araújo, Sofia J

    2014-01-01

    Cell migration is a widespread and complex process that is crucial for morphogenesis and for the underlying invasion and metastasis of human cancers. During migration, cells are steered toward target sites by guidance molecules that induce cell direction and movement through complex intracellular mechanisms. The spatio-temporal regulation of the expression of these guidance molecules is of extreme importance for both normal morphogenesis and human disease. One way to achieve this precise regulation is by combinatorial inputs of different transcription factors. Here we used Drosophila melanogaster mutants with migration defects in the ganglionic branches of the tracheal system to further clarify guidance regulation during cell migration. By studying the cellular consequences of overactivated Hh signalling, using ptc mutants, we found that Hh positively regulates Bnl/FGF levels during embryonic stages. Our results show that Hh modulates cell migration non-autonomously in the tissues surrounding the action of its activity. We further demonstrate that the Hh signalling pathway regulates bnl expression via Stripe (Sr), a zinc-finger transcription factor with homology to the Early Growth Response (EGR) family of vertebrate transcription factors. We propose that Hh modulates embryonic cell migration by participating in the spatio-temporal regulation of bnl expression in a permissive mode. By doing so, we provide a molecular link between the activation of Hh signalling and increased chemotactic responses during cell migration.

  8. Roles of threonine 192 and asparagine 382 in agonist and antagonist interactions with M1 muscarinic receptors

    PubMed Central

    Huang, Xi-Ping; Nagy, Peter I; Williams, Frederick E; Peseckis, Steven M; Messer, William S

    1999-01-01

    Conserved amino acids, such as Thr in transmembrane domains (TM) V and Asn in TM VI of muscarinic receptors, may be important in agonist binding and/or receptor activation. In order to determine the functional roles of Thr192 and Asn382 in human M1 receptors in ligand binding and receptor activation processes, we created and characterized mutant receptors with Thr192 or Asn382 substituted by Ala.HM1 wild-type (WT) and mutant receptors [HM1(Thr192Ala) and HM1(Asn382Ala)] were stably expressed in A9 L cells. The Kd values for 3H-(R)-QNB and Ki values for other classical muscarinic antagonists were similar at HM1(WT) and HM1(Thr192Ala) mutant receptors, yet higher at HM1(Asn382Ala) mutant receptors. Carbachol exhibited lower potency and efficacy in stimulating PI hydrolysis via HM1(Thr192Ala) mutant receptors, and intermediate agonist activity at the HM1(Asn382Ala) mutant receptors.The Asn382 residue in TM VI but not the Thr192 residue in TM V of the human M1 receptor appears to participate directly in antagonist binding. Both Thr192 and Asn382 residues are involved differentially in agonist binding and/or receptor activation processes, yet the Asn382 residue is less important than Thr192 in agonist activation of M1 receptors.Molecular modelling studies indicate that substitution of Thr192 or Asn382 results in the loss of hydrogen-bond interactions and changes in the agonist binding mode associated with an increase in hydrophobic interactions between ligand and receptor. PMID:10188986

  9. CARD8 is a negative regulator for NLRP3 inflammasome, but mutant NLRP3 in cryopyrin-associated periodic syndromes escapes the restriction

    PubMed Central

    2014-01-01

    Introduction NLRP3 plays a role in sensing various pathogen components or stresses in the innate immune system. Once activated, NLRP3 associates with apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and procaspase-1 to form a large protein complex termed inflammasome. Although some investigators have proposed a model of NLRP3-inflammasome containing an adaptor protein caspase recruitment domain-containing protein 8 (CARD8), the role of this molecule remains obscure. This study aimed to clarify the interaction between CARD8 and wild-type NLRP3 as well as mutant forms of NLRP3 linked with cryopyrin-associated periodic syndromes (CAPS). Methods In here HEK293 expression system, cells were transfected with the cDNAs for inflammasome components. Also used were peripheral blood mononuclear cells (PBMCs) and human monocyte-derived macrophages (HMDMs) from healthy volunteers. The interaction of CARD8 and NLRP3 was studied by immunoprecipitation. The effect of CARD8 expression on IL-1β secretion was assessed by ELISA. CARD8 knockdown experiments were carried out by transfection of the specific siRNA into HMDMs. Results In HEK293 cells, CARD8 interacted with wild-type NLRP3, but not with CAPS-associated mutant NLRP3. CARD8 significantly reduced IL-1β secretion from cells transfected with wild-type NLRP3, but not if they were transfected with mutant NLRP3. In addition, association of endogenously expressed CARD8 with NLRP3 was confirmed in resting PBMCs, and CARD8 knockdown resulted in higher amount of IL-1β secretion from HMDMs. Conclusions Until specific stimuli activate NLRP3, CARD8 holds NLRP3, and is supposed to prevent activation by subtle stimuli. However, CAPS-associated mutant NLRP3 is unable to bind with CARD8, which might be relevant to the pathogenesis of CAPS. PMID:24517500

  10. CARD8 is a negative regulator for NLRP3 inflammasome, but mutant NLRP3 in cryopyrin-associated periodic syndromes escapes the restriction.

    PubMed

    Ito, Sayaka; Hara, Yukichi; Kubota, Tetsuo

    2014-02-12

    NLRP3 plays a role in sensing various pathogen components or stresses in the innate immune system. Once activated, NLRP3 associates with apoptosis-associated speck-like protein containing a caspase recruitment domain (ASC) and procaspase-1 to form a large protein complex termed inflammasome. Although some investigators have proposed a model of NLRP3-inflammasome containing an adaptor protein caspase recruitment domain-containing protein 8 (CARD8), the role of this molecule remains obscure. This study aimed to clarify the interaction between CARD8 and wild-type NLRP3 as well as mutant forms of NLRP3 linked with cryopyrin-associated periodic syndromes (CAPS). In here HEK293 expression system, cells were transfected with the cDNAs for inflammasome components. Also used were peripheral blood mononuclear cells (PBMCs) and human monocyte-derived macrophages (HMDMs) from healthy volunteers. The interaction of CARD8 and NLRP3 was studied by immunoprecipitation. The effect of CARD8 expression on IL-1β secretion was assessed by ELISA. CARD8 knockdown experiments were carried out by transfection of the specific siRNA into HMDMs. In HEK293 cells, CARD8 interacted with wild-type NLRP3, but not with CAPS-associated mutant NLRP3. CARD8 significantly reduced IL-1β secretion from cells transfected with wild-type NLRP3, but not if they were transfected with mutant NLRP3. In addition, association of endogenously expressed CARD8 with NLRP3 was confirmed in resting PBMCs, and CARD8 knockdown resulted in higher amount of IL-1β secretion from HMDMs. Until specific stimuli activate NLRP3, CARD8 holds NLRP3, and is supposed to prevent activation by subtle stimuli. However, CAPS-associated mutant NLRP3 is unable to bind with CARD8, which might be relevant to the pathogenesis of CAPS.

  11. The thiazide sensitive sodium chloride co-transporter NCC is modulated by site-specific ubiquitylation.

    PubMed

    Rosenbaek, Lena L; Rizzo, Federica; Wu, Qi; Rojas-Vega, Lorena; Gamba, Gerardo; MacAulay, Nanna; Staub, Olivier; Fenton, Robert A

    2017-10-11

    The renal sodium chloride cotransporter, NCC, in the distal convoluted tubule is important for maintaining body Na + and K + homeostasis. Endogenous NCC is highly ubiquitylated, but the role of individual ubiquitylation sites is not established. Here, we assessed the role of 10 ubiquitylation sites for NCC function. Transient transfections of HEK293 cells with human wildtype (WT) NCC or various K to R mutants identified greater membrane abundance for K706R, K828R and K909R mutants. Relative to WT-NCC, stable tetracycline inducible MDCKI cell lines expressing K706R, K828R and K909R mutants had significantly higher total and phosphorylated NCC levels at the apical plasma membrane under basal conditions. Low chloride stimulation increased membrane abundance of all mutants to similar or greater levels than WT-NCC. Under basal conditions K828R and K909R mutants had less ubiquitylated NCC in the plasma membrane, and all mutants displayed reduced NCC ubiquitylation following low chloride stimulation. Thiazide-sensitive sodium-22 uptakes were elevated in the mutants and internalization from the plasma membrane was significantly less than WT-NCC. K909R had increased half-life, whereas chloroquine or MG132 treatment indicated that K706 and K909 play roles in lysosomal and proteasomal NCC degradation, respectively. In conclusion, site-specific ubiquitylation of NCC plays alternative roles for NCC function.

  12. Development of novel O-polysaccharide based glycoconjugates for immunization against glanders.

    PubMed

    Burtnick, Mary N; Heiss, Christian; Schuler, A Michele; Azadi, Parastoo; Brett, Paul J

    2012-01-01

    Burkholderia mallei the etiologic agent of glanders, causes severe disease in humans and animals and is a potential agent of biological warfare and terrorism. Diagnosis and treatment of glanders can be challenging, and in the absence of chemotherapeutic intervention, acute human disease is invariably fatal. At present, there are no human or veterinary vaccines available for immunization against disease. One of the goals of our research, therefore, is to identify and characterize protective antigens expressed by B. mallei and use them to develop efficacious glanders vaccine candidates. Previous studies have demonstrated that the O-polysaccharide (OPS) expressed by B. mallei is both a virulence factor and a protective antigen. Recently, we demonstrated that Burkholderia thailandensis, a closely related but non-pathogenic species, can be genetically manipulated to express OPS antigens that are recognized by B. mallei OPS-specific monoclonal antibodies (mAbs). As a result, these antigens have become important components of the various OPS-based subunit vaccines that we are currently developing in our laboratory. In this study, we describe a method for isolating B. mallei-like OPS antigens from B. thailandensis oacA mutants. Utilizing these purified OPS antigens, we also describe a simple procedure for coupling the polysaccharides to protein carriers such as cationized bovine serum albumin, diphtheria toxin mutant CRM197 and cholera toxin B subunit. Additionally, we demonstrate that high titer IgG responses against purified B. mallei LPS can be generated by immunizing mice with the resulting constructs. Collectively, these approaches provide a rational starting point for the development of novel OPS-based glycoconjugates for immunization against glanders.

  13. Development of novel O-polysaccharide based glycoconjugates for immunization against glanders

    PubMed Central

    Burtnick, Mary N.; Heiss, Christian; Schuler, A. Michele; Azadi, Parastoo; Brett, Paul J.

    2012-01-01

    Burkholderia mallei the etiologic agent of glanders, causes severe disease in humans and animals and is a potential agent of biological warfare and terrorism. Diagnosis and treatment of glanders can be challenging, and in the absence of chemotherapeutic intervention, acute human disease is invariably fatal. At present, there are no human or veterinary vaccines available for immunization against disease. One of the goals of our research, therefore, is to identify and characterize protective antigens expressed by B. mallei and use them to develop efficacious glanders vaccine candidates. Previous studies have demonstrated that the O-polysaccharide (OPS) expressed by B. mallei is both a virulence factor and a protective antigen. Recently, we demonstrated that Burkholderia thailandensis, a closely related but non-pathogenic species, can be genetically manipulated to express OPS antigens that are recognized by B. mallei OPS-specific monoclonal antibodies (mAbs). As a result, these antigens have become important components of the various OPS-based subunit vaccines that we are currently developing in our laboratory. In this study, we describe a method for isolating B. mallei-like OPS antigens from B. thailandensis oacA mutants. Utilizing these purified OPS antigens, we also describe a simple procedure for coupling the polysaccharides to protein carriers such as cationized bovine serum albumin, diphtheria toxin mutant CRM197 and cholera toxin B subunit. Additionally, we demonstrate that high titer IgG responses against purified B. mallei LPS can be generated by immunizing mice with the resulting constructs. Collectively, these approaches provide a rational starting point for the development of novel OPS-based glycoconjugates for immunization against glanders. PMID:23205347

  14. Prominent dominant negative effect of a mutant Fas molecule lacking death domain on cell-mediated induction of apoptosis.

    PubMed

    Yokota, Aya; Takeuchi, Emiko; Iizuka, Misao; Ikegami, Yuko; Takayama, Hajime; Shinohara, Nobukata

    2005-01-01

    Using a panel of transfectant B lymphoma cells expressing varying amounts of the mutant Fas together with the endogenous wild type Fas, semi-quantitative studies on the dominant negative effect of a murine mutant Fas molecule lacking death domain were carried out. In anti-Fas antibody-mediated induction of apoptosis, the mutant molecules exerted significant dominant-negative effect only when their expression level was comparable to or higher than that of wild type molecules, or when exposed to low amounts of the antibody. The inhibitory effect was accompanied by the failure in DISC formation in spite of Fas aggregation. When they were subjected to T cell-mediated Fas-based induction of apoptosis, however, the dominant negative effect was prominent such that the expression of even a small amount of the mutant molecules resulted in significant inhibition. Such a strong inhibitory effect explains the dominant phenotype of this type of mutant Fas molecules in ALPS heterozygous patients and also implies that the physiological effectors for Fas in vivo are cells, i.e., FasL-expressing activated T cells.

  15. Molecular characterization of human ABHD2 as TAG lipase and ester hydrolase

    PubMed Central

    M., Naresh Kumar; V.B.S.C., Thunuguntla; G.K., Veeramachaneni; B., Chandra Sekhar; Guntupalli, Swapna; J.S., Bondili

    2016-01-01

    Alterations in lipid metabolism have been progressively documented as a characteristic property of cancer cells. Though, human ABHD2 gene was found to be highly expressed in breast and lung cancers, its biochemical functionality is yet uncharacterized. In the present study we report, human ABHD2 as triacylglycerol (TAG) lipase along with ester hydrolysing capacity. Sequence analysis of ABHD2 revealed the presence of conserved motifs G205XS207XG209 and H120XXXXD125. Phylogenetic analysis showed homology to known lipases, Drosophila melanogaster CG3488. To evaluate the biochemical role, recombinant ABHD2 was expressed in Saccharomyces cerevisiae using pYES2/CT vector and His-tag purified protein showed TAG lipase activity. Ester hydrolase activity was confirmed with pNP acetate, butyrate and palmitate substrates respectively. Further, the ABHD2 homology model was built and the modelled protein was analysed based on the RMSD and root mean square fluctuation (RMSF) of the 100 ns simulation trajectory. Docking the acetate, butyrate and palmitate ligands with the model confirmed covalent binding of ligands with the Ser207 of the GXSXG motif. The model was validated with a mutant ABHD2 developed with alanine in place of Ser207 and the docking studies revealed loss of interaction between selected ligands and the mutant protein active site. Based on the above results, human ABHD2 was identified as a novel TAG lipase and ester hydrolase. PMID:27247428

  16. Molecular characterization of human ABHD2 as TAG lipase and ester hydrolase.

    PubMed

    M, Naresh Kumar; V B S C, Thunuguntla; G K, Veeramachaneni; B, Chandra Sekhar; Guntupalli, Swapna; J S, Bondili

    2016-08-01

    Alterations in lipid metabolism have been progressively documented as a characteristic property of cancer cells. Though, human ABHD2 gene was found to be highly expressed in breast and lung cancers, its biochemical functionality is yet uncharacterized. In the present study we report, human ABHD2 as triacylglycerol (TAG) lipase along with ester hydrolysing capacity. Sequence analysis of ABHD2 revealed the presence of conserved motifs G(205)XS(207)XG(209) and H(120)XXXXD(125) Phylogenetic analysis showed homology to known lipases, Drosophila melanogaster CG3488. To evaluate the biochemical role, recombinant ABHD2 was expressed in Saccharomyces cerevisiae using pYES2/CT vector and His-tag purified protein showed TAG lipase activity. Ester hydrolase activity was confirmed with pNP acetate, butyrate and palmitate substrates respectively. Further, the ABHD2 homology model was built and the modelled protein was analysed based on the RMSD and root mean square fluctuation (RMSF) of the 100 ns simulation trajectory. Docking the acetate, butyrate and palmitate ligands with the model confirmed covalent binding of ligands with the Ser(207) of the GXSXG motif. The model was validated with a mutant ABHD2 developed with alanine in place of Ser(207) and the docking studies revealed loss of interaction between selected ligands and the mutant protein active site. Based on the above results, human ABHD2 was identified as a novel TAG lipase and ester hydrolase. © 2016 The Author(s).

  17. Proteomic analyses reveal the key roles of BrlA and AbaA in biogenesis of gliotoxin in Aspergillus fumigatus

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Shin, Kwang-Soo, E-mail: shinks@dju.kr; Kim, Young Hwan; Graduate School of Analytical Science and Technology, Chungnam National University, Daejeon, 305-764

    2015-07-31

    The opportunistic human pathogenic fungus Aspergillus fumigatus primarily reproduces by forming a large number of asexual spores (conidia). Sequential activation of the central regulators BrlA, AbaA and WetA is necessary for the fungus to undergo asexual development. In this study, to address the presumed roles of these key developmental regulators during proliferation of the fungus, we analyzed and compared the proteomes of vegetative cells of wild type (WT) and individual mutant strains. Approximately 1300 protein spots were detectable from 2-D electrophoresis gels. Among these, 13 proteins exhibiting significantly altered accumulation levels were further identified by ESI-MS/MS. Markedly, we found thatmore » the GliM and GliT proteins associated with gliotoxin (GT) biosynthesis and self-protection of the fungus from GT were significantly down-regulated in the ΔabaA and ΔbrlA mutants. Moreover, mRNA levels of other GT biosynthetic genes including gliM, gliP, gliT, and gliZ were significantly reduced in both mutant strains, and no and low levels of GT were detectable in the ΔbrlA and ΔabaA mutant strains, respectively. As GliT is required for the protection of the fungus from GT, growth of the ΔbrlA mutant with reduced levels of GliT was severely impaired by exogenous GT. Our studies demonstrate that AbaA and BrlA positively regulate expression of the GT biosynthetic gene cluster in actively growing vegetative cells, and likely bridge morphological and chemical development during the life-cycle of A. fumigatus. - Highlights: • Proteome analyses of WT and mutants reveal 13 differentially expressed proteins. • The GliT and GliM proteins are significantly down-regulated by ΔabaA and ΔbrlA. • Expression of other gliotoxin biosynthetic genes is lowered by ΔabaA and ΔbrlA. • Growth of ΔbrlA strain lacking GliT is completely inhibited by exogenous gliotoxin. • BrlA and AbaA play key roles in biogenesis of gliotoxin in Aspergillus fumigatus.« less

  18. Expression in Bacillus subtilis of the Bacillus thuringiensis cryIIIA toxin gene is not dependent on a sporulation-specific sigma factor and is increased in a spo0A mutant.

    PubMed

    Agaisse, H; Lereclus, D

    1994-08-01

    Expression of the Bacillus thuringiensis cryIIIA gene encoding a Coleoptera-specific toxin is weak during vegetative growth and is activated at the onset of the stationary phase. cryIIIA'-'lacZ fusions and primer extension analysis show that the regulation of cryIIIA expression is similar in Bacillus subtilis and in B. thuringiensis. Activation of cryIIIA expression was not altered in B. subtilis mutant strains deficient for the sigma H and sigma E sporulation-specific sigma factors or for minor sigma factors such as sigma B, sigma D, or sigma L. This result and the nucleotide sequence of the -35 and -10 regions of the cryIIIA promoter suggest that cryIIIA expression might be directed by the E sigma A form of RNA polymerase. Expression of the cryIIIA'-'lacZ fusion is shut off after t2 (2 h after time zero) of sporulation in the B. subtilis wild-type strain grown on nutrient broth sporulation medium. However, no decrease in cryIIIA-directed beta-galactosidase activity occurred in sigma H, kinA, or spo0A mutant strains. Moreover, beta-galactosidase activity was higher and remained elevated after t2 in the spo0A mutant strain. beta-Galactosidase activity was weak in abrB and spo0A abrB mutant strains, suggesting that AbrB is responsible for the higher level of cryIIIA expression observed in a spo0A mutant. However, both in spo0A and spo0A abrB mutant strains, beta-galactosidase activity remained elevated after t2, suggesting that even in the absence of AbrB, cryIIIA expression is controlled through modulation of the phosphorylated form of Spo0A. When the cryIIIA gene is expressed in a B. subtilis spo0A mutant strain or in the 168 wild-type strain, large amounts of toxins are produced and accumulate to form a flat rectangular crystal characteristic of the coleopteran-specific B. thuringiensis strains.

  19. Truncation of the human immunodeficiency virus type 1 transmembrane glycoprotein cytoplasmic domain blocks virus infectivity.

    PubMed Central

    Dubay, J W; Roberts, S J; Hahn, B H; Hunter, E

    1992-01-01

    Human immunodeficiency virus type 1 contains a transmembrane glycoprotein with an unusually long cytoplasmic domain. To determine the role of this domain in virus replication, a series of single nucleotide changes that result in the insertion of premature termination codons throughout the cytoplasmic domain has been constructed. These mutations delete from 6 to 192 amino acids from the carboxy terminus of gp41 and do not affect the amino acid sequence of the regulatory proteins encoded by rev and tat. The effects of these mutations on glycoprotein biosynthesis and function as well as on virus infectivity have been examined in the context of a glycoprotein expression vector and the viral genome. All of the mutant glycoproteins were synthesized, processed, and transported to the cell surface in a manner similar to that of the wild-type glycoprotein. With the exception of mutants that remove the membrane anchor domain, all of the mutant glycoproteins retained the ability to cause fusion of CD4-bearing cells. However, deletion of more than 19 amino acids from the C terminus of gp41 blocked the ability of mutant virions to infect cells. This defect in virus infectivity appeared to be due at least in part to a failure of the virus to efficiently incorporate the truncated glycoprotein. Similar data were obtained for mutations in two different env genes and two different target cell lines. These results indicate that the cytoplasmic domain of gp41 plays a critical role during virus assembly and entry in the life cycle of human immunodeficiency virus type 1. Images PMID:1357190

  20. Apoptosis-inducing signal sequence mutation in carbonic anhydrase IV identified in patients with the RP17 form of retinitis pigmentosa

    PubMed Central

    Rebello, George; Ramesar, Rajkumar; Vorster, Alvera; Roberts, Lisa; Ehrenreich, Liezle; Oppon, Ekow; Gama, Dumisani; Bardien, Soraya; Greenberg, Jacquie; Bonapace, Giuseppe; Waheed, Abdul; Shah, Gul N.; Sly, William S.

    2004-01-01

    Genetic and physical mapping of the RP17 locus on 17q identified a 3.6-megabase candidate region that includes the gene encoding carbonic anhydrase IV (CA4), a glycosylphosphatidylinositol-anchored protein that is highly expressed in the choriocapillaris of the human eye. By sequencing candidate genes in this region, we identified a mutation that causes replacement of an arginine with a tryptophan (R14W) in the signal sequence of the CA4 gene at position -5 relative to the signal sequence cleavage site. This mutation was found to cosegregate with the disease phenotype in two large families and was not found in 36 unaffected family members or 100 controls. Expression of the mutant cDNA in COS-7 cells produced several findings, suggesting a mechanism by which the mutation can explain the autosomal dominant disease. In transfected COS-7 cells, the R14W mutation (i) reduced the steady-state level of carbonic anhydrase IV activity expressed by 28% due to a combination of decreased synthesis and accelerated turnover; (ii) led to up-regulation of immunoglobulin-binding protein, double-stranded RNA-regulated protein kinase-like ER kinase, and CCAAT/enhancer-binding protein homologous protein, markers of the unfolded protein response and endoplasmic reticulum stress; and (iii) induced apoptosis, as evidenced by annexin V binding and terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling staining, in most cells expressing the mutant, but not the WT, protein. We suggest that a high level of expression of the mutant allele in the endothelial cells of the choriocapillaris leads to apoptosis, leading in turn to ischemia in the overlying retina and producing autosomal dominant retinitis pigmentosa. PMID:15090652

  1. HoxB2 binds mutant SOD1 and is altered in transgenic model of ALS.

    PubMed

    Zhai, Jinbin; Lin, Hong; Canete-Soler, Rafaela; Schlaepfer, William W

    2005-09-15

    Mutations in Cu/Zn superoxide dismutase (SOD1) cause approximately 20% of familial amyotrophic lateral sclerosis by a toxic gain of function; however, the precise mechanisms remain unclear. Here, we report the identification of HoxB2, a homeodomain-containing transcription factor, as a G93A mutant SOD1 interactive protein in a yeast two-hybrid screen. We show that HoxB2 co-precipitates and co-localizes with mutant SOD1 in neuronal cell lines, as well as in brain and spinal cord of G93A mutant SOD1 transgenic mice. Mutagenesis further shows that this interaction is mediated by the central homeodomain of HoxB2. In motor neuron-like NSC-34 cells, overexpression of HoxB2 or its homeodomain decreases the insolubility of mutant SOD1 and inhibits G93A or G86R mutant SOD1-induced neuronal cell death. In human and mouse tissues, we show that expression of HoxB2 persists in adult spinal cord and is primarily localized in nuclei of motor neurons. In G93A transgenic mice, HoxB2 co-localizes with mutant SOD1 and is redistributed to perikarya and proximal neurites of motor neurons. In addition, there is progressive accumulation of HoxB2 and mutant SOD1 as punctate inclusions in the neuropil surrounding motor neurons. Taken together, our findings demonstrate that interaction of HoxB2 with mutant SOD1 occurs in motor neurons of G93A mutant SOD1 transgenic mice and suggest that this interaction may modulate the neurotoxicity of mutant SOD1.

  2. Oncogenic KRAS and BRAF Drive Metabolic Reprogramming in Colorectal Cancer *

    PubMed Central

    Hutton, Josiah E.; Wang, Xiaojing; Zimmerman, Lisa J.; Slebos, Robbert J. C.; Trenary, Irina A.; Young, Jamey D.; Li, Ming; Liebler, Daniel C.

    2016-01-01

    Metabolic reprogramming, in which altered utilization of glucose and glutamine supports rapid growth, is a hallmark of most cancers. Mutations in the oncogenes KRAS and BRAF drive metabolic reprogramming through enhanced glucose uptake, but the broader impact of these mutations on pathways of carbon metabolism is unknown. Global shotgun proteomic analysis of isogenic DLD-1 and RKO colon cancer cell lines expressing mutant and wild type KRAS or BRAF, respectively, failed to identify significant differences (at least 2-fold) in metabolic protein abundance. However, a multiplexed parallel reaction monitoring (PRM) strategy targeting 73 metabolic proteins identified significant protein abundance increases of 1.25–twofold in glycolysis, the nonoxidative pentose phosphate pathway, glutamine metabolism, and the phosphoserine biosynthetic pathway in cells with KRAS G13D mutations or BRAF V600E mutations. These alterations corresponded to mutant KRAS and BRAF-dependent increases in glucose uptake and lactate production. Metabolic reprogramming and glucose conversion to lactate in RKO cells were proportional to levels of BRAF V600E protein. In DLD-1 cells, these effects were independent of the ratio of KRAS G13D to KRAS wild type protein. A study of 8 KRAS wild type and 8 KRAS mutant human colon tumors confirmed the association of increased expression of glycolytic and glutamine metabolic proteins with KRAS mutant status. Metabolic reprogramming is driven largely by modest (<2-fold) alterations in protein expression, which are not readily detected by the global profiling methods most commonly employed in proteomic studies. The results indicate the superiority of more precise, multiplexed, pathway-targeted analyses to study functional proteome systems. Data are available through MassIVE Accession MSV000079486 at ftp://MSV000079486@massive.ucsd.edu. PMID:27340238

  3. Functional assessment of sodium chloride cotransporter NCC mutants in polarized mammalian epithelial cells.

    PubMed

    Rosenbaek, Lena L; Rizzo, Federica; MacAulay, Nanna; Staub, Olivier; Fenton, Robert A

    2017-08-01

    The thiazide-sensitive sodium chloride cotransporter NCC is important for maintaining serum sodium (Na + ) and, indirectly, serum potassium (K + ) levels. Functional studies on NCC have used cell lines with native NCC expression, transiently transfected nonpolarized cell lines, or Xenopus laevis oocytes. Here, we developed the use of polarized Madin-Darby canine kidney type I (MDCKI) mammalian epithelial cell lines with tetracycline-inducible human NCC expression to study NCC activity and membrane abundance in the same system. In radiotracer assays, induced cells grown on filters had robust thiazide-sensitive and chloride dependent sodium-22 ( 22 Na) uptake from the apical side. To minimize cost and maximize throughput, assays were modified to use cells grown on plastic. On plastic, cells had similar thiazide-sensitive 22 Na uptakes that increased following preincubation of cells in chloride-free solutions. NCC was detected in the plasma membrane, and both membrane abundance and phosphorylation of NCC were increased by incubation in chloride-free solutions. Furthermore, in cells exposed for 15 min to low or high extracellular K + , the levels of phosphorylated NCC increased and decreased, respectively. To demonstrate that the system allows rapid and systematic assessment of mutated NCC, three phosphorylation sites in NCC were mutated, and NCC activity was examined. 22 Na fluxes in phosphorylation-deficient mutants were reduced to baseline levels, whereas phosphorylation-mimicking mutants were constitutively active, even without chloride-free stimulation. In conclusion, this system allows the activity, cellular localization, and abundance of wild-type or mutant NCC to be examined in the same polarized mammalian expression system in a rapid, easy, and low-cost fashion. Copyright © 2017 the American Physiological Society.

  4. C2cd3 is required for cilia formation and Hedgehog signaling in mouse

    PubMed Central

    Hoover, Amber N.; Wynkoop, Aaron; Zeng, Huiqing; Jia, Jinping; Niswander, Lee A.; Liu, Aimin

    2011-01-01

    Cilia are essential for mammalian embryonic development as well as for the physiological activity of various adult organ systems. Despite the multiple crucial roles that cilia play, the mechanisms underlying ciliogenesis in mammals remain poorly understood. Taking a forward genetic approach, we have identified Hearty (Hty), a recessive lethal mouse mutant with multiple defects, including neural tube defects, abnormal dorsal-ventral patterning of the spinal cord, a defect in left-right axis determination and severe polydactyly (extra digits). By genetic mapping, sequence analysis of candidate genes and characterization of a second mutant allele, we identify Hty as C2cd3, a novel gene encoding a vertebrate-specific C2 domain-containing protein. Target gene expression and double-mutant analyses suggest that C2cd3 is an essential regulator of intracellular transduction of the Hedgehog signal. Furthering a link between Hedgehog signaling and cilia function, we find that cilia formation and proteolytic processing of Gli3 are disrupted in C2cd3 mutants. Finally, we observe C2cd3 protein at the basal body, consistent with its essential function in ciliogenesis. Interestingly, the human ortholog for this gene lies in proximity to the critical regions of Meckel-Gruber syndrome 2 (MKS2) and Joubert syndrome 2 (JBTS2), making it a potential candidate for these two human genetic disorders. PMID:19004860

  5. Headbobber: A Combined Morphogenetic and Cochleosaccular Mouse Model to Study 10qter Deletions in Human Deafness

    PubMed Central

    Buniello, Annalisa; Hardisty-Hughes, Rachel E.; Pass, Johanna C.; Bober, Eva; Smith, Richard J.; Steel, Karen P.

    2013-01-01

    The recessive mouse mutant headbobber (hb) displays the characteristic behavioural traits associated with vestibular defects including headbobbing, circling and deafness. This mutation was caused by the insertion of a transgene into distal chromosome 7 affecting expression of native genes. We show that the inner ear of hb/hb mutants lacks semicircular canals and cristae, and the saccule and utricle are fused together in a single utriculosaccular sac. Moreover, we detect severe abnormalities of the cochlear sensory hair cells, the stria vascularis looks severely disorganised, Reissner's membrane is collapsed and no endocochlear potential is detected. Myo7a and Kcnj10 expression analysis show a lack of the melanocyte-like intermediate cells in hb/hb stria vascularis, which can explain the absence of endocochlear potential. We use Trp2 as a marker of melanoblasts migrating from the neural crest at E12.5 and show that they do not interdigitate into the developing strial epithelium, associated with abnormal persistence of the basal lamina in the hb/hb cochlea. We perform array CGH, deep sequencing as well as an extensive expression analysis of candidate genes in the headbobber region of hb/hb and littermate controls, and conclude that the headbobber phenotype is caused by: 1) effect of a 648 kb deletion on distal Chr7, resulting in the loss of three protein coding genes (Gpr26, Cpmx2 and Chst15) with expression in the inner ear but unknown function; and 2) indirect, long range effect of the deletion on the expression of neighboring genes on Chr7, associated with downregulation of Hmx3, Hmx2 and Nkx1.2 homeobox transcription factors. Interestingly, deletions of the orthologous region in humans, affecting the same genes, have been reported in nineteen patients with common features including sensorineural hearing loss and vestibular problems. Therefore, we propose that headbobber is a useful model to gain insight into the mechanisms underlying deafness in human 10qter deletion syndrome. PMID:23457544

  6. The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females

    PubMed Central

    Sakai, Takaomi; Kasuya, Junko; Kitamoto, Toshihiro; Aigaki, Toshiro

    2009-01-01

    Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. Here we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNAi in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. On the other hand, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity. PMID:19531155

  7. The Drosophila TRPA channel, Painless, regulates sexual receptivity in virgin females.

    PubMed

    Sakai, T; Kasuya, J; Kitamoto, T; Aigaki, T

    2009-07-01

    Transient receptor potential (TRP) channels play crucial roles in sensory perception. Expression of the Drosophila painless (pain) gene, a homolog of the mammalian TRPA1/ANKTM1 gene, in the peripheral nervous system is required for avoidance behavior of noxious heat or wasabi. In this study, we report a novel role of the Pain TRP channel expressed in the nervous system in the sexual receptivity in Drosophila virgin females. Compared with wild-type females, pain mutant females copulated with wild-type males significantly earlier. Wild-type males showed comparable courtship latency and courtship index toward wild-type and pain mutant females. Therefore, the early copulation observed in wild-type male and pain mutant female pairs is the result of enhanced sexual receptivity in pain mutant females. Involvement of pain in enhanced female sexual receptivity was confirmed by rescue experiments in which expression of a pain transgene in a pain mutant background restored the female sexual receptivity to the wild-type level. Targeted expression of pain RNA interference (RNAi) in putative cholinergic or GABAergic neurons phenocopied the mutant phenotype of pain females. However, target expression of pain RNAi in dopaminergic neurons did not affect female sexual receptivity. In addition, conditional suppression of neurotransmission in putative GABAergic neurons resulted in a similar enhanced sexual receptivity. Our results suggest that Pain TRP channels expressed in cholinergic and/or GABAergic neurons are involved in female sexual receptivity.

  8. Human Norovirus and Its Surrogates Induce Plant Immune Response in Arabidopsis thaliana and Lactuca sativa.

    PubMed

    Markland, Sarah M; Bais, Harsh; Kniel, Kalmia E

    2017-08-01

    Human norovirus is the leading cause of foodborne illness worldwide with the majority of outbreaks linked to fresh produce and leafy greens. It is essential that we thoroughly understand the type of relationship and interactions that take place between plants and human norovirus to better utilize control strategies to reduce transmission of norovirus in the field onto plants harvested for human consumption. In this study the expression of gene markers for the salicylic acid (SA) and jasmonic acid (JA) plant defense pathways was measured and compared in romaine lettuce (Lactuca sativa) and Arabidopsis thaliana Col-0 plants that were inoculated with Murine Norovirus-1, Tulane Virus, human norovirus GII.4, or Hank's Balanced Salt Solution (control). Genes involving both the SA and JA pathways were expressed in both romaine lettuce and A. thaliana for all three viruses, as well as controls. Studies, including gene expression of SA- and JA-deficient A. thaliana mutant lines, suggest that the JA pathway is more likely involved in the plant immune response to human norovirus. This research provides the first pieces of information regarding how foodborne viruses interact with plants in the preharvest environment.

  9. Identification of Novel Glycosyltransferases Required for Assembly of the Pasteurella multocida A:1 Lipopolysaccharide and Their Involvement in Virulence▿ †

    PubMed Central

    Boyce, John D.; Harper, Marina; St. Michael, Frank; John, Marietta; Aubry, Annie; Parnas, Henrietta; Logan, Susan M.; Wilkie, Ian W.; Ford, Mark; Cox, Andrew D.; Adler, Ben

    2009-01-01

    We previously determined the structure of the Pasteurella multocida Heddleston type 1 lipopolysaccharide (LPS) molecule and characterized some of the transferases essential for LPS biosynthesis. We also showed that P. multocida strains expressing truncated LPS display reduced virulence. Here, we have identified all of the remaining glycosyltransferases required for synthesis of the oligosaccharide extension of the P. multocida Heddleston type 1 LPS, including a novel α-1,6 glucosyltransferase, a β-1,4 glucosyltransferase, a putative bifunctional galactosyltransferase, and two heptosyltransferases. In addition, we identified a novel oligosaccharide extension expressed only in a heptosyltransferase (hptE) mutant background. All of the analyzed mutants expressing LPS with a truncated main oligosaccharide extension displayed reduced virulence, but those expressing LPS with an intact heptose side chain were able to persist for long periods in muscle tissue. The hptC mutant, which expressed LPS with the shortest oligosaccharide extension and no heptose side chain, was unable to persist on the muscle or cause any disease. Furthermore, all of the mutants displayed increased sensitivity to the chicken antimicrobial peptide fowlicidin 1, with mutants expressing highly truncated LPS being the most sensitive. PMID:19168738

  10. Determining the Advantages, Costs, and Trade-Offs of a Novel Sodium Channel Mutation in the Copepod Acartia hudsonica to Paralytic Shellfish Toxins (PST)

    PubMed Central

    Finiguerra, Michael; Avery, David E.; Dam, Hans G.

    2015-01-01

    The marine copepod Acartia hudsonica was shown to be adapted to dinoflagellate prey, Alexandrium fundyense, which produce paralytic shellfish toxins (PST). Adaptation to PSTs in other organisms is caused by a mutation in the sodium channel. Recently, a mutation in the sodium channel in A. hudsonica was found. In this study, we rigorously tested for advantages, costs, and trade-offs associated with the mutant isoform of A. hudsonica under toxic and non-toxic conditions. We combined fitness with wild-type: mutant isoform ratio measurements on the same individual copepod to test our hypotheses. All A. hudsonica copepods express both the wild-type and mutant sodium channel isoforms, but in different proportions; some individuals express predominantly mutant (PMI) or wild-type isoforms (PWI), while most individuals express relatively equal amounts of each (EI). There was no consistent pattern of improved performance as a function of toxin dose for egg production rate (EPR), ingestion rate (I), and gross growth efficiency (GGE) for individuals in the PMI group relative to individuals in the PWI expression group. Neither was there any evidence to indicate a fitness benefit to the mutant isoform at intermediate toxin doses. No clear advantage under toxic conditions was associated with the mutation. Using a mixed-diet approach, there was also no observed relationship between individual wild-type: mutant isoform ratios and among expression groups, on both toxic and non-toxic diets, for eggs produced over three days. Lastly, expression of the mutant isoform did not mitigate the negative effects of the toxin. That is, the reductions in EPR from a toxic to non-toxic diet for copepods were independent of expression groups. Overall, the results did not support our hypotheses; the mutant sodium channel isoform does not appear to be related to adaptation to PST in A. hudsonica. Other potential mechanisms responsible for the adaptation are discussed. PMID:26075900

  11. Genetic requirements for high constitutive SOS expression in recA730 mutants of Escherichia coli.

    PubMed

    Vlašić, Ignacija; Šimatović, Ana; Brčić-Kostić, Krunoslav

    2011-09-01

    The RecA protein in its functional state is in complex with single-stranded DNA, i.e., in the form of a RecA filament. In SOS induction, the RecA filament functions as a coprotease, enabling the autodigestion of the LexA repressor. The RecA filament can be formed by different mechanisms, but all of them require three enzymatic activities essential for the processing of DNA double-stranded ends. These are helicase, 5'-3' exonuclease, and RecA loading onto single-stranded DNA (ssDNA). In some mutants, the SOS response can be expressed constitutively during the process of normal DNA metabolism. The RecA730 mutant protein is able to form the RecA filament without the help of RecBCD and RecFOR mediators since it better competes with the single-strand binding (SSB) protein for ssDNA. As a consequence, the recA730 mutants show high constitutive SOS expression. In the study described in this paper, we studied the genetic requirements for constitutive SOS expression in recA730 mutants. Using a β-galactosidase assay, we showed that the constitutive SOS response in recA730 mutants exhibits different requirements in different backgrounds. In a wild-type background, the constitutive SOS response is partially dependent on RecBCD function. In a recB1080 background (the recB1080 mutation retains only helicase), constitutive SOS expression is partially dependent on RecBCD helicase function and is strongly dependent on RecJ nuclease. Finally, in a recB-null background, the constitutive SOS expression of the recA730 mutant is dependent on the RecJ nuclease. Our results emphasize the importance of the 5'-3' exonuclease for high constitutive SOS expression in recA730 mutants and show that RecBCD function can further enhance the excellent intrinsic abilities of the RecA730 protein in vivo. Copyright © 2011, American Society for Microbiology. All Rights Reserved.

  12. Induction of expression and co-localization of heat shock polypeptides with the polyalanine expansion mutant of poly(A)-binding protein N1 after chemical stress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wang Qishan; Bag, Jnanankur

    Formation of nuclear inclusions consisting of aggregates of a polyalanine expansion mutant of nuclear poly(A)-binding protein (PABPN1) is the hallmark of oculopharyngeal muscular dystrophy (OPMD). OPMD is a late onset autosomal dominant disease. Patients with this disorder exhibit progressive swallowing difficulty and drooping of their eye lids, which starts around the age of 50. Previously we have shown that treatment of cells expressing the mutant PABPN1 with a number of chemicals such as ibuprofen, indomethacin, ZnSO{sub 4}, and 8-hydroxy-quinoline induces HSP70 expression and reduces PABPN1 aggregation. In these studies we have shown that expression of additional HSPs including HSP27, HSP40,more » and HSP105 were induced in mutant PABPN1 expressing cells following exposure to the chemicals mentioned above. Furthermore, all three additional HSPs were translocated to the nucleus and probably helped to properly fold the mutant PABPN1 by co-localizing with this protein.« less

  13. The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib

    PubMed Central

    Booth, Laurence; Roberts, Jane L.; Poklepovic, Andrew; Kirkwood, John; Avogadri-Connors, Francesca; Cutler Jr, Richard E.; Lalani, Alshad S.; Dent, Paul

    2018-01-01

    ABSTRACT The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins. PMID:29219657

  14. The levels of mutant K-RAS and mutant N-RAS are rapidly reduced in a Beclin1 / ATG5 -dependent fashion by the irreversible ERBB1/2/4 inhibitor neratinib.

    PubMed

    Booth, Laurence; Roberts, Jane L; Poklepovic, Andrew; Kirkwood, John; Sander, Cindy; Avogadri-Connors, Francesca; Cutler, Richard E; Lalani, Alshad S; Dent, Paul

    2018-02-01

    The FDA approved irreversible inhibitor of ERBB1/2/4, neratinib, was recently shown to rapidly down-regulate the expression of ERBB1/2/4 as well as the levels of c-MET and mutant K-RAS via autophagic degradation. In the present studies, in a dose-dependent fashion, neratinib reduced the expression levels of mutant K-RAS or of mutant N-RAS, which was augmented in an additive to greater than additive fashion by the HDAC inhibitors sodium valproate and AR42. Neratinib could reduce PDGFRα levels in GBM cells, that was enhanced by sodium valproate. Knock down of Beclin1 or of ATG5 prevented neratinib and neratinib combined with sodium valproate / AR42 from reducing the expression of mutant N-RAS in established PDX and fresh PDX models of ovarian cancer and melanoma, respectively. Neratinib and the drug combinations caused the co-localization of mutant RAS proteins and ERBB2 with Beclin1 and cathepsin B. The drug combination activated the AMP-dependent protein kinase that was causal in enhancing HMG Co A reductase phosphorylation. Collectively, our data reinforce the concept that the irreversible ERBB1/2/4 inhibitor neratinib has the potential for use in the treatment of tumors expressing mutant RAS proteins.

  15. Pseudomonas aeruginosa evasion of phagocytosis is mediated by loss of swimming motility and is independent of flagellum expression.

    PubMed

    Amiel, Eyal; Lovewell, Rustin R; O'Toole, George A; Hogan, Deborah A; Berwin, Brent

    2010-07-01

    Pseudomonas aeruginosa is a pathogenic Gram-negative bacterium that causes severe opportunistic infections in immunocompromised individuals; in particular, severity of infection with P. aeruginosa positively correlates with poor prognosis in cystic fibrosis (CF) patients. Establishment of chronic infection by this pathogen is associated with downregulation of flagellar expression and of other genes that regulate P. aeruginosa motility. The current paradigm is that loss of flagellar expression enables immune evasion by the bacteria due to loss of engagement by phagocytic receptors that recognize flagellar components and loss of immune activation through flagellin-mediated Toll-like receptor (TLR) signaling. In this work, we employ bacterial and mammalian genetic approaches to demonstrate that loss of motility, not the loss of the flagellum per se, is the critical factor in the development of resistance to phagocytosis by P. aeruginosa. We demonstrate that isogenic P. aeruginosa mutants deficient in flagellar function, but retaining an intact flagellum, are highly resistant to phagocytosis by both murine and human phagocytic cells at levels comparable to those of flagellum-deficient mutants. Furthermore, we show that loss of MyD88 signaling in murine phagocytes does not recapitulate the phagocytic deficit observed for either flagellum-deficient or motility-deficient P. aeruginosa mutants. Our data demonstrate that loss of bacterial motility confers a dramatic resistance to phagocytosis that is independent of both flagellar expression and TLR signaling. These findings provide an explanation for the well-documented observation of nonmotility in clinical P. aeruginosa isolates and for how this phenotype confers upon the bacteria an advantage in the context of immune evasion.

  16. Dam methylation is required for efficient biofilm production in Salmonella enterica serovar Enteritidis.

    PubMed

    Aya Castañeda, María del Rosario; Sarnacki, Sebastián Hernán; Noto Llana, Mariángeles; López Guerra, Adriana Gabriela; Giacomodonato, Mónica Nancy; Cerquetti, María Cristina

    2015-01-16

    The ecological success of Salmonella enterica to survive in different environments is due, in part, to the ability to form biofilms, something which is especially important for food industry. The aim of the current study was to evaluate the involvement of Dam methylation in biofilm production in S. Enteritidis strains. The ability to generate biofilms was analyzed in wild type and dam mutant strains. In S. Enteritidis, the absence of Dam affected the capacity to develop pellicles at the air-liquid interface and reduced the ability to form biofilm on polystyrene surfaces. Curli and cellulose production, determined by Congo red and calcofluor assays, were affected in dam mutant strains. Relative quantitative real-time PCR experiments showed that the expression of csgD and csgA genes is reduced in mutants lacking dam gene with respect to the wild type strains, whereas transcript levels of bcsA are not affected in the absence of Dam. To our knowledge, this is the first report on the participation of Dam methylation on biofilm production in Enteritidis or any other serovar of S. enterica. Results presented here suggest that changes in gene expression required for biofilm production are finely regulated by Dam methylation. Thus, Dam methylation could modulate csgD expression and upregulate the expression of factors related with biofilm production, including curli and cellulose. This study contributes to the understanding of biofilm regulation in Salmonella spp. and to the design of new strategies to prevent food contamination and humans and animals infections. Copyright © 2014. Published by Elsevier B.V.

  17. Functional Heterologous Protein Expression by Genetically Engineered Probiotic Yeast Saccharomyces boulardii

    PubMed Central

    Hudson, Lauren E.; Fasken, Milo B.; McDermott, Courtney D.; McBride, Shonna M.; Kuiper, Emily G.; Guiliano, David B.; Corbett, Anita H.; Lamb, Tracey J.

    2014-01-01

    Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders. PMID:25391025

  18. Functional heterologous protein expression by genetically engineered probiotic yeast Saccharomyces boulardii.

    PubMed

    Hudson, Lauren E; Fasken, Milo B; McDermott, Courtney D; McBride, Shonna M; Kuiper, Emily G; Guiliano, David B; Corbett, Anita H; Lamb, Tracey J

    2014-01-01

    Recent studies have suggested the potential of probiotic organisms to be adapted for the synthesis and delivery of oral therapeutics. The probiotic yeast Saccharomyces boulardii would be especially well suited for this purpose due to its ability, in contrast to probiotic prokaryotes, to perform eukaryotic post translational modifications. This probiotic yeast thus has the potential to express a broad array of therapeutic proteins. Currently, however, use of wild type (WT) S. boulardii relies on antibiotic resistance for the selection of transformed yeast. Here we report the creation of auxotrophic mutant strains of S. boulardii that can be selected without antibiotics and demonstrate that these yeast can express functional recombinant protein even when recovered from gastrointestinal immune tissues in mice. A UV mutagenesis approach was employed to generate three uracil auxotrophic S. boulardii mutants that show a low rate of reversion to wild type growth. These mutants can express recombinant protein and are resistant in vitro to low pH, bile acid salts, and anaerobic conditions. Critically, oral gavage experiments using C57BL/6 mice demonstrate that mutant S. boulardii survive and are taken up into gastrointestinal immune tissues on a similar level as WT S. boulardii. Mutant yeast recovered from gastrointestinal immune tissues furthermore retain expression of functional recombinant protein. These data show that auxotrophic mutant S. boulardii can safely express recombinant protein without antibiotic selection and can deliver recombinant protein to gastrointestinal immune tissues. These auxotrophic mutants of S. boulardii pave the way for future experiments to test the ability of S. boulardii to deliver therapeutics and mediate protection against gastrointestinal disorders.

  19. Multiple developmental programs are altered by loss of Zic1 and Zic4 to cause Dandy-Walker malformation cerebellar pathogenesis

    PubMed Central

    Blank, Marissa C.; Grinberg, Inessa; Aryee, Emmanuel; Laliberte, Christine; Chizhikov, Victor V.; Henkelman, R. Mark; Millen, Kathleen J.

    2011-01-01

    Heterozygous deletions encompassing the ZIC1;ZIC4 locus have been identified in a subset of individuals with the common cerebellar birth defect Dandy-Walker malformation (DWM). Deletion of Zic1 and Zic4 in mice produces both cerebellar size and foliation defects similar to human DWM, confirming a requirement for these genes in cerebellar development and providing a model to delineate the developmental basis of this clinically important congenital malformation. Here, we show that reduced cerebellar size in Zic1 and Zic4 mutants results from decreased postnatal granule cell progenitor proliferation. Through genetic and molecular analyses, we show that Zic1 and Zic4 have Shh-dependent function promoting proliferation of granule cell progenitors. Expression of the Shh-downstream genes Ptch1, Gli1 and Mycn was downregulated in Zic1/4 mutants, although Shh production and Purkinje cell gene expression were normal. Reduction of Shh dose on the Zic1+/−;Zic4+/− background also resulted in cerebellar size reductions and gene expression changes comparable with those observed in Zic1−/−;Zic4−/− mice. Zic1 and Zic4 are additionally required to pattern anterior vermis foliation. Zic mutant folial patterning abnormalities correlated with disrupted cerebellar anlage gene expression and Purkinje cell topography during late embryonic stages; however, this phenotype was Shh independent. In Zic1+/−;Zic4+/−;Shh+/−, we observed normal cerebellar anlage patterning and foliation. Furthermore, cerebellar patterning was normal in both Gli2-cko and Smo-cko mutant mice, where all Shh function was removed from the developing cerebellum. Thus, our data demonstrate that Zic1 and Zic4 have both Shh-dependent and -independent roles during cerebellar development and that multiple developmental disruptions underlie Zic1/4-related DWM. PMID:21307096

  20. Cysteine Scanning Mutagenesis of Transmembrane Domain 10 in Organic Anion Transporting Polypeptide 1B1

    PubMed Central

    2015-01-01

    Organic anion transporting polypeptide (OATP) 1B1 is an important drug transporter expressed in human hepatocytes. Previous studies have indicated that transmembrane (TM) domain 2, 6, 8, 9, and in particular 10 might be part of the substrate binding site/translocation pathway. To explore which amino acids in TM10 are important for substrate transport, we mutated 34 amino acids individually to cysteines, expressed them in HEK293 cells, and determined their surface expression. Transport activity of the two model substrates estrone-3-sulfate and estradiol-17β-glucuronide as well as of the drug substrate valsartan for selected mutants was measured. Except for F534C and F537C, all mutants were expressed at the plasma membrane of HEK293 cells. Mutants Q541C and A549C did not transport estradiol-17β-glucuronide and showed negligible estrone-3-sulfate transport. However, A549C showed normal valsartan transport. Pretreatment with the anionic and cell impermeable sodium (2-sulfonatoethyl)methanethiosulfonate (MTSES) affected the transport of each substrate differently. Pretreatment of L545C abolished estrone-3-sulfate uptake almost completely, while it stimulated estradiol-17β-glucuronide uptake. Further analyses revealed that mutant L545C in the absence of MTSES showed biphasic kinetics for estrone-3-sulfate that was converted to monophasic kinetics with a decreased apparent affinity, explaining the previously seen inhibition. In contrast, the apparent affinity for estradiol-17β-glucuronide was not changed by MTSES treatment, but the Vmax value was increased about 4-fold, explaining the previously seen stimulation. Maleimide labeling of L545C was affected by preincubation with estrone-3-sulfate but not with estradiol-17β-glucuronide. These results strongly suggest that L545C is part of the estrone-3-sulfate binding site/translocation pathway but is not directly involved in binding/translocation of estradiol-17β-glucuronide. PMID:24673529

Top