Sample records for expression analysis suggests

  1. Tightly Regulated Expression of Autographa californica Multicapsid Nucleopolyhedrovirus Immediate Early Genes Emerges from Their Interactions and Possible Collective Behaviors

    PubMed Central

    Taka, Hitomi; Asano, Shin-ichiro; Matsuura, Yoshiharu; Bando, Hisanori

    2015-01-01

    To infect their hosts, DNA viruses must successfully initiate the expression of viral genes that control subsequent viral gene expression and manipulate the host environment. Viral genes that are immediately expressed upon infection play critical roles in the early infection process. In this study, we investigated the expression and regulation of five canonical regulatory immediate-early (IE) genes of Autographa californica multicapsid nucleopolyhedrovirus: ie0, ie1, ie2, me53, and pe38. A systematic transient gene-expression analysis revealed that these IE genes are generally transactivators, suggesting the existence of a highly interactive regulatory network. A genetic analysis using gene knockout viruses demonstrated that the expression of these IE genes was tolerant to the single deletions of activator IE genes in the early stage of infection. A network graph analysis on the regulatory relationships observed in the transient expression analysis suggested that the robustness of IE gene expression is due to the organization of the IE gene regulatory network and how each IE gene is activated. However, some regulatory relationships detected by the genetic analysis were contradictory to those observed in the transient expression analysis, especially for IE0-mediated regulation. Statistical modeling, combined with genetic analysis using knockout alleles for ie0 and ie1, showed that the repressor function of ie0 was due to the interaction between ie0 and ie1, not ie0 itself. Taken together, these systematic approaches provided insight into the topology and nature of the IE gene regulatory network. PMID:25816136

  2. Transcription Analysis of the Myometrium of Labouring and Non-Labouring Women

    PubMed Central

    Hutchinson, James L.; Hibbert, Nanette; Freeman, Tom C.; Saunders, Philippa T. K.; Norman, Jane E.

    2016-01-01

    An incomplete understanding of the molecular mechanisms that initiate normal human labour at term seriously hampers the development of effective ways to predict, prevent and treat disorders such as preterm labour. Appropriate analysis of large microarray experiments that compare gene expression in non-labouring and labouring gestational tissues is necessary to help bridge these gaps in our knowledge. In this work, gene expression in 48 (22 labouring, 26 non-labouring) lower-segment myometrial samples collected at Caesarean section were analysed using Illumina HT-12 v4.0 BeadChips. Normalised data were compared between labouring and non-labouring groups using traditional statistical methods and a novel network graph approach. We sought technical validation with quantitative real-time PCR, and biological replication through inverse variance-weighted meta-analysis with published microarray data. We have extended the list of genes suggested to be associated with labour: Compared to non-labouring samples, labouring samples showed apparent higher expression at 960 probes (949 genes) and apparent lower expression at 801 probes (789 genes) (absolute fold change ≥1.2, rank product percentage of false positive value (RP-PFP) <0.05). Although half of the women in the labouring group had received pharmaceutical treatment to induce or augment labour, sensitivity analysis suggested that this did not confound our results. In agreement with previous studies, functional analysis suggested that labour was characterised by an increase in the expression of inflammatory genes and network analysis suggested a strong neutrophil signature. Our analysis also suggested that labour is characterised by a decrease in the expression of muscle-specific processes, which has not been explicitly discussed previously. We validated these findings through the first formal meta-analysis of raw data from previous experiments and we hypothesise that this represents a change in the composition of myometrial tissue at labour. Further work will be necessary to reveal whether these results are solely due to leukocyte infiltration into the myometrium as a mechanism initiating labour, or in addition whether they also represent gene changes in the myocytes themselves. We have made all our data available at www.ebi.ac.uk/arrayexpress/ (accession number E-MTAB-3136) to facilitate progression of this work. PMID:27176052

  3. AhR-mediated gene expression in the developing mouse telencephalon.

    PubMed

    Gohlke, Julia M; Stockton, Pat S; Sieber, Stella; Foley, Julie; Portier, Christopher J

    2009-11-01

    We hypothesize that TCDD-induced developmental neurotoxicity is modulated through an AhR-dependent interaction with key regulatory neuronal differentiation pathways during telencephalon development. To test this hypothesis we examined global gene expression in both dorsal and ventral telencephalon tissues in E13.5 AhR-/- and wildtype mice exposed to TCDD or vehicle. Consistent with previous biochemical, pathological and behavioral studies, our results suggest TCDD initiated changes in gene expression in the developing telencephalon are primarily AhR-dependent, as no statistically significant gene expression changes are evident after TCDD exposure in AhR-/- mice. Based on a gene regulatory network for neuronal specification in the developing telencephalon, the present analysis suggests differentiation of GABAergic neurons in the ventral telencephalon is compromised in TCDD exposed and AhR-/- mice. In addition, our analysis suggests Sox11 may be directly regulated by AhR based on gene expression and comparative genomics analyses. In conclusion, this analysis supports the hypothesis that AhR has a specific role in the normal development of the telencephalon and provides a mechanistic framework for neurodevelopmental toxicity of chemicals that perturb AhR signaling.

  4. Similarity of markers identified from cancer gene expression studies: observations from GEO.

    PubMed

    Shi, Xingjie; Shen, Shihao; Liu, Jin; Huang, Jian; Zhou, Yong; Ma, Shuangge

    2014-09-01

    Gene expression profiling has been extensively conducted in cancer research. The analysis of multiple independent cancer gene expression datasets may provide additional information and complement single-dataset analysis. In this study, we conduct multi-dataset analysis and are interested in evaluating the similarity of cancer-associated genes identified from different datasets. The first objective of this study is to briefly review some statistical methods that can be used for such evaluation. Both marginal analysis and joint analysis methods are reviewed. The second objective is to apply those methods to 26 Gene Expression Omnibus (GEO) datasets on five types of cancers. Our analysis suggests that for the same cancer, the marker identification results may vary significantly across datasets, and different datasets share few common genes. In addition, datasets on different cancers share few common genes. The shared genetic basis of datasets on the same or different cancers, which has been suggested in the literature, is not observed in the analysis of GEO data. © The Author 2013. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  5. Archetypal analysis of diverse Pseudomonas aeruginosa transcriptomes reveals adaptation in cystic fibrosis airways

    PubMed Central

    2013-01-01

    Background Analysis of global gene expression by DNA microarrays is widely used in experimental molecular biology. However, the complexity of such high-dimensional data sets makes it difficult to fully understand the underlying biological features present in the data. The aim of this study is to introduce a method for DNA microarray analysis that provides an intuitive interpretation of data through dimension reduction and pattern recognition. We present the first “Archetypal Analysis” of global gene expression. The analysis is based on microarray data from five integrated studies of Pseudomonas aeruginosa isolated from the airways of cystic fibrosis patients. Results Our analysis clustered samples into distinct groups with comprehensible characteristics since the archetypes representing the individual groups are closely related to samples present in the data set. Significant changes in gene expression between different groups identified adaptive changes of the bacteria residing in the cystic fibrosis lung. The analysis suggests a similar gene expression pattern between isolates with a high mutation rate (hypermutators) despite accumulation of different mutations for these isolates. This suggests positive selection in the cystic fibrosis lung environment, and changes in gene expression for these isolates are therefore most likely related to adaptation of the bacteria. Conclusions Archetypal analysis succeeded in identifying adaptive changes of P. aeruginosa. The combination of clustering and matrix factorization made it possible to reveal minor similarities among different groups of data, which other analytical methods failed to identify. We suggest that this analysis could be used to supplement current methods used to analyze DNA microarray data. PMID:24059747

  6. Wait, are you sad or angry? Large exposure time differences required for the categorization of facial expressions of emotion

    PubMed Central

    Du, Shichuan; Martinez, Aleix M.

    2013-01-01

    Abstract Facial expressions of emotion are essential components of human behavior, yet little is known about the hierarchical organization of their cognitive analysis. We study the minimum exposure time needed to successfully classify the six classical facial expressions of emotion (joy, surprise, sadness, anger, disgust, fear) plus neutral as seen at different image resolutions (240 × 160 to 15 × 10 pixels). Our results suggest a consistent hierarchical analysis of these facial expressions regardless of the resolution of the stimuli. Happiness and surprise can be recognized after very short exposure times (10–20 ms), even at low resolutions. Fear and anger are recognized the slowest (100–250 ms), even in high-resolution images, suggesting a later computation. Sadness and disgust are recognized in between (70–200 ms). The minimum exposure time required for successful classification of each facial expression correlates with the ability of a human subject to identify it correctly at low resolutions. These results suggest a fast, early computation of expressions represented mostly by low spatial frequencies or global configural cues and a later, slower process for those categories requiring a more fine-grained analysis of the image. We also demonstrate that those expressions that are mostly visible in higher-resolution images are not recognized as accurately. We summarize implications for current computational models. PMID:23509409

  7. Reconstruction of the genome-scale co-expression network for the Hippo signaling pathway in colorectal cancer.

    PubMed

    Dehghanian, Fariba; Hojati, Zohreh; Hosseinkhan, Nazanin; Mousavian, Zaynab; Masoudi-Nejad, Ali

    2018-05-26

    The Hippo signaling pathway (HSP) has been identified as an essential and complex signaling pathway for tumor suppression that coordinates proliferation, differentiation, cell death, cell growth and stemness. In the present study, we conducted a genome-scale co-expression analysis to reconstruct the HSP in colorectal cancer (CRC). Five key modules were detected through network clustering, and a detailed discussion of two modules containing respectively 18 and 13 over and down-regulated members of HSP was provided. Our results suggest new potential regulatory factors in the HSP. The detected modules also suggest novel genes contributing to CRC. Moreover, differential expression analysis confirmed the differential expression pattern of HSP members and new suggested regulatory factors between tumor and normal samples. These findings can further reveal the importance of HSP in CRC. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Suggested Greek translations of expressions in the experimental analysis of behavior

    PubMed Central

    Charalambous, Neophytos; Cramer, Owen; Roberts, Carl L.

    1979-01-01

    Greek-English and English-Greek translations of expressions in the experimental analysis of behavior are presented. Included is a short discussion of some of the problems which arose, partly because of the mentalistic nature of Greek science. PMID:16812132

  9. Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana

    PubMed Central

    Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H.; Trivedi, Prabodh K.

    2016-01-01

    Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana. PMID:27539368

  10. Genome-wide Expression Analysis and Metabolite Profiling Elucidate Transcriptional Regulation of Flavonoid Biosynthesis and Modulation under Abiotic Stresses in Banana.

    PubMed

    Pandey, Ashutosh; Alok, Anshu; Lakhwani, Deepika; Singh, Jagdeep; Asif, Mehar H; Trivedi, Prabodh K

    2016-08-19

    Flavonoid biosynthesis is largely regulated at the transcriptional level due to the modulated expression of genes related to the phenylpropanoid pathway in plants. Although accumulation of different flavonoids has been reported in banana, a staple fruit crop, no detailed information is available on regulation of the biosynthesis in this important plant. We carried out genome-wide analysis of banana (Musa acuminata, AAA genome) and identified 28 genes belonging to 9 gene families associated with flavonoid biosynthesis. Expression analysis suggested spatial and temporal regulation of the identified genes in different tissues of banana. Analysis revealed enhanced expression of genes related to flavonol and proanthocyanidin (PA) biosynthesis in peel and pulp at the early developmental stages of fruit. Genes involved in anthocyanin biosynthesis were highly expressed during banana fruit ripening. In general, higher accumulation of metabolites was observed in the peel as compared to pulp tissue. A correlation between expression of genes and metabolite content was observed at the early stage of fruit development. Furthermore, this study also suggests regulation of flavonoid biosynthesis, at transcriptional level, under light and dark exposures as well as methyl jasmonate (MJ) treatment in banana.

  11. Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone's level of tolerance.

    PubMed

    Ali, Shahin S; Melnick, Rachel L; Crozier, Jayne; Phillips-Mora, Wilberth; Strem, Mary D; Shao, Jonathan; Zhang, Dapeng; Sicher, Richard; Meinhardt, Lyndel; Bailey, Bryan A

    2014-09-01

    An understanding of the tolerance mechanisms of Theobroma cacao used against Moniliophthora roreri, the causal agent of frosty pod rot, is important for the generation of stable disease-tolerant clones. A comparative view was obtained of transcript populations of infected pods from two susceptible and two tolerant clones using RNA sequence (RNA-Seq) analysis. A total of 3009 transcripts showed differential expression among clones. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of differentially expressed genes indicated shifts in 152 different metabolic pathways between the tolerant and susceptible clones. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) analyses of 36 genes verified the differential expression. Regression analysis validated a uniform progression in gene expression in association with infection levels and fungal loads in the susceptible clones. Expression patterns observed in the susceptible clones diverged in tolerant clones, with many genes showing higher expression at a low level of infection and fungal load. Principal coordinate analyses of real-time qRT-PCR data separated the gene expression patterns between susceptible and tolerant clones for pods showing malformation. Although some genes were constitutively differentially expressed between clones, most results suggested that defence responses were induced at low fungal load in the tolerant clones. Several elicitor-responsive genes were highly expressed in tolerant clones, suggesting rapid recognition of the pathogen and induction of defence genes. Expression patterns suggested that the jasmonic acid-ethylene- and/or salicylic acid-mediated defence pathways were activated in the tolerant clones, being enhanced by reduced brassinosteroid (BR) biosynthesis and catabolic inactivation of both BR and abscisic acids. Finally, several genes associated with hypersensitive response-like cell death were also induced in tolerant clones. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  12. Identification of potential transcriptomic markers in developing pediatric sepsis: a weighted gene co-expression network analysis and a case-control validation study.

    PubMed

    Li, Yiping; Li, Yanhong; Bai, Zhenjiang; Pan, Jian; Wang, Jian; Fang, Fang

    2017-12-13

    Sepsis represents a complex disease with the dysregulated inflammatory response and high mortality rate. The goal of this study was to identify potential transcriptomic markers in developing pediatric sepsis by a co-expression module analysis of the transcriptomic dataset. Using the R software and Bioconductor packages, we performed a weighted gene co-expression network analysis to identify co-expression modules significantly associated with pediatric sepsis. Functional interpretation (gene ontology and pathway analysis) and enrichment analysis with known transcription factors and microRNAs of the identified candidate modules were then performed. In modules significantly associated with sepsis, the intramodular analysis was further performed and "hub genes" were identified and validated by quantitative real-time PCR (qPCR) in this study. 15 co-expression modules in total were detected, and four modules ("midnight blue", "cyan", "brown", and "tan") were most significantly associated with pediatric sepsis and suggested as potential sepsis-associated modules. Gene ontology analysis and pathway analysis revealed that these four modules strongly associated with immune response. Three of the four sepsis-associated modules were also enriched with known transcription factors (false discovery rate-adjusted P < 0.05). Hub genes were identified in each of the four modules. Four of the identified hub genes (MYB proto-oncogene like 1, killer cell lectin like receptor G1, stomatin, and membrane spanning 4-domains A4A) were further validated to be differentially expressed between septic children and controls by qPCR. Four pediatric sepsis-associated co-expression modules were identified in this study. qPCR results suggest that hub genes in these modules are potential transcriptomic markers for pediatric sepsis diagnosis. These results provide novel insights into the pathogenesis of pediatric sepsis and promote the generation of diagnostic gene sets.

  13. Genomic survey, expression profile and co-expression network analysis of OsWD40 family in rice

    PubMed Central

    2012-01-01

    Background WD40 proteins represent a large family in eukaryotes, which have been involved in a broad spectrum of crucial functions. Systematic characterization and co-expression analysis of OsWD40 genes enable us to understand the networks of the WD40 proteins and their biological processes and gene functions in rice. Results In this study, we identify and analyze 200 potential OsWD40 genes in rice, describing their gene structures, genome localizations, and evolutionary relationship of each member. Expression profiles covering the whole life cycle in rice has revealed that transcripts of OsWD40 were accumulated differentially during vegetative and reproductive development and preferentially up or down-regulated in different tissues. Under phytohormone treatments, 25 OsWD40 genes were differentially expressed with treatments of one or more of the phytohormone NAA, KT, or GA3 in rice seedlings. We also used a combined analysis of expression correlation and Gene Ontology annotation to infer the biological role of the OsWD40 genes in rice. The results suggested that OsWD40 genes may perform their diverse functions by complex network, thus were predictive for understanding their biological pathways. The analysis also revealed that OsWD40 genes might interact with each other to take part in metabolic pathways, suggesting a more complex feedback network. Conclusions All of these analyses suggest that the functions of OsWD40 genes are diversified, which provide useful references for selecting candidate genes for further functional studies. PMID:22429805

  14. Genome-Wide Identification and Expression Analysis of the Mitogen-Activated Protein Kinase Gene Family in Cassava

    PubMed Central

    Yan, Yan; Wang, Lianzhe; Ding, Zehong; Tie, Weiwei; Ding, Xupo; Zeng, Changying; Wei, Yunxie; Zhao, Hongliang; Peng, Ming; Hu, Wei

    2016-01-01

    Mitogen-activated protein kinases (MAPKs) play central roles in plant developmental processes, hormone signaling transduction, and responses to abiotic stress. However, no data are currently available about the MAPK family in cassava, an important tropical crop. Herein, 21 MeMAPK genes were identified from cassava. Phylogenetic analysis indicated that MeMAPKs could be classified into four subfamilies. Gene structure analysis demonstrated that the number of introns in MeMAPK genes ranged from 1 to 10, suggesting large variation among cassava MAPK genes. Conserved motif analysis indicated that all MeMAPKs had typical protein kinase domains. Transcriptomic analysis suggested that MeMAPK genes showed differential expression patterns in distinct tissues and in response to drought stress between wild subspecies and cultivated varieties. Interaction networks and co-expression analyses revealed that crucial pathways controlled by MeMAPK networks may be involved in the differential response to drought stress in different accessions of cassava. Expression of nine selected MAPK genes showed that these genes could comprehensively respond to osmotic, salt, cold, oxidative stressors, and abscisic acid (ABA) signaling. These findings yield new insights into the transcriptional control of MAPK gene expression, provide an improved understanding of abiotic stress responses and signaling transduction in cassava, and lead to potential applications in the genetic improvement of cassava cultivars. PMID:27625666

  15. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    PubMed

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  16. HES1, a target of Notch signaling, is elevated in canine osteosarcoma, but reduced in the most aggressive tumors.

    PubMed

    Dailey, Deanna D; Anfinsen, Kristin P; Pfaff, Liza E; Ehrhart, E J; Charles, J Brad; Bønsdorff, Tina B; Thamm, Douglas H; Powers, Barbara E; Jonasdottir, Thora J; Duval, Dawn L

    2013-07-01

    Hairy and enhancer of split 1 (HES1), a basic helix-loop-helix transcriptional repressor, is a downstream target of Notch signaling. Notch signaling and HES1 expression have been linked to growth and survival in a variety of human cancer types and have been associated with increased metastasis and invasiveness in human osteosarcoma cell lines. Osteosarcoma (OSA) is an aggressive cancer demonstrating both high metastatic rate and chemotherapeutic resistance. The current study examined expression of Notch signaling mediators in primary canine OSA tumors and canine and human osteosarcoma cell lines to assess their role in OSA development and progression. Reverse transcriptase - quantitative PCR (RT-qPCR) was utilized to quantify HES1, HEY1, NOTCH1 and NOTCH2 gene expression in matched tumor and normal metaphyseal bone samples taken from dogs treated for appendicular OSA at the Colorado State University Veterinary Teaching Hospital. Gene expression was also assessed in tumors from dogs with a disease free interval (DFI) of <100 days compared to those with a DFI > 300 days following treatment with surgical amputation followed by standard chemotherapy. Immunohistochemistry was performed to confirm expression of HES1. Data from RT-qPCR and immunohistochemical (IHC) experiments were analyzed using REST2009 software and survival analysis based on IHC expression employed the Kaplan-Meier method and log rank analysis. Unbiased clustered images were generated from gene array analysis data for Notch/HES1 associated genes. Gene array analysis of Notch/HES1 associated genes suggested alterations in the Notch signaling pathway may contribute to the development of canine OSA. HES1 mRNA expression was elevated in tumor samples relative to normal bone, but decreased in tumor samples from dogs with a DFI < 100 days relative to those with a DFI > 300 days. NOTCH2 and HEY1 mRNA expression was also elevated in tumors relative to normal bone, but was not differentially expressed between the DFI tumor groups. Survival analysis confirmed an association between decreased HES1 immunosignal and shorter DFI. Our findings suggest that activation of Notch signaling occurs and may contribute to the development of canine OSA. However, association of low HES1 expression and shorter DFI suggests that mechanisms that do not alter HES1 expression may drive the most aggressive tumors.

  17. Perceiving Facial and Vocal Expressions of Emotion in Individuals with Williams Syndrome

    ERIC Educational Resources Information Center

    Plesa-Skwerer, Daniela; Faja, Susan; Schofield, Casey; Verbalis, Alyssa; Tager-Flusberg, Helen

    2006-01-01

    People with Williams syndrome are extremely sociable, empathic, and expressive in communication. Some researchers suggest they may be especially sensitive to perceiving emotional expressions. We administered the Faces and Paralanguage subtests of the Diagnostic Analysis of Nonverbal Accuracy Scale (DANVA2), a standardized measure of emotion…

  18. CNS development under altered gravity: cerebellar glial and neuronal protein expression in rat neonates exposed to hypergravity

    NASA Astrophysics Data System (ADS)

    Nguon, K.; Li, G.-H.; Sajdel-Sulkowska, E. M.

    2004-01-01

    The future of space exploration depends on a solid understanding of the developmental process under microgravity, specifically in relation to the central nervous system (CNS). We have previously employed a hypergravity paradigm to assess the impact of altered gravity on the developing rat cerebellum [Exp. Biol. Med. 226 (2000) 790]. The present study addresses the molecular mechanisms involved in the cerebellar response to hypergravity. Specifically, the study focuses on the expression of selected glial and neuronal cerebellar proteins in rat neonates exposed to hypergravity (1.5 G) from embryonic day (E)11 to postnatal day (P)6 or P9 (the time of maximal cerebellar changes) comparing them against their expression in rat neonates developing under normal gravity. Proteins were analyzed by quantitative Western blots of cerebellar homogenates; RNA analysis was performed in the same samples using quantitative PCR. Densitometric analysis of Western blots suggested a reduction in glial (glial acidic protein, GFAP) and neuronal (neuronal cell adhesion moiecule, NCAM-L1, synaptophysin) proteins, but the changes in individual cerebellar proteins in hypergravity-exposed neonates appeared both age- and gender-specific. RNA analysis suggested a reduction in GFAP and synaptophysin mRNAs on P6. These data suggest that exposure to hypergravity may interfere with the expression of selected cerebellar proteins. These changes in protein expression may be involved in mediating the effect of hypergravity on the developing rat cerebellum.

  19. MUC1 Predicts Colorectal Cancer Metastasis: A Systematic Review and Meta-Analysis of Case Controlled Studies

    PubMed Central

    Lu, Minxun; Liu, Yang; Zheng, Tianying; Feng, Shijian; Hao, Meiqin; Shi, Huashan

    2015-01-01

    Objective To evaluate the predicting value of MUC1 expression in lymph node and distant metastasis of colorectal cancer (CRC). Methods Pubmed/ MEDLINE and EMBASE were searched to identify eligible studies that evaluated the correlation between MUC1 and CRC. A meta-analysis was conducted to evaluate the impact of MUC1 expression on CRC metastasis. Results A total of 18 studies (n = 3271) met inclusion criteria and the mean Newcastle-Ottawa Scale (NOS) score was 6.3 with a range from 4 to 8. The pooled OR in the meta-analysis of 15 studies indicated that positive MUC1 expression correlated with more CRC node metastasis (OR = 2.32, 95% CI = 1.63–3.29). The data synthesis of 6 studies suggested that MUC1 expression predicted more possibility of CRC distant metastasis (OR = 2.22, 95% CI = 1.23–4.00). In addition, the combined OR of 7 studies showed that MUC1 expression indicated higher Duke’s stage (OR = 3.02, 95% CI = 2.11–4.33). No publication bias was found in the mate-analysis by Begg’s test or Egger’s test with the exception of the meta-analysis of MUC1 with CRC node metastasis (Begg’s test p = 0.729, Egger’s test p = 0.000). Conclusions Despite of some modest bias, the pooled evidence suggested that MUC1 expression was significantly correlated with CRC metastasis. PMID:26367866

  20. Gene expression analysis and microdialysis suggest hypothalamic triiodothyronine (T3) gates daily torpor in Djungarian hamsters (Phodopus sungorus).

    PubMed

    Bank, Jonathan H H; Cubuk, Ceyda; Wilson, Dana; Rijntjes, Eddy; Kemmling, Julia; Markovsky, Hanna; Barrett, Perry; Herwig, Annika

    2017-07-01

    Thyroid hormones play an important role in regulating seasonal adaptations of mammals. Several studies suggested that reduced availability of 3,3',5-triiodothyronine (T3) in the hypothalamus is required for the physiological adaptation to winter in Djungarian hamsters. We have previously shown that T3 is involved in the regulation of daily torpor, but it remains unclear, whether T3 affects torpor by central or peripheral mechanisms. To determine the effect of T3 concentrations within the hypothalamus in regulating daily torpor, we tested the hypothesis that low hypothalamic T3 metabolism would favour torpor and high T3 concentrations would not. In experiment 1 gene expression in torpid hamsters was assessed for transporters carrying thyroid hormones between cerebrospinal fluid and hypothalamic cells and for deiodinases enzymes, activating or inactivating T3 within hypothalamic cells. Gene expression analysis suggests reduced T3 in hypothalamic cells during torpor. In experiment 2, hypothalamic T3 concentrations were altered via microdialysis and torpor behaviour was continuously monitored by implanted body temperature transmitters. Increased T3 concentrations in the hypothalamus reduced expression of torpor as well as torpor bout duration and depth. Subsequent analysis of gene expression in the ependymal layer of the third ventricle showed clear up-regulation of T3 inactivating deiodinase 3 but no changes in several other genes related to photoperiodic adaptations in hamsters. Finally, serum analysis revealed that increased total T3 serum concentrations were not necessary to inhibit torpor expression. Taken together, our results are consistent with the hypothesis that T3 availability within the hypothalamus significantly contributes to the regulation of daily torpor via a central pathway.

  1. [Stability analysis of reference gene based on real-time PCR in Artemisia annua under cadmium treatment].

    PubMed

    Zhou, Liang-Yun; Mo, Ge; Wang, Sheng; Tang, Jin-Fu; Yue, Hong; Huang, Lu-Qi; Shao, Ai-Juan; Guo, Lan-Ping

    2014-03-01

    In this study, Actin, 18S rRNA, PAL, GAPDH and CPR of Artemisia annua were selected as candidate reference genes, and their gene-specific primers for real-time PCR were designed, then geNorm, NormFinder, BestKeeper, Delta CT and RefFinder were used to evaluate their expression stability in the leaves of A. annua under treatment of different concentrations of Cd, with the purpose of finding a reliable reference gene to ensure the reliability of gene-expression analysis. The results showed that there were some significant differences among the candidate reference genes under different treatments and the order of expression stability of candidate reference gene was Actin > 18S rRNA > PAL > GAPDH > CPR. These results suggested that Actin, 18S rRNA and PAL could be used as ideal reference genes of gene expression analysis in A. annua and multiple internal control genes were adopted for results calibration. In addition, differences in expression stability of candidate reference genes in the leaves of A. annua under the same concentrations of Cd were observed, which suggested that the screening of candidate reference genes was needed even under the same treatment. To our best knowledge, this study for the first time provided the ideal reference genes under Cd treatment in the leaves of A. annua and offered reference for the gene expression analysis of A. annua under other conditions.

  2. Genome-wide evolutionary characterization and expression analyses of major latex protein (MLP) family genes in Vitis vinifera.

    PubMed

    Zhang, Ningbo; Li, Ruimin; Shen, Wei; Jiao, Shuzhen; Zhang, Junxiang; Xu, Weirong

    2018-04-27

    The major latex protein/ripening-related protein (MLP/RRP) subfamily is known to be involved in a wide range of biological processes of plant development and various stress responses. However, the biological function of MLP/RRP proteins is still far from being clear and identification of them may provide important clues for understanding their roles. Here, we report a genome-wide evolutionary characterization and gene expression analysis of the MLP family in European Vitis species. A total of 14 members, was found in the grape genome, all of which are located on chromosome 1, where are predominantly arranged in tandem clusters. We have noticed, most surprisingly, promoter-sharing by several non-identical but highly similar gene members to a greater extent than expected by chance. Synteny analysis between the grape and Arabidopsis thaliana genomes suggested that 3 grape MLP genes arose before the divergence of the two species. Phylogenetic analysis provided further insights into the evolutionary relationship between the genes, as well as their putative functions, and tissue-specific expression analysis suggested distinct biological roles for different members. Our expression data suggested a couple of candidate genes involved in abiotic stresses and phytohormone responses. The present work provides new insight into the evolution and regulation of Vitis MLP genes, which represent targets for future studies and inclusion in tolerance-related molecular breeding programs.

  3. Biochemical and genetic analysis of the yeast proteome with a movable ORF collection

    PubMed Central

    Gelperin, Daniel M.; White, Michael A.; Wilkinson, Martha L.; Kon, Yoshiko; Kung, Li A.; Wise, Kevin J.; Lopez-Hoyo, Nelson; Jiang, Lixia; Piccirillo, Stacy; Yu, Haiyuan; Gerstein, Mark; Dumont, Mark E.; Phizicky, Eric M.; Snyder, Michael; Grayhack, Elizabeth J.

    2005-01-01

    Functional analysis of the proteome is an essential part of genomic research. To facilitate different proteomic approaches, a MORF (moveable ORF) library of 5854 yeast expression plasmids was constructed, each expressing a sequence-verified ORF as a C-terminal ORF fusion protein, under regulated control. Analysis of 5573 MORFs demonstrates that nearly all verified ORFs are expressed, suggests the authenticity of 48 ORFs characterized as dubious, and implicates specific processes including cytoskeletal organization and transcriptional control in growth inhibition caused by overexpression. Global analysis of glycosylated proteins identifies 109 new confirmed N-linked and 345 candidate glycoproteins, nearly doubling the known yeast glycome. PMID:16322557

  4. A Government Action Approach to First Amendment Analysis.

    ERIC Educational Resources Information Center

    Walden, Ruth

    1992-01-01

    Suggests focusing on the actions of government that restrict free expression rather than focusing on the values served by freedom of expression. Bases the approach on the premise that the court's function is to determine when a particular government action violates the First Amendment, not whether the expression at issue is entitled to…

  5. Cloning, characterization, expression and comparative analysis of pig Golgi membrane sphingomyelin synthase 1.

    PubMed

    Guillén, Natalia; Navarro, María A; Surra, Joaquín C; Arnal, Carmen; Fernández-Juan, Marta; Cebrián-Pérez, Jose Alvaro; Osada, Jesús

    2007-02-15

    Pig sphingomyelin synthase 1 (SMS1) cDNA was cloned, characterized and compared to the human ortholog. Porcine protein consists of 413 amino acids and displays a 97% sequence identity with human protein. A phylogenic tree of proteins reveals that porcine SMS1 is more closely related to bovine and rodent proteins than to human. Analysis of protein mass was higher than the theoretical prediction based on amino acid sequence suggesting a kind of posttranslational modification. Quantitative representation of tissue distribution obtained by real-time RT-PCR showed that it was widely expressed although important variations in levels were obtained among organs. Thus, the cardiovascular system, especially the heart, showed the highest value of all the tissues studied. Regional differences of expression were observed in the central nervous system and intestinal tract. Analysis of the hepatic mRNA and protein expressions of SMS1 following turpentine treatment revealed a progressive decrease in the former paralleled by a decrease in the protein concentration. These findings indicate the variation in expression in the different tissues might suggest a different requirement of Golgi sphingomyelin for the specific function in each organ and a regulation of the enzyme in response to turpentine-induced hepatic injury.

  6. SAGE analysis of early oogenesis in the silkworm, Bombyx mori.

    PubMed

    Funaguma, Shunsuke; Hashimoto, Shin-ichi; Suzuki, Yutaka; Omuro, Naoko; Sugano, Sumio; Mita, Kazuei; Katsuma, Susumu; Shimada, Toru

    2007-02-01

    To identify genes involved in the differentiation of Bombyx cystoblast, we constructed two 3' long serial analysis of gene expression (Long SAGE) libraries from stage 1-3 or stage 2-3 egg chambers and compared their gene expression profiles. In both libraries, the most frequent tags were derived from the same novel transcript. The transcript does not have any open reading frame capable of encoding a protein with over 100 amino acids in length. RNA blot analysis revealed that this transcript is specifically and abundantly expressed in the Bombyx ovary, mainly the germ line cells in the ovarioles. These results suggest that Bombyx oogenesis may be regulated by a previously unidentified non-coding RNA. Comparison of the gene expression profiles between the stage 1-3 and stage 2-3 egg chamber libraries revealed that 272 tags were significantly more abundant in stage 1-3 egg chambers (p<0.05 and at least two-fold change) than in library 2. Among the differentially expressed transcripts were the sequences that correspond to ATP synthase subunit d (3.1-fold enriched) and ATP synthase coupling factor 6 (9.1-fold enriched), suggesting that they are involved in regulation of cell cycle of cystocytes.

  7. A Functional Genomic Meta-Analysis of Clinical Trials in Systemic Sclerosis: Toward Precision Medicine and Combination Therapy.

    PubMed

    Taroni, Jaclyn N; Martyanov, Viktor; Mahoney, J Matthew; Whitfield, Michael L

    2017-05-01

    Systemic sclerosis is an orphan, systemic autoimmune disease with no FDA-approved treatments. Its heterogeneity and rarity often result in underpowered clinical trials making the analysis and interpretation of associated molecular data challenging. We performed a meta-analysis of gene expression data from skin biopsies of patients with systemic sclerosis treated with five therapies: mycophenolate mofetil, rituximab, abatacept, nilotinib, and fresolimumab. A common clinical improvement criterion of -20% or -5 modified Rodnan skin score was applied to each study. We applied a machine learning approach that captured features beyond differential expression and was better at identifying targets of therapies than the differential expression alone. Regardless of treatment mechanism, abrogation of inflammatory pathways accompanied clinical improvement in multiple studies suggesting that high expression of immune-related genes indicates active and targetable disease. Our framework allowed us to compare different trials and ask if patients who failed one therapy would likely improve on a different therapy, based on changes in gene expression. Genes with high expression at baseline in fresolimumab nonimprovers were downregulated in mycophenolate mofetil improvers, suggesting that immunomodulatory or combination therapy may have benefitted these patients. This approach can be broadly applied to increase tissue specificity and sensitivity of differential expression results. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Clinical Significance of MiR-137 Expression in Patients with Gastric Cancer After Radical Gastrectomy

    PubMed Central

    Gu, Qiaoyan; Zhang, Jun; Hu, Haifeng; Tan, Yu-e; Shi, Shengmei; Nian, Yuanyuan

    2015-01-01

    The dysregulation of miR-137 plays vital roles in the oncogenesis and progression of various types of cancer, but its role in prognosis of gastric cancer patients remains unknown. This study was designed to investigate the expression and prognostic significance of miR-137 in gastric cancer patients after radical gastrectomy. Quantitative real-time PCR (qRT-PCR) was performed to evaluate the expression of miR-137 in human gastric cancer cell lines and tissues in patients with gastric adenocarcinoma. Results were assessed for association with clinical factors and overall survival by using Kaplan-Meier analysis. Prognostic values of miR-137 expression and clinical outcomes were evaluated by Cox regression analysis. The results exhibited that the expression level of miR-137 was decreased in human gastric cancer cell lines and tissues, and down-regulated expression of miR-137 was associated with tumor cell differentiation, N stage, and TNM stage. Decreased miR-137 expression in gastric cancer tissues was positively correlated with poor overall survival of gastric cancer patients. Further multivariate Cox regression analysis suggested that miR-137 expression was an independent prognostic indicator for gastric cancer except for TNM stage. Applying the prognostic value of miR-137 expression to TNM stage III group showed a better risk stratification for overall survival. In conclusion, the results reinforced the critical role for the down-regulated miR-137 expression in gastric cancer and suggested that miR-137 expression could be a prognostic indicator for this disease. In addition, these patients with TNM stage III gastric cancer and low miR-137 expression might need more aggressive postoperative treatment and closer follow-up. PMID:26545111

  9. In situ hybridization analysis of the expression of futsch, tau, and MESK2 homologues in the brain of the European honeybee (Apis mellifera L.).

    PubMed

    Kaneko, Kumi; Hori, Sayaka; Morimoto, Mai M; Nakaoka, Takayoshi; Paul, Rajib Kumar; Fujiyuki, Tomoko; Shirai, Kenichi; Wakamoto, Akiko; Tsuboko, Satomi; Takeuchi, Hideaki; Kubo, Takeo

    2010-02-16

    The importance of visual sense in Hymenopteran social behavior is suggested by the existence of a Hymenopteran insect-specific neural circuit related to visual processing and the fact that worker honeybee brain changes morphologically according to its foraging experience. To analyze molecular and neural bases that underlie the visual abilities of the honeybees, we used a cDNA microarray to search for gene(s) expressed in a neural cell-type preferential manner in a visual center of the honeybee brain, the optic lobes (OLs). Expression analysis of candidate genes using in situ hybridization revealed two genes expressed in a neural cell-type preferential manner in the OLs. One is a homologue of Drosophila futsch, which encodes a microtubule-associated protein and is preferentially expressed in the monopolar cells in the lamina of the OLs. The gene for another microtubule-associated protein, tau, which functionally overlaps with futsch, was also preferentially expressed in the monopolar cells, strongly suggesting the functional importance of these two microtubule-associated proteins in monopolar cells. The other gene encoded a homologue of Misexpression Suppressor of Dominant-negative Kinase Suppressor of Ras 2 (MESK2), which might activate Ras/MAPK-signaling in Drosophila. MESK2 was expressed preferentially in a subclass of neurons located in the ventral region between the lamina and medulla neuropil in the OLs, suggesting that this subclass is a novel OL neuron type characterized by MESK2-expression. These three genes exhibited similar expression patterns in the worker, drone, and queen brains, suggesting that they function similarly irrespective of the honeybee sex or caste. Here we identified genes that are expressed in a monopolar cell (Amfutsch and Amtau) or ventral medulla-preferential manner (AmMESK2) in insect OLs. These genes may aid in visualizing neurites of monopolar cells and ventral medulla cells, as well as in analyzing the function of these neurons.

  10. Identifying novel glioma associated pathways based on systems biology level meta-analysis.

    PubMed

    Hu, Yangfan; Li, Jinquan; Yan, Wenying; Chen, Jiajia; Li, Yin; Hu, Guang; Shen, Bairong

    2013-01-01

    With recent advances in microarray technology, including genomics, proteomics, and metabolomics, it brings a great challenge for integrating this "-omics" data to analysis complex disease. Glioma is an extremely aggressive and lethal form of brain tumor, and thus the study of the molecule mechanism underlying glioma remains very important. To date, most studies focus on detecting the differentially expressed genes in glioma. However, the meta-analysis for pathway analysis based on multiple microarray datasets has not been systematically pursued. In this study, we therefore developed a systems biology based approach by integrating three types of omics data to identify common pathways in glioma. Firstly, the meta-analysis has been performed to study the overlapping of signatures at different levels based on the microarray gene expression data of glioma. Among these gene expression datasets, 12 pathways were found in GeneGO database that shared by four stages. Then, microRNA expression profiles and ChIP-seq data were integrated for the further pathway enrichment analysis. As a result, we suggest 5 of these pathways could be served as putative pathways in glioma. Among them, the pathway of TGF-beta-dependent induction of EMT via SMAD is of particular importance. Our results demonstrate that the meta-analysis based on systems biology level provide a more useful approach to study the molecule mechanism of complex disease. The integration of different types of omics data, including gene expression microarrays, microRNA and ChIP-seq data, suggest some common pathways correlated with glioma. These findings will offer useful potential candidates for targeted therapeutic intervention of glioma.

  11. A cell-penetrating peptide analogue, P7, exerts antimicrobial activity against Escherichia coli ATCC25922 via penetrating cell membrane and targeting intracellular DNA.

    PubMed

    Li, Lirong; Shi, Yonghui; Cheng, Xiangrong; Xia, Shufang; Cheserek, Maureen Jepkorir; Le, Guowei

    2015-01-01

    The antibacterial activities and mechanism of a new P7 were investigated in this study. P7 showed antimicrobial activities against five harmful microorganisms which contaminate and spoil food (MIC=4-32 μM). Flow cytometry and scanning electron microscopy analyses demonstrated that P7 induced pore-formation on the cell surface and led to morphological changes but did not lyse cell. Confocal fluorescence microscopic observations and flow cytometry analysis expressed that P7 could penetrate the Escherichia coli cell membrane and accumulate in the cytoplasm. Moreover, P7 possessed a strong DNA binding affinity. Further cell cycle analysis and change in gene expression analysis suggested that P7 induced a decreased expression in the genes involved in DNA replication. Up-regulated expression genes encoding DNA damage repair. This study suggests that P7 could be applied as a candidate for the development of new food preservatives as it exerts its antibacterial activities by penetrating cell membranes and targets intracellular DNA. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Analysis of differential gene expression by bead-based fiber-optic array in growth-hormone-secreting pituitary adenomas.

    PubMed

    Jiang, Zhiquan; Gui, Songbo; Zhang, Yazhuo

    2010-09-01

    Growth-hormone-secreting pituitary adenomas (GHomas) account for approximately 20% of all pituitary neoplasms. However, the pathogenesis of GHomas remains to be elucidated. To explore the possible pathogenesis of GHomas, we used bead-based fiber-optic arrays to examine the gene expression in five GHomas and compared them to three healthy pituitaries. Four differentially expressed genes were chosen randomly for validation by quantitative real-time reverse transcription-polymerase chain reaction. We then performed pathway analysis on the identified differentially expressed genes using the Kyoto Encyclopedia of Genes and Genomes. Array analysis showed significant increases in the expression of 353 genes and 206 expressed sequence tags (ESTs) and decreases in 565 genes and 29 ESTs. Bioinformatic analysis showed that the genes HIGD1B, HOXB2, ANGPT2, HPGD and BTG2 may play an important role in the tumorigenesis and progression of GHomas. Pathway analysis showed that the wingless-type signaling pathway and extracellular-matrix receptor interactions may play a key role in the tumorigenesis and progression of GHomas. Our data suggested that there are numerous aberrantly expressed genes and pathways involved in the pathogenesis of GHomas. Bead-based fiber-optic arrays combined with pathway analysis of differentially expressed genes appear to be a valid method for investigating the pathogenesis of tumors.

  13. Analysis of differential gene expression by bead-based fiber-optic array in growth-hormone-secreting pituitary adenomas

    PubMed Central

    JIANG, ZHIQUAN; GUI, SONGBO; ZHANG, YAZHUO

    2010-01-01

    Growth-hormone-secreting pituitary adenomas (GHomas) account for approximately 20% of all pituitary neoplasms. However, the pathogenesis of GHomas remains to be elucidated. To explore the possible pathogenesis of GHomas, we used bead-based fiber-optic arrays to examine the gene expression in five GHomas and compared them to three healthy pituitaries. Four differentially expressed genes were chosen randomly for validation by quantitative real-time reverse transcription-polymerase chain reaction. We then performed pathway analysis on the identified differentially expressed genes using the Kyoto Encyclopedia of Genes and Genomes. Array analysis showed significant increases in the expression of 353 genes and 206 expressed sequence tags (ESTs) and decreases in 565 genes and 29 ESTs. Bioinformatic analysis showed that the genes HIGD1B, HOXB2, ANGPT2, HPGD and BTG2 may play an important role in the tumorigenesis and progression of GHomas. Pathway analysis showed that the wingless-type signaling pathway and extracellular-matrix receptor interactions may play a key role in the tumorigenesis and progression of GHomas. Our data suggested that there are numerous aberrantly expressed genes and pathways involved in the pathogenesis of GHomas. Bead-based fiber-optic arrays combined with pathway analysis of differentially expressed genes appear to be a valid method for investigating the pathogenesis of tumors. PMID:22993617

  14. HES1, a target of Notch signaling, is elevated in canine osteosarcoma, but reduced in the most aggressive tumors

    PubMed Central

    2013-01-01

    Background Hairy and enhancer of split 1 (HES1), a basic helix-loop-helix transcriptional repressor, is a downstream target of Notch signaling. Notch signaling and HES1 expression have been linked to growth and survival in a variety of human cancer types and have been associated with increased metastasis and invasiveness in human osteosarcoma cell lines. Osteosarcoma (OSA) is an aggressive cancer demonstrating both high metastatic rate and chemotherapeutic resistance. The current study examined expression of Notch signaling mediators in primary canine OSA tumors and canine and human osteosarcoma cell lines to assess their role in OSA development and progression. Results Reverse transcriptase - quantitative PCR (RT-qPCR) was utilized to quantify HES1, HEY1, NOTCH1 and NOTCH2 gene expression in matched tumor and normal metaphyseal bone samples taken from dogs treated for appendicular OSA at the Colorado State University Veterinary Teaching Hospital. Gene expression was also assessed in tumors from dogs with a disease free interval (DFI) of <100 days compared to those with a DFI > 300 days following treatment with surgical amputation followed by standard chemotherapy. Immunohistochemistry was performed to confirm expression of HES1. Data from RT-qPCR and immunohistochemical (IHC) experiments were analyzed using REST2009 software and survival analysis based on IHC expression employed the Kaplan-Meier method and log rank analysis. Unbiased clustered images were generated from gene array analysis data for Notch/HES1 associated genes. Gene array analysis of Notch/HES1 associated genes suggested alterations in the Notch signaling pathway may contribute to the development of canine OSA. HES1 mRNA expression was elevated in tumor samples relative to normal bone, but decreased in tumor samples from dogs with a DFI < 100 days relative to those with a DFI > 300 days. NOTCH2 and HEY1 mRNA expression was also elevated in tumors relative to normal bone, but was not differentially expressed between the DFI tumor groups. Survival analysis confirmed an association between decreased HES1 immunosignal and shorter DFI. Conclusions Our findings suggest that activation of Notch signaling occurs and may contribute to the development of canine OSA. However, association of low HES1 expression and shorter DFI suggests that mechanisms that do not alter HES1 expression may drive the most aggressive tumors. PMID:23816051

  15. CNS development under altered gravity: cerebellar glial and neuronal protein expression in rat neonates exposed to hypergravity

    NASA Technical Reports Server (NTRS)

    Nguon, K.; Li, G-H; Sajdel-Sulkowska, E. M.

    2004-01-01

    The future of space exploration depends on a solid understanding of the developmental process under microgravity, specifically in relation to the central nervous system (CNS). We have previously employed a hypergravity paradigm to assess the impact of altered gravity on the developing rat cerebellum. The present study addresses the molecular mechanisms involved in the cerebellar response to hypergravity. Specifically, the study focuses on the expression of selected glial and neuronal cerebellar proteins in rat neonates exposed to hypergravity (1.5 G) from embryonic day (E)11 to postnatal day (P)6 or P9 (the time of maximal cerebellar changes) comparing them against their expression in rat neonates developing under normal gravity. Proteins were analyzed by quantitative Western blots of cerebellar homogenates; RNA analysis was performed in the same samples using quantitative PCR. Densitometric analysis of Western blots suggested a reduction in glial (glial acidic protein, GFAP) and neuronal (neuronal cell adhesion molecule, NCAM-L1, synaptophysin) proteins, but the changes in individual cerebellar proteins in hypergravity-exposed neonates appeared both age- and gender-specific. RNA analysis suggested a reduction in GFAP and synaptophysin mRNAs on P6. These data suggest that exposure to hypergravity may interfere with the expression of selected cerebellar proteins. These changes in protein expression may be involved in mediating the effect of hypergravity on the developing rat cerebellum. c2003 COSPAR. Published by Elsevier Ltd. All rights reserved.

  16. Molecular characterization and expression analysis of Triticum aestivum squamosa-promoter binding protein-box genes involved in ear development.

    PubMed

    Zhang, Bin; Liu, Xia; Zhao, Guangyao; Mao, Xinguo; Li, Ang; Jing, Ruilian

    2014-06-01

    Wheat (Triticum aestivum L.) is one of the most important crops in the world. Squamosa-promoter binding protein (SBP)-box genes play a critical role in regulating flower and fruit development. In this study, 10 novel SBP-box genes (TaSPL genes) were isolated from wheat ((Triticum aestivum L.) cultivar Yanzhan 4110). Phylogenetic analysis classified the TaSPL genes into five groups (G1-G5). The motif combinations and expression patterns of the TaSPL genes varied among the five groups with each having own distinctive characteristics: TaSPL20/21 in G1 and TaSPL17 in G2 mainly expressed in the shoot apical meristem and the young ear, and their expression levels responded to development of the ear; TaSPL6/15 belonging to G3 were upregulated and TaSPL1/23 in G4 were downregulated during grain development; the gene in G5 (TaSPL3) expressed constitutively. Thus, the consistency of the phylogenetic analysis, motif compositions, and expression patterns of the TaSPL genes revealed specific gene structures and functions. On the other hand, the diverse gene structures and different expression patterns suggested that wheat SBP-box genes have a wide range of functions. The results also suggest a potential role for wheat SBP-box genes in ear development. This study provides a significant beginning of functional analysis of SBP-box genes in wheat. © 2014 The Authors. Journal of Integrative Plant Biology Published by Wiley Publishing Asia Pty Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.

  17. Combining Shapley value and statistics to the analysis of gene expression data in children exposed to air pollution

    PubMed Central

    Moretti, Stefano; van Leeuwen, Danitsja; Gmuender, Hans; Bonassi, Stefano; van Delft, Joost; Kleinjans, Jos; Patrone, Fioravante; Merlo, Domenico Franco

    2008-01-01

    Background In gene expression analysis, statistical tests for differential gene expression provide lists of candidate genes having, individually, a sufficiently low p-value. However, the interpretation of each single p-value within complex systems involving several interacting genes is problematic. In parallel, in the last sixty years, game theory has been applied to political and social problems to assess the power of interacting agents in forcing a decision and, more recently, to represent the relevance of genes in response to certain conditions. Results In this paper we introduce a Bootstrap procedure to test the null hypothesis that each gene has the same relevance between two conditions, where the relevance is represented by the Shapley value of a particular coalitional game defined on a microarray data-set. This method, which is called Comparative Analysis of Shapley value (shortly, CASh), is applied to data concerning the gene expression in children differentially exposed to air pollution. The results provided by CASh are compared with the results from a parametric statistical test for testing differential gene expression. Both lists of genes provided by CASh and t-test are informative enough to discriminate exposed subjects on the basis of their gene expression profiles. While many genes are selected in common by CASh and the parametric test, it turns out that the biological interpretation of the differences between these two selections is more interesting, suggesting a different interpretation of the main biological pathways in gene expression regulation for exposed individuals. A simulation study suggests that CASh offers more power than t-test for the detection of differential gene expression variability. Conclusion CASh is successfully applied to gene expression analysis of a data-set where the joint expression behavior of genes may be critical to characterize the expression response to air pollution. We demonstrate a synergistic effect between coalitional games and statistics that resulted in a selection of genes with a potential impact in the regulation of complex pathways. PMID:18764936

  18. Upregulation of the ESR1 Gene and ESR Ratio (ESR1/ESR2) is Associated with a Worse Prognosis in Papillary Thyroid Carcinoma: The Impact of the Estrogen Receptor α/β Expression on Clinical Outcomes in Papillary Thyroid Carcinoma Patients.

    PubMed

    Yi, Jin Wook; Kim, Su-Jin; Kim, Jong Kyu; Seong, Chan Yong; Yu, Hyeong Won; Chai, Young Jun; Choi, June Young; Lee, Kyu Eun

    2017-11-01

    A gender disparity exists with respect to the incidence of papillary thyroid cancer (PTC), suggesting that sex hormones such as estrogen play a role in PTC development and progression. In this study, we compared estrogen receptor gene expression patterns in PTCs to determine the clinical significance of estrogen gene expression in PTC. We analyzed ESR1 and ESR2 messenger RNA expression counts using data from The Cancer Genome Atlas (TCGA). To validate the results of TCGA analysis, we analyzed microarray data (GSE 54958) from the Gene Expression Omnibus. ESR1 gene expression and ESR ratio (ESR1/ESR2) were significantly higher in PTC tissues than in paired normal thyroid tissues (mean 659.427 vs. 264.045 for ESR1, 92.017 vs. 19.064 for ESR ratio). Among female patients, ESR1 expression and ESR ratio were negatively correlated with increased age. ESR1 expression and ESR ratio were higher in patients with classic PTC, lymphovascular invasion, BRAF V600E mutation, and radioiodine therapy. Classification analysis demonstrated that higher ESR1 expression and a higher ESR ratio faced a worse overall survival (hazard ratio 6.348 for ESR1, 4.031 for ESR ratio). Validation microarray analysis demonstrated that ESR1 expression and ESR ratio were higher in tumor tissues, classic PTC, and BRAF V600E . Higher ESR1 expression and a higher ESR ratio were associated with aggressive prognostic factors and worse overall survival in female PTC patients. Our results suggest that ESR1 and ESR ratio can be used as prognostic markers to predict female patient survival and have potential as a therapeutic target.

  19. Genome-Wide Analysis of the Musa WRKY Gene Family: Evolution and Differential Expression during Development and Stress

    PubMed Central

    Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K.; Asif, Mehar H.

    2016-01-01

    The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively. PMID:27014321

  20. Genome-Wide Analysis of the Musa WRKY Gene Family: Evolution and Differential Expression during Development and Stress.

    PubMed

    Goel, Ridhi; Pandey, Ashutosh; Trivedi, Prabodh K; Asif, Mehar H

    2016-01-01

    The WRKY gene family plays an important role in the development and stress responses in plants. As information is not available on the WRKY gene family in Musa species, genome-wide analysis has been carried out in this study using available genomic information from two species, Musa acuminata and Musa balbisiana. Analysis identified 147 and 132 members of the WRKY gene family in M. acuminata and M. balbisiana, respectively. Evolutionary analysis suggests that the WRKY gene family expanded much before the speciation in both the species. Most of the orthologs retained in two species were from the γ duplication event which occurred prior to α and β genome-wide duplication (GWD) events. Analysis also suggests that subtle changes in nucleotide sequences during the course of evolution have led to the development of new motifs which might be involved in neo-functionalization of different WRKY members in two species. Expression and cis-regulatory motif analysis suggest possible involvement of Group II and Group III WRKY members during various stresses and growth/development including fruit ripening process respectively.

  1. Transcriptome-wide effects of inverted SINEs on gene expression and their impact on RNA polymerase II activity.

    PubMed

    Tajaddod, Mansoureh; Tanzer, Andrea; Licht, Konstantin; Wolfinger, Michael T; Badelt, Stefan; Huber, Florian; Pusch, Oliver; Schopoff, Sandy; Janisiw, Michael; Hofacker, Ivo; Jantsch, Michael F

    2016-10-25

    Short interspersed elements (SINEs) represent the most abundant group of non-long-terminal repeat transposable elements in mammalian genomes. In primates, Alu elements are the most prominent and homogenous representatives of SINEs. Due to their frequent insertion within or close to coding regions, SINEs have been suggested to play a crucial role during genome evolution. Moreover, Alu elements within mRNAs have also been reported to control gene expression at different levels. Here, we undertake a genome-wide analysis of insertion patterns of human Alus within transcribed portions of the genome. Multiple, nearby insertions of SINEs within one transcript are more abundant in tandem orientation than in inverted orientation. Indeed, analysis of transcriptome-wide expression levels of 15 ENCODE cell lines suggests a cis-repressive effect of inverted Alu elements on gene expression. Using reporter assays, we show that the negative effect of inverted SINEs on gene expression is independent of known sensors of double-stranded RNAs. Instead, transcriptional elongation seems impaired, leading to reduced mRNA levels. Our study suggests that there is a bias against multiple SINE insertions that can promote intramolecular base pairing within a transcript. Moreover, at a genome-wide level, mRNAs harboring inverted SINEs are less expressed than mRNAs harboring single or tandemly arranged SINEs. Finally, we demonstrate a novel mechanism by which inverted SINEs can impact on gene expression by interfering with RNA polymerase II.

  2. Genome-wide identification and characterisation of F-box family in maize.

    PubMed

    Jia, Fengjuan; Wu, Bingjiang; Li, Hui; Huang, Jinguang; Zheng, Chengchao

    2013-11-01

    F-box-containing proteins, as the key components of the protein degradation machinery, are widely distributed in higher plants and are considered as one of the largest known families of regulatory proteins. The F-box protein family plays a crucial role in plant growth and development and in response to biotic and abiotic stresses. However, systematic analysis of the F-box family in maize (Zea mays) has not been reported yet. In this paper, we identified and characterised the maize F-box genes in a genome-wide scale, including phylogenetic analysis, chromosome distribution, gene structure, promoter analysis and gene expression profiles. A total of 359 F-box genes were identified and divided into 15 subgroups by phylogenetic analysis. The F-box domain was relatively conserved, whereas additional motifs outside the F-box domain may indicate the functional diversification of maize F-box genes. These genes were unevenly distributed in ten maize chromosomes, suggesting that they expanded in the maize genome because of tandem and segmental duplication events. The expression profiles suggested that the maize F-box genes had temporal and spatial expression patterns. Putative cis-acting regulatory DNA elements involved in abiotic stresses were observed in maize F-box gene promoters. The gene expression profiles under abiotic stresses also suggested that some genes participated in stress responsive pathways. Furthermore, ten genes were chosen for quantitative real-time PCR analysis under drought stress and the results were consistent with the microarray data. This study has produced a comparative genomics analysis of the maize ZmFBX gene family that can be used in further studies to uncover their roles in maize growth and development.

  3. Analysis of differential gene expression by bead-based fiber-optic array in nonfunctioning pituitary adenomas.

    PubMed

    Jiang, Z; Gui, S; Zhang, Y

    2011-05-01

    Nonfunctioning pituitary adenomas (NFPAs) are relatively common, accounting for 30% of all pituitary adenomas; however, their pathogenesis remains enigmatic. To explore the possible pathogenesis of NFPAs, we used fiber-optic BeadArray to examine gene expression in 5 NFPAs compared with 3 normal pituitaries. 4 differentially expressed genes were chosen randomly for validation by reverse transcriptase-real time quantitative polymerase chain reaction (RT-qPCR). We then analyzed the differentially expressed gene profile with Kyoto Encyclopedia of Genes and Genomes (KEGG). The array analysis indentified significant increases in the expression of 1,402 genes and 383 expressed sequence tags (ESTs), and decreases in 1,697 genes and 113 ESTs in the NFPAs. Bioinformatic and pathway analysis showed that the genes HIGD1B, FAM5C, PMAIP1 and the pathway cell-cycle regulation may play an important role in tumorigenesis and progression of NFPAs. Our data suggest fiber-optic BeadArray combined with pathway analysis of differential gene expression profile appears to be a valid approach for investigating the pathogenesis of tumors. © Georg Thieme Verlag KG Stuttgart · New York.

  4. Identification and expression analysis of BoMF25, a novel polygalacturonase gene involved in pollen development of Brassica oleracea.

    PubMed

    Lyu, Meiling; Liang, Ying; Yu, Youjian; Ma, Zhiming; Song, Limin; Yue, Xiaoyan; Cao, Jiashu

    2015-06-01

    BoMF25 acts on pollen wall. Polygalacturonase (PG) is a pectin-digesting enzyme involved in numerous plant developmental processes and is described to be of critical importance for pollen wall development. In the present study, a PG gene, BoMF25, was isolated from Brassica oleracea. BoMF25 is the homologous gene of At4g35670, a PG gene in Arabidopsis thaliana with a high expression level at the tricellular pollen stage. Collinear analysis revealed that the orthologous gene of BoMF25 in Brassica campestris (syn. B. rapa) genome was probably lost because of genome deletion and reshuffling. Sequence analysis indicated that BoMF25 contained four classical conserved domains (I, II, III, and IV) of PG protein. Homology and phylogenetic analyses showed that BoMF25 was clustered in Clade F. The putative promoter sequence, containing classical cis-acting elements and pollen-specific motifs, could drive green fluorescence protein expression in onion epidermal cells. Quantitative RT-PCR analysis suggested that BoMF25 was mainly expressed in the anther at the late stage of pollen development. In situ hybridization analysis also indicated that the strong and specific expression signal of BoMF25 existed in pollen grains at the mature pollen stage. Subcellular localization showed that the fluorescence signal was observed in the cell wall of onion epidermal cells, which suggested that BoMF25 may be a secreted protein localized in the pollen wall.

  5. Comparison of Gene Expression in Human Embryonic Stem Cells, hESC-Derived Mesenchymal Stem Cells and Human Mesenchymal Stem Cells.

    PubMed

    Barbet, Romain; Peiffer, Isabelle; Hatzfeld, Antoinette; Charbord, Pierre; Hatzfeld, Jacques A

    2011-01-01

    We present a strategy to identify developmental/differentiation and plasma membrane marker genes of the most primitive human Mesenchymal Stem Cells (hMSCs). Using sensitive and quantitative TaqMan Low Density Arrays (TLDA) methodology, we compared the expression of 381 genes in human Embryonic Stem Cells (hESCs), hESC-derived MSCs (hES-MSCs), and hMSCs. Analysis of differentiation genes indicated that hES-MSCs express the sarcomeric muscle lineage in addition to the classical mesenchymal lineages, suggesting they are more primitive than hMSCs. Transcript analysis of membrane antigens suggests that IL1R1(low), BMPR1B(low), FLT4(low), LRRC32(low), and CD34 may be good candidates for the detection and isolation of the most primitive hMSCs. The expression in hMSCs of cytokine genes, such as IL6, IL8, or FLT3LG, without expression of the corresponding receptor, suggests a role for these cytokines in the paracrine control of stem cell niches. Our database may be shared with other laboratories in order to explore the considerable clinical potential of hES-MSCs, which appear to represent an intermediate developmental stage between hESCs and hMSCs.

  6. Clinicopathological analysis in PTCL-NOS with CADM1 expression.

    PubMed

    Kato, Takeharu; Miyoshi, Hiroaki; Kobayashi, Seiichiro; Yoshida, Noriaki; Imaizumi, Yoshitaka; Seto, Masao; Uchimaru, Kaoru; Miyazaki, Yasushi; Ohshima, Koichi

    2017-11-01

    Peripheral T cell lymphoma, not otherwise specified (PTCL-NOS), is a heterogeneous disease with respect to clinicopathological features. Cell adhesion molecule 1 (CADM1) has been reported to be ectopically expressed in adult T cell leukaemia/lymphoma (ATLL). However, the frequency of CADM1 expression remains unknown in peripheral T cell lymphomas. In the current study, CADM1 expression was analysed in 88 PTCL-NOS patients. CADM1 was expressed in 14 of 88 (15.9%) PTCL-NOS cases, and its expression was associated with C-C chemokine receptor type 4 (CCR4) expression and nuclear atypia. CADM1-positive PTCL-NOS cases (10/74) had a significantly poorer prognosis than CADM1-negative cases (64/74) (P = 0.001). Multivariate analysis confirmed that CADM1 expression was an independent prognostic factor in PTCL-NOS. These findings suggest that CADM1 expression is a novel prognostic factor for PTCL-NOS.

  7. Quantitative Proteomic and Microarray Analysis of the Archaeon Methanosarcina Acetivorans Grown with Acetate Versus Methanol*

    PubMed Central

    Li, Lingyun; Li, Qingbo; Rohlin, Lars; Kim, UnMi; Salmon, Kirsty; Rejtar, Tomas; Gunsalus, Robert P.; Karger, Barry L.; Ferry, James G.

    2008-01-01

    Summary Methanosarcina acetivorans strain C2A is an acetate- and methanol-utilizing methane-producing organism for which the genome, the largest yet sequenced among the Archaea, reveals extensive physiological diversity. LC linear ion trap-FTICR mass spectrometry was employed to analyze acetate- vs. methanol-grown cells metabolically labeled with 14N vs. 15N, respectively, to obtain quantitative protein abundance ratios. DNA microarray analyses of acetate- vs. methanol-grown cells was also performed to determine gene expression ratios. The combined approaches were highly complementary, extending the physiological understanding of growth and methanogenesis. Of the 1081 proteins detected, 255 were ≥ 3-fold differentially abundant. DNA microarray analysis revealed 410 genes that were ≥ 2.5-fold differentially expressed of 1972 genes with detected expression. The ratios of differentially abundant proteins were in good agreement with expression ratios of the encoding genes. Taken together, the results suggest several novel roles for electron transport components specific to acetate-grown cells, including two flavodoxins each specific for growth on acetate or methanol. Protein abundance ratios indicated that duplicate CO dehydrogenase/acetyl-CoA complexes function in the conversion of acetate to methane. Surprisingly, the protein abundance and gene expression ratios indicated a general stress response in acetate- vs. methanol-grown cells that included enzymes specific for polyphosphate accumulation and oxidative stress. The microarray analysis identified transcripts of several genes encoding regulatory proteins with identity to the PhoU, MarR, GlnK, and TetR families commonly found in the Bacteria domain. An analysis of neighboring genes suggested roles in controlling phosphate metabolism (PhoU), ammonia assimilation (GlnK), and molybdopterin cofactor biosynthesis (TetR). Finally, the proteomic and microarray results suggested roles for two-component regulatory systems specific for each growth substrate. PMID:17269732

  8. The Role of Vitamin D in the Transcriptional Program of Human Pregnancy

    PubMed Central

    Al-Garawi, Amal; Carey, Vincent J.; Chhabra, Divya; Morrow, Jarrett; Lasky-Su, Jessica; Qiu, Weiliang; Laranjo, Nancy; Litonjua, Augusto A.; Weiss, Scott T.

    2016-01-01

    Background Patterns of gene expression of human pregnancy are poorly understood. In a trial of vitamin D supplementation in pregnant women, peripheral blood transcriptomes were measured longitudinally on 30 women and used to characterize gene co-expression networks. Objective Studies suggest that increased maternal Vitamin D levels may reduce the risk of asthma in early life, yet the underlying mechanisms have not been examined. In this study, we used a network-based approach to examine changes in gene expression profiles during the course of normal pregnancy and evaluated their association with maternal Vitamin D levels. Design The VDAART study is a randomized clinical trial of vitamin D supplementation in pregnancy for reduction of pediatric asthma risk. The trial enrolled 881 women at 10–18 weeks of gestation. Longitudinal gene expression measures were obtained on thirty pregnant women, using RNA isolated from peripheral blood samples obtained in the first and third trimesters. Differentially expressed genes were identified using significance of analysis of microarrays (SAM), and clustered using a weighted gene co-expression network analysis (WGCNA). Gene-set enrichment was performed to identify major biological pathways. Results Comparison of transcriptional profiles between first and third trimesters of pregnancy identified 5839 significantly differentially expressed genes (FDR<0.05). Weighted gene co-expression network analysis clustered these transcripts into 14 co-expression modules of which two showed significant correlation with maternal vitamin D levels. Pathway analysis of these two modules revealed genes enriched in immune defense pathways and extracellular matrix reorganization as well as genes enriched in notch signaling and transcription factor networks. Conclusion Our data show that gene expression profiles of healthy pregnant women change during the course of pregnancy and suggest that maternal Vitamin D levels influence transcriptional profiles. These alterations of the maternal transcriptome may contribute to fetal immune imprinting and reduce allergic sensitization in early life. Trial Registration clinicaltrials.gov NCT00920621 PMID:27711190

  9. Profiling of experiential pleasure, emotional regulation and emotion expression in patients with schizophrenia.

    PubMed

    Zou, Ying-Min; Ni, Ke; Yang, Zhuo-Ya; Li, Ying; Cai, Xin-Lu; Xie, Dong-Jie; Zhang, Rui-Ting; Zhou, Fu-Chun; Li, Wen-Xiu; Lui, Simon S Y; Shum, David H K; Cheung, Eric F C; Chan, Raymond C K

    2018-05-01

    Emotion deficits may be the basis of negative symptoms in schizophrenia patients and they are prevalent in these patients. However, inconsistent findings about emotion deficits in schizophrenia suggest that there may be subtypes. The present study aimed to examine and profile experiential pleasure, emotional regulation and expression in patients with schizophrenia. A set of checklists specifically capturing experiential pleasure, emotional regulation, emotion expression, depressive symptoms and anhedonia were administered to 146 in-patients with schizophrenia and 73 demographically-matched healthy controls. Psychiatric symptoms and negative symptoms were also evaluated by a trained psychiatrist for patients with schizophrenia. Two-stage cluster analysis and discriminant function analysis were used to analyze the profile of these measures in patients with schizophrenia. We found a three-cluster solution. Cluster 1 (n=41) was characterized by a deficit in experiential pleasure and emotional regulation, Cluster 2 (n=47) was characterized by a general deficit in experiential pleasure, emotional regulation and emotion expression, and Cluster 3 (n=57) was characterized by a deficit in emotion expression. Results of a discriminant function analysis indicated that the three groups were reasonably discrete. The present findings suggest that schizophrenia patients can be classified into three subtypes based on experiential pleasure, emotional regulation and emotion expression, which are characterized by distinct clinical representations. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. Characterization of X Chromosome Inactivation Using Integrated Analysis of Whole-Exome and mRNA Sequencing

    PubMed Central

    Szelinger, Szabolcs; Malenica, Ivana; Corneveaux, Jason J.; Siniard, Ashley L.; Kurdoglu, Ahmet A.; Ramsey, Keri M.; Schrauwen, Isabelle; Trent, Jeffrey M.; Narayanan, Vinodh; Huentelman, Matthew J.; Craig, David W.

    2014-01-01

    In females, X chromosome inactivation (XCI) is an epigenetic, gene dosage compensatory mechanism by inactivation of one copy of X in cells. Random XCI of one of the parental chromosomes results in an approximately equal proportion of cells expressing alleles from either the maternally or paternally inherited active X, and is defined by the XCI ratio. Skewed XCI ratio is suggestive of non-random inactivation, which can play an important role in X-linked genetic conditions. Current methods rely on indirect, semi-quantitative DNA methylation-based assay to estimate XCI ratio. Here we report a direct approach to estimate XCI ratio by integrated, family-trio based whole-exome and mRNA sequencing using phase-by-transmission of alleles coupled with allele-specific expression analysis. We applied this method to in silico data and to a clinical patient with mild cognitive impairment but no clear diagnosis or understanding molecular mechanism underlying the phenotype. Simulation showed that phased and unphased heterozygous allele expression can be used to estimate XCI ratio. Segregation analysis of the patient's exome uncovered a de novo, interstitial, 1.7 Mb deletion on Xp22.31 that originated on the paternally inherited X and previously been associated with heterogeneous, neurological phenotype. Phased, allelic expression data suggested an 83∶20 moderately skewed XCI that favored the expression of the maternally inherited, cytogenetically normal X and suggested that the deleterious affect of the de novo event on the paternal copy may be offset by skewed XCI that favors expression of the wild-type X. This study shows the utility of integrated sequencing approach in XCI ratio estimation. PMID:25503791

  11. Genome-wide analysis of transcription factors during somatic embryogenesis in banana (Musa spp.) cv. Grand Naine.

    PubMed

    Shivani; Awasthi, Praveen; Sharma, Vikrant; Kaur, Navjot; Kaur, Navneet; Pandey, Pankaj; Tiwari, Siddharth

    2017-01-01

    Transcription factors BABY BOOM (BBM), WUSCHEL (WUS), BSD, LEAFY COTYLEDON (LEC), LEAFY COTYLEDON LIKE (LIL), VIVIPAROUS1 (VP1), CUP SHAPED COTYLEDONS (CUC), BOLITA (BOL), and AGAMOUS LIKE (AGL) play a crucial role in somatic embryogenesis. In this study, we identified eighteen genes of these nine transcription factors families from the banana genome database. All genes were analyzed for their structural features, subcellular, and chromosomal localization. Protein sequence analysis indicated the presence of characteristic conserved domains in these transcription factors. Phylogenetic analysis revealed close evolutionary relationship among most transcription factors of various monocots. The expression patterns of eighteen genes in embryogenic callus containing somatic embryos (precisely isolated by Laser Capture Microdissection), non-embryogenic callus, and cell suspension cultures of banana cultivar Grand Naine were analyzed. The application of 2, 4-dichlorophenoxyacetic acid (2, 4-D) in the callus induction medium enhanced the expression of MaBBM1, MaBBM2, MaWUS2, and MaVP1 in the embryogenic callus. It suggested 2, 4-D acts as an inducer for the expression of these genes. The higher expression of MaBBM2 and MaWUS2 in embryogenic cell suspension (ECS) as compared to non-embryogenic cells suspension (NECS), suggested that these genes may play a crucial role in banana somatic embryogenesis. MaVP1 showed higher expression in both ECS and NECS, whereas MaLEC2 expression was significantly higher in NECS. It suggests that MaLEC2 has a role in the development of non-embryogenic cells. We postulate that MaBBM2 and MaWUS2 can be served as promising molecular markers for the embryogencity in banana.

  12. Genome-wide analysis of transcription factors during somatic embryogenesis in banana (Musa spp.) cv. Grand Naine

    PubMed Central

    Shivani; Awasthi, Praveen; Sharma, Vikrant; Kaur, Navjot; Kaur, Navneet; Pandey, Pankaj

    2017-01-01

    Transcription factors BABY BOOM (BBM), WUSCHEL (WUS), BSD, LEAFY COTYLEDON (LEC), LEAFY COTYLEDON LIKE (LIL), VIVIPAROUS1 (VP1), CUP SHAPED COTYLEDONS (CUC), BOLITA (BOL), and AGAMOUS LIKE (AGL) play a crucial role in somatic embryogenesis. In this study, we identified eighteen genes of these nine transcription factors families from the banana genome database. All genes were analyzed for their structural features, subcellular, and chromosomal localization. Protein sequence analysis indicated the presence of characteristic conserved domains in these transcription factors. Phylogenetic analysis revealed close evolutionary relationship among most transcription factors of various monocots. The expression patterns of eighteen genes in embryogenic callus containing somatic embryos (precisely isolated by Laser Capture Microdissection), non-embryogenic callus, and cell suspension cultures of banana cultivar Grand Naine were analyzed. The application of 2, 4-dichlorophenoxyacetic acid (2, 4-D) in the callus induction medium enhanced the expression of MaBBM1, MaBBM2, MaWUS2, and MaVP1 in the embryogenic callus. It suggested 2, 4-D acts as an inducer for the expression of these genes. The higher expression of MaBBM2 and MaWUS2 in embryogenic cell suspension (ECS) as compared to non-embryogenic cells suspension (NECS), suggested that these genes may play a crucial role in banana somatic embryogenesis. MaVP1 showed higher expression in both ECS and NECS, whereas MaLEC2 expression was significantly higher in NECS. It suggests that MaLEC2 has a role in the development of non-embryogenic cells. We postulate that MaBBM2 and MaWUS2 can be served as promising molecular markers for the embryogencity in banana. PMID:28797040

  13. Microarray-based gene expression analysis of strong seed dormancy in rice cv. N22 and less dormant mutant derivatives.

    PubMed

    Wu, Tao; Yang, Chunyan; Ding, Baoxu; Feng, Zhiming; Wang, Qian; He, Jun; Tong, Jianhua; Xiao, Langtao; Jiang, Ling; Wan, Jianmin

    2016-02-01

    Seed dormancy in rice is an important trait related to the pre-harvest sprouting resistance. In order to understand the molecular mechanisms of seed dormancy, gene expression was investigated by transcriptome analysis using seeds of the strongly dormant cultivar N22 and its less dormant mutants Q4359 and Q4646 at 24 days after heading (DAH). Microarray data revealed more differentially expressed genes in Q4359 than in Q4646 compared to N22. Most genes differing between Q4646 and N22 also differed between Q4359 and N22. GO analysis of genes differentially expressed in both Q4359 and Q4646 revealed that some genes such as those for starch biosynthesis were repressed, whereas metabolic genes such as those for carbohydrate metabolism were enhanced in Q4359 and Q4646 seeds relative to N22. Expression of some genes involved in cell redox homeostasis and chromatin remodeling differed significantly only between Q4359 and N22. The results suggested a close correlation between cell redox homeostasis, chromatin remodeling and seed dormancy. In addition, some genes involved in ABA signaling were down-regulated, and several genes involved in GA biosynthesis and signaling were up-regulated. These observations suggest that reduced seed dormancy in Q4359 was regulated by ABA-GA antagonism. A few differentially expressed genes were located in the regions containing qSdn-1 and qSdn-5 suggesting that they could be candidate genes underlying seed dormancy. Our work provides useful leads to further determine the underling mechanisms of seed dormancy and for cloning seed dormancy genes from N22. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

  14. Prognostic value of long non-coding RNA CCAT1 expression in patients with cancer: A meta-analysis.

    PubMed

    Shi, Deyao; Wu, Fashuai; Gao, Feng; Qing, Xiangcheng; Shao, Zengwu

    2017-01-01

    LncRNA CCAT1 is significantly overexpressed in various types of cancers, suggesting that it might be associated with prognosis and clinicopathological features in patients with cancer. A comprehensive search was performed in Pubmed, Web of Science, OVID and CNKI databases. We also retrieved articles from other sources, such as retrieving from the reference lists of relevant articles. Eligible studies were included based on defined exclusion and inclusion criteria to perform a meta-analysis. STATA 14.0 was used to estimate pooled hazard ratios (HRs) with 95% confidence interval (95% CI), the heterogeneity among studies and publication bias to judge the prognostic value. A total of 1587 patients from 11 eligible studies were included in the meta-analysis. The results showed that high expression level of CCAT1 was significantly associated with shorter overall survival in cancer patients (HR 2.335, 95% CI:1.551-3.517); in the subgroup analysis, region (China or UK), sample size (more or less than 100), type of cancer (digestive or non-digestive disease) and paper quality (score more or less than 7) did not alter the association between CCAT1 expression and cancer prognosis but preoperative treatment did. And CCAT1 expression was an independent prognostic marker for overall survival in patients with cancer (pooled HR 2.195, 95%CI:1.316-3.664) using Cox multivariate analyses. The clinicopathological parameters analysis further showed that increased expression level of CCAT1 was correlated with tumor size, lymph node metastasis, TNM stage, distant metastasis, microvascular invasion and capsular formation in relevant cancers. The meta-analysis results from present study suggested that increased expression level of CCAT1 was associated with poor prognosis and can serve as an independent biomarker. And the expression level of CCAT1 was associated with clinicopathological features in relevant cancers.

  15. High Rab27A expression indicates favorable prognosis in CRC.

    PubMed

    Shi, Chuanbing; Yang, Xiaojun; Ni, Yijiang; Hou, Ning; Xu, Li; Zhan, Feng; Zhu, Huijun; Xiong, Lin; Chen, Pingsheng

    2015-06-13

    Rab27A is a peculiar member in Rab family and has been suggested to play essential roles in the development of human cancers. However, the association between Rab27A expression and clinicopathological characteristics of colorectal cancer (CRC) has not been elucidated yet. One-step quantitative real-time polymerase chain reaction (qPCR) test with 18 fresh-frozen CRC samples and immunohistochemistry (IHC) analysis in 112 CRC cases were executed to evaluate the relationship between Rab27A expression and the clinicopathological features of CRC. Cox regression and Kaplan-Meier survival analyses were performed to identify the prognostic factors for 112 CRC patients. The results specified that the expression levels of Rab27A mRNA and protein were significantly higher in CRC tissues than that in matched non-cancerous tissues, in both qPCR test (p = 0.029) and IHC analysis (p = 0.020). The IHC data indicated that the Rab27A protein expression in CRC was statistically correlated with lymph node metastasis (p = 0.022) and TNM stage (p = 0.026). Cox multi-factor analysis and Kaplan-Meier method suggested Rab27A protein expression (p = 0.012) and tumor differentiation (p = 0.004) were significantly associated with the overall survival of CRC patients. The data indicated the differentiate expression of Rab27A in CRC tissues and matched non-cancerous tissues. Rab27A may be used as a valuable prognostic biomarker for CRC patients.

  16. Genome-wide analysis of starch metabolism genes in potato (Solanum tuberosum L.).

    PubMed

    Van Harsselaar, Jessica K; Lorenz, Julia; Senning, Melanie; Sonnewald, Uwe; Sonnewald, Sophia

    2017-01-05

    Starch is the principle constituent of potato tubers and is of considerable importance for food and non-food applications. Its metabolism has been subject of extensive research over the past decades. Despite its importance, a description of the complete inventory of genes involved in starch metabolism and their genome organization in potato plants is still missing. Moreover, mechanisms regulating the expression of starch genes in leaves and tubers remain elusive with regard to differences between transitory and storage starch metabolism, respectively. This study aimed at identifying and mapping the complete set of potato starch genes, and to study their expression pattern in leaves and tubers using different sets of transcriptome data. Moreover, we wanted to uncover transcription factors co-regulated with starch accumulation in tubers in order to get insight into the regulation of starch metabolism. We identified 77 genomic loci encoding enzymes involved in starch metabolism. Novel isoforms of many enzymes were found. Their analysis will help to elucidate mechanisms of starch biosynthesis and degradation. Expression analysis of starch genes led to the identification of tissue-specific isoenzymes suggesting differences in the transcriptional regulation of starch metabolism between potato leaf and tuber tissues. Selection of genes predominantly expressed in developing potato tubers and exhibiting an expression pattern indicative for a role in starch biosynthesis enabled the identification of possible transcriptional regulators of tuber starch biosynthesis by co-expression analysis. This study provides the annotation of the complete set of starch metabolic genes in potato plants and their genomic localizations. Novel, so far undescribed, enzyme isoforms were revealed. Comparative transcriptome analysis enabled the identification of tuber- and leaf-specific isoforms of starch genes. This finding suggests distinct regulatory mechanisms in transitory and storage starch metabolism. Putative regulatory proteins of starch biosynthesis in potato tubers have been identified by co-expression and their expression was verified by quantitative RT-PCR.

  17. Integration of QTL and bioinformatic tools to identify candidate genes for triglycerides in mice[S

    PubMed Central

    Leduc, Magalie S.; Hageman, Rachael S.; Verdugo, Ricardo A.; Tsaih, Shirng-Wern; Walsh, Kenneth; Churchill, Gary A.; Paigen, Beverly

    2011-01-01

    To identify genetic loci influencing lipid levels, we performed quantitative trait loci (QTL) analysis between inbred mouse strains MRL/MpJ and SM/J, measuring triglyceride levels at 8 weeks of age in F2 mice fed a chow diet. We identified one significant QTL on chromosome (Chr) 15 and three suggestive QTL on Chrs 2, 7, and 17. We also carried out microarray analysis on the livers of parental strains of 282 F2 mice and used these data to find cis-regulated expression QTL. We then narrowed the list of candidate genes under significant QTL using a “toolbox” of bioinformatic resources, including haplotype analysis; parental strain comparison for gene expression differences and nonsynonymous coding single nucleotide polymorphisms (SNP); cis-regulated eQTL in livers of F2 mice; correlation between gene expression and phenotype; and conditioning of expression on the phenotype. We suggest Slc25a7 as a candidate gene for the Chr 7 QTL and, based on expression differences, five genes (Polr3 h, Cyp2d22, Cyp2d26, Tspo, and Ttll12) as candidate genes for Chr 15 QTL. This study shows how bioinformatics can be used effectively to reduce candidate gene lists for QTL related to complex traits. PMID:21622629

  18. Variable directionality of gene expression changes across generations does not constitute negative evidence of epigenetic inheritance.

    PubMed

    Sharma, Abhay

    2015-01-01

    Transgenerational epigenetic inheritance in mammals has been controversial due to inherent difficulties in its experimental demonstration. A recent report has, however, opened a new front in the ongoing debate by claiming that endocrine disrupting chemicals, contrary to previous findings, do not cause effects across generations. This claim is based on the observation that gene expression changes induced by these chemicals in the exposed and unexposed generations are mainly in the opposite direction. This analysis shows that the pattern of gene expression reported in the two generations is not expected by chance and is suggestive of transmission across generations. A meta-analysis of diverse data sets related to endocrine disruptor-induced transgenerational gene expression alterations, including the data provided in the said report, further suggests that effects of endocrine disrupting chemicals persist in unexposed generations. Based on the prior evidence of phenotypic variability and gene expression alterations in opposite direction between generations, it is argued here that calling evidence of mismatched directionality in gene expression in experiments testing potential of environmental agents in inducing epigenetic inheritance of phenotypic traits as negative is untenable. This is expected to settle the newly raised doubts over epigenetic inheritance in mammals.

  19. Hypoxia-inducible factor 1–mediated human GATA1 induction promotes erythroid differentiation under hypoxic conditions

    PubMed Central

    Zhang, Feng-Lin; Shen, Guo-Min; Liu, Xiao-Ling; Wang, Fang; Zhao, Ying-Ze; Zhang, Jun-Wu

    2012-01-01

    Abstract Hypoxia-inducible factor promotes erythropoiesis through coordinated cell type–specific hypoxia responses. GATA1 is essential to normal erythropoiesis and plays a crucial role in erythroid differentiation. In this study, we show that hypoxia-induced GATA1 expression is mediated by HIF1 in erythroid cells. Under hypoxic conditions, significantly increased GATA1 mRNA and protein levels were detected in K562 cells and erythroid induction cultures of CD34+ haematopoietic stem/progenitor cells. Enforced HIF1α expression increased GATA1 expression, while HIF1α knockdown by RNA interference decreased GATA1 expression. In silico analysis revealed one potential hypoxia response element (HRE). The results from reporter gene and mutation analysis suggested that this element is necessary for hypoxic response. Chromatin immunoprecipitation (ChIP)-PCR showed that the putative HRE was recognized and bound by HIF1 in vivo. These results demonstrate that the up-regulation of GATA1 during hypoxia is directly mediated by HIF1.The mRNA expression of some erythroid differentiation markers was increased under hypoxic conditions, but decreased with RNA interference of HIF1α or GATA1. Flow cytometry analysis also indicated that hypoxia, desferrioxamine or CoCl2 induced expression of erythroid surface markers CD71 and CD235a, while expression repression of HIF1α or GATA1 by RNA interference led to a decreased expression of CD235a. These results suggested that HIF1-mediated GATA1 up-regulation promotes erythropoiesis in order to satisfy the needs of an organism under hypoxic conditions. PMID:22050843

  20. Brain Responses to Dynamic Facial Expressions: A Normative Meta-Analysis.

    PubMed

    Zinchenko, Oksana; Yaple, Zachary A; Arsalidou, Marie

    2018-01-01

    Identifying facial expressions is crucial for social interactions. Functional neuroimaging studies show that a set of brain areas, such as the fusiform gyrus and amygdala, become active when viewing emotional facial expressions. The majority of functional magnetic resonance imaging (fMRI) studies investigating face perception typically employ static images of faces. However, studies that use dynamic facial expressions (e.g., videos) are accumulating and suggest that a dynamic presentation may be more sensitive and ecologically valid for investigating faces. By using quantitative fMRI meta-analysis the present study examined concordance of brain regions associated with viewing dynamic facial expressions. We analyzed data from 216 participants that participated in 14 studies, which reported coordinates for 28 experiments. Our analysis revealed bilateral fusiform and middle temporal gyri, left amygdala, left declive of the cerebellum and the right inferior frontal gyrus. These regions are discussed in terms of their relation to models of face processing.

  1. Characterization of a Crabs Claw Gene in basal eudicot species Epimedium sagittatum (Berberidaceae).

    PubMed

    Sun, Wei; Huang, Wenjun; Li, Zhineng; Lv, Haiyan; Huang, Hongwen; Wang, Ying

    2013-01-08

    The Crabs Claw (CRC) YABBY gene is required for regulating carpel development in angiosperms and has played an important role in nectary evolution during core eudicot speciation. The function or expression of CRC-like genes has been explored in two basal eudicots, Eschscholzia californica and Aquilegia formosa. To further investigate the function of CRC orthologous genes related to evolution of carpel and nectary development in basal eudicots, a CRC ortholog, EsCRC, was isolated and characterized from Epimedium sagittatum (Sieb. and Zucc.) Maxim. A phylogenetic analysis of EsCRC and previously identified CRC-like genes placed EsCRC within the basal eudicot lineage. Gene expression results suggest that EsCRC is involved in the development of sepals and carpels, but not nectaries. Phenotypic complementation of the Arabidopsis mutant crc-1 was achieved by constitutive expression of EsCRC. In addition, over-expression of EsCRC in Arabidopsis and tobacco gave rise to abaxially curled leaves. Transgenic results together with the gene expression analysis suggest that EsCRC may maintain a conserved function in carpel development and also play a novel role related to sepal formation. Absence of EsCRC and ElCRC expression in nectaries further indicates that nectary development in non-core eudicots is unrelated to expression of CRC-like genes.

  2. Characterization of a Crabs Claw Gene in Basal Eudicot Species Epimedium sagittatum (Berberidaceae)

    PubMed Central

    Sun, Wei; Huang, Wenjun; Li, Zhineng; Lv, Haiyan; Huang, Hongwen; Wang, Ying

    2013-01-01

    The Crabs Claw (CRC) YABBY gene is required for regulating carpel development in angiosperms and has played an important role in nectary evolution during core eudicot speciation. The function or expression of CRC-like genes has been explored in two basal eudicots, Eschscholzia californica and Aquilegia formosa. To further investigate the function of CRC orthologous genes related to evolution of carpel and nectary development in basal eudicots, a CRC ortholog, EsCRC, was isolated and characterized from Epimedium sagittatum (Sieb. and Zucc.) Maxim. A phylogenetic analysis of EsCRC and previously identified CRC-like genes placed EsCRC within the basal eudicot lineage. Gene expression results suggest that EsCRC is involved in the development of sepals and carpels, but not nectaries. Phenotypic complementation of the Arabidopsis mutant crc-1 was achieved by constitutive expression of EsCRC. In addition, over-expression of EsCRC in Arabidopsis and tobacco gave rise to abaxially curled leaves. Transgenic results together with the gene expression analysis suggest that EsCRC may maintain a conserved function in carpel development and also play a novel role related to sepal formation. Absence of EsCRC and ElCRC expression in nectaries further indicates that nectary development in non-core eudicots is unrelated to expression of CRC-like genes. PMID:23299438

  3. Gene expression profiling combined with bioinformatics analysis identify biomarkers for Parkinson disease.

    PubMed

    Diao, Hongyu; Li, Xinxing; Hu, Sheng; Liu, Yunhui

    2012-01-01

    Parkinson disease (PD) progresses relentlessly and affects approximately 4% of the population aged over 80 years old. It is difficult to diagnose in its early stages. The purpose of our study is to identify molecular biomarkers for PD initiation using a computational bioinformatics analysis of gene expression. We downloaded the gene expression profile of PD from Gene Expression Omnibus and identified differentially coexpressed genes (DCGs) and dysfunctional pathways in PD patients compared to controls. Besides, we built a regulatory network by mapping the DCGs to known regulatory data between transcription factors (TFs) and target genes and calculated the regulatory impact factor of each transcription factor. As the results, a total of 1004 genes associated with PD initiation were identified. Pathway enrichment of these genes suggests that biological processes of protein turnover were impaired in PD. In the regulatory network, HLF, E2F1 and STAT4 were found have altered expression levels in PD patients. The expression levels of other transcription factors, NKX3-1, TAL1, RFX1 and EGR3, were not found altered. However, they regulated differentially expressed genes. In conclusion, we suggest that HLF, E2F1 and STAT4 may be used as molecular biomarkers for PD; however, more work is needed to validate our result.

  4. Gene Expression Profiling Combined with Bioinformatics Analysis Identify Biomarkers for Parkinson Disease

    PubMed Central

    Diao, Hongyu; Li, Xinxing; Hu, Sheng; Liu, Yunhui

    2012-01-01

    Parkinson disease (PD) progresses relentlessly and affects approximately 4% of the population aged over 80 years old. It is difficult to diagnose in its early stages. The purpose of our study is to identify molecular biomarkers for PD initiation using a computational bioinformatics analysis of gene expression. We downloaded the gene expression profile of PD from Gene Expression Omnibus and identified differentially coexpressed genes (DCGs) and dysfunctional pathways in PD patients compared to controls. Besides, we built a regulatory network by mapping the DCGs to known regulatory data between transcription factors (TFs) and target genes and calculated the regulatory impact factor of each transcription factor. As the results, a total of 1004 genes associated with PD initiation were identified. Pathway enrichment of these genes suggests that biological processes of protein turnover were impaired in PD. In the regulatory network, HLF, E2F1 and STAT4 were found have altered expression levels in PD patients. The expression levels of other transcription factors, NKX3-1, TAL1, RFX1 and EGR3, were not found altered. However, they regulated differentially expressed genes. In conclusion, we suggest that HLF, E2F1 and STAT4 may be used as molecular biomarkers for PD; however, more work is needed to validate our result. PMID:23284986

  5. Prognostic relevance of Centromere protein H expression in esophageal carcinoma.

    PubMed

    Guo, Xian-Zhi; Zhang, Ge; Wang, Jun-Ye; Liu, Wan-Li; Wang, Fang; Dong, Ju-Qin; Xu, Li-Hua; Cao, Jing-Yan; Song, Li-Bing; Zeng, Mu-Sheng

    2008-08-13

    Many kinetochore proteins have been shown to be associated with human cancers. The aim of the present study was to clarify the expression of Centromere protein H (CENP-H), one of the fundamental components of the human active kinetochore, in esophageal carcinoma and its correlation with clinicopathological features. We examined the expression of CENP-H in immortalized esophageal epithelial cells as well as in esophageal carcinoma cells, and in 12 cases of esophageal carcinoma tissues and the paired normal esophageal tissues by RT-PCR and Western blot analysis. In addition, we analyzed CENP-H protein expression in 177 clinicopathologically characterized esophageal carcinoma cases by immunohistochemistry. Statistical analyses were applied to test for prognostic and diagnostic associations. The level of CENP-H mRNA and protein were higher in the immortalized cells, cancer cell lines and most cancer tissues than in normal control tissues. Immunohistochemistry showed that CENP-H was expressed in 127 of 171 ESCC cases (74.3%) and in 3 of 6 esophageal adenocarcinoma cases (50%). Statistical analysis of ESCC cases showed that there was a significant difference of CENP-H expression in patients categorized according to gender (P = 0.013), stage (P = 0.023) and T classification (P = 0.019). Patients with lower CENP-H expression had longer overall survival time than those with higher CENP-H expression. Multivariate analysis suggested that CENP-H expression was an independent prognostic marker for esophageal carcinoma patients. A prognostic value of CENP-H was also found in the subgroup of T3 approximately T4 and N0 tumor classification. Our results suggest that CENP-H protein is a valuable marker of esophageal carcinoma progression. CENP-H might be used as a valuable prognostic marker for esophageal carcinoma patients.

  6. MSX-1 gene expression and regulation in embryonic palatal tissue.

    PubMed

    Nugent, P; Greene, R M

    1998-01-01

    The palatal cleft seen in Msx-1 knock-out mice suggests a role for this gene in normal palate development. The cleft is presumed secondary to tooth and jaw malformations, since in situ hybridization suggests that Msx-1 mRNA is not highly expressed in developing palatal tissue. In this study we demonstrate, by Northern blot analysis, the expression of Msx-1, but not Msx-2, in the developing palate and in primary cultures of murine embryonic palate mesenchymal cells. Furthermore, we propose a role for Msx-1 in retinoic acid-induced cleft palate, since retinoic acid inhibits Msx-1 mRNA expression in palate mesenchymal cells. We also demonstrate that transforming growth factor beta inhibits Msx-1 mRNA expression in palate mesenchymal cells, with retinoic acid and transforming growth factor beta acting synergistically when added simultaneously to these cells. These data suggest a mechanistic interaction between retinoic acid, transforming growth factor beta, and Msx-1 in the etiology of retinoic acid-induced cleft palate.

  7. Expression Analysis of the Theileria parva Subtelomere-Encoded Variable Secreted Protein Gene Family

    PubMed Central

    Schmied, Stéfanie; Affentranger, Sarah; Parvanova, Iana; Kang'a, Simon; Nene, Vishvanath; Katzer, Frank; McKeever, Declan; Müller, Joachim; Bishop, Richard; Pain, Arnab; Dobbelaere, Dirk A. E.

    2009-01-01

    Background The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs) form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm. Methodology/Principal Findings We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals. Conclusions Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic proteins. PMID:19325907

  8. HSP86 and HSP84 exhibit cellular specificity of expression and co-precipitate with an HSP70 family member in the murine testis

    NASA Technical Reports Server (NTRS)

    Gruppi, C. M.; Wolgemuth, D. J.

    1993-01-01

    This study extends to the protein level our previous observations, which had established the stage and cellular specificity of expression of hsp86 and hsp84 in the murine testis in the absence of exogenous stress. Immunoblot analysis was used to demonstrate that HSP86 protein was present throughout testicular development and that its levels increased with the appearance of differentiating germ cells. HSP86 was most abundant in the germ cell population and was present at significantly lower levels in the somatic cells. By contrast, the HSP84 protein was detected in the somatic cells of the testis rather than in germ cells. The steady-state levels of HSP86 and HSP84 paralleled the pattern of the expression of their respective mRNAs, suggesting that regulation at the level of translation was not a major mechanism controlling hsp90 gene expression in testicular cells. Immunoprecipitation analysis revealed that a 70-kDa protein coprecipitated with the HSP86/HSP84 proteins in testicular homogenates. This protein was identified as an HSP70 family member by immunoblot analysis, suggesting that HSP70 and HSP90 family members interact in testicular cells.

  9. Radiogenomics analysis identifies correlations of digital mammography with clinical molecular signatures in breast cancer.

    PubMed

    Tamez-Peña, Jose-Gerardo; Rodriguez-Rojas, Juan-Andrés; Gomez-Rueda, Hugo; Celaya-Padilla, Jose-Maria; Rivera-Prieto, Roxana-Alicia; Palacios-Corona, Rebeca; Garza-Montemayor, Margarita; Cardona-Huerta, Servando; Treviño, Victor

    2018-01-01

    In breast cancer, well-known gene expression subtypes have been related to a specific clinical outcome. However, their impact on the breast tissue phenotype has been poorly studied. Here, we investigate the association of imaging data of tumors to gene expression signatures from 71 patients with breast cancer that underwent pre-treatment digital mammograms and tumor biopsies. From digital mammograms, a semi-automated radiogenomics analysis generated 1,078 features describing the shape, signal distribution, and texture of tumors along their contralateral image used as control. From tumor biopsy, we estimated the OncotypeDX and PAM50 recurrence scores using gene expression microarrays. Then, we used multivariate analysis under stringent cross-validation to train models predicting recurrence scores. Few univariate features reached Spearman correlation coefficients above 0.4. Nevertheless, multivariate analysis yielded significantly correlated models for both signatures (correlation of OncotypeDX = 0.49 ± 0.07 and PAM50 = 0.32 ± 0.10 in stringent cross-validation and OncotypeDX = 0.83 and PAM50 = 0.78 for a unique model). Equivalent models trained from the unaffected contralateral breast were not correlated suggesting that the image signatures were tumor-specific and that overfitting was not a considerable issue. We also noted that models were improved by combining clinical information (triple negative status and progesterone receptor). The models used mostly wavelets and fractal features suggesting their importance to capture tumor information. Our results suggest that molecular-based recurrence risk and breast cancer subtypes have observable radiographic phenotypes. To our knowledge, this is the first study associating mammographic information to gene expression recurrence signatures.

  10. Radiogenomics analysis identifies correlations of digital mammography with clinical molecular signatures in breast cancer

    PubMed Central

    Tamez-Peña, Jose-Gerardo; Rodriguez-Rojas, Juan-Andrés; Gomez-Rueda, Hugo; Celaya-Padilla, Jose-Maria; Rivera-Prieto, Roxana-Alicia; Palacios-Corona, Rebeca; Garza-Montemayor, Margarita; Cardona-Huerta, Servando

    2018-01-01

    In breast cancer, well-known gene expression subtypes have been related to a specific clinical outcome. However, their impact on the breast tissue phenotype has been poorly studied. Here, we investigate the association of imaging data of tumors to gene expression signatures from 71 patients with breast cancer that underwent pre-treatment digital mammograms and tumor biopsies. From digital mammograms, a semi-automated radiogenomics analysis generated 1,078 features describing the shape, signal distribution, and texture of tumors along their contralateral image used as control. From tumor biopsy, we estimated the OncotypeDX and PAM50 recurrence scores using gene expression microarrays. Then, we used multivariate analysis under stringent cross-validation to train models predicting recurrence scores. Few univariate features reached Spearman correlation coefficients above 0.4. Nevertheless, multivariate analysis yielded significantly correlated models for both signatures (correlation of OncotypeDX = 0.49 ± 0.07 and PAM50 = 0.32 ± 0.10 in stringent cross-validation and OncotypeDX = 0.83 and PAM50 = 0.78 for a unique model). Equivalent models trained from the unaffected contralateral breast were not correlated suggesting that the image signatures were tumor-specific and that overfitting was not a considerable issue. We also noted that models were improved by combining clinical information (triple negative status and progesterone receptor). The models used mostly wavelets and fractal features suggesting their importance to capture tumor information. Our results suggest that molecular-based recurrence risk and breast cancer subtypes have observable radiographic phenotypes. To our knowledge, this is the first study associating mammographic information to gene expression recurrence signatures. PMID:29596496

  11. Alterations in the lenticular protein profile in experimental selenite-induced cataractogenesis and prevention by ellagic acid.

    PubMed

    Sakthivel, Muniyan; Geraldine, Pitchairaj; Thomas, Philip A

    2011-08-01

    Accumulating evidence suggests that oxidative stress underlies age-related formation of cataract, and that antioxidants retard cataractogenesis. This study aimed to evaluate whether ellagic acid, a natural polyphenol with antioxidant properties, prevents alterations in the lenticular protein profile in an experimental model of selenite cataract. Alterations in lenticular protein were determined by two-dimensional electrophoresis (2DE) and image analysis. Eluted αA-crystallin spots were analyzed by mass spectrometry. Western blot analysis was also performed to confirm the differential expression of certain crystallins and cytoskeletal proteins. In cataractous lenses, 2DE and image analysis revealed approximately 45 and 60 prominent spots in soluble and insoluble protein fractions respectively. Analysis of the pI and molecular weight of protein spots revealed differences in the expression of crystallin proteins in soluble and insoluble fractions. Western blot analysis confirmed changes in the expression of αA- and βB1- crystallins in both soluble and insoluble protein fractions, while mass spectrometry confirmed the degradation of αA-crystallin in selenite cataractous lenses. Western blot analysis also confirmed the occurrence of altered expression of certain cytoskeletal proteins in insoluble fractions. However, the lenticular protein profile in lenses from selenite-challenged, ellagic acid-treated rats was essentially similar to that noted in lenses from normal rats. The present study confirms the importance of structural and cytoskeletal proteins in the maintenance of lenticular transparency; the results also suggest that ellagic acid prevents lenticular protein alterations induced by selenite in an experimental setting.

  12. Genome-wide classification, evolutionary analysis and gene expression patterns of the kinome in Gossypium

    PubMed Central

    Yan, Jun; Li, Guilin; Guo, Xingqi; Li, Yang; Cao, Xuecheng

    2018-01-01

    The protein kinase (PK, kinome) family is one of the largest families in plants and regulates almost all aspects of plant processes, including plant development and stress responses. Despite their important functions, comprehensive functional classification, evolutionary analysis and expression patterns of the cotton PK gene family has yet to be performed on PK genes. In this study, we identified the cotton kinomes in the Gossypium raimondii, Gossypium arboretum, Gossypium hirsutum and Gossypium barbadense genomes and classified them into 7 groups and 122–24 subfamilies using software HMMER v3.0 scanning and neighbor-joining (NJ) phylogenetic analysis. Some conserved exon-intron structures were identified not only in cotton species but also in primitive plants, ferns and moss, suggesting the significant function and ancient origination of these PK genes. Collinearity analysis revealed that 16.6 million years ago (Mya) cotton-specific whole genome duplication (WGD) events may have played a partial role in the expansion of the cotton kinomes, whereas tandem duplication (TD) events mainly contributed to the expansion of the cotton RLK group. Synteny analysis revealed that tetraploidization of G. hirsutum and G. barbadense contributed to the expansion of G. hirsutum and G. barbadense PKs. Global expression analysis of cotton PKs revealed stress-specific and fiber development-related expression patterns, suggesting that many cotton PKs might be involved in the regulation of the stress response and fiber development processes. This study provides foundational information for further studies on the evolution and molecular function of cotton PKs. PMID:29768506

  13. Expression and mutational analysis of Cip/Kip family in early glottic cancer.

    PubMed

    Kim, D-K; Lee, J H; Lee, O J; Park, C H

    2015-02-01

    Genetic alteration of cyclin-dependent kinase inhibitors has been associated with carcinogenesis mechanisms in various organs. This study aimed to evaluate the expression and mutational analysis of Cip/Kip family cyclin-dependent kinase inhibitors (p21CIP1/WAF1, p27KIP1 and p57KIP2) in early glottic cancer. Expressions of Cip/Kip family and p53 were determined by quantitative reverse transcription polymerase chain reaction and densitometry. For the analysis of p21 inactivation, sequence alteration was assessed using single-strand conformational polymorphism polymerase chain reaction. Additionally, the inactivation mechanism of p27 and p57 were investigated using DNA methylation analysis. Reduced expression of p27 and p57 were detected in all samples, whereas the expression of p21 was incompletely down-regulated in 6 of 11 samples. Additionally, single-strand conformational polymorphism polymerase chain reaction analysis showed the p53 mutation at exon 6. Methylation of p27 and p57 was detected by DNA methylation assay. Our results suggest that the Cip/Kip family may have a role as a molecular mechanism of carcinogenesis in early glottic cancer.

  14. Adolescent mouse takes on an active transcriptomic expression during postnatal cerebral development.

    PubMed

    Xu, Wei; Xin, Chengqi; Lin, Qiang; Ding, Feng; Gong, Wei; Zhou, Yuanyuan; Yu, Jun; Cui, Peng; Hu, Songnian

    2014-06-01

    Postnatal cerebral development is a complicated biological process precisely controlled by multiple genes. To understand the molecular mechanism of cerebral development, we compared dynamics of mouse cerebrum transcriptome through three developmental stages using high-throughput RNA-seq technique. Three libraries were generated from the mouse cerebrum at infancy, adolescence and adulthood, respectively. Consequently, 44,557,729 (infancy), 59,257,530 (adolescence) and 72,729,636 (adulthood) reads were produced, which were assembled into 15,344, 16,048 and 15,775 genes, respectively. We found that the overall gene expression level increased from infancy to adolescence and decreased later on upon reaching adulthood. The adolescence cerebrum has the most active gene expression, with expression of a large number of regulatory genes up-regulated and some crucial pathways activated. Transcription factor (TF) analysis suggested the similar dynamics as expression profiling, especially those TFs functioning in neurogenesis differentiation, oligodendrocyte lineage determination and circadian rhythm regulation. Moreover, our data revealed a drastic increase in myelin basic protein (MBP)-coding gene expression in adolescence and adulthood, suggesting that the brain myelin may be generated since mouse adolescence. In addition, differential gene expression analysis indicated the activation of rhythmic pathway, suggesting the function of rhythmic movement since adolescence; Furthermore, during infancy and adolescence periods, gene expression related to axonrepulsion and attraction showed the opposite trends, indicating that axon repulsion was activated after birth, while axon attraction might be activated at the embryonic stage and declined during the postnatal development. Our results from the present study may shed light on the molecular mechanism underlying the postnatal development of the mammalian cerebrum. Copyright © 2014. Production and hosting by Elsevier Ltd.

  15. Linguistic analysis of project ownership for undergraduate research experiences.

    PubMed

    Hanauer, D I; Frederick, J; Fotinakes, B; Strobel, S A

    2012-01-01

    We used computational linguistic and content analyses to explore the concept of project ownership for undergraduate research. We used linguistic analysis of student interview data to develop a quantitative methodology for assessing project ownership and applied this method to measure degrees of project ownership expressed by students in relation to different types of educational research experiences. The results of the study suggest that the design of a research experience significantly influences the degree of project ownership expressed by students when they describe those experiences. The analysis identified both positive and negative aspects of project ownership and provided a working definition for how a student experiences his or her research opportunity. These elements suggest several features that could be incorporated into an undergraduate research experience to foster a student's sense of project ownership.

  16. Are Women More Emotionally Skilled When It Comes to Expression of Emotions in the Foreign Language? Gender, Emotional Intelligence and Personality Traits in Relation to Emotional Expression in the L2

    ERIC Educational Resources Information Center

    Ozanska-Ponikwia, Katarzyna

    2017-01-01

    The present study investigates the link between gender, emotional intelligence (EI), personality traits and self-reported emotional expression in the second language (L2). Data analysis suggests that gender might not influence self-perceived emotional expression in the L2, as the results of the t-test show that both males and females declare…

  17. NKp44 expression, phylogenesis and function in non-human primate NK cells

    PubMed Central

    De Maria, Andrea; Ugolotti, Elisabetta; Rutjens, Erik; Mazza, Stefania; Radic, Luana; Faravelli, Alessandro; Koopman, Gerrit; Di Marco, Eddi; Costa, Paola; Ensoli, Barbara; Cafaro, Aurelio; Mingari, Maria Cristina; Moretta, Lorenzo; Heeney, Jonathan

    2009-01-01

    Molecular and functional characterization of the natural cytotoxicity receptor (NCR) NKp44 in species other than Homo sapiens has been elusive, so far. Here, we provide complete phenotypic, molecular and functional characterization for NKp44 triggering receptor on Pan troglodytes NK cells, the closest human relative, and the analysis of NKp44-genomic locus and transcription in Macaca fascicularis. Similar to H. sapiens, NKp44 expression is detectable on chimpanzee NK cells only upon activation. However, basal NKp44 transcription is 5-fold higher in chimpanzees with lower differential increases upon cell activation compared with humans. Upon activation, an overall 12-fold lower NKp44 gene expression is observed in P. troglodytes compared with H. sapiens NK cells with only a slight reduction in NKp44 surface expression. Functional analysis of ‘in vitro’ activated purified NK cells confirms the NKp44 triggering potential compared with other major NCRs. These findings suggest the presence of a post-transcriptional regulation that evolved differently in H. sapiens. Analysis of cynomolgus NKp44-genomic sequence and transcription pattern showed very low levels of transcription with occurrence of out-of-frame transcripts and no surface expression. The present comparative analysis suggests that NKp44-genomic organization appears during macaque speciation, with considerable evolution of its transcriptional and post-transcriptional tuning. Thus, NKp44 may represent an NCR being only recently emerged during speciation, acquiring functional relevance only in non-human primates closest to H. sapiens. PMID:19147838

  18. Positive Selection Underlies Faster-Z Evolution of Gene Expression in Birds

    PubMed Central

    Dean, Rebecca; Harrison, Peter W.; Wright, Alison E.; Zimmer, Fabian; Mank, Judith E.

    2015-01-01

    The elevated rate of evolution for genes on sex chromosomes compared with autosomes (Fast-X or Fast-Z evolution) can result either from positive selection in the heterogametic sex or from nonadaptive consequences of reduced relative effective population size. Recent work in birds suggests that Fast-Z of coding sequence is primarily due to relaxed purifying selection resulting from reduced relative effective population size. However, gene sequence and gene expression are often subject to distinct evolutionary pressures; therefore, we tested for Fast-Z in gene expression using next-generation RNA-sequencing data from multiple avian species. Similar to studies of Fast-Z in coding sequence, we recover clear signatures of Fast-Z in gene expression; however, in contrast to coding sequence, our data indicate that Fast-Z in expression is due to positive selection acting primarily in females. In the soma, where gene expression is highly correlated between the sexes, we detected Fast-Z in both sexes, although at a higher rate in females, suggesting that many positively selected expression changes in females are also expressed in males. In the gonad, where intersexual correlations in expression are much lower, we detected Fast-Z for female gene expression, but crucially, not males. This suggests that a large amount of expression variation is sex-specific in its effects within the gonad. Taken together, our results indicate that Fast-Z evolution of gene expression is the product of positive selection acting on recessive beneficial alleles in the heterogametic sex. More broadly, our analysis suggests that the adaptive potential of Z chromosome gene expression may be much greater than that of gene sequence, results which have important implications for the role of sex chromosomes in speciation and sexual selection. PMID:26067773

  19. Computational gene expression profiling under salt stress reveals patterns of co-expression

    PubMed Central

    Sanchita; Sharma, Ashok

    2016-01-01

    Plants respond differently to environmental conditions. Among various abiotic stresses, salt stress is a condition where excess salt in soil causes inhibition of plant growth. To understand the response of plants to the stress conditions, identification of the responsible genes is required. Clustering is a data mining technique used to group the genes with similar expression. The genes of a cluster show similar expression and function. We applied clustering algorithms on gene expression data of Solanum tuberosum showing differential expression in Capsicum annuum under salt stress. The clusters, which were common in multiple algorithms were taken further for analysis. Principal component analysis (PCA) further validated the findings of other cluster algorithms by visualizing their clusters in three-dimensional space. Functional annotation results revealed that most of the genes were involved in stress related responses. Our findings suggest that these algorithms may be helpful in the prediction of the function of co-expressed genes. PMID:26981411

  20. [Plasma proteomic analysis in children with infectious mononucleosis].

    PubMed

    Ran, Zhi-Ling; Xiao, Bin; Liu, Hong-Rui; Liu, You-Ping; Sheng, Qiao-Ni

    2015-03-01

    To explore the abnormal expression of plasma proteins by analysis of proteomic expression profile in children with infectious mononucleosis (IM). Two dimensional gel electrophoresis (2-DE) followed by the mass spectrometry was used to examine important protein spots with different expression levels between children with IM and normal controls. Seven differential proteins were obtained: hemopexin, vitamin D binding protein, fetuin A, C-reactive protein, apolipoprotein A, haptoglobin and transthyretin. Compared with the control group, haptoglobin showed a higher expression level in children with IM, and the expression levels of the other proteins were obviously down-regulated. The expression changes of differential proteins identified in this study are all related with the liver acute injury, suggesting that children with IM are associated with acute liver injury. Further studies on the characteristics of above proteins will contribute to the diagnosis and treatment of pediatric IM.

  1. Long noncoding RNA CCAT2 can predict metastasis and poor prognosis: A meta-analysis.

    PubMed

    Fan, Yang-Hua; Fang, Hua; Ji, Chen-Xing; Xie, Huan; Xiao, Bing; Zhu, Xin-Gen

    2017-03-01

    It has been reported that Colon cancer-associated transcript 2 (CCAT2) is dysregulated in various cancers. We performed this meta-analysis to clarify its promising functions as a prognosis marker in malignant tumors. Electronic databases, including PubMed, Medline, OVID, Cochrane Library, and Web of Science, were searched from inception to October 20, 2016. The hazard ratio (HR) and 95% confidence interval (CI) were calculated to explore the relationship between CCAT2 expression and survival, which were extracted from the eligible studies. The odds ratio (OR) was calculated to assess the association between CCAT2 expression and pathological parameters using RevMan5.3 software. Six original studies were included in this meta-analysis including 725 cancer patients. The pooled HR suggested that high CCAT2 expression was significantly correlated with overall survival (OS) (HR=2.30, 95% CI: 1.62-3.25, p<0.00001) in cancer patients. Subgroup analysis revealed a significant association between CCAT2 and OS in urogenital system (HR=1.70, 95% CI: 1.27-2.26, p<0.003) and non-urogenital system cancer patients (HR=3.18, 95% CI: 2.09-4.83, p<0.0001). A significant association was observed between high CCAT2 expression and poor progression-free survival (PFS) in cancer patients (pooled HR=2.76, 95% CI: 1.74-4.37). CCAT2 expression was significantly related to lymph node metastasis (LNM) (OR=4.33, 95% CI 2.03-9.22), distant metastasis (DM) (OR=11.66, 95% CI: 5.36-25.37) and tumor stage (OR=2.58, 95% CI 1.86-3.57). This meta-analysis demonstrated that high CCAT2 expression significantly predicts poor OS, poor PFS, LNM, DM and tumor stage, suggesting that high CCAT2 expression may serve as a novel biomarker for poor prognosis and metastasis in cancers. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Genome-wide characterization and analysis of bZIP transcription factor gene family related to abiotic stress in cassava.

    PubMed

    Hu, Wei; Yang, Hubiao; Yan, Yan; Wei, Yunxie; Tie, Weiwei; Ding, Zehong; Zuo, Jiao; Peng, Ming; Li, Kaimian

    2016-03-07

    The basic leucine zipper (bZIP) transcription factor family plays crucial roles in various aspects of biological processes. Currently, no information is available regarding the bZIP family in the important tropical crop cassava. Herein, 77 bZIP genes were identified from cassava. Evolutionary analysis indicated that MebZIPs could be divided into 10 subfamilies, which was further supported by conserved motif and gene structure analyses. Global expression analysis suggested that MebZIPs showed similar or distinct expression patterns in different tissues between cultivated variety and wild subspecies. Transcriptome analysis of three cassava genotypes revealed that many MebZIP genes were activated by drought in the root of W14 subspecies, indicating the involvement of these genes in the strong resistance of cassava to drought. Expression analysis of selected MebZIP genes in response to osmotic, salt, cold, ABA, and H2O2 suggested that they might participate in distinct signaling pathways. Our systematic analysis of MebZIPs reveals constitutive, tissue-specific and abiotic stress-responsive candidate MebZIP genes for further functional characterization in planta, yields new insights into transcriptional regulation of MebZIP genes, and lays a foundation for understanding of bZIP-mediated abiotic stress response.

  3. Co-expression Network Approach to Studying the Effects of Botulinum Neurotoxin-A.

    PubMed

    Mukund, Kavitha; Ward, Samuel R; Lieber, Richard L; Subramaniam, Shankar

    2017-10-16

    Botulinum Neurotoxin A (BoNT-A) is a potent neurotoxin with several clinical applications.The goal of this study was to utilize co-expression network theory to analyze temporal transcriptional data from skeletal muscle after BoNT-A treatment. Expression data for 2000 genes (extracted using a ranking heuristic) served as the basis for this analysis. Using weighted gene co-expression network analysis (WGCNA), we identified 19 co-expressed modules, further hierarchically clustered into 5 groups. Quantifying average expression and co-expression patterns across these groups revealed temporal aspects of muscle's response to BoNT-A. Functional analysis revealed enrichment of group 1 with metabolism; group 5 with contradictory functions of atrophy and cellular recovery; and groups 2 and 3 with extracellular matrix (ECM) and non-fast fiber isoforms. Topological positioning of two highly ranked, significantly expressed genes- Dclk1 and Ostalpha within group 5 suggested possible mechanistic roles in recovery from BoNT-A induced atrophy. Phenotypic correlations of groups with titin and myosin protein content further emphasized the effect of BoNT-A on the sarcomeric contraction machinery in early phase of chemodenervation. In summary, our approach revealed a hierarchical functional response to BoNT-A induced paralysis with early metabolic and later ECM responses and identified putative biomarkers associated with chemodenervation. Additionally, our results provide an unbiased validation of the response documented in our previous workBotulinum Neurotoxin A (BoNT-A) is a potent neurotoxin with several clinical applications.The goal of this study was to utilize co-expression network theory to analyze temporal transcriptional data from skeletal muscle after BoNT-A treatment. Expression data for 2000 genes (extracted using a ranking heuristic) served as the basis for this analysis. Using weighted gene co-expression network analysis (WGCNA), we identified 19 co-expressed modules, further hierarchically clustered into 5 groups. Quantifying average expression and co-expression patterns across these groups revealed temporal aspects of muscle's response to BoNT-A. Functional analysis revealed enrichment of group 1 with metabolism; group 5 with contradictory functions of atrophy and cellular recovery; and groups 2 and 3 with extracellular matrix (ECM) and non-fast fiber isoforms. Topological positioning of two highly ranked, significantly expressed genes- Dclk1 and Ostalpha within group 5 suggested possible mechanistic roles in recovery from BoNT-A induced atrophy. Phenotypic correlations of groups with titin and myosin protein content further emphasized the effect of BoNT-A on the sarcomeric contraction machinery in early phase of chemodenervation. In summary, our approach revealed a hierarchical functional response to BoNT-A induced paralysis with early metabolic and later ECM responses and identified putative biomarkers associated with chemodenervation. Additionally, our results provide an unbiased validation of the response documented in our previous work.

  4. RNA sequencing-based longitudinal transcriptomic profiling gives novel insights into the disease mechanism of generalized pustular psoriasis.

    PubMed

    Wang, Lingyan; Yu, Xiaoling; Wu, Chao; Zhu, Teng; Wang, Wenming; Zheng, Xiaofeng; Jin, Hongzhong

    2018-06-05

    Generalized pustular psoriasis (GPP) is a rare, episodic, potentially life-threatening inflammatory disease. However, the pathogenesis of GPP, and universally accepted therapies for treating it, remain undefined. To better understand the disease mechanism of GPP, we performed a transcriptome analysis to profile the gene expression of peripheral blood mononuclear cells (PBMCs) from patients enrolled at the time of diagnosis and receiving follow-up treatment for up to 6 months. RNA sequencing data revealed that gene expression in five GPP patients' PBMCs was profoundly altered following acitretin treatment. Differentially expressed gene (DEG) analysis suggested that genes related to psoriatic inflammation, including CXCL1, CXCL8 (IL-8), S100A8, S100A9, S100A12 and LCN2, were significantly downregulated in patients in remission from GPP. Functional enrichment and annotation analysis unveiled a cluster of DEGs significantly associated with the function of leukocytes, particularly neutrophils. Pathway analysis suggested that a variety of pro-inflammatory pathways were inhibited in patients in remission. This analysis not only reaffirmed known signaling pathways in GPP pathogenesis, but also implicated novel factors and pathways, such as cell cycle regulation pathways. Furthermore, regulator network analysis provided bioinformatics-based support for upstream molecules as potential therapeutic targets such as oncostatin M. This longitudinal analysis of blood transcriptomes provides the first evidence that dysregulated gene expression in peripheral blood may significantly contribute to psoriatic inflammation in GPP patients. Novel canonical pathways and biomarkers identified in the current research may provide insights to help understand GPP pathobiology and advance novel therapeutics.

  5. A novel method to identify pathways associated with renal cell carcinoma based on a gene co-expression network

    PubMed Central

    RUAN, XIYUN; LI, HONGYUN; LIU, BO; CHEN, JIE; ZHANG, SHIBAO; SUN, ZEQIANG; LIU, SHUANGQING; SUN, FAHAI; LIU, QINGYONG

    2015-01-01

    The aim of the present study was to develop a novel method for identifying pathways associated with renal cell carcinoma (RCC) based on a gene co-expression network. A framework was established where a co-expression network was derived from the database as well as various co-expression approaches. First, the backbone of the network based on differentially expressed (DE) genes between RCC patients and normal controls was constructed by the Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database. The differentially co-expressed links were detected by Pearson’s correlation, the empirical Bayesian (EB) approach and Weighted Gene Co-expression Network Analysis (WGCNA). The co-expressed gene pairs were merged by a rank-based algorithm. We obtained 842; 371; 2,883 and 1,595 co-expressed gene pairs from the co-expression networks of the STRING database, Pearson’s correlation EB method and WGCNA, respectively. Two hundred and eighty-one differentially co-expressed (DC) gene pairs were obtained from the merged network using this novel method. Pathway enrichment analysis based on the Kyoto Encyclopedia of Genes and Genomes (KEGG) database and the network enrichment analysis (NEA) method were performed to verify feasibility of the merged method. Results of the KEGG and NEA pathway analyses showed that the network was associated with RCC. The suggested method was computationally efficient to identify pathways associated with RCC and has been identified as a useful complement to traditional co-expression analysis. PMID:26058425

  6. [Expression and clinical significance of BCL6 corepressor-like 1 in non-small cell lung cancer].

    PubMed

    Zhao, Xu; Tuo, Hang; Si, Meili; Wang, Lei; Liang, Ping

    2015-12-01

    To detect the expression of BCL6 corepressor-like 1 (BCORL1) in tumor tissues of human non-small cell lung cancer (NSCLC) and determine the effect of BCORL1 on cell migration and invasion in A549 cells by knockdown of BCORL1. Sixty-eight pairs of NSCLC and nontumor tissues were collected and the expressions of BCORL1 and E-cadherin in them were detected using immunohistochemical staining. The expression of BCORL1 was knocked down by siRNA in A549 cells. Transwell(TM) assays were performed to test NSCLC cell migration and invasion in vitro. The expression of BCORL1 in NSCLC was significantly higher than that in paired noncancerous tissues, while E-cadherin was down-regulated in NSCLC as compared with nontumor tissues. Pearson correlation coefficient analysis suggested that BCORL1 was negatively correlated with E-cadherin expression in NSCLC tissues. Clinical association analysis suggested that the elevated expression of BCORL1 was evidently associated with the higher incidence of lymph node metastasis and more advanced TNM stage. When the expression of BCORL1 was down-regulated by a specific siRNA, E-cadherin was up-regulated, and BCORL1 knockdown obviously inhibited cell migration and invasion in A549 cells. BCORL1 is overexpressed in NSCLC tissues and it is negatively correlated with E-cadherin expression. Its high expression is correlated with poor prognostic features. BCORL1 knockdown up-regulates E-cadherin expression and subsequently inhibits cell migration and invasion of lung cancer cells.

  7. Regulation of human corneal epithelial mucins by rebamipide.

    PubMed

    Itoh, Shinsaku; Itoh, Kuni; Shinohara, Hisashi

    2014-02-01

    Membrane-associated mucins (MAMs) play important roles in barrier function and tear stability, and their expression on the ocular surface is altered in dry eye disease. Rebamipide is a mucin secretagogue that promotes the production of mucin-like glycoproteins in human corneal epithelial (HCE) cells. However, the expression of MAMs on the corneal epithelia (MUC1, MUC4, MUC16), which is induced by rebamipide, is poorly understood. In this study, we investigated the effect of rebamipide on the regulation of MAM expression in HCE cells. MUC16, Ki67 and PCNA expression levels in HCE cells isolated at confluence and at 24 hours after confluence were examined by Western blotting to assess cell proliferation. HCE cells isolated at 24 hours after confluence were cultured in medium supplemented with 1-10 µM rebamipide or 0.3-30 nM of epidermal growth factor (EGF). Real-time PCR (RT-PCR) and Western blot analysis of MAMs were performed to evaluate the effect of rebamipide. Western blot analysis of cells treated with an EGF receptor inhibitor (AG1478) or MEK1/2 inhibitor (U0126) was performed to reveal the relationship between EGF receptor activation and rebamipide-induced MAM expression. HCE cells isolated at 24 hours after confluence had lower cell proliferation activity and increased MUC16 expression compared with cells isolated at confluence. RT-PCR and Western blot analysis revealed that rebamipide increased MAM gene expression for 2 hours and protein expression for 24 hours in HCE cells. EGF inhibitor treatment led to reduced levels of all three MAMs that are normally induced by rebamipide, whereas EGF induced the expression of all three MAMs. We suggested that rebamipide increased MUC1, MUC4 and MUC16 expression levels through signals involved in EGF receptor activation in the human corneal epithelia. These data suggest that rebamipide may improve subjective symptoms of dry eye disease by upregulating MAM expression.

  8. Photoperiodic regulation of glycogen metabolism, glycolysis, and glutamine synthesis in tanycytes of the Siberian hamster suggests novel roles of tanycytes in hypothalamic function.

    PubMed

    Nilaweera, Kanishka; Herwig, Annika; Bolborea, Matei; Campbell, Gill; Mayer, Claus D; Morgan, Peter J; Ebling, Francis J P; Barrett, Perry

    2011-11-01

    The objective of this study is to investigate the impact of photoperiod on the temporal and spatial expression of genes involved in glucose metabolism in the brain of the seasonal mammal Phodopus sungorus (Siberian hamster). In situ hybridization was performed on brain sections obtained from male hamsters held in long photoperiod (high body weight and developed testes) or short photoperiod (reduced body weight with testicular regression). This analysis revealed upregulation in expression of genes involved in glycogen and glucose metabolism in short photoperiod and localized to the tanycyte layer of the third ventricle. On the basis of these data and a previously identified photoperiod-dependent increase in activity of neighboring hypothalamic neurons, we hypothesized that the observed expression changes may reflect alteration in either metabolic fuel or precursor neurotransmitter supply to surrounding neurons. Gene expression analysis was performed for genes involved in lactate and glutamate transport. This analysis showed that the gene for the lactate transporter MCT2 and glutamate transporter GLAST was decreased in the tanycyte layer in short photoperiod. Expression of mRNA for glutamine synthetase, the final enzyme in the synthesis of the neuronal neurotransmitter precursor, glutamine, was also decreased in short photoperiod. These data suggest a role for tanycytes in modulating glutamate concentrations and neurotransmitter supply in the hypothalamic environment. Copyright © 2011 Wiley-Liss, Inc.

  9. Genome-Wide Evolutionary Characterization and Expression Analyses of WRKY Family Genes in Brachypodium distachyon

    PubMed Central

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-01-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. PMID:24453041

  10. Association between toll-like receptors expression and major depressive disorder.

    PubMed

    Hung, Yi-Yung; Kang, Hong-Yo; Huang, Kai-Wei; Huang, Tiao-Lai

    2014-12-15

    Accumulating evidences suggest that Toll-like receptors (TLRs) were involved in the pathophysiology of major depressive disorder. TLR4 was thought to be associated with major depressive disorder in animal model, but the others were still unknown. In order to examine TLR1-9 mRNA expression levels in peripheral blood and their relationships with the psychopathology of major depressive disorder, 30 patients with major depressive disorder were compared with 29 healthy controls. The 17-item Hamilton Depression Rating Scale (HAMD-17) was used to assess the severity of major depression. The mRNA expression levels of TLRs were examined in parallel with a housekeeping gene using real-time polymerase chain reaction (RT-PCR). Analysis of covariance with age and body mass index adjustment revealed a significantly higher expression of TLR3, 4, 5 and 7 mRNA but lower expression of TLR1 and 6 in patients with major depressive disorder as compared with healthy controls. Multiple linear regression analysis revealed that TLR4 was an independent risk factor relating to severity of major depression. These findings suggest that TLRs, especially TLR4, may be involved in the psychopathology of major depression. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  11. Four-miRNA signature as a prognostic tool for lung adenocarcinoma.

    PubMed

    Lin, Yan; Lv, Yufeng; Liang, Rong; Yuan, Chunling; Zhang, Jinyan; He, Dan; Zheng, Xiaowen; Zhang, Jianfeng

    2018-01-01

    The aim of this study was to generate a novel miRNA expression signature to accurately predict prognosis for patients with lung adenocarcinoma (LUAD). Using expression profiles downloaded from The Cancer Genome Atlas database, we identified multiple miRNAs with differential expression between LUAD and paired healthy tissues. We then evaluated the prognostic values of the differentially expressed miRNAs using univariate/multivariate Cox regression analysis. This analysis was ultimately used to construct a four-miRNA signature that effectively predicted patient survival. Finally, we analyzed potential functional roles of the target genes for these four miRNAs using Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses. Based on our cutoff criteria ( P <0.05 and |log2FC| >1.0), we identified a total of 187 differentially expressed miRNAs, including 148 that were upregulated in LUAD tissues and 39 that were downregulated. Four miRNAs (miR-148a-5p, miR-31-5p, miR-548v, and miR-550a-5p) were independently associated with survival based on Kaplan-Meier analysis. We generated a signature index based on the expression of these four miRNAs and stratified patients into low- and high-risk groups. Patients in the high-risk group had significantly shorter survival times than those in the low-risk group ( P =0.002). A functional enrichment analysis suggested that the target genes of these four miRNAs were involved in protein phosphorylation and the Hippo and sphingolipid signaling pathways. Taken together, our results suggest that our four-miRNA signature can be used as a prognostic tool for patients with LUAD.

  12. The Role of p-STAT3 as a Prognostic and Clinicopathological Marker in Colorectal Cancer: A Systematic Review and Meta-Analysis

    PubMed Central

    Chu, Qi; Gan, Yong; Ren, Hui; Zhang, Liyan; Wang, Liwei; Li, Xiaoxiu; Wang, Wei

    2016-01-01

    Objective High expression of phosphorylated signal transducer and activator of transcription 3 (p-STAT3) has been detected in a variety of human tumors. However, the association of positive p-STAT3 expression with clinicopathological parameters and the prognosis of colorectal cancer patients remain controversial. To identify the relationship between p-STAT3 expression and clinicopathological parameters and prognosis in patients with colorectal cancer, a systematic review and meta-analysis were performed. Methods We performed a comprehensive literature search from PubMed, EMBASE, and SinoMed through 27 March, 2016. Hazard ratios (HRs) with 95% confidence intervals (CI) were combined to evaluate the association between p-STAT3 expression and overall survival of colorectal cancer patients. Odds ratios (ORs) with 95% CI were combined to evaluate the association between p-STAT3 expression and clinicopathological parameters in patients with colorectal cancer. Results Seventeen studies including a total of 2,346 colorectal cancer patients were included in this meta-analysis. The combined HR was 1.43 (95% CI: 1.23–1.67, P < 0.001), which suggested a positive relationship between p-STAT3 overexpression and poorer overall survival of colorectal cancer patients. In addition, the results indicated that positive p-STAT3 expression was significantly associated with the presence of lymph node metastasis (OR: 2.43, 95% CI: 1.18–5.01, P = 0.02) but was not associated with TNM stage, tumor differentiation or gender. Conclusion The meta-analysis results suggest that p-STAT3 overexpression is unfavorable for the prognosis of colorectal cancer patients, and p-STAT3 overexpression is associated with the presence of lymph node metastasis among colorectal cancer patients. PMID:27504822

  13. Network-based differential gene expression analysis suggests cell cycle related genes regulated by E2F1 underlie the molecular difference between smoker and non-smoker lung adenocarcinoma

    PubMed Central

    2013-01-01

    Background Differential gene expression (DGE) analysis is commonly used to reveal the deregulated molecular mechanisms of complex diseases. However, traditional DGE analysis (e.g., the t test or the rank sum test) tests each gene independently without considering interactions between them. Top-ranked differentially regulated genes prioritized by the analysis may not directly relate to the coherent molecular changes underlying complex diseases. Joint analyses of co-expression and DGE have been applied to reveal the deregulated molecular modules underlying complex diseases. Most of these methods consist of separate steps: first to identify gene-gene relationships under the studied phenotype then to integrate them with gene expression changes for prioritizing signature genes, or vice versa. It is warrant a method that can simultaneously consider gene-gene co-expression strength and corresponding expression level changes so that both types of information can be leveraged optimally. Results In this paper, we develop a gene module based method for differential gene expression analysis, named network-based differential gene expression (nDGE) analysis, a one-step integrative process for prioritizing deregulated genes and grouping them into gene modules. We demonstrate that nDGE outperforms existing methods in prioritizing deregulated genes and discovering deregulated gene modules using simulated data sets. When tested on a series of smoker and non-smoker lung adenocarcinoma data sets, we show that top differentially regulated genes identified by the rank sum test in different sets are not consistent while top ranked genes defined by nDGE in different data sets significantly overlap. nDGE results suggest that a differentially regulated gene module, which is enriched for cell cycle related genes and E2F1 targeted genes, plays a role in the molecular differences between smoker and non-smoker lung adenocarcinoma. Conclusions In this paper, we develop nDGE to prioritize deregulated genes and group them into gene modules by simultaneously considering gene expression level changes and gene-gene co-regulations. When applied to both simulated and empirical data, nDGE outperforms the traditional DGE method. More specifically, when applied to smoker and non-smoker lung cancer sets, nDGE results illustrate the molecular differences between smoker and non-smoker lung cancer. PMID:24341432

  14. Prognostic implications of adhesion molecule expression in colorectal cancer.

    PubMed

    Seo, Kyung-Jin; Kim, Maru; Kim, Jeana

    2015-01-01

    Research on the expression of adhesion molecules, E-cadherin (ECAD), CD24, CD44 and osteopontin (OPN) in colorectal cancer (CRC) has been limited, even though CRC is one of the leading causes of cancer-related deaths. This study was conducted to evaluate the expression of adhesion molecules in CRC and to determine their relationships with clinicopathologic variables, and the prognostic significance. The expression of ECAD, CD24, CD44 and OPN was examined in 174 stage II and III CRC specimens by immunohistochemistry of TMA. Negative ECAD expression was significantly correlated with advanced nodal stage and poor tumor differentiation. Multivariate analysis showed that both negative expression of ECAD and positive expression of CD24 were independent prognostic factors for disease-free survival (DFS) in CRC patients (P<0.001, relative risk [RR] = 5.596, 95% CI = 2.712-11.549; P = 0.038, RR = 3.768, 95% CI = 1.077-13.185, respectively). However, for overall survival (OS), only ECAD negativity showed statistically significant results in multivariate analysis (P<0.001, RR = 4.819, 95% CI = 2.515-9.234). Positive expression of CD24 was associated with poor OS in univariate analysis but was of no prognostic value in multivariate analysis. In conclusion, our study suggests that among these four adhesion molecules, ECAD and CD24 expression can be considered independent prognostic factors. The role of CD44 and OPN may need further evaluation.

  15. Prognostic implications of adhesion molecule expression in colorectal cancer

    PubMed Central

    Seo, Kyung-Jin; Kim, Maru; Kim, Jeana

    2015-01-01

    Research on the expression of adhesion molecules, E-cadherin (ECAD), CD24, CD44 and osteopontin (OPN) in colorectal cancer (CRC) has been limited, even though CRC is one of the leading causes of cancer-related deaths. This study was conducted to evaluate the expression of adhesion molecules in CRC and to determine their relationships with clinicopathologic variables, and the prognostic significance. The expression of ECAD, CD24, CD44 and OPN was examined in 174 stage II and III CRC specimens by immunohistochemistry of TMA. Negative ECAD expression was significantly correlated with advanced nodal stage and poor tumor differentiation. Multivariate analysis showed that both negative expression of ECAD and positive expression of CD24 were independent prognostic factors for disease-free survival (DFS) in CRC patients (P<0.001, relative risk [RR] = 5.596, 95% CI = 2.712-11.549; P = 0.038, RR = 3.768, 95% CI = 1.077-13.185, respectively). However, for overall survival (OS), only ECAD negativity showed statistically significant results in multivariate analysis (P<0.001, RR = 4.819, 95% CI = 2.515-9.234). Positive expression of CD24 was associated with poor OS in univariate analysis but was of no prognostic value in multivariate analysis. In conclusion, our study suggests that among these four adhesion molecules, ECAD and CD24 expression can be considered independent prognostic factors. The role of CD44 and OPN may need further evaluation. PMID:26097606

  16. Differential global gene expression in red and white skeletal muscle

    NASA Technical Reports Server (NTRS)

    Campbell, W. G.; Gordon, S. E.; Carlson, C. J.; Pattison, J. S.; Hamilton, M. T.; Booth, F. W.

    2001-01-01

    The differences in gene expression among the fiber types of skeletal muscle have long fascinated scientists, but for the most part, previous experiments have only reported differences of one or two genes at a time. The evolving technology of global mRNA expression analysis was employed to determine the potential differential expression of approximately 3,000 mRNAs between the white quad (white muscle) and the red soleus muscle (mixed red muscle) of female ICR mice (30-35 g). Microarray analysis identified 49 mRNA sequences that were differentially expressed between white and mixed red skeletal muscle, including newly identified differential expressions between muscle types. For example, the current findings increase the number of known, differentially expressed mRNAs for transcription factors/coregulators by nine and signaling proteins by three. The expanding knowledge of the diversity of mRNA expression between white and mixed red muscle suggests that there could be quite a complex regulation of phenotype between muscles of different fiber types.

  17. Comparative analysis of expression of two p97 homologues in Caenorhabditis elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamauchi, Seiji; Yamanaka, Kunitoshi; Ogura, Teru

    2006-06-30

    Caenorhabditis elegans possesses two p97/VCP/Cdc48p homologues, named CDC-48.1 (C06A1.1) and CDC-48.2 (C41C4.8), although their expression regulation and functional diversity have not yet been studied. We therefore investigated spatial and temporal expression patterns of two p97 homologues in this study. RT-PCR and Western blot analysis showed that the amount of cdc-48.1 was about twofold of that of cdc-48.2 in adults and that two p97 homologues were induced by ER stress. The amount of cdc-48.1 mRNA did not increase in the cdc-48.2 deletion mutant and vice versa. In situ hybridization showed that two p97 homologues are mainly expressed in germ cells. Inmore » vivo expression analysis by using GFP translational fusion constructs revealed that CDC-48.1::GFP was expressed from embryos through to adult worms, while CDC-48.2::GFP was expressed mainly in embryos. These results suggest that the expression of two p97 homologues of C. elegans is differently regulated and independent of each other.« less

  18. Tissue and cell-type co-expression networks of transcription factors and wood component genes in Populus trichocarpa.

    PubMed

    Shi, Rui; Wang, Jack P; Lin, Ying-Chung; Li, Quanzi; Sun, Ying-Hsuan; Chen, Hao; Sederoff, Ronald R; Chiang, Vincent L

    2017-05-01

    Co-expression networks based on transcriptomes of Populus trichocarpa major tissues and specific cell types suggest redundant control of cell wall component biosynthetic genes by transcription factors in wood formation. We analyzed the transcriptomes of five tissues (xylem, phloem, shoot, leaf, and root) and two wood forming cell types (fiber and vessel) of Populus trichocarpa to assemble gene co-expression subnetworks associated with wood formation. We identified 165 transcription factors (TFs) that showed xylem-, fiber-, and vessel-specific expression. Of these 165 TFs, 101 co-expressed (correlation coefficient, r > 0.7) with the 45 secondary cell wall cellulose, hemicellulose, and lignin biosynthetic genes. Each cell wall component gene co-expressed on average with 34 TFs, suggesting redundant control of the cell wall component gene expression. Co-expression analysis showed that the 101 TFs and the 45 cell wall component genes each has two distinct groups (groups 1 and 2), based on their co-expression patterns. The group 1 TFs (44 members) are predominantly xylem and fiber specific, and are all highly positively co-expressed with the group 1 cell wall component genes (30 members), suggesting their roles as major wood formation regulators. Group 1 TFs include a lateral organ boundary domain gene (LBD) that has the highest number of positively correlated cell wall component genes (36) and TFs (47). The group 2 TFs have 57 members, including 14 vessel-specific TFs, and are generally less correlated with the cell wall component genes. An exception is a vessel-specific basic helix-loop-helix (bHLH) gene that negatively correlates with 20 cell wall component genes, and may function as a key transcriptional suppressor. The co-expression networks revealed here suggest a well-structured transcriptional homeostasis for cell wall component biosynthesis during wood formation.

  19. CHARACTERIZATION OF INFLAMMATORY GENE EXPRESSION AND GALECTIN-3 FUNCTION AFTER SPINAL CORD INJURY IN MICE

    PubMed Central

    Pajoohesh-Ganji, Ahdeah; Knoblach, Susan M.; Faden, Alan I.; Byrnes, Kimberly R.

    2012-01-01

    Inflammation has long been implicated in secondary tissue damage after spinal cord injury (SCI). Our previous studies of inflammatory gene expression in rats after SCI revealed two temporally correlated clusters: the first was expressed early after injury and the second was up-regulated later, with peak expression at 1–2 weeks and persistent up-regulation through 6 months. To further address the role of inflammation after SCI, we examined inflammatory genes in a second species, mice, through 28 days after SCI. Using anchor gene clustering analysis, we found similar expression patterns for both the acute and chronic gene clusters previously identified after rat SCI. The acute group returned to normal expression levels by 7 days post-injury. The chronic group, which included C1qB, p22phox and galectin-3, showed peak expression at 7 days and remained up-regulated through 28 days. Immunohistochemistry and western blot analysis showed that the protein expression of these genes was consistent with the mRNA expression. Further exploration of the role of one of these genes, galectin-3, suggests that galectin-3 may contribute to secondary injury. In summary, our findings extend our prior gene profiling data by demonstrating the chronic expression of a cluster of microglial associated inflammatory genes after SCI in mice. Moreover, by demonstrating that inhibition of one such factor improves recovery, the findings suggest that such chronic up-regulation of inflammatory processes may contribute to secondary tissue damage after SCI, and that there may be a broader therapeutic window for neuroprotection than generally accepted. PMID:22884909

  20. Interleukin-like EMT inducer regulates partial phenotype switching in MITF-low melanoma cell lines

    PubMed Central

    Noguchi, Ken; Dalton, Annamarie C.; Howley, Breege V.; McCall, Buckley J.; Yoshida, Akihiro; Diehl, J. Alan

    2017-01-01

    ILEI (FAM3C) is a secreted factor that contributes to the epithelial-to-mesenchymal transition (EMT), a cell biological process that confers metastatic properties to a tumor cell. Initially, we found that ILEI mRNA is highly expressed in melanoma metastases but not in primary tumors, suggesting that ILEI contributes to the malignant properties of melanoma. While melanoma is not an epithelial cell-derived tumor and does not undergo a traditional EMT, melanoma undergoes a similar process known as phenotype switching in which high (micropthalmia-related transcription factor) MITF expressing (MITF-high) proliferative cells switch to a low expressing (MITF-low) invasive state. We observed that MITF-high proliferative cells express low levels of ILEI (ILEI-low) and MITF-low invasive cells express high levels of ILEI (ILEI-high). We found that inducing phenotype switching towards the MITF-low invasive state increases ILEI mRNA expression, whereas phenotype switching towards the MITF-high proliferative state decreases ILEI mRNA expression. Next, we used in vitro assays to show that knockdown of ILEI attenuates invasive potential but not MITF expression or chemoresistance. Finally, we used gene expression analysis to show that ILEI regulates several genes involved in the MITF-low invasive phenotype including JARID1B, HIF-2α, and BDNF. Gene set enrichment analysis suggested that ILEI-regulated genes are enriched for JUN signaling, a known regulator of the MITF-low invasive phenotype. In conclusion, we demonstrate that phenotype switching regulates ILEI expression, and that ILEI regulates partial phenotype switching in MITF-low melanoma cell lines. PMID:28545079

  1. Obesity is associated with more activated neutrophils in African American male youth.

    PubMed

    Xu, X; Su, S; Wang, X; Barnes, V; De Miguel, C; Ownby, D; Pollock, J; Snieder, H; Chen, W; Wang, X

    2015-01-01

    There is emerging evidence suggesting the role of peripheral blood leukocytes in the pathogenesis of obesity and related diseases. However, few studies have taken a genome-wide approach to investigating gene expression profiles in peripheral leukocytes between obese and lean individuals with the consideration of obesity-related shifts in leukocyte types. We conducted this study in 95 African Americans (AAs) of both genders (age 14-20 years, 46 lean and 49 obese). Complete blood count with differential test (CBC) was performed in whole blood. Genome-wide gene expression analysis was obtained using the Illumina HumanHT-12 V4 Beadchip with RNA extracted from peripheral leukocytes. Out of the 95 participants, 64 had neutrophils stored. The validation study was based on real-time PCR with RNA extracted from purified neutrophils. CBC test suggested that, in males, obesity was associated with increased neutrophil percentage (P=0.03). Genome-wide gene expression analysis showed that, in males, the majority of the most differentially expressed genes were related to neutrophil activation. Validation of the gene expression levels of ELANE (neutrophil elastase) and MPO (myeloperoxidase) in purified neutrophils demonstrated that the expression of these two genes--important biomarkers of neutrophils activation--were significantly elevated in obese males (P=0.01 and P=0.02, respectively). The identification of increased neutrophil percentage and activation in obese AA males suggests that neutrophils have an essential role in the pathogenesis of obesity-related disease. Further functional and mechanistic studies on neutrophils may contribute to the development of novel intervention strategies reducing the burden associated with obesity-related health problems.

  2. Expression pattern of cadherins in the naked mole rat (Heterocephalus glaber) suggests innate cortical diversification of the cerebrum.

    PubMed

    Matsunaga, Eiji; Nambu, Sanae; Iriki, Atsushi; Okanoya, Kazuo

    2011-06-15

    The cerebral cortex is an indispensable region for higher cognitive function that is remarkably diverse among mammalian species. Although previous research has shown that the cortical area map in the mammalian cerebral cortex is formed by innate and activity-dependent mechanisms, it remains unknown how these mechanisms contribute to the evolution and diversification of the functional cortical areas in various species. The naked mole rat (Heterocephalus glaber) is a subterranean, eusocial rodent. Physiological and anatomical studies have revealed that the visual system is regressed and the somatosensory system is enlarged. To examine whether species differences in cortical area development are caused by intrinsic factors or environmental factors, we performed comparative gene expression analysis of neonatal naked mole rat and mouse brains. The expression domain of cadherin-6, a somatosensory marker, was expanded caudally and shifted dorsally in the cortex, whereas the expression domain of cadherin-8, a visual marker, was reduced caudally in the neonatal naked mole rat cortex. The expression domain of cadherin-8 was also reduced in other visual areas, such as the lateral geniculate nucleus and superior colliculus. Immunohistochemical analysis of thalamocortical fibers further suggested that somatosensory input did not affect cortical gene expression in the neonatal naked mole rat brain. These results suggest that the development of the somatosensory system and the regression of the visual system in the naked mole rat cortex are due to intrinsic genetic mechanisms as well as sensory input-dependent mechanisms. Intrinsic genetic mechanisms thus appear to contribute to species diversity in cortical area formation. Copyright © 2011 Wiley-Liss, Inc.

  3. GPR30 and estrogen receptor expression: new insights into hormone dependence of inflammatory breast cancer.

    PubMed

    Arias-Pulido, Hugo; Royce, Melanie; Gong, Yun; Joste, Nancy; Lomo, Lesley; Lee, Sang-Joon; Chaher, Nabila; Verschraegen, Claire; Lara, Juanita; Prossnitz, Eric R; Cristofanilli, Massimo

    2010-08-01

    GPR30 is a novel G protein-coupled estrogen receptor (ER) associated with metastases in breast cancer (BC) and poor survival in endometrial and ovarian tumors. The association of GPR30 expression with inflammatory breast cancer (IBC), an aggressive and commonly hormone-independent form of BC, has not been studied. GPR30, ER, progesterone receptor (PR), epidermal growth factor receptor (EGFR), and HER-2 expression were assessed by immunohistochemistry (and FISH for HER-2) in 88 primary IBCs. GPR30 expression was correlated with patient overall survival (OS), disease-free survival (DFS), pathologic variables, and other biomarkers. GPR30 expression was found in 69% of IBC cases. ER, PR, HER-2, and EGFR were found in 43, 35, 39, and 34% of IBC cases, respectively. GPR30 expression correlated inversely with ER expression (P = 0.02). Co-expression of ER and GPR30 was found in 24% of IBC samples; 19% expressed only ER and 46% expressed only GPR30. Univariate analysis showed no association between GPR30 expression and OS or DFS. However, co-expression of ER and GPR30 was associated with improved OS (P < 0.03) and marginally with DFS (P < 0.06); the absence of both ER and GPR30 was associated with worse OS and DFS (P = 0.03 for both). Multivariate analysis identified ER as an independent prognostic factor of OS (P = 0.008) and DFS (P = 0.02). The majority of IBC tumors are GPR30-positive, suggesting that estrogen signaling may be active in ER-negative IBC patients. These findings suggest potential new therapeutic targets for IBC such as novel endocrine agents or direct modulation of GPR30.

  4. Identification of Potential Biomarkers for Rhegmatogenous Retinal Detachment Associated with Choroidal Detachment by Vitreous iTRAQ-Based Proteomic Profiling

    PubMed Central

    Wu, Zhifeng; Ding, Nannan; Yu, Mengxi; Wang, Ke; Luo, Shasha; Zou, Wenjun; Zhou, Ying; Yan, Biao; Jiang, Qin

    2016-01-01

    Rhegmatogenous retinal detachment associated with choroidal detachment (RRDCD) is a complicated and serious type of rhegmatogenous retinal detachment (RRD). In this study, we identified differentially expressed proteins in the vitreous humors of RRDCD and RRD using isobaric tags for relative and absolute quantitation (iTRAQ) combined with nano-liquid chromatography-electrospray ion trap-mass spectrometry-mass spectrometry (nano-LC-ESI-MS/MS) and bioinformatic analysis. Our result shows that 103 differentially expressed proteins, including 54 up-regulated and 49 down-regulated proteins were identified in RRDCD. Gene ontology (GO) analysis suggested that most of the differentially expressed proteins were extracellular.The Kyoto encyclopedia of genes and genomes (KEGG) pathway analysis suggested that proteins related to complement and coagulation cascades were significantly enriched. iTRAQ-based proteomic profiling reveals that complement and coagulation cascades and inflammation may play important roles in the pathogenesis of RRDCD. This study may provide novel insights into the pathogenesis of RRDCD and offer potential opportunities for the diagnosis and treatment of RRDCD. PMID:27941623

  5. Retinal-specific ATP-binding cassette transporter (ABCR/ABCA4) is expressed at the choroid plexus in rat brain.

    PubMed

    Bhongsatiern, Jiraganya; Ohtsuki, Sumio; Tachikawa, Masanori; Hori, Satoko; Terasaki, Tetsuya

    2005-03-01

    ATP-binding cassette (ABC) transporter A4 is a member of the ABC transporter subfamily A which has been reported to be exclusively expressed in the retina. In contrast, a previous report has suggested a possible relationship between ABCA4 and CNS function. The purpose of the present study was to investigate the localization of ABCA4 mRNA and protein in rat brain. In situ hybridization analysis revealed that ABCA4 mRNA was localized in the lateral ventricles. RT-PCR analysis detected ABCA4 mRNA in isolated rat choroid plexus and conditionally immortalized rat choroid plexus epithelial cells (TR-CSFB). Furthermore, ABCA4 protein was also detected in the isolated rat choroid plexus at about 250 kDa by western blot analysis, and its apparent molecular size was reduced by N-glycosidase F treatment. These results suggest that glycosylated ABCA4 protein is expressed in rat choroid plexus epithelial cells. ABCA4 may play a role in the function of the blood-cerebrospinal fluid barrier and affect CSF conditions.

  6. BFDCA: A Comprehensive Tool of Using Bayes Factor for Differential Co-Expression Analysis.

    PubMed

    Wang, Duolin; Wang, Juexin; Jiang, Yuexu; Liang, Yanchun; Xu, Dong

    2017-02-03

    Comparing the gene-expression profiles between biological conditions is useful for understanding gene regulation underlying complex phenotypes. Along this line, analysis of differential co-expression (DC) has gained attention in the recent years, where genes under one condition have different co-expression patterns compared with another. We developed an R package Bayes Factor approach for Differential Co-expression Analysis (BFDCA) for DC analysis. BFDCA is unique in integrating various aspects of DC patterns (including Shift, Cross, and Re-wiring) into one uniform Bayes factor. We tested BFDCA using simulation data and experimental data. Simulation results indicate that BFDCA outperforms existing methods in accuracy and robustness of detecting DC pairs and DC modules. Results of using experimental data suggest that BFDCA can cluster disease-related genes into functional DC subunits and estimate the regulatory impact of disease-related genes well. BFDCA also achieves high accuracy in predicting case-control phenotypes by using significant DC gene pairs as markers. BFDCA is publicly available at http://dx.doi.org/10.17632/jdz4vtvnm3.1. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Segmental duplications: evolution and impact among the current Lepidoptera genomes.

    PubMed

    Zhao, Qian; Ma, Dongna; Vasseur, Liette; You, Minsheng

    2017-07-06

    Structural variation among genomes is now viewed to be as important as single nucleoid polymorphisms in influencing the phenotype and evolution of a species. Segmental duplication (SD) is defined as segments of DNA with homologous sequence. Here, we performed a systematic analysis of segmental duplications (SDs) among five lepidopteran reference genomes (Plutella xylostella, Danaus plexippus, Bombyx mori, Manduca sexta and Heliconius melpomene) to understand their potential impact on the evolution of these species. We find that the SDs content differed substantially among species, ranging from 1.2% of the genome in B. mori to 15.2% in H. melpomene. Most SDs formed very high identity (similarity higher than 90%) blocks but had very few large blocks. Comparative analysis showed that most of the SDs arose after the divergence of each linage and we found that P. xylostella and H. melpomene showed more duplications than other species, suggesting they might be able to tolerate extensive levels of variation in their genomes. Conserved ancestral and species specific SD events were assessed, revealing multiple examples of the gain, loss or maintenance of SDs over time. SDs content analysis showed that most of the genes embedded in SDs regions belonged to species-specific SDs ("Unique" SDs). Functional analysis of these genes suggested their potential roles in the lineage-specific evolution. SDs and flanking regions often contained transposable elements (TEs) and this association suggested some involvement in SDs formation. Further studies on comparison of gene expression level between SDs and non-SDs showed that the expression level of genes embedded in SDs was significantly lower, suggesting that structure changes in the genomes are involved in gene expression differences in species. The results showed that most of the SDs were "unique SDs", which originated after species formation. Functional analysis suggested that SDs might play different roles in different species. Our results provide a valuable resource beyond the genetic mutation to explore the genome structure for future Lepidoptera research.

  8. Microarray analysis of glial cells resistant to JCV infection suggests a correlation between viral infection and inflammatory cytokine gene expression

    PubMed Central

    Manley, Kate; Gee, Gretchen V; Simkevich, Carl P; Sedivy, John M; Atwood, Walter J

    2007-01-01

    The human polyomavirus, JCV, has a highly restricted tropism and primarily infects glial cells. The mechanisms restricting infection of cells by JCV are poorly understood. Previously we developed and described a glial cell line that was resistant to JCV infection with the aim of using these cells to identify factors that determine JCV tropism. Gene expression profiling of susceptible and resistant glial cells revealed a direct correlation between the expression of inflammatory cytokines and susceptibility to JCV infection. This correlation manifested at the level of viral gene transcription. Previous studies have suggested a link between an increase in cytokine gene expression in HIV patients and the development of PML and these data support this hypothesis. PMID:17555786

  9. Single-Cell RNA-Sequencing: Assessment of Differential Expression Analysis Methods.

    PubMed

    Dal Molin, Alessandra; Baruzzo, Giacomo; Di Camillo, Barbara

    2017-01-01

    The sequencing of the transcriptomes of single-cells, or single-cell RNA-sequencing, has now become the dominant technology for the identification of novel cell types and for the study of stochastic gene expression. In recent years, various tools for analyzing single-cell RNA-sequencing data have been proposed, many of them with the purpose of performing differentially expression analysis. In this work, we compare four different tools for single-cell RNA-sequencing differential expression, together with two popular methods originally developed for the analysis of bulk RNA-sequencing data, but largely applied to single-cell data. We discuss results obtained on two real and one synthetic dataset, along with considerations about the perspectives of single-cell differential expression analysis. In particular, we explore the methods performance in four different scenarios, mimicking different unimodal or bimodal distributions of the data, as characteristic of single-cell transcriptomics. We observed marked differences between the selected methods in terms of precision and recall, the number of detected differentially expressed genes and the overall performance. Globally, the results obtained in our study suggest that is difficult to identify a best performing tool and that efforts are needed to improve the methodologies for single-cell RNA-sequencing data analysis and gain better accuracy of results.

  10. [Prokaryotic expression, purification and biological activity analysis of recombinant β-Lactamase protein].

    PubMed

    Zhou, Xiao-liang; Shi, Pei-ji; Wang, Hao

    2011-01-01

    To prepare RGD4CβL fusion protein using prokaryotic expression system and evaluate the biological activity of the RGD4CβL. RGD4CβL gene was cloned into pColdII to contruct β-Lactamase prokaryotic expression vector. After transformation, the recombinant vector was induced to express recombinant protein RGD4CβL by IPTG in E.coli BL(DE3). The recombinant protein was purified by Ni-NTA resin under denaturing condition and then dialyzed to renature. The tumor cell targeting ability of the recombinant protein was analyzed by flow cytometric analysis. After cleavage and purification, β-Lactamase moiety showed the expected size of 42 000 on Tricine-SDS-PAGE, and was further confirmed by Western blotting. Based on flow cytometric analysis, the purified protein specially targeted breast cancer cell line MCF-7. This research successfully estiblished a method for prokaryotic expression and purification of β-lactamase. These results suggest the potential use of the protein as an agent for ADEPT.

  11. Expression of glypican-3 is highly associated with pediatric hepatoblastoma: a systemic analysis.

    PubMed

    Xiong, Xiao-Li; Qin, Huan; Yan, Su-Qi; Zhou, Li-Shan; Chen, Peng; Zhao, Dong- Chi

    2015-01-01

    Glypican-3 (GPC3) is reported to be an oncofetal protein that is a useful diagnostic immunomarker for hepatoblastoma. However, the results are not inclusive. This study systemically investigated the association between expression of GPC3 and pediatric hepatoblastoma. Clinical studies evaluating the association were identified using a predefined search strategy. GPC3 immunohistochemistry was applied in the pathological diagnosis of hepatoblastoma using the monoclonal antibodies with formalin-fixed and paraffin-embedded specimens. Positive predictive rates for the association between expression of GPC3 and pediatric hepatoblastoma were calculated. Specimens from four clinical studies which including 134 patients with pediatric hepatoblastoma tested by GPC3 immunohistochemistry were considered eligible for inclusion. Systemic analysis showed that, in all patients, pooled positive predictive rate of the association between expression of GPC3 and pediatric hepatoblastoma was 95.5% (128/134). This systemic analysis suggests that the expression of glypican-3 is highly associated with the diagnosis of pediatric hepatoblastoma.

  12. Genome-wide analysis and expression profiling suggest diverse roles of GH3 genes during development and abiotic stress responses in legumes

    PubMed Central

    Singh, Vikash K.; Jain, Mukesh; Garg, Rohini

    2014-01-01

    Growth hormone auxin regulates various cellular processes by altering the expression of diverse genes in plants. Among various auxin-responsive genes, GH3 genes maintain endogenous auxin homeostasis by conjugating excess of auxin with amino acids. GH3 genes have been characterized in many plant species, but not in legumes. In the present work, we identified members of GH3 gene family and analyzed their chromosomal distribution, gene structure, gene duplication and phylogenetic analysis in different legumes, including chickpea, soybean, Medicago, and Lotus. A comprehensive expression analysis in different vegetative and reproductive tissues/stages revealed that many of GH3 genes were expressed in a tissue-specific manner. Notably, chickpea CaGH3-3, soybean GmGH3-8 and -25, and Lotus LjGH3-4, -5, -9 and -18 genes were up-regulated in root, indicating their putative role in root development. In addition, chickpea CaGH3-1 and -7, and Medicago MtGH3-7, -8, and -9 were found to be highly induced under drought and/or salt stresses, suggesting their role in abiotic stress responses. We also observed the examples of differential expression pattern of duplicated GH3 genes in soybean, indicating their functional diversification. Furthermore, analyses of three-dimensional structures, active site residues and ligand preferences provided molecular insights into function of GH3 genes in legumes. The analysis presented here would help in investigation of precise function of GH3 genes in legumes during development and stress conditions. PMID:25642236

  13. Molecular cloning, mRNA expression and tissue distribution analysis of Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors.

    PubMed

    Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng

    2015-01-25

    Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  14. Local Adaptation of Sun-Exposure-Dependent Gene Expression Regulation in Human Skin.

    PubMed

    Kita, Ryosuke; Fraser, Hunter B

    2016-10-01

    Sun-exposure is a key environmental variable in the study of human evolution. Several skin-pigmentation genes serve as classical examples of positive selection, suggesting that sun-exposure has significantly shaped worldwide genomic variation. Here we investigate the interaction between genetic variation and sun-exposure, and how this impacts gene expression regulation. Using RNA-Seq data from 607 human skin samples, we identified thousands of transcripts that are differentially expressed between sun-exposed skin and non-sun-exposed skin. We then tested whether genetic variants may influence each individual's gene expression response to sun-exposure. Our analysis revealed 10 sun-exposure-dependent gene expression quantitative trait loci (se-eQTLs), including genes involved in skin pigmentation (SLC45A2) and epidermal differentiation (RASSF9). The allele frequencies of the RASSF9 se-eQTL across diverse populations correlate with the magnitude of solar radiation experienced by these populations, suggesting local adaptation to varying levels of sunlight. These results provide the first examples of sun-exposure-dependent regulatory variation and suggest that this variation has contributed to recent human adaptation.

  15. NIPA-like domain containing 1 is a novel tumor-promoting factor in oral squamous cell carcinoma.

    PubMed

    Sasahira, Tomonori; Nishiguchi, Yukiko; Kurihara-Shimomura, Miyako; Nakashima, Chie; Kuniyasu, Hiroki; Kirita, Tadaaki

    2018-05-01

    In our previous global gene expression analysis, we identified NIPA-like domain containing 1 (NIPAL1), which encodes a magnesium transporter, as one of the most overexpressed genes in recurrent oral squamous cell carcinoma (OSCC). Although has been NIPAL1 linked with gout pathogenesis, little is known about its expression and function in human malignancies. In this study, we examined NIPAL1 expression in 192 cases of OSCC by immunohistochemistry and performed a functional analysis of human OSCC cells. NIPAL1 immunostaining was observed in 39 of 192 OSCC patients (20.3%). NIPAL1 expression correlated significantly with cancer cell intravsation (P = 0.0062), as well as with poorer disease-free survival in a Kaplan-Meier analysis (P < 0.0001). Moreover, a multivariate Cox proportional hazards model analysis revealed that NIPAL1 expression was an independent predictor of disease-free survival in OSCC (P < 0.0001). In a functional analysis, NIPAL1 regulated the growth and adhesion of OSCC tumor cells and endothelial cells. Our findings suggest that NIPAL1 might be a novel factor promoting OSCC tumorigenesis, as well as a useful molecular marker of OSCC.

  16. Rapid evolution and copy number variation of primate RHOXF2, an X-linked homeobox gene involved in male reproduction and possibly brain function.

    PubMed

    Niu, Ao-lei; Wang, Yin-qiu; Zhang, Hui; Liao, Cheng-hong; Wang, Jin-kai; Zhang, Rui; Che, Jun; Su, Bing

    2011-10-12

    Homeobox genes are the key regulators during development, and they are in general highly conserved with only a few reported cases of rapid evolution. RHOXF2 is an X-linked homeobox gene in primates. It is highly expressed in the testicle and may play an important role in spermatogenesis. As male reproductive system is often the target of natural and/or sexual selection during evolution, in this study, we aim to dissect the pattern of molecular evolution of RHOXF2 in primates and its potential functional consequence. We studied sequences and copy number variation of RHOXF2 in humans and 16 nonhuman primate species as well as the expression patterns in human, chimpanzee, white-browed gibbon and rhesus macaque. The gene copy number analysis showed that there had been parallel gene duplications/losses in multiple primate lineages. Our evidence suggests that 11 nonhuman primate species have one RHOXF2 copy, and two copies are present in humans and four Old World monkey species, and at least 6 copies in chimpanzees. Further analysis indicated that the gene duplications in primates had likely been mediated by endogenous retrovirus (ERV) sequences flanking the gene regions. In striking contrast to non-human primates, humans appear to have homogenized their two RHOXF2 copies by the ERV-mediated non-allelic recombination mechanism. Coding sequence and phylogenetic analysis suggested multi-lineage strong positive selection on RHOXF2 during primate evolution, especially during the origins of humans and chimpanzees. All the 8 coding region polymorphic sites in human populations are non-synonymous, implying on-going selection. Gene expression analysis demonstrated that besides the preferential expression in the reproductive system, RHOXF2 is also expressed in the brain. The quantitative data suggests expression pattern divergence among primate species. RHOXF2 is a fast-evolving homeobox gene in primates. The rapid evolution and copy number changes of RHOXF2 had been driven by Darwinian positive selection acting on the male reproductive system and possibly also on the central nervous system, which sheds light on understanding the role of homeobox genes in adaptive evolution.

  17. Current status and clinical association of beta-catenin with juvenile nasopharyngeal angiofibroma.

    PubMed

    Mishra, A; Singh, V; Verma, V; Pandey, S; Trivedi, R; Singh, H P; Kumar, S; Dwivedi, R C; Mishra, S C

    2016-10-01

    A possible role of the APC/beta-catenin pathway in the pathogenesis of sporadic juvenile nasopharyngeal angiofibroma has been suggested. This paper presents its current status and clinical association in our patients. A prospective observational study was conducted at King George Medical University and Central Drug Research Institute, in Lucknow, India. Western blot analysis was undertaken in 16 cases to examine beta-catenin expression. The clinical details were recorded along with follow up observations, to determine associations. Up-regulation of beta-catenin expression was seen in 69 per cent of cases. The clinical variables did not reveal significant differences between patients with extremes of expression (extreme under- vs over-expression). However, absent expression was shown exclusively in young adults aged over 18 years, while enhanced expression was associated with an altered facial profile. Although a beta-catenin association was seen in a subset of our sporadic juvenile nasopharyngeal angiofibroma cases, its expression was not homogeneous. This is in contrast to the Western literature that suggests a universal (homogenous) enhanced expression in the majority. Hence, further research is required to better define its molecular cascade.

  18. Molecular Profile of Peripheral Blood Mononuclear Cells from Patients with Rheumatoid Arthritis

    PubMed Central

    Edwards, Christopher J; Feldman, Jeffrey L; Beech, Jonathan; Shields, Kathleen M; Stover, Jennifer A; Trepicchio, William L; Larsen, Glenn; Foxwell, Brian MJ; Brennan, Fionula M; Feldmann, Marc; Pittman, Debra D

    2007-01-01

    Rheumatoid arthritis (RA) is a chronic inflammatory arthritis. Currently, diagnosis of RA may take several weeks, and factors used to predict a poor prognosis are not always reliable. Gene expression in RA may consist of a unique signature. Gene expression analysis has been applied to synovial tissue to define molecularly distinct forms of RA; however, expression analysis of tissue taken from a synovial joint is invasive and clinically impractical. Recent studies have demonstrated that unique gene expression changes can be identified in peripheral blood mononuclear cells (PBMCs) from patients with cancer, multiple sclerosis, and lupus. To identify RA disease-related genes, we performed a global gene expression analysis. RNA from PBMCs of 9 RA patients and 13 normal volunteers was analyzed on an oligonucleotide array. Compared with normal PBMCs, 330 transcripts were differentially expressed in RA. The differentially regulated genes belong to diverse functional classes and include genes involved in calcium binding, chaperones, cytokines, transcription, translation, signal transduction, extracellular matrix, integral to plasma membrane, integral to intracellular membrane, mitochondrial, ribosomal, structural, enzymes, and proteases. A k-nearest neighbor analysis identified 29 transcripts that were preferentially expressed in RA. Ten genes with increased expression in RA PBMCs compared with controls mapped to a RA susceptibility locus, 6p21.3. These results suggest that analysis of RA PBMCs at the molecular level may provide a set of candidate genes that could yield an easily accessible gene signature to aid in early diagnosis and treatment. PMID:17515956

  19. Knockdown of Ran GTPase expression inhibits the proliferation and migration of breast cancer cells.

    PubMed

    Sheng, Chenyi; Qiu, Jian; Wang, Yingying; He, Zhixian; Wang, Hua; Wang, Qingqing; Huang, Yeqing; Zhu, Lianxin; Shi, Feng; Chen, Yingying; Xiong, Shiyao; Xu, Zhen; Ni, Qichao

    2018-05-03

    Breast cancer is the second leading cause of cancer‑associated mortality in women worldwide. Strong evidence has suggested that Ran, which is a small GTP binding protein involved in the transport of RNA and protein across the nucleus, may be a key cellular protein involved in the metastatic progression of cancer. The present study investigated Ran gene expression in breast cancer tissue samples obtained from 140 patients who had undergone surgical resection for breast cancer. Western blot analysis of Ran in breast cancer tissues and paired adjacent normal tissues showed that expression of Ran was significantly increased in breast cancer tissues. Immunohistochemistry analyses conducted on formalin‑fixed paraffin‑embedded breast cancer tissue sections revealed that Ran expression was associated with tumor histological grade, nerve invasion and metastasis, vascular metastasis and Ki‑67 expression (a marker of cell proliferation). Kaplan‑Meier survival analysis showed that increased Ran expression in patients with breast cancer was positively associated with a poor survival prognosis. Furthermore, in vitro experiments demonstrated that highly migratory MDA‑MB‑231 cancer cells treated with Ran‑si‑RNA (si‑Ran), which knocked down expression of Ran, exhibited decreased motility in trans‑well migration and wound healing assays. Cell cycle analysis of Ran knocked down MDA‑MB‑231 cells implicated Ran in cell cycle arrest and the inhibition of proliferation. Furthermore, a starvation and re‑feeding (CCK‑8) assay was performed, which indicated that Ran regulated breast cancer cell proliferation. Taken together, the results provide strong in vitro evidence of the involvement of Ran in the progression of breast cancer and suggest that it could have high potential as a therapeutic target and/or marker of disease.

  20. Effects of mutant human Ki-ras{sup G12C} gene dosage on murine lung tumorigenesis and signaling to its downstream effectors

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dance-Barnes, Stephanie T.; Kock, Nancy D.; Floyd, Heather S.

    2008-08-15

    Studies in cell culture have suggested that the level of RAS expression can influence the transformation of cells and the signaling pathways stimulated by mutant RAS expression. However, the levels of RAS expression in vivo appear to be subject to feedback regulation, limiting the total amount of RAS protein that can be expressed. We utilized a bitransgenic mouse lung tumor model that expressed the human Ki-ras{sup G12C} allele in a tetracycline-inducible, lung-specific manner. Treatment for 12 months with 500 {mu}g/ml of doxycycline (DOX) allowed for maximal expression of the human Ki-ras{sup G12C} allele in the lung, and resulted in themore » development of focal hyperplasia and adenomas. We determined if different levels of mutant RAS expression would influence the phenotype of the lung lesions. Treatment with 25, 100 and 500 {mu}g/ml of DOX resulted in dose-dependent increases in transgene expression and tumor multiplicity. Microscopic analysis of the lungs of mice treated with the 25 {mu}g/ml dose of DOX revealed infrequent foci of hyperplasia, whereas mice treated with the 100 and 500 {mu}g/ml doses exhibited numerous hyperplastic foci and also adenomas. Immunohistochemical and RNA analysis of the downstream effector pathways demonstrated that different levels of mutant RAS transgene expression resulted in differences in the expression and/or phosphorylation of specific signaling molecules. Our results suggest that the molecular alterations driving tumorigenesis may differ at different levels of mutant Ki-ras{sup G12C} expression, and this should be taken into consideration when inducible transgene systems are utilized to promote tumorigenesis in mouse models.« less

  1. JC Virus Mediates Invasion and Migration in Colorectal Metastasis

    PubMed Central

    Link, Alexander; Shin, Sung Kwan; Nagasaka, Takeshi; Balaguer, Francesc; Koi, Minoru; Jung, Barbara; Boland, C. Richard; Goel, Ajay

    2009-01-01

    Introduction JC Virus (JCV), a human polyomavirus, is frequently present in colorectal cancers (CRCs). JCV large T-Ag (T-Ag) expressed in approximately half of all CRC's, however, its functional role in CRC is poorly understood. We hypothesized that JCV T-Ag may mediate metastasis in CRC cells through increased migration and invasion. Material and Methods CRC cell lines (HCT116 and SW837) were stably transfected with JCV early transcript sequences cloned into pCR3 or empty vectors. Migration and invasion assays were performed using Boyden chambers. Global gene expression analysis was performed to identify genetic targets and pathways altered by T-Ag expression. Microarray results were validated by qRT-PCR, protein expression analyses and immunohistochemistry. Matching primary CRCs and liver metastases from 33 patients were analyzed for T-Ag expression by immunohistochemistry. Results T-Ag expressing cell lines showed 2 to 3-fold increase in migration and invasion compared to controls. JCV T-Ag expression resulted in differential expression of several genetic targets, including genes that mediate cell migration and invasion. Pathway analysis suggested a significant involvement of these genes with AKT and MAPK signaling. Treatment with selective PI3K/AKT and MAPK pathway inhibitors resulted in reduced migration and invasion. In support of our in-vitro results, immunohistochemical staining of the advanced stage tumors revealed frequent JCV T-Ag expression in metastatic primary tumors (92%) as well as in their matching liver metastasis (73%). Conclusion These data suggest that JCV T-Ag expression in CRC associates with a metastatic phenotype, which may partly be mediated through the AKT/MAPK signaling pathway. Frequent expression of JCV T-Ag in CRC liver metastasis provides further clues supporting a mechanistic role for JCV as a possible mediator of cellular motility and invasion in CRC. PMID:19997600

  2. Similar protein expression profiles of ovarian and endometrial high-grade serous carcinomas.

    PubMed

    Hiramatsu, Kosuke; Yoshino, Kiyoshi; Serada, Satoshi; Yoshihara, Kosuke; Hori, Yumiko; Fujimoto, Minoru; Matsuzaki, Shinya; Egawa-Takata, Tomomi; Kobayashi, Eiji; Ueda, Yutaka; Morii, Eiichi; Enomoto, Takayuki; Naka, Tetsuji; Kimura, Tadashi

    2016-03-01

    Ovarian and endometrial high-grade serous carcinomas (HGSCs) have similar clinical and pathological characteristics; however, exhaustive protein expression profiling of these cancers has yet to be reported. We performed protein expression profiling on 14 cases of HGSCs (7 ovarian and 7 endometrial) and 18 endometrioid carcinomas (9 ovarian and 9 endometrial) using iTRAQ-based exhaustive and quantitative protein analysis. We identified 828 tumour-expressed proteins and evaluated the statistical similarity of protein expression profiles between ovarian and endometrial HGSCs using unsupervised hierarchical cluster analysis (P<0.01). Using 45 statistically highly expressed proteins in HGSCs, protein ontology analysis detected two enriched terms and proteins composing each term: IMP2 and MCM2. Immunohistochemical analyses confirmed the higher expression of IMP2 and MCM2 in ovarian and endometrial HGSCs as well as in tubal and peritoneal HGSCs than in endometrioid carcinomas (P<0.01). The knockdown of either IMP2 or MCM2 by siRNA interference significantly decreased the proliferation rate of ovarian HGSC cell line (P<0.01). We demonstrated the statistical similarity of the protein expression profiles of ovarian and endometrial HGSC beyond the organs. We suggest that increased IMP2 and MCM2 expression may underlie some of the rapid HGSC growth observed clinically.

  3. In Silico Analysis of Expression Data for Identification of Genes Involved in Spatial Accumulation of Calcium in Developing Seeds of Rice

    PubMed Central

    Goel, Anshita; Gaur, Vikram S.; Arora, Sandeep; Gupta, Sanjay

    2012-01-01

    Abstract The calcium (Ca2+) transporters, like Ca2+ channels, Ca2+ ATPases, and Ca2+ exchangers, are instrumental for signaling and transport. However, the mechanism by which they orchestrate the accumulation of Ca2+ in grain filling has not yet been investigated. Hence the present study was designed to identify the potential calcium transporter genes that may be responsible for the spatial accumulation of calcium during grain filling. In silico expression analyses were performed to identify Ca2+ transporters that predominantly express during the different developmental stages of Oryza sativa. A total of 13 unique calcium transporters (7 from massively parallel signature sequencing [MPSS] data analysis, and 9 from microarray analysis) were identified. Analysis of variance (ANOVA) revealed differential expression of the transporters across tissues, and principal component analysis (PCA) exhibited their seed-specific distinctive expression profile. Interestingly, Ca2+ exchanger genes are highly expressed in the initial stages, whereas some Ca2+ ATPase genes are highly expressed throughout seed development. Furthermore, analysis of the cis-elements located in the promoter region of the subset of 13 genes suggested that Dof proteins play essential roles in regulating the expression of Ca2+ transporter genes during rice seed development. Based on these results, we developed a hypothetical model explaining the transport and tissue specific distribution of calcium in developing cereal seeds. The model may be extrapolated to understand the mechanism behind the exceptionally high level of calcium accumulation seen in grains like finger millet. PMID:22734689

  4. Towards a cognitive resource limitations model of diminished expression in schizotypy.

    PubMed

    Cohen, Alex S; Morrison, Sean C; Brown, Laura A; Minor, Kyle S

    2012-02-01

    Diminished expression of speech is a pernicious feature of both schizophrenia and schizotypy--defined as the personality organization reflecting a putative genetic schizophrenia liability. As yet, the mechanism underlying diminished expression is unclear. We tested the hypothesis that diminished expression reflects a cognitive resource issue--that is, as cognitive resources are depleted, expression becomes diminished in individuals with psychometrically defined schizotypy. Acoustic analysis of natural speech was procured during experimentally manipulated baseline and high cognitive-load dual tasks and examined in 38 individuals with psychometrically defined schizotypy and 34 controls. For both groups, expression significantly decreased as a function of increased task demands, although there were no group differences in expression or magnitude of change across baseline to high cognitive-load conditions. Participants with self-reported constricted affect showed significant reductions in expression under high-load versus baseline speaking conditions relative to other schizotypal and control participants. Moreover, psychometrically defined schizotypal participants with poor cognitive performance on the high-load task, suggestive of depleted cognitive resources, also showed expressivity reductions compared with other participants. These findings suggest that diminished expression occurs as a function of limited cognitive resources in psychometrically defined schizotypy. PsycINFO Database Record (c) 2012 APA, all rights reserved.

  5. Transcriptomic analysis in the developing zebrafish embryo after compound exposure: Individual gene expression and pathway regulation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hermsen, Sanne A.B., E-mail: Sanne.Hermsen@rivm.nl; Department of Toxicogenomics, Maastricht University, P.O. Box 616, 6200 MD, Maastricht; Institute for Risk Assessment Sciences

    2013-10-01

    The zebrafish embryotoxicity test is a promising alternative assay for developmental toxicity. Classically, morphological assessment of the embryos is applied to evaluate the effects of compound exposure. However, by applying differential gene expression analysis the sensitivity and predictability of the test may be increased. For defining gene expression signatures of developmental toxicity, we explored the possibility of using gene expression signatures of compound exposures based on commonly expressed individual genes as well as based on regulated gene pathways. Four developmental toxic compounds were tested in concentration-response design, caffeine, carbamazepine, retinoic acid and valproic acid, and two non-embryotoxic compounds, D-mannitol andmore » saccharin, were included. With transcriptomic analyses we were able to identify commonly expressed genes, which were mostly development related, after exposure to the embryotoxicants. We also identified gene pathways regulated by the embryotoxicants, suggestive of their modes of action. Furthermore, whereas pathways may be regulated by all compounds, individual gene expression within these pathways can differ for each compound. Overall, the present study suggests that the use of individual gene expression signatures as well as pathway regulation may be useful starting points for defining gene biomarkers for predicting embryotoxicity. - Highlights: • The zebrafish embryotoxicity test in combination with transcriptomics was used. • We explored two approaches of defining gene biomarkers for developmental toxicity. • Four compounds in concentration-response design were tested. • We identified commonly expressed individual genes as well as regulated gene pathways. • Both approaches seem suitable starting points for defining gene biomarkers.« less

  6. Aberrant Expression of Xist in Aborted Porcine Fetuses Derived from Somatic Cell Nuclear Transfer Embryos

    PubMed Central

    Yuan, Lin; Wang, Anfeng; Yao, Chaogang; Huang, Yongye; Duan, Feifei; Lv, Qinyan; Wang, Dongxu; Ouyang, Hongsheng; Li, Zhanjun; Lai, Liangxue

    2014-01-01

    Cloned pigs generated by somatic cell nuclear transfer (SCNT) show a greater ratio of early abortion during mid-gestation than normal controls. X-linked genes have been demonstrated to be important for the development of cloned embryos. To determine the relationship between the expression of X-linked genes and abortion of cloned porcine fetuses, the expression of X-linked genes were investigated by quantitative real-time polymerase chain reaction (q-PCR) and the methylation status of Xist DMR was performed by bisulfate-specific PCR (BSP). q-PCR analysis indicated that there was aberrant expression of X-linked genes, especially the upregulated expression of Xist in both female and male aborted fetuses compared to control fetuses. Results of BSP suggested that hypomethylation of Xist occurred in aborted fetuses, whether male or female. These results suggest that the abnormal expression of Xist may be associated with the abortion of fetuses derived from somatic cell nuclear transfer embryos. PMID:25429426

  7. Insights into the diversity of NOD-like receptors: Identification and expression analysis of NLRC3, NLRC5 and NLRX1 in rainbow trout.

    PubMed

    Álvarez, Claudio A; Ramírez-Cepeda, Felipe; Santana, Paula; Torres, Elisa; Cortés, Jimena; Guzmán, Fanny; Schmitt, Paulina; Mercado, Luis

    2017-07-01

    Nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) are efficient soluble intracellular sensors that activate defense mechanisms against pathogens. In teleost fish, the involvement of NLRs in the immune response is not well understood. However, recent work has evidenced the expression of different NLRs in response to some pathogen associated molecular patterns (PAMPs). In the present work, the cDNA sequence encoding three new NOD-like receptors were identified in Oncorhynchus mykiss, namely OmNLRC3, OmNLRC5 and OmNLRX1. Results showed that their sequences coded for proteins of 1135, 836 and 1010 amino acids, respectively. The deduced protein sequences of all receptors showed characteristic domains of this receptor family, such as leucine rich repeats and NACHT domain. Phylogenetic analysis revealed a high degree of identity with other NOD-like receptors and they are clustered into different families. Transcript expression analysis indicated that OmNLRs are constitutively expressed in liver, spleen, intestine, gill, skin and brain. OmNLR expression was upregulated in kidney and gills from rainbow trout in response to LPS. In order to give new insights into the function of these new NLR members, an in vitro model of immune stimulation was established using the rainbow trout cell line RTgill-W1. Expression analysis revealed that RTgill-W1 overexpressed proinflammatory cytokines in response to LPS and poly I:C alongside with a differential overexpression of OmNLRC3, OmNLRC5 and OmNLRX1. The expression of OmNLRC5 was further verified at the protein level by immunofluorescence. Finally, the effect of the overexpressed cytokines on the OmNLR expression by RTgill-W1 cells was assessed, suggesting a regulatory mechanism on OmNLRC3 expression. Overall, results suggest that O. mykiss NOD-like receptors could play a key role in the defense mechanisms of teleost through PAMP recognition. Future studies will focus on gills which could be related with a key sensor mucosal system in one of the most environmentally fish exposed tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  8. High lncRNA H19 expression as prognostic indicator: data mining in female cancers and polling analysis in non-female cancers

    PubMed Central

    Peng, Li; Liu, Zhao-Yang; Li, Wen-Ling; Zhang, Chao-Yang; Zhang, Ya-Qin; Pan, Xi; Chen, Jun; Li, Yue-Hui

    2017-01-01

    Upregulation of lncRNA H19 expression is associated with an unfavorable prognosis in some cancers. However, the prognostic value of H19 in female-specific cancers has remained uncharacterized. In this study, the prognostic power of high H19 expression in female cancer patients from the TCGA datasets was analyzed using Kaplan-Meier survival curves and Cox's proportional hazard modeling. In addition, in a meta-analysis of non-female cancer patients from TCGA datasets and 12 independent studies, hazard ratios (HRs) with 95% confidence interval (CI) for overall survival (OS) and disease-free survival (DFS)/relapse-free survival (RFS)/metastasis-free survival (MFS)/progression-free survival (PFS) were pooled to assess the prognostic value of high H19 expression. Kaplan-Meier analysis revealed that patients with uterine corpus cancer and higher H19 expression had a shorter OS (HR=2.710, p<0.05), while females with cervical cancer and increased H19 expression had a shorter RFS (HR=2.261, p<0.05). Multivariate Cox regression analysis showed that high H19 expression could independently predict a poorer prognosis in cervical cancer patients (HR=4.099, p<0.05). In the meta-analysis, patients with high H19 expression showed a poorer outcome in non-female cancer (p<0.05). These results suggest that high lncRNA H19 expression is predictive of an unfavorable prognosis in two female cancers (uterine corpus endometrioid cancer and cervical cancer) as well as in non-female cancer patients. PMID:27926484

  9. High lncRNA H19 expression as prognostic indicator: data mining in female cancers and polling analysis in non-female cancers.

    PubMed

    Peng, Li; Yuan, Xiao-Qing; Liu, Zhao-Yang; Li, Wen-Ling; Zhang, Chao-Yang; Zhang, Ya-Qin; Pan, Xi; Chen, Jun; Li, Yue-Hui; Li, Guan-Cheng

    2017-01-03

    Upregulation of lncRNA H19 expression is associated with an unfavorable prognosis in some cancers. However, the prognostic value of H19 in female-specific cancers has remained uncharacterized. In this study, the prognostic power of high H19 expression in female cancer patients from the TCGA datasets was analyzed using Kaplan-Meier survival curves and Cox's proportional hazard modeling. In addition, in a meta-analysis of non-female cancer patients from TCGA datasets and 12 independent studies, hazard ratios (HRs) with 95% confidence interval (CI) for overall survival (OS) and disease-free survival (DFS)/relapse-free survival (RFS)/metastasis-free survival (MFS)/progression-free survival (PFS) were pooled to assess the prognostic value of high H19 expression. Kaplan-Meier analysis revealed that patients with uterine corpus cancer and higher H19 expression had a shorter OS (HR=2.710, p<0.05), while females with cervical cancer and increased H19 expression had a shorter RFS (HR=2.261, p<0.05). Multivariate Cox regression analysis showed that high H19 expression could independently predict a poorer prognosis in cervical cancer patients (HR=4.099, p<0.05). In the meta-analysis, patients with high H19 expression showed a poorer outcome in non-female cancer (p<0.05). These results suggest that high lncRNA H19 expression is predictive of an unfavorable prognosis in two female cancers (uterine corpus endometrioid cancer and cervical cancer) as well as in non-female cancer patients.

  10. Genome-wide identification of translationally inhibited and degraded miR-155 targets using RNA-interacting protein-IP

    PubMed Central

    Meier, Jan; Hovestadt, Volker; Zapatka, Marc; Pscherer, Armin; Lichter, Peter; Seiffert, Martina

    2013-01-01

    MicroRNAs (miRNAs) are single-stranded, small, non-coding RNAs, which fine-tune protein expression by degrading and/or translationally inhibiting mRNAs. Manipulation of miRNA expression in animal models frequently results in severe phenotypes indicating their relevance in controlling cellular functions, most likely by interacting with multiple targets. To better understand the effect of miRNA activities, genome-wide analysis of their targets are required. MicroRNA profiling as well as transcriptome analysis upon enforced miRNA expression were frequently used to investigate their relevance. However, these approaches often fail to identify relevant miRNAs targets. Therefore, we tested the precision of RNA-interacting protein immunoprecipitation (RIP) using AGO2-specific antibodies, a core component of the “RNA-induced silencing complex” (RISC), followed by RNA sequencing (Seq) in a defined cellular system, the HEK293T cells with stable, ectopic expression of miR-155. Thereby, we identified 100 AGO2-associated mRNAs in miR-155-expressing cells, of which 67 were in silico predicted miR-155 target genes. An integrated analysis of the corresponding expression profiles indicated that these targets were either regulated by mRNA decay or by translational repression. Of the identified miR-155 targets, 17 were related to cell cycle control, suggesting their involvement in the observed increase in cell proliferation of HEK293T cells upon miR-155 expression. Additional, secondary changes within the gene expression profile were detected and might contribute to this phenotype as well. Interestingly, by analyzing RIP-Seq data of HEK-293T cells and two B-cell lines we identified a recurrent disproportional enrichment of several miRNAs, including miR-155 and miRNAs of the miR-17-92 cluster, in the AGO2-associated precipitates, suggesting discrepancies in miRNA expression and activity. PMID:23673373

  11. Altered gene expression in dry age-related macular degeneration suggests early loss of choroidal endothelial cells.

    PubMed

    Whitmore, S Scott; Braun, Terry A; Skeie, Jessica M; Haas, Christine M; Sohn, Elliott H; Stone, Edwin M; Scheetz, Todd E; Mullins, Robert F

    2013-01-01

    Age-related macular degeneration (AMD) is a major cause of blindness in developed countries. The molecular pathogenesis of early events in AMD is poorly understood. We investigated differential gene expression in samples of human retinal pigment epithelium (RPE) and choroid from early AMD and control maculas with exon-based arrays. Gene expression levels in nine human donor eyes with early AMD and nine control human donor eyes were assessed using Affymetrix Human Exon ST 1.0 arrays. Two controls did not pass quality control and were removed. Differentially expressed genes were annotated using the Database for Annotation, Visualization and Integrated Discovery (DAVID), and gene set enrichment analysis (GSEA) was performed on RPE-specific and endothelium-associated gene sets. The complement factor H (CFH) genotype was also assessed, and differential expression was analyzed regarding high AMD risk (YH/HH) and low AMD risk (YY) genotypes. Seventy-five genes were identified as differentially expressed (raw p value <0.01; ≥50% fold change, mean log2 expression level in AMD or control ≥ median of all average gene expression values); however, no genes were significant (adj. p value <0.01) after correction for multiple hypothesis testing. Of 52 genes with decreased expression in AMD (fold change <0.5; raw p value <0.01), 18 genes were identified by DAVID analysis as associated with vision or neurologic processes. The GSEA of the RPE-associated and endothelium-associated genes revealed a significant decrease in genes typically expressed by endothelial cells in the early AMD group compared to controls, consistent with previous histologic and proteomic studies. Analysis of the CFH genotype indicated decreased expression of ADAMTS9 in eyes with high-risk genotypes (fold change = -2.61; raw p value=0.0008). GSEA results suggest that RPE transcripts are preserved or elevated in early AMD, concomitant with loss of endothelial cell marker expression. These results are consistent with the notion that choroidal endothelial cell dropout or dedifferentiation occurs early in the pathogenesis of AMD.

  12. Positive Selection Underlies Faster-Z Evolution of Gene Expression in Birds.

    PubMed

    Dean, Rebecca; Harrison, Peter W; Wright, Alison E; Zimmer, Fabian; Mank, Judith E

    2015-10-01

    The elevated rate of evolution for genes on sex chromosomes compared with autosomes (Fast-X or Fast-Z evolution) can result either from positive selection in the heterogametic sex or from nonadaptive consequences of reduced relative effective population size. Recent work in birds suggests that Fast-Z of coding sequence is primarily due to relaxed purifying selection resulting from reduced relative effective population size. However, gene sequence and gene expression are often subject to distinct evolutionary pressures; therefore, we tested for Fast-Z in gene expression using next-generation RNA-sequencing data from multiple avian species. Similar to studies of Fast-Z in coding sequence, we recover clear signatures of Fast-Z in gene expression; however, in contrast to coding sequence, our data indicate that Fast-Z in expression is due to positive selection acting primarily in females. In the soma, where gene expression is highly correlated between the sexes, we detected Fast-Z in both sexes, although at a higher rate in females, suggesting that many positively selected expression changes in females are also expressed in males. In the gonad, where intersexual correlations in expression are much lower, we detected Fast-Z for female gene expression, but crucially, not males. This suggests that a large amount of expression variation is sex-specific in its effects within the gonad. Taken together, our results indicate that Fast-Z evolution of gene expression is the product of positive selection acting on recessive beneficial alleles in the heterogametic sex. More broadly, our analysis suggests that the adaptive potential of Z chromosome gene expression may be much greater than that of gene sequence, results which have important implications for the role of sex chromosomes in speciation and sexual selection. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Expression of stanniocalcin 1 in thyroid side population cells and thyroid cancer cells.

    PubMed

    Hayase, Suguru; Sasaki, Yoshihito; Matsubara, Tsutomu; Seo, Daekwan; Miyakoshi, Masaaki; Murata, Tsubasa; Ozaki, Takashi; Kakudo, Kennichi; Kumamoto, Kensuke; Ylaya, Kris; Cheng, Sheue-yann; Thorgeirsson, Snorri S; Hewitt, Stephen M; Ward, Jerrold M; Kimura, Shioko

    2015-04-01

    Mouse thyroid side population (SP) cells consist of a minor population of mouse thyroid cells that may have multipotent thyroid stem cell characteristics. However the nature of thyroid SP cells remains elusive, particularly in relation to thyroid cancer. Stanniocalcin (STC) 1 and 2 are secreted glycoproteins known to regulate serum calcium and phosphate homeostasis. In recent years, the relationship of STC1/2 expression to cancer has been described in various tissues. Microarray analysis was carried out to determine genes up- and down-regulated in thyroid SP cells as compared with non-SP cells. Among genes up-regulated, stanniocalcin 1 (STC1) was chosen for study because of its expression in various thyroid cells by Western blotting and immunohistochemistry. Gene expression analysis revealed that genes known to be highly expressed in cancer cells and/or involved in cancer invasion/metastasis were markedly up-regulated in SP cells from both intact as well as partial thyroidectomized thyroids. Among these genes, expression of STC1 was found in five human thyroid carcinoma-derived cell lines as revealed by analysis of mRNA and protein, and its expression was inversely correlated with the differentiation status of the cells. Immunohistochemical analysis demonstrated higher expression of STC1 in the thyroid tumor cell line and thyroid tumor tissues from humans and mice. These results suggest that SP cells contain a population of cells that express genes also highly expressed in cancer cells including Stc1, which warrants further study on the role of SP cells and/or STC1 expression in thyroid cancer.

  14. Expression of Stanniocalcin 1 in Thyroid Side Population Cells and Thyroid Cancer Cells

    PubMed Central

    Hayase, Suguru; Sasaki, Yoshihito; Matsubara, Tsutomu; Seo, Daekwan; Miyakoshi, Masaaki; Murata, Tsubasa; Ozaki, Takashi; Kakudo, Kennichi; Kumamoto, Kensuke; Ylaya, Kris; Cheng, Sheue-yann; Thorgeirsson, Snorri S.; Hewitt, Stephen M.; Ward, Jerrold M.

    2015-01-01

    Background: Mouse thyroid side population (SP) cells consist of a minor population of mouse thyroid cells that may have multipotent thyroid stem cell characteristics. However the nature of thyroid SP cells remains elusive, particularly in relation to thyroid cancer. Stanniocalcin (STC) 1 and 2 are secreted glycoproteins known to regulate serum calcium and phosphate homeostasis. In recent years, the relationship of STC1/2 expression to cancer has been described in various tissues. Method: Microarray analysis was carried out to determine genes up- and down-regulated in thyroid SP cells as compared with non-SP cells. Among genes up-regulated, stanniocalcin 1 (STC1) was chosen for study because of its expression in various thyroid cells by Western blotting and immunohistochemistry. Results: Gene expression analysis revealed that genes known to be highly expressed in cancer cells and/or involved in cancer invasion/metastasis were markedly up-regulated in SP cells from both intact as well as partial thyroidectomized thyroids. Among these genes, expression of STC1 was found in five human thyroid carcinoma–derived cell lines as revealed by analysis of mRNA and protein, and its expression was inversely correlated with the differentiation status of the cells. Immunohistochemical analysis demonstrated higher expression of STC1 in the thyroid tumor cell line and thyroid tumor tissues from humans and mice. Conclusion: These results suggest that SP cells contain a population of cells that express genes also highly expressed in cancer cells including Stc1, which warrants further study on the role of SP cells and/or STC1 expression in thyroid cancer. PMID:25647164

  15. Characterization and Expression Pattern Analysis of the T-Complex Protein-1 Zeta Subunit in Musca domestica L (Diptera).

    PubMed

    Zhao, Xuejun; Xiu, Jiangfan; Li, Yan; Ma, Huiling; Wu, Jianwei; Wang, Bo; Guo, Guo

    2017-07-01

    Chaperonins, belonging to the T-complex protein-1 (TCP-1) family, assist in the correct folding of nascent and misfolded proteins. It is well-known that in mammals, the zeta subunit of the TCP-1 complex (TCP-1ζ) plays a vital role in the folding and assembly of cytoskeleta proteins. This study reported for the first time the cloning, characterization and expression pattern analysis of the TCP-1ζ from Musca domestica, which was named as MdTCP-1ζ. The MdTCP-1ζ cDNA is 1,803 bp long with a 1,596 bp open reading frame that encodes a protein with 531 bp amino acids. The analysis of the transcriptional profile of MdTCP-1ζ using qRT-PCR revealed relatively high expression in the salivary glands and trachea at the tissues while among the developmental stages. The highest expression was observed only in the eggs suggesting that the MdTCP-1ζ may play a role in embryonic development. The expression of MdTCP-1ζ was also significantly induced after exposure to short-term heat shock and infection by Escherichia coli, Staphylococcus aureus, or Candida albicans. This suggested that MdTCP-1ζ may take part in the immune responses of housefly and perhaps contribute to the protection against cellular injury. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  16. BMPs regulate msx gene expression in the dorsal neuroectoderm of Drosophila and vertebrates by distinct mechanisms.

    PubMed

    Esteves, Francisco F; Springhorn, Alexander; Kague, Erika; Taylor, Erika; Pyrowolakis, George; Fisher, Shannon; Bier, Ethan

    2014-09-01

    In a broad variety of bilaterian species the trunk central nervous system (CNS) derives from three primary rows of neuroblasts. The fates of these neural progenitor cells are determined in part by three conserved transcription factors: vnd/nkx2.2, ind/gsh and msh/msx in Drosophila melanogaster/vertebrates, which are expressed in corresponding non-overlapping patterns along the dorsal-ventral axis. While this conserved suite of "neural identity" gene expression strongly suggests a common ancestral origin for the patterning systems, it is unclear whether the original regulatory mechanisms establishing these patterns have been similarly conserved during evolution. In Drosophila, genetic evidence suggests that Bone Morphogenetic Proteins (BMPs) act in a dosage-dependent fashion to repress expression of neural identity genes. BMPs also play a dose-dependent role in patterning the dorsal and lateral regions of the vertebrate CNS, however, the mechanism by which they achieve such patterning has not yet been clearly established. In this report, we examine the mechanisms by which BMPs act on cis-regulatory modules (CRMs) that control localized expression of the Drosophila msh and zebrafish (Danio rerio) msxB in the dorsal central nervous system (CNS). Our analysis suggests that BMPs act differently in these organisms to regulate similar patterns of gene expression in the neuroectoderm: repressing msh expression in Drosophila, while activating msxB expression in the zebrafish. These findings suggest that the mechanisms by which the BMP gradient patterns the dorsal neuroectoderm have reversed since the divergence of these two ancient lineages.

  17. BMPs Regulate msx Gene Expression in the Dorsal Neuroectoderm of Drosophila and Vertebrates by Distinct Mechanisms

    PubMed Central

    Esteves, Francisco F.; Taylor, Erika; Pyrowolakis, George; Fisher, Shannon; Bier, Ethan

    2014-01-01

    In a broad variety of bilaterian species the trunk central nervous system (CNS) derives from three primary rows of neuroblasts. The fates of these neural progenitor cells are determined in part by three conserved transcription factors: vnd/nkx2.2, ind/gsh and msh/msx in Drosophila melanogaster/vertebrates, which are expressed in corresponding non-overlapping patterns along the dorsal-ventral axis. While this conserved suite of “neural identity” gene expression strongly suggests a common ancestral origin for the patterning systems, it is unclear whether the original regulatory mechanisms establishing these patterns have been similarly conserved during evolution. In Drosophila, genetic evidence suggests that Bone Morphogenetic Proteins (BMPs) act in a dosage-dependent fashion to repress expression of neural identity genes. BMPs also play a dose-dependent role in patterning the dorsal and lateral regions of the vertebrate CNS, however, the mechanism by which they achieve such patterning has not yet been clearly established. In this report, we examine the mechanisms by which BMPs act on cis-regulatory modules (CRMs) that control localized expression of the Drosophila msh and zebrafish (Danio rerio) msxB in the dorsal central nervous system (CNS). Our analysis suggests that BMPs act differently in these organisms to regulate similar patterns of gene expression in the neuroectoderm: repressing msh expression in Drosophila, while activating msxB expression in the zebrafish. These findings suggest that the mechanisms by which the BMP gradient patterns the dorsal neuroectoderm have reversed since the divergence of these two ancient lineages. PMID:25210771

  18. Single cell transcriptome analysis of MCF-7 reveals consistently and inconsistently expressed gene groups each associated with distinct cellular localization and functions

    PubMed Central

    Chen, Tzu-Han; Shiau, Hsin-Chieh

    2018-01-01

    Single cell transcriptome (SCT) analysis provides superior resolution to illustrate tumor cell heterogeneity for clinical implications. We characterized four SCTs of MCF-7 using 143 housekeeping genes (HKGs) as control, of which lactate dehydrogenase B (LDHB) expression is silenced. These SCT libraries mapped to 11,423, 11,486, 10,380, and 11,306 RefSeq genes (UCSC), respectively. High consistency in HKG expression levels across all four SCTs, along with transcriptional silencing of LDHB, was observed, suggesting a high sensitivity and reproducibility of the SCT analysis. Cross-library comparison on expression levels by scatter plotting revealed a linear correlation and an 83–94% overlap in transcript isoforms and expressed genes were also observed. To gain insight of transcriptional diversity among the SCTs, expressed genes were split into consistently expressed (CE) (expressed in all SCTs) and inconsistently expressed (IE) (expressed in some but not all SCTs) genes for further characterization, along with the 142 expressed HKGs as a reference. Distinct transcriptional strengths were found among these groups, with averages of 1,612.0, 88.0 and 1.2 FPKM for HKGs, CE and IE, respectively. Comparison between CE and IE groups further indicated that expressions of CE genes vary more significantly than that of IE genes. Gene Ontology analysis indicated that proteins encoded by CE genes are mainly involved in fundamental intracellular activities, while proteins encoded by IE genes are mainly for extracellular activities, especially acting as receptors or ion channels. The diversified gene expressions, especially for those encoded by IE genes, may contribute to cancer drug resistance. PMID:29920548

  19. Characterisation and Expression Analysis of MrLip1, a Class 3 Family Lipase of Malassezia restricta.

    PubMed

    Park, Minji; Jung, Won Hee; Han, Song Hee; Lee, Young Hoon; Lee, Yang Won

    2015-11-01

    The genus Malassezia is associated with a wide range of skin diseases and is the predominant fungal genus isolated from human skin. Of the 14 Malassezia species identified, M. restricta is the most abundant fungal species found from both healthy and diseased skin. Emerging evidences have suggested that extracellular lipases of Malassezia play a critical role in its survival on the host skin surface. This study aimed to characterise the lipase 1 homologue (MrLip1) in M. restricta and to analyse its expression under different environmental conditions. The full sequence of the gene encoding MrLip1 was determined by rapid amplification of cDNA ends, and it was then heterologously expressed in Pichia pastoris. MrLip1 protein was successfully purified and used for lipase assay and specific antibody generation for use in expression analysis. The optimum pH and temperature for the activity of purified MrLip1 were pH 5.0 and 34 °C respectively. Furthermore, the expression of MrLip1 peaked at a similar pH and temperature, suggesting that the optimal conditions for MrLip1 protein activity and expression are similar to that found on the human skin surface. This study provides data to improve our understanding of the role and characteristics of lipase 1 in M. restricta. © 2015 Blackwell Verlag GmbH.

  20. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    PubMed

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  1. Molecular cloning and expression profile of an ATP-binding cassette (ABC) transporter gene from the hemipteran insect Nilaparvata lugens.

    PubMed

    Zha, W J; Li, S H; Zhou, L; Chen, Z J; Liu, K; Yang, G C; Hu, G; He, G C; You, A Q

    2015-03-30

    The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. In insects, ABC transporters have important functions in the transport of molecules, and are also involved in insecticide resistance, metabolism, and development. In this study, the Nilaparvata lugens Stal (Hemiptera: Delphacidae) ABCG (NlABCG) gene was identified and characterized. The complete mRNA sequence of NlABCG was 2608-bp long, with an open reading frame of 2064 bp encoding a protein comprised of 687 amino acids. The conserved regions include three N-glycosylation and 34 phosphorylation sites, as well as seven transmembrane domains. The amino acid identity with the closely related species Acyrthosiphon pisum was 42.8%. Developmental expression analysis using quantitative real-time reverse transcriptase PCR suggested that the NlABCG transcript was expressed at all developmental stages of N. lugens. The lowest expression of NlABCG was in the 1st instar, and levels increased with larval growth. The transcript profiles of NlABCG were analyzed in various tissues from a 5th instar nymph, and the highest expression was observed in the midgut. These results suggest that the sequence, characteristics, and expression of NlABCG are highly conserved, and basic information is provided for its functional analysis.

  2. Accumulation of p62 in degenerated spinal cord under chronic mechanical compression: functional analysis of p62 and autophagy in hypoxic neuronal cells.

    PubMed

    Tanabe, Fumito; Yone, Kazunori; Kawabata, Naoya; Sakakima, Harutoshi; Matsuda, Fumiyo; Ishidou, Yasuhiro; Maeda, Shingo; Abematsu, Masahiko; Komiya, Setsuro; Setoguchi, Takao

    2011-12-01

    Intracellular accumulation of altered proteins, including p62 and ubiquitinated proteins, is the basis of most neurodegenerative disorders. The relationship among the accumulation of altered proteins, autophagy, and spinal cord dysfunction by cervical spondylotic myelopathy has not been clarified. We examined the expression of p62 and autophagy markers in the chronically compressed spinal cord of tiptoe-walking Yoshimura mice. In addition, we examined the expression and roles of p62 and autophagy in hypoxic neuronal cells. Western blot analysis showed the accumulation of p62, ubiquitinated proteins, and microtubule-associated protein 1 light chain 3 (LC3), an autophagic marker, in the compressed spinal cord. Immunohistochemical examinations showed that p62 accumulated in neurons, axons, astrocytes, and oligodendrocytes. Electron microscopy showed the expression of autophagy markers, including autolysosomes and autophagic vesicles, in the compressed spinal cord. These findings suggest the presence of p62 and autophagy in the degenerated compressed spinal cord. Hypoxic stress increased the expression of p62, ubiquitinated proteins, and LC3-II in neuronal cells. In addition, LC3 turnover assay and GFP-LC3 cleavage assay showed that hypoxic stress increased autophagy flux in neuronal cells. These findings suggest that hypoxic stress induces accumulation of p62 and autophagy in neuronal cells. The forced expression of p62 decreased the number of neuronal cells under hypoxic stress. These findings suggest that p62 accumulation under hypoxic stress promotes neuronal cell death. Treatment with 3-methyladenine, an autophagy inhibitor decreased the number of neuronal cells, whereas lithium chloride, an autophagy inducer increased the number of cells under hypoxic stress. These findings suggest that autophagy promotes neuronal cell survival under hypoxic stress. Our findings suggest that pharmacological inducers of autophagy may be useful for treating cervical spondylotic myelopathy patients.

  3. Deficits in facial affect recognition among antisocial populations: a meta-analysis.

    PubMed

    Marsh, Abigail A; Blair, R J R

    2008-01-01

    Individuals with disorders marked by antisocial behavior frequently show deficits in recognizing displays of facial affect. Antisociality may be associated with specific deficits in identifying fearful expressions, which would implicate dysfunction in neural structures that subserve fearful expression processing. A meta-analysis of 20 studies was conducted to assess: (a) if antisocial populations show any consistent deficits in recognizing six emotional expressions; (b) beyond any generalized impairment, whether specific fear recognition deficits are apparent; and (c) if deficits in fear recognition are a function of task difficulty. Results show a robust link between antisocial behavior and specific deficits in recognizing fearful expressions. This impairment cannot be attributed solely to task difficulty. These results suggest dysfunction among antisocial individuals in specified neural substrates, namely the amygdala, involved in processing fearful facial affect.

  4. Comparative study of joint analysis of microarray gene expression data in survival prediction and risk assessment of breast cancer patients

    PubMed Central

    2016-01-01

    Abstract Microarray gene expression data sets are jointly analyzed to increase statistical power. They could either be merged together or analyzed by meta-analysis. For a given ensemble of data sets, it cannot be foreseen which of these paradigms, merging or meta-analysis, works better. In this article, three joint analysis methods, Z -score normalization, ComBat and the inverse normal method (meta-analysis) were selected for survival prognosis and risk assessment of breast cancer patients. The methods were applied to eight microarray gene expression data sets, totaling 1324 patients with two clinical endpoints, overall survival and relapse-free survival. The performance derived from the joint analysis methods was evaluated using Cox regression for survival analysis and independent validation used as bias estimation. Overall, Z -score normalization had a better performance than ComBat and meta-analysis. Higher Area Under the Receiver Operating Characteristic curve and hazard ratio were also obtained when independent validation was used as bias estimation. With a lower time and memory complexity, Z -score normalization is a simple method for joint analysis of microarray gene expression data sets. The derived findings suggest further assessment of this method in future survival prediction and cancer classification applications. PMID:26504096

  5. Molecular classification of gastric cancer: a new paradigm.

    PubMed

    Shah, Manish A; Khanin, Raya; Tang, Laura; Janjigian, Yelena Y; Klimstra, David S; Gerdes, Hans; Kelsen, David P

    2011-05-01

    Gastric cancer may be subdivided into 3 distinct subtypes--proximal, diffuse, and distal gastric cancer--based on histopathologic and anatomic criteria. Each subtype is associated with unique epidemiology. Our aim is to test the hypothesis that these distinct gastric cancer subtypes may also be distinguished by gene expression analysis. Patients with localized gastric adenocarcinoma being screened for a phase II preoperative clinical trial (National Cancer Institute, NCI #5917) underwent endoscopic biopsy for fresh tumor procurement. Four to 6 targeted biopsies of the primary tumor were obtained. Macrodissection was carried out to ensure more than 80% carcinoma in the sample. HG-U133A GeneChip (Affymetrix) was used for cDNA expression analysis, and all arrays were processed and analyzed using the Bioconductor R-package. Between November 2003 and January 2006, 57 patients were screened to identify 36 patients with localized gastric cancer who had adequate RNA for expression analysis. Using supervised analysis, we built a classifier to distinguish the 3 gastric cancer subtypes, successfully classifying each into tightly grouped clusters. Leave-one-out cross-validation error was 0.14, suggesting that more than 85% of samples were classified correctly. Gene set analysis with the false discovery rate set at 0.25 identified several pathways that were differentially regulated when comparing each gastric cancer subtype to adjacent normal stomach. Subtypes of gastric cancer that have epidemiologic and histologic distinctions are also distinguished by gene expression data. These preliminary data suggest a new classification of gastric cancer with implications for improving our understanding of disease biology and identification of unique molecular drivers for each gastric cancer subtype. ©2011 AACR.

  6. Molecular Classification of Gastric Cancer: A new paradigm

    PubMed Central

    Shah, Manish A.; Khanin, Raya; Tang, Laura; Janjigian, Yelena Y.; Klimstra, David S.; Gerdes, Hans; Kelsen, David P.

    2011-01-01

    Purpose Gastric cancer may be subdivided into three distinct subtypes –proximal, diffuse, and distal gastric cancer– based on histopathologic and anatomic criteria. Each subtype is associated with unique epidemiology. Our aim is to test the hypothesis that these distinct gastric cancer subtypes may also be distinguished by gene expression analysis. Experimental Design Patients with localized gastric adenocarcinoma being screened for a phase II preoperative clinical trial (NCI 5917) underwent endoscopic biopsy for fresh tumor procurement. 4–6 targeted biopsies of the primary tumor were obtained. Macrodissection was performed to ensure >80% carcinoma in the sample. HG-U133A GeneChip (Affymetrix) was used for cDNA expression analysis, and all arrays were processed and analyzed using the Bioconductor R-package. Results Between November 2003 and January 2006, 57 patients were screened to identify 36 patients with localized gastric cancer who had adequate RNA for expression analysis. Using supervised analysis, we built a classifier to distinguish the three gastric cancer subtypes, successfully classifying each into tightly grouped clusters. Leave-one-out cross validation error was 0.14, suggesting that >85% of samples were classified correctly. Gene set analysis with the False Discovery Rate set at 0.25 identified several pathways that were differentially regulated when comparing each gastric cancer subtype to adjacent normal stomach. Conclusions Subtypes of gastric cancer that have epidemiologic and histologic distinction are also distinguished by gene expression data. These preliminary data suggest a new classification of gastric cancer with implications for improving our understanding of disease biology and identification of unique molecular drivers for each gastric cancer subtype. PMID:21430069

  7. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    PubMed

    Guo, Yong; Qiu, Li-Juan

    2013-01-01

    The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max). In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs) were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  8. Cloning of zebrafish Mustn1 orthologs and their expression during early development.

    PubMed

    Camarata, Troy; Vasilyev, Aleksandr; Hadjiargyrou, Michael

    2016-11-15

    Mustn1 is a small nuclear protein that is involved in the development and regeneration of the musculoskeletal system. Previous work established a role for Mustn1 in myogenic and chondrogenic differentiation. In addition, recent evidence suggests a potential role for Mustn1 in cilia function in zebrafish. A detailed study of Mustn1 expression has yet to be conducted in zebrafish. As such, we report herein the cloning of the zebrafish Mustn1 orthologs, mustn1a and mustn1b, and their expression during zebrafish embryonic and larval development. Results indicate a 44% nucleotide identity between the two paralogs. Phylogenetic analysis further confirmed that the Mustn1a and 1b predicted proteins were highly related to other vertebrate members of the Mustn1 protein family. Whole mount in situ hybridization revealed expression of both mustn1a and 1b at the 7-somite stage through 72hpf in structures such as Kupffer's vesicle, segmental mesoderm, head structures, and otic vesicle. Additionally, in 5day old larva, mustn1a and 1b expression is detected in the neurocranium, otic capsule, and the gut. Although both were expressed in the neurocranium, mustn1a was localized in the hypophyseal fenestra whereas mustn1b was found near the posterior basicapsular commissure. mustn1b also displayed expression in the ceratohyal and ceratobranchial elements of the pharyngeal skeleton. These expression patterns were verified temporally by q-PCR analysis. Taken together, we conclude that Mustn1 expression is conserved in vertebrates and that the variations in expression of the two zebrafish paralogs suggest different modes of molecular regulation. Copyright © 2016 Elsevier B.V. All rights reserved.

  9. Lipopolysaccharide-induced innate immune factors in the bottlenose dolphin (Tursiops truncatus) detected in expression sequence tag analysis.

    PubMed

    Ohishi, Kazue; Shishido, Reiko; Iwata, Yasunao; Saitoh, Masafumi; Takenaka, Ryota; Ohtsu, Dai; Okutsu, Kenji; Maruyama, Tadashi

    2011-11-01

    EST analysis based on the megaclone-megasorting method was performed using leukocytes from the bottlenose dolphin (Tursiops truncatus) with or without LPS stimulation. A total of 849 upregulated and 384 downregulated EST clones were sequenced, annotated, and functionally classified. Ferritin heavy peptide I was the most abundant upregulated transcript, suggesting that LPS stimulation induced high production of reactive oxygen species, which were sequestered in ferritin. Among the immune factors, the transcripts coding for an IL-1Ra, homologs to bovine serum amyloid A3, and canine intercellular adhesion molecule-1 were highly expressed. Markedly downregulated transcripts of immune factors were those for homologs of calcium-binding proteins belonging to the S100 family, S100A12, S100A8, and S100A6. Time-course experiments on the expression of some immune factors including IL-1Ra suggested that these factors interact and control cetacean innate immunity. © 2011 The Societies and Blackwell Publishing Asia Pty Ltd.

  10. Meta-Analysis of Tumor Stem-Like Breast Cancer Cells Using Gene Set and Network Analysis

    PubMed Central

    Lee, Won Jun; Kim, Sang Cheol; Yoon, Jung-Ho; Yoon, Sang Jun; Lim, Johan; Kim, You-Sun; Kwon, Sung Won; Park, Jeong Hill

    2016-01-01

    Generally, cancer stem cells have epithelial-to-mesenchymal-transition characteristics and other aggressive properties that cause metastasis. However, there have been no confident markers for the identification of cancer stem cells and comparative methods examining adherent and sphere cells are widely used to investigate mechanism underlying cancer stem cells, because sphere cells have been known to maintain cancer stem cell characteristics. In this study, we conducted a meta-analysis that combined gene expression profiles from several studies that utilized tumorsphere technology to investigate tumor stem-like breast cancer cells. We used our own gene expression profiles along with the three different gene expression profiles from the Gene Expression Omnibus, which we combined using the ComBat method, and obtained significant gene sets using the gene set analysis of our datasets and the combined dataset. This experiment focused on four gene sets such as cytokine-cytokine receptor interaction that demonstrated significance in both datasets. Our observations demonstrated that among the genes of four significant gene sets, six genes were consistently up-regulated and satisfied the p-value of < 0.05, and our network analysis showed high connectivity in five genes. From these results, we established CXCR4, CXCL1 and HMGCS1, the intersecting genes of the datasets with high connectivity and p-value of < 0.05, as significant genes in the identification of cancer stem cells. Additional experiment using quantitative reverse transcription-polymerase chain reaction showed significant up-regulation in MCF-7 derived sphere cells and confirmed the importance of these three genes. Taken together, using meta-analysis that combines gene set and network analysis, we suggested CXCR4, CXCL1 and HMGCS1 as candidates involved in tumor stem-like breast cancer cells. Distinct from other meta-analysis, by using gene set analysis, we selected possible markers which can explain the biological mechanisms and suggested network analysis as an additional criterion for selecting candidates. PMID:26870956

  11. Characteristics of allelic gene expression in human brain cells from single-cell RNA-seq data analysis.

    PubMed

    Zhao, Dejian; Lin, Mingyan; Pedrosa, Erika; Lachman, Herbert M; Zheng, Deyou

    2017-11-10

    Monoallelic expression of autosomal genes has been implicated in human psychiatric disorders. However, there is a paucity of allelic expression studies in human brain cells at the single cell and genome wide levels. In this report, we reanalyzed a previously published single-cell RNA-seq dataset from several postmortem human brains and observed pervasive monoallelic expression in individual cells, largely in a random manner. Examining single nucleotide variants with a predicted functional disruption, we found that the "damaged" alleles were overall expressed in fewer brain cells than their counterparts, and at a lower level in cells where their expression was detected. We also identified many brain cell type-specific monoallelically expressed genes. Interestingly, many of these cell type-specific monoallelically expressed genes were enriched for functions important for those brain cell types. In addition, function analysis showed that genes displaying monoallelic expression and correlated expression across neuronal cells from different individual brains were implicated in the regulation of synaptic function. Our findings suggest that monoallelic gene expression is prevalent in human brain cells, which may play a role in generating cellular identity and neuronal diversity and thus increasing the complexity and diversity of brain cell functions.

  12. G Protein-Coupled Estrogen Receptor (GPER) Expression in Normal and Abnormal Endometrium

    PubMed Central

    Lessey, Bruce A.; Taylor, Robert N.; Wang, Wei; Bagchi, Milan K.; Yuan, Lingwen; Scotchie, Jessica; Fritz, Marc A.; Young, Steven L.

    2012-01-01

    Rapid estrogen effects are mediated by membrane receptors, and evidence suggests a role for both a membrane-associated form of estrogen receptor alpha (ESR1; ERα) and G-protein coupled receptor 30 (GPER; GPR30). Considering estrogen’s importance in endometrial physiology and endometriosis pathophysiology, we hypothesized that GPER could be involved in both cyclic changes in endometrial estrogen action and that aberrant expression might be seen in the eutopic endometrium of women with endometriosis. Using real-time reverse transcriptase–polymerase chain reaction (RT-PCR) and immunohistochemical analysis of normal endometrium, endometrial samples demonstrated cycle-regulated expression of GPER, with maximal expression in the proliferative phase. Eutopic and ectopic endometrium from women with endometriosis overexpressed GPER as compared to eutopic endometrium of normal participants. Ishikawa cells, an adenocarcinoma cell line, expressed GPER, with increased expression upon treatment with estrogen or an ESR1 agonist, but not with a GPER-specific agonist. Decreased expression was seen in Ishikawa cells stably transfected with progesterone receptor A. Together, these data suggest that normal endometrial GPER expression is cyclic and regulated by nuclear estrogen and progesterone receptors, while expression is dysregulated in endometriosis. PMID:22378861

  13. G protein-coupled estrogen receptor (GPER) expression in normal and abnormal endometrium.

    PubMed

    Plante, Beth J; Lessey, Bruce A; Taylor, Robert N; Wang, Wei; Bagchi, Milan K; Yuan, Lingwen; Scotchie, Jessica; Fritz, Marc A; Young, Steven L

    2012-07-01

    Rapid estrogen effects are mediated by membrane receptors, and evidence suggests a role for both a membrane-associated form of estrogen receptor alpha (ESR1; ERα) and G-protein coupled receptor 30 (GPER; GPR30). Considering estrogen's importance in endometrial physiology and endometriosis pathophysiology, we hypothesized that GPER could be involved in both cyclic changes in endometrial estrogen action and that aberrant expression might be seen in the eutopic endometrium of women with endometriosis. Using real-time reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemical analysis of normal endometrium, endometrial samples demonstrated cycle-regulated expression of GPER, with maximal expression in the proliferative phase. Eutopic and ectopic endometrium from women with endometriosis overexpressed GPER as compared to eutopic endometrium of normal participants. Ishikawa cells, an adenocarcinoma cell line, expressed GPER, with increased expression upon treatment with estrogen or an ESR1 agonist, but not with a GPER-specific agonist. Decreased expression was seen in Ishikawa cells stably transfected with progesterone receptor A. Together, these data suggest that normal endometrial GPER expression is cyclic and regulated by nuclear estrogen and progesterone receptors, while expression is dysregulated in endometriosis.

  14. Comparative Analysis of Gene Expression for Convergent Evolution of Camera Eye Between Octopus and Human

    PubMed Central

    Ogura, Atsushi; Ikeo, Kazuho; Gojobori, Takashi

    2004-01-01

    Although the camera eye of the octopus is very similar to that of humans, phylogenetic and embryological analyses have suggested that their camera eyes have been acquired independently. It has been known as a typical example of convergent evolution. To study the molecular basis of convergent evolution of camera eyes, we conducted a comparative analysis of gene expression in octopus and human camera eyes. We sequenced 16,432 ESTs of the octopus eye, leading to 1052 nonredundant genes that have matches in the protein database. Comparing these 1052 genes with 13,303 already-known ESTs of the human eye, 729 (69.3%) genes were commonly expressed between the human and octopus eyes. On the contrary, when we compared octopus eye ESTs with human connective tissue ESTs, the expression similarity was quite low. To trace the evolutionary changes that are potentially responsible for camera eye formation, we also compared octopus-eye ESTs with the completed genome sequences of other organisms. We found that 1019 out of the 1052 genes had already existed at the common ancestor of bilateria, and 875 genes were conserved between humans and octopuses. It suggests that a larger number of conserved genes and their similar gene expression may be responsible for the convergent evolution of the camera eye. PMID:15289475

  15. TROP2 overexpression promotes proliferation and invasion of lung adenocarcinoma cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Zanhua; The Chest Hospital of Jiangxi Province Department of Respiration; Jiang, Xunsheng

    2016-01-29

    Recent studies suggest that the human trophoblast cell-surface antigen TROP2 is highly expressed in a number of tumours and is correlated with poor prognosis. However, its role in non-small cell lung carcinoma (NSCLC) remains largely unknown. Here we examined TROP2 expression by immunohistochemistry in a series of 68 patients with adenocarcinoma (ADC). We found significantly elevated TROP2 expression in ADC tissues compared with normal lung tissues (P < 0.05), and TROP2 overexpression was significantly associated with TNM (tumour, node, metastasis) stage (P = 0.012), lymph node metastasis (P = 0.038), and histologic grade (P = 0.013). Kaplan–Meier survival analysis revealed that high TROP2 expression correlated with poor prognosismore » (P = 0.046). Multivariate analysis revealed that TROP2 expression was an independent prognostic marker for overall survival of ADC patients. Moreover, TROP2 overexpression enhanced cell proliferation, migration, and invasion in the NSCLC cell line A549, whereas knockdown of TROP2 induced apoptosis and impaired proliferation, migration, and invasion in the PC-9 cells. Altogether, our data suggest that TROP2 plays an important role in promoting ADC and may represent a novel prognostic biomarker and therapeutic target for the disease.« less

  16. Cloning and expression analysis of innate immune genes from red sea bream to assess different susceptibility to megalocytivirus infection.

    PubMed

    Jin, J W; Kim, Y C; Hong, S; Kim, M S; Jeong, J B; Jeong, H D

    2017-04-01

    As suggested by the Office International des Epizooties (OIE), fishes belonging to the genus Oplegnathus are more sensitive to megalocytivirus infection than other fish species including red sea bream (Pagrus major). To assess the roles of the innate immune response to these different susceptibilities, we cloned the genes encoding inflammatory factors including IL-8 and COX-2, and the antiviral factor like Mx from red sea bream for the first time and performed phylogenetic and structural analysis. Analysed expression levels of IL-1β, IL-8 and COX-2 and the antiviral factor like Mx genes performed with in vivo challenge experiment showed no difference in inflammatory gene expression or respiratory burst activity between red sea bream and rock bream (Oplegnathus fasciatus). However, the Mx gene expression levels in red sea bream were markedly higher than those in rock bream, suggesting the importance of type I interferon (IFN)-induced proteins, particularly Mx, during megalocytivirus infection, rather than inflammation-related genes. The in vitro challenge experiments using embryonic primary cultures derived from both fish species showed no difference in cytopathic effects (CPE), viral replication profiles, and inflammatory and Mx gene expression pattern between the two fish species. © 2016 John Wiley & Sons Ltd.

  17. 5-Hydroxyferulic acid methyl ester isolated from wasabi leaves inhibits 3T3-L1 adipocyte differentiation.

    PubMed

    Misawa, Naoki; Hosoya, Takahiro; Yoshida, Shuhei; Sugimoto, Osamu; Yamada-Kato, Tomoe; Kumazawa, Shigenori

    2018-02-26

    To investigate the compounds present in wasabi leaves (Wasabia japonica Matsumura) that inhibit the adipocyte differentiation, activity-guided fractionation was performed on these leaves. 5-Hydroxyferulic acid methyl ester (1: 5-HFA ester), one of the phenylpropanoids, was isolated from wasabi leaves as a compound that inhibits the adipocyte differentiation. Compound 1 suppressed the intracellular lipid accumulation of 3T3-L1 cells without significant cytotoxicity. Gene expression analysis revealed that 1 suppressed the mRNA expression of 2 master regulators of adipocyte differentiation, PPARγ and C/EBPα. Furthermore, 1 downregulated the expression of adipogenesis-related genes, GLUT4, LPL, SREBP-1c, ACC, and FAS. Protein expression analysis revealed that 1 suppressed PPARγ protein expression. Moreover, to investigate the relationship between the structure and activity of inhibiting the adipocyte differentiation, we synthesized 12 kinds of phenylpropanoid analog. Comparison of the activity among 1 and its analogs suggested that the compound containing the substructure that possess a common functional group at the ortho position such as a catechol group exhibits the activity of inhibiting the adipocyte differentiation. Taken together, our findings suggest that 1 from wasabi leaves inhibits adipocyte differentiation via the downregulation of PPARγ. Copyright © 2018 John Wiley & Sons, Ltd.

  18. Expression analysis of sox3 during testicular development, recrudescence, and after hCG induction in catfish, Clarias batrachus.

    PubMed

    Rajakumar, Anbazhagan; Senthilkumaran, Balasubramanian

    2014-01-01

    In teleosts, the expression of steroidogenic enzymes and related transcription factor genes occurs in a stage- and tissue-specific manner causing sexual development. The role of sox3, an evolutionary ancestor of SRY, has not been studied in detail. Therefore, the full-length cDNA of sox3 (1,197 kb) was cloned from catfish testis, and mRNA expression was analyzed during gonadal development, during the seasonal reproductive cycle, and after human chorionic gonadotropin (hCG) induction. Tissue distribution analysis showed that sox3 expression was higher in testis, ovary, and brain compared to other tissues analyzed. Developing and mature testis showed higher sox3 expression than ovary of corresponding stages, and more sox3 transcripts were found during the spawning phase of the seasonal reproductive cycle. Expression of sox3 was upregulated by hCG after in vivo and in vitro induction, suggesting that gonadotropins might stimulate it. In situ hybridization and immunohistochemistry showed the presence of sox3 mRNA and protein in somatic and interstitial cell layers of the testis. Sox3 could also be found in the zona radiata of developing and mature oocytes. Exposure of methyltestosterone (1 µg/l) and ethinylestradiol (1 µg/l) for 21 days during testicular development showed lower sox3 expression levels in the testis and brain, indicating a certain feedback intervention. These results suggest a possible role for Sox3 in the regulation of testicular development and function. © 2014 S. Karger AG, Basel.

  19. TUSC2 downregulates PD-L1 expression in non-small cell lung cancer (NSCLC).

    PubMed

    Cao, Xiaobo; Zhao, Yang; Wang, Jing; Dai, Bingbing; Gentile, Emanuela; Lin, Jing; Pu, Xingxiang; Ji, Lin; Wu, Shuhong; Meraz, Ismail; Majidi, Mourad; Roth, Jack A

    2017-12-08

    Expression of the TUSC2 tumor-suppressor gene in TUSC2-deficient NSCLC cells decreased PD-L1 expression and inhibited mTOR activity. Overexpressing TUSC2 or treatment with rapamycin resulted in similar inhibition of PD-L1 expression. Both TUSC2 and rapamycin decreased p70 and SK6 phosphorylation, suggesting that TUSC2 and rapamycin share the same mTOR target. Microarray mRNA expression analysis using TUSC2-inducible H1299 showed that genes that negatively regulate the mTOR pathway were significantly upregulated by TUSC2 compared with control. The presence of IFN-γ significantly increased PD-L1 expression in lung cancer cell lines, but overexpressing TUSC2 in these cell lines prevented PD-L1 from increasing in the presence of IFN-γ. Taken together, these findings show that TUSC2 can decrease PD-L1 expression in lung cancer cells. This ability to modify the tumor microenvironment suggests that TUSC2 could be added to checkpoint inhibitors to improve the treatment of lung cancer.

  20. TUSC2 downregulates PD-L1 expression in non-small cell lung cancer (NSCLC)

    PubMed Central

    Cao, Xiaobo; Zhao, Yang; Wang, Jing; Dai, Bingbing; Gentile, Emanuela; Lin, Jing; Pu, Xingxiang; Ji, Lin; Wu, Shuhong; Meraz, Ismail; Majidi, Mourad; Roth, Jack A.

    2017-01-01

    Expression of the TUSC2 tumor-suppressor gene in TUSC2-deficient NSCLC cells decreased PD-L1 expression and inhibited mTOR activity. Overexpressing TUSC2 or treatment with rapamycin resulted in similar inhibition of PD-L1 expression. Both TUSC2 and rapamycin decreased p70 and SK6 phosphorylation, suggesting that TUSC2 and rapamycin share the same mTOR target. Microarray mRNA expression analysis using TUSC2-inducible H1299 showed that genes that negatively regulate the mTOR pathway were significantly upregulated by TUSC2 compared with control. The presence of IFN-γ significantly increased PD-L1 expression in lung cancer cell lines, but overexpressing TUSC2 in these cell lines prevented PD-L1 from increasing in the presence of IFN-γ. Taken together, these findings show that TUSC2 can decrease PD-L1 expression in lung cancer cells. This ability to modify the tumor microenvironment suggests that TUSC2 could be added to checkpoint inhibitors to improve the treatment of lung cancer. PMID:29296193

  1. Diethylstilbestrol affects the expression of GPER in the gubernaculum testis.

    PubMed

    Zhang, Xuan; Ke, Song; Chen, Kai-Hong; Li, Jian-Hong; Ma, Lian; Jiang, Xue-Wu

    2015-01-01

    Recent evidence suggested a positive correlation between environmental estrogens (EEs) and high incidence of abnormalities in male urogenital system. EEs are known to cause the abnormalities of testes development and testicular descent. Diethylstilbestrol (DES) is a nonsteroidal synthetic estrogen that disrupts the morphology and proliferation of gubernacular cells, and its nongenomic effects on gubernaculum testis cells may be mediated by G protein-coupled estrogen receptor (GPER). In this study, we detected the expression of GPER in mouse gubernacular testis and investigated the effects of DES on the expression of GPER in gubernaculum testis cells. RT-PCR analysis revealed that GPER mRNA was expressed in the gubernaculum. GPER protein was detected in the parenchymal cells of the gubernaculum early in development. Furthermore, we demonstrate that GPER inhibitor G15 relieved DES-induced inhibition of GPER expression in gubernaculum testis cell, but ER inhibitor ICI 182780 had the converse effects on DES-induced inhibition of GPER expression in these cells. These data suggest that the effects of DES on mouse gubernaculum testis cells are mediated at least partially by the regulation of GPER expression.

  2. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    PubMed

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  3. Expression of the Bacillus anthracis protective antigen gene by baculovirus and vaccinia virus recombinants.

    PubMed Central

    Iacono-Connors, L C; Schmaljohn, C S; Dalrymple, J M

    1990-01-01

    The gene encoding Bacillus anthracis protective antigen (PA) was modified by site-directed mutagenesis, subcloned into baculovirus and vaccinia virus plasmid transfer vectors (pAcYM1 and pSC-11, respectively), and inserted via homologous recombinations into baculovirus Autographa californica nuclear polyhedrosis virus or vaccinia virus (strains WR and Connaught). Expression of PA was detected in both systems by immunofluorescence assays with antisera from rabbits immunized with B. anthracis PA. Western blot (immunoblot) analysis showed that the expressed product of both systems was slightly larger (86 kilodaltons) than B. anthracis-produced PA (83.5 kilodaltons). Analysis of trypsin digests of virus-expressed and authentic PA suggested that the size difference was due to the presence of a signal sequence remaining with the virus-expressed protein. Immunization of mice with either recombinant baculovirus-infected Spodoptera frugiperda cells or with vaccinia virus recombinants elicited a high-titer, anti-PA antibody response. Images PMID:2105271

  4. Gene Expression Analysis of Mouse Embryonic Stem Cells Following Levitation in an Ultrasound Standing Wave Trap

    PubMed Central

    Bazou, Despina; Kearney, Roisin; Mansergh, Fiona; Bourdon, Celine; Farrar, Jane; Wride, Michael

    2011-01-01

    In the present paper, gene expression analysis of mouse embryonic stem (ES) cells levitated in a novel ultrasound standing wave trap (USWT) (Bazou et al. 2005a) at variable acoustic pressures (0.08–0.85 MPa) and times (5–60 min) was performed. Our results showed that levitation of ES cells at the highest employed acoustic pressure for 60 min does not modify gene expression and cells maintain their pluripotency. Embryoid bodies (EBs) also expressed the early and late neural differentiation markers, which were also unaffected by the acoustic field. Our results suggest that the ultrasound trap microenvironment is minimally invasive as the biologic consequences of ES cell replication and EB differentiation proceed without significantly affecting gene expression. The technique holds great promise in safe cell manipulation techniques for a variety of applications including tissue engineering and regenerative medicine. (E-mail: Bazoud@tcd.ie) PMID:21208732

  5. Inhibition of HIV-1 gene expression by retroviral vector-mediated small-guide RNAs that direct specific RNA cleavage by tRNase ZL

    PubMed Central

    Habu, Yuichiro; Miyano-Kurosaki, Naoko; Kitano, Michiko; Endo, Yumihiko; Yukita, Masakazu; Ohira, Shigeru; Takaku, Hiroaki; Nashimoto, Masayuki; Takaku, Hiroshi

    2005-01-01

    The tRNA 3′-processing endoribonuclease (tRNase Z or 3′ tRNase; EC 3.1.26.11) is an essential enzyme that removes the 3′ trailer from pre-tRNA. The long form (tRNase ZL) can cleave a target RNA in vitro at the site directed by an appropriate small-guide RNA (sgRNA). Here, we investigated whether this sgRNA/tRNase ZL strategy could be applied to gene therapy for AIDS. We tested the ability of four sgRNA-expression plasmids to inhibit HIV-1 gene expression in COS cells, using a transient-expression assay. The three sgRNAs guide inhibition of HIV-1 gene expression in cultured COS cells. Analysis of the HIV-1 mRNA levels suggested that sgRNA directed the tRNase ZL to mediate the degradation of target RNA. The observation that sgRNA was localized primarily in nuclei suggests that tRNase ZL cleaves the HIV-1 mRNA when complexed with sgRNA in this location. We also examined the ability of two retroviral vectors expressing sgRNA to suppress HIV-1 expression in HIV-1-infected Jurkat T cells. sgRNA-SL4 suppressed HIV-1 expression almost completely in infected cells for up to 18 days. These results suggest that the sgRNA/tRNase ZL approach is effective in downregulating HIV-1 gene expression. PMID:15647506

  6. Expression Profile of NOTCH3 in Mouse Spermatogonia.

    PubMed

    Okada, Ryu; Fujimagari, Megumi; Koya, Eri; Hirose, Yoshikazu; Sato, Tomomi; Nishina, Yukio

    2017-01-01

    Stable and sustainable spermatogenesis is supported by the strict regulation of self-renewal and differentiation of spermatogonial stem cells (SSC), which are a rare population of undifferentiated spermatogonia. It has been revealed that some signaling factors regulate the self-renewal of SSC; however, the molecular mechanism of SSC maintenance is still not completely understood. Notch signaling is an evolutionarily conserved juxtacrine signaling that plays important roles in the cell fate determination of various tissue stem cells. Recently, analyses of loss- and gain-of-function suggested that Notch signaling was necessary for normal spermatogenesis. However, the expression of Notch signal components in spermatogonia is still unclear. Here, we analyzed the distribution of NOTCH3-expressing spermatogonia and the target genes. Double immunostaining with differentiation markers revealed that NOTCH3 was expressed in some undifferentiated and differentiated spermatogonia in mouse testes. To define the target gene of Notch3 signaling in spermatogonia, we analyzed the mRNA expression pattern of Hes and Hey family genes during testis development. Hes1 abundance was decreased during testis development, suggesting that spermatogonia may express Hes1. Immunohistochemical analysis showed that HES1 was expressed in prepubertal spermatogonia, whereas it was expressed predominantly in adult Sertoli cells and weakly in adult spermatogonia. Furthermore, NOTCH3-HES1 double-positive spermatogonia were in pup and adult testes. These results suggest that Notch3 signaling in spermatogonia could promote Hes1 expression. © 2017 S. Karger AG, Basel.

  7. Characterization and Expression Analysis of Receptor for Activated C Kinase from Silk-producing Insect Antheraea pernyi.

    PubMed

    Zhu, Bao-Jian; Yu, Hao; Tian, Sen; Dai, Li-Shang; Sun, Yu; Liu, Chao-Liang

    2016-01-01

    The receptor for activated C kinase (RACK) is an important scaffold protein with regulatory functions in cells. However, its role in the immune response of Antheraea pernyi to pathogen challenge remains unclear. To investigate the biological functions of RACK in the wild silkworm A. pernyi, cloning was performed and the expression patterns of the RACK gene were analyzed. Sequence analysis revealed that the RACK gene was 1120 bp containing a 960-bp open reading frame. The deduced RACK protein sequence reveals the higher identity with its homologs from other insects. SDS-PAGE and western blot analysis demonstrated successful expression of a 36-kDa recombinant RACK protein in Escherichia coli. The titer of a rabbit-raised antibody against recombinant RACK protein was about 1: 20000, determined by ELISA. Real-time PCR analysis showed that RACK expression was higher in fat bodies than in other examined A. pernyi tissues. The expression of RACK mRNA in fat bodies of fifth larvae of A. pernyi was obviously induced after nucleopolyhedrovirus, E. coli or Beauveria bassiana challenge. However, the expression patterns of RACK were different in response to these pathogens. Our data suggest that RACK may play a role in the innate immune responses of A. pernyi.

  8. Comparative proteomic analysis in children with idiopathic short stature (ISS) before and after short-term recombinant human growth hormone (rhGH) therapy.

    PubMed

    Heo, Sun Hee; Choi, Jin-Ho; Kim, Yoo-Mi; Jung, Chang-Woo; Lee, Jin; Jin, Hye Young; Kim, Gu-Hwan; Lee, Beom Hee; Shin, Choong Ho; Yoo, Han-Wook

    2013-04-01

    This study was undertaken to identify growth hormone (GH) responsive proteins and protein expression patterns by short-term recombinant human growth hormone (rhGH) therapy in patients with idiopathic short stature (ISS) using proteomic analysis. Seventeen children (14 males and three females) with ISS were included. They were treated with rhGH at a dose of 0.31 ± 0.078 mg/kg/week for 3 months. Immunodepletion of six highly-abundant serum proteins followed by 2D DIGE analysis, and subsequent MALDI TOF MS, were employed to generate a panel of proteins differentially expressed after short-term rhGH therapy and verify the differences in serum levels of specific proteins by rhGH therapy. Fourteen spots were differentially expressed after rhGH treatment. Among them, apo E and apo L-1 expression were consistently enhanced, whereas serum amyloid A was reduced after rhGH therapy. The differential expressions of these proteins were subsequently verified by Western blot analysis using sera of the before and after rhGH treatment. This study suggests that rhGH therapy influences lipoprotein metabolism and enhances apo L-1 protein expression in ISS patients. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  9. ZNF281 inhibits neuronal differentiation and is a prognostic marker for neuroblastoma.

    PubMed

    Pieraccioli, Marco; Nicolai, Sara; Pitolli, Consuelo; Agostini, Massimiliano; Antonov, Alexey; Malewicz, Michal; Knight, Richard A; Raschellà, Giuseppe; Melino, Gerry

    2018-06-25

    Derangement of cellular differentiation because of mutation or inappropriate expression of specific genes is a common feature in tumors. Here, we show that the expression of ZNF281, a zinc finger factor involved in several cellular processes, decreases during terminal differentiation of murine cortical neurons and in retinoic acid-induced differentiation of neuroblastoma (NB) cells. The ectopic expression of ZNF281 inhibits the neuronal differentiation of murine cortical neurons and NB cells, whereas its silencing causes the opposite effect. Furthermore, TAp73 inhibits the expression of ZNF281 through miR34a. Conversely, MYCN promotes the expression of ZNF281 at least in part by inhibiting miR34a. These findings imply a functional network that includes p73, MYCN, and ZNF281 in NB cells, where ZNF281 acts by negatively affecting neuronal differentiation. Array analysis of NB cells silenced for ZNF281 expression identified GDNF and NRP2 as two transcriptional targets inhibited by ZNF281. Binding of ZNF281 to the promoters of these genes suggests a direct mechanism of repression. Bioinformatic analysis of NB datasets indicates that ZNF281 expression is higher in aggressive, undifferentiated stage 4 than in localized stage 1 tumors supporting a central role of ZNF281 in affecting the differentiation of NB. Furthermore, patients with NB with high expression of ZNF281 have a poor clinical outcome compared with low-expressors. These observations suggest that ZNF281 is a controller of neuronal differentiation that should be evaluated as a prognostic marker in NB. Copyright © 2018 the Author(s). Published by PNAS.

  10. H{sup +}/peptide transporter (PEPT2) is expressed in human epidermal keratinocytes and is involved in skin oligopeptide transport

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kudo, Michiko; Katayoshi, Takeshi; Kobayashi-Nakamura, Kumiko

    Peptide transporter 2 (PEPT2) is a member of the proton-coupled oligopeptide transporter family, which mediates the cellular uptake of oligopeptides and peptide-like drugs. Although PEPT2 is expressed in many tissues, its expression in epidermal keratinocytes remains unclear. We investigated PEPT2 expression profile and functional activity in keratinocytes. We confirmed PEPT2 mRNA expression in three keratinocyte lines (normal human epidermal keratinocytes (NHEKs), immortalized keratinocytes, and malignant keratinocytes) by reverse transcription-polymerase chain reaction (RT-PCR) and quantitative real-time RT-PCR. In contrast to PEPT1, PEPT2 expression in the three keratinocytes was similar or higher than that in HepG2 cells, used as PEPT2-positive cells. Immunolocalizationmore » analysis using human skin showed epidermal PEPT2 localization. We studied keratinocyte transport function by measuring the oligopeptide content using liquid chromatography/tandem mass spectrometry. Glycylsarcosine uptake in NHEKs was pH-dependent, suggesting that keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. We also performed a skin-permeability test of several oligopeptides using skin substitute, suggesting that di- and tripeptides pass actively through the epidermis. In conclusion, PEPT2 is expressed in keratinocytes and involved in skin oligopeptide uptake. -- Highlights: •PEPT2 is expressed in keratinocytes, which are more common than other skin cells. •Immunolocalization analysis using human skin revealed epidermal PEPT2 localization. •Keratinocytes could absorb small peptides in the presence of an inward H{sup +} gradient. •Di- and tripeptide pass actively through the epidermis.« less

  11. Targeted deletion and lipidomic analysis identify epithelial cell COX-2 as a major driver of chemically induced skin cancer.

    PubMed

    Jiao, Jing; Ishikawa, Tomo-O; Dumlao, Darren S; Norris, Paul C; Magyar, Clara E; Mikulec, Carol; Catapang, Art; Dennis, Edward A; Fischer, Susan M; Herschman, Harvey R

    2014-11-01

    Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX-2) plays a critical role in DMBA/TPA-induced skin tumor induction. Although many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell type-specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared with littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2-expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell type-specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biologic responses. Cox-2 gene deletion demonstrates that intrinsic COX-2 expression in initiated keratinocytes is a principal driver of skin carcinogenesis; lipidomic analysis identifies likely prostanoid effectors. ©2014 American Association for Cancer Research.

  12. Microarray Meta-Analysis Identifies Acute Lung Injury Biomarkers in Donor Lungs That Predict Development of Primary Graft Failure in Recipients

    PubMed Central

    Haitsma, Jack J.; Furmli, Suleiman; Masoom, Hussain; Liu, Mingyao; Imai, Yumiko; Slutsky, Arthur S.; Beyene, Joseph; Greenwood, Celia M. T.; dos Santos, Claudia

    2012-01-01

    Objectives To perform a meta-analysis of gene expression microarray data from animal studies of lung injury, and to identify an injury-specific gene expression signature capable of predicting the development of lung injury in humans. Methods We performed a microarray meta-analysis using 77 microarray chips across six platforms, two species and different animal lung injury models exposed to lung injury with or/and without mechanical ventilation. Individual gene chips were classified and grouped based on the strategy used to induce lung injury. Effect size (change in gene expression) was calculated between non-injurious and injurious conditions comparing two main strategies to pool chips: (1) one-hit and (2) two-hit lung injury models. A random effects model was used to integrate individual effect sizes calculated from each experiment. Classification models were built using the gene expression signatures generated by the meta-analysis to predict the development of lung injury in human lung transplant recipients. Results Two injury-specific lists of differentially expressed genes generated from our meta-analysis of lung injury models were validated using external data sets and prospective data from animal models of ventilator-induced lung injury (VILI). Pathway analysis of gene sets revealed that both new and previously implicated VILI-related pathways are enriched with differentially regulated genes. Classification model based on gene expression signatures identified in animal models of lung injury predicted development of primary graft failure (PGF) in lung transplant recipients with larger than 80% accuracy based upon injury profiles from transplant donors. We also found that better classifier performance can be achieved by using meta-analysis to identify differentially-expressed genes than using single study-based differential analysis. Conclusion Taken together, our data suggests that microarray analysis of gene expression data allows for the detection of “injury" gene predictors that can classify lung injury samples and identify patients at risk for clinically relevant lung injury complications. PMID:23071521

  13. Gene expression analysis of immunostained endothelial cells isolated from formaldehyde-fixated paraffin embedded tumors using laser capture microdissection--a technical report.

    PubMed

    Kaneko, Tomoatsu; Okiji, Takashi; Kaneko, Reika; Suda, Hideaki; Nör, Jacques E

    2009-12-01

    Laser capture microdissection (LCM) allows microscopic procurement of specific cell types from tissue sections that can then be used for gene expression analysis. In conventional LCM, frozen tissues stained with hematoxylin are normally used to the molecular analysis. Recent studies suggested that it is possible to carry out gene expression analysis of formaldehyde-fixated paraffin embedded (FFPE) tissues that were stained with hematoxylin. However, it is still unclear if quantitative gene expression analyses can be performed from LCM cells from FFPE tissues that were subjected to immunostaining to enhance identification of target cells. In this proof-of-principle study, we analyzed by reverse transcription-PCR (RT-PCR) and real time PCR the expression of genes in factor VIII immunostained human endothelial cells that were dissected from FFPE tissues by LCM. We observed that immunostaining should be performed at 4 degrees C to preserve the mRNA from the cells. The expression of Bcl-2 in the endothelial cells was evaluated by RT-PCR and by real time PCR. Glyceraldehyde-3-phosphate dehydrogenase and 18S were used as house keeping genes for RT-PCR and real time PCR, respectively. This report unveils a method for quantitative gene expression analysis in cells that were identified by immunostaining and retrieved by LCM from FFPE tissues. This method is ideally suited for the analysis of relatively rare cell types within a tissue, and should improve on our ability to perform differential diagnosis of pathologies as compared to conventional LCM.

  14. Transcriptional analysis of product-concentration driven changes in cellular programs of recombinant Clostridium acetobutylicumstrains.

    PubMed

    Tummala, Seshu B; Junne, Stefan G; Paredes, Carlos J; Papoutsakis, Eleftherios T

    2003-12-30

    Antisense RNA (asRNA) downregulation alters protein expression without changing the regulation of gene expression. Downregulation of primary metabolic enzymes possibly combined with overexpression of other metabolic enzymes may result in profound changes in product formation, and this may alter the large-scale transcriptional program of the cells. DNA-array based large-scale transcriptional analysis has the potential to elucidate factors that control cellular fluxes even in the absence of proteome data. These themes are explored in the study of large-scale transcriptional analysis programs and the in vivo primary-metabolism fluxes of several related recombinant C. acetobutylicum strains: C. acetobutylicum ATCC 824(pSOS95del) (plasmid control; produces high levels of butanol snd acetone), 824(pCTFB1AS) (expresses antisense RNA against CoA transferase (ctfb1-asRNA); produces very low levels of butanol and acetone), and 824(pAADB1) (expresses ctfb1-asRNA and the alcohol-aldehyde dahydrogenase gene (aad); produce high alcohol and low acetone levels). DNA-array based transcriptional analysis revealed that the large changes in product concentrations (snd notably butanol concentration) due to ctfb1-asRNA expression alone and in combination with aad overexpression resulted in dramatic changes of the cellular transcriptome. Cluster analysis and gene expression patterns of established and putative operons involved in stress response, motility, sporulation, and fatty-acid biosynthesis indicate that these simple genetic changes dramatically alter the cellular programs of C. acetobutylicum. Comparison of gene expression and flux analysis data may point to possible flux-controling steps and suggest unknown regulatory mechanisms. Copyright 2003; Wiley Periodicals, Inc.

  15. Age Dependent Variability in Gene Expression in Fischer 344 ...

    EPA Pesticide Factsheets

    Recent evidence suggests older adults may be a sensitive population with regard to environmental exposure to toxic compounds. One source of this sensitivity could be an enhanced variability in response. Studies on phenotypic differences have suggested that variation in response does increase with age. However, few reports address the question of variation in gene expression as an underlying cause for increased variability of phenotypic response in the aged. In this study, we utilized global analysis to compare variation in constitutive gene expression in the retinae of young (4 mos), middle-aged (11 mos) and aged (23 mos) Fischer 344 rats. Three hundred and forty transcripts were identified in which variance in expression increased from 4 to 23 mos of age, while only twelve transcripts were found for which it decreased. Functional roles for identified genes were clustered in basic biological categories including cell communication, function, metabolism and response to stimuli. Our data suggest that population stochastically-induced variability should be considered in assessing sensitivity due to old age. Recent evidence suggests older adults may be a sensitive population with regard to environmental exposure to toxic compounds. One source of this sensitivity could be an enhanced variability in response. Studies on phenotypic differences have suggested that variation in response does increase with age. However, few reports address the question of variation in

  16. Digital gene expression profiling of flax (Linum usitatissimum L.) stem peel identifies genes enriched in fiber-bearing phloem tissue.

    PubMed

    Guo, Yuan; Qiu, Caisheng; Long, Songhua; Chen, Ping; Hao, Dongmei; Preisner, Marta; Wang, Hui; Wang, Yufu

    2017-08-30

    To better understand the molecular mechanisms and gene expression characteristics associated with development of bast fiber cell within flax stem phloem, the gene expression profiling of flax stem peels and leaves were screened, using Illumina's Digital Gene Expression (DGE) analysis. Four DGE libraries (2 for stem peel and 2 for leaf), ranging from 6.7 to 9.2 million clean reads were obtained, which produced 7.0 million and 6.8 million mapped reads for flax stem peel and leave, respectively. By differential gene expression analysis, a total of 975 genes, of which 708 (73%) genes have protein-coding annotation, were identified as phloem enriched genes putatively involved in the processes of polysaccharide and cell wall metabolism. Differential expression genes (DEGs) was validated using quantitative RT-PCR, the expression pattern of all nine genes determined by qRT-PCR fitted in well with that obtained by sequencing analysis. Cluster and Gene Ontology (GO) analysis revealed that a large number of genes related to metabolic process, catalytic activity and binding category were expressed predominantly in the stem peels. The Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis of the phloem enriched genes suggested approximately 111 biological pathways. The large number of genes and pathways produced from DGE sequencing will expand our understanding of the complex molecular and cellular events in flax bast fiber development and provide a foundation for future studies on fiber development in other bast fiber crops. Copyright © 2017 Elsevier B.V. All rights reserved.

  17. Differential expression and alternative splicing of rice sulphate transporter family members regulate sulphur status during plant growth, development and stress conditions.

    PubMed

    Kumar, Smita; Asif, Mehar Hasan; Chakrabarty, Debasis; Tripathi, Rudra Deo; Trivedi, Prabodh Kumar

    2011-06-01

    Sulphur, an essential nutrient required for plant growth and development, is mainly taken up by the plants as inorganic sulphate from the soil and assimilated into the sulphur reductive pathway. The uptake and transport of sulphate in plants is carried out by transporters encoded by the sulphate transporter gene family. Plant sulphate transporters have been classified with respect to their protein sequences, kinetic properties and tissue-specific localization in Arabidopsis. Though sulphate transporter genes from few other plants have also been characterized, no detailed study with respect to the structure and expression of this family from rice has been carried out. Here, we present genome-wide identification, structural and expression analyses of the rice sulphate transporter gene family. Our analysis using microarray data and MPSS database suggests that 14 rice sulphate transporters are differentially expressed during growth and development in various tissues and during biotic and abiotic stresses. Our analysis also suggests differential accumulation of splice variants of OsSultr1;1 and OsSultr4;1 transcripts during these processes. Apart from known spliced variants, we report an unusual alternative splicing of OsSultr1;1 transcript related to sulphur supply in growth medium and during stress response. Taken together, our study suggests that differential expression and alternative splicing of members of the sulphate transporter family plays an important role in regulating cellular sulphur status required for growth and development and during stress conditions. These findings significantly advance our understanding of the posttranscriptional regulatory mechanisms operating to regulate sulphur demand by the plant.

  18. Differential expression pattern of protein markers for predicting chemosensitivity of dexamethasone-based chemotherapy of B cell acute lymphoblastic leukemia.

    PubMed

    Dehghan-Nayeri, Nasrin; Eshghi, Peyman; Pour, Kourosh Goudarzi; Rezaei-Tavirani, Mostafa; Omrani, Mir Davood; Gharehbaghian, Ahmad

    2017-07-01

    Dexamethasone is considered as a direct chemotherapeutic agent in the treatment of pediatric acute lymphoblastic leukemia (ALL). Beside the advantages of the drug, some problems arising from the dose-related side effects are challenging issues during the treatment. Accordingly, the classification of patients to dexamethasone sensitive and resistance groups can help to select optimizing the therapeutic dose with the lowest adverse effects particularly in sensitive cases. For this purpose, we investigated inhibited proliferation and induced cytotoxicity in NALM-6 cells, as sensitive cells, after dexamethasone treatment. In addition, comparative protein expression analysis using the 2DE-MALDI-TOF MS technique was performed to identify the specific altered proteins. In addition, we evaluated mRNA expression levels of the identified proteins in bone-marrow samples from pediatric ALL patients using the real-time q-PCR method. Eventually, proteomic analysis revealed a combination of biomarkers, including capping proteins (CAPZA1 and CAPZB), chloride channel (CLIC1), purine nucleoside phosphorylase (PNP), and proteasome activator (PSME1), in response to the dexamethasone treatment. In addition, our results indicated low expression of identified proteins at both the mRNA and protein expression levels after drug treatment. Moreover, quantitative real-time PCR data analysis indicated that independent of the molecular subtypes of the leukemia, CAPZA1, CAPZB, CLIC1, and PNP expression levels were lower in ALL samples than normal samples, although PSME1 expression level was higher in ALL samples than normal samples. Furthermore, the expression level of all proteins (except PSME1) was different between high-risk and standard-risk patients that suggesting the prognostic value of them. In conclusion, our study suggests a panel of biomarkers comprising CAPZA1, CAPZB, CLIC1, PNP, and PSME1 as early diagnosis and treatment evaluation markers that may differentiate cancer cells which are presumably to benefit from dexamethasone-based chemotherapy and may facilitate the prediction of clinical outcome.

  19. Identification and expression analysis of the genes involved in serotonin biosynthesis and transduction in the field cricket Gryllus bimaculatus.

    PubMed

    Watanabe, T; Sadamoto, Hitoshi; Aonuma, H

    2011-10-01

    Serotonin (5-HT) modulates various aspects of behaviours such as aggressive behaviour and circadian behaviour in the cricket. To elucidate the molecular basis of the cricket 5-HT system, we identified 5-HT-related genes in the field cricket Gryllus bimaculatus DeGeer. Complementary DNA of tryptophan hydroxylase and phenylalanine-tryptophan hydroxylase, which convert tryptophan into 5-hydroxy-L-tryptophan (5-HTP), and that of aromatic L-amino acid decarboxylase, which converts 5-HTP into 5-HT, were isolated from a cricket brain cDNA library. In addition, four 5-HT receptor genes (5-HT(1A) , 5-HT(1B) , 5-HT(2α) , and 5-HT(7) ) were identified. Expression analysis of the tryptophan hydroxylase gene TRH and phenylalanine-tryptophan hydroxylase gene TPH, which are selectively involved in neuronal and peripheral 5-HT synthesis in Drosophila, suggested that two 5-HT synthesis pathways co-exist in the cricket neuronal tissues. The four 5-HT receptor genes were expressed in various tissues at differential expression levels, suggesting that the 5-HT system is widely distributed in the cricket. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.

  20. Molecular cloning, expression pattern, and chemical analysis of heat shock protein 70 (HSP70) in the mudskipper Boleophthalmus pectinirostris: Evidence for its role in regulating spermatogenesis.

    PubMed

    Han, Ying-Li; Yang, Wan-Xi; Long, Ling-Li; Sheng, Zhang; Zhou, Yang; Zhao, Yong-Qiang; Wang, You-Fa; Zhu, Jun-Quan

    2016-01-10

    Heat shock protein 70 (HSP70) is molecular chaperone that is important for reproductive biological processes. In this study, a full length HSP70 from the mudskipper (Boleophthalmus pectinirostris) was characterized. It was found to contain: a 108 bp 5'-untranslated region, a 208 bp 3'-untranslated region, and a 1953 bp open reading frame, which encodes a protein of 650 amino acids with a theoretical molecular weight of 71.1 kDa and an isoelectric point of 5.17. RT-PCR analysis revealed that HSP70 was ubiquitously expressed in all major tissues with differential expression levels. This suggests that HSP70 has vital and conserved biological functions. HSP70 was localized mainly in the cytoplasm of germinal cells, indicating an important role of this protein during spermatogenesis. In response to heat stress, the testes presented abnormal morphology in connective tissues, in which HSP70 immunoreactivity was not observed. HSP70 mRNA expression in the gill, liver, and testes was significantly increased, which suggests that HSP70 plays an important role in protection against heat stress. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. Identification and functional characterization of effectors in expressed sequence tags from various life cycle stages of the potato cyst nematode Globodera pallida.

    PubMed

    Jones, John T; Kumar, Amar; Pylypenko, Liliya A; Thirugnanasambandam, Amarnath; Castelli, Lydia; Chapman, Sean; Cock, Peter J A; Grenier, Eric; Lilley, Catherine J; Phillips, Mark S; Blok, Vivian C

    2009-11-01

    In this article, we describe the analysis of over 9000 expressed sequence tags (ESTs) from cDNA libraries obtained from various life cycle stages of Globodera pallida. We have identified over 50 G. pallida effectors from this dataset using bioinformatics analysis, by screening clones in order to identify secreted proteins up-regulated after the onset of parasitism and using in situ hybridization to confirm the expression in pharyngeal gland cells. A substantial gene family encoding G. pallida SPRYSEC proteins has been identified. The expression of these genes is restricted to the dorsal pharyngeal gland cell. Different members of the SPRYSEC family of proteins from G. pallida show different subcellular localization patterns in plants, with some localized to the cytoplasm and others to the nucleus and nucleolus. Differences in subcellular localization may reflect diverse functional roles for each individual protein or, more likely, variety in the compartmentalization of plant proteins targeted by the nematode. Our data are therefore consistent with the suggestion that the SPRYSEC proteins suppress host defences, as suggested previously, and that they achieve this through interaction with a range of host targets.

  2. Microarray analysis of differential gene expression elicited in Trametes versicolor during interspecific mycelial interactions.

    PubMed

    Eyre, Catherine; Muftah, Wafa; Hiscox, Jennifer; Hunt, Julie; Kille, Peter; Boddy, Lynne; Rogers, Hilary J

    2010-08-01

    Trametes versicolor is an important white rot fungus of both industrial and ecological interest. Saprotrophic basidiomycetes are the major decomposition agents in woodland ecosystems, and rarely form monospecific populations, therefore interspecific mycelial interactions continually occur. Interactions have different outcomes including replacement of one species by the other or deadlock. We have made subtractive cDNA libraries to enrich for genes that are expressed when T. versicolor interacts with another saprotrophic basidiomycete, Stereum gausapatum, an interaction that results in the replacement of the latter. Expressed sequence tags (ESTs) (1920) were used for microarray analysis, and their expression compared during interaction with three different fungi: S. gausapatum (replaced by T. versicolor), Bjerkandera adusta (deadlock) and Hypholoma fasciculare (replaced T. versicolor). Expression of significantly more probes changed in the interaction between T. versicolor and S. gausapatum or B. adusta compared to H. fasciculare, suggesting a relationship between interaction outcome and changes in gene expression. Copyright © 2010 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  3. Analysis of a Plant Transcriptional Regulatory Network Using Transient Expression Systems.

    PubMed

    Díaz-Triviño, Sara; Long, Yuchen; Scheres, Ben; Blilou, Ikram

    2017-01-01

    In plant biology, transient expression systems have become valuable approaches used routinely to rapidly study protein expression, subcellular localization, protein-protein interactions, and transcriptional activity prior to in vivo studies. When studying transcriptional regulation, luciferase reporter assays offer a sensitive readout for assaying promoter behavior in response to different regulators or environmental contexts and to confirm and assess the functional relevance of predicted binding sites in target promoters. This chapter aims to provide detailed methods for using luciferase reporter system as a rapid, efficient, and versatile assay to analyze transcriptional regulation of target genes by transcriptional regulators. We describe a series of optimized transient expression systems consisting of Arabidopsis thaliana protoplasts, infiltrated Nicotiana benthamiana leaves, and human HeLa cells to study the transcriptional regulations of two well-characterized transcriptional regulators SCARECROW (SCR) and SHORT-ROOT (SHR) on one of their targets, CYCLIN D6 (CYCD6).Here, we illustrate similarities and differences in outcomes when using different systems. The plant-based systems revealed that the SCR-SHR complex enhances CYCD6 transcription, while analysis in HeLa cells showed that the complex is not sufficient to strongly induce CYCD6 transcription, suggesting that additional, plant-specific regulators are required for full activation. These results highlight the importance of the system and suggest that including heterologous systems, such as HeLa cells, can provide a more comprehensive analysis of a complex gene regulatory network.

  4. Auxin Response Factor Genes Repertoire in Mulberry: Identification, and Structural, Functional and Evolutionary Analyses

    PubMed Central

    Baranwal, Vinay Kumar; Negi, Nisha; Khurana, Paramjit

    2017-01-01

    Auxin Response Factors (ARFs) are at the core of the regulation mechanism for auxin-mediated responses, along with AUX/IAA proteins.They are critical in the auxin-mediated control of various biological responses including development and stress. A wild mulberry species genome has been sequenced and offers an opportunity to investigate this important gene family. A total of 17 ARFs have been identified from mulberry (Morus notabilis) which show a wide range of expression patterns. Of these 17 ARFs, 15 have strong acidic isoelectric point (pI) values and a molecular mass ranging from 52 kDa to 101 kDa. The putative promoters of these ARFs harbour cis motifs related to light-dependent responses, various stress responses and hormone regulations suggestive of their multifactorial regulation. The gene ontology terms for ARFs indicate their role in flower development, stress, root morphology and other such development and stress mitigation related activities. Conserved motif analysis showed the presence of all typical domains in all but four members that lack the PB1 domain and thus represent truncated ARFs. Expression analysis of these ARFs suggests their preferential expression in tissues ranging from leaf, root, winter bud, bark and male flowers. These ARFs showed differential expression in the leaf tissue of M. notabilis, Morus laevigata and Morus serrata. Insights gained from this analysis have implications in mulberry improvement programs. PMID:28841197

  5. ASR5 is involved in the regulation of miRNA expression in rice.

    PubMed

    Neto, Lauro Bücker; Arenhart, Rafael Augusto; de Oliveira, Luiz Felipe Valter; de Lima, Júlio Cesar; Bodanese-Zanettini, Maria Helena; Margis, Rogerio; Margis-Pinheiro, Márcia

    2015-11-01

    The work describes an ASR knockdown transcriptomic analysis by deep sequencing of rice root seedlings and the transactivation of ASR cis-acting elements in the upstream region of a MIR gene. MicroRNAs are key regulators of gene expression that guide post-transcriptional control of plant development and responses to environmental stresses. ASR (ABA, Stress and Ripening) proteins are plant-specific transcription factors with key roles in different biological processes. In rice, ASR proteins have been suggested to participate in the regulation of stress response genes. This work describes the transcriptomic analysis by deep sequencing two libraries, comparing miRNA abundance from the roots of transgenic ASR5 knockdown rice seedlings with that of the roots of wild-type non-transformed rice seedlings. Members of 59 miRNA families were detected, and 276 mature miRNAs were identified. Our analysis detected 112 miRNAs that were differentially expressed between the two libraries. A predicted inverse correlation between miR167abc and its target gene (LOC_Os07g29820) was confirmed using RT-qPCR. Protoplast transactivation assays showed that ASR5 is able to recognize binding sites upstream of the MIR167a gene and drive its expression in vivo. Together, our data establish a comparative study of miRNAome profiles and is the first study to suggest the involvement of ASR proteins in miRNA gene regulation.

  6. Recognizing Facial Expressions Automatically from Video

    NASA Astrophysics Data System (ADS)

    Shan, Caifeng; Braspenning, Ralph

    Facial expressions, resulting from movements of the facial muscles, are the face changes in response to a person's internal emotional states, intentions, or social communications. There is a considerable history associated with the study on facial expressions. Darwin [22] was the first to describe in details the specific facial expressions associated with emotions in animals and humans, who argued that all mammals show emotions reliably in their faces. Since that, facial expression analysis has been a area of great research interest for behavioral scientists [27]. Psychological studies [48, 3] suggest that facial expressions, as the main mode for nonverbal communication, play a vital role in human face-to-face communication. For illustration, we show some examples of facial expressions in Fig. 1.

  7. Prognostic value of matrix metalloproteinase 9 expression in patients with juvenile nasopharyngeal angiofibroma: tissue microarray analysis.

    PubMed

    Sun, Xicai; Guo, Limin; Wang, Jingjing; Wang, Huan; Liu, Zhuofu; Liu, Juan; Yu, Huapeng; Hu, Li; Li, Han; Wang, Dehui

    2014-08-01

    Although JNA is a benign neoplasm histopathologically, it has a propensity for locally destructive growth and remains a higher postoperative recurrence rate. The aim of this study was to analyze the expression and localization of MMP-9 in JNA using tissue microarray to elucidate its correlation with clinicopathological features and recurrence. The expression of MMP-9 was assessed by immunohistochemistry in a tissue microarray from 70 patients with JNA and 10 control subjects. Correlation between the levels of MMP-9 expression and clinicopathologic variables, as well as tumor recurrence, were analyzed. MMP-9 was detected in perivascular and extravascular less differentiated cells and stromal cells of patients with JNA but not in the matured vascular endothelial cells of these patients. The presence of MMP-9 expression in JNA was correlated with patient's age (p=0.001). Spearman correlation analysis suggested that high expression of MMP-9 in JNA had negative correlation with patient's age (r=-0.412, p<0.001). The recurrence rate in JNA patients with high MMP-9 expression was significantly higher than those with low MMP-9 expression (p=0.002). In multivariate and ROC curve analysis, MMP-9 was a good prognostic factor for tumor recurrence of JNA. Higher MMP-9 expression is a poor prognostic factor for patients with JNA who have been surgically treated. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  8. Long non-coding RNA LSINCT5 predicts negative prognosis and exhibits oncogenic activity in gastric cancer.

    PubMed

    Xu, Mi-Die; Qi, Peng; Weng, Wei-Wei; Shen, Xiao-Han; Ni, Shu-Juan; Dong, Lei; Huang, Dan; Tan, Cong; Sheng, Wei-Qi; Zhou, Xiao-Yan; Du, Xiang

    2014-12-01

    Long non-coding RNAs (lncRNAs) are recently discovered RNA transcripts that are aberrantly expressed in many tumor types. Numerous studies have suggested that lncRNAs can be utilized for cancer diagnosis and prognosis. LSINCT5 (long stress-induced non-coding transcript 5) is dramatically upregulated in breast and ovarian cancer and affects cellular proliferation. However, the expression pattern of LSINCT5 in gastrointestinal cancer and the association between aberrant expression of LSINCT5 in gastrointestinal cancer and malignancy, metastasis, or prognosis remain unknown. LSINCT5 expression was detected in gastrointestinal cancer and paired adjacent normal tissue samples or cell lines using reverse transcription quantitative PCR (RT-qPCR). We also investigated the potential relationship between tumor LSINCT5 levels and clinicopathological features of gastrointestinal cancer. Finally, we assessed whether LSINCT5 influences in vitro cell proliferation. The expression of LSINCT5 is significantly upregulated in gastrointestinal cancer tissues and cell lines relative to their normal counterparts. In addition, increased LSINCT5 expression was correlated with a larger tumor size, deeper tumor depth, and advanced clinical stage. Kaplan-Meier analysis indicated that gastric cancer (GC) and colorectal cancer (CRC) patients with higher LSINCT5 expression levels have worse disease-free survival (DFS) and disease-specific survival (DSS) rates. Moreover, multivariate analysis revealed that increased expression of LSINCT5 is an independent predictor of DFS and DSS rates in GC patients. The ectopic expression of LSINCT5 in gastrointestinal cancer cell lines resulted in an increase in cellular proliferation; conversely, knock down of LSINCT5 significantly inhibited proliferation. These results suggest that LSINCT5 may represent a novel prognostic indicator and a target for gene therapy in gastrointestinal cancer.

  9. Distinct profiles of expressed sequence tags during intestinal regeneration in the sea cucumber Holothuria glaberrima

    PubMed Central

    Rojas-Cartagena, Carmencita; Ortíz-Pineda, Pablo; Ramírez-Gómez, Francisco; Suárez-Castillo, Edna C.; Matos-Cruz, Vanessa; Rodríguez, Carlos; Ortíz-Zuazaga, Humberto; García-Arrarás, José E.

    2010-01-01

    Repair and regeneration are key processes for tissue maintenance, and their disruption may lead to disease states. Little is known about the molecular mechanisms that underline the repair and regeneration of the digestive tract. The sea cucumber Holothuria glaberrima represents an excellent model to dissect and characterize the molecular events during intestinal regeneration. To study the gene expression profile, cDNA libraries were constructed from normal, 3-day, and 7-day regenerating intestines of H. glaberrima. Clones were randomly sequenced and queried against the nonredundant protein database at the National Center for Biotechnology Information. RT-PCR analyses were made of several genes to determine their expression profile during intestinal regeneration. A total of 5,173 sequences from three cDNA libraries were obtained. About 46.2, 35.6, and 26.2% of the sequences for the normal, 3-days, and 7-days cDNA libraries, respectively, shared significant similarity with known sequences in the protein database of GenBank but only present 10% of similarity among them. Analysis of the libraries in terms of functional processes, protein domains, and most common sequences suggests that a differential expression profile is taking place during the regeneration process. Further examination of the expressed sequence tag dataset revealed that 12 putative genes are differentially expressed at significant level (R > 6). Experimental validation by RT-PCR analysis reveals that at least three genes (unknown C-4677-1, melanotransferrin, and centaurin) present a differential expression during regeneration. These findings strongly suggest that the gene expression profile varies among regeneration stages and provide evidence for the existence of differential gene expression. PMID:17579180

  10. Gene expression profiling of bone marrow mesenchymal stem cells from Osteogenesis Imperfecta patients during osteoblast differentiation.

    PubMed

    Kaneto, Carla Martins; Pereira Lima, Patrícia S; Prata, Karen Lima; Dos Santos, Jane Lima; de Pina Neto, João Monteiro; Panepucci, Rodrigo Alexandre; Noushmehr, Houtan; Covas, Dimas Tadeu; de Paula, Francisco José Alburquerque; Silva, Wilson Araújo

    2017-06-01

    Mesenchymal stem cells (MSCs) are precursors present in adult bone marrow that are able to differentiate into osteoblasts, adipocytes and chondroblasts that have gained great importance as a source for cell therapy. Recently, a number of studies involving the analysis of gene expression of undifferentiated MSCs and of MSCs in the differentiation into multiple lineage processes were observed but there is no information concerning the gene expression of MSCs from Osteogenesis Imperfecta (OI) patients. Osteogenesis Imperfecta is characterized as a genetic disorder in which a generalized osteopenia leads to excessive bone fragility and severe bone deformities. The aim of this study was to analyze gene expression profile during osteogenic differentiation from BMMSCs (Bone Marrow Mesenchymal Stem Cells) obtained from patients with Osteogenesis Imperfecta and from control subjects. Bone marrow samples were collected from three normal subjects and five patients with OI. Mononuclear cells were isolated for obtaining mesenchymal cells that had been expanded until osteogenic differentiation was induced. RNA was harvested at seven time points during the osteogenic differentiation period (D0, D+1, D+2, D+7, D+12, D+17 and D+21). Gene expression analysis was performed by the microarray technique and identified several differentially expressed genes. Some important genes for osteoblast differentiation had lower expression in OI patients, suggesting a smaller commitment of these patient's MSCs with the osteogenic lineage. Other genes also had their differential expression confirmed by RT-qPCR. An increase in the expression of genes related to adipocytes was observed, suggesting an increase of adipogenic differentiation at the expense osteogenic differentiation. Copyright © 2017. Published by Elsevier Masson SAS.

  11. Overexpression of GRß in colonic mucosal cell line partly reflects altered gene expression in colonic mucosa of patients with inflammatory bowel disease.

    PubMed

    Nagy, Zsolt; Acs, Bence; Butz, Henriett; Feldman, Karolina; Marta, Alexa; Szabo, Peter M; Baghy, Kornelia; Pazmany, Tamas; Racz, Karoly; Liko, Istvan; Patocs, Attila

    2016-01-01

    The glucocorticoid receptor (GR) plays a crucial role in inflammatory responses. GR has several isoforms, of which the most deeply studied are the GRα and GRß. Recently it has been suggested that in addition to its negative dominant effect on GRα, the GRß may have a GRα-independent transcriptional activity. The GRß isoform was found to be frequently overexpressed in various autoimmune diseases, including inflammatory bowel disease (IBD). In this study, we wished to test whether the gene expression profile found in a GRß overexpressing intestinal cell line (Caco-2GRß) might mimic the gene expression alterations found in patients with IBD. Whole genome microarray analysis was performed in both normal and GRß overexpressing Caco-2 cell lines with and without dexamethasone treatment. IBD-related genes were identified from a meta-analysis of 245 microarrays available in online microarray deposits performed on intestinal mucosa samples from patients with IBD and healthy individuals. The differentially expressed genes were further studied using in silico pathway analysis. Overexpression of GRß altered a large proportion of genes that were not regulated by dexamethasone suggesting that GRß may have a GRα-independent role in the regulation of gene expression. About 10% of genes differentially expressed in colonic mucosa samples from IBD patients compared to normal subjects were also detected in Caco-2 GRß intestinal cell line. Common genes are involved in cell adhesion and cell proliferation. Overexpression of GRß in intestinal cells may affect appropriate mucosal repair and intact barrier function. The proposed novel role of GRß in intestinal epithelium warrants further studies. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Differential Effect of Active Smoking on Gene Expression in Male and Female Smokers

    PubMed Central

    Paul, Sunirmal; Amundson, Sally A

    2015-01-01

    Smoking is the second leading cause of preventable death in the United States. Cohort epidemiological studies have demonstrated that women are more vulnerable to cigarette-smoking induced diseases than their male counterparts, however, the molecular basis of these differences has remained unknown. In this study, we explored if there were differences in the gene expression patterns between male and female smokers, and how these patterns might reflect different sex-specific responses to the stress of smoking. Using whole genome microarray gene expression profiling, we found that a substantial number of oxidant related genes were expressed in both male and female smokers, however, smoking-responsive genes did indeed differ greatly between male and female smokers. Gene set enrichment analysis (GSEA) against reference oncogenic signature gene sets identified a large number of oncogenic pathway gene-sets that were significantly altered in female smokers compared to male smokers. In addition, functional annotation with Ingenuity Pathway Analysis (IPA) identified smoking-correlated genes associated with biological functions in male and female smokers that are directly relevant to well-known smoking related pathologies. However, these relevant biological functions were strikingly overrepresented in female smokers compared to male smokers. IPA network analysis with the functional categories of immune and inflammatory response gene products suggested potential interactions between smoking response and female hormones. Our results demonstrate a striking dichotomy between male and female gene expression responses to smoking. This is the first genome-wide expression study to compare the sex-specific impacts of smoking at a molecular level and suggests a novel potential connection between sex hormone signaling and smoking-induced diseases in female smokers. PMID:25621181

  13. Genome-Wide Identification, Expression, and Functional Analysis of the Sugar Transporter Gene Family in Cassava (Manihot esculenta).

    PubMed

    Liu, Qin; Dang, Huijie; Chen, Zhijian; Wu, Junzheng; Chen, Yinhua; Chen, Songbi; Luo, Lijuan

    2018-03-26

    The sugar transporter ( STP ) gene family encodes monosaccharide transporters that contain 12 transmembrane domains and belong to the major facilitator superfamily. STP genes play critical roles in monosaccharide distribution and participate in diverse plant metabolic processes. To investigate the potential roles of STPs in cassava ( Manihot esculenta ) tuber root growth, genome-wide identification and expression and functional analyses of the STP gene family were performed in this study. A total of 20 MeSTP genes ( MeSTP1 - 20 ) containing the Sugar_tr conserved motifs were identified from the cassava genome, which could be further classified into four distinct groups in the phylogenetic tree. The expression profiles of the MeSTP genes explored using RNA-seq data showed that most of the MeSTP genes exhibited tissue-specific expression, and 15 out of 20 MeSTP genes were mainly expressed in the early storage root of cassava. qRT-PCR analysis further confirmed that most of the MeSTPs displayed higher expression in roots after 30 and 40 days of growth, suggesting that these genes may be involved in the early growth of tuber roots. Although all the MeSTP proteins exhibited plasma membrane localization, variations in monosaccharide transport activity were found through a complementation analysis in a yeast ( Saccharomyces cerevisiae ) mutant, defective in monosaccharide uptake. Among them, MeSTP2, MeSTP15, and MeSTP19 were able to efficiently complement the uptake of five monosaccharides in the yeast mutant, while MeSTP3 and MeSTP16 only grew on medium containing galactose, suggesting that these two MeSTP proteins are transporters specific for galactose. This study provides significant insights into the potential functions of MeSTPs in early tuber root growth, which possibly involves the regulation of monosaccharide distribution.

  14. Genome-Wide Identification, Evolution and Expression Analysis of mTERF Gene Family in Maize

    PubMed Central

    Zhao, Yanxin; Cai, Manjun; Zhang, Xiaobo; Li, Yurong; Zhang, Jianhua; Zhao, Hailiang; Kong, Fei; Zheng, Yonglian; Qiu, Fazhan

    2014-01-01

    Plant mitochondrial transcription termination factor (mTERF) genes comprise a large family with important roles in regulating organelle gene expression. In this study, a comprehensive database search yielded 31 potential mTERF genes in maize (Zea mays L.) and most of them were targeted to mitochondria or chloroplasts. Maize mTERF were divided into nine main groups based on phylogenetic analysis, and group IX represented the mitochondria and species-specific clade that diverged from other groups. Tandem and segmental duplication both contributed to the expansion of the mTERF gene family in the maize genome. Comprehensive expression analysis of these genes, using microarray data and RNA-seq data, revealed that these genes exhibit a variety of expression patterns. Environmental stimulus experiments revealed differential up or down-regulation expression of maize mTERF genes in seedlings exposed to light/dark, salts and plant hormones, respectively, suggesting various important roles of maize mTERF genes in light acclimation and stress-related responses. These results will be useful for elucidating the roles of mTERF genes in the growth, development and stress response of maize. PMID:24718683

  15. Detecting and Categorizing Fleeting Emotions in Faces

    PubMed Central

    Sweeny, Timothy D.; Suzuki, Satoru; Grabowecky, Marcia; Paller, Ken A.

    2013-01-01

    Expressions of emotion are often brief, providing only fleeting images from which to base important social judgments. We sought to characterize the sensitivity and mechanisms of emotion detection and expression categorization when exposure to faces is very brief, and to determine whether these processes dissociate. Observers viewed 2 backward-masked facial expressions in quick succession, 1 neutral and the other emotional (happy, fearful, or angry), in a 2-interval forced-choice task. On each trial, observers attempted to detect the emotional expression (emotion detection) and to classify the expression (expression categorization). Above-chance emotion detection was possible with extremely brief exposures of 10 ms and was most accurate for happy expressions. We compared categorization among expressions using a d′ analysis, and found that categorization was usually above chance for angry versus happy and fearful versus happy, but consistently poor for fearful versus angry expressions. Fearful versus angry categorization was poor even when only negative emotions (fearful, angry, or disgusted) were used, suggesting that this categorization is poor independent of decision context. Inverting faces impaired angry versus happy categorization, but not emotion detection, suggesting that information from facial features is used differently for emotion detection and expression categorizations. Emotion detection often occurred without expression categorization, and expression categorization sometimes occurred without emotion detection. These results are consistent with the notion that emotion detection and expression categorization involve separate mechanisms. PMID:22866885

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yang, Yi -Lin; Ni, Jian; Hsu, Ping -Chih

    Malignant pleural mesothelioma (mesothelioma) is a highly aggressive cancer without an effective treatment. Cul4A, a scaffold protein that recruits substrates for degradation, is amplified in several human cancers, including mesothelioma. We have recently shown that Cul4A plays an oncogenic role in vitro and in a mouse model. In this study, we analysed clinical mesothelioma tumours and found moderate to strong expression of Cul4A in 70.9% (51/72) of these tumours, as shown by immunohistochemistry. In 72.2% mesothelioma tumours with increased Cul4A copy number identified by fluorescence in situ hybridization analysis, Cul4A protein expression was moderate to strong. Similarly, Cul4A was overexpressedmore » and Cul4A copy number was increased in human mesothelioma cell lines. Because Gli1 is highly expressed in human mesothelioma cells, we compared Cul4A and Gli1 expression in mesothelioma tumours and found their expression associated (P < 0.05, chi-square). In mesothelioma cell lines, inhibiting Cul4A by siRNA decreased Gli1 expression, suggesting that Gli1 expression is, at least in part, regulated by Cul4A in mesothelioma cells. Our results suggest a linkage between Cul4A and Gli1 expression in human mesothelioma.« less

  17. The Expression of the Endogenous mTORC1 Inhibitor Sestrin 2 Is Induced by UVB and Balanced with the Expression Level of Sestrin 1.

    PubMed

    Mlitz, Veronika; Gendronneau, Gaelle; Berlin, Irina; Buchberger, Maria; Eckhart, Leopold; Tschachler, Erwin

    2016-01-01

    Sestrin 2 (SESN2) is an evolutionarily conserved regulator of mechanistic target of rapamycin complex 1 (mTORC1) which controls central cellular processes such as protein translation and autophagy. Previous studies have suggested that SESN2 itself is subjected to regulation at multiple levels. Here, we investigated the expression of SESN2 in the skin and in isolated skin cells. SESN2 was detected by immunofluorescence analysis in fibroblasts and keratinocytes of human skin. Differentiation of epidermal keratinocytes was not associated with altered SESN2 expression and siRNA-mediated knockdown of SESN2 did not impair stratum corneum formation in vitro. However, SESN2 was increased in both cell types when the expression of its paralog SESN1 was blocked by siRNA-mediated knock down, indicating a compensatory mechanism for the control of expression. Irradiation with UVB but not with UVA significantly increased SESN2 expression in both keratinocytes and fibroblasts. Upregulation of SESN2 expression could be completely blocked by suppression of p53. These results suggest that SESN2 is dispensable for normal epidermal keratinization but involved in the UVB stress response of skin cells.

  18. Onset of Tlx-3 expression in the chick cerebellar cortex correlates with the morphological development of fissures and delineates a posterior transverse boundary.

    PubMed

    Logan, Cairine; Millar, Cassie; Bharadia, Vinay; Rouleau, Katherine

    2002-06-24

    Recent studies have shown that the mammalian cerebellar cortex can be subdivided into a reproducible array of zones and stripes. In particular, discontinuous patterns of gene expression together with mutational analysis suggest that there are at least four distinct transverse zones along the rostrocaudal axis in mouse: the anterior zone (lobules I-V), the central zone (lobules VI and VII), the posterior zone (lobules VIII and IX), and the nodular zone (lobule X). Here we show that the divergent homeobox-containing transcription factor, Tlx- 3 (also known as Hox11L2 or Rnx) is transiently expressed in external granule cells in a distinct transverse domain of the developing chick cerebellar cortex. Expression is first detected at Hamburger and Hamilton (HH) stage 35. Interestingly, Tlx-3 mRNA expression is initially confined to, and coincident with, the morphological development of fissures. Slightly later, at HH stage 38, expression extends throughout the developing external granular layer (EGL) of lobules I-IXab. Notably, no Tlx-3 expression was detected in lobules IXc and X at any developmental time point examined. Expression is noticeably stronger in nonproliferating cells located in the deep layer of the EGL. Tlx-3 expression is downregulated as granule cells migrate inward to form the internal granule layer and is undetectable shortly after birth. These results suggest that Tlx-3 is expressed as granule cells become postmitotic and suggest that Tlx-3 may play a role in the differentiation of distinct neuronal populations in the cerebellum. Copyright 2002 Wiley-Liss, Inc.

  19. TGF-beta3 is expressed in taste buds and inhibits proliferation of primary cultured taste epithelial cells.

    PubMed

    Nakamura, Shin-ichi; Kawai, Takayuki; Kamakura, Takashi; Ookura, Tetsuya

    2010-01-01

    Transforming growth factor-betas (TGF-betas), expressed in various tissues, play important roles in embryonic development and adult tissue homeostasis through their effects on cell proliferation, cell differentiation, cell death, and cell motility. However, expression of TGF-beta signaling components and their biological effect on taste epithelia has not been elucidated. We performed expression analysis of TGF-beta signaling components in taste epithelia and found that the TGF-beta3 mRNA was specifically expressed in taste buds. Type II TGF-betas receptor (TbetaR-II) mRNA was specifically expressed in the tongue epithelia including the taste epithelia. To elucidate the biological function of TGF-beta3 in taste epithelia, we performed proliferation assay with primary cultured taste epithelial cells. In the presence of TGF-beta3, percentage of BrdU-labeled cells decreased significantly, suggesting that the TGF-beta3 inhibited the proliferation of cultured taste epithelial cells through inhibiting cell-cycle entry into S phase. By quantitative reverse transcription-polymerase chain reaction assay, we found that the TGF-beta3 resulted in an increased level of expression of p15Ink4b and p21Cip1, suggesting that the TGF-beta3 inhibited the taste epithelial cell proliferation through inhibiting G1cyclin-Cdk complexes. Taken together, these results suggested that the TGF-beta3 may regulate taste epithelial cell homeostasis through controlling cell proliferation.

  20. Social Risk and Depression: Evidence from Manual and Automatic Facial Expression Analysis

    PubMed Central

    Girard, Jeffrey M.; Cohn, Jeffrey F.; Mahoor, Mohammad H.; Mavadati, Seyedmohammad; Rosenwald, Dean P.

    2014-01-01

    Investigated the relationship between change over time in severity of depression symptoms and facial expression. Depressed participants were followed over the course of treatment and video recorded during a series of clinical interviews. Facial expressions were analyzed from the video using both manual and automatic systems. Automatic and manual coding were highly consistent for FACS action units, and showed similar effects for change over time in depression severity. For both systems, when symptom severity was high, participants made more facial expressions associated with contempt, smiled less, and those smiles that occurred were more likely to be accompanied by facial actions associated with contempt. These results are consistent with the “social risk hypothesis” of depression. According to this hypothesis, when symptoms are severe, depressed participants withdraw from other people in order to protect themselves from anticipated rejection, scorn, and social exclusion. As their symptoms fade, participants send more signals indicating a willingness to affiliate. The finding that automatic facial expression analysis was both consistent with manual coding and produced the same pattern of depression effects suggests that automatic facial expression analysis may be ready for use in behavioral and clinical science. PMID:24598859

  1. Antennal transcriptome analysis of the Asian longhorned beetle Anoplophora glabripennis

    PubMed Central

    Hu, Ping; Wang, Jingzhen; Cui, Mingming; Tao, Jing; Luo, Youqing

    2016-01-01

    Olfactory proteins form the basis of insect olfactory recognition, which is crucial for host identification, mating, and oviposition. Using transcriptome analysis of Anoplophora glabripennis antenna, we identified 42 odorant-binding proteins (OBPs), 12 chemosensory proteins (CSPs), 14 pheromone-degrading enzymes (PDEs), 1 odorant-degrading enzymes (ODE), 37 odorant receptors (ORs), 11 gustatory receptors (GRs), 2 sensory neuron membrane proteins (SNMPs), and 4 ionotropic receptor (IR). All CSPs and PBPs were expressed in antennae, confirming the authenticity of the transcriptome data. CSP expression profiles showed that AglaCSP3, AglaCSP6, and AglaCSP12 were expressed preferentially in maxillary palps and AglaCSP7 and AglaCSP9 were strongly expressed in antennae. The vast majority of CSPs were highly expressed in multiple chemosensory tissues, suggesting their participation in olfactory recognition in almost all olfactory tissues. Intriguingly, the PBP AglaPBP2 was preferentially expressed in antenna, indicating that it is the main protein involved in efficient and sensitive pheromone recognition. Phylogenetic analysis of olfactory proteins indicated AglaGR1 may detect CO2. This study establishes a foundation for determining the chemoreception molecular mechanisms of A. glabripennis, which would provide a new perspective for controlling pest populations, especially those of borers. PMID:27222053

  2. Breast cancer genome and transcriptome integration implicates specific mutational signatures with immune cell infiltration

    PubMed Central

    Smid, Marcel; Rodríguez-González, F. Germán; Sieuwerts, Anieta M.; Salgado, Roberto; Prager-Van der Smissen, Wendy J. C.; Vlugt-Daane, Michelle van der; van Galen, Anne; Nik-Zainal, Serena; Staaf, Johan; Brinkman, Arie B.; van de Vijver, Marc J.; Richardson, Andrea L.; Fatima, Aquila; Berentsen, Kim; Butler, Adam; Martin, Sancha; Davies, Helen R.; Debets, Reno; Gelder, Marion E. Meijer-Van; van Deurzen, Carolien H. M.; MacGrogan, Gaëtan; Van den Eynden, Gert G. G. M.; Purdie, Colin; Thompson, Alastair M.; Caldas, Carlos; Span, Paul N.; Simpson, Peter T.; Lakhani, Sunil R.; Van Laere, Steven; Desmedt, Christine; Ringnér, Markus; Tommasi, Stefania; Eyford, Jorunn; Broeks, Annegien; Vincent-Salomon, Anne; Futreal, P. Andrew; Knappskog, Stian; King, Tari; Thomas, Gilles; Viari, Alain; Langerød, Anita; Børresen-Dale, Anne-Lise; Birney, Ewan; Stunnenberg, Hendrik G.; Stratton, Mike; Foekens, John A.; Martens, John W. M.

    2016-01-01

    A recent comprehensive whole genome analysis of a large breast cancer cohort was used to link known and novel drivers and substitution signatures to the transcriptome of 266 cases. Here, we validate that subtype-specific aberrations show concordant expression changes for, for example, TP53, PIK3CA, PTEN, CCND1 and CDH1. We find that CCND3 expression levels do not correlate with amplification, while increased GATA3 expression in mutant GATA3 cancers suggests GATA3 is an oncogene. In luminal cases the total number of substitutions, irrespective of type, associates with cell cycle gene expression and adverse outcome, whereas the number of mutations of signatures 3 and 13 associates with immune-response specific gene expression, increased numbers of tumour-infiltrating lymphocytes and better outcome. Thus, while earlier reports imply that the sheer number of somatic aberrations could trigger an immune-response, our data suggests that substitutions of a particular type are more effective in doing so than others. PMID:27666519

  3. Eye-Specific Gene Expression following Embryonic Ethanol Exposure in Zebrafish: Roles for Heat Shock Factor 1

    PubMed Central

    Kashyap, Bhavani; Pegorsch, Laurel; Frey, Ruth A.; Sun, Chi; Shelden, Eric A.; Stenkamp, Deborah L.

    2014-01-01

    The mechanisms through which ethanol exposure results in developmental defects remain unclear. We used the zebrafish model to elucidate eye-specific mechanisms that underlie ethanol-mediated microphthalmia (reduced eye size), through time-series microarray analysis of gene expression within eyes of embryos exposed to 1.5% ethanol. 62 genes were differentially expressed (DE) in ethanol-treated as compared to control eyes sampled during retinal neurogenesis (24-48 hours post-fertilization). The EDGE (extraction of differential gene expression) algorithm identified >3000 genes DE over developmental time in ethanol-exposed eyes as compared to controls. The DE lists included several genes indicating a mis-regulated cellular stress response due to ethanol exposure. Combined treatment with sub-threshold levels of ethanol and a morpholino targeting heat shock factor 1 mRNA resulted in microphthalmia, suggesting convergent molecular pathways. Thermal preconditioning partially prevented ethanol-mediated microphthalmia while maintaining Hsf-1 expression. These data suggest roles for reduced Hsf-1 in mediating microphthalmic effects of embryonic ethanol exposure. PMID:24355176

  4. Ubiquitin‑like protein FAT10 regulates DNA damage repair via modification of proliferating cell nuclear antigen.

    PubMed

    Chen, Zhenchuan; Zhang, Wei; Yun, Zhimin; Zhang, Xue; Gong, Feng; Wang, Yunfang; Ji, Shouping; Leng, Ling

    2018-06-01

    In response to DNA damage, proliferating cell nuclear antigen (PCNA) has an important role as a positive regulator and as a scaffold protein associated with DNA damage bypass and repair pathways by serving as a platform for the recruitment of associated components. As demonstrated in the present study, the ubiquitin‑like modifier human leukocyte antigen F locus adjacent transcript 10 (FAT10), which binds to PCNA but has not previously been demonstrated to be associated with the DNA damage response (DDR), is induced by ultraviolet/ionizing radiation and VP‑16 treatment in HeLa cells. Furthermore, DNA damage enhances FAT10 expression. Immunoprecipitation analysis suggested PCNA is modified by FAT10, and the degradation of FATylated PCNA located in the cytoplasm is regulated by the 26S proteasome, which is also responsible for the upregulation of nuclear foci formation. Furthermore, immunofluorescence experiment suggested FAT10 co‑localizes with PCNA in nuclear foci, thus suggesting that FATylation of PCNA may affect DDR via the induction of PCNA degradation in the cytoplasm or nucleus. In addition, immunohistochemistry experiment suggested the expression levels of FAT10 and PCNA are enhanced in HCC tissues compared with healthy liver tissues; however, the expression of FAT10 is suppressed in regenerated liver tissues, which express high levels of PCNA, thus suggesting that the association between FAT10 and PCNA expression is only exhibited in tumor tissues. In conclusion, the results of the present study suggest that FAT10 may be involved in DDR and therefore the progression of tumorigenesis.

  5. 3'-UTR-located inverted Alu repeats facilitate mRNA translational repression and stress granule accumulation

    PubMed Central

    Fitzpatrick, Terry; Huang, Sui

    2012-01-01

    Alu repeats within human genes may potentially alter gene expression. Here, we show that 3′-UTR-located inverted Alu repeats significantly reduce expression of an AcGFP reporter gene. Mutational analysis demonstrates that the secondary structure, but not the primary nucleotide sequence, of the inverted Alu repeats is critical for repression. The expression levels and nucleocytoplasmic distribution of reporter mRNAs with or without 3′-UTR inverted Alu repeats are similar; suggesting that reporter gene repression is not due to changes in mRNA levels or mRNA nuclear sequestration. Instead, reporter gene mRNAs harboring 3′-UTR inverted Alu repeats accumulate in cytoplasmic stress granules. These findings may suggest a novel mechanism whereby 3′-UTR-located inverted Alu repeats regulate human gene expression through sequestration of mRNAs within stress granules. PMID:22688648

  6. Selection of reference genes for RT-qPCR analysis in tumor tissues from male hepatocellular carcinoma patients with hepatitis B infection and cirrhosis.

    PubMed

    Liu, Shuang; Zhu, Pengfei; Zhang, Ling; Ding, Shanlong; Zheng, Sujun; Wang, Yang; Lu, Fengmin

    2013-01-01

    Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) has been widely used to quantify relative gene expression because of the high specificity, sensitivity and accuracy of this technique. However, its reliability is strongly depends on the expression stability of reference gene used for data normalization. Therefore, identification of reliable and condition specific reference genes is critical for the success of RT-qPCR. Hepatitis B virus (HBV) infection, male gender and the presence of cirrhosis are widely recognized as the leading independent risk factors for the development of hepatocellular carcinoma (HCC). This study aimed to select reliable reference gene for RT-qPCR analysis in HCC patients with all of those risk factors. Six candidate reference genes were analyzed in 33 paired tumor and non-tumor tissues from untreated HCC patients. The genes expression stabilities were assessed by geNorm and NormFinder. C-terminal binding protein 1(CTBP1) was the most stable gene among the 6 candidate genes evaluated by both geNorm and NormFinder. The expression stability values were 0.08 for CTBP1 and UBC, 0.09 for HPRT1, 0.12 for HMBS, 0.14 for GAPDH and 0.18 for 18S with geNorm analysis. The stability values suggested by NormFinder software were CTBP1: 0.044, UBC: 0.063, HMBS: 0.072, HPRT1: 0.072, GAPDH: 0.098 and 18S rRNA: 0.161. This is the first systematic analysis which suggested CTBP1 as the highest expression-stable gene in human male HBV infection related-HCC with cirrhosis. We recommend CTBP1 as the best candidate reference gene when RT-qPCR was used to determine gene(s) expression in HCC. This may facilitate the relevant HBV related HCC studies in the future.

  7. New Insights into the Organization, Recombination, Expression and Functional Mechanism of Low Molecular Weight Glutenin Subunit Genes in Bread Wheat

    PubMed Central

    Fan, Huajie; Sun, Jiazhu; Zhang, Zhongjuan; Qin, Huanju; Li, Bin; Hao, Shanting; Li, Zhensheng; Wang, Daowen; Zhang, Aimin; Ling, Hong-Qing

    2010-01-01

    The bread-making quality of wheat is strongly influenced by multiple low molecular weight glutenin subunit (LMW-GS) proteins expressed in the seeds. However, the organization, recombination and expression of LMW-GS genes and their functional mechanism in bread-making are not well understood. Here we report a systematic molecular analysis of LMW-GS genes located at the orthologous Glu-3 loci (Glu-A3, B3 and D3) of bread wheat using complementary approaches (genome wide characterization of gene members, expression profiling, proteomic analysis). Fourteen unique LMW-GS genes were identified for Xiaoyan 54 (with superior bread-making quality). Molecular mapping and recombination analyses revealed that the three Glu-3 loci of Xiaoyan 54 harbored dissimilar numbers of LMW-GS genes and covered different genetic distances. The number of expressed LMW-GS in the seeds was higher in Xiaoyan 54 than in Jing 411 (with relatively poor bread-making quality). This correlated with the finding of higher numbers of active LMW-GS genes at the A3 and D3 loci in Xiaoyan 54. Association analysis using recombinant inbred lines suggested that positive interactions, conferred by genetic combinations of the Glu-3 locus alleles with more numerous active LMW-GS genes, were generally important for the recombinant progenies to attain high Zeleny sedimentation value (ZSV), an important indicator of bread-making quality. A higher number of active LMW-GS genes tended to lead to a more elevated ZSV, although this tendency was influenced by genetic background. This work provides substantial new insights into the genomic organization and expression of LMW-GS genes, and molecular genetic evidence suggesting that these genes contribute quantitatively to bread-making quality in hexaploid wheat. Our analysis also indicates that selection for high numbers of active LMW-GS genes can be used for improvement of bread-making quality in wheat breeding. PMID:20975830

  8. Transcriptomic information from Pacific white shrimp (Litopenaeus vannamei) ovary and eyestalk, and expression patterns for genes putatively involved in the reproductive process.

    PubMed

    Ventura-López, Claudia; Galindo-Torres, Pavel E; Arcos, Fabiola G; Galindo-Sánchez, Clara; Racotta, Ilie S; Escobedo-Fregoso, Cristina; Llera-Herrera, Raúl; Ibarra, Ana M

    2017-05-15

    The increased use of massive sequencing technologies has enabled the identification of several genes known to be involved in different mechanisms associated with reproduction that so far have only been studied in vertebrates and other model invertebrate species. In order to further investigate the genes involved in Litopenaeus vannamei reproduction, cDNA and SSH libraries derived from female eyestalk and gonad were produced, allowing the identification of expressed sequences tags (ESTs) that potentially have a role in the regulation of gonadal maturation. In the present study, different transcripts involved in reproduction were identified and a number of them were characterized as full-length. These transcripts were evaluated in males and females in order to establish their tissue expression profiles during developmental stages (juvenile, subadult and adult), and in the case of females, their possible association with gonad maturation was assessed through expression analysis of vitellogenin. The results indicated that the expression of vitellogenin receptor (vtgr) and minichromosome maintenance (mcm) family members in the female gonad suggest an important role during previtellogenesis. Additionally, the expression profiles of genes such as famet, igfbp and gpcr in brain tissues suggest an interaction between the insulin/insulin-like growth factor signaling pathway (IIS) and methyl farnesoate (MF) biosynthesis for control of reproduction. Furthermore, the specific expression pattern of farnesoic acid O-methyltransferase suggests that final synthesis of MF is carried out in different target tissues, where it is regulated by esterase enzymes under a tissue-specific hormonal control. Finally, the presence of a vertebrate type steroid receptor in hepatopancreas and intestine besides being highly expressed in female gonads, suggest a role of that receptor during sexual maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  9. Visible red and infrared light alters gene expression in human marrow stromal fibroblast cells.

    PubMed

    Guo, J; Wang, Q; Wai, D; Zhang, Q Z; Shi, S H; Le, A D; Shi, S T; Yen, S L-K

    2015-04-01

    This study tested whether or not gene expression in human marrow stromal fibroblast (MSF) cells depends on light wavelength and energy density. Primary cultures of isolated human bone marrow stem cells (hBMSC) were exposed to visible red (VR, 633 nm) and infrared (IR, 830 nm) radiation wavelengths from a light emitting diode (LED) over a range of energy densities (0.5, 1.0, 1.5, and 2.0 Joules/cm2) Cultured cells were assayed for cell proliferation, osteogenic potential, adipogenesis, mRNA and protein content. mRNA was analyzed by microarray and compared among different wavelengths and energy densities. Mesenchymal and epithelial cell responses were compared to determine whether responses were cell type specific. Protein array analysis was used to further analyze key pathways identified by microarrays. Different wavelengths and energy densities produced unique sets of genes identified by microarray analysis. Pathway analysis pointed to TGF-beta 1 in the visible red and Akt 1 in the infrared wavelengths as key pathways to study. TGF-beta protein arrays suggested switching from canonical to non-canonical TGF-beta pathways with increases to longer IR wavelengths. Microarrays suggest RANKL and MMP 10 followed IR energy density dose-response curves. Epithelial and mesenchymal cells respond differently to stimulation by light suggesting cell type-specific response is possible. These studies demonstrate differential gene expression with different wavelengths, energy densities and cell types. These differences in gene expression have the potential to be exploited for therapeutic purposes and can help explain contradictory results in the literature when wavelengths, energy densities and cell types differ. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  10. Insights into the pathogenesis of dominant retinitis pigmentosa associated with a D477G mutation in RPE65.

    PubMed

    Choi, Elliot H; Suh, Susie; Sander, Christopher L; Hernandez, Christian J Ortiz; Bulman, Elizabeth R; Khadka, Nimesh; Dong, Zhiqian; Shi, Wuxian; Palczewski, Krzysztof; Kiser, Philip D

    2018-04-12

    RPE65 is the essential trans-cis isomerase of the classical retinoid (visual) cycle. Mutations in RPE65 give rise to severe retinal dystrophies, most of which are associated with loss of protein function and recessive inheritance. The only known exception is a c.1430G>A (D477G) mutation that gives rise to dominant retinitis pigmentosa with delayed onset and choroidal and macular involvement. Position 477 is distant from functionally critical regions of RPE65. Hence, the mechanism of D477G pathogenicity remains unclear, although protein misfolding and aggregation mechanisms have been suggested. We characterized a D477G knock-in mouse model which exhibited mild age-dependent changes in retinal structure and function. Immunoblot analysis of protein extracts from the eyes of the knock-in mice demonstrated the presence of ubiquitinated RPE65 and reduced RPE65 expression. We observed an accumulation of retinyl esters in the knock-in mice as well as a delay in rhodopsin regeneration kinetics and diminished electroretinography responses, indicative of RPE65 functional impairment induced by the D477G mutation in vivo. However, a cell line expressing D477G RPE65 revealed protein expression levels, cellular localization, and retinoid isomerase activity comparable to cells expressing wild-type protein. Structural analysis of an RPE65 chimera suggested that the D477G mutation does not perturb protein folding or tertiary structure. Instead, the mutation generates an aggregation-prone surface that could induce cellular toxicity through abnormal complex formation as suggested by crystal packing analysis. These results indicate that a toxic gain-of-function induced by the D477G RPE65 substitution may play a role in the pathogenesis of this form of dominant retinitis pigmentosa.

  11. Characterization of the telomere complex, TERF1 and TERF2 genes in muntjac species with fusion karyotypes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hartmann, Nils; Scherthan, Harry

    The telomere binding proteins TRF1 and TRF2 maintain and protect chromosome ends and confer karyotypic stability. Chromosome evolution in the genus Muntiacus is characterized by numerous tandem (end-to-end) fusions. To study TRF1 and TRF2 telomere binding proteins in Muntiacus species, we isolated and characterized the TERF1 and -2 genes from Indian muntjac (Muntiacus muntjak vaginalis; 2n = 6 female) and from Chinese muntjac (Muntiacus reveesi; 2n = 46). Expression analysis revealed that both genes are ubiquitously expressed and sequence analysis identified several transcript variants of both TERF genes. Control experiments disclosed a novel testis-specific splice variant of TERF1 in humanmore » testes. Amino acid sequence comparisons demonstrate that Muntiacus TRF1 and in particular TRF2 are highly conserved between muntjac and human. In vivo TRF2-GFP and immuno-staining studies in muntjac cell lines revealed telomeric TRF2 localization, while deletion of the DNA binding domain abrogated this localization, suggesting muntjac TRF2 represents a functional telomere protein. Finally, expression analysis of a set of telomere-related genes revealed their presence in muntjac fibroblasts and testis tissue, which suggests the presence of a conserved telomere complex in muntjacs. However, a deviation from the common theme was noted for the TERT gene, encoding the catalytic subunit of telomerase; TERT expression could not be detected in Indian or Chinese muntjac cDNA or genomic DNA using a series of conserved primers, while TRAP assay revealed functional telomerase in Chinese muntjac testis tissues. This suggests muntjacs may harbor a diverged telomerase sequence.« less

  12. The Effects of Cyclic Hydrostatic Pressure on Chondrogenesis and Viability of Human Adipose- and Bone Marrow-Derived Mesenchymal Stem Cells in Three-Dimensional Agarose Constructs

    PubMed Central

    Puetzer, Jennifer; Williams, John; Gillies, Allison; Bernacki, Susan

    2013-01-01

    This study investigates the effects of cyclic hydrostatic pressure (CHP) on chondrogenic differentiation of human adipose-derived stem cells (hASCs) in three-dimensional (3-D) agarose constructs maintained in a complete growth medium without soluble chondrogenic inducing factors. hASCs were seeded in 2% agarose hydrogels and exposed to 7.5 MPa CHP for 4 h per day at a frequency of 1 Hz for up to 21 days. On days 0, 7, 14, and 21, the expression levels of collagen II, Sox9, aggrecan, and cartilage oligomeric matrix protein (COMP) were examined by real-time reverse transcriptase–polymerase chain reaction analysis. Gene expression analysis found collagen II mRNA expression in only the CHP-loaded construct at day 14 and at no other time during the study. CHP-loaded hASCs exhibited upregulated mRNA expression of Sox9, aggrecan, and COMP at day 7 relative to unloaded controls, suggesting that CHP initiated chondrogenic differentiation of hASCs in a manner similar to human bone marrow-derived mesenchymal stem cells (hMSC). By day 14, however, loaded hASC constructs exhibited significantly lower mRNA expression of the chondrogenic markers than unloaded controls. Additionally, by day 21, the samples exhibited little measurable mRNA expression at all, suggesting a decreased viability. Histological analysis validated the lack of mRNA expression at day 21 for both the loaded and unloaded control samples with a visible decrease in the cell number and change in morphology. A comparative study with hASCs and hMSCs further examined long-term cell viability in 3-D agarose constructs of both cell types. Decreased cell metabolic activity was observed throughout the 21-day experimental period in both the CHP-loaded and control constructs of both hMSCs and hASCs, suggesting a decrease in cell metabolic activity, alluding to a decrease in cell viability. This suggests that a 2% agarose hydrogel may not optimally support hASC or hMSC viability in a complete growth medium in the absence of soluble chondrogenic inducing factors over long culture durations. This is the first study to examine the ability of mechanical stimuli alone, in the absence of chondrogenic factors transforming growth factor beta (TGF-β)3, TGF-β1 and/or bone morphogenetic protein 6 (BMP6) to induce hASC chondrogenic differentiation. The findings of this study suggest that CHP initiates hASC chondrogenic differentiation, even in the absence of soluble chondrogenic inductive factors, confirming the importance of considering both mechanical stimuli and appropriate 3-D culture for cartilage tissue engineering using hASCs. PMID:22871265

  13. Toward a dynamical theory of body movement in musical performance

    PubMed Central

    Demos, Alexander P.; Chaffin, Roger; Kant, Vivek

    2014-01-01

    Musicians sway expressively as they play in ways that seem clearly related to the music, but quantifying the relationship has been difficult. We suggest that a complex systems framework and its accompanying tools for analyzing non-linear dynamical systems can help identify the motor synergies involved. Synergies are temporary assemblies of parts that come together to accomplish specific goals. We assume that the goal of the performer is to convey musical structure and expression to the audience and to other performers. We provide examples of how dynamical systems tools, such as recurrence quantification analysis (RQA), can be used to examine performers' movements and relate them to the musical structure and to the musician's expressive intentions. We show how detrended fluctuation analysis (DFA) can be used to identify synergies and discover how they are affected by the performer's expressive intentions. PMID:24904490

  14. Evolution of the Chordate Regeneration Blastema: Differential Gene Expression and Conserved Role of Notch Signaling During Siphon Regeneration in the Ascidian Ciona

    PubMed Central

    Hamada, Mayuko; Goricki, Spela; Byerly, Mardi S.; Satoh, Noriyuki; Jeffery, William R.

    2015-01-01

    The regeneration of the oral siphon (OS) and other distal structures in the ascidian Ciona intestinalis occurs by epimorphosis involving the formation of a blastema of proliferating cells. Despite the longstanding use of Ciona as a model in molecular developmental biology, regeneration in this system has not been previously explored by molecular analysis. Here we have employed microarray analysis and quantitative real time RT-PCR to identify genes with differential expression profiles during OS regeneration. The majority of differentially expressed genes were downregulated during OS regeneration, suggesting roles in normal growth and homeostasis. However, a subset of differentially expressed genes was upregulated in the regenerating OS, suggesting functional roles during regeneration. Among the upregulated genes were key members of the Notch signaling pathway, including those encoding the delta and jagged ligands, two fringe modulators, and to a lesser extent the notch receptor. In situ hybridization showed a complementary pattern of delta1 and notch gene expression in the blastema of the regenerating OS. Chemical inhibition of the Notch signaling pathway reduced the levels of cell proliferation in the branchial sac, a stem cell niche that contributes progenitor cells to the regenerating OS, and in the OS regeneration blastema, where siphon muscle fibers eventually re-differentiate. Chemical inhibition also prevented the replacement of oral siphon pigment organs, sensory receptors rimming the entrance of the OS, and siphon muscle fibers, but had no effects on the formation of the wound epidermis. Since Notch signaling is involved in the maintenance of proliferative activity in both the Ciona and vertebrate regeneration blastema, the results suggest a conserved evolutionary role of this signaling pathway in chordate regeneration. The genes identified in this investigation provide the foundation for future molecular analysis of OS regeneration. PMID:26206613

  15. Potential Role of Circulating MiR-21 in the Diagnosis and Prognosis of Digestive System Cancer: A Systematic Review and Meta-Analysis.

    PubMed

    Yin, Chengqiang; Zhou, Xiaoying; Dang, Yini; Yan, Jin; Zhang, Guoxin

    2015-12-01

    Recent evidences indicate that circulating microRNAs (miRNAs) exhibit aberrant expression in the plasma of patients suffering from cancer compared to normal individuals, suggesting that it may be a useful noninvasion diagnostic method. MiR-21 plays crucial roles in carcinogenesis and can be served as a biomarker for the detection of various cancers. Therefore, the aim of this meta-analysis is to assess the potential role of miR-21 for digestive system cancer. By searching the PubMed, Embase, and Web of Science for publications concerning the diagnostic value of miR-21 for digestive system cancer, total of 23 publications were included in this meta-analysis. Receiver operating characteristic curves (ROC) were used to check the overall test performance. For prognostic meta-analysis, pooled hazard ratios (HRs) of circulating miR-21 for survival were calculated. Totally 23 eligible publications were included in this meta-analysis (15 articles for diagnosis and 8 articles for prognosis). For diagnostic meta-analysis, the summary estimates revealed that the pooled sensitivity and specificity were 0.76 (95% CI = 0.70-0.82) and 0.84 (95% CI = 0.78-0.89). Besides, the area under the summary ROC curve (AUC) is 0.87. For prognostic meta-analysis, the pooled HR of higher miR-21 expression in circulation was 1.94 (95% CI = 0.99-3.82, P = 0.055), which indicated higher miR-21 expression could be likely to predict poorer survival in digestive system cancer. The subgroup analysis implied the higher expression of miR-21 was correlated with worse overall survival in the Asian population in digestive system cancer (HR = 2.41, 95% CI = 1.21-4.77, P = 0.012). The current evidence suggests circulating miR-21 may be suitable to be a diagnostic and prognostic biomarker for digestive system cancer in the Asians.

  16. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine.

    PubMed

    Bradford, Emily M; Vairamani, Kanimozhi; Shull, Gary E

    2016-02-15

    To investigate the intestinal functions of the NKCC1 Na(+)-K(+)-2Cl cotransporter (SLC12a2 gene), differential mRNA expression changes in NKCC1-null intestine were analyzed. Microarray analysis of mRNA from intestines of adult wild-type mice and gene-targeted NKCC1-null mice (n = 6 of each genotype) was performed to identify patterns of differential gene expression changes. Differential expression patterns were further examined by Gene Ontology analysis using the online Gorilla program, and expression changes of selected genes were verified using northern blot analysis and quantitative real time-polymerase chain reaction. Histological staining and immunofluorescence were performed to identify cell types in which upregulated pancreatic digestive enzymes were expressed. Genes typically associated with pancreatic function were upregulated. These included lipase, amylase, elastase, and serine proteases indicative of pancreatic exocrine function, as well as insulin and regenerating islet genes, representative of endocrine function. Northern blot analysis and immunohistochemistry showed that differential expression of exocrine pancreas mRNAs was specific to the duodenum and localized to a subset of goblet cells. In addition, a major pattern of changes involving differential expression of olfactory receptors that function in chemical sensing, as well as other chemosensing G-protein coupled receptors, was observed. These changes in chemosensory receptor expression may be related to the failure of intestinal function and dependency on parenteral nutrition observed in humans with SLC12a2 mutations. The results suggest that loss of NKCC1 affects not only secretion, but also goblet cell function and chemosensing of intestinal contents via G-protein coupled chemosensory receptors.

  17. Integrative analysis of gut microbiota composition, host colonic gene expression and intraluminal metabolites in aging C57BL/6J mice.

    PubMed

    van der Lugt, Benthe; Rusli, Fenni; Lute, Carolien; Lamprakis, Andreas; Salazar, Ethel; Boekschoten, Mark V; Hooiveld, Guido J; Müller, Michael; Vervoort, Jacques; Kersten, Sander; Belzer, Clara; Kok, Dieuwertje E G; Steegenga, Wilma T

    2018-05-16

    The aging process is associated with diminished colonic health. In this study, we applied an integrative approach to reveal potential interactions between determinants of colonic health in aging C57BL/6J mice. Analysis of gut microbiota composition revealed an enrichment of various potential pathobionts, including Desulfovibrio spp . , and a decline of the health-promoting Akkermansia spp . and Lactobacillus spp. during aging. Intraluminal concentrations of various metabolites varied between ages and we found evidence for an increased gut permeability at higher age. Colonic gene expression analysis suggested that during the early phase of aging (between 6 and 12 months), expression of genes involved in epithelial-to-mesenchymal transition and (re)organization of the extracellular matrix were increased. Differential expression of these genes was strongly correlated with Bifidobacterium spp. During the later phase of aging (between 12 and 28 months), gene expression profiles pointed towards a diminished antimicrobial defense and were correlated with an uncultured Gastranaerophilales spp. This study demonstrates that aging is associated with pronounced changes in gut microbiota composition and colonic gene expression. Furthermore, the strong correlations between specific bacterial genera and host gene expression may imply that orchestrated interactions take place in the vicinity of the colonic wall and potentially mediate colonic health during aging.

  18. Microarray Analysis Gene Expression Profiles in Laryngeal Muscle After Recurrent Laryngeal Nerve Injury.

    PubMed

    Bijangi-Vishehsaraei, Khadijeh; Blum, Kevin; Zhang, Hongji; Safa, Ahmad R; Halum, Stacey L

    2016-03-01

    The pathophysiology of recurrent laryngeal nerve (RLN) transection injury is rare in that it is characteristically followed by a high degree of spontaneous reinnervation, with reinnervation of the laryngeal adductor complex (AC) preceding that of the abducting posterior cricoarytenoid (PCA) muscle. Here, we aim to elucidate the differentially expressed myogenic factors following RLN injury that may be at least partially responsible for the spontaneous reinnervation. F344 male rats underwent RLN injury (n = 12) or sham surgery (n = 12). One week after RLN injury, larynges were harvested following euthanasia. The mRNA was extracted from PCA and AC muscles bilaterally, and microarray analysis was performed using a full rat genome array. Microarray analysis of denervated AC and PCA muscles demonstrated dramatic differences in gene expression profiles, with 205 individual probes that were differentially expressed between the denervated AC and PCA muscles and only 14 genes with similar expression patterns. The differential expression patterns of the AC and PCA suggest different mechanisms of reinnervation. The PCA showed the gene patterns of Wallerian degeneration, while the AC expressed the gene patterns of reinnervation by adjacent axonal sprouting. This finding may reveal important therapeutic targets applicable to RLN and other peripheral nerve injuries. © The Author(s) 2015.

  19. Analysis of gene expression and regulation implicates C2H9orf152 has an important role in calcium metabolism and chicken reproduction.

    PubMed

    Liu, Long; Fan, Yanfeng; Zhang, Zhenhe; Yang, Chan; Geng, Tuoyu; Gong, Daoqing; Hou, Zhuocheng; Ning, Zhonghua

    2017-01-01

    The reproductive system of a female bird is responsible for egg production. The genes highly expressed in oviduct are potentially important. From RNA-seq analysis, C2H9orf152 (an orthologous gene of human C9orf152) was identified as highly expressed in chicken uterus. To infer its function, we obtained and characterized its complete cDNA sequence, determined its spatiotemporal expression, and probed its transcription factor(s) through pharmaceutical approach. Data showed that the complete cDNA sequence was 1468bp long with a 789bp of open reading frame. Compared to other tested tissues, this gene was highly expressed in the oviduct and liver tissues, especially uterus. Its expression in uterus was gradually increased during developmental and reproductive periods, which verified its involvement in the growth and maturity of reproductive system. In contrast, its expression was not significant different between active and quiescent uterus, suggesting the role of C2H9orf152 in reproduction is likely due to its long-term effect. Moreover, based on its 5'-flanking sequence, Foxd3 and Hnf4a were predicted as transcription factors of C2H9orf152. Using berberine or retinoic acid (which can regulate the activities of Hnf4a and Foxd3, respectively), we demonstrated suppression of C2H9orf152 by the chemicals in chicken primary hepatocytes. As retinoic acid regulates calcium metabolism, and Hnf4a is a key nuclear factor to liver, these findings suggest that C2H9orf152 is involved in liver function and calcium metabolism of reproductive system. In conclusion, C2H9orf152 may have a long-term effect on chicken reproductive system by regulating calcium metabolism, suggesting this gene has an important implication in the improvement of egg production and eggshell quality. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Employing conservation of co-expression to improve functional inference

    PubMed Central

    Daub, Carsten O; Sonnhammer, Erik LL

    2008-01-01

    Background Observing co-expression between genes suggests that they are functionally coupled. Co-expression of orthologous gene pairs across species may improve function prediction beyond the level achieved in a single species. Results We used orthology between genes of the three different species S. cerevisiae, D. melanogaster, and C. elegans to combine co-expression across two species at a time. This led to increased function prediction accuracy when we incorporated expression data from either of the other two species and even further increased when conservation across both of the two other species was considered at the same time. Employing the conservation across species to incorporate abundant model organism data for the prediction of protein interactions in poorly characterized species constitutes a very powerful annotation method. Conclusion To be able to employ the most suitable co-expression distance measure for our analysis, we evaluated the ability of four popular gene co-expression distance measures to detect biologically relevant interactions between pairs of genes. For the expression datasets employed in our co-expression conservation analysis above, we used the GO and the KEGG PATHWAY databases as gold standards. While the differences between distance measures were small, Spearman correlation showed to give most robust results. PMID:18808668

  1. Characterization of proopiomelanocortin in the snakeskin gourami (Trichopodus pectoralis) and its expression in relation to food intake.

    PubMed

    Boonanuntanasarn, S; Jangprai, A; Yoshizaki, G

    2015-01-01

    Proopiomelanocortin (POMC) is the precursor of several hormones involved in physiological systems including feed intake. The snakeskin gourami (Trichopodus pectoralis) POMC complementary DNA (TpPOMC) was cloned and characterized. Phylogenetic analysis showed that TpPOMC was clustered in a major POMC lineage in fish. Analysis of the Ka to Ks ratios for the entire POMC sequence and for each hormonal segment suggested that different POMC-derived peptide segments were subject to different evolutionary pressures. High expression level of TpPOMC was observed in all brain regions, with the highest levels in the diencephalon and pituitary gland. In situ hybridization also revealed that TpPOMC-expressing cells were distributed in discrete brain regions. The transcription level of TpPOMC was also found at moderate levels in several peripheral tissues, including gills, liver, head kidney, trunk kidney, stomach, intestine, spleen, ovary and testis, and at a low level in muscle. The expression level of TpPOMC was evaluated in each brain region (telencephalon, mesencephalon, metencephalon, and diencephalon together with the pituitary gland) at 1 h before the first and the last meals of the day and compared with expression levels at a time interval between the first and the last meals of the day. Low expression levels of TpPOMC were found at 1 h before the last meal of the day (P < 0.05). These finding suggest that decreased POMC expression level may lead to reduced melanocyte-stimulating hormones, which may in part be responsible for stimulating food intake. The effect of short-term fasting (24 h) on TpPOMC expression level in each brain region was also investigated. In telencephalon and diencephalon together with the pituitary gland, TpPOMC messenger RNA reached a nadir at 12 h of fasting, whereas TpPOMC transcript showed a nadir at 6 h of fasting in metencephalon and mesencephalon. A peak of TpPOMC level was observed at 18 h of fasting in metencephalon and diencephalon together with the pituitary gland. These findings suggest that TpPOMC expression is affected by nutritional status. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Interactome analysis of longitudinal pharyngeal infection of cynomolgus macaques by group A Streptococcus.

    PubMed

    Shea, Patrick R; Virtaneva, Kimmo; Kupko, John J; Porcella, Stephen F; Barry, William T; Wright, Fred A; Kobayashi, Scott D; Carmody, Aaron; Ireland, Robin M; Sturdevant, Daniel E; Ricklefs, Stacy M; Babar, Imran; Johnson, Claire A; Graham, Morag R; Gardner, Donald J; Bailey, John R; Parnell, Michael J; Deleo, Frank R; Musser, James M

    2010-03-09

    Relatively little is understood about the dynamics of global host-pathogen transcriptome changes that occur during bacterial infection of mucosal surfaces. To test the hypothesis that group A Streptococcus (GAS) infection of the oropharynx provokes a distinct host transcriptome response, we performed genome-wide transcriptome analysis using a nonhuman primate model of experimental pharyngitis. We also identified host and pathogen biological processes and individual host and pathogen gene pairs with correlated patterns of expression, suggesting interaction. For this study, 509 host genes and seven biological pathways were differentially expressed throughout the entire 32-day infection cycle. GAS infection produced an initial widespread significant decrease in expression of many host genes, including those involved in cytokine production, vesicle formation, metabolism, and signal transduction. This repression lasted until day 4, at which time a large increase in expression of host genes was observed, including those involved in protein translation, antigen presentation, and GTP-mediated signaling. The interactome analysis identified 73 host and pathogen gene pairs with correlated expression levels. We discovered significant correlations between transcripts of GAS genes involved in hyaluronic capsule production and host endocytic vesicle formation, GAS GTPases and host fibrinolytic genes, and GAS response to interaction with neutrophils. We also identified a strong signal, suggesting interaction between host gammadelta T cells and genes in the GAS mevalonic acid synthesis pathway responsible for production of isopentenyl-pyrophosphate, a short-chain phospholipid that stimulates these T cells. Taken together, our results are unique in providing a comprehensive understanding of the host-pathogen interactome during mucosal infection by a bacterial pathogen.

  3. Characterization and expression of a metallothionein gene in the aquatic fern Azolla filiculoides under heavy metal stress.

    PubMed

    Schor-Fumbarov, Tamar; Goldsbrough, Peter B; Adam, Zach; Tel-Or, Elisha

    2005-12-01

    A cDNA encoding a type 2 metallothionein (MT) was isolated from Azolla filiculoides, termed AzMT2, accession no. AF482470. The AzMT2 transcript was expressed in sterile A. filiculoides that were free of the cyanobiont Anabaena azollae after erythromycin treatment, proving that AzMT2 is encoded by the fern genome. AzMT2 RNA expression was enhanced by the addition of Cd(+2), Cu(+2), Zn(+2) and Ni(+2) to the growth medium. The transcript level of AzMT2 correlated with the metal content in the plants. Temporal analysis of AzMT2 expression demonstrated that Cd(2+) and Ni(2+) induction of AzMT2 RNA expression occurred within 48 h. AzMT2-enhanced expression responded more intensely to the toxic Cd and Ni ions in A. filiculoides suggesting that AzMT2 may participate in detoxification mechanism. The more moderate response of AzMT2 to Zn and Cu ions, which are essential micronutrients, suggest a role for AzMT2 in metal homeostasis.

  4. A revised list of Spanish translations of operant terminology

    PubMed Central

    Gallegos, Xochitl; Colotla, Victor A.

    1980-01-01

    The experimental analysis of behavior has grown enormously in Latin America within the last decade. This paper offers an updating revision of suggested Spanish translations of operant expressions. PMID:16812173

  5. The Long Noncoding RNA Landscape of the Mouse Eye.

    PubMed

    Chen, Weiwei; Yang, Shuai; Zhou, Zhonglou; Zhao, Xiaoting; Zhong, Jiayun; Reinach, Peter S; Yan, Dongsheng

    2017-12-01

    Long noncoding RNAs (lncRNAs) are important regulators of diverse biological functions. However, an extensive in-depth analysis of their expression profile and function in mammalian eyes is still lacking. Here we describe comprehensive landscapes of stage-dependent and tissue-specific lncRNA expression in the mouse eye. Affymetrix transcriptome array profiled lncRNA signatures from six different ocular tissue subsets (i.e., cornea, lens, retina, RPE, choroid, and sclera) in newborn and 8-week-old mice. Quantitative RT-PCR analysis validated array findings. Cis analyses and Gene Ontology (GO) annotation of protein-coding genes adjacent to signature lncRNA loci clarified potential lncRNA roles in maintaining tissue identity and regulating eye maturation during the aforementioned phase. In newborn and 8-week-old mice, we identified 47,332 protein-coding and noncoding gene transcripts. LncRNAs comprise 19,313 of these transcripts annotated in public data banks. During this maturation phase of these six different tissue subsets, more than 1000 lncRNAs expression levels underwent ≥2-fold changes. qRT-PCR analysis confirmed part of the gene microarray analysis results. K-means clustering identified 910 lncRNAs in the P0 groups and 686 lncRNAs in the postnatal 8-week-old groups, suggesting distinct tissue-specific lncRNA clusters. GO analysis of protein-coding genes proximal to lncRNA signatures resolved close correlations with their tissue-specific functional maturation between P0 and 8 weeks of age in the 6 tissue subsets. Characterizating maturational changes in lncRNA expression patterns as well as tissue-specific lncRNA signatures in six ocular tissues suggest important contributions made by lncRNA to the control of developmental processes in the mouse eye.

  6. Pyrethroid Resistance in Malaysian Populations of Dengue Vector Aedes aegypti Is Mediated by CYP9 Family of Cytochrome P450 Genes.

    PubMed

    Ishak, Intan H; Kamgang, Basile; Ibrahim, Sulaiman S; Riveron, Jacob M; Irving, Helen; Wondji, Charles S

    2017-01-01

    Dengue control and prevention rely heavily on insecticide-based interventions. However, insecticide resistance in the dengue vector Aedes aegypti, threatens the continued effectiveness of these tools. The molecular basis of the resistance remains uncharacterised in many endemic countries including Malaysia, preventing the design of evidence-based resistance management. Here, we investigated the underlying molecular basis of multiple insecticide resistance in Ae. aegypti populations across Malaysia detecting the major genes driving the metabolic resistance. Genome-wide microarray-based transcription analysis was carried out to detect the genes associated with metabolic resistance in these populations. Comparisons of the susceptible New Orleans strain to three non-exposed multiple insecticide resistant field strains; Penang, Kuala Lumpur and Kota Bharu detected 2605, 1480 and 425 differentially expressed transcripts respectively (fold-change>2 and p-value ≤ 0.05). 204 genes were commonly over-expressed with monooxygenase P450 genes (CYP9J27, CYP6CB1, CYP9J26 and CYP9M4) consistently the most up-regulated detoxification genes in all populations, indicating that they possibly play an important role in the resistance. In addition, glutathione S-transferases, carboxylesterases and other gene families commonly associated with insecticide resistance were also over-expressed. Gene Ontology (GO) enrichment analysis indicated an over-representation of GO terms linked to resistance such as monooxygenases, carboxylesterases, glutathione S-transferases and heme-binding. Polymorphism analysis of CYP9J27 sequences revealed a high level of polymorphism (except in Joho Bharu), suggesting a limited directional selection on this gene. In silico analysis of CYP9J27 activity through modelling and docking simulations suggested that this gene is involved in the multiple resistance in Malaysian populations as it is predicted to metabolise pyrethroids, DDT and bendiocarb. The predominant over-expression of cytochrome P450s suggests that synergist-based (PBO) control tools could be utilised to improve control of this major dengue vector across Malaysia.

  7. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization.

    PubMed

    Gout, Jean-Francois; Lynch, Michael

    2015-08-01

    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  8. Increased phosphatidylethanolamine N-methyltransferase gene expression in non-small-cell lung cancer tissue predicts shorter patient survival

    PubMed Central

    ZINRAJH, DAVID; HÖRL, GERD; JÜRGENS, GÜNTHER; MARC, JANJA; SOK, MIHA; CERNE, DARKO

    2014-01-01

    Lipid mobilization is of great importance for tumor growth and studies have suggested that cancer cells exhibit abnormal choline phospholipid metabolism. In the present study, we hypothesized that phosphatidylethanolamine N-methyltransferase (PEMT) gene expression is increased in non-small-cell lung cancer (NSCLC) tissues and that increased gene expression acts as a predictor of shorter patient survival. Forty-two consecutive patients with resected NSCLC were enrolled in this study. Paired samples of lung cancer tissues and adjacent non-cancer lung tissues were collected from resected specimens for the estimation of PEMT expression. SYBR Green-based real-time polymerase chain reaction was used for quantification of PEMT mRNA in lung cancer tissues. Lipoprotein lipase (LPL) and fatty acid synthase (FASN) activities had already been measured in the same tissues. During a four-year follow-up, 21 patients succumbed to tumor progression. One patient did not survive due to non-cancer reasons and was not included in the analysis. Cox regression analysis was used to assess the prognostic value of PEMT expression. Our findings show that elevated PEMT expression in the cancer tissue, relative to that in the adjacent non-cancer lung tissue, predicts shorter patient survival independently of standard prognostic factors and also independently of increased LPL or FASN activity, the two other lipid-related predictors of shorter patient survival. These findings suggest that active phosphatidylcholine and/or choline metabolism are essential for tumor growth and progression. PMID:24932311

  9. Increased phosphatidylethanolamine N-methyltransferase gene expression in non-small-cell lung cancer tissue predicts shorter patient survival.

    PubMed

    Zinrajh, David; Hörl, Gerd; Jürgens, Günther; Marc, Janja; Sok, Miha; Cerne, Darko

    2014-06-01

    Lipid mobilization is of great importance for tumor growth and studies have suggested that cancer cells exhibit abnormal choline phospholipid metabolism. In the present study, we hypothesized that phosphatidylethanolamine N-methyltransferase (PEMT) gene expression is increased in non-small-cell lung cancer (NSCLC) tissues and that increased gene expression acts as a predictor of shorter patient survival. Forty-two consecutive patients with resected NSCLC were enrolled in this study. Paired samples of lung cancer tissues and adjacent non-cancer lung tissues were collected from resected specimens for the estimation of PEMT expression. SYBR Green-based real-time polymerase chain reaction was used for quantification of PEMT mRNA in lung cancer tissues. Lipoprotein lipase (LPL) and fatty acid synthase (FASN) activities had already been measured in the same tissues. During a four-year follow-up, 21 patients succumbed to tumor progression. One patient did not survive due to non-cancer reasons and was not included in the analysis. Cox regression analysis was used to assess the prognostic value of PEMT expression. Our findings show that elevated PEMT expression in the cancer tissue, relative to that in the adjacent non-cancer lung tissue, predicts shorter patient survival independently of standard prognostic factors and also independently of increased LPL or FASN activity, the two other lipid-related predictors of shorter patient survival. These findings suggest that active phosphatidylcholine and/or choline metabolism are essential for tumor growth and progression.

  10. Metabolomics Reveals Signature of Mitochondrial Dysfunction in Diabetic Kidney Disease

    PubMed Central

    Karl, Bethany; Mathew, Anna V.; Gangoiti, Jon A.; Wassel, Christina L.; Saito, Rintaro; Pu, Minya; Sharma, Shoba; You, Young-Hyun; Wang, Lin; Diamond-Stanic, Maggie; Lindenmeyer, Maja T.; Forsblom, Carol; Wu, Wei; Ix, Joachim H.; Ideker, Trey; Kopp, Jeffrey B.; Nigam, Sanjay K.; Cohen, Clemens D.; Groop, Per-Henrik; Barshop, Bruce A.; Natarajan, Loki; Nyhan, William L.; Naviaux, Robert K.

    2013-01-01

    Diabetic kidney disease is the leading cause of ESRD, but few biomarkers of diabetic kidney disease are available. This study used gas chromatography-mass spectrometry to quantify 94 urine metabolites in screening and validation cohorts of patients with diabetes mellitus (DM) and CKD(DM+CKD), in patients with DM without CKD (DM–CKD), and in healthy controls. Compared with levels in healthy controls, 13 metabolites were significantly reduced in the DM+CKD cohorts (P≤0.001), and 12 of the 13 remained significant when compared with the DM–CKD cohort. Many of the differentially expressed metabolites were water-soluble organic anions. Notably, organic anion transporter-1 (OAT1) knockout mice expressed a similar pattern of reduced levels of urinary organic acids, and human kidney tissue from patients with diabetic nephropathy demonstrated lower gene expression of OAT1 and OAT3. Analysis of bioinformatics data indicated that 12 of the 13 differentially expressed metabolites are linked to mitochondrial metabolism and suggested global suppression of mitochondrial activity in diabetic kidney disease. Supporting this analysis, human diabetic kidney sections expressed less mitochondrial protein, urine exosomes from patients with diabetes and CKD had less mitochondrial DNA, and kidney tissues from patients with diabetic kidney disease had lower gene expression of PGC1α (a master regulator of mitochondrial biogenesis). We conclude that urine metabolomics is a reliable source for biomarkers of diabetic complications, and our data suggest that renal organic ion transport and mitochondrial function are dysregulated in diabetic kidney disease. PMID:23949796

  11. Proteomic and cellular localisation studies suggest non-tight junction cytoplasmic and nuclear roles for occludin in astrocytes.

    PubMed

    Morgan, Sarah V; Garwood, Claire J; Jennings, Luke; Simpson, Julie E; Castelli, Lydia M; Heath, Paul R; Mihaylov, Simeon R; Vaquéz-Villaseñor, Irina; Minshull, Thomas C; Ince, Paul G; Dickman, Mark J; Hautbergue, Guillaume M; Wharton, Stephen B

    2018-05-08

    Occludin is a component of tight junctions, which are essential structural components of the blood-brain barrier. However, occludin is expressed in cells without tight junctions, implying additional functions. We determined the expression and localisation of occludin in astrocytes in cell culture and in human brain tissue, and sought novel binding partners using a proteomic approach. Expression was investigated by immunocytochemistry and immunoblotting in the 1321N1 astrocytoma cell line and ScienCell human primary astrocytes, and by immunohistochemistry in human autopsy brain tissue. Recombinant N- and C-terminal occludin was used to pull-down proteins from 1321N1 cell lysates and protein-binding partners identified by mass spectrometry analysis. Occludin was expressed in both the cytoplasm and nucleus of astrocytes in vitro and in vivo. Mass spectrometry identified binding to nuclear and cytoplasmic proteins, particularly those related to RNA metabolism and nuclear function. Occludin is expressed in several subcellular compartments of brain cell-types that do not form tight junctions and the expression patterns in cell culture reflect those in human brain tissue, indicating they are suitable model systems. Proteomic analysis suggests that occludin has novel functions in neuroepithelial cells that are unrelated to tight junction formation. Further research will establish the roles of these functions in both cellular physiology and in disease states. © 2018 The Authors. European Journal of Neuroscience published by Federation of European Neuroscience Societies and John Wiley & Sons Ltd.

  12. Modulation of α power and functional connectivity during facial affect recognition.

    PubMed

    Popov, Tzvetan; Miller, Gregory A; Rockstroh, Brigitte; Weisz, Nathan

    2013-04-03

    Research has linked oscillatory activity in the α frequency range, particularly in sensorimotor cortex, to processing of social actions. Results further suggest involvement of sensorimotor α in the processing of facial expressions, including affect. The sensorimotor face area may be critical for perception of emotional face expression, but the role it plays is unclear. The present study sought to clarify how oscillatory brain activity contributes to or reflects processing of facial affect during changes in facial expression. Neuromagnetic oscillatory brain activity was monitored while 30 volunteers viewed videos of human faces that changed their expression from neutral to fearful, neutral, or happy expressions. Induced changes in α power during the different morphs, source analysis, and graph-theoretic metrics served to identify the role of α power modulation and cross-regional coupling by means of phase synchrony during facial affect recognition. Changes from neutral to emotional faces were associated with a 10-15 Hz power increase localized in bilateral sensorimotor areas, together with occipital power decrease, preceding reported emotional expression recognition. Graph-theoretic analysis revealed that, in the course of a trial, the balance between sensorimotor power increase and decrease was associated with decreased and increased transregional connectedness as measured by node degree. Results suggest that modulations in α power facilitate early registration, with sensorimotor cortex including the sensorimotor face area largely functionally decoupled and thereby protected from additional, disruptive input and that subsequent α power decrease together with increased connectedness of sensorimotor areas facilitates successful facial affect recognition.

  13. CES2, ABCG2, TS and Topo-I primary and synchronous metastasis expression and clinical outcome in metastatic colorectal cancer patients treated with first-line FOLFIRI regimen.

    PubMed

    Silvestris, Nicola; Simone, Giovanni; Partipilo, Giulia; Scarpi, Emanuela; Lorusso, Vito; Brunetti, Anna Elisabetta; Maiello, Evaristo; Paradiso, Angelo; Mangia, Anita

    2014-09-05

    Enzymatic activation of irinotecan (CPT-11) is due to carboxylesterase (CES), and its pharmacological behavior is influenced by drug resistance-related proteins. We previously reported that the clinical response and prognosis of metastatic colorectal cancer (mCRC) patients did not differ in tumors with different thymidylate synthase (TS) or topoisomerase-I (Topo-I) expression. Using immunohistochemistry (IHC), we evaluated the biological role of CES2 and the expression of breast cancer resistance protein (BCRP/ABCG2) in 58 consecutive mCRC patients, who had undergone a first-line CPT-11/5-FU/leucovirin (FOLFIRI) regimen. The expression of these proteins was also examined in a group of synchronous lymph nodes and liver metastases. Furthermore, all samples were revaluated for TS and Topo-I expression. High expression of CES2, ABCG2, TS and Topo-I was observed in 55%, 56%, 38% and 49% of patients, respectively. There was a significant association between high TS and high ABCG2 expression (p = 0.049). Univariate analysis showed that only TS expression significantly impacted on time to progression (p = 0.005). Moreover, Cox' multivariate analysis revealed that TS expression was significantly associated with overall survival (p = 0.01). No significant correlation was found between investigated markers expression and clinical response. Topo-I expression resulted in being significantly higher in liver metastases with respect to the corresponding primary tumors (p < 0.0001), emphasizing the role of Topo-I expression in metastatic cancer biology. In primary tumor tissues, CES2 expression tended to be higher than that observed in liver metastasis tissues (p = 0.05). These preliminary data may suggest CES2 over-expression as a potential marker of malignant phenotype. In light of these findings, we suggest that Topo-I expression together with TS expression could be associated with metastatic progression of CRC. Further studies are warranted with the aim of evaluating the potential predictive and prognostic role of CES2 and ABCG2 in larger series of patients.

  14. Expression of emotions related to the experience of cancer in younger and older Arab breast cancer survivors.

    PubMed

    Goldblatt, Hadass; Cohen, Miri; Azaiza, Faisal

    2016-12-01

    Researchers have suggested that older adults express less negative emotions. Yet, emotional expression patterns in older and younger breast cancer survivors, have barely been examined. This study aimed to explore types and intensity of negative and positive emotional expression related to the breast cancer experience by younger and older Arab breast cancer survivors. Participants were 20 younger (aged 32-50) and 20 older (aged 51-75) Muslim and Christian Arab breast cancer survivors (stages I-III), currently free of disease. Data were gathered through in-depth semi-structured interviews. Mixed methods analyses were conducted, including: (1) frequency analysis of participants' emotional expressions; (2) content analysis of emotional expressions, categorized according to negative and positive emotions. Three emotional expression modalities were revealed: (1) Succinct versus comprehensive accounts; (2) expression of emotions versus avoidance of emotions; (3) patterns of expression of positive emotions and a sense of personal growth. Younger women provided more detailed accounts about their illness experiences than older women. Older women's accounts were succinct, action-focused, and included more emotion-avoiding expressions than younger women. Understanding the relationships between emotional expression, emotional experience, and cancer survivors' quality of life, specifically of those from traditional communities, is necessary for developing effective psycho-social interventions.

  15. Expression of proteinase inhibitor II proteins during floral development in Solanum americanum.

    PubMed

    Sin, Suk-Fong; Chye, Mee-Len

    2004-10-01

    The heterologous expression of serine proteinase inhibitor II (PIN2) proteins confers insect resistance in transgenic plants, but little is known of their endogenous roles. We have cloned two cDNAs encoding Solanum americanum PIN2 proteins, SaPIN2a and SaPIN2b. SaPIN2a is highly expressed in stem, particularly in the phloem, suggesting it could possibly regulate proteolysis in the sieve elements. When SaPIN2a was expressed in transgenic lettuce, we observed an inhibition of endogenous trypsin- and chymotrypsin-like activities. Here, we demonstrate that both SaPIN2a and SaPIN2b are expressed in floral tissues that are destined to undergo developmental programmed cell death (PCD), suggesting possible endogenous roles in inhibiting trypsin- and chymotrypsin-like activities during flower development. Northern and western blot analyses revealed that SaPIN2a and SaPIN2b mRNAs and proteins show highest expression early in floral development. In situ hybridization analysis and immunolocalization on floral sections, localized SaPIN2a and SaPIN2b mRNAs and their proteins to tissues that would apparently undergo PCD: the ovules, the stylar transmitting tissue, the stigma and the vascular bundles. Detection of PCD in floral sections was achieved using terminal deoxynucleotidyltransferase-mediated dUTP nick end labeling (TUNEL) analysis. Examination of the mid-style before, and 1 day after, pollination revealed that high expression of SaPIN2a and SaPIN2b in the style was inversely correlated with PCD.

  16. Alteration of gene expression in human hepatocellular carcinoma with integrated hepatitis B virus DNA.

    PubMed

    Tamori, Akihiro; Yamanishi, Yoshihiro; Kawashima, Shuichi; Kanehisa, Minoru; Enomoto, Masaru; Tanaka, Hiromu; Kubo, Shoji; Shiomi, Susumu; Nishiguchi, Shuhei

    2005-08-15

    Integration of hepatitis B virus (HBV) DNA into the human genome is one of the most important steps in HBV-related carcinogenesis. This study attempted to find the link between HBV DNA, the adjoining cellular sequence, and altered gene expression in hepatocellular carcinoma (HCC) with integrated HBV DNA. We examined 15 cases of HCC infected with HBV by cassette ligation-mediated PCR. The human DNA adjacent to the integrated HBV DNA was sequenced. Protein coding sequences were searched for in the human sequence. In five cases with HBV DNA integration, from which good quality RNA was extracted, gene expression was examined by cDNA microarray analysis. The human DNA sequence successive to integrated HBV DNA was determined in the 15 HCCs. Eight protein-coding regions were involved: ras-responsive element binding protein 1, calmodulin 1, mixed lineage leukemia 2 (MLL2), FLJ333655, LOC220272, LOC255345, LOC220220, and LOC168991. The MLL2 gene was expressed in three cases with HBV DNA integrated into exon 3 of MLL2 and in one case with HBV DNA integrated into intron 3 of MLL2. Gene expression analysis suggested that two HCCs with HBV integrated into MLL2 had similar patterns of gene expression compared with three HCCs with HBV integrated into other loci of human chromosomes. HBV DNA was integrated at random sites of human DNA, and the MLL2 gene was one of the targets for integration. Our results suggest that HBV DNA might modulate human genes near integration sites, followed by integration site-specific expression of such genes during hepatocarcinogenesis.

  17. Common acute lymphoblastic leukaemia-lymphoma expressing cytokeratin: a case report.

    PubMed

    Menestrina, F; Lestani, M; Scarpa, A; Viale, G; Bonetti, F; Pizzolo, G; Chilosi, M

    1994-01-01

    This report presents a case of common acute lymphoblastic leukaemia-lymphoma expressing low molecular weight cytokeratin but no leukocyte common antigen (CD45) in a 57-year-old man. The unusual morphology and clinical course together with the aberrant immunohistochemical results suggested a diagnosis of undifferentiated carcinoma. A detailed immunohistochemistry study on frozen and paraffin sections and molecular analysis prevented a diagnostic mistake.

  18. Genome-wide analysis of drought induced gene expression changes in flax (Linum usitatissimum).

    PubMed

    Dash, Prasanta K; Cao, Yongguo; Jailani, Abdul K; Gupta, Payal; Venglat, Prakash; Xiang, Daoquan; Rai, Rhitu; Sharma, Rinku; Thirunavukkarasu, Nepolean; Abdin, Malik Z; Yadava, Devendra K; Singh, Nagendra K; Singh, Jas; Selvaraj, Gopalan; Deyholos, Mike; Kumar, Polumetla Ananda; Datla, Raju

    2014-01-01

    A robust phenotypic plasticity to ward off adverse environmental conditions determines performance and productivity in crop plants. Flax (linseed), is an important cash crop produced for natural textile fiber (linen) or oilseed with many health promoting products. This crop is prone to drought stress and yield losses in many parts of the world. Despite recent advances in drought research in a number of important crops, related progress in flax is very limited. Since, response of this plant to drought stress has not been addressed at the molecular level; we conducted microarray analysis to capture transcriptome associated with induced drought in flax. This study identified 183 differentially expressed genes (DEGs) associated with diverse cellular, biophysical and metabolic programs in flax. The analysis also revealed especially the altered regulation of cellular and metabolic pathways governing photosynthesis. Additionally, comparative transcriptome analysis identified a plethora of genes that displayed differential regulation both spatially and temporally. These results revealed co-regulated expression of 26 genes in both shoot and root tissues with implications for drought stress response. Furthermore, the data also showed that more genes are upregulated in roots compared to shoots, suggesting that roots may play important and additional roles in response to drought in flax. With prolonged drought treatment, the number of DEGs increased in both tissue types. Differential expression of selected genes was confirmed by qRT-PCR, thus supporting the suggested functional association of these intrinsic genes in maintaining growth and homeostasis in response to imminent drought stress in flax. Together the present study has developed foundational and new transcriptome data sets for drought stress in flax.

  19. Cul4A overexpression associated with Gli1 expression in malignant pleural mesothelioma

    DOE PAGES

    Yang, Yi -Lin; Ni, Jian; Hsu, Ping -Chih; ...

    2015-07-27

    Malignant pleural mesothelioma (mesothelioma) is a highly aggressive cancer without an effective treatment. Cul4A, a scaffold protein that recruits substrates for degradation, is amplified in several human cancers, including mesothelioma. We have recently shown that Cul4A plays an oncogenic role in vitro and in a mouse model. In this study, we analysed clinical mesothelioma tumours and found moderate to strong expression of Cul4A in 70.9% (51/72) of these tumours, as shown by immunohistochemistry. In 72.2% mesothelioma tumours with increased Cul4A copy number identified by fluorescence in situ hybridization analysis, Cul4A protein expression was moderate to strong. Similarly, Cul4A was overexpressedmore » and Cul4A copy number was increased in human mesothelioma cell lines. Because Gli1 is highly expressed in human mesothelioma cells, we compared Cul4A and Gli1 expression in mesothelioma tumours and found their expression associated (P < 0.05, chi-square). In mesothelioma cell lines, inhibiting Cul4A by siRNA decreased Gli1 expression, suggesting that Gli1 expression is, at least in part, regulated by Cul4A in mesothelioma cells. Our results suggest a linkage between Cul4A and Gli1 expression in human mesothelioma.« less

  20. Immunohistochemical analysis of cytokeratin and human milk fat globulin expression in mucinous carcinoma of the skin.

    PubMed

    Ohnishi, Takamitsu; Takizawa, Hajime; Watanabe, Shinichi

    2002-01-01

    Mucinous carcinoma of the skin (MCS) is a rare epithelial tumor which arises primarily in the skin. Metastatic MC from extracutaneous sites, especially breast or colon, mimics MCS and cannot be differentiated from MCS by routine histology alone. Nine cases of MCS were analyzed immunohistochemically using monoclonal antibodies against cytokeratins (CKs) and human milk fat globulin 1 (HMFG) in order to clarify their nature and compare the immunophenotypes with those of other MCs studied in the literature. Expression of simple epithelial CKs in most of the tumor cells of all cases studied and co-expression of simple and stratified epithelial CKs in some tumor cells of two cases were recognized. CK 20 expression could not detected in any tumor cells. Focal HMFG expression in the luminal or outer surface of the nests was observed in three cases. From CKs expression, MCS was speculated to differentiated mainly toward the secretory cells of the sweat glands, and some tumor cells toward the transient portion between the dermal duct and the secretory portion. Focal HMFG expression suggested either a consequence of malignant transformation or apocrine differentiation. No expression of CK 20 in MCS suggests that we may exclude the diagnosis of metastatic colorectal MC which expressed CK 20.

  1. Differential relationships between D1 and D2 dopamine receptor expression in the medial preoptic nucleus and sexually-motivated song in male European starlings (Sturnus vulgaris)

    PubMed Central

    DeVries, M. S.; Cordes, M.A.; Stevenson, S.A.; Riters, L.V.

    2015-01-01

    Converging data in songbirds support a central role for the medial preoptic nucleus (POM) in motivational aspects of vocal production. Recent data suggest that dopamine in the POM plays a complex modulatory role in the production of sexually-motivated song and that an optimal level of dopamine D1 receptor stimulation is required to facilitate singing behavior. To further explore this possibility, we used quantitative real time PCR to examine relationships between mRNA expression of D1 as well as D2 receptors in the POM (and also the lateral septum and Area X) and sexually-motivated singing behavior in male European starlings. Results showed that both males with the highest and lowest D1 expression in the POM sang significantly less than males with intermediate levels of expression. Furthermore, singing behavior rose linearly in association with increasing levels of D1 expression in POM but dropped abruptly, such that individuals with D1 expression values higher than the mean sang very little. Analysis of birds with low and intermediate levels of D1 expression in POM revealed strong positive correlations between D1 expression and song but negative relationships between D2 receptor expression and song. These findings support prior work suggesting an optimal level of POM D1 receptor stimulation best facilitates sexually-motivated singing behavior. Results also suggest that D2 receptors may work in opposition to D1 receptors in POM to modify vocal production. PMID:26079111

  2. Expression of the fructose receptor BmGr9 and its involvement in the promotion of feeding, suggested by its co-expression with neuropeptide F1 in Bombyx mori.

    PubMed

    Mang, Dingze; Shu, Min; Tanaka, Shiho; Nagata, Shinji; Takada, Tomoyuki; Endo, Haruka; Kikuta, Shingo; Tabunoki, Hiroko; Iwabuchi, Kikuo; Sato, Ryoichi

    2016-08-01

    Insect gustatory receptors (Grs) are members of a large family of proteins with seven transmembrane domains that provide insects with the ability to detect chemical signals critical for feeding, mating, and oviposition. To date, 69 Bombyx mori Grs (BmGrs) genes have been identified via genome studies. BmGr9 has been shown to respond specifically to fructose and to function as a ligand-gated ion channel selectively activated by fructose. However, the sites where this Gr are expressed remain unclear. We demonstrated using reverse transcription (RT)-PCR that BmGr9 is widely expressed in the central nervous system (CNS), as well as oral sensory organs. Additionally, immunohistochemistry was performed using anti-BmGr9 antiserum to show that BmGr9 is expressed in cells of the oral sensory organs, including the maxillary galea, maxillary palps, labrum, and labium, as well as in putative neurosecretory cells of the CNS. Furthermore, double immunohistochemical analysis showed that most BmGr9-expressing cells co-localized with putative neuropeptide F1-expressing cells in the brain, suggesting that BmGr9 is involved in the promotion of feeding behaviors. In addition, a portion of BmGr9-expressing cells in the brain co-localized with cells expressing BmGr6, a molecule of the sugar receptor clade, suggesting that sugars other than fructose are involved in the regulation of feeding behaviors in B. mori larvae. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Unintended changes in protein expression revealed by proteomic analysis of seeds from transgenic pea expressing a bean alpha-amylase inhibitor gene.

    PubMed

    Chen, Hancai; Bodulovic, Greg; Hall, Prudence J; Moore, Andy; Higgins, Thomas J V; Djordjevic, Michael A; Rolfe, Barry G

    2009-09-01

    Seeds of genetically modified (GM) peas (Pisum sativum L.) expressing the gene for alpha-amylase inhibitor-1 (alphaAI1) from the common bean (Phaseolus vulgaris L. cv. Tendergreen) exhibit resistance to the pea weevil (Bruchus pisorum). A proteomic analysis was carried out to compare seeds from GM pea lines expressing the bean alphaAI1 protein and the corresponding alphaAI1-free segregating lines and non-GM parental line to identify unintended alterations to the proteome of GM peas due to the introduction of the gene for alphaAI1. Proteomic analysis showed that in addition to the presence of alphaAI1, 33 other proteins were differentially accumulated in the alphaAI1-expressing GM lines compared with their non-GM parental line and these were grouped into five expression classes. Among these 33 proteins, only three were found to be associated with the expression of alphaAI1 in the GM pea lines. The accumulation of the remaining 30 proteins appears to be associated with Agrobacterium-mediated transformation events. Sixteen proteins were identified after MALDI-TOF-TOF analysis. About 56% of the identified proteins with altered accumulation in the GM pea were storage proteins including legumin, vicilin or convicilin, phaseolin, cupin and valosin-containing protein. Two proteins were uniquely expressed in the alphaAI1-expressing GM lines and one new protein was present in both the alphaAI1-expressing GM lines and their alphaAI1-free segregating lines, suggesting that both transgenesis and transformation events led to demonstrable changes in the proteomes of the GM lines tested.

  4. A whole-blood transcriptome meta-analysis identifies gene expression signatures of cigarette smoking

    PubMed Central

    Huan, Tianxiao; Joehanes, Roby; Schurmann, Claudia; Schramm, Katharina; Pilling, Luke C.; Peters, Marjolein J.; Mägi, Reedik; DeMeo, Dawn; O'Connor, George T.; Ferrucci, Luigi; Teumer, Alexander; Homuth, Georg; Biffar, Reiner; Völker, Uwe; Herder, Christian; Waldenberger, Melanie; Peters, Annette; Zeilinger, Sonja; Metspalu, Andres; Hofman, Albert; Uitterlinden, André G.; Hernandez, Dena G.; Singleton, Andrew B.; Bandinelli, Stefania; Munson, Peter J.; Lin, Honghuang; Benjamin, Emelia J.; Esko, Tõnu; Grabe, Hans J.; Prokisch, Holger; van Meurs, Joyce B.J.; Melzer, David; Levy, Daniel

    2016-01-01

    Abstract Cigarette smoking is a leading modifiable cause of death worldwide. We hypothesized that cigarette smoking induces extensive transcriptomic changes that lead to target-organ damage and smoking-related diseases. We performed a meta-analysis of transcriptome-wide gene expression using whole blood-derived RNA from 10,233 participants of European ancestry in six cohorts (including 1421 current and 3955 former smokers) to identify associations between smoking and altered gene expression levels. At a false discovery rate (FDR) <0.1, we identified 1270 differentially expressed genes in current vs. never smokers, and 39 genes in former vs. never smokers. Expression levels of 12 genes remained elevated up to 30 years after smoking cessation, suggesting that the molecular consequence of smoking may persist for decades. Gene ontology analysis revealed enrichment of smoking-related genes for activation of platelets and lymphocytes, immune response, and apoptosis. Many of the top smoking-related differentially expressed genes, including LRRN3 and GPR15, have DNA methylation loci in promoter regions that were recently reported to be hypomethylated among smokers. By linking differential gene expression with smoking-related disease phenotypes, we demonstrated that stroke and pulmonary function show enrichment for smoking-related gene expression signatures. Mediation analysis revealed the expression of several genes (e.g. ALAS2) to be putative mediators of the associations between smoking and inflammatory biomarkers (IL6 and C-reactive protein levels). Our transcriptomic study provides potential insights into the effects of cigarette smoking on gene expression in whole blood and their relations to smoking-related diseases. The results of such analyses may highlight attractive targets for treating or preventing smoking-related health effects. PMID:28158590

  5. Whole Genome Gene Expression Meta-Analysis of Inflammatory Bowel Disease Colon Mucosa Demonstrates Lack of Major Differences between Crohn's Disease and Ulcerative Colitis

    PubMed Central

    Østvik, Ann E.; Drozdov, Ignat; Gustafsson, Bjørn I.; Kidd, Mark; Beisvag, Vidar; Torp, Sverre H.; Waldum, Helge L.; Martinsen, Tom Christian; Damås, Jan Kristian; Espevik, Terje; Sandvik, Arne K.

    2013-01-01

    Background In inflammatory bowel disease (IBD), genetic susceptibility together with environmental factors disturbs gut homeostasis producing chronic inflammation. The two main IBD subtypes are Ulcerative colitis (UC) and Crohn’s disease (CD). We present the to-date largest microarray gene expression study on IBD encompassing both inflamed and un-inflamed colonic tissue. A meta-analysis including all available, comparable data was used to explore important aspects of IBD inflammation, thereby validating consistent gene expression patterns. Methods Colon pinch biopsies from IBD patients were analysed using Illumina whole genome gene expression technology. Differential expression (DE) was identified using LIMMA linear model in the R statistical computing environment. Results were enriched for gene ontology (GO) categories. Sets of genes encoding antimicrobial proteins (AMP) and proteins involved in T helper (Th) cell differentiation were used in the interpretation of the results. All available data sets were analysed using the same methods, and results were compared on a global and focused level as t-scores. Results Gene expression in inflamed mucosa from UC and CD are remarkably similar. The meta-analysis confirmed this. The patterns of AMP and Th cell-related gene expression were also very similar, except for IL23A which was consistently higher expressed in UC than in CD. Un-inflamed tissue from patients demonstrated minimal differences from healthy controls. Conclusions There is no difference in the Th subgroup involvement between UC and CD. Th1/Th17 related expression, with little Th2 differentiation, dominated both diseases. The different IL23A expression between UC and CD suggests an IBD subtype specific role. AMPs, previously little studied, are strongly overexpressed in IBD. The presented meta-analysis provides a sound background for further research on IBD pathobiology. PMID:23468882

  6. Whole genome gene expression meta-analysis of inflammatory bowel disease colon mucosa demonstrates lack of major differences between Crohn's disease and ulcerative colitis.

    PubMed

    Granlund, Atle van Beelen; Flatberg, Arnar; Østvik, Ann E; Drozdov, Ignat; Gustafsson, Bjørn I; Kidd, Mark; Beisvag, Vidar; Torp, Sverre H; Waldum, Helge L; Martinsen, Tom Christian; Damås, Jan Kristian; Espevik, Terje; Sandvik, Arne K

    2013-01-01

    In inflammatory bowel disease (IBD), genetic susceptibility together with environmental factors disturbs gut homeostasis producing chronic inflammation. The two main IBD subtypes are Ulcerative colitis (UC) and Crohn's disease (CD). We present the to-date largest microarray gene expression study on IBD encompassing both inflamed and un-inflamed colonic tissue. A meta-analysis including all available, comparable data was used to explore important aspects of IBD inflammation, thereby validating consistent gene expression patterns. Colon pinch biopsies from IBD patients were analysed using Illumina whole genome gene expression technology. Differential expression (DE) was identified using LIMMA linear model in the R statistical computing environment. Results were enriched for gene ontology (GO) categories. Sets of genes encoding antimicrobial proteins (AMP) and proteins involved in T helper (Th) cell differentiation were used in the interpretation of the results. All available data sets were analysed using the same methods, and results were compared on a global and focused level as t-scores. Gene expression in inflamed mucosa from UC and CD are remarkably similar. The meta-analysis confirmed this. The patterns of AMP and Th cell-related gene expression were also very similar, except for IL23A which was consistently higher expressed in UC than in CD. Un-inflamed tissue from patients demonstrated minimal differences from healthy controls. There is no difference in the Th subgroup involvement between UC and CD. Th1/Th17 related expression, with little Th2 differentiation, dominated both diseases. The different IL23A expression between UC and CD suggests an IBD subtype specific role. AMPs, previously little studied, are strongly overexpressed in IBD. The presented meta-analysis provides a sound background for further research on IBD pathobiology.

  7. miRNA regulation of cytotoxic effects in mouse Sertoli cells exposed to nonylphenol

    PubMed Central

    2011-01-01

    Background It is known that some environmental chemicals affect the human endocrine system. The harmful effects of endocrine disrupting chemical (EDC) nonylphenol (NP) have been studied since the 1980s. It is known that NP adversely affects physiological functions by mimicking the natural hormone 17 beta-estradiol. In the present study, we analyzed the expression of miRNAs and their target genes in mouse Sertoli TM4 cells to better understand the regulatory roles of miRNAs on Sertoli cells after NP exposure. Methods Mouse TM4 Sertoli cells were treated with NP for 3 or 24 h, and global gene and miRNA expression were analyzed using Agilent mouse whole genome and mouse miRNA v13 arrays. Results We identified genes that were > 2-fold differentially expressed in NP-treated cells and control cells (P < 0.05) and analyzed their functions through Gene Ontology analysis. We also identified miRNAs that were differentially expressed in NP-treated and control cells. Of the 186 miRNAs the expression of which differed between NP-treated and control cells, 59 and 147 miRNAs exhibited 1.3-fold increased or decreased expression at 3 and 24 h, respectively. Network analysis of deregulated miRNAs suggested that Ppara may regulate the expression of certain miRNAs, including miR-378, miR-125a-3p miR-20a, miR-203, and miR-101a, after exposure to NP. Additionally, comprehensive analysis of predicted target genes for miRNAs showed that the expression of genes with roles in cell proliferation, the cell cycle, and cell death were regulated by miRNA in NP-treated TM4 cells. Levels of expression of the miRNAs miR-135a* and miR-199a-5p were validated by qRT-PCR. Finally, miR-135a* target gene analysis suggests that the generation of reactive oxygen species (ROS) following exposure to NP exposure may be mediated by miR-135a* through regulation of the Wnt/beta-catenin signaling pathway. Conclusions Collectively, these data help to determine NP's actions on mouse TM4 Sertoli cells and increase our understanding of the molecular mechanisms underlying the adverse effects of xenoestrogens on the reproductive system. PMID:21914226

  8. A novel pair of immunoglobulin-like receptors expressed by B cells and myeloid cells

    PubMed Central

    Kubagawa, Hiromi; Burrows, Peter D.; Cooper, Max D.

    1997-01-01

    An Fcα receptor probe of human origin was used to identify novel members of the Ig gene superfamily in mice. Paired Ig-like receptors, named PIR-A and PIR-B, are predicted from sequence analysis of the cDNAs isolated from a mouse splenic library. Both type I transmembrane proteins possess similar ectodomains with six Ig-like loops, but have different transmembrane and cytoplasmic regions. The predicted PIR-A protein has a short cytoplasmic tail and a charged Arg residue in the transmembrane region that, by analogy with the FcαR relative, suggests the potential for association with an additional transmembrane protein to form a signal transducing unit. In contrast, the PIR-B protein has an uncharged transmembrane region and a long cytoplasmic tail containing four potential immunoreceptor tyrosine-based inhibitory motifs. These features are shared by the related killer inhibitory receptors. PIR-A proteins appear to be highly variable, in that predicted peptide sequences differ for seven randomly selected PIR-A clones, whereas PIR-B cDNA clones are invariant. Southern blot analysis with PIR-B and PIR-A-specific probes suggests only one PIR-B gene and multiple PIR-A genes. The PIR-A and PIR-B genes are expressed in B lymphocytes and myeloid lineage cells, wherein both are expressed simultaneously. The characteristics of the highly-conserved PIR-A and PIR-B genes and their coordinate cellular expression suggest a potential regulatory role in humoral, inflammatory, and allergic responses. PMID:9144225

  9. Tissue-specific promoter utilisation of the kallikrein-related peptidase genes, KLK5 and KLK7, and cellular localisation of the encoded proteins suggest roles in exocrine pancreatic function.

    PubMed

    Dong, Ying; Matigian, Nick; Harvey, Tracey J; Samaratunga, Hemamali; Hooper, John D; Clements, Judith A

    2008-02-01

    Abstract Tissue kallikrein (kallikrein 1) was first identified in pancreas and is the namesake of the kallikrein-related peptidase (KLK) family. KLK1 and the other 14 members of the human KLK family are encoded by 15 serine protease genes clustered at chromosome 19q13.4. Our Northern blot analysis of 19 normal human tissues for expression of KLK4 to KLK15 identified pancreas as a common expression site for the gene cluster spanning KLK5 to KLK13, as well as for KLK15 which is located adjacent to KLK1. Consistent with previous reports detailing the ability of KLK genes to generate organ- and disease-specific transcripts, detailed molecular and in silico analyses indicated that KLK5 and KLK7 generate transcripts in pancreas variant from those in skin or ovary. Consistently, we identified in the promoters of these KLK genes motifs which conform with consensus binding sites for transcription factors conferring pancreatic expression. In addition, immunohistochemical analysis revealed predominant localisation of KLK5 and KLK7 in acinar cells of the exocrine pancreas, suggesting roles for these enzymes in digestion. Our data also support expression patterns derived from gene duplication events in the human KLK cluster. These findings suggest that, in addition to KLK1, other related KLK enzymes will function in the exocrine pancreas.

  10. Global identification of genes regulated by estrogen signaling and demethylation in MCF-7 breast cancer cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Putnik, Milica, E-mail: milica.putnik@ki.se; Zhao, Chunyan, E-mail: chunyan.zhao@ki.se; Gustafsson, Jan-Ake, E-mail: jan-ake.gustafsson@ki.se

    Highlights: Black-Right-Pointing-Pointer Estrogen signaling and demethylation can both control gene expression in breast cancers. Black-Right-Pointing-Pointer Cross-talk between these mechanisms is investigated in human MCF-7 breast cancer cells. Black-Right-Pointing-Pointer 137 genes are influenced by both 17{beta}-estradiol and demethylating agent 5-aza-2 Prime -deoxycytidine. Black-Right-Pointing-Pointer A set of genes is identified as targets of both estrogen signaling and demethylation. Black-Right-Pointing-Pointer There is no direct molecular interplay of mediators of estrogen and epigenetic signaling. -- Abstract: Estrogen signaling and epigenetic modifications, in particular DNA methylation, are involved in regulation of gene expression in breast cancers. Here we investigated a potential regulatory cross-talk between thesemore » two pathways by identifying their common target genes and exploring underlying molecular mechanisms in human MCF-7 breast cancer cells. Gene expression profiling revealed that the expression of approximately 140 genes was influenced by both 17{beta}-estradiol (E2) and a demethylating agent 5-aza-2 Prime -deoxycytidine (DAC). Gene ontology (GO) analysis suggests that these genes are involved in intracellular signaling cascades, regulation of cell proliferation and apoptosis. Based on previously reported association with breast cancer, estrogen signaling and/or DNA methylation, CpG island prediction and GO analysis, we selected six genes (BTG3, FHL2, PMAIP1, BTG2, CDKN1A and TGFB2) for further analysis. Tamoxifen reverses the effect of E2 on the expression of all selected genes, suggesting that they are direct targets of estrogen receptor. Furthermore, DAC treatment reactivates the expression of all selected genes in a dose-dependent manner. Promoter CpG island methylation status analysis revealed that only the promoters of BTG3 and FHL2 genes are methylated, with DAC inducing demethylation, suggesting DNA methylation directs repression of these genes in MCF-7 cells. In a further analysis of the potential interplay between estrogen signaling and DNA methylation, E2 treatment showed no effect on the methylation status of these promoters. Additionally, we show that the ER{alpha} recruitment occurs at the FHL2 promoter in an E2- and DAC-independent fashion. In conclusion, we identified a set of genes regulated by both estrogen signaling and DNA methylation. However, our data does not support a direct molecular interplay of mediators of estrogen and epigenetic signaling at promoters of regulated genes.« less

  11. Quantification of protein expression in cells and cellular subcompartments on immunohistochemical sections using a computer supported image analysis system.

    PubMed

    Braun, Martin; Kirsten, Robert; Rupp, Niels J; Moch, Holger; Fend, Falko; Wernert, Nicolas; Kristiansen, Glen; Perner, Sven

    2013-05-01

    Quantification of protein expression based on immunohistochemistry (IHC) is an important step for translational research and clinical routine. Several manual ('eyeballing') scoring systems are used in order to semi-quantify protein expression based on chromogenic intensities and distribution patterns. However, manual scoring systems are time-consuming and subject to significant intra- and interobserver variability. The aim of our study was to explore, whether new image analysis software proves to be sufficient as an alternative tool to quantify protein expression. For IHC experiments, one nucleus specific marker (i.e., ERG antibody), one cytoplasmic specific marker (i.e., SLC45A3 antibody), and one marker expressed in both compartments (i.e., TMPRSS2 antibody) were chosen. Stainings were applied on TMAs, containing tumor material of 630 prostate cancer patients. A pathologist visually quantified all IHC stainings in a blinded manner, applying a four-step scoring system. For digital quantification, image analysis software (Tissue Studio v.2.1, Definiens AG, Munich, Germany) was applied to obtain a continuous spectrum of average staining intensity. For each of the three antibodies we found a strong correlation of the manual protein expression score and the score of the image analysis software. Spearman's rank correlation coefficient was 0.94, 0.92, and 0.90 for ERG, SLC45A3, and TMPRSS2, respectively (p⟨0.01). Our data suggest that the image analysis software Tissue Studio is a powerful tool for quantification of protein expression in IHC stainings. Further, since the digital analysis is precise and reproducible, computer supported protein quantification might help to overcome intra- and interobserver variability and increase objectivity of IHC based protein assessment.

  12. Coffee cysteine proteinases and related inhibitors with high expression during grain maturation and germination

    PubMed Central

    2012-01-01

    Background Cysteine proteinases perform multiple functions in seeds, including participation in remodelling polypeptides and recycling amino acids during maturation and germination. Currently, few details exist concerning these genes and proteins in coffee. Furthermore, there is limited information on the cysteine proteinase inhibitors which influence the activities of these proteinases. Results Two cysteine proteinase (CP) and four cysteine proteinase inhibitor (CPI) gene sequences have been identified in coffee with significant expression during the maturation and germination of coffee grain. Detailed expression analysis of the cysteine proteinase genes CcCP1 and CcCP4 in Robusta using quantitative RT-PCR showed that these transcripts accumulate primarily during grain maturation and germination/post germination. The corresponding proteins were expressed in E. coli and purified, but only one, CcCP4, which has a KDDL/KDEL C-terminal sequence, was found to be active after a short acid treatment. QRT-PCR expression analysis of the four cysteine proteinase inhibitor genes in Robusta showed that CcCPI-1 is primarily expressed in developing and germinating grain and CcCPI-4 is very highly expressed during the late post germination period, as well as in mature, but not immature leaves. Transcripts corresponding to CcCPI-2 and CcCPI-3 were detected in most tissues examined at relatively similar, but generally low levels. Conclusions Several cysteine proteinase and cysteine proteinase inhibitor genes with strong, relatively specific expression during coffee grain maturation and germination are presented. The temporal expression of the CcCP1 gene suggests it is involved in modifying proteins during late grain maturation and germination. The expression pattern of CcCP4, and its close identity with KDEL containing CP proteins, implies this proteinase may play a role in protein and/or cell remodelling during late grain germination, and that it is likely to play a strong role in the programmed cell death associated with post-germination of the coffee grain. Expression analysis of the cysteine proteinase inhibitor genes suggests that CcCPI-1 could primarily be involved in modulating the activity of grain CP activity; while CcCPI-4 may play roles modulating grain CP activity and in the protection of the young coffee seedlings from insects and pathogens. CcCPI-2 and CcCPI-3, having lower and more widespread expression, could be more general "house-keeping" CPI genes. PMID:22380654

  13. Involvement of clip-domain serine protease in the anti-Vibrio immune response of abalone (Haliotis discus hannai)-Molecular cloning, characterization and functional analysis.

    PubMed

    Hu, Jian-Jian; Chen, Yu-Lei; Duan, Xue-Kun; Jin, Teng-Chuan; Li, Yue; Zhang, Ling-Jing; Liu, Guang-Ming; Cao, Min-Jie

    2018-01-01

    Vibrio parahemolyticus (V. parahemolyticus) is a major pathogen for abalone, an important economical shellfish in coastal area of China. There is little known about the abalone innate immune system against pathogen infection. Clip-domain serine proteases (cSPs) are increasingly recognized to play important roles in host immune defense in invertebrates. In this study, we cloned a cSP (Hdh-cSP) from abalone (Haliotis discus hannai). We found out that Hdh-cSP was widely expressed in multiple tissues of abalone, with highest level in the immune-like organ, hepatopancreas. V. parahemolyticus infection induced significantly elevated expression of Hdh-cSP in addition to better-characterized innate immune component genes including Rel/NF-κB, allograft inflammatory factor (ALInFa), macrophage expressed protein (MEP) and caspase-8. Importantly, the silencing of Hdh-cSP reduced the expression of these genes, suggesting that Hdh-cSP was an upstream regulatory factor in V. parahemolyticus infection. Further analysis showed that apoptosis of hemocytes was inhibited when the transcription of Hdh-cSP was knocked down, suggesting that Hdh-cSP participated in cell apoptosis by regulation of caspase 8 expression in V. parahemolyticus infection. Therefore, our study established an important role of cSP in the innate immunity against V. parahemolyticus infection in abalone. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Distinct types of primary cutaneous large B-cell lymphoma identified by gene expression profiling.

    PubMed

    Hoefnagel, Juliette J; Dijkman, Remco; Basso, Katia; Jansen, Patty M; Hallermann, Christian; Willemze, Rein; Tensen, Cornelis P; Vermeer, Maarten H

    2005-05-01

    In the European Organization for Research and Treatment of Cancer (EORTC) classification 2 types of primary cutaneous large B-cell lymphoma (PCLBCL) are distinguished: primary cutaneous follicle center cell lymphomas (PCFCCL) and PCLBCL of the leg (PCLBCL-leg). Distinction between both groups is considered important because of differences in prognosis (5-year survival > 95% and 52%, respectively) and the first choice of treatment (radiotherapy or systemic chemotherapy, respectively), but is not generally accepted. To establish a molecular basis for this subdivision in the EORTC classification, we investigated the gene expression profiles of 21 PCLBCLs by oligonucleotide microarray analysis. Hierarchical clustering based on a B-cell signature (7450 genes) classified PCLBCL into 2 distinct subgroups consisting of, respectively, 8 PCFCCLs and 13 PCLBCLsleg. PCLBCLs-leg showed increased expression of genes associated with cell proliferation; the proto-oncogenes Pim-1, Pim-2, and c-Myc; and the transcription factors Mum1/IRF4 and Oct-2. In the group of PCFCCL high expression of SPINK2 was observed. Further analysis suggested that PCFCCLs and PCLBCLs-leg have expression profiles similar to that of germinal center B-cell-like and activated B-cell-like diffuse large B-cell lymphoma, respectively. The results of this study suggest that different pathogenetic mechanisms are involved in the development of PCFCCLs and PCLBCLs-leg and provide molecular support for the subdivision used in the EORTC classification.

  15. Gluconate as suitable potential reduction supplier in Corynebacterium glutamicum: cloning and expression of gntP and gntK in Escherichia coli.

    PubMed

    Porco, Antonietta; Gamero, Elida E; Mylonás, Elena; Istúriz, Tomás

    2008-01-01

    Corynebacterium glutamicum is widely used in the industrial production of amino acids. We have found that this bacterium grows exponentially on a mineral medium supplemented with gluconate. Gluconate permease and Gluconokinase are expressed in an inducible form and, 6-phosphogluconate dehydrogenase, although constitutively expressed, shows a 3-fold higher specific level in gluconate grown cells than those grown in fructose under similar conditions. Interestingly, these activities are lower than those detected in the strain Escherichia coli M1-8, cultivated under similar conditions. Additionally, here we also confirmed that this bacterium lacks 6-phosphogluconate dehydratase activity. Thus, gluconate must be metabolized through the pentose phosphate pathway. Genes encoding gluconate transport and its phosphorylation were cloned from C. glutamicum, and expressed in suitable E. coli mutants. Sequence analysis revealed that the amino acid sequences obtained from these genes, denoted as gntP and gntK, were similar to those found in other bacteria. Analysis of both genes by RT-PCR suggested constitutive expression, in disagreement with the inducible character of their corresponding activities. The results suggest that gluconate might be a suitable source of reduction potential for improving the efficiency in cultures engaged in amino acids production. This is the first time that gluconate specific enzymatic activities are reported in C. glutamicum.

  16. Differential expression of lncRNAs during the HIV replication cycle: an underestimated layer in the HIV-host interplay.

    PubMed

    Trypsteen, Wim; Mohammadi, Pejman; Van Hecke, Clarissa; Mestdagh, Pieter; Lefever, Steve; Saeys, Yvan; De Bleser, Pieter; Vandesompele, Jo; Ciuffi, Angela; Vandekerckhove, Linos; De Spiegelaere, Ward

    2016-10-26

    Studying the effects of HIV infection on the host transcriptome has typically focused on protein-coding genes. However, recent advances in the field of RNA sequencing revealed that long non-coding RNAs (lncRNAs) add an extensive additional layer to the cell's molecular network. Here, we performed transcriptome profiling throughout a primary HIV infection in vitro to investigate lncRNA expression at the different HIV replication cycle processes (reverse transcription, integration and particle production). Subsequently, guilt-by-association, transcription factor and co-expression analysis were performed to infer biological roles for the lncRNAs identified in the HIV-host interplay. Many lncRNAs were suggested to play a role in mechanisms relying on proteasomal and ubiquitination pathways, apoptosis, DNA damage responses and cell cycle regulation. Through transcription factor binding analysis, we found that lncRNAs display a distinct transcriptional regulation profile as compared to protein coding mRNAs, suggesting that mRNAs and lncRNAs are independently modulated. In addition, we identified five differentially expressed lncRNA-mRNA pairs with mRNA involvement in HIV pathogenesis with possible cis regulatory lncRNAs that control nearby mRNA expression and function. Altogether, the present study demonstrates that lncRNAs add a new dimension to the HIV-host interplay and should be further investigated as they may represent targets for controlling HIV replication.

  17. Global gene expression analysis using RNA-seq uncovered a new role for SR1/CAMTA3 transcription factor in salt stress

    PubMed Central

    Prasad, Kasavajhala V. S. K.; Abdel-Hameed, Amira A. E.; Xing, Denghui; Reddy, Anireddy S. N.

    2016-01-01

    Abiotic and biotic stresses cause significant yield losses in all crops. Acquisition of stress tolerance in plants requires rapid reprogramming of gene expression. SR1/CAMTA3, a member of signal responsive transcription factors (TFs), functions both as a positive and a negative regulator of biotic stress responses and as a positive regulator of cold stress-induced gene expression. Using high throughput RNA-seq, we identified ~3000 SR1-regulated genes. Promoters of about 60% of the differentially expressed genes have a known DNA binding site for SR1, suggesting that they are likely direct targets. Gene ontology analysis of SR1-regulated genes confirmed previously known functions of SR1 and uncovered a potential role for this TF in salt stress. Our results showed that SR1 mutant is more tolerant to salt stress than the wild type and complemented line. Improved tolerance of sr1 seedlings to salt is accompanied with the induction of salt-responsive genes. Furthermore, ChIP-PCR results showed that SR1 binds to promoters of several salt-responsive genes. These results suggest that SR1 acts as a negative regulator of salt tolerance by directly repressing the expression of salt-responsive genes. Overall, this study identified SR1-regulated genes globally and uncovered a previously uncharacterized role for SR1 in salt stress response. PMID:27251464

  18. Integrated network analysis identifies fight-club nodes as a class of hubs encompassing key putative switch genes that induce major transcriptome reprogramming during grapevine development.

    PubMed

    Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

    2014-12-01

    We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named "fight-club hubs" characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named "switch genes" was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. © 2014 American Society of Plant Biologists. All rights reserved.

  19. Integrated Network Analysis Identifies Fight-Club Nodes as a Class of Hubs Encompassing Key Putative Switch Genes That Induce Major Transcriptome Reprogramming during Grapevine Development[W][OPEN

    PubMed Central

    Palumbo, Maria Concetta; Zenoni, Sara; Fasoli, Marianna; Massonnet, Mélanie; Farina, Lorenzo; Castiglione, Filippo; Pezzotti, Mario; Paci, Paola

    2014-01-01

    We developed an approach that integrates different network-based methods to analyze the correlation network arising from large-scale gene expression data. By studying grapevine (Vitis vinifera) and tomato (Solanum lycopersicum) gene expression atlases and a grapevine berry transcriptomic data set during the transition from immature to mature growth, we identified a category named “fight-club hubs” characterized by a marked negative correlation with the expression profiles of neighboring genes in the network. A special subset named “switch genes” was identified, with the additional property of many significant negative correlations outside their own group in the network. Switch genes are involved in multiple processes and include transcription factors that may be considered master regulators of the previously reported transcriptome remodeling that marks the developmental shift from immature to mature growth. All switch genes, expressed at low levels in vegetative/green tissues, showed a significant increase in mature/woody organs, suggesting a potential regulatory role during the developmental transition. Finally, our analysis of tomato gene expression data sets showed that wild-type switch genes are downregulated in ripening-deficient mutants. The identification of known master regulators of tomato fruit maturation suggests our method is suitable for the detection of key regulators of organ development in different fleshy fruit crops. PMID:25490918

  20. Molecular analysis of endo-β-mannanase genes upon seed imbibition suggest a cross-talk between radicle and micropylar endosperm during germination of Arabidopsis thaliana

    PubMed Central

    Iglesias-Fernández, Raquel; del Carmen Rodríguez-Gacio, María; Barrero-Sicilia, Cristina; Carbonero, Pilar

    2011-01-01

    The endo-β-mannanase (MAN) family is represented in the Arabidopsis genome by eight members, all with canonical signal peptides and only half of them being expressed in germinating seeds. The transcripts of these genes were localized in the radicle and micropylar endosperm (ME) before radicle protrusion and this expression disappears as soon as the endosperm is broken by the emerging radicle tip. However, only three of these MAN genes, AtMAN5, AtMAN7 and especially AtMAN6 influence the germination time (t50) as assessed by the analysis of the corresponding knock-out lines. The data suggest a possible interaction between embryo and ME regarding the role of MAN during the Arabidopsis germination process. PMID:21301215

  1. Efficient experimental design and analysis strategies for the detection of differential expression using RNA-Sequencing

    PubMed Central

    2012-01-01

    Background RNA sequencing (RNA-Seq) has emerged as a powerful approach for the detection of differential gene expression with both high-throughput and high resolution capabilities possible depending upon the experimental design chosen. Multiplex experimental designs are now readily available, these can be utilised to increase the numbers of samples or replicates profiled at the cost of decreased sequencing depth generated per sample. These strategies impact on the power of the approach to accurately identify differential expression. This study presents a detailed analysis of the power to detect differential expression in a range of scenarios including simulated null and differential expression distributions with varying numbers of biological or technical replicates, sequencing depths and analysis methods. Results Differential and non-differential expression datasets were simulated using a combination of negative binomial and exponential distributions derived from real RNA-Seq data. These datasets were used to evaluate the performance of three commonly used differential expression analysis algorithms and to quantify the changes in power with respect to true and false positive rates when simulating variations in sequencing depth, biological replication and multiplex experimental design choices. Conclusions This work quantitatively explores comparisons between contemporary analysis tools and experimental design choices for the detection of differential expression using RNA-Seq. We found that the DESeq algorithm performs more conservatively than edgeR and NBPSeq. With regard to testing of various experimental designs, this work strongly suggests that greater power is gained through the use of biological replicates relative to library (technical) replicates and sequencing depth. Strikingly, sequencing depth could be reduced as low as 15% without substantial impacts on false positive or true positive rates. PMID:22985019

  2. Efficient experimental design and analysis strategies for the detection of differential expression using RNA-Sequencing.

    PubMed

    Robles, José A; Qureshi, Sumaira E; Stephen, Stuart J; Wilson, Susan R; Burden, Conrad J; Taylor, Jennifer M

    2012-09-17

    RNA sequencing (RNA-Seq) has emerged as a powerful approach for the detection of differential gene expression with both high-throughput and high resolution capabilities possible depending upon the experimental design chosen. Multiplex experimental designs are now readily available, these can be utilised to increase the numbers of samples or replicates profiled at the cost of decreased sequencing depth generated per sample. These strategies impact on the power of the approach to accurately identify differential expression. This study presents a detailed analysis of the power to detect differential expression in a range of scenarios including simulated null and differential expression distributions with varying numbers of biological or technical replicates, sequencing depths and analysis methods. Differential and non-differential expression datasets were simulated using a combination of negative binomial and exponential distributions derived from real RNA-Seq data. These datasets were used to evaluate the performance of three commonly used differential expression analysis algorithms and to quantify the changes in power with respect to true and false positive rates when simulating variations in sequencing depth, biological replication and multiplex experimental design choices. This work quantitatively explores comparisons between contemporary analysis tools and experimental design choices for the detection of differential expression using RNA-Seq. We found that the DESeq algorithm performs more conservatively than edgeR and NBPSeq. With regard to testing of various experimental designs, this work strongly suggests that greater power is gained through the use of biological replicates relative to library (technical) replicates and sequencing depth. Strikingly, sequencing depth could be reduced as low as 15% without substantial impacts on false positive or true positive rates.

  3. Unraveling the oral cancer lncRNAome: Identification of novel lncRNAs associated with malignant progression and HPV infection.

    PubMed

    Nohata, Nijiro; Abba, Martin C; Gutkind, J Silvio

    2016-08-01

    The role of long non-coding RNA (lncRNA) expression in human head and neck squamous cell carcinoma (HNSCC) is still poorly understood. In this study, we aimed at establishing the onco-lncRNAome profiling of HNSCC and to identify lncRNAs correlating with prognosis and patient survival. The Atlas of Noncoding RNAs in Cancer (TANRIC) database was employed to retrieve the lncRNA expression information generated from The Cancer Genome Atlas (TCGA) HNSCC RNA-sequencing data. RNA-sequencing data from HNSCC cell lines were also considered for this study. Bioinformatics approaches, such as differential gene expression analysis, survival analysis, principal component analysis, and Co-LncRNA enrichment analysis were performed. Using TCGA HNSCC RNA-sequencing data from 426 HNSCC and 42 adjacent normal tissues, we found 728 lncRNA transcripts significantly and differentially expressed in HNSCC. Among the 728 lncRNAs, 55 lncRNAs were significantly associated with poor prognosis, such as overall survival and/or disease-free survival. Next, we found 140 lncRNA transcripts significantly and differentially expressed between Human Papilloma Virus (HPV) positive tumors and HPV negative tumors. Thirty lncRNA transcripts were differentially expressed between TP53 mutated and TP53 wild type tumors. Co-LncRNA analysis suggested that protein-coding genes that are co-expressed with these deregulated lncRNAs might be involved in cancer associated molecular events. With consideration of differential expression of lncRNAs in a HNSCC cell lines panel (n=22), we found several lncRNAs that may represent potential targets for diagnosis, therapy and prevention of HNSCC. LncRNAs profiling could provide novel insights into the potential mechanisms of HNSCC oncogenesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Unraveling the Oral Cancer lncRNAome: Identification of Novel lncRNAs Associated with Malignant Progression and HPV Infection

    PubMed Central

    Nohata, Nijiro; Abba, Martin C.; Gutkind, J. Silvio

    2017-01-01

    Objectives The role of long non-coding RNA (lncRNA) expression in human head and neck squamous cell carcinoma (HNSCC) is still poorly understood. In this study, we aimed at establishing the onco-lncRNAome profiling of HNSCC and to identify lncRNAs correlating with prognosis and patient survival. Materials and Methods The Atlas of Noncoding RNAs in Cancer (TANRIC) database was employed to retrieve the lncRNA expression information generated from The Cancer Genome Atlas (TCGA) HNSCC RNA-sequencing data. RNA-sequencing data from HNSCC cell lines were also considered for this study. Bioinformatics approaches, such as differential gene expression analysis, survival analysis, principal component analysis, and Co-LncRNA enrichment analysis were performed. Results Using TCGA HNSCC RNA-sequencing data from 426 HNSCC and 42 adjacent normal tissues, we found 728 lncRNA transcripts significantly and differentially expressed in HNSCC. Among the 728 lncRNAs, 55 lncRNAs were significantly associated with poor prognosis, such as overall survival and/or disease-free survival. Next, we found 140 lncRNA transcripts significantly and differentially expressed between Human Papilloma Virus (HPV) positive tumors and HPV negative tumors. Thirty lncRNA transcripts were differentially expressed between TP53 mutated and TP53 wild type tumors. Co-LncRNA analysis suggested that protein-coding genes that are co-expressed with these deregulated lncRNAs might be involved in cancer associated molecular events. With consideration of differential expression of lncRNAs in a HNSCC cell lines panel (n=22), we found several lncRNAs that may represent potential targets for diagnosis, therapy and prevention of HNSCC. Conclusion LncRNAs profiling could provide novel insights into the potential mechanisms of HNSCC oncogenesis. PMID:27424183

  5. PD-L2 expression in colorectal cancer: Independent prognostic effect and targetability by deglycosylation.

    PubMed

    Wang, Huanbin; Yao, Han; Li, Chushu; Liang, Lunxi; Zhang, Yao; Shi, Hubing; Zhou, Chongzhi; Chen, Yingxuan; Fang, Jing-Yuan; Xu, Jie

    2017-01-01

    Colorectal cancer (CRC) is the second leading cause of cancer death worldwide, and immune checkpoint blockade therapy provides an opportunity for improving the outcome of CRC patients. Recent studies suggest that programmed death ligand-1 (PD-L1) is only expressed in 12% of CRCs. Here, we demonstrate that PD-L2 is expressed in approximately 40% CRCs, and its expression independently associates with poor survival of CRC patients. By detection of PD-L2 expression by immunofluorescence in 124 CRC cases with 10-y survival data, we found significant association between PD-L2 overexpression in cancer cells and worse overall survival (46.3 vs 69.1 mo; p = 0.0004). The association remained significant in multivariate COX regression analysis (hazard ratio = 2.778, 95% confidence interval [CI] = 1.668-4.627; p < 0.0001). In the validation CRC data set, significant association between PD-L2 overexpression and poor survival was supported by the univariate analysis (27.1 vs. 88.9 mo; p = 0.0002) and multivariate model (hazard ratio = 7.09, 95%CI 1.78-28.16; p = 0.005). Western Blot revealed strong induction of PD-L2 expression by interferon-γ (IFNγ) in CRC cells, and the mRNA levels of both genes were significantly correlated in CRC tissue samples. Suppression of glycosylation with tunicamycin caused a shift in molecular weight and significant decrease in the expression of PD-L2 protein. In conclusion, PD-L2 overexpression in CRC cells, under the regulation by IFNγ and glycosylation, associates with poor survival of patients with colorectal cancer. These findings highlight PD-L2 as a promising therapeutic target in CRC and suggest potential routes to control PD-L2 expression in CRC cells.

  6. PD-L2 expression in colorectal cancer: Independent prognostic effect and targetability by deglycosylation

    PubMed Central

    Wang, Huanbin; Yao, Han; Li, Chushu; Liang, Lunxi; Zhang, Yao; Shi, Hubing; Zhou, Chongzhi; Chen, Yingxuan; Fang, Jing-Yuan

    2017-01-01

    ABSTRACT Colorectal cancer (CRC) is the second leading cause of cancer death worldwide, and immune checkpoint blockade therapy provides an opportunity for improving the outcome of CRC patients. Recent studies suggest that programmed death ligand-1 (PD-L1) is only expressed in 12% of CRCs. Here, we demonstrate that PD-L2 is expressed in approximately 40% CRCs, and its expression independently associates with poor survival of CRC patients. By detection of PD-L2 expression by immunofluorescence in 124 CRC cases with 10-y survival data, we found significant association between PD-L2 overexpression in cancer cells and worse overall survival (46.3 vs 69.1 mo; p = 0.0004). The association remained significant in multivariate COX regression analysis (hazard ratio = 2.778, 95% confidence interval [CI] = 1.668–4.627; p < 0.0001). In the validation CRC data set, significant association between PD-L2 overexpression and poor survival was supported by the univariate analysis (27.1 vs. 88.9 mo; p = 0.0002) and multivariate model (hazard ratio = 7.09, 95%CI 1.78–28.16; p = 0.005). Western Blot revealed strong induction of PD-L2 expression by interferon-γ (IFNγ) in CRC cells, and the mRNA levels of both genes were significantly correlated in CRC tissue samples. Suppression of glycosylation with tunicamycin caused a shift in molecular weight and significant decrease in the expression of PD-L2 protein. In conclusion, PD-L2 overexpression in CRC cells, under the regulation by IFNγ and glycosylation, associates with poor survival of patients with colorectal cancer. These findings highlight PD-L2 as a promising therapeutic target in CRC and suggest potential routes to control PD-L2 expression in CRC cells. PMID:28811964

  7. Proteome and Transcriptome Analysis of Ovary, Intersex Gonads, and Testis Reveals Potential Key Sex Reversal/Differentiation Genes and Mechanism in Scallop Chlamys nobilis.

    PubMed

    Shi, Yu; Liu, Wenguang; He, Maoxian

    2018-04-01

    Bivalve mollusks exhibit hermaphroditism and sex reversal/differentiation. Studies generally focus on transcriptional profiling and specific genes related to sex determination and differentiation. Few studies on sex reversal/differentiation have been reported. A combination analysis of gonad proteomics and transcriptomics was conducted on Chlamys nobilis to provide a systematic understanding of sex reversal/differentiation in bivalves. We obtained 4258 unique peptides and 93,731 unigenes with good correlation between messenger RNA and protein levels. Candidate genes in sex reversal/differentiation were found: 15 genes differentially expressed between sexes were identified and 12 had obvious sexual functions. Three novel genes (foxl2, β-catenin, and sry) were expressed highly in intersex individuals and were likely involved in the control of gonadal sex in C. nobilis. High expression of foxl2 or β-catenin may inhibit sry and activate 5-HT receptor and vitellogenin to maintain female development. High expression of sry may inhibit foxl2 and β-catenin and activate dmrt2, fem-1, sfp2, sa6, Amy-1, APCP4, and PLK to maintain male function. High expression of sry, foxl2, and β-catenin in C. nobilis may be involved in promoting and maintaining sex reversal/differentiation. The downstream regulator may not be dimorphic expressed genes, but genes expressed in intersex individuals, males and females. Different expression patterns of sex-related genes and gonadal histological characteristics suggested that C. nobilis may change its sex from male to female. These findings suggest highly conserved sex reversal/differentiation with diverged regulatory pathways during C. nobilis evolution. This study provides valuable genetic resources for understanding sex reversal/differentiation (intersex) mechanisms and pathways underlying bivalve reproductive regulation.

  8. DNA polymerase β variant Ile260Met generates global gene expression changes related to cellular transformation

    PubMed Central

    Sweasy, Joann B.

    2012-01-01

    Maintenance of genomic stability is essential for cellular survival. The base excision repair (BER) pathway is critical for resolution of abasic sites and damaged bases, estimated to occur 20,000 times in cells daily. DNA polymerase β (Pol β) participates in BER by filling DNA gaps that result from excision of damaged bases. Approximately 30% of human tumours express Pol β variants, many of which have altered fidelity and activity in vitro and when expressed, induce cellular transformation. The prostate tumour variant Ile260Met transforms cells and is a sequence-context-dependent mutator. To test the hypothesis that mutations induced in vivo by Ile260Met lead to cellular transformation, we characterized the genome-wide expression profile of a clone expressing Ile260Met as compared with its non-induced counterpart. Using a 1.5-fold minimum cut-off with a false discovery rate (FDR) of <0.05, 912 genes exhibit altered expression. Microarray results were confirmed by quantitative real-time polymerase chain reaction (qRT-PCR) and revealed unique expression profiles in other clones. Gene Ontology (GO) clusters were analyzed using Ingenuity Pathways Analysis to identify altered gene networks and associated nodes. We determined three nodes of interest that exhibited dysfunctional regulation of downstream gene products without themselves having altered expression. One node, peroxisome proliferator-activated protein γ (PPARG), was sequenced and found to contain a coding region mutation in PPARG2 only in transformed cells. Further analysis suggests that this mutation leads to dominant negative activity of PPARG2. PPARG is a transcription factor implicated to have tumour suppressor function. This suggests that the PPARG2 mutant may have played a role in driving cellular transformation. We conclude that PPARG induces cellular transformation by a mutational mechanism. PMID:22914675

  9. Reduced Dermatopontin Expression Is a Molecular Link Between Uterine Leiomyomas and Keloids

    PubMed Central

    Catherino, William H.; Leppert, Phyllis C.; Stenmark, Matthew H.; Payson, Mark; Potlog-Nahari, Clariss; Nieman, Lynnette K.; Segars, James H.

    2014-01-01

    Uterine leiomyomas are prevalent estrogen-responsive clonal tumors, but the specific genetic alterations that contribute to their development have not been elucidated. To identify genes involved in the formation of leiomyomas, we used global expression profiling to compare clonal tumors with normal myometrium. Contrary to expectation, genes involved in estrogen action were not differentially expressed between leiomyoma and normal myometrium. Genes encoding extracellular-matrix proteins were prominently featured, suggesting their involvement in formation of a myofibroblast phenotype. Analysis of the extracellular matrix in the leiomyomas revealed a disordered collagen fibril orientation. Expression of the collagen-binding protein dermatopontin was found to be consistently decreased in leiomyoma by both reverse transcriptase-polymerase chain reaction (RT-PCR) and real-time RT-PCR (mean underexpression = 9.41-fold) regardless of leiomyoma size, leiomyoma location, patient race, and patient age. This expression pattern was observed in 11 subjects and a total of 23 leiomyoma: myometrium pairs. Decreased expression of dermatopontin was also associated with keloid formation, a fibrotic disease that shares epidemiologic similarities with leiomyoma. Immunohistochemical studies of leiomyomas and keloids demonstrated reduced levels of dermatopontin in both tissues. In addition, ultrastructural analysis revealed that the orientation of the collagen fibrils in the keloid tissues strongly resembled that in the leiomyomas. Reduction in dermatopontin was associated with an increase in transforming growth factor–β3 (TGFB3) mRNA levels in leiomyomas, whereas other genes involved in dermatopontin signaling were not differentially expressed. These findings suggest that leiomyoma development involves a myofibroblast cell phenotype characterized by dysregulation of genes encoding extracellular-matrix proteins. In particular, decreased expression of dermatopontin represents a molecular link between the leiomyoma and keloid phenotypes. PMID:15139000

  10. Spi-C has opposing effects to PU.1 on gene expression in progenitor B cells.

    PubMed

    Schweitzer, Brock L; Huang, Kelly J; Kamath, Meghana B; Emelyanov, Alexander V; Birshtein, Barbara K; DeKoter, Rodney P

    2006-08-15

    The Ets transcription factor Spi-C, expressed in B cells and macrophages, is closely related to PU.1 and has the ability to recognize the same DNA consensus sequence. However, the function of Spi-C has yet to be determined. The purpose of this study is to further examine Spi-C activity in B cell development. First, using retroviral vectors to infect PU.1(-/-) fetal liver progenitors, Spi-C was found to be inefficient at inducing cytokine-dependent proliferation and differentiation of progenitor B (pro-B) cells or macrophages relative to PU.1 or Spi-B. Next, Spi-C was ectopically expressed in fetal liver-derived, IL-7-dependent pro-B cell lines. Wild-type (WT) pro-B cells ectopically expressing Spi-C (WT-Spi-C) have several phenotypic characteristics of pre-B cells such as increased CD25 and decreased c-Kit surface expression. In addition, WT-Spi-C pro-B cells express increased levels of IgH sterile transcripts and reduced levels of expression and transcription of the FcgammaRIIb gene. Gel-shift analysis suggests that Spi-C, ectopically expressed in pro-B cells, can bind PU.1 consensus sites in the IgH intronic enhancer and FcgammaRIIb promoter. Transient transfection analysis demonstrated that PU.1 functions to repress the IgH intronic enhancer and activate the FcgammaRIIb promoter, while Spi-C opposes these activities. WT-Spi-C pro-B cells have reduced levels of dimethylation on lysine 9 of histone H3 within the IgH 3' regulatory region, indicating that Spi-C can contribute to removal of repressive features in the IgH locus. Overall, these studies suggest that Spi-C may promote B cell differentiation by modulating the activity of PU.1-dependent genes.

  11. Association of estradiol on expression of melanocortin receptors and their accessory proteins in the liver of chicken (Gallus gallus).

    PubMed

    Ren, Junxiao; Li, Yanmin; Xu, Naiyi; Li, Hong; Li, Cuicui; Han, Ruili; Wang, Yanbin; Li, Zhuanjian; Kang, Xiangtao; Liu, Xiaojun; Tian, Yadong

    2017-01-01

    The melanocortin receptor accessory proteins (MRAP and MRAP2) are small single-pass transmembrane proteins that regulate the biological functions of the melanocortin receptor (MCR) family. MCRs comprise five receptors (MC1R-MC5R) with diverse physiological roles in mammals. Five MCR members and two MRAPs were also predicted in the chicken (Gallus gallus) genome. However, little is known about their expression, regulation and biological functions. In this study, we cloned the MRAP and MRAP2 genes. Sequencing analysis revealed that the functional domains of MRAP and MRAP2 were conserved among species, suggesting that the physiological roles of chicken MRAP and MRAP2 could be similar to their mammalian counterparts. Tissue expression analysis demonstrated that MRAP was expressed in the adrenal gland, liver, spleen, glandular stomach and lungs, while MRAP2 is predominantly expressed in the adrenal gland. All five MCRs were present in the adrenal gland, but showed different expression patterns in other tissues. The MC5R was the only MCR member that was expressed in the chicken liver. The expression levels of MRAP in chicken liver were significantly increased at sexual maturity stage, and were significantly up-regulated (P<0.05) when chickens and chicken primary hepatocytes were treated with 17β-estradiol in vivo and in vitro, respectively; however, expression levels of PPARγ were down-regulated, and no effect on MC5R was observed. Our results suggested that estrogen could stimulate the expression of MRAP in the liver of chicken through inhibiting the expression of transcription regulation factor PPARγ, and MRAP might play its biological role in a different way rather than forming an MRAP/MC2R complex in chicken liver during the egg-laying period. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. sae is essential for expression of the staphylococcal adhesins Eap and Emp.

    PubMed

    Harraghy, Niamh; Kormanec, Jan; Wolz, Christiane; Homerova, Dagmar; Goerke, Christiane; Ohlsen, Knut; Qazi, Saara; Hill, Philip; Herrmann, Mathias

    2005-06-01

    Eap and Emp are two Staphylococcus aureus adhesins initially described as extracellular matrix binding proteins. Eap has since emerged as being important in adherence to and invasion of eukaryotic cells, as well as being described as an immunomodulator and virulence factor in chronic infections. This paper describes the mapping of the transcription start point of the eap and emp promoters. Moreover, using reporter-gene assays and real-time PCR in defined regulatory mutants, environmental conditions and global regulators affecting expression of eap and emp were investigated. Marked differences were found in expression of eap and emp between strain Newman and the 8325 derivatives SH1000 and 8325-4. Moreover, both genes were repressed in the presence of glucose. Analysis of expression of both genes in various regulatory mutants revealed that sarA and agr were involved in their regulation, but the data suggested that there were additional regulators of both genes. In a sae mutant, expression of both genes was severely repressed. sae expression was also reduced in the presence of glucose, suggesting that repression of eap and emp in glucose-containing medium may, in part, be a consequence of a decrease in expression of sae.

  13. Expression and functional role of inhibitor-of-apoptosis protein livin (BIRC7) in neuroblastoma.

    PubMed

    Dasgupta, Anindya; Alvarado, Carlos S; Xu, Zhiheng; Findley, Harry W

    2010-09-10

    We evaluated the expression of the inhibitor-of-apoptosis protein (IAP)livin (BIRC7)in 59 cases ofneuroblastoma (NBL) by quantitative RT-PCR. We also examined the role of livin in protecting tumor cells from chemotherapy drugs. Livin expression varied significantly amongtumors. High levels of expression were observed in 17 of 39 patients with advanced stages (stages 3 and 4) and 6 of 20 patients with localized stages (stages 1 and 2). Livin-transfected, MYCN-amplified NBL cells showed increased resistance to doxorubicin and etoposide. Conversely, livin knockdown with siRNA enhanced spontaneous and drug-induced apoptosis in NBL cells. Multivariate analysis of prognostic factors showed that high livin expression worsened prognosis for patients with MYCN-amplified tumors. Our data suggest that (i) livin is frequently expressed in NBL and protects tumor cells with amplified MYCN oncogene from genotoxic agents; (ii) the antiapoptotic effect of livin in NBL is blocked by siRNA; (iii) in the sample studied, high livin expression enhanced the adverse prognostic impact of MYCN amplification. These findings suggest that livin may contribute to drug resistance in NBL. Copyright © 2010 Elsevier Inc. All rights reserved.

  14. Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

    PubMed

    Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

    2015-08-18

    p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.

  15. Digital sorting of complex tissues for cell type-specific gene expression profiles.

    PubMed

    Zhong, Yi; Wan, Ying-Wooi; Pang, Kaifang; Chow, Lionel M L; Liu, Zhandong

    2013-03-07

    Cellular heterogeneity is present in almost all gene expression profiles. However, transcriptome analysis of tissue specimens often ignores the cellular heterogeneity present in these samples. Standard deconvolution algorithms require prior knowledge of the cell type frequencies within a tissue or their in vitro expression profiles. Furthermore, these algorithms tend to report biased estimations. Here, we describe a Digital Sorting Algorithm (DSA) for extracting cell-type specific gene expression profiles from mixed tissue samples that is unbiased and does not require prior knowledge of cell type frequencies. The results suggest that DSA is a specific and sensitivity algorithm in gene expression profile deconvolution and will be useful in studying individual cell types of complex tissues.

  16. Therapeutic activities of intravenous immunoglobulins in multiple sclerosis involve modulation of chemokine expression.

    PubMed

    Pigard, Nadine; Elovaara, Irina; Kuusisto, Hanna; Paalavuo, Raija; Dastidar, Prasun; Zimmermann, Klaus; Schwarz, Hans-Peter; Reipert, Birgit

    2009-04-30

    The objective of this study was to identify genes that are differentially expressed in peripheral T cells of patients with MS exacerbation receiving treatment with IVIG. Using microarray analysis, we identified 360 genes that were at least two-fold up- or down-regulated. The expression of four representative genes (PTGER4, CXCL5, IL11 and CASP2) was confirmed by quantitative PCR. Four of the differentially expressed genes encode chemokines (CXCL3, CXCL5, CCL13 and XCL2) that are involved in directing leukocyte migration. We suggest that the modulation of chemokine expression in peripheral T cells contributes to the beneficial activity of IVIG in patients with MS exacerbation.

  17. Integrated analysis of numerous heterogeneous gene expression profiles for detecting robust disease-specific biomarkers and proposing drug targets.

    PubMed

    Amar, David; Hait, Tom; Izraeli, Shai; Shamir, Ron

    2015-09-18

    Genome-wide expression profiling has revolutionized biomedical research; vast amounts of expression data from numerous studies of many diseases are now available. Making the best use of this resource in order to better understand disease processes and treatment remains an open challenge. In particular, disease biomarkers detected in case-control studies suffer from low reliability and are only weakly reproducible. Here, we present a systematic integrative analysis methodology to overcome these shortcomings. We assembled and manually curated more than 14,000 expression profiles spanning 48 diseases and 18 expression platforms. We show that when studying a particular disease, judicious utilization of profiles from other diseases and information on disease hierarchy improves classification quality, avoids overoptimistic evaluation of that quality, and enhances disease-specific biomarker discovery. This approach yielded specific biomarkers for 24 of the analyzed diseases. We demonstrate how to combine these biomarkers with large-scale interaction, mutation and drug target data, forming a highly valuable disease summary that suggests novel directions in disease understanding and drug repurposing. Our analysis also estimates the number of samples required to reach a desired level of biomarker stability. This methodology can greatly improve the exploitation of the mountain of expression profiles for better disease analysis. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  18. Uncovering Hidden Layers of Cell Cycle Regulation through Integrative Multi-omic Analysis

    PubMed Central

    Aviner, Ranen; Shenoy, Anjana; Elroy-Stein, Orna; Geiger, Tamar

    2015-01-01

    Studying the complex relationship between transcription, translation and protein degradation is essential to our understanding of biological processes in health and disease. The limited correlations observed between mRNA and protein abundance suggest pervasive regulation of post-transcriptional steps and support the importance of profiling mRNA levels in parallel to protein synthesis and degradation rates. In this work, we applied an integrative multi-omic approach to study gene expression along the mammalian cell cycle through side-by-side analysis of mRNA, translation and protein levels. Our analysis sheds new light on the significant contribution of both protein synthesis and degradation to the variance in protein expression. Furthermore, we find that translation regulation plays an important role at S-phase, while progression through mitosis is predominantly controlled by changes in either mRNA levels or protein stability. Specific molecular functions are found to be co-regulated and share similar patterns of mRNA, translation and protein expression along the cell cycle. Notably, these include genes and entire pathways not previously implicated in cell cycle progression, demonstrating the potential of this approach to identify novel regulatory mechanisms beyond those revealed by traditional expression profiling. Through this three-level analysis, we characterize different mechanisms of gene expression, discover new cycling gene products and highlight the importance and utility of combining datasets generated using different techniques that monitor distinct steps of gene expression. PMID:26439921

  19. Molecular Cloning, Bioinformatic Analysis, and Expression of Bombyx mori Lebocin 5 Gene Related to Beauveria bassiana Infection.

    PubMed

    Lü, Dingding; Hou, Chengxiang; Qin, Guangxing; Gao, Kun; Chen, Tian; Guo, Xijie

    2017-01-01

    A full-length cDNA of lebocin 5 (BmLeb5) was first cloned from silkworm, Bombyx mori , by rapid amplification of cDNA ends. The BmLeb5 gene is 808 bp in length and the open reading frame encodes a 179-amino acid hydroxyproline-rich peptide. Bioinformatic analysis results showed that BmLeb5 owns an O-glycosylation site and four RXXR motifs as other lebocins. Sequence similarity and phylogenic analysis results indicated that lebocins form a multiple gene family in silkworm as cecropins. Quantitative real-time PCR analysis revealed that BmLeb5 was highest expressed in the fat body. In the silkworm larvae infected by Beauveria bassiana , the expression level of BmLeb5 was upregulated in the fat body and hemolymph which are the most important immune tissues in silkworm. The recombinant protein of BmLeb5 was for the first time successfully expressed with prokaryotic expression system and purified. There are no reports so far that the expression of lebocins could be induced by entomopathogenic fungus. Our study suggested that BmLeb5 might play an important role in the immune response of silkworm to defend B. bassiana infection. The results also provided helpful information for further studying the lebocin family functioned in antifungal immune response in the silkworm.

  20. Annotation and expression of carboxylesterases in the silkworm, Bombyx mori.

    PubMed

    Yu, Quan-You; Lu, Cheng; Li, Wen-Le; Xiang, Zhong-Huai; Zhang, Ze

    2009-11-24

    Carboxylesterase is a multifunctional superfamily and ubiquitous in all living organisms, including animals, plants, insects, and microbes. It plays important roles in xenobiotic detoxification, and pheromone degradation, neurogenesis and regulating development. Previous studies mainly used Dipteran Drosophila and mosquitoes as model organisms to investigate the roles of the insect COEs in insecticide resistance. However, genome-wide characterization of COEs in phytophagous insects and comparative analysis remain to be performed. Based on the newly assembled genome sequence, 76 putative COEs were identified in Bombyx mori. Relative to other Dipteran and Hymenopteran insects, alpha-esterases were significantly expanded in the silkworm. Genomics analysis suggested that BmCOEs showed chromosome preferable distribution and 55% of which were tandem arranged. Sixty-one BmCOEs were transcribed based on cDNA/ESTs and microarray data. Generally, most of the COEs showed tissue specific expressions and expression level between male and female did not display obvious differences. Three main patterns could be classified, i.e. midgut-, head and integument-, and silk gland-specific expressions. Midgut is the first barrier of xenobiotics peroral toxicity, in which COEs may be involved in eliminating secondary metabolites of mulberry leaves and contaminants of insecticides in diet. For head and integument-class, most of the members were homologous to odorant-degrading enzyme (ODE) and antennal esterase. RT-PCR verified that the ODE-like esterases were also highly expressed in larvae antenna and maxilla, and thus they may play important roles in degradation of plant volatiles or other xenobiotics. B. mori has the largest number of insect COE genes characterized to date. Comparative genomic analysis suggested that the gene expansion mainly occurred in silkworm alpha-esterases. Expression evidence indicated that the expanded genes were specifically expressed in midgut, integument and head, implying that these genes may have important roles in detoxifying secondary metabolites of mulberry leaves, contaminants in diet, and odorants. Our results provide some new insights into functions and evolutionary characteristics of COEs in phytophagous insects.

  1. Subgroup-Elimination Transcriptomics Identifies Signaling Proteins that Define Subclasses of TRPV1-Positive Neurons and a Novel Paracrine Circuit

    PubMed Central

    Isensee, Jörg; Wenzel, Carsten; Buschow, Rene; Weissmann, Robert; Kuss, Andreas W.; Hucho, Tim

    2014-01-01

    Normal and painful stimuli are detected by specialized subgroups of peripheral sensory neurons. The understanding of the functional differences of each neuronal subgroup would be strongly enhanced by knowledge of the respective subgroup transcriptome. The separation of the subgroup of interest, however, has proven challenging as they can hardly be enriched. Instead of enriching, we now rapidly eliminated the subgroup of neurons expressing the heat-gated cation channel TRPV1 from dissociated rat sensory ganglia. Elimination was accomplished by brief treatment with TRPV1 agonists followed by the removal of compromised TRPV1(+) neurons using density centrifugation. By differential microarray and sequencing (RNA-Seq) based expression profiling we compared the transcriptome of all cells within sensory ganglia versus the same cells lacking TRPV1 expressing neurons, which revealed 240 differentially expressed genes (adj. p<0.05, fold-change>1.5). Corroborating the specificity of the approach, many of these genes have been reported to be involved in noxious heat or pain sensitization. Beyond the expected enrichment of ion channels, we found the TRPV1 transcriptome to be enriched for GPCRs and other signaling proteins involved in adenosine, calcium, and phosphatidylinositol signaling. Quantitative population analysis using a recent High Content Screening (HCS) microscopy approach identified substantial heterogeneity of expressed target proteins even within TRPV1-positive neurons. Signaling components defined distinct further subgroups within the population of TRPV1-positive neurons. Analysis of one such signaling system showed that the pain sensitizing prostaglandin PGD2 activates DP1 receptors expressed predominantly on TRPV1(+) neurons. In contrast, we found the PGD2 producing prostaglandin D synthase to be expressed exclusively in myelinated large-diameter neurons lacking TRPV1, which suggests a novel paracrine neuron-neuron communication. Thus, subgroup analysis based on the elimination rather than enrichment of the subgroup of interest revealed proteins that define subclasses of TRPV1-positive neurons and suggests a novel paracrine circuit. PMID:25551770

  2. Annotation and expression of carboxylesterases in the silkworm, Bombyx mori

    PubMed Central

    2009-01-01

    Background Carboxylesterase is a multifunctional superfamily and ubiquitous in all living organisms, including animals, plants, insects, and microbes. It plays important roles in xenobiotic detoxification, and pheromone degradation, neurogenesis and regulating development. Previous studies mainly used Dipteran Drosophila and mosquitoes as model organisms to investigate the roles of the insect COEs in insecticide resistance. However, genome-wide characterization of COEs in phytophagous insects and comparative analysis remain to be performed. Results Based on the newly assembled genome sequence, 76 putative COEs were identified in Bombyx mori. Relative to other Dipteran and Hymenopteran insects, alpha-esterases were significantly expanded in the silkworm. Genomics analysis suggested that BmCOEs showed chromosome preferable distribution and 55% of which were tandem arranged. Sixty-one BmCOEs were transcribed based on cDNA/ESTs and microarray data. Generally, most of the COEs showed tissue specific expressions and expression level between male and female did not display obvious differences. Three main patterns could be classified, i.e. midgut-, head and integument-, and silk gland-specific expressions. Midgut is the first barrier of xenobiotics peroral toxicity, in which COEs may be involved in eliminating secondary metabolites of mulberry leaves and contaminants of insecticides in diet. For head and integument-class, most of the members were homologous to odorant-degrading enzyme (ODE) and antennal esterase. RT-PCR verified that the ODE-like esterases were also highly expressed in larvae antenna and maxilla, and thus they may play important roles in degradation of plant volatiles or other xenobiotics. Conclusion B. mori has the largest number of insect COE genes characterized to date. Comparative genomic analysis suggested that the gene expansion mainly occurred in silkworm alpha-esterases. Expression evidence indicated that the expanded genes were specifically expressed in midgut, integument and head, implying that these genes may have important roles in detoxifying secondary metabolites of mulberry leaves, contaminants in diet, and odorants. Our results provide some new insights into functions and evolutionary characteristics of COEs in phytophagous insects. PMID:19930670

  3. Fyn-Dependent Gene Networks in Acute Ethanol Sensitivity

    PubMed Central

    Farris, Sean P.; Miles, Michael F.

    2013-01-01

    Studies in humans and animal models document that acute behavioral responses to ethanol are predisposing factor for the risk of long-term drinking behavior. Prior microarray data from our laboratory document strain- and brain region-specific variation in gene expression profile responses to acute ethanol that may be underlying regulators of ethanol behavioral phenotypes. The non-receptor tyrosine kinase Fyn has previously been mechanistically implicated in the sedative-hypnotic response to acute ethanol. To further understand how Fyn may modulate ethanol behaviors, we used whole-genome expression profiling. We characterized basal and acute ethanol-evoked (3 g/kg) gene expression patterns in nucleus accumbens (NAC), prefrontal cortex (PFC), and ventral midbrain (VMB) of control and Fyn knockout mice. Bioinformatics analysis identified a set of Fyn-related gene networks differently regulated by acute ethanol across the three brain regions. In particular, our analysis suggested a coordinate basal decrease in myelin-associated gene expression within NAC and PFC as an underlying factor in sensitivity of Fyn null animals to ethanol sedation. An in silico analysis across the BXD recombinant inbred (RI) strains of mice identified a significant correlation between Fyn expression and a previously published ethanol loss-of-righting-reflex (LORR) phenotype. By combining PFC gene expression correlates to Fyn and LORR across multiple genomic datasets, we identified robust Fyn-centric gene networks related to LORR. Our results thus suggest that multiple system-wide changes exist within specific brain regions of Fyn knockout mice, and that distinct Fyn-dependent expression networks within PFC may be important determinates of the LORR due to acute ethanol. These results add to the interpretation of acute ethanol behavioral sensitivity in Fyn kinase null animals, and identify Fyn-centric gene networks influencing variance in ethanol LORR. Such networks may also inform future design of pharmacotherapies for the treatment and prevention of alcohol use disorders. PMID:24312422

  4. Upregulated SOX9 expression indicates worse prognosis in solid tumors: a systematic review and meta-analysis

    PubMed Central

    Ruan, Haihua; Hu, Shuangyan; Zhang, Hongyu; Du, Gang; Li, Xiaoting; Li, Xiaobo; Li, Xichuan

    2017-01-01

    It was recently reported that increased SOX9 expression drives tumor growth and promotes cancer invasion during human tumorigenicity and metastasis. However, the prognostic value of SOX9 for the survival of patients with solid tumors remains controversial. The present meta-analysis was thus performed to highlight the link between dysregulated SOX9 expression and prognosis in cancer patients. A systematic literature search was conducted using the electronic databases PubMed, Web of Science and Embase to identify eligible studies. A random-effects meta-analytical model was employed to correlate SOX9 expression with overall survival (OS), disease-free survival (DFS) and clinicopathological features. In total, 17 studies with 3307 patients were eligible for the final analysis. Combined hazard ratios (HRs) and 95% confidence intervals (CIs) suggested that high SOX9 expression has an unfavourable impact on OS (HR = 1.66, 95% CI 1.36–2.02, P < 0.001) and DFS (HR = 3.54, 95% CI 2.29–5.47, P = 0.008) in multivariate analysis. Additionally, the pooled odds ratios (ORs) indicated that SOX9 over-expression is associated with large tumor size, lymph node metastasis, distant metastasis and a higher clinical stage. Overall, these results indicated that SOX9 over-expression in patients with solid tumors might be related to poor prognosis and could serve as a potential predictive marker of poor clinicopathological prognosis factor. PMID:29348895

  5. Characteristic Markers of the WNT Signaling Pathways Are Differentially Expressed in Osteoarthritic Cartilage

    PubMed Central

    Dehne, T.; Lindahl, A.; Brittberg, M.; Pruss, A.; Ringe, J.; Sittinger, M.; Karlsson, C.

    2012-01-01

    Objective: It is well known that expression of markers for WNT signaling is dysregulated in osteoarthritic (OA) bone. However, it is still not fully known if the expression of these markers also is affected in OA cartilage. The aim of this study was therefore to examine this issue. Methods: Human cartilage biopsies from OA and control donors were subjected to genome-wide oligonucleotide microarrays. Genes involved in WNT signaling were selected using the BioRetis database, KEGG pathway analysis was searched using DAVID software tools, and cluster analysis was performed using Genesis software. Results from the microarray analysis were verified using quantitative real-time PCR and immunohistochemistry. In order to study the impact of cytokines for the dysregulated WNT signaling, OA and control chondrocytes were stimulated with interleukin-1 and analyzed with real-time PCR for their expression of WNT-related genes. Results: Several WNT markers displayed a significantly altered expression in OA compared to normal cartilage. Interestingly, inhibitors of the canonical and planar cell polarity WNT signaling pathways displayed significantly increased expression in OA cartilage, while the Ca2+/WNT signaling pathway was activated. Both real-time PCR and immunohistochemistry verified the microarray results. Real-time PCR analysis demonstrated that interleukin-1 upregulated expression of important WNT markers. Conclusions: WNT signaling is significantly affected in OA cartilage. The result suggests that both the canonical and planar cell polarity WNT signaling pathways were partly inhibited while the Ca2+/WNT pathway was activated in OA cartilage. PMID:26069618

  6. Identification and expression analyses of two genes encoding putative low-affinity nitrate transporters from Nicotiana plumbaginifolia.

    PubMed

    Fraisier, V; Dorbe, M F; Daniel-Vedele, F

    2001-01-01

    Higher plants have both high- and low-affinity nitrate uptake systems (HATS and LATS respectively). Here we report the isolation and characterization of two genes, NpNRT1.1 and NpNRT1.2, from Nicotiana plumbaginifolia whose structural features suggest that they both belong to the NRT1 gene family, which is involved in the LATS. Amino acid sequence alignment showed that the N. plumbaginifolia proteins have greater similarity to their corresponding tomato homologues than to each other. Genomic Southern blot analysis indicates that there are probably more than two members of this family in N. plumbaginifolia. Northern blot analysis shows that NpNRT1.2 expression is restricted strictly to roots, whereas NpNRT1.1, in addition to roots, is expressed at a basal level in all other plant organs. Likewise, differential expression in response to external treatments with various N sources was observed for these two genes: NpNRT1.1 can be considered as a constitutively expressed gene whereas NpNRT1.2 expression is dependent strictly on high nitrate concentrations. Finally, over-expression of a gene involved in the HATS does not lead to any modification of LATS gene expression.

  7. Comparative phylogenetic analysis and transcriptional profiling of MADS-box gene family identified DAM and FLC-like genes in apple (Malusx domestica)

    PubMed Central

    Kumar, Gulshan; Arya, Preeti; Gupta, Khushboo; Randhawa, Vinay; Acharya, Vishal; Singh, Anil Kumar

    2016-01-01

    The MADS-box transcription factors play essential roles in various processes of plant growth and development. In the present study, phylogenetic analysis of 142 apple MADS-box proteins with that of other dicotyledonous species identified six putative Dormancy-Associated MADS-box (DAM) and four putative Flowering Locus C-like (FLC-like) proteins. In order to study the expression of apple MADS-box genes, RNA-seq analysis of 3 apical and 5 spur bud stages during dormancy, 6 flower stages and 7 fruit development stages was performed. The dramatic reduction in expression of two MdDAMs, MdMADS063 and MdMADS125 and two MdFLC-like genes, MdMADS135 and MdMADS136 during dormancy release suggests their role as flowering-repressors in apple. Apple orthologs of Arabidopsis genes, FLOWERING LOCUS T, FRIGIDA, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 and LEAFY exhibit similar expression patterns as reported in Arabidopsis, suggesting functional conservation in floral signal integration and meristem determination pathways. Gene ontology enrichment analysis of predicted targets of DAM revealed their involvement in regulation of reproductive processes and meristematic activities, indicating functional conservation of SVP orthologs (DAM) in apple. This study provides valuable insights into the functions of MADS-box proteins during apple phenology, which may help in devising strategies to improve important traits in apple. PMID:26856238

  8. Genome-wide analysis of the R2R3-MYB transcription factor gene family in sweet orange (Citrus sinensis).

    PubMed

    Liu, Chaoyang; Wang, Xia; Xu, Yuantao; Deng, Xiuxin; Xu, Qiang

    2014-10-01

    MYB transcription factor represents one of the largest gene families in plant genomes. Sweet orange (Citrus sinensis) is one of the most important fruit crops worldwide, and recently the genome has been sequenced. This provides an opportunity to investigate the organization and evolutionary characteristics of sweet orange MYB genes from whole genome view. In the present study, we identified 100 R2R3-MYB genes in the sweet orange genome. A comprehensive analysis of this gene family was performed, including the phylogeny, gene structure, chromosomal localization and expression pattern analyses. The 100 genes were divided into 29 subfamilies based on the sequence similarity and phylogeny, and the classification was also well supported by the highly conserved exon/intron structures and motif composition. The phylogenomic comparison of MYB gene family among sweet orange and related plant species, Arabidopsis, cacao and papaya suggested the existence of functional divergence during evolution. Expression profiling indicated that sweet orange R2R3-MYB genes exhibited distinct temporal and spatial expression patterns. Our analysis suggested that the sweet orange MYB genes may play important roles in different plant biological processes, some of which may be potentially involved in citrus fruit quality. These results will be useful for future functional analysis of the MYB gene family in sweet orange.

  9. Comparative phylogenetic analysis and transcriptional profiling of MADS-box gene family identified DAM and FLC-like genes in apple (Malusx domestica).

    PubMed

    Kumar, Gulshan; Arya, Preeti; Gupta, Khushboo; Randhawa, Vinay; Acharya, Vishal; Singh, Anil Kumar

    2016-02-09

    The MADS-box transcription factors play essential roles in various processes of plant growth and development. In the present study, phylogenetic analysis of 142 apple MADS-box proteins with that of other dicotyledonous species identified six putative Dormancy-Associated MADS-box (DAM) and four putative Flowering Locus C-like (FLC-like) proteins. In order to study the expression of apple MADS-box genes, RNA-seq analysis of 3 apical and 5 spur bud stages during dormancy, 6 flower stages and 7 fruit development stages was performed. The dramatic reduction in expression of two MdDAMs, MdMADS063 and MdMADS125 and two MdFLC-like genes, MdMADS135 and MdMADS136 during dormancy release suggests their role as flowering-repressors in apple. Apple orthologs of Arabidopsis genes, FLOWERING LOCUS T, FRIGIDA, SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 and LEAFY exhibit similar expression patterns as reported in Arabidopsis, suggesting functional conservation in floral signal integration and meristem determination pathways. Gene ontology enrichment analysis of predicted targets of DAM revealed their involvement in regulation of reproductive processes and meristematic activities, indicating functional conservation of SVP orthologs (DAM) in apple. This study provides valuable insights into the functions of MADS-box proteins during apple phenology, which may help in devising strategies to improve important traits in apple.

  10. Aberrant Gene Expression in Humans

    PubMed Central

    Yang, Ence; Ji, Guoli; Brinkmeyer-Langford, Candice L.; Cai, James J.

    2015-01-01

    Gene expression as an intermediate molecular phenotype has been a focus of research interest. In particular, studies of expression quantitative trait loci (eQTL) have offered promise for understanding gene regulation through the discovery of genetic variants that explain variation in gene expression levels. Existing eQTL methods are designed for assessing the effects of common variants, but not rare variants. Here, we address the problem by establishing a novel analytical framework for evaluating the effects of rare or private variants on gene expression. Our method starts from the identification of outlier individuals that show markedly different gene expression from the majority of a population, and then reveals the contributions of private SNPs to the aberrant gene expression in these outliers. Using population-scale mRNA sequencing data, we identify outlier individuals using a multivariate approach. We find that outlier individuals are more readily detected with respect to gene sets that include genes involved in cellular regulation and signal transduction, and less likely to be detected with respect to the gene sets with genes involved in metabolic pathways and other fundamental molecular functions. Analysis of polymorphic data suggests that private SNPs of outlier individuals are enriched in the enhancer and promoter regions of corresponding aberrantly-expressed genes, suggesting a specific regulatory role of private SNPs, while the commonly-occurring regulatory genetic variants (i.e., eQTL SNPs) show little evidence of involvement. Additional data suggest that non-genetic factors may also underlie aberrant gene expression. Taken together, our findings advance a novel viewpoint relevant to situations wherein common eQTLs fail to predict gene expression when heritable, rare inter-individual variation exists. The analytical framework we describe, taking into consideration the reality of differential phenotypic robustness, may be valuable for investigating complex traits and conditions. PMID:25617623

  11. Cloning and expression profile of ionotropic receptors in the parasitoid wasp Microplitis mediator (Hymenoptera: Braconidae).

    PubMed

    Wang, Shan-Ning; Peng, Yong; Lu, Zi-Yun; Dhiloo, Khalid Hussain; Zheng, Yao; Shan, Shuang; Li, Rui-Jun; Zhang, Yong-Jun; Guo, Yu-Yuan

    2016-07-01

    Ionotropic receptors (IRs) mainly detect the acids and amines having great importance in many insect species, representing an ancient olfactory receptor family in insects. In the present work, we performed RNAseq of Microplitis mediator antennae and identified seventeen IRs. Full-length MmedIRs were cloned and sequenced. Phylogenetic analysis of the Hymenoptera IRs revealed that ten MmedIR genes encoded "antennal IRs" and seven encoded "divergent IRs". Among the IR25a orthologous groups, two genes, MmedIR25a.1 and MmedIR25a.2, were found in M. mediator. Gene structure analysis of MmedIR25a revealed a tandem duplication of IR25a in M. mediator. The tissue distribution and development specific expression of the MmedIR genes suggested that these genes showed a broad expression profile. Quantitative gene expression analysis showed that most of the genes are highly enriched in adult antennae, indicating the candidate chemosensory function of this family in parasitic wasps. Using immunocytochemistry, we confirmed that one co-receptor, MmedIR8a, was expressed in the olfactory sensory neurons. Our data will supply fundamental information for functional analysis of the IRs in parasitoid wasp chemoreception. Copyright © 2016 Elsevier Ltd. All rights reserved.

  12. Gene Expression Profile Analysis is Directly Affected by the Selected Reference Gene: The Case of Leaf-Cutting Atta Sexdens

    PubMed Central

    Máximo, Wesley P. F.; Zanetti, Ronald; Paiva, Luciano V.

    2018-01-01

    Although several ant species are important targets for the development of molecular control strategies, only a few studies focus on identifying and validating reference genes for quantitative reverse transcription polymerase chain reaction (RT-qPCR) data normalization. We provide here an extensive study to identify and validate suitable reference genes for gene expression analysis in the ant Atta sexdens, a threatening agricultural pest in South America. The optimal number of reference genes varies according to each sample and the result generated by RefFinder differed about which is the most suitable reference gene. Results suggest that the RPS16, NADH and SDHB genes were the best reference genes in the sample pool according to stability values. The SNF7 gene expression pattern was stable in all evaluated sample set. In contrast, when using less stable reference genes for normalization a large variability in SNF7 gene expression was recorded. There is no universal reference gene suitable for all conditions under analysis, since these genes can also participate in different cellular functions, thus requiring a systematic validation of possible reference genes for each specific condition. The choice of reference genes on SNF7 gene normalization confirmed that unstable reference genes might drastically change the expression profile analysis of target candidate genes. PMID:29419794

  13. B7-H3 expression and its correlation with clinicopathologic features, angiogenesis, and prognosis in intrahepatic cholangiocarcinoma.

    PubMed

    Cheng, Rui; Chen, Yongqin; Zhou, Haohui; Wang, Bi; Du, Qiang; Chen, Yanling

    2018-05-01

    This study was designed to explore the expression of B7-H3 in human intrahepatic cholangiocarcinoma (ICC) and its association with the clinicopathologic factors. In the current study, the expression of B7-H3 in 45 patients with intrahepatic cholangiocarcinoma and 8 patients with hepatolithiasis was analyzed by immunohistochemistry, which revealed that B7-H3 was not expressed in hepatolithiatic tissues, but positively expressed in 57.8% (26/45) of the ICC cases. The expression of B7-H3 was significantly associated with lymph node metastases and venous invasion. A positive correlation was also observed between the expression of B7-H3 and MVD, an index for tumor angiogenesis. Further survival analysis indicated that patients with B7-H3 negative expression had higher overall survival (OS) and cancer-specific survival (CSS) rates than those with B7-H3 positive expression. Multivariate analysis revealed that B7-H3 expression was an independent prognostic indicator for poor OS and CSS of ICC patients. Our results suggest that B7-H3 may be a valuable biomarker in determining tumor progression and prognosis of intrahepatic cholangiocarcinoma. It is also a potential target for antivascular therapy of ICC. © 2018 APMIS. Published by John Wiley & Sons Ltd.

  14. Integrating Genomic Analysis with the Genetic Basis of Gene Expression: Preliminary Evidence of the Identification of Causal Genes for Cardiovascular and Metabolic Traits Related to Nutrition in Mexicans123

    PubMed Central

    Bastarrachea, Raúl A.; Gallegos-Cabriales, Esther C.; Nava-González, Edna J.; Haack, Karin; Voruganti, V. Saroja; Charlesworth, Jac; Laviada-Molina, Hugo A.; Veloz-Garza, Rosa A.; Cardenas-Villarreal, Velia Margarita; Valdovinos-Chavez, Salvador B.; Gomez-Aguilar, Patricia; Meléndez, Guillermo; López-Alvarenga, Juan Carlos; Göring, Harald H. H.; Cole, Shelley A.; Blangero, John; Comuzzie, Anthony G.; Kent, Jack W.

    2012-01-01

    Whole-transcriptome expression profiling provides novel phenotypes for analysis of complex traits. Gene expression measurements reflect quantitative variation in transcript-specific messenger RNA levels and represent phenotypes lying close to the action of genes. Understanding the genetic basis of gene expression will provide insight into the processes that connect genotype to clinically significant traits representing a central tenet of system biology. Synchronous in vivo expression profiles of lymphocytes, muscle, and subcutaneous fat were obtained from healthy Mexican men. Most genes were expressed at detectable levels in multiple tissues, and RNA levels were correlated between tissue types. A subset of transcripts with high reliability of expression across tissues (estimated by intraclass correlation coefficients) was enriched for cis-regulated genes, suggesting that proximal sequence variants may influence expression similarly in different cellular environments. This integrative global gene expression profiling approach is proving extremely useful for identifying genes and pathways that contribute to complex clinical traits. Clearly, the coincidence of clinical trait quantitative trait loci and expression quantitative trait loci can help in the prioritization of positional candidate genes. Such data will be crucial for the formal integration of positional and transcriptomic information characterized as genetical genomics. PMID:22797999

  15. Analyzing gene expression from relative codon usage bias in Yeast genome: a statistical significance and biological relevance.

    PubMed

    Das, Shibsankar; Roymondal, Uttam; Sahoo, Satyabrata

    2009-08-15

    Based on the hypothesis that highly expressed genes are often characterized by strong compositional bias in terms of codon usage, there are a number of measures currently in use that quantify codon usage bias in genes, and hence provide numerical indices to predict the expression levels of genes. With the recent advent of expression measure from the score of the relative codon usage bias (RCBS), we have explicitly tested the performance of this numerical measure to predict the gene expression level and illustrate this with an analysis of Yeast genomes. In contradiction with previous other studies, we observe a weak correlations between GC content and RCBS, but a selective pressure on the codon preferences in highly expressed genes. The assertion that the expression of a given gene depends on the score of relative codon usage bias (RCBS) is supported by the data. We further observe a strong correlation between RCBS and protein length indicating natural selection in favour of shorter genes to be expressed at higher level. We also attempt a statistical analysis to assess the strength of relative codon bias in genes as a guide to their likely expression level, suggesting a decrease of the informational entropy in the highly expressed genes.

  16. Controlled hydrostatic pressure stress downregulates the expression of ribosomal genes in preimplantation embryos: a possible protection mechanism?

    PubMed

    Bock, I; Raveh-Amit, H; Losonczi, E; Carstea, A C; Feher, A; Mashayekhi, K; Matyas, S; Dinnyes, A; Pribenszky, C

    2016-04-01

    The efficiency of various assisted reproductive techniques can be improved by preconditioning the gametes and embryos with sublethal hydrostatic pressure treatment. However, the underlying molecular mechanism responsible for this protective effect remains unknown and requires further investigation. Here, we studied the effect of optimised hydrostatic pressure treatment on the global gene expression of mouse oocytes after embryonic genome activation. Based on a gene expression microarray analysis, a significant effect of treatment was observed in 4-cell embryos derived from treated oocytes, revealing a transcriptional footprint of hydrostatic pressure-affected genes. Functional analysis identified numerous genes involved in protein synthesis that were downregulated in 4-cell embryos in response to hydrostatic pressure treatment, suggesting that regulation of translation has a major role in optimised hydrostatic pressure-induced stress tolerance. We present a comprehensive microarray analysis and further delineate a potential mechanism responsible for the protective effect of hydrostatic pressure treatment.

  17. Cloning of rat MLH1 and expression analysis of MSH2, MSH3, MSH6, and MLH1 during spermatogenesis.

    PubMed

    Geeta Vani, R; Varghese, C M; Rao, M R

    1999-12-15

    The mismatch repair system has been highly conserved in various species. In eukaryotic cells, the Mut S and Mut L homologues play crucial roles in both DNA mismatch repair and meiotic recombination. A full-length rat cDNA clone for rat MLH1 has been constructed using the RT-PCR method. The cDNA has an open reading frame of 2274 nucleotides for a protein of 757 amino acids. We have also obtained partial cDNA clones for MSH3 and MSH6. Northern blot analysis of rat MLH1, MSH2, MSH3, and MSH6 in the testes of rats of different ages showed differential expression of these genes as a function of developmental maturation of the testes. The expression analysis suggests that MSH3 may have a more predominant role in the meiotic recombination process. Copyright 1999 Academic Press.

  18. Integrative analysis of RNA, translation, and protein levels reveals distinct regulatory variation across humans

    PubMed Central

    Cenik, Can; Cenik, Elif Sarinay; Byeon, Gun W.; Grubert, Fabian; Candille, Sophie I.; Spacek, Damek; Alsallakh, Bilal; Tilgner, Hagen; Araya, Carlos L.; Tang, Hua; Ricci, Emiliano; Snyder, Michael P.

    2015-01-01

    Elucidating the consequences of genetic differences between humans is essential for understanding phenotypic diversity and personalized medicine. Although variation in RNA levels, transcription factor binding, and chromatin have been explored, little is known about global variation in translation and its genetic determinants. We used ribosome profiling, RNA sequencing, and mass spectrometry to perform an integrated analysis in lymphoblastoid cell lines from a diverse group of individuals. We find significant differences in RNA, translation, and protein levels suggesting diverse mechanisms of personalized gene expression control. Combined analysis of RNA expression and ribosome occupancy improves the identification of individual protein level differences. Finally, we identify genetic differences that specifically modulate ribosome occupancy—many of these differences lie close to start codons and upstream ORFs. Our results reveal a new level of gene expression variation among humans and indicate that genetic variants can cause changes in protein levels through effects on translation. PMID:26297486

  19. Serum immunoreactivity of cancer/testis antigen OY-TES-1 and its tissues expression in glioma.

    PubMed

    Li, Xisheng; Yan, Jun; Fan, Rong; Luo, Bin; Zhang, Qingmei; Lin, Yongda; Zhou, Sufang; Luo, Guorong; Xie, Xiaoxun; Xiao, Shaowen

    2017-05-01

    OY-TES-1 is a member of the cancer/testis antigen family that is expressed in healthy testis tissue and certain types of cancerous tissue. The present study aimed to analyze the expression pattern of OY-TES-1 and serum anti-OY-TES-1 antibody concentration in patients with glioma. OY-TES-1 mRNA was detected in 28/36 (78%) of glioma cases using conventional reverse transcription polymerase chain reaction (RT-PCR) analysis. RT-quantitative-PCR revealed that OY-TES-1 was expressed at a higher level in glioma tissues compared with normal adult tissues (with the exception of testis tissue). Anti-OY-TES-1 antibodies were present in the serum of 5/36 (14%) of patients with glioma, but absent in all the serum samples from 107 healthy donors. Immunohistochemical analysis demonstrated that OY-TES-1 protein was expressed in all glioma tissues from patients with anti-OY-TES-1 antibody seropositivity. These results suggest that OY-TES-1 is a novel candidate for glioma immunotherapy.

  20. Expression of the glutamine metabolism-related proteins glutaminase 1 and glutamate dehydrogenase in canine mammary tumours.

    PubMed

    Ryu, J-E; Park, H-K; Choi, H-J; Lee, H-B; Lee, H-J; Lee, H; Yu, E-S; Son, W-C

    2018-06-01

    Glutamine metabolism is an important metabolic pathway for cancer cell survival, and there is a critical connection between tumour growth and glutamine metabolism. Because of their similarities, canine mammary carcinomas are useful for studying human breast cancer. Accordingly, we investigated the correlations between the expression of glutamine metabolism-related proteins and the pathological features of canine mammary tumours. We performed immunohistochemical and western blot analysis of 39 mammary tumour tissues. In immunohistochemical analysis, the expression of glutaminase 1 (GLS1) in the epithelial region increased according to the histological grade (P < .005). In the stromal region, complex-type tumours displayed significantly higher GLS1 intensity than simple-type tumours. However, glutamate dehydrogenase expression did not show the same tendencies as GLS1. The western blot results were consistent with the immunohistochemical findings. These results suggest that the expression of GLS1 is correlates with clinicopathological factors in canine mammary tumours and shows a similar pattern to human breast cancer. © 2017 John Wiley & Sons Ltd.

  1. Gene expression analysis of mouse embryonic stem cells following levitation in an ultrasound standing wave trap.

    PubMed

    Bazou, Despina; Kearney, Roisin; Mansergh, Fiona; Bourdon, Celine; Farrar, Jane; Wride, Michael

    2011-02-01

    In the present paper, gene expression analysis of mouse embryonic stem (ES) cells levitated in a novel ultrasound standing wave trap (USWT) (Bazou et al. 2005a) at variable acoustic pressures (0.08-0.85 MPa) and times (5-60 min) was performed. Our results showed that levitation of ES cells at the highest employed acoustic pressure for 60 min does not modify gene expression and cells maintain their pluripotency. Embryoid bodies (EBs) also expressed the early and late neural differentiation markers, which were also unaffected by the acoustic field. Our results suggest that the ultrasound trap microenvironment is minimally invasive as the biologic consequences of ES cell replication and EB differentiation proceed without significantly affecting gene expression. The technique holds great promise in safe cell manipulation techniques for a variety of applications including tissue engineering and regenerative medicine. Copyright © 2011 World Federation for Ultrasound in Medicine & Biology. Published by Elsevier Inc. All rights reserved.

  2. Biochemical and Expression Analyses of the Rice Cinnamoyl-CoA Reductase Gene Family.

    PubMed

    Park, Hye Lin; Bhoo, Seong Hee; Kwon, Mi; Lee, Sang-Won; Cho, Man-Ho

    2017-01-01

    Cinnamoyl-CoA reductase (CCR) is the first committed enzyme in the monolignol pathway for lignin biosynthesis and catalyzes the conversion of hydroxycinnamoyl-CoAs into hydroxycinnamaldehydes. In the rice genome, 33 genes are annotated as CCR and CCR-like genes, collectively called OsCCR s. To elucidate the functions of OsCCR s, their phylogenetic relationships, expression patterns at the transcription levels and biochemical characteristics were thoroughly analyzed. Of the 33 OsCCR s, 24 of them encoded polypeptides of lengths similar to those of previously identified plant CCRs. The other nine OsCCRs had much shorter peptide lengths. Phylogenetic tree and sequence similarities suggested OsCCR4, 5, 17, 18, 19, 20, and 21 as likely candidates for functional CCRs in rice. To elucidate biochemical functions, OsCCR1, 5, 17, 19, 20, 21, and 26 were heterologously expressed in Escherichia coli and the resulting recombinant OsCCRs were purified to apparent homogeneity. Activity assays of the recombinant OsCCRs with hydroxycinnamoyl-CoAs revealed that OsCCR17, 19, 20, and 21 were biochemically active CCRs, in which the NAD(P)-binding and NADP-specificity motifs as well as the CCR signature motif were fully conserved. The kinetic parameters of enzyme reactions revealed that feruloyl-CoA, a precursor for the guaiacyl (G)-unit of lignin, is the most preferred substrate of OsCCR20 and 21. This result is consistent with a high content (about 70%) of G-units in rice lignins. Phylogenetic analysis revealed that OsCCR19 and 20 were grouped with other plant CCRs involved in developmental lignification, whereas OsCCR17 and 21 were closely related to stress-responsible CCRs identified from other plant species. In agreement with the phylogenetic analysis, expression analysis demonstrated that OsCCR20 was constitutively expressed throughout the developmental stages of rice, showing particularly high expression levels in actively lignifying tissues, such as roots and stems. These results suggest that OsCCR20 is primarily involved in developmental deposition of lignins in secondary cell walls. As expected, the expressions of OsCCR17 and 21 were induced in response to biotic and abiotic stresses, such as Magnaporthe grisea and Xanthomonas oryzae pv. oryzae ( Xoo ) infections, UV-irradiation and high salinity, suggesting that these genes play a role in defense-related processes in rice.

  3. A Model-Based Analysis of Chemical and Temporal Patterns of Cuticular Hydrocarbons in Male Drosophila melanogaster

    PubMed Central

    Kent, Clement; Azanchi, Reza; Smith, Ben; Chu, Adrienne; Levine, Joel

    2007-01-01

    Drosophila Cuticular Hydrocarbons (CH) influence courtship behaviour, mating, aggregation, oviposition, and resistance to desiccation. We measured levels of 24 different CH compounds of individual male D. melanogaster hourly under a variety of environmental (LD/DD) conditions. Using a model-based analysis of CH variation, we developed an improved normalization method for CH data, and show that CH compounds have reproducible cyclic within-day temporal patterns of expression which differ between LD and DD conditions. Multivariate clustering of expression patterns identified 5 clusters of co-expressed compounds with common chemical characteristics. Turnover rate estimates suggest CH production may be a significant metabolic cost. Male cuticular hydrocarbon expression is a dynamic trait influenced by light and time of day; since abundant hydrocarbons affect male sexual behavior, males may present different pheromonal profiles at different times and under different conditions. PMID:17896002

  4. Better Prognosis of Patients with Glioma Expressing FGF2-Dependent PDGFRA Irrespective of Morphological Diagnosis

    PubMed Central

    Chen, Dongfeng; Persson, Annette; Sun, Yingyu; Salford, Leif G.; Nord, David Gisselsson; Englund, Elisabet; Jiang, Tao; Fan, Xiaolong

    2013-01-01

    Signaling of platelet derived growth factor receptor alpha (PDGFRA) is critically involved in the development of gliomas. However, the clinical relevance of PDGFRA expression in glioma subtypes and the mechanisms of PDGFRA expression in gliomas have been controversial. Under the supervision of morphological diagnosis, analysis of the GSE16011 and the Repository of Molecular Brain Neoplasia Data (Rembrandt) set revealed enriched PDGFRA expression in low-grade gliomas. However, gliomas with the top 25% of PDGFRA expression levels contained nearly all morphological subtypes, which was associated with frequent IDH1 mutation, 1p LOH, 19q LOH, less EGFR amplification, younger age at disease onset and better survival compared to those gliomas with lower levels of PDGFRA expression. SNP analysis in Rembrandt data set and FISH analysis in eleven low passage glioma cell lines showed infrequent amplification of PDGFRA. Using in vitro culture of these low passage glioma cells, we tested the hypothesis of gliogenic factor dependent expression of PDGFRA in glioma cells. Fibroblast growth factor 2 (FGF2) was able to maintain PDGFRA expression in glioma cells. FGF2 also induced PDGFRA expression in glioma cells with low or non-detectable PDGFRA expression. FGF2-dependent maintenance of PDGFRA expression was concordant with the maintenance of a subset of gliogenic genes and higher rates of cell proliferation. Further, concordant expression patterns of FGF2 and PDGFRA were detected in glioma samples by immunohistochemical staining. Our findings suggest a role of FGF2 in regulating PDGFRA expression in the subset of gliomas with younger age at disease onset and longer patient survival regardless of their morphological diagnosis. PMID:23630597

  5. The aquaglyceroporin AQP9 contributes to the sex-specific effects of in utero arsenic exposure on placental gene expression.

    PubMed

    Winterbottom, Emily F; Koestler, Devin C; Fei, Dennis Liang; Wika, Eric; Capobianco, Anthony J; Marsit, Carmen J; Karagas, Margaret R; Robbins, David J

    2017-06-14

    Sex-specific factors play a major role in human health and disease, including responses to environmental stresses such as toxicant exposure. Increasing evidence suggests that such sex differences also exist during fetal development. In a previous report using the resources of the New Hampshire Birth Cohort Study (NHBCS), we found that low-to-moderate in utero exposure to arsenic, a highly toxic and widespread pollutant, was associated with altered expression of several key developmental genes in the fetal portion of the placenta. These associations were sex-dependent, suggesting that in utero arsenic exposure differentially impacts male and female fetuses. In the present study, we investigated the molecular basis for these sex-specific responses to arsenic. Using NanoString technology, we further analyzed the fetal placenta samples from the NHBCS for the expression of genes encoding arsenic transporters and metabolic enzymes. Multivariable linear regression analysis was used to examine their relationship with arsenic exposure and with key developmental genes, after stratification by fetal sex. We found that maternal arsenic exposure was strongly associated with expression of the AQP9 gene, encoding an aquaglyceroporin transporter, in female but not male fetal placenta. Moreover, AQP9 expression associated with that of a subset of female-specific arsenic-responsive genes. Our results suggest that AQP9 is upregulated in response to arsenic exposure in female, but not male, fetal placenta. Based on these results and prior studies, increased AQP9 expression may lead to increased arsenic transport in the female fetal placenta, which in turn may alter the expression patterns of key developmental genes that we have previously shown to be associated with arsenic exposure. Thus, this study suggests that AQP9 may play a role in the sex-specific effects of in utero arsenic exposure.

  6. Targeted Deletion and Lipidomic Analysis Identify Epithelial Cell COX-2 as a Major Driver of Chemically-induced Skin Cancer

    PubMed Central

    Jiao, Jing; Ishikawa, Tomo-o; Dumlao, Darren S.; Norris, Paul C.; Magyar, Clara E.; Mikulec, Carol; Catapang, Art; Dennis, Edward A.; Fischer, Susan M.; Herschman, Harvey R.

    2014-01-01

    Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX2) plays a critical role in DMBA/TPA-induced skin tumor induction. While many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell-type specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared to littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2 expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell-type specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biological responses. PMID:25063587

  7. Modeling antibiotic and cytotoxic effects of the dimeric isoquinoline IQ-143 on metabolism and its regulation in Staphylococcus aureus, Staphylococcus epidermidis and human cells

    PubMed Central

    2011-01-01

    Background Xenobiotics represent an environmental stress and as such are a source for antibiotics, including the isoquinoline (IQ) compound IQ-143. Here, we demonstrate the utility of complementary analysis of both host and pathogen datasets in assessing bacterial adaptation to IQ-143, a synthetic analog of the novel type N,C-coupled naphthyl-isoquinoline alkaloid ancisheynine. Results Metabolite measurements, gene expression data and functional assays were combined with metabolic modeling to assess the effects of IQ-143 on Staphylococcus aureus, Staphylococcus epidermidis and human cell lines, as a potential paradigm for novel antibiotics. Genome annotation and PCR validation identified novel enzymes in the primary metabolism of staphylococci. Gene expression response analysis and metabolic modeling demonstrated the adaptation of enzymes to IQ-143, including those not affected by significant gene expression changes. At lower concentrations, IQ-143 was bacteriostatic, and at higher concentrations bactericidal, while the analysis suggested that the mode of action was a direct interference in nucleotide and energy metabolism. Experiments in human cell lines supported the conclusions from pathway modeling and found that IQ-143 had low cytotoxicity. Conclusions The data suggest that IQ-143 is a promising lead compound for antibiotic therapy against staphylococci. The combination of gene expression and metabolite analyses with in silico modeling of metabolite pathways allowed us to study metabolic adaptations in detail and can be used for the evaluation of metabolic effects of other xenobiotics. PMID:21418624

  8. Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development

    PubMed Central

    Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C.; Zhang, Baohong

    2016-01-01

    TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development. PMID:26857372

  9. Comprehensive analysis of TCP transcription factors and their expression during cotton (Gossypium arboreum) fiber early development.

    PubMed

    Ma, Jun; Liu, Fang; Wang, Qinglian; Wang, Kunbo; Jones, Don C; Zhang, Baohong

    2016-02-09

    TCP proteins are plant-specific transcription factors implicated to perform a variety of physiological functions during plant growth and development. In the current study, we performed for the first time the comprehensive analysis of TCP gene family in a diploid cotton species, Gossypium arboreum, including phylogenetic analysis, chromosome location, gene duplication status, gene structure and conserved motif analysis, as well as expression profiles in fiber at different developmental stages. Our results showed that G. arboreum contains 36 TCP genes, distributing across all of the thirteen chromosomes. GaTCPs within the same subclade of the phylogenetic tree shared similar exon/intron organization and motif composition. In addition, both segmental duplication and whole-genome duplication contributed significantly to the expansion of GaTCPs. Many these TCP transcription factor genes are specifically expressed in cotton fiber during different developmental stages, including cotton fiber initiation and early development. This suggests that TCP genes may play important roles in cotton fiber development.

  10. Role of Adrenal Glucocorticoid Signaling in Prefrontal Cortex Gene Expression and Acute Behavioral Responses to Ethanol

    PubMed Central

    Costin, Blair N.; Wolen, Aaron R.; Fitting, Sylvia; Shelton, Keith L.; Miles, Michael F.

    2012-01-01

    Background Glucocorticoid hormones modulate acute and chronic behavioral and molecular responses to drugs of abuse including psychostimulants and opioids. There is growing evidence that glucocorticoids might also modulate behavioral responses to ethanol. Acute ethanol activates the HPA axis, causing release of adrenal glucocorticoid hormones. Our prior genomic studies suggest glucocorticoids play a role in regulating gene expression in the prefrontal cortex (PFC) of DBA2/J (D2) mice following acute ethanol administration. However, few studies have analyzed the role of glucocorticoid signaling in behavioral responses to acute ethanol. Such work could be significant, given the predictive value for level of response to acute ethanol in the risk for alcoholism. Methods We studied whether the glucocorticoid receptor (GR) antagonist, RU-486, or adrenalectomy (ADX) altered male D2 mouse behavioral responses to acute (locomotor activation, anxiolysis or loss-of-righting reflex (LORR)) or repeated (sensitization) ethanol treatment. Whole genome microarray analysis and bioinformatics approaches were used to identify PFC candidate genes possibly responsible for altered behavioral responses to ethanol following ADX. Results ADX and RU-486 both impaired acute ethanol (2 g/kg) induced locomotor activation in D2 mice without affecting basal locomotor activity. However, neither ADX nor RU-486 altered initiation of ethanol sensitization (locomotor activation or jump counts), ethanol-induced anxiolysis or LORR. ADX mice showed microarray gene expression changes in PFC that significantly overlapped with acute ethanol-responsive gene sets derived by our prior microarray studies. Q-rtPCR analysis verified that ADX decreased PFC expression of Fkbp5 while significantly increasing Gpr6 expression. In addition, high dose RU-486 pre-treatment blunted ethanol-induced Fkbp5 expression. Conclusions Our studies suggest that ethanol’s activation of adrenal glucocorticoid release and subsequent GR activation may partially modulate ethanol’s acute locomotor activation in male D2 mice. Furthermore, since adrenal glucocorticoid basal tone regulated PFC gene expression, including a significant set of acute ethanol-responsive genes, this suggests that glucocorticoid regulated PFC gene expression may be an important factor modulating acute behavioral responses to ethanol. PMID:22671426

  11. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine

    PubMed Central

    Bradford, Emily M; Vairamani, Kanimozhi; Shull, Gary E

    2016-01-01

    AIM: To investigate the intestinal functions of the NKCC1 Na+-K+-2Cl cotransporter (SLC12a2 gene), differential mRNA expression changes in NKCC1-null intestine were analyzed. METHODS: Microarray analysis of mRNA from intestines of adult wild-type mice and gene-targeted NKCC1-null mice (n = 6 of each genotype) was performed to identify patterns of differential gene expression changes. Differential expression patterns were further examined by Gene Ontology analysis using the online Gorilla program, and expression changes of selected genes were verified using northern blot analysis and quantitative real time-polymerase chain reaction. Histological staining and immunofluorescence were performed to identify cell types in which upregulated pancreatic digestive enzymes were expressed. RESULTS: Genes typically associated with pancreatic function were upregulated. These included lipase, amylase, elastase, and serine proteases indicative of pancreatic exocrine function, as well as insulin and regenerating islet genes, representative of endocrine function. Northern blot analysis and immunohistochemistry showed that differential expression of exocrine pancreas mRNAs was specific to the duodenum and localized to a subset of goblet cells. In addition, a major pattern of changes involving differential expression of olfactory receptors that function in chemical sensing, as well as other chemosensing G-protein coupled receptors, was observed. These changes in chemosensory receptor expression may be related to the failure of intestinal function and dependency on parenteral nutrition observed in humans with SLC12a2 mutations. CONCLUSION: The results suggest that loss of NKCC1 affects not only secretion, but also goblet cell function and chemosensing of intestinal contents via G-protein coupled chemosensory receptors. PMID:26909237

  12. Differential expression analysis of genes involved in high-temperature induced sex differentiation in Nile tilapia.

    PubMed

    Li, Chun Ge; Wang, Hui; Chen, Hong Ju; Zhao, Yan; Fu, Pei Sheng; Ji, Xiang Shan

    2014-01-01

    Nowadays, high temperature effects on the molecular pathways during sex differentiation in teleosts need to be deciphered. In this study, a systematic differential expression analysis of genes involved in high temperature-induced sex differentiation was done in the Nile tilapia gonad and brain. Our results showed that high temperature caused significant down-regulation of CYP19A1A in the gonad of both sexes in induction group, and FOXL2 in the ovary of the induction group. The expressions of GTHα, LHβ and ERα were also significantly down-regulated in the brain of both sexes in the induction and recovery groups. On the contrary, the expression of CYP11B2 was significantly up-regulated in the ovary, but not in the testis in both groups. Spearman rank correlation analysis showed that there are significant correlations between the expressions of CYP19A1A, FOXL2, or DMRT1 in the gonads and the expression of some genes in the brain. Another result in this study showed that high temperature up-regulated the expression level of DNMT1 in the testis of the induction group, and DNMT1 and DNMT3A in the female brain of both groups. The expression and correlation analysis of HSPs showed that high temperature action on tilapia HSPs might indirectly induce the expression changes of sex differentiation genes in the gonads. These findings provide new insights on TSD and suggest that sex differentiation related genes, heat shock proteins, and DNA methylation genes are new candidates for studying TSD in fish species. Copyright © 2014 Elsevier Inc. All rights reserved.

  13. Co-expression of midkine and pleiotrophin predicts poor survival in human glioma.

    PubMed

    Ma, Jinyang; Lang, Bojuan; Wang, Xiongwei; Wang, Lei; Dong, Yuanxun; Hu, Huojun

    2014-11-01

    The aim of this study was to investigate whether co-expression of midkine (MK) and pleiotrophin (PTN) has prognostic relevance in human gliomas. Immunohistochemistry was used to investigate the expression of MK and PTN proteins in 168 patients with gliomas. The levels of MK and PTN mRNA in glioma tissues and paratumor tissues were evaluated in 45 paired cases by quantitative real-time polymerase chain reaction (qRT-PCR). Kaplan-Meier survival analysis was performed to assess prognostic significance. The expression levels of MK and PTN proteins in glioma tissue were both significantly higher (both p<0.001) than those in paratumor tissues on immunohistochemistry analysis, which was confirmed by qRT-PCR analysis. Additionally, the overexpression of either MK or PTN was significantly associated with the World Health Organization Grade (p=0.001 and 0.034, respectively), low Karnofsky Performance Status (KPS) score (p=0.022 and 0.001, respectively), time to recurrence (p=0.043 and 0.011, respectively) and poor overall survival (p=0.018 and 0.001, respectively). Multivariate Cox proportional-hazards regression analysis revealed that increased expressions of MK and PTN were both independent prognostic factors for poor overall survival (p=0.030 and 0.022, respectively). Furthermore, the co-expression of MK and PTN was more significantly (p=0.003) associated with adverse prognosis in patients with gliomas than the respective expression of MK or PTN alone. To our knowledge, these findings are the first to indicate that the co-expression of MK and PTN is significantly correlated with prognosis in glioma patients, suggesting that the co-expression of these proteins may be used as both an early diagnostic and independent prognostic marker. Copyright © 2014 Elsevier Ltd. All rights reserved.

  14. Large-scale transcriptome analysis reveals arabidopsis metabolic pathways are frequently influenced by different pathogens.

    PubMed

    Jiang, Zhenhong; He, Fei; Zhang, Ziding

    2017-07-01

    Through large-scale transcriptional data analyses, we highlighted the importance of plant metabolism in plant immunity and identified 26 metabolic pathways that were frequently influenced by the infection of 14 different pathogens. Reprogramming of plant metabolism is a common phenomenon in plant defense responses. Currently, a large number of transcriptional profiles of infected tissues in Arabidopsis (Arabidopsis thaliana) have been deposited in public databases, which provides a great opportunity to understand the expression patterns of metabolic pathways during plant defense responses at the systems level. Here, we performed a large-scale transcriptome analysis based on 135 previously published expression samples, including 14 different pathogens, to explore the expression pattern of Arabidopsis metabolic pathways. Overall, metabolic genes are significantly changed in expression during plant defense responses. Upregulated metabolic genes are enriched on defense responses, and downregulated genes are enriched on photosynthesis, fatty acid and lipid metabolic processes. Gene set enrichment analysis (GSEA) identifies 26 frequently differentially expressed metabolic pathways (FreDE_Paths) that are differentially expressed in more than 60% of infected samples. These pathways are involved in the generation of energy, fatty acid and lipid metabolism as well as secondary metabolite biosynthesis. Clustering analysis based on the expression levels of these 26 metabolic pathways clearly distinguishes infected and control samples, further suggesting the importance of these metabolic pathways in plant defense responses. By comparing with FreDE_Paths from abiotic stresses, we find that the expression patterns of 26 FreDE_Paths from biotic stresses are more consistent across different infected samples. By investigating the expression correlation between transcriptional factors (TFs) and FreDE_Paths, we identify several notable relationships. Collectively, the current study will deepen our understanding of plant metabolism in plant immunity and provide new insights into disease-resistant crop improvement.

  15. In Planta Stage-Specific Fungal Gene Profiling Elucidates the Molecular Strategies of Fusarium graminearum Growing inside Wheat Coleoptiles[W][OA

    PubMed Central

    Zhang, Xiao-Wei; Jia, Lei-Jie; Zhang, Yan; Jiang, Gang; Li, Xuan; Zhang, Dong; Tang, Wei-Hua

    2012-01-01

    The ascomycete Fusarium graminearum is a destructive fungal pathogen of wheat (Triticum aestivum). To better understand how this pathogen proliferates within the host plant, we tracked pathogen growth inside wheat coleoptiles and then examined pathogen gene expression inside wheat coleoptiles at 16, 40, and 64 h after inoculation (HAI) using laser capture microdissection and microarray analysis. We identified 344 genes that were preferentially expressed during invasive growth in planta. Gene expression profiles for 134 putative plant cell wall–degrading enzyme genes suggest that there was limited cell wall degradation at 16 HAI and extensive degradation at 64 HAI. Expression profiles for genes encoding reactive oxygen species (ROS)–related enzymes suggest that F. graminearum primarily scavenges extracellular ROS before a later burst of extracellular ROS is produced by F. graminearum enzymes. Expression patterns of genes involved in primary metabolic pathways suggest that F. graminearum relies on the glyoxylate cycle at an early stage of plant infection. A secondary metabolite biosynthesis gene cluster was specifically induced at 64 HAI and was required for virulence. Our results indicate that F. graminearum initiates infection of coleoptiles using covert penetration strategies and switches to overt cellular destruction of tissues at an advanced stage of infection. PMID:23266949

  16. Rrp1b, a New Candidate Susceptibility Gene for Breast Cancer Progression and Metastasis

    PubMed Central

    Crawford, Nigel P. S; Qian, Xiaolan; Ziogas, Argyrios; Papageorge, Alex G; Boersma, Brenda J; Walker, Renard C; Lukes, Luanne; Rowe, William L; Zhang, Jinghui; Ambs, Stefan; Lowy, Douglas R; Anton-Culver, Hoda; Hunter, Kent W

    2007-01-01

    A novel candidate metastasis modifier, ribosomal RNA processing 1 homolog B (Rrp1b), was identified through two independent approaches. First, yeast two-hybrid, immunoprecipitation, and functional assays demonstrated a physical and functional interaction between Rrp1b and the previous identified metastasis modifier Sipa1. In parallel, using mouse and human metastasis gene expression data it was observed that extracellular matrix (ECM) genes are common components of metastasis predictive signatures, suggesting that ECM genes are either important markers or causal factors in metastasis. To investigate the relationship between ECM genes and poor prognosis in breast cancer, expression quantitative trait locus analysis of polyoma middle-T transgene-induced mammary tumor was performed. ECM gene expression was found to be consistently associated with Rrp1b expression. In vitro expression of Rrp1b significantly altered ECM gene expression, tumor growth, and dissemination in metastasis assays. Furthermore, a gene signature induced by ectopic expression of Rrp1b in tumor cells predicted survival in a human breast cancer gene expression dataset. Finally, constitutional polymorphism within RRP1B was found to be significantly associated with tumor progression in two independent breast cancer cohorts. These data suggest that RRP1B may be a novel susceptibility gene for breast cancer progression and metastasis. PMID:18081427

  17. The Brassicaceae Family Displays Divergent, Shoot-Skewed NLR Resistance Gene Expression.

    PubMed

    Munch, David; Gupta, Vikas; Bachmann, Asger; Busch, Wolfgang; Kelly, Simon; Mun, Terry; Andersen, Stig Uggerhøj

    2018-02-01

    Nucleotide-binding site leucine-rich repeat resistance genes (NLRs) allow plants to detect microbial effectors. We hypothesized that NLR expression patterns could reflect organ-specific differences in effector challenge and tested this by carrying out a meta-analysis of expression data for 1,235 NLRs from nine plant species. We found stable NLR root/shoot expression ratios within species, suggesting organ-specific hardwiring of NLR expression patterns in anticipation of distinct challenges. Most monocot and dicot plant species preferentially expressed NLRs in roots. In contrast, Brassicaceae species, including oilseed rape ( Brassica napus ) and the model plant Arabidopsis ( Arabidopsis thaliana ), were unique in showing NLR expression skewed toward the shoot across multiple phylogenetically distinct groups of NLRs. The Brassicaceae are also outliers in the sense that they have lost the common symbiosis signaling pathway, which enables intracellular infection by root symbionts. While it is unclear if these two events are related, the NLR expression shift identified here suggests that the Brassicaceae may have evolved unique pattern-recognition receptors and antimicrobial root metabolites to substitute for NLR protection. Such innovations in root protection could potentially be exploited in crop rotation schemes or for enhancing root defense systems of non-Brassicaceae crops. © 2018 American Society of Plant Biologists. All Rights Reserved.

  18. Genome-wide identification of conserved intronic non-coding sequences using a Bayesian segmentation approach.

    PubMed

    Algama, Manjula; Tasker, Edward; Williams, Caitlin; Parslow, Adam C; Bryson-Richardson, Robert J; Keith, Jonathan M

    2017-03-27

    Computational identification of non-coding RNAs (ncRNAs) is a challenging problem. We describe a genome-wide analysis using Bayesian segmentation to identify intronic elements highly conserved between three evolutionarily distant vertebrate species: human, mouse and zebrafish. We investigate the extent to which these elements include ncRNAs (or conserved domains of ncRNAs) and regulatory sequences. We identified 655 deeply conserved intronic sequences in a genome-wide analysis. We also performed a pathway-focussed analysis on genes involved in muscle development, detecting 27 intronic elements, of which 22 were not detected in the genome-wide analysis. At least 87% of the genome-wide and 70% of the pathway-focussed elements have existing annotations indicative of conserved RNA secondary structure. The expression of 26 of the pathway-focused elements was examined using RT-PCR, providing confirmation that they include expressed ncRNAs. Consistent with previous studies, these elements are significantly over-represented in the introns of transcription factors. This study demonstrates a novel, highly effective, Bayesian approach to identifying conserved non-coding sequences. Our results complement previous findings that these sequences are enriched in transcription factors. However, in contrast to previous studies which suggest the majority of conserved sequences are regulatory factor binding sites, the majority of conserved sequences identified using our approach contain evidence of conserved RNA secondary structures, and our laboratory results suggest most are expressed. Functional roles at DNA and RNA levels are not mutually exclusive, and many of our elements possess evidence of both. Moreover, ncRNAs play roles in transcriptional and post-transcriptional regulation, and this may contribute to the over-representation of these elements in introns of transcription factors. We attribute the higher sensitivity of the pathway-focussed analysis compared to the genome-wide analysis to improved alignment quality, suggesting that enhanced genomic alignments may reveal many more conserved intronic sequences.

  19. In situ aromatase expression in primary tumor is associated with estrogen receptor expression but is not predictive of response to endocrine therapy in advanced breast cancer

    PubMed Central

    2009-01-01

    Background New, third-generation aromatase inhibitors (AIs) have proven comparable or superior to the anti-estrogen tamoxifen for treatment of estrogen receptor (ER) and/or progesterone receptor (PR) positive breast cancer. AIs suppress total body and intratumoral estrogen levels. It is unclear whether in situ carcinoma cell aromatization is the primary source of estrogen production for tumor growth and whether the aromatase expression is predictive of response to endocrine therapy. Due to methodological difficulties in the determination of the aromatase protein, COX-2, an enzyme involved in the synthesis of aromatase, has been suggested as a surrogate marker for aromatase expression. Methods Primary tumor material was retrospectively collected from 88 patients who participated in a randomized clinical trial comparing the AI letrozole to the anti-estrogen tamoxifen for first-line treatment of advanced breast cancer. Semi-quantitative immunohistochemical (IHC) analysis was performed for ER, PR, COX-2 and aromatase using Tissue Microarrays (TMAs). Aromatase was also analyzed using whole sections (WS). Kappa analysis was applied to compare association of protein expression levels. Univariate Wilcoxon analysis and the Cox-analysis were performed to evaluate time to progression (TTP) in relation to marker expression. Results Aromatase expression was associated with ER, but not with PR or COX-2 expression in carcinoma cells. Measurements of aromatase in WS were not comparable to results from TMAs. Expression of COX-2 and aromatase did not predict response to endocrine therapy. Aromatase in combination with high PR expression may select letrozole treated patients with a longer TTP. Conclusion TMAs are not suitable for IHC analysis of in situ aromatase expression and we did not find COX-2 expression in carcinoma cells to be a surrogate marker for aromatase. In situ aromatase expression in tumor cells is associated with ER expression and may thus point towards good prognosis. Aromatase expression in cancer cells is not predictive of response to endocrine therapy, indicating that in situ estrogen synthesis may not be the major source of intratumoral estrogen. However, aromatase expression in combination with high PR expression may select letrozole treated patients with longer TTP. Trial registration Sub-study of trial P025 for advanced breast cancer. PMID:19531212

  20. Nesprin-2 epsilon: A novel nesprin isoform expressed in human ovary and Ntera-2 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lam, Le Thanh; Boehm, Sabrina V.; Roberts, Roland G.

    2011-08-26

    Highlights: {yields} A novel epsilon isoform of nesprin-2 has been discovered. {yields} This 120 kDa protein was predicted by bioinformatic analysis, but has not previously been observed. {yields} It is the main isoform expressed in a teratocarcinoma cell line and is also found in ovary. {yields} Like other nesprins, it is located at the nuclear envelope. {yields} We suggest it may have a role in very early development or in some ovary-specific function. -- Abstract: The nuclear envelope-associated cytoskeletal protein, nesprin-2, is encoded by a large gene containing several internal promoters that produce shorter isoforms. In a study of Ntera-2more » teratocarcinoma cells, a novel isoform, nesprin-2-epsilon, was found to be the major mRNA and protein product of the nesprin-2 gene. Its existence was predicted by bioinformatic analysis, but this is the first direct demonstration of both the mRNA and the 120 kDa protein which is located at the nuclear envelope. In a panel of 21 adult and foetal human tissues, the nesprin-2-epsilon mRNA was strongly expressed in ovary but was a minor isoform elsewhere. The expression pattern suggests a possible link with very early development and a likely physiological role in ovary.« less

  1. The mature anther-preferentially expressed genes are associated with pollen fertility, pollen germination and anther dehiscence in rice.

    PubMed

    Ling, Sheng; Chen, Caisheng; Wang, Yang; Sun, Xiaocong; Lu, Zhanhua; Ouyang, Yidan; Yao, Jialing

    2015-02-19

    The anthers and pollen grains are critical for male fertility and hybrid rice breeding. The development of rice mature anther and pollen consists of multiple continuous stages. However, molecular mechanisms regulating mature anther development were poorly understood. In this study, we have identified 291 mature anther-preferentially expressed genes (OsSTA) in rice based on Affymetrix microarray data. Gene Ontology (GO) analysis indicated that OsSTA genes mainly participated in metabolic and cellular processes that are likely important for rice anther and pollen development. The expression patterns of OsSTA genes were validated using real-time PCR and mRNA in situ hybridizations. Cis-element identification showed that most of the OsSTA genes had the cis-elements responsive to phytohormone regulation. Co-expression analysis of OsSTA genes showed that genes annotated with pectinesterase and calcium ion binding activities were rich in the network, suggesting that OsSTA genes could be involved in pollen germination and anther dehiscence. Furthermore, OsSTA RNAi transgenic lines showed male-sterility and pollen germination defects. The results suggested that OsSTA genes function in rice male fertility, pollen germination and anther dehiscence and established molecular regulating networks that lay the foundation for further functional studies.

  2. Global gene expression profiling of oral cavity cancers suggests molecular heterogeneity within anatomic subsites

    PubMed Central

    Severino, Patricia; Alvares, Adriana M; Michaluart, Pedro; Okamoto, Oswaldo K; Nunes, Fabio D; Moreira-Filho, Carlos A; Tajara, Eloiza H

    2008-01-01

    Background Oral squamous cell carcinoma (OSCC) is a frequent neoplasm, which is usually aggressive and has unpredictable biological behavior and unfavorable prognosis. The comprehension of the molecular basis of this variability should lead to the development of targeted therapies as well as to improvements in specificity and sensitivity of diagnosis. Results Samples of primary OSCCs and their corresponding surgical margins were obtained from male patients during surgery and their gene expression profiles were screened using whole-genome microarray technology. Hierarchical clustering and Principal Components Analysis were used for data visualization and One-way Analysis of Variance was used to identify differentially expressed genes. Samples clustered mostly according to disease subsite, suggesting molecular heterogeneity within tumor stages. In order to corroborate our results, two publicly available datasets of microarray experiments were assessed. We found significant molecular differences between OSCC anatomic subsites concerning groups of genes presently or potentially important for drug development, including mRNA processing, cytoskeleton organization and biogenesis, metabolic process, cell cycle and apoptosis. Conclusion Our results corroborate literature data on molecular heterogeneity of OSCCs. Differences between disease subsites and among samples belonging to the same TNM class highlight the importance of gene expression-based classification and challenge the development of targeted therapies. PMID:19014556

  3. Identification of membrane-associated proteins with pathogenic potential expressed by Corynebacterium pseudotuberculosis grown in animal serum.

    PubMed

    Raynal, José Tadeu; Bastos, Bruno Lopes; Vilas-Boas, Priscilla Carolinne Bagano; Sousa, Thiago de Jesus; Costa-Silva, Marcos; de Sá, Maria da Conceição Aquino; Portela, Ricardo Wagner; Moura-Costa, Lília Ferreira; Azevedo, Vasco; Meyer, Roberto

    2018-01-25

    Previous works defining antigens that might be used as vaccine targets against Corynebacterium pseudotuberculosis, which is the causative agent of sheep and goat caseous lymphadenitis, have focused on secreted proteins produced in a chemically defined culture media. Considering that such antigens might not reflect the repertoire of proteins expressed during infection conditions, this experiment aimed to investigate the membrane-associated proteins with pathogenic potential expressed by C. pseudotuberculosis grown directly in animal serum. Its membrane-associated proteins have been extracted using an organic solvent enrichment methodology, followed by LC-MS/MS and bioinformatics analysis for protein identification and classification. The results revealed 22 membrane-associated proteins characterized as potentially pathogenic. An interaction network analysis indicated that the four potentially pathogenic proteins ciuA, fagA, OppA4 and OppCD were biologically connected within two distinct network pathways, which were both associated with the ABC Transporters KEGG pathway. These results suggest that C. pseudotuberculosis pathogenesis might be associated with the transport and uptake of nutrients; other seven identified potentially pathogenic membrane proteins also suggest that pathogenesis might involve events of bacterial resistance and adhesion. The proteins herein reported potentially reflect part of the protein repertoire expressed during real infection conditions and might be tested as vaccine antigens.

  4. Epigenetic regulation of APC in the molecular pathogenesis of gallbladder cancer.

    PubMed

    Tekcham, Dinesh Singh; Poojary, Satish S; Bhunia, Shushruta; Barbhuiya, Mustafa Ahmed; Gupta, Sanjeev; Shrivastav, Braj Raj; Tiwari, Pramod Kumar

    2016-05-01

    Loss of function of adenomatous polyposis coli (APC) has been reported in cancer. The two promoters of APC, 1A and 1B also have roles in cancer. But, the epigenetic role of APC promoters is not yet clear in gallbladder cancer (GBC) and gallstone diseases (GSD). We undertook this study to determine the epigenetic role of APC in GBC and GSD. Methylation-specific (MS)-PCR was used to analyze the methylation of APC gene. The expression of APC gene was studied by semi-quantitative PCR, real-time PCR and immunohistochemistry (IHC) in GBC, GSD and adjacent normal tissues. Of the two promoters, APC 1A promoter was found methylated in 96 per cent GBC ( P=0.0155) and 80 per cent GSD (P=0.015). Exon 1 was downregulated in grade II (P=0.002) and grade III (P=0.0001) of GBC, while exon 2 was normally expressed. Scoring analysis of IHC revealed 0 or negativity in 34.48 per cent (P=0.057) and 1+ in 24.14 per cent (P=0.005) GBC cases suggesting loss of APC expression. The present findings indicate epigenetic silencing of APC in advanced GBC. The methylation pattern, followed by expression analysis of APC may be suggested for diagnostic, prognostic and therapeutic purposes in GBC in future.

  5. How much do we know about the coupling of G-proteins to serotonin receptors?

    PubMed Central

    2014-01-01

    Serotonin receptors are G-protein-coupled receptors (GPCRs) involved in a variety of psychiatric disorders. G-proteins, heterotrimeric complexes that couple to multiple receptors, are activated when their receptor is bound by the appropriate ligand. Activation triggers a cascade of further signalling events that ultimately result in cell function changes. Each of the several known G-protein types can activate multiple pathways. Interestingly, since several G-proteins can couple to the same serotonin receptor type, receptor activation can result in induction of different pathways. To reach a better understanding of the role, interactions and expression of G-proteins a literature search was performed in order to list all the known heterotrimeric combinations and serotonin receptor complexes. Public databases were analysed to collect transcript and protein expression data relating to G-proteins in neural tissues. Only a very small number of heterotrimeric combinations and G-protein-receptor complexes out of the possible thousands suggested by expression data analysis have been examined experimentally. In addition this has mostly been obtained using insect, hamster, rat and, to a lesser extent, human cell lines. Besides highlighting which interactions have not been explored, our findings suggest additional possible interactions that should be examined based on our expression data analysis. PMID:25011628

  6. How much do we know about the coupling of G-proteins to serotonin receptors?

    PubMed

    Giulietti, Matteo; Vivenzio, Viviana; Piva, Francesco; Principato, Giovanni; Bellantuono, Cesario; Nardi, Bernardo

    2014-07-10

    Serotonin receptors are G-protein-coupled receptors (GPCRs) involved in a variety of psychiatric disorders. G-proteins, heterotrimeric complexes that couple to multiple receptors, are activated when their receptor is bound by the appropriate ligand. Activation triggers a cascade of further signalling events that ultimately result in cell function changes. Each of the several known G-protein types can activate multiple pathways. Interestingly, since several G-proteins can couple to the same serotonin receptor type, receptor activation can result in induction of different pathways. To reach a better understanding of the role, interactions and expression of G-proteins a literature search was performed in order to list all the known heterotrimeric combinations and serotonin receptor complexes. Public databases were analysed to collect transcript and protein expression data relating to G-proteins in neural tissues. Only a very small number of heterotrimeric combinations and G-protein-receptor complexes out of the possible thousands suggested by expression data analysis have been examined experimentally. In addition this has mostly been obtained using insect, hamster, rat and, to a lesser extent, human cell lines. Besides highlighting which interactions have not been explored, our findings suggest additional possible interactions that should be examined based on our expression data analysis.

  7. Microarray expression profiling and co-expression network analysis of circulating LncRNAs and mRNAs associated with neurotoxicity induced by BPA.

    PubMed

    Pang, Wei; Lian, Fu-Zhi; Leng, Xue; Wang, Shu-Min; Li, Yi-Bo; Wang, Zi-Yu; Li, Kai-Ren; Gao, Zhi-Xian; Jiang, Yu-Gang

    2018-05-01

    A growing body of evidence has shown bisphenol A (BPA), an estrogen-like industrial chemical, has adverse effects on the nervous system. In this study, we investigated the transcriptional behavior of long non-coding RNAs (lncRNAs) and mRNAs to provide the information to explore neurotoxic effects induced by BPA. By microarray expression profiling, we discovered 151 differentially expressed lncRNAs and 794 differentially expressed mRNAs in the BPA intervention group compared with the control group. Gene ontology analysis indicated the differentially expressed mRNAs were mainly involved in fundamental metabolic processes and physiological and pathological conditions, such as development, synaptic transmission, homeostasis, injury, and neuroinflammation responses. In the expression network of the BPA-induced group, a great number of nodes and connections were found in comparison to the control-derived network. We identified lncRNAs that were aberrantly expressed in the BPA group, among which, growth arrest specific 5 (GAS5) might participate in the BPA-induced neurotoxicity by regulating Jun, RAS, and other pathways indirectly through these differentially expressed genes. This study provides the first investigation of genome-wide lncRNA expression and correlation between lncRNA and mRNA expression in the BPA-induced neurotoxicity. Our results suggest that the elevated expression of lncRNAs is a major biomarker in the neurotoxicity induced by BPA.

  8. Rice Phospholipase A Superfamily: Organization, Phylogenetic and Expression Analysis during Abiotic Stresses and Development

    PubMed Central

    Singh, Amarjeet; Baranwal, Vinay; Shankar, Alka; Kanwar, Poonam; Ranjan, Rajeev; Yadav, Sandeep; Pandey, Amita; Kapoor, Sanjay; Pandey, Girdhar K.

    2012-01-01

    Background Phospholipase A (PLA) is an important group of enzymes responsible for phospholipid hydrolysis in lipid signaling. PLAs have been implicated in abiotic stress signaling and developmental events in various plants species. Genome-wide analysis of PLA superfamily has been carried out in dicot plant Arabidopsis. A comprehensive genome-wide analysis of PLAs has not been presented yet in crop plant rice. Methodology/Principal Findings A comprehensive bioinformatics analysis identified a total of 31 PLA encoding genes in the rice genome, which are divided into three classes; phospholipase A1 (PLA1), patatin like phospholipases (pPLA) and low molecular weight secretory phospholipase A2 (sPLA2) based on their sequences and phylogeny. A subset of 10 rice PLAs exhibited chromosomal duplication, emphasizing the role of duplication in the expansion of this gene family in rice. Microarray expression profiling revealed a number of PLA members expressing differentially and significantly under abiotic stresses and reproductive development. Comparative expression analysis with Arabidopsis PLAs revealed a high degree of functional conservation between the orthologs in two plant species, which also indicated the vital role of PLAs in stress signaling and plant development across different plant species. Moreover, sub-cellular localization of a few candidates suggests their differential localization and functional role in the lipid signaling. Conclusion/Significance The comprehensive analysis and expression profiling would provide a critical platform for the functional characterization of the candidate PLA genes in crop plants. PMID:22363522

  9. Expression analysis of dihydroflavonol 4-reductase genes in Petunia hybrida.

    PubMed

    Chu, Y X; Chen, H R; Wu, A Z; Cai, R; Pan, J S

    2015-05-12

    Dihydroflavonol 4-reductase (DFR) genes from Rosa chinensis (Asn type) and Calibrachoa hybrida (Asp type), driven by a CaMV 35S promoter, were integrated into the petunia (Petunia hybrida) cultivar 9702. Exogenous DFR gene expression characteristics were similar to flower-color changes, and effects on anthocyanin concentration were observed in both types of DFR gene transformants. Expression analysis showed that exogenous DFR genes were expressed in all of the tissues, but the expression levels were significantly different. However, both of them exhibited a high expression level in petals that were starting to open. The introgression of DFR genes may significantly change DFR enzyme activity. Anthocyanin ultra-performance liquid chromatography results showed that anthocyanin concentrations changed according to DFR enzyme activity. Therefore, the change in flower color was probably the result of a DFR enzyme change. Pelargonidin 3-O-glucoside was found in two different transgenic petunias, indicating that both CaDFR and RoDFR could catalyze dihydrokaempferol. Our results also suggest that transgenic petunias with DFR gene of Asp type could biosynthesize pelargonidin 3-O-glucoside.

  10. Genome-wide identification of wheat (Triticum aestivum) expansins and expansin expression analysis in cold-tolerant and cold-sensitive wheat cultivars

    PubMed Central

    Zhang, Jun-Feng; Xu, Yong-Qing; Dong, Jia-Min; Peng, Li-Na; Feng, Xu; Wang, Xu; Li, Fei; Miao, Yu; Yao, Shu-Kuan; Zhao, Qiao-Qin; Feng, Shan-Shan; Hu, Bao-Zhong

    2018-01-01

    Plant expansins are proteins involved in cell wall loosening, plant growth, and development, as well as in response to plant diseases and other stresses. In this study, we identified 128 expansin coding sequences from the wheat (Triticum aestivum) genome. These sequences belong to 45 homoeologous copies of TaEXPs, including 26 TaEXPAs, 15 TaEXPBs and four TaEXLAs. No TaEXLB was identified. Gene expression and sub-expression profiles revealed that most of the TaEXPs were expressed either only in root tissues or in multiple organs. Real-time qPCR analysis showed that many TaEXPs were differentially expressed in four different tissues of the two wheat cultivars—the cold-sensitive ‘Chinese Spring (CS)’ and the cold-tolerant ‘Dongnongdongmai 1 (D1)’ cultivars. Our results suggest that the differential expression of TaEXPs could be related to low-temperature tolerance or sensitivity of different wheat cultivars. Our study expands our knowledge on wheat expansins and sheds new light on the functions of expansins in plant development and stress response. PMID:29596529

  11. The prognostic implications of growth-related gene product β in laryngeal squamous cell carcinoma.

    PubMed

    Tang, Mingming; Xu, Xinjiang; Chen, Juanjuan; Huang, Jiangfei; Jiang, Bin; Han, Liang

    2017-09-01

    Growth-related gene product β (GROβ) is an angiogenic chemokine that belongs to the CXC chemokine family, and a number of studies have suggested that GROβ is associated with tumor development and progression. However, a number of studies have investigated the association between GROβ expression and the clinical attributes of laryngeal squamous cell carcinoma (LSCC). In the present study, one-step quantitative polymerase chain reaction and immunohistochemistry analysis were used to detect GROβ expression and evaluate the association between its expression and the clinicopathological characteristics of LSCC. The results demonstrated that the GROβ mRNA and protein expression levels were significantly increased in LSCC compared with the corresponding non-cancerous tissues. GROβ protein expression in LSCC was associated with tumor-node-metastasis stage, lymph node metastasis and histopathological grade. The Kaplan-Meier method and Cox multi-factor analysis indicated that high GROβ expression, lymph node metastasis and histopathological grade were significantly associated with poor survival of patients with LSCC. These data indicated that GROβ may be a novel prognostic biomarker of LSCC.

  12. Analysis of the 5′ untranslated region (5′UTR) of the alcohol oxidase 1 (AOX1) gene in recombinant protein expression in Pichia pastoris

    PubMed Central

    Staley, Chris A.; Huang, Amy; Nattestad, Maria; Oshiro, Kristin T.; Ray, Laura E.; Mulye, Tejas; Li, Zhiguo Harry; Le, Thu; Stephens, Justin J.; Gomez, Seth R.; Moy, Allison D.; Nguyen, Jackson C.; Franz, Andreas H.; Lin-Cereghino, Joan; Lin-Cereghino, Geoff P.

    2012-01-01

    Pichia pastoris is a methylotrophic yeast that has been genetically engineered to express over one thousand heterologous proteins valued for industrial, pharmaceutical and basic research purposes. In most cases, the 5′ untranslated region (UTR) of the alcohol oxidase 1 (AOX1) gene is fused to the coding sequence of the recombinant gene for protein expression in this yeast. Because the effect of the AOX1 5′UTR on protein expression is not known, site-directed mutagenesis was performed in order to decrease or increase the length of this region. Both of these types of changes were shown to affect translational efficiency, not transcript stability. While increasing the length of the 5′UTR clearly decreased expression of a β-galactosidase reporter in a proportional manner, a deletion analysis demonstrated that the AOX1 5′UTR contains a complex mixture of both positive and negative cis-acting elements, suggesting that the construction of a synthetic 5′UTR optimized for a higher level of expression may be challenging. PMID:22285974

  13. Characterization of LeMir, a Root-Knot Nematode-Induced Gene in Tomato with an Encoded Product Secreted from the Root1

    PubMed Central

    Brenner, Eric D.; Lambert, Kris N.; Kaloshian, Isgouhi; Williamson, Valerie M.

    1998-01-01

    A tomato gene that is induced early after infection of tomato (Lycopersicon esculentum Mill.) with root-knot nematodes (Meloidogyne javanica) encodes a protein with 54% amino acid identity to miraculin, a flavorless protein that causes sour substances to be perceived as sweet. This gene was therefore named LeMir (L. esculentum miraculin). Sequence similarity places the encoded protein in the soybean trypsin-inhibitor family (Kunitz). LeMir mRNA is found in root, hypocotyl, and flower tissues, with the highest expression in the root. Rapid induction of expression upon nematode infection is localized to root tips. In situ hybridization shows that LeMir is expressed constitutively in the root-cap and root-tip epidermis. The LeMir protein product (LeMir) was produced in the yeast Pichia pastoris for generation of antibodies. Western-blot analysis showed that LeMir expression is up-regulated by nematode infection and by wounding. LeMir is also expressed in tomato callus tissue. Immunoprint analysis revealed that LeMir is expressed throughout the seedling root, but that levels are highest at the root/shoot junction. Analysis of seedling root exudates revealed that LeMir is secreted from the root into the surrounding environment, suggesting that it may interact with soil-borne microorganisms. PMID:9733543

  14. Functional analysis of CYP6ER1, a P450 gene associated with imidacloprid resistance in Nilaparvata lugens

    PubMed Central

    Pang, Rui; Chen, Meng; Liang, Zhikun; Yue, Xiangzhao; Ge, Hu; Zhang, Wenqing

    2016-01-01

    The cytochrome P450 CYP6ER1 has been reported to play an important role in imidacloprid resistance of the brown planthopper (BPH), Nilaparvata lugens, and is overexpressed in most resistant populations. In the present study, we confirmed that CYP6ER1 expression can be induced by certain levels of imidacloprid. Developmental expression analysis revealed that CYP6ER1 was expressed highly in the adult stage, and tissue distribution analysis showed that CYP6ER1 was expressed mainly in the fat body and midgut. RNA interference (RNAi) of CYP6ER1 and transgenic expression of CYP6ER1 in Drosophila melanogaster both suggested that the expression of CYP6ER1 is sufficient to confer imidacloprid resistance. Furthermore, we analyzed the interaction of imidacloprid and CYP6ER1 monooxygenase by using dynamic simulations and molecular docking. We found that Nitrogen atoms in the heterocycle of the imidacloprid molecule may bind to iron atoms in the center of the homology model of CYP6ER1 via 4,5-dihedro-1H-imidazole. This finding contributes to a better understanding of how CYP6ER1 takes part in the insecticide metabolism. PMID:27721443

  15. Functional analysis of CYP6ER1, a P450 gene associated with imidacloprid resistance in Nilaparvata lugens.

    PubMed

    Pang, Rui; Chen, Meng; Liang, Zhikun; Yue, Xiangzhao; Ge, Hu; Zhang, Wenqing

    2016-10-10

    The cytochrome P450 CYP6ER1 has been reported to play an important role in imidacloprid resistance of the brown planthopper (BPH), Nilaparvata lugens, and is overexpressed in most resistant populations. In the present study, we confirmed that CYP6ER1 expression can be induced by certain levels of imidacloprid. Developmental expression analysis revealed that CYP6ER1 was expressed highly in the adult stage, and tissue distribution analysis showed that CYP6ER1 was expressed mainly in the fat body and midgut. RNA interference (RNAi) of CYP6ER1 and transgenic expression of CYP6ER1 in Drosophila melanogaster both suggested that the expression of CYP6ER1 is sufficient to confer imidacloprid resistance. Furthermore, we analyzed the interaction of imidacloprid and CYP6ER1 monooxygenase by using dynamic simulations and molecular docking. We found that Nitrogen atoms in the heterocycle of the imidacloprid molecule may bind to iron atoms in the center of the homology model of CYP6ER1 via 4,5-dihedro-1H-imidazole. This finding contributes to a better understanding of how CYP6ER1 takes part in the insecticide metabolism.

  16. Functional expression of dental plaque microbiota.

    PubMed

    Peterson, Scott N; Meissner, Tobias; Su, Andrew I; Snesrud, Erik; Ong, Ana C; Schork, Nicholas J; Bretz, Walter A

    2014-01-01

    Dental caries remains a significant public health problem and is considered pandemic worldwide. The prediction of dental caries based on profiling of microbial species involved in disease and equally important, the identification of species conferring dental health has proven more difficult than anticipated due to high interpersonal and geographical variability of dental plaque microbiota. We have used RNA-Seq to perform global gene expression analysis of dental plaque microbiota derived from 19 twin pairs that were either concordant (caries-active or caries-free) or discordant for dental caries. The transcription profiling allowed us to define a functional core microbiota consisting of nearly 60 species. Similarities in gene expression patterns allowed a preliminary assessment of the relative contribution of human genetics, environmental factors and caries phenotype on the microbiota's transcriptome. Correlation analysis of transcription allowed the identification of numerous functional networks, suggesting that inter-personal environmental variables may co-select for groups of genera and species. Analysis of functional role categories allowed the identification of dominant functions expressed by dental plaque biofilm communities, that highlight the biochemical priorities of dental plaque microbes to metabolize diverse sugars and cope with the acid and oxidative stress resulting from sugar fermentation. The wealth of data generated by deep sequencing of expressed transcripts enables a greatly expanded perspective concerning the functional expression of dental plaque microbiota.

  17. Functional expression of dental plaque microbiota

    PubMed Central

    Peterson, Scott N.; Meissner, Tobias; Su, Andrew I.; Snesrud, Erik; Ong, Ana C.; Schork, Nicholas J.; Bretz, Walter A.

    2014-01-01

    Dental caries remains a significant public health problem and is considered pandemic worldwide. The prediction of dental caries based on profiling of microbial species involved in disease and equally important, the identification of species conferring dental health has proven more difficult than anticipated due to high interpersonal and geographical variability of dental plaque microbiota. We have used RNA-Seq to perform global gene expression analysis of dental plaque microbiota derived from 19 twin pairs that were either concordant (caries-active or caries-free) or discordant for dental caries. The transcription profiling allowed us to define a functional core microbiota consisting of nearly 60 species. Similarities in gene expression patterns allowed a preliminary assessment of the relative contribution of human genetics, environmental factors and caries phenotype on the microbiota's transcriptome. Correlation analysis of transcription allowed the identification of numerous functional networks, suggesting that inter-personal environmental variables may co-select for groups of genera and species. Analysis of functional role categories allowed the identification of dominant functions expressed by dental plaque biofilm communities, that highlight the biochemical priorities of dental plaque microbes to metabolize diverse sugars and cope with the acid and oxidative stress resulting from sugar fermentation. The wealth of data generated by deep sequencing of expressed transcripts enables a greatly expanded perspective concerning the functional expression of dental plaque microbiota. PMID:25177549

  18. Transcriptome profiling of a Saccharomyces cerevisiae mutant with a constitutively activated Ras/cAMP pathway.

    PubMed

    Jones, D L; Petty, J; Hoyle, D C; Hayes, A; Ragni, E; Popolo, L; Oliver, S G; Stateva, L I

    2003-12-16

    Often changes in gene expression levels have been considered significant only when above/below some arbitrarily chosen threshold. We investigated the effect of applying a purely statistical approach to microarray analysis and demonstrated that small changes in gene expression have biological significance. Whole genome microarray analysis of a pde2Delta mutant, constructed in the Saccharomyces cerevisiae reference strain FY23, revealed altered expression of approximately 11% of protein encoding genes. The mutant, characterized by constitutive activation of the Ras/cAMP pathway, has increased sensitivity to stress, reduced ability to assimilate nonfermentable carbon sources, and some cell wall integrity defects. Applying the Munich Information Centre for Protein Sequences (MIPS) functional categories revealed increased expression of genes related to ribosome biogenesis and downregulation of genes in the cell rescue, defense, cell death and aging category, suggesting a decreased response to stress conditions. A reduced level of gene expression in the unfolded protein response pathway (UPR) was observed. Cell wall genes whose expression was affected by this mutation were also identified. Several of the cAMP-responsive orphan genes, upon further investigation, revealed cell wall functions; others had previously unidentified phenotypes assigned to them. This investigation provides a statistical global transcriptome analysis of the cellular response to constitutive activation of the Ras/cAMP pathway.

  19. Complex and extensive post-transcriptional regulation revealed by integrative proteomic and transcriptomic analysis of metabolite stress response in Clostridium acetobutylicum.

    PubMed

    Venkataramanan, Keerthi P; Min, Lie; Hou, Shuyu; Jones, Shawn W; Ralston, Matthew T; Lee, Kelvin H; Papoutsakis, E Terry

    2015-01-01

    Clostridium acetobutylicum is a model organism for both clostridial biology and solvent production. The organism is exposed to its own toxic metabolites butyrate and butanol, which trigger an adaptive stress response. Integrative analysis of proteomic and RNAseq data may provide novel insights into post-transcriptional regulation. The identified iTRAQ-based quantitative stress proteome is made up of 616 proteins with a 15 % genome coverage. The differentially expressed proteome correlated poorly with the corresponding differential RNAseq transcriptome. Up to 31 % of the differentially expressed proteins under stress displayed patterns opposite to those of the transcriptome, thus suggesting significant post-transcriptional regulation. The differential proteome of the translation machinery suggests that cells employ a different subset of ribosomal proteins under stress. Several highly upregulated proteins but with low mRNA levels possessed mRNAs with long 5'UTRs and strong RBS scores, thus supporting the argument that regulatory elements on the long 5'UTRs control their translation. For example, the oxidative stress response rubrerythrin was upregulated only at the protein level up to 40-fold without significant mRNA changes. We also identified many leaderless transcripts, several displaying different transcriptional start sites, thus suggesting mRNA-trimming mechanisms under stress. Downregulation of Rho and partner proteins pointed to changes in transcriptional elongation and termination under stress. The integrative proteomic-transcriptomic analysis demonstrated complex expression patterns of a large fraction of the proteome. Such patterns could not have been detected with one or the other omic analyses. Our analysis proposes the involvement of specific molecular mechanisms of post-transcriptional regulation to explain the observed complex stress response.

  20. Evaluation of Different Normalization and Analysis Procedures for Illumina Gene Expression Microarray Data Involving Small Changes

    PubMed Central

    Johnstone, Daniel M.; Riveros, Carlos; Heidari, Moones; Graham, Ross M.; Trinder, Debbie; Berretta, Regina; Olynyk, John K.; Scott, Rodney J.; Moscato, Pablo; Milward, Elizabeth A.

    2013-01-01

    While Illumina microarrays can be used successfully for detecting small gene expression changes due to their high degree of technical replicability, there is little information on how different normalization and differential expression analysis strategies affect outcomes. To evaluate this, we assessed concordance across gene lists generated by applying different combinations of normalization strategy and analytical approach to two Illumina datasets with modest expression changes. In addition to using traditional statistical approaches, we also tested an approach based on combinatorial optimization. We found that the choice of both normalization strategy and analytical approach considerably affected outcomes, in some cases leading to substantial differences in gene lists and subsequent pathway analysis results. Our findings suggest that important biological phenomena may be overlooked when there is a routine practice of using only one approach to investigate all microarray datasets. Analytical artefacts of this kind are likely to be especially relevant for datasets involving small fold changes, where inherent technical variation—if not adequately minimized by effective normalization—may overshadow true biological variation. This report provides some basic guidelines for optimizing outcomes when working with Illumina datasets involving small expression changes. PMID:27605185

  1. Expression Profile of Long Noncoding RNAs in Human Earlobe Keloids: A Microarray Analysis

    PubMed Central

    Guo, Liang; Xu, Kai; Yan, Hongbo; Feng, Haifeng

    2016-01-01

    Background. Long noncoding RNAs (lncRNAs) play key roles in a wide range of biological processes and their deregulation results in human disease, including keloids. Earlobe keloid is a type of pathological skin scar, and the molecular pathogenesis of this disease remains largely unknown. Methods. In this study, microarray analysis was used to determine the expression profiles of lncRNAs and mRNAs between 3 pairs of earlobe keloid and normal specimens. Gene Ontology (GO) categories and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway enrichment analyses were performed to identify the main functions of the differentially expressed genes and earlobe keloid-related pathways. Results. A total of 2068 lncRNAs and 1511 mRNAs were differentially expressed between earlobe keloid and normal tissues. Among them, 1290 lncRNAs and 1092 mRNAs were upregulated, and 778 lncRNAs and 419 mRNAs were downregulated. Pathway analysis revealed that 24 pathways were correlated to the upregulated transcripts, while 11 pathways were associated with the downregulated transcripts. Conclusion. We characterized the expression profiles of lncRNA and mRNA in earlobe keloids and suggest that lncRNAs may serve as diagnostic biomarkers for the therapy of earlobe keloid. PMID:28101509

  2. [The French adaptation of the STAXI-2, C.D. Spielberger's State-trait anger expression inventory].

    PubMed

    Borteyrou, X; Bruchon-Schweitzer, M; Spielberger, C D

    2008-06-01

    The assessment of anger has received increasing attention because of growing evidence that anger and hostility are related to heart disease. Research on anger assessment has also been stimulated by the development of psychometric measures for evaluating different aspects of anger. First, we review the major self-report scales used to assess anger and hostility. The scales appeared to have been constructed without explicit definition of anger and there is little differentiation between the experience and expression of anger. The factor-derived STAXI-2 is a 57-item measure of the expression of anger, and is comprised of the state-trait anger scale [Spielberger CD, Jacobs G, Russell JS, Crane RS. Assessment of anger: the state-trait anger scale. In: Butcher JN, Spielberger CD, editors. Advances in personality assessment, 2. Hillside, NJ: Erlbaum; 1983] and the anger expression scale (AX; Spielberger et al., 1985). The state anger scale (SAS) includes three subscales: feeling angry, feeling like expressing anger verbally, and feeling like expressing anger physically. The trait anger scale (TAS) consists of two subscales: angry temperament and angry reaction. The AX deals with the direction of both anger expression and anger control, resulting in four revised AX subscales: anger expression/out (verbal and physical, aggressive behavior directed toward other persons or objects), and anger expression/in (anger suppression), anger control/out (attempts to monitor and prevent the outward expression of anger) and anger control/in (active attempts to calm down and reduce angry feelings). The aim of this work was to examine the factor structure and the psychometric properties of the French adaptation of STAXI-2. A sample of 1085 French subjects, 546 female and 539 male, between 18 and 70 years old participated in the study. The 57 items of the three original subscales (SAS, TAS, and AX scale) were analyzed separately by sex and by subscale, using exploratory factor analyses (principal axis analysis, followed by promax rotations). For the first part of the questionnaire (SAS), factor analysis suggested the presence of three factors with eigenvalues >1.0; but the factor structure obtained for males and females differed and was difficult to interpret. Moreover, the explained variance of Factors 2 and 3 was low. Velicer's MAP criteria and screen test established that one solution factor was more relevant. Confirmatory factor analysis suggested that the three factor solution was acceptable, but the unifactorial solution adjusted better to the data. For the second part of the questionnaire (TAS) factor analysis was conducted following the same procedure, and two factors were extracted. The explained variance of Factor 2 was very low. Velicer's MAP criteria and screen test suggested that the solution factor was more relevant. Moreover, the adjustment parameters of the original two-factor structure were not satisfactory. Finally, the analyses of the 32 items of anger expression and control yielded four factors with eigenvalues >1.0. All items loaded higher than 0.38 on the corresponding factor and lower than 0.30 in other factor. The factor structure of the AX scale was fairly robust, both for males and females. Internal consistency and test-retest reliability of the subscales were acceptable except for the SAS. The correlations of the six subscales with four criterion variables (Buss Durkee hostility inventory, Cook and Medley Ho scale, NEO PI-R Ho scale and Courtauld emotions control scale) were in the expected direction, establishing their convergent validity. In summary, the analysis reported in this study checked the factor structure of the STAXI-2 translated into French. The state anger dimension was also essentially confirmed, but no distinction was found between the three components: feeling angry, feeling like expressing anger verbally, and feeling like expressing anger physically. Moreover, the distinction between angry temperament and angry reaction was not confirmed because of gender differences, but we established a robust and valid trait anger factor. Finally, we confirmed the factor structure of the original anger expression scale without gender differences. Some practical and theoretical perspectives for the use of the French adaptation of the STAXI-2 are suggested.

  3. Emergent Self-Organized Criticality in Gene Expression Dynamics: Temporal Development of Global Phase Transition Revealed in a Cancer Cell Line

    PubMed Central

    Tsuchiya, Masa; Giuliani, Alessandro; Hashimoto, Midori; Erenpreisa, Jekaterina; Yoshikawa, Kenichi

    2015-01-01

    Background The underlying mechanism of dynamic control of the genome-wide expression is a fundamental issue in bioscience. We addressed it in terms of phase transition by a systemic approach based on both density analysis and characteristics of temporal fluctuation for the time-course mRNA expression in differentiating MCF-7 breast cancer cells. Methodology In a recent work, we suggested criticality as an essential aspect of dynamic control of genome-wide gene expression. Criticality was evident by a unimodal-bimodal transition through flattened unimodal expression profile. The flatness on the transition suggests the existence of a critical transition at which up- and down-regulated expression is balanced. Mean field (averaging) behavior of mRNAs based on the temporal expression changes reveals a sandpile type of transition in the flattened profile. Furthermore, around the transition, a self-similar unimodal-bimodal transition of the whole expression occurs in the density profile of an ensemble of mRNA expression. These singular and scaling behaviors identify the transition as the expression phase transition driven by self-organized criticality (SOC). Principal Findings Emergent properties of SOC through a mean field approach are revealed: i) SOC, as a form of genomic phase transition, consolidates distinct critical states of expression, ii) Coupling of coherent stochastic oscillations between critical states on different time-scales gives rise to SOC, and iii) Specific gene clusters (barcode genes) ranging in size from kbp to Mbp reveal similar SOC to genome-wide mRNA expression and ON-OFF synchronization to critical states. This suggests that the cooperative gene regulation of topological genome sub-units is mediated by the coherent phase transitions of megadomain-scaled conformations between compact and swollen chromatin states. Conclusion and Significance In summary, our study provides not only a systemic method to demonstrate SOC in whole-genome expression, but also introduces novel, physically grounded concepts for a breakthrough in the study of biological regulation. PMID:26067993

  4. Gene expression analysis predicts insect venom anaphylaxis in indolent systemic mastocytosis.

    PubMed

    Niedoszytko, M; Bruinenberg, M; van Doormaal, J J; de Monchy, J G R; Nedoszytko, B; Koppelman, G H; Nawijn, M C; Wijmenga, C; Jassem, E; Elberink, J N G Oude

    2011-05-01

    Anaphylaxis to insect venom (Hymenoptera) is most severe in patients with mastocytosis and may even lead to death. However, not all patients with mastocytosis suffer from anaphylaxis. The aim of the study was to analyze differences in gene expression between patients with indolent systemic mastocytosis (ISM) and a history of insect venom anaphylaxis (IVA) compared to those patients without a history of anaphylaxis, and to determine the predictive use of gene expression profiling. Whole-genome gene expression analysis was performed in peripheral blood cells. Twenty-two adults with ISM were included: 12 with a history of IVA and 10 without a history of anaphylaxis of any kind. Significant differences in single gene expression corrected for multiple testing were found for 104 transcripts (P < 0.05). Gene ontology analysis revealed that the differentially expressed genes were involved in pathways responsible for the development of cancer and focal and cell adhesion suggesting that the expression of genes related to the differentiation state of cells is higher in patients with a history of anaphylaxis. Based on the gene expression profiles, a naïve Bayes prediction model was built identifying patients with IVA. In ISM, gene expression profiles are different between patients with a history of IVA and those without. These findings might reflect a more pronounced mast cells dysfunction in patients without a history of anaphylaxis. Gene expression profiling might be a useful tool to predict the risk of anaphylaxis on insect venom in patients with ISM. Prospective studies are needed to substantiate any conclusions. © 2010 John Wiley & Sons A/S.

  5. Expressed Sequence Tag Analysis of the Human Pathogen Paracoccidioides brasiliensis Yeast Phase: Identification of Putative Homologues of Candida albicans Virulence and Pathogenicity Genes

    PubMed Central

    Goldman, Gustavo H.; dos Reis Marques, Everaldo; Custódio Duarte Ribeiro, Diógenes; Ângelo de Souza Bernardes, Luciano; Quiapin, Andréa Carla; Vitorelli, Patrícia Marostica; Savoldi, Marcela; Semighini, Camile P.; de Oliveira, Regina C.; Nunes, Luiz R.; Travassos, Luiz R.; Puccia, Rosana; Batista, Wagner L.; Ferreira, Leslie Ecker; Moreira, Júlio C.; Bogossian, Ana Paula; Tekaia, Fredj; Nobrega, Marina Pasetto; Nobrega, Francisco G.; Goldman, Maria Helena S.

    2003-01-01

    Paracoccidioides brasiliensis, a thermodimorphic fungus, is the causative agent of the prevalent systemic mycosis in Latin America, paracoccidioidomycosis. We present here a survey of expressed genes in the yeast pathogenic phase of P. brasiliensis. We obtained 13,490 expressed sequence tags from both 5′ and 3′ ends. Clustering analysis yielded the partial sequences of 4,692 expressed genes that were functionally classified by similarity to known genes. We have identified several Candida albicans virulence and pathogenicity homologues in P. brasiliensis. Furthermore, we have analyzed the expression of some of these genes during the dimorphic yeast-mycelium-yeast transition by real-time quantitative reverse transcription-PCR. Clustering analysis of the mycelium-yeast transition revealed three groups: (i) RBT, hydrophobin, and isocitrate lyase; (ii) malate dehydrogenase, contigs Pb1067 and Pb1145, GPI, and alternative oxidase; and (iii) ubiquitin, delta-9-desaturase, HSP70, HSP82, and HSP104. The first two groups displayed high mRNA expression in the mycelial phase, whereas the third group showed higher mRNA expression in the yeast phase. Our results suggest the possible conservation of pathogenicity and virulence mechanisms among fungi, expand considerably gene identification in P. brasiliensis, and provide a broader basis for further progress in understanding its biological peculiarities. PMID:12582121

  6. Cloning, Expression Analysis and Enzyme Activity Assays of the α-Carbonic Anhydrase Gene from Chlamydomonas sp. ICE-L.

    PubMed

    Qu, Changfeng; He, Yingying; Zheng, Zhou; An, Meiling; Li, Lulu; Wang, Xixi; He, Xiaodong; Wang, Yibin; Liu, Fangming; Miao, Jinlai

    2018-01-01

    The α-carbonic anhydrase (α-CA) is a zinc ion-containing enzyme that catalyzes the hydration of carbon dioxide. In this paper, a full-length α-CA gene was cloned from Chlamydomonas sp. ICE-L using RT-PCR and RACE-PCR for bioinformatic analysis. The α-CA open reading frame obtained by PCR was cloned into a vector and transformed into Escherichia coli to generate α-CA-producing bacteria. The α-CA was highly expressed upon induction with isopropyl-β-d-thiogalactoside (IPTG) at a final concentration of 0.8 mM. A single band with a molecular weight of approximate 40 kDa expressed in the recombinant E. coli strain harboring the α-CA vector was observed in SDS-PAGE analysis. The carbon dioxide hydration activity and esterase activity of α-CA expressed by the recombinant strain were 0.404 U/mg and 0.319 U, respectively. In addition, three conditions, temperature, salinity and UVB radiation exposure, were selected to analyze α-CA transcription levels by qRT-PCR. The results suggested UVB exposure increased the expression of relative mRNA; meanwhile, the α-CA mRNA expression was rapidly induced by temperature and salinity stress, indicating that Chlamydomonas sp. ICE-L might modulate the α-CA mRNA expression to adapt to the extreme environments.

  7. The prognostic role of CD68 and FoxP3 expression in patients with primary central nervous system lymphoma.

    PubMed

    Cho, Hyunsoo; Kim, Se Hoon; Kim, Soo-Jeong; Chang, Jong Hee; Yang, Woo Ick; Suh, Chang-Ok; Cheong, June-Won; Kim, Yu Ri; Lee, Jung Yeon; Jang, Ji Eun; Kim, Yundeok; Min, Yoo Hong; Kim, Jin Seok

    2017-07-01

    The prognostic role of CD68 and FoxP3 in primary central nervous system lymphoma (PCNSL) has not been evaluated. Thus, we examined the prognostic significance of CD68 and FoxP3 expression in tumor samples of 76 newly diagnosed immunocompetent PCNSL patients. All patients were treated initially with high-dose methotrexate (HD-MTX)-based chemotherapy, and 16 (21.1%) patients received upfront autologous stem cell transplantation (ASCT) consolidation. High expression of CD68 (>55 cells/high-power field) or FoxP3 (>15 cells/high-power field) was observed in 10 patients, respectively. High CD68 expression was associated with inferior overall survival (OS) and progression-free survival (PFS) in multivariate analysis (P = 0.023 and P = 0.021, respectively). In addition, we performed subgroup analysis based on upfront ASCT. High CD68 expression was also associated with inferior OS and PFS in multivariate analysis (P = 0.013 and P < 0.001, respectively) among patients who did not receive upfront ASCT (n = 60), but not in patients who received upfront ASCT. The expression of FoxP3 was not significantly associated with survival. Therefore, we identified a prognostic significance of high CD68 expression in PCNSL, which suggests a need for further clinical trials and biological studies on the role of PCNSL tumor microenvironment.

  8. Integrative Transcriptomic Analysis Uncovers Novel Gene Modules That Underlie the Sulfate Response in Arabidopsis thaliana

    PubMed Central

    Henríquez-Valencia, Carlos; Arenas-M, Anita; Medina, Joaquín; Canales, Javier

    2018-01-01

    Sulfur is an essential nutrient for plant growth and development. Sulfur is a constituent of proteins, the plasma membrane and cell walls, among other important cellular components. To obtain new insights into the gene regulatory networks underlying the sulfate response, we performed an integrative meta-analysis of transcriptomic data from five different sulfate experiments available in public databases. This bioinformatic approach allowed us to identify a robust set of genes whose expression depends only on sulfate availability, indicating that those genes play an important role in the sulfate response. In relation to sulfate metabolism, the biological function of approximately 45% of these genes is currently unknown. Moreover, we found several consistent Gene Ontology terms related to biological processes that have not been extensively studied in the context of the sulfate response; these processes include cell wall organization, carbohydrate metabolism, nitrogen compound transport, and the regulation of proteolysis. Gene co-expression network analyses revealed relationships between the sulfate-responsive genes that were distributed among seven function-specific co-expression modules. The most connected genes in the sulfate co-expression network belong to a module related to the carbon response, suggesting that this biological function plays an important role in the control of the sulfate response. Temporal analyses of the network suggest that sulfate starvation generates a biphasic response, which involves that major changes in gene expression occur during both the early and late responses. Network analyses predicted that the sulfate response is regulated by a limited number of transcription factors, including MYBs, bZIPs, and NF-YAs. In conclusion, our analysis identified new candidate genes and provided new hypotheses to advance our understanding of the transcriptional regulation of sulfate metabolism in plants. PMID:29692794

  9. Integrative Transcriptomic Analysis Uncovers Novel Gene Modules That Underlie the Sulfate Response in Arabidopsis thaliana.

    PubMed

    Henríquez-Valencia, Carlos; Arenas-M, Anita; Medina, Joaquín; Canales, Javier

    2018-01-01

    Sulfur is an essential nutrient for plant growth and development. Sulfur is a constituent of proteins, the plasma membrane and cell walls, among other important cellular components. To obtain new insights into the gene regulatory networks underlying the sulfate response, we performed an integrative meta-analysis of transcriptomic data from five different sulfate experiments available in public databases. This bioinformatic approach allowed us to identify a robust set of genes whose expression depends only on sulfate availability, indicating that those genes play an important role in the sulfate response. In relation to sulfate metabolism, the biological function of approximately 45% of these genes is currently unknown. Moreover, we found several consistent Gene Ontology terms related to biological processes that have not been extensively studied in the context of the sulfate response; these processes include cell wall organization, carbohydrate metabolism, nitrogen compound transport, and the regulation of proteolysis. Gene co-expression network analyses revealed relationships between the sulfate-responsive genes that were distributed among seven function-specific co-expression modules. The most connected genes in the sulfate co-expression network belong to a module related to the carbon response, suggesting that this biological function plays an important role in the control of the sulfate response. Temporal analyses of the network suggest that sulfate starvation generates a biphasic response, which involves that major changes in gene expression occur during both the early and late responses. Network analyses predicted that the sulfate response is regulated by a limited number of transcription factors, including MYBs, bZIPs, and NF-YAs. In conclusion, our analysis identified new candidate genes and provided new hypotheses to advance our understanding of the transcriptional regulation of sulfate metabolism in plants.

  10. Basic Helix-Loop-Helix Transcription Factor Bmsage Is Involved in Regulation of fibroin H-chain Gene via Interaction with SGF1 in Bombyx mori

    PubMed Central

    Li, Qiong-Yan; Hu, Wen-Bo; Zhou, Meng-Ting; Nie, Hong-Yi; Zhang, Yin-Xia; Peng, Zhang-Chuan; Zhao, Ping; Xia, Qing-You

    2014-01-01

    Silk glands are specialized in the synthesis of several secretory proteins. Expression of genes encoding the silk proteins in Bombyx mori silk glands with strict territorial and developmental specificities is regulated by many transcription factors. In this study, we have characterized B. mori sage, which is closely related to sage in the fruitfly Drosophila melanogaster. It is termed Bmsage; it encodes transcription factor Bmsage, which belongs to the Mesp subfamily, containing a basic helix–loop–helix motif. Bmsage transcripts were detected specifically in the silk glands of B. mori larvae through RT-PCR analysis. Immunoblotting analysis confirmed the Bmsage protein existed exclusively in B. mori middle and posterior silk gland cells. Bmsage has a low level of expression in the 4th instar molting stages, which increases gradually in the 5th instar feeding stages and then declines from the wandering to the pupation stages. Quantitative PCR analysis suggested the expression level of Bmsage in a high silk strain was higher compared to a lower silk strain on day 3 of the larval 5th instar. Furthermore, far western blotting and co-immunoprecipitation assays showed the Bmsage protein interacted with the fork head transcription factor silk gland factor 1 (SGF1). An electrophoretic mobility shift assay showed the complex of Bmsage and SGF1 proteins bound to the A and B elements in the promoter of fibroin H-chain gene(fib-H), respectively. Luciferase reporter gene assays confirmed the complex of Bmsage and SGF1 proteins increased the expression of fib-H. Together, these results suggest Bmsage is involved in the regulation of the expression of fib-H by being together with SGF1 in B. mori PSG cells. PMID:24740008

  11. Characterization and Expression Analysis of Phytoene Synthase from Bread Wheat (Triticum aestivum L.)

    PubMed Central

    Flowerika; Alok, Anshu; Kumar, Jitesh; Thakur, Neha; Pandey, Ashutosh; Pandey, Ajay Kumar; Upadhyay, Santosh Kumar; Tiwari, Siddharth

    2016-01-01

    Phytoene synthase (PSY) regulates the first committed step of the carotenoid biosynthetic pathway in plants. The present work reports identification and characterization of the three PSY genes (TaPSY1, TaPSY2 and TaPSY3) in wheat (Triticum aestivum L.). The TaPSY1, TaPSY2, and TaPSY3 genes consisted of three homoeologs on the long arm of group 7 chromosome (7L), short arm of group 5 chromosome (5S), and long arm of group 5 chromosome (5L), respectively in each subgenomes (A, B, and D) with a similarity range from 89% to 97%. The protein sequence analysis demonstrated that TaPSY1 and TaPSY3 retain most of conserved motifs for enzyme activity. Phylogenetic analysis of all TaPSY revealed an evolutionary relationship among PSY proteins of various monocot species. TaPSY derived from A and D subgenomes shared proximity to the PSY of Triticum urartu and Aegilops tauschii, respectively. The differential expression of TaPSY1, TaPSY2, and TaPSY3 in the various tissues, seed development stages, and stress treatments suggested their role in plant development, and stress condition. TaPSY3 showed higher expression in all tissues, followed by TaPSY1. The presence of multiple stress responsive cis-regulatory elements in promoter region of TaPSY3 correlated with the higher expression during drought and heat stresses has suggested their role in these conditions. The expression pattern of TaPSY3 was correlated with the accumulation of β-carotene in the seed developmental stages. Bacterial complementation assay has validated the functional activity of each TaPSY protein. Hence, TaPSY can be explored in developing genetically improved wheat crop. PMID:27695116

  12. cDNA cloning, genomic organization and expression analysis during somatic embryogenesis of the translationally controlled tumor protein (TCTP) gene from Japanese larch (Larix leptolepis).

    PubMed

    Zhang, Li-Feng; Li, Wan-Feng; Han, Su-Ying; Yang, Wen-Hua; Qi, Li-Wang

    2013-10-15

    A full-length cDNA and genomic sequences of a translationally controlled tumor protein (TCTP) gene were isolated from Japanese larch (Larix leptolepis) and designated LaTCTP. The length of the cDNA was 1, 043 bp and contained a 504 bp open reading frame that encodes a predicted protein of 167 amino acids, characterized by two signature sequences of the TCTP protein family. Analysis of the LaTCTP gene structure indicated four introns and five exons, and it is the largest of all currently known TCTP genes in plants. The 5'-flanking promoter region of LaTCTP was cloned using an improved TAIL-PCR technique. In this region we identified many important potential cis-acting elements, such as a Box-W1 (fungal elicitor responsive element), a CAT-box (cis-acting regulatory element related to meristem expression), a CGTCA-motif (cis-acting regulatory element involved in MeJA-responsiveness), a GT1-motif (light responsive element), a Skn-1-motif (cis-acting regulatory element required for endosperm expression) and a TGA-element (auxin-responsive element), suggesting that expression of LaTCTP is highly regulated. Expression analysis demonstrated ubiquitous localization of LaTCTP mRNA in the roots, stems and needles, high mRNA levels in the embryonal-suspensor mass (ESM), browning embryogenic cultures and mature somatic embryos, and low levels of mRNA at day five during somatic embryogenesis. We suggest that LaTCTP might participate in the regulation of somatic embryo development. These results provide a theoretical basis for understanding the molecular regulatory mechanism of LaTCTP and lay the foundation for artificial regulation of somatic embryogenesis. © 2013.

  13. Identification and Characterization of Long Non-Coding RNAs Related to Mouse Embryonic Brain Development from Available Transcriptomic Data

    PubMed Central

    He, Hongjuan; Xiu, Youcheng; Guo, Jing; Liu, Hui; Liu, Qi; Zeng, Tiebo; Chen, Yan; Zhang, Yan; Wu, Qiong

    2013-01-01

    Long non-coding RNAs (lncRNAs) as a key group of non-coding RNAs have gained widely attention. Though lncRNAs have been functionally annotated and systematic explored in higher mammals, few are under systematical identification and annotation. Owing to the expression specificity, known lncRNAs expressed in embryonic brain tissues remain still limited. Considering a large number of lncRNAs are only transcribed in brain tissues, studies of lncRNAs in developmental brain are therefore of special interest. Here, publicly available RNA-sequencing (RNA-seq) data in embryonic brain are integrated to identify thousands of embryonic brain lncRNAs by a customized pipeline. A significant proportion of novel transcripts have not been annotated by available genomic resources. The putative embryonic brain lncRNAs are shorter in length, less spliced and show less conservation than known genes. The expression of putative lncRNAs is in one tenth on average of known coding genes, while comparable with known lncRNAs. From chromatin data, putative embryonic brain lncRNAs are associated with active chromatin marks, comparable with known lncRNAs. Embryonic brain expressed lncRNAs are also indicated to have expression though not evident in adult brain. Gene Ontology analysis of putative embryonic brain lncRNAs suggests that they are associated with brain development. The putative lncRNAs are shown to be related to possible cis-regulatory roles in imprinting even themselves are deemed to be imprinted lncRNAs. Re-analysis of one knockdown data suggests that four regulators are associated with lncRNAs. Taken together, the identification and systematic analysis of putative lncRNAs would provide novel insights into uncharacterized mouse non-coding regions and the relationships with mammalian embryonic brain development. PMID:23967161

  14. Molecular identification and functional expression of mu 3, a novel alternatively spliced variant of the human mu opiate receptor gene.

    PubMed

    Cadet, Patrick; Mantione, Kirk J; Stefano, George B

    2003-05-15

    Studies from our laboratory have revealed a novel mu opiate receptor, mu 3, which is expressed in both vascular tissues and leukocytes. The mu 3 receptor is selective for opiate alkaloids and is insensitive to opioid peptides. We now identify the mu 3 receptor at the molecular level using a 441-bp conserved region of the mu 1 receptor. Sequence analysis of the isolated cDNA suggests that it is a novel, alternatively spliced variant of the mu opiate receptor gene. To determine whether protein expressed from this cDNA exhibits the biochemical characteristics expected of the mu 3 receptor, the cDNA clone was expressed in a heterologous system. At the functional level, COS-1 cells transfected with the mu 3 receptor cDNA exhibited dose-dependent release of NO following treatment with morphine, but not opioid peptides (i.e., Met-enkephalin). Naloxone was able to block the effect of morphine on COS-1 transfected cells. Nontransfected COS-1 cells did not produce NO in the presence of morphine or the opioid peptides at similar concentrations. Receptor binding analysis with [(3)H]dihydromorphine further supports the opiate alkaloid selectivity and opioid peptide insensitivity of this receptor. These data suggest that this new mu opiate receptor cDNA encodes the mu 3 opiate receptor, since it exhibits biochemical characteristics known to be unique to this receptor (opiate alkaloid selective and opioid peptide insensitive). Furthermore, using Northern blot, RT-PCR, and sequence analysis, we have demonstrated the expression of this new mu variant in human vascular tissue, mononuclear cells, polymorphonuclear cells, and human neuroblastoma cells.

  15. Aldehyde Dehydrogenase Gene Superfamily in Populus: Organization and Expression Divergence between Paralogous Gene Pairs.

    PubMed

    Tian, Feng-Xia; Zang, Jian-Lei; Wang, Tan; Xie, Yu-Li; Zhang, Jin; Hu, Jian-Jun

    2015-01-01

    Aldehyde dehydrogenases (ALDHs) constitute a superfamily of NAD(P)+-dependent enzymes that catalyze the irreversible oxidation of a wide range of reactive aldehydes to their corresponding nontoxic carboxylic acids. ALDHs have been studied in many organisms from bacteria to mammals; however, no systematic analyses incorporating genome organization, gene structure, expression profiles, and cis-acting elements have been conducted in the model tree species Populus trichocarpa thus far. In this study, a comprehensive analysis of the Populus ALDH gene superfamily was performed. A total of 26 Populus ALDH genes were found to be distributed across 12 chromosomes. Genomic organization analysis indicated that purifying selection may have played a pivotal role in the retention and maintenance of PtALDH gene families. The exon-intron organizations of PtALDHs were highly conserved within the same family, suggesting that the members of the same family also may have conserved functionalities. Microarray data and qRT-PCR analysis indicated that most PtALDHs had distinct tissue-specific expression patterns. The specificity of cis-acting elements in the promoter regions of the PtALDHs and the divergence of expression patterns between nine paralogous PtALDH gene pairs suggested that gene duplications may have freed the duplicate genes from the functional constraints. The expression levels of some ALDHs were up- or down-regulated by various abiotic stresses, implying that the products of these genes may be involved in the adaptation of Populus to abiotic stresses. Overall, the data obtained from our investigation contribute to a better understanding of the complexity of the Populus ALDH gene superfamily and provide insights into the function and evolution of ALDH gene families in vascular plants.

  16. Fungal and host transcriptome analysis of pH-regulated genes during colonization of apple fruits by Penicillium expansum.

    PubMed

    Barad, Shiri; Sela, Noa; Kumar, Dilip; Kumar-Dubey, Amit; Glam-Matana, Nofar; Sherman, Amir; Prusky, Dov

    2016-05-04

    Penicillium expansum is a destructive phytopathogen that causes decay in deciduous fruits during postharvest handling and storage. During colonization the fungus secretes D-gluconic acid (GLA), which modulates environmental pH and regulates mycotoxin accumulation in colonized tissue. Till now no transcriptomic analysis has addressed the specific contribution of the pathogen's pH regulation to the P. expansum colonization process. For this purpose total RNA from the leading edge of P. expansum-colonized apple tissue of cv. 'Golden Delicious' and from fungal cultures grown under pH 4 or 7 were sequenced and their gene expression patterns were compared. We present a large-scale analysis of the transcriptome data of P. expansum and apple response to fungal colonization. The fungal analysis revealed nine different clusters of gene expression patterns that were divided among three major groups in which the colonized tissue showed, respectively: (i) differing transcript expression patterns between mycelial growth at pH 4 and pH 7; (ii) similar transcript expression patterns of mycelial growth at pH 4; and (iii) similar transcript expression patterns of mycelial growth at pH 7. Each group was functionally characterized in order to decipher genes that are important for pH regulation and also for colonization of apple fruits by Penicillium. Furthermore, comparison of gene expression of healthy apple tissue with that of colonized tissue showed that differentially expressed genes revealed up-regulation of the jasmonic acid and mevalonate pathways, and also down-regulation of the glycogen and starch biosynthesis pathways. Overall, we identified important genes and functionalities of P. expansum that were controlled by the environmental pH. Differential expression patterns of genes belonging to the same gene family suggest that genes were selectively activated according to their optimal environmental conditions (pH, in vitro or in vivo) to enable the fungus to cope with varying conditions and to make optimal use of available enzymes. Comparison between the activation of the colonized host's gene responses by alkalizing Colletotrichum gloeosporioides and acidifying P. expansum pathogens indicated similar gene response patterns, but stronger responses to P. expansum, suggesting the importance of acidification by P. expansum as a factor in its increased aggressiveness.

  17. Structure and expression of GSL1 and GSL2 genes encoding gibberellin stimulated-like proteins in diploid and highly heterozygous tetraploid potato reveals their highly conserved and essential status.

    PubMed

    Meiyalaghan, Sathiyamoorthy; Thomson, Susan J; Fiers, Mark W E J; Barrell, Philippa J; Latimer, Julie M; Mohan, Sara; Jones, E Eirian; Conner, Anthony J; Jacobs, Jeanne M E

    2014-01-02

    GSL1 and GSL2, Gibberellin Stimulated-Like proteins (also known as Snakin-1 and Snakin-2), are cysteine-rich peptides from potato (Solanum tuberosum L.) with antimicrobial properties. Similar peptides in other species have been implicated in diverse biological processes and are hypothesised to play a role in several aspects of plant development, plant responses to biotic or abiotic stress through their participation in hormone crosstalk, and redox homeostasis. To help resolve the biological roles of GSL1 and GSL2 peptides we have undertaken an in depth analysis of the structure and expression of these genes in potato. We have characterised the full length genes for both GSL1 (chromosome 4) and GSL2 (chromosome 1) from diploid and tetraploid potato using the reference genome sequence of potato, coupled with further next generation sequencing of four highly heterozygous tetraploid cultivars. The frequency of SNPs in GSL1 and GSL2 were very low with only one SNP every 67 and 53 nucleotides in exon regions of GSL1 and GSL2, respectively. Analysis of comprehensive RNA-seq data substantiated the role of specific promoter motifs in transcriptional control of gene expression. Expression analysis based on the frequency of next generation sequence reads established that GSL2 was expressed at a higher level than GSL1 in 30 out of 32 tissue and treatment libraries. Furthermore, both the GSL1 and GSL2 genes exhibited constitutive expression that was not up regulated in response to biotic or abiotic stresses, hormone treatments or wounding. Potato transformation with antisense knock-down expression cassettes failed to recover viable plants. The potato GSL1 and GSL2 genes are very highly conserved suggesting they contribute to an important biological function. The known antimicrobial activity of the GSL proteins, coupled with the FPKM analysis from RNA-seq data, implies that both genes contribute to the constitutive defence barriers in potatoes. The lethality of antisense knock-down expression of GSL1 and GSL2, coupled with the rare incidence of SNPs in these genes, suggests an essential role for this gene family. These features are consistent with the GSL protein family playing a role in several aspects of plant development in addition to plant defence against biotic stresses.

  18. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kinoshita, Takashi; Nohata, Nijiro; Fuse, Miki

    Highlights: Black-Right-Pointing-Pointer Tumor suppressive microRNA-133a regulates moesin (MSN) expression in HNSCC. Black-Right-Pointing-Pointer Silencing of MSN in HNSCC cells suppressed proliferation, migration and invasion. Black-Right-Pointing-Pointer The expression level of MSN was significantly up-regulated in cancer tissues. -- Abstract: Recently, many studies suggest that microRNAs (miRNAs) contribute to the development, invasion and metastasis of various types of human cancers. Our recent study revealed that expression of microRNA-133a (miR-133a) was significantly reduced in head and neck squamous cell carcinoma (HNSCC) and that restoration of miR-133a inhibited cell proliferation, migration and invasion in HNSCC cell lines, suggesting that miR-133a function as a tumor suppressor.more » Genome-wide gene expression analysis of miR-133a transfectants and TargetScan database showed that moesin (MSN) was a promising candidate of miR-133a target gene. MSN is a member of the ERM (ezrin, radixin and moesin) protein family and ERM function as cross-linkers between plasma membrane and actin-based cytoskeleton. The functions of MSN in cancers are controversial in previous reports. In this study, we focused on MSN and investigated whether MSN was regulated by tumor suppressive miR-133a and contributed to HNSCC oncogenesis. Restoration of miR-133a in HNSCC cell lines (FaDu, HSC3, IMC-3 and SAS) suppressed the MSN expression both in mRNA and protein level. Silencing study of MSN in HNSCC cell lines demonstrated significant inhibitions of cell proliferation, migration and invasion activities in si-MSN transfectants. In clinical specimen with HNSCC, the expression level of MSN was significantly up-regulated in cancer tissues compared to adjacent non-cancerous tissues. These data suggest that MSN may function as oncogene and is regulated by tumor suppressive miR-133a. Our analysis data of novel tumor-suppressive miR-133a-mediated cancer pathways could provide new insights into the potential mechanisms of HNSCC oncogenesis.« less

  19. A role for transforming growth factor-{beta} apoptotic signaling pathway in liver injury induced by ingestion of water contaminated with high levels of Cr(VI)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Rafael, A.I.; Almeida, A.; Santos, P.

    2007-10-15

    Hexavalent chromium [Cr(VI)] exposure is commonly associated with lung cancer. Although other adverse health effects have been reported, some authors, on assuming that orally ingested Cr(VI) is efficiently detoxified upon reduction by body fluids, believe that Cr(VI) do not target cells other than respiratory tract cells. In rodents, ingested Cr(VI)-contaminated water was reported to induce, in the liver, increases in TGF-{beta} transcripts. As TGF-{beta} dependent signaling pathways are closely associated with hepatic injury, the present study was undertaken addressing two specific issues: the effects of ingestion of water contaminated with high levels of Cr(VI) in rat liver structure and function;more » and the role of the TGF-{beta} pathway in Cr(VI)-induced liver injury. Examination of Wistar rats exposed to 20 ppm Cr(VI)-contaminated water for 10 weeks showed increased serum glucose and alanine aminotransferase (ALT) levels. Liver histological examination revealed hepatocellular apoptosis, further confirmed by immunohystochemical study of Caspase 3 expression. Liver gene expression analysis revealed increased expression of Smad2/Smad4 and Dapk, suggesting the involvement of the TGF-{beta} pathway in the apoptotic process. Since no changes in Smad3 expression were observed it appears apoptosis is using a Smad3-independent pathway. Increased expression of both Caspase 8 and Daxx genes suggests also the involvement of the Fas pathway. Gene expression analysis also revealed that a p160{sup ROCK}-Rho-independent pathway operates, leading to cell contraction and membrane blebbing, characteristic apoptotic features. These findings suggest that either the amount of Cr(VI) ingested overwhelmed the body fluids reductive capacity or some Cr(VI) escapes the reductive protection barrier, thus targeting the liver and inducing apoptosis.« less

  20. EMP2 is a novel therapeutic target for endometrial cancer stem cells

    PubMed Central

    Kiyohara, Meagan H.; Dillard, Christen; Tsui, Jessica; Kim, Sara Ruth; Lu, Jianyi; Sachdev, Divya; Goodglick, Lee; Tong, Maomeng; Torous, Vanda Farahmand; Aryasomayajula, Chinmayi; Wang, Wei; Najafzadeh, Parisa; Gordon, Lynn K.; Braun, Jonathan; McDermott, Sean; Wicha, Max S.; Wadehra, Madhuri

    2017-01-01

    Previous studies have suggested that overexpression of the oncogenic protein epithelial membrane protein-2 (EMP2) correlates with endometrial carcinoma progression and ultimately poor survival from disease. To understand the role of EMP2 in the etiology of disease, gene analysis was performed to show transcripts that are reciprocally regulated by EMP2 levels. In particular, EMP2 expression correlates with and helps regulate the expression of several cancer stem cell associated markers including aldehyde dehydrogenase 1 (ALDH1). ALDH expression significantly promotes tumor initiation and correlates with the levels of EMP2 expression in both patient samples and tumor cell lines. As therapy against CSCs in endometrial cancer is lacking, the ability of anti-EMP2 IgG1 therapy to reduce primary and secondary tumor formation using xenograft HEC1A models was determined. Anti-EMP2 IgG1 reduced the expression and activity of ALDH and correspondingly reduced both primary and secondary tumor load. Our results collectively suggest that anti-EMP2 therapy may be a novel method of reducing endometrial cancer stem cells. PMID:28604744

  1. Characterization of the molecular features and expression patterns of two serine proteases in Hermetia illucens (Diptera: Stratiomyidae) larvae.

    PubMed

    Kim, Wontae; Bae, Sungwoo; Kim, Ayoung; Park, Kwanho; Lee, Sangbeom; Choi, Youngcheol; Han, Sangmi; Park, Younghan; Koh, Youngho

    2011-06-01

    To investigate the molecular scavenging capabilities of the larvae of Hermetia illucens, two serine proteases (SPs) were cloned and characterized. Multiple sequence alignments and phylogenetic tree analysis of the deduced amino acid sequences of Hi-SP1 and Hi-SP2 were suggested that Hi-SP1 may be a chymotrypsin- and Hi-SP2 may be a trypsin-like protease. Hi-SP1 and Hi-SP2 3-D homology models revealed that a catalytic triad, three disulfide bonds, and a substrate-binding pocket were highly conserved, as would be expected of a SP. E. coli expressed Hi-SP1 and Hi-SP2 showed chymotrypsin or trypsin activities, respectively. Hi-SP2 mRNAs were consistently expressed during larval development. In contrast, the expression of Hi-SP1 mRNA fluctuated between feeding and molting stages and disappeared at the pupal stages. These expression pattern differences suggest that Hi-SP1 may be a larval specific chymotrypsin-like protease involved with food digestion, while Hi-SP2 may be a trypsin-like protease with diverse functions at different stages.

  2. Genome-wide transcriptome and expression profile analysis of Phalaenopsis during explant browning.

    PubMed

    Xu, Chuanjun; Zeng, Biyu; Huang, Junmei; Huang, Wen; Liu, Yumei

    2015-01-01

    Explant browning presents a major problem for in vitro culture, and can lead to the death of the explant and failure of regeneration. Considerable work has examined the physiological mechanisms underlying Phalaenopsis leaf explant browning, but the molecular mechanisms of browning remain elusive. In this study, we used whole genome RNA sequencing to examine Phalaenopsis leaf explant browning at genome-wide level. We first used Illumina high-throughput technology to sequence the transcriptome of Phalaenopsis and then performed de novo transcriptome assembly. We assembled 79,434,350 clean reads into 31,708 isogenes and generated 26,565 annotated unigenes. We assigned Gene Ontology (GO) terms, Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations, and potential Pfam domains to each transcript. Using the transcriptome data as a reference, we next analyzed the differential gene expression of explants cultured for 0, 3, and 6 d, respectively. We then identified differentially expressed genes (DEGs) before and after Phalaenopsis explant browning. We also performed GO, KEGG functional enrichment and Pfam analysis of all DEGs. Finally, we selected 11 genes for quantitative real-time PCR (qPCR) analysis to confirm the expression profile analysis. Here, we report the first comprehensive analysis of transcriptome and expression profiles during Phalaenopsis explant browning. Our results suggest that Phalaenopsis explant browning may be due in part to gene expression changes that affect the secondary metabolism, such as: phenylpropanoid pathway and flavonoid biosynthesis. Genes involved in photosynthesis and ATPase activity have been found to be changed at transcription level; these changes may perturb energy metabolism and thus lead to the decay of plant cells and tissues. This study provides comprehensive gene expression data for Phalaenopsis browning. Our data constitute an important resource for further functional studies to prevent explant browning.

  3. Genome-Wide Transcriptome and Expression Profile Analysis of Phalaenopsis during Explant Browning

    PubMed Central

    Xu, Chuanjun; Zeng, Biyu; Huang, Junmei; Huang, Wen; Liu, Yumei

    2015-01-01

    Background Explant browning presents a major problem for in vitro culture, and can lead to the death of the explant and failure of regeneration. Considerable work has examined the physiological mechanisms underlying Phalaenopsis leaf explant browning, but the molecular mechanisms of browning remain elusive. In this study, we used whole genome RNA sequencing to examine Phalaenopsis leaf explant browning at genome-wide level. Methodology/Principal Findings We first used Illumina high-throughput technology to sequence the transcriptome of Phalaenopsis and then performed de novo transcriptome assembly. We assembled 79,434,350 clean reads into 31,708 isogenes and generated 26,565 annotated unigenes. We assigned Gene Ontology (GO) terms, Kyoto Encyclopedia of Genes and Genomes (KEGG) annotations, and potential Pfam domains to each transcript. Using the transcriptome data as a reference, we next analyzed the differential gene expression of explants cultured for 0, 3, and 6 d, respectively. We then identified differentially expressed genes (DEGs) before and after Phalaenopsis explant browning. We also performed GO, KEGG functional enrichment and Pfam analysis of all DEGs. Finally, we selected 11 genes for quantitative real-time PCR (qPCR) analysis to confirm the expression profile analysis. Conclusions/Significance Here, we report the first comprehensive analysis of transcriptome and expression profiles during Phalaenopsis explant browning. Our results suggest that Phalaenopsis explant browning may be due in part to gene expression changes that affect the secondary metabolism, such as: phenylpropanoid pathway and flavonoid biosynthesis. Genes involved in photosynthesis and ATPase activity have been found to be changed at transcription level; these changes may perturb energy metabolism and thus lead to the decay of plant cells and tissues. This study provides comprehensive gene expression data for Phalaenopsis browning. Our data constitute an important resource for further functional studies to prevent explant browning. PMID:25874455

  4. Functional characterization of two new members of the caffeoyl CoA O-methyltransferase-like gene family from Vanilla planifolia reveals a new class of plastid-localized O-methyltransferases.

    PubMed

    Widiez, Thomas; Hartman, Thomas G; Dudai, Nativ; Yan, Qing; Lawton, Michael; Havkin-Frenkel, Daphna; Belanger, Faith C

    2011-08-01

    Caffeoyl CoA O-methyltransferases (OMTs) have been characterized from numerous plant species and have been demonstrated to be involved in lignin biosynthesis. Higher plant species are known to have additional caffeoyl CoA OMT-like genes, which have not been well characterized. Here, we identified two new caffeoyl CoA OMT-like genes by screening a cDNA library from specialized hair cells of pods of the orchid Vanilla planifolia. Characterization of the corresponding two enzymes, designated Vp-OMT4 and Vp-OMT5, revealed that in vitro both enzymes preferred as a substrate the flavone tricetin, yet their sequences and phylogenetic relationships to other enzymes are distinct from each other. Quantitative analysis of gene expression indicated a dramatic tissue-specific expression pattern for Vp-OMT4, which was highly expressed in the hair cells of the developing pod, the likely location of vanillin biosynthesis. Although Vp-OMT4 had a lower activity with the proposed vanillin precursor, 3,4-dihydroxybenzaldehyde, than with tricetin, the tissue specificity of expression suggests it may be a candidate for an enzyme involved in vanillin biosynthesis. In contrast, the Vp-OMT5 gene was mainly expressed in leaf tissue and only marginally expressed in pod hair cells. Phylogenetic analysis suggests Vp-OMT5 evolved from a cyanobacterial enzyme and it clustered within a clade in which the sequences from eukaryotic species had predicted chloroplast transit peptides. Transient expression of a GFP-fusion in tobacco demonstrated that Vp-OMT5 was localized in the plastids. This is the first flavonoid OMT demonstrated to be targeted to the plastids.

  5. Etanercept Promotes Bone Formation via Suppression of Dickkopf-1 Expression in Rats with Collagen-Induced Arthritis

    PubMed Central

    Tanida, Atsushi; Kishimoto, Yuji; Okano, Toru; Hagino, Hiroshi

    2013-01-01

    Background Various clinical reports suggest etanercept (ETN) has some efficacy in bone formation in rheumatoid arthritis (RA). To examine this effect, we investigated the gene expression of cytokines relevant to osteoblast/osteoclast differentiation, and evaluated histomorphometric findings in mature rats with collagen-induced arthritis (CIA). Methods Total RNA was extracted from knee joints with CIA after ETN or placebo administration. Subsequently, realtime-PCR was carried out to quantify the mRNAs encoding Wnt-1, Dickkopf-1 (DKK-1), receptor activator of nuclear factor kappa-B ligand (RANKL), osteoprotegelin (OPG) and TNF (tumor necrosis factor)-alpha. In histomorphometric analysis, the infiltrating pannus volume and pannus surface, and the following items in contact with pannus surface were measured: osteoclast number, osteoid surface, osteoid volume and labeling surface. These were evaluated in the distal femur with CIA with or without ETN administration. Results TNF-alpha, RANKL and OPG mRNA expressions, linked to osteoclastogenesis, were not significantly different with or without ETN administration. ETN administration significantly increased Wnt-1 mRNA expression, the osteoblast promoter, and decreased DKK-1 mRNA expression, the Wnt signal inhibitor. In histomorphometric analysis, pannus volume, pannus surface and osteoclast number, parameters of bone destruction, were not significantly different among groups. Osteoid volume, osteoid surface and labeling surface, parameters of bone formation, increased significantly with ETN administration. Conclusion Our results suggest that ETN suppresses DDK-1 expression, and, as a result, Wnt expression is promoted and osteoblastogenesis becomes more active, independent of the regulation of osteoclast activity. Marked bone formation is attributed to the fact that ETN directly promotes osteoblastogenesis, not as a result of suppressing osteoclastogenesis. PMID:24031147

  6. Genome-wide characterization and analysis of F-box protein-encoding genes in the Malus domestica genome.

    PubMed

    Cui, Hao-Ran; Zhang, Zheng-Rong; Lv, Wei; Xu, Jia-Ning; Wang, Xiao-Yun

    2015-08-01

    The F-box protein family is a large family that is characterized by conserved F-box domains of approximately 40-50 amino acids in the N-terminus. F-box proteins participate in diverse cellular processes, such as development of floral organs, signal transduction and response to stress, primarily as a component of the Skp1-cullin-F-box (SCF) complex. In this study, using a global search of the apple genome, 517 F-box protein-encoding genes (F-box genes for short) were identified and further subdivided into 12 groups according to the characterization of known functional domains, which suggests the different potential functions or processes that they were involved in. Among these domains, the galactose oxidase domain was analyzed for the first time in plants, and this domain was present with or without the Kelch domain. The F-box genes were distributed in all 17 apple chromosomes with various densities and tended to form gene clusters. Spatial expression profile analysis revealed that F-box genes have organ-specific expression and are widely expressed in all organs. Proteins that contained the galactose oxidase domain were highly expressed in leaves, flowers and seeds. From a fruit ripening expression profile, 166 F-box genes were identified. The expressions of most of these genes changed little during maturation, but five of them increased significantly. Using qRT-PCR to examine the expression of F-box genes encoding proteins with domains related to stress, the results revealed that F-box proteins were up- or down-regulated, which suggests that F-box genes were involved in abiotic stress. The results of this study helped to elucidate the functions of F-box proteins, especially in Rosaceae plants.

  7. Transposable elements contribute to activation of maize genes in response to abiotic stress.

    PubMed

    Makarevitch, Irina; Waters, Amanda J; West, Patrick T; Stitzer, Michelle; Hirsch, Candice N; Ross-Ibarra, Jeffrey; Springer, Nathan M

    2015-01-01

    Transposable elements (TEs) account for a large portion of the genome in many eukaryotic species. Despite their reputation as "junk" DNA or genomic parasites deleterious for the host, TEs have complex interactions with host genes and the potential to contribute to regulatory variation in gene expression. It has been hypothesized that TEs and genes they insert near may be transcriptionally activated in response to stress conditions. The maize genome, with many different types of TEs interspersed with genes, provides an ideal system to study the genome-wide influence of TEs on gene regulation. To analyze the magnitude of the TE effect on gene expression response to environmental changes, we profiled gene and TE transcript levels in maize seedlings exposed to a number of abiotic stresses. Many genes exhibit up- or down-regulation in response to these stress conditions. The analysis of TE families inserted within upstream regions of up-regulated genes revealed that between four and nine different TE families are associated with up-regulated gene expression in each of these stress conditions, affecting up to 20% of the genes up-regulated in response to abiotic stress, and as many as 33% of genes that are only expressed in response to stress. Expression of many of these same TE families also responds to the same stress conditions. The analysis of the stress-induced transcripts and proximity of the transposon to the gene suggests that these TEs may provide local enhancer activities that stimulate stress-responsive gene expression. Our data on allelic variation for insertions of several of these TEs show strong correlation between the presence of TE insertions and stress-responsive up-regulation of gene expression. Our findings suggest that TEs provide an important source of allelic regulatory variation in gene response to abiotic stress in maize.

  8. Structured association analysis leads to insight into Saccharomyces cerevisiae gene regulation by finding multiple contributing eQTL hotspots associated with functional gene modules.

    PubMed

    Curtis, Ross E; Kim, Seyoung; Woolford, John L; Xu, Wenjie; Xing, Eric P

    2013-03-21

    Association analysis using genome-wide expression quantitative trait locus (eQTL) data investigates the effect that genetic variation has on cellular pathways and leads to the discovery of candidate regulators. Traditional analysis of eQTL data via pairwise statistical significance tests or linear regression does not leverage the availability of the structural information of the transcriptome, such as presence of gene networks that reveal correlation and potentially regulatory relationships among the study genes. We employ a new eQTL mapping algorithm, GFlasso, which we have previously developed for sparse structured regression, to reanalyze a genome-wide yeast dataset. GFlasso fully takes into account the dependencies among expression traits to suppress false positives and to enhance the signal/noise ratio. Thus, GFlasso leverages the gene-interaction network to discover the pleiotropic effects of genetic loci that perturb the expression level of multiple (rather than individual) genes, which enables us to gain more power in detecting previously neglected signals that are marginally weak but pleiotropically significant. While eQTL hotspots in yeast have been reported previously as genomic regions controlling multiple genes, our analysis reveals additional novel eQTL hotspots and, more interestingly, uncovers groups of multiple contributing eQTL hotspots that affect the expression level of functional gene modules. To our knowledge, our study is the first to report this type of gene regulation stemming from multiple eQTL hotspots. Additionally, we report the results from in-depth bioinformatics analysis for three groups of these eQTL hotspots: ribosome biogenesis, telomere silencing, and retrotransposon biology. We suggest candidate regulators for the functional gene modules that map to each group of hotspots. Not only do we find that many of these candidate regulators contain mutations in the promoter and coding regions of the genes, in the case of the Ribi group, we provide experimental evidence suggesting that the identified candidates do regulate the target genes predicted by GFlasso. Thus, this structured association analysis of a yeast eQTL dataset via GFlasso, coupled with extensive bioinformatics analysis, discovers a novel regulation pattern between multiple eQTL hotspots and functional gene modules. Furthermore, this analysis demonstrates the potential of GFlasso as a powerful computational tool for eQTL studies that exploit the rich structural information among expression traits due to correlation, regulation, or other forms of biological dependencies.

  9. Expression analysis of URI/RMP gene in endometrioid adenocarcinoma by tissue microarray immunohistochemistry.

    PubMed

    Gu, Junxia; Liang, Yuting; Qiao, Longwei; Li, Xiaoyun; Li, Xingang; Lu, Yaojuan; Zheng, Qiping

    2013-01-01

    Multiple studies have recently demonstrated the oncogenic property of URI (or RMP, a member of the prefoldin family of molecular chaperones) during progression of hepatocellular carcinoma, ovarian cancer, and possibly prostate cancer. Most recently, we have shown that URI/RMP is up-regulated in cervical cancer, another reproductive system tumor beside ovarian and prostate cancers. To investigate if URI/RMP also plays a role in other reproductive system tumors, especially in endometrioid adenocarcinoma, we analyzed URI/RMP expression in a TMA (tissue microarray) containing tissues from 30 cases of endometrioid adenocarcinoma (which covers tumor tissues from Grade I through Grade III) and adjacent endometrium by immunohistochemistry (IHC) and densitometry analysis using image-pro plus 6.0 software. Our results showed that the mean density of URI/RMP expression in cancerous tissue is slightly higher than that of the adjacent endometrial tissue, though not statistically significant (p>0.05). There is no significant difference either between the mean density of Grade III cancerous tissue and that of Grade I and II cancers. Notably, we detected significantly higher signal intensity in cancerous tissue of all 7 Grade III cases than that of their adjacent endometrial tissue (p<0.05), suggesting a correlation of URI/RMP expression with the differentiation and pathological classification of endometrioid adenocarcinoma. Together, our results demonstrate the heterogeneous expression of URI/RMP in endometrioid adenocarcinoma. The higher level of URI/RMP expression in high-grade endometrioid adenocarcinomas compared to tissues of adjacent endometrium or gland suggests a diagnostic and possibly, a prognostic value of URI/RMP in endometrioid adenocarcinoma.

  10. Expression analysis of URI/RMP gene in endometrioid adenocarcinoma by tissue microarray immunohistochemistry

    PubMed Central

    Gu, Junxia; Liang, Yuting; Qiao, Longwei; Li, Xiaoyun; Li, Xingang; Lu, Yaojuan; Zheng, Qiping

    2013-01-01

    Multiple studies have recently demonstrated the oncogenic property of URI (or RMP, a member of the prefoldin family of molecular chaperones) during progression of hepatocellular carcinoma, ovarian cancer, and possibly prostate cancer. Most recently, we have shown that URI/RMP is up-regulated in cervical cancer, another reproductive system tumor beside ovarian and prostate cancers. To investigate if URI/RMP also plays a role in other reproductive system tumors, especially in endometrioid adenocarcinoma, we analyzed URI/RMP expression in a TMA (tissue microarray) containing tissues from 30 cases of endometrioid adenocarcinoma (which covers tumor tissues from Grade I through Grade III) and adjacent endometrium by immunohistochemistry (IHC) and densitometry analysis using image-pro plus 6.0 software. Our results showed that the mean density of URI/RMP expression in cancerous tissue is slightly higher than that of the adjacent endometrial tissue, though not statistically significant (p>0.05). There is no significant difference either between the mean density of Grade III cancerous tissue and that of Grade I and II cancers. Notably, we detected significantly higher signal intensity in cancerous tissue of all 7 Grade III cases than that of their adjacent endometrial tissue (p<0.05), suggesting a correlation of URI/RMP expression with the differentiation and pathological classification of endometrioid adenocarcinoma. Together, our results demonstrate the heterogeneous expression of URI/RMP in endometrioid adenocarcinoma. The higher level of URI/RMP expression in high-grade endometrioid adenocarcinomas compared to tissues of adjacent endometrium or gland suggests a diagnostic and possibly, a prognostic value of URI/RMP in endometrioid adenocarcinoma. PMID:24228101

  11. Apoptosis induced by low-level laser in polymorphonuclear cells of acute joint inflammation: comparative analysis of two energy densities.

    PubMed

    Dos Anjos, Lúcia Mara Januário; da Fonseca, Adenilson de Souza; Gameiro, Jacy; de Paoli, Flávia

    2017-07-01

    Anti-inflammatory property of low-level laser therapy (LLLT) has been widely described in literature, although action mechanisms are not always clarified. Thus, this study aimed to evaluate apoptosis mechanisms in the LLLT anti-inflammatory effects on the arthritis experimental model in vivo at two different energy densities (3 and 30 Jcm -2 ). Arthritis was induced in mice by zymosan solution, animals were distributed into five groups, and morphological analysis, immunocytochemistry and gene expressions for apoptotic proteins were performed. Data showed an anti-inflammatory effect, DNA fragmentation in polymorphonuclear (PMN) cells and alteration in gene expression of proteins related to apoptosis pathways after LLLT. p53 gene expression increased at both energy densities, Bcl2 gene expression increased at 3 Jcm -2 , and Bcl2 tissue expression decreased at 30 Jcm -2 . In addition, apoptosis was restricted to PMN cells. Results suggest that apoptosis in PMN cells comprise part of LLLT anti-inflammatory mechanisms by disbalance promotion between expression of pro-apoptotic (Bax and p53) and anti-apoptotic (Bcl-2) proteins, with pro-apoptotic gene expression selectively in PMN cells.

  12. Increase in the adhesion molecule P-selectin in endothelium overlying atherosclerotic plaques. Coexpression with intercellular adhesion molecule-1.

    PubMed Central

    Johnson-Tidey, R. R.; McGregor, J. L.; Taylor, P. R.; Poston, R. N.

    1994-01-01

    P-selectin (GMP-140) is an adhesion molecule present within endothelial cells that is rapidly translocated to the cell membrane upon activation, where it mediates endothelial-leukocyte interactions. Immunohistochemical analysis of human atherosclerotic plaques has shown strong expression of P-selectin by the endothelium overlying active atherosclerotic plaques. P-selectin is not, however, detected in normal arterial endothelium or in endothelium overlying inactive fibrous plaques. Color image analysis was used to quantitate the degree of P-selectin expression in the endothelium and demonstrates a statistically significant increase in P-selectin expression by atherosclerotic endothelial cells. Double immunofluorescence shows that some of this P-selectin is expressed on the luminal surface of the endothelial cells. Previous work has demonstrated a significant up-regulation in the expression of the intercellular adhesion molecule-1 in atherosclerotic endothelium and a study on the expression of intercellular adhesion molecule-1 and P-selectin in atherosclerosis shows a highly positive correlation. These results suggest that the selective and cooperative expression of P-selectin and intercellular adhesion molecule-1 may be involved in the recruitment of monocytes into sites of atherosclerosis. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:7513951

  13. Network Analysis Implicates Alpha-Synuclein (Snca) in the Regulation of Ovariectomy-Induced Bone Loss

    PubMed Central

    Calabrese, Gina; Mesner, Larry D.; Foley, Patricia L.; Rosen, Clifford J.; Farber, Charles R.

    2016-01-01

    The postmenopausal period in women is associated with decreased circulating estrogen levels, which accelerate bone loss and increase the risk of fracture. Here, we gained novel insight into the molecular mechanisms mediating bone loss in ovariectomized (OVX) mice, a model of human menopause, using co-expression network analysis. Specifically, we generated a co-expression network consisting of 53 gene modules using expression profiles from intact and OVX mice from a panel of inbred strains. The expression of four modules was altered by OVX, including module 23 whose expression was decreased by OVX across all strains. Module 23 was enriched for genes involved in the response to oxidative stress, a process known to be involved in OVX-induced bone loss. Additionally, module 23 homologs were co-expressed in human bone marrow. Alpha synuclein (Snca) was one of the most highly connected “hub” genes in module 23. We characterized mice deficient in Snca and observed a 40% reduction in OVX-induced bone loss. Furthermore, protection was associated with the altered expression of specific network modules, including module 23. In summary, the results of this study suggest that Snca regulates bone network homeostasis and ovariectomy-induced bone loss. PMID:27378017

  14. MicroRNA-34c-5p is related to recurrence in laryngeal squamous cell carcinoma.

    PubMed

    Re, Massimo; Çeka, Artan; Rubini, Corrado; Ferrante, Luigi; Zizzi, Antonio; Gioacchini, Federico M; Tulli, Michele; Spazzafumo, Liana; Sellari-Franceschini, Stefano; Procopio, Antonio D; Olivieri, Fabiola

    2015-09-01

    Altered microRNA expression has been found in many cancer types, including laryngeal squamous cell carcinoma (LSCC). We investigated the association of LSCC-related miR-34c-5p with disease-free survival and overall survival. Retrospective cohort study. Expression levels of miR-34c-5p were detected in 90 LSCC formalin-fixed paraffin-embedded tissues by reverse-transcription quantitative polymerase chain reaction. Overall survival and disease-free survival were evaluated using the Kaplan-Meier method, and multivariate analysis was performed using Cox proportional hazard analysis. A downregulation of miR-34c-5p expression significantly correlated with worse disease-free and overall survival. In the multivariate analysis, low miR-34c-5p expression was associated with an increased risk of recurrence. A downregulation of miR-34c-5p in LSCC is independently associated with unfavorable disease-free survival, suggesting that miR-34c-5p might be a promising marker for evaluating the risk of recurrences. NA. © 2015 The American Laryngological, Rhinological and Otological Society, Inc.

  15. Integrative Analysis of Longitudinal Metabolomics Data from a Personal Multi-Omics Profile

    PubMed Central

    Stanberry, Larissa; Mias, George I.; Haynes, Winston; Higdon, Roger; Snyder, Michael; Kolker, Eugene

    2013-01-01

    The integrative personal omics profile (iPOP) is a pioneering study that combines genomics, transcriptomics, proteomics, metabolomics and autoantibody profiles from a single individual over a 14-month period. The observation period includes two episodes of viral infection: a human rhinovirus and a respiratory syncytial virus. The profile studies give an informative snapshot into the biological functioning of an organism. We hypothesize that pathway expression levels are associated with disease status. To test this hypothesis, we use biological pathways to integrate metabolomics and proteomics iPOP data. The approach computes the pathways’ differential expression levels at each time point, while taking into account the pathway structure and the longitudinal design. The resulting pathway levels show strong association with the disease status. Further, we identify temporal patterns in metabolite expression levels. The changes in metabolite expression levels also appear to be consistent with the disease status. The results of the integrative analysis suggest that changes in biological pathways may be used to predict and monitor the disease. The iPOP experimental design, data acquisition and analysis issues are discussed within the broader context of personal profiling. PMID:24958148

  16. Study of pharmacological effects of nilvadipine on RCS rat retinal degeneration by microarray analysis.

    PubMed

    Sato, Motoya; Ohguro, Hiroshi; Ohguro, Ikuyo; Mamiya, Kazuhisa; Takano, Yoshiko; Yamazaki, Hitoshi; Metoki, Tomomi; Miyagawa, Yasuhiro; Ishikawa, Fotoshi; Nakazawa, Mitsuru

    2003-07-11

    In our recent study, we found that the Ca(2+) antagonist, nilvadipine caused significant preservation of photoreceptor cells in The Royal College of Surgeons (RCS) rats [Invest. Ophthalmol. Vis. Sci. 43 (2002) 919]. Here, to elucidate the mechanisms of nilvadipine-induced effects we analyzed altered gene expression of 1101 genes commonly expressed in rodent by DNA microarray analysis in the retinas of nilvadipine-treated and untreated RCS rats and SD rat. In the total number of genes, the expression of 30 genes was altered upon administration of nilvadipine to RCS rats, including several genes related to the apoptotic pathway and other mechanisms. Remarkably, neurotrophic factors, FGF-2 and Arc, known to suppress the apoptosis in the central nervous system, were up-regulated. These changes were also confirmed by real-time quantitative (Taqman) RT-PCR and Western blot analysis. Therefore, our present data suggested that administration of nilvadipine to RCS rats increases the expression of endogenous FGF-2 and Arc in retina, and potentially has a protective effect against retinal degeneration.

  17. Analysis of Gene Expression and Physiological Responses in Three Mexican Maize Landraces under Drought Stress and Recovery Irrigation

    PubMed Central

    Hayano-Kanashiro, Corina; Calderón-Vázquez, Carlos; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Simpson, June

    2009-01-01

    Background Drought is one of the major constraints for plant productivity worldwide. Different mechanisms of drought-tolerance have been reported for several plant species including maize. However, the differences in global gene expression between drought-tolerant and susceptible genotypes and their relationship to physiological adaptations to drought are largely unknown. The study of the differences in global gene expression between tolerant and susceptible genotypes could provide important information to design more efficient breeding programs to produce maize varieties better adapted to water limiting conditions. Methodology/Principal Findings Changes in physiological responses and gene expression patterns were studied under drought stress and recovery in three Mexican maize landraces which included two drought tolerant (Cajete criollo and Michoacán 21) and one susceptible (85-2) genotypes. Photosynthesis, stomatal conductance, soil and leaf water potentials were monitored throughout the experiment and microarray analysis was carried out on transcripts obtained at 10 and 17 days following application of stress and after recovery irrigation. The two tolerant genotypes show more drastic changes in global gene expression which correlate with different physiological mechanisms of adaptation to drought. Differences in the kinetics and number of up- and down-regulated genes were observed between the tolerant and susceptible maize genotypes, as well as differences between the two tolerant genotypes. Interestingly, the most dramatic differences between the tolerant and susceptible genotypes were observed during recovery irrigation, suggesting that the tolerant genotypes activate mechanisms that allow more efficient recovery after a severe drought. Conclusions/Significance A correlation between levels of photosynthesis and transcription under stress was observed and differences in the number, type and expression levels of transcription factor families were also identified under drought and recovery between the three maize landraces. Gene expression analysis suggests that the drought tolerant landraces have a greater capacity to rapidly modulate more genes under drought and recovery in comparison to the susceptible landrace. Modulation of a greater number of differentially expressed genes of different TF gene families is an important characteristic of the tolerant genotypes. Finally, important differences were also noted between the tolerant landraces that underlie different mechanisms of achieving tolerance. PMID:19888455

  18. Genome-wide gene phylogeny of CIPK family in cassava and expression analysis of partial drought-induced genes

    PubMed Central

    Hu, Wei; Xia, Zhiqiang; Yan, Yan; Ding, Zehong; Tie, Weiwei; Wang, Lianzhe; Zou, Meiling; Wei, Yunxie; Lu, Cheng; Hou, Xiaowan; Wang, Wenquan; Peng, Ming

    2015-01-01

    Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs) have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava. PMID:26579161

  19. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    NASA Technical Reports Server (NTRS)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  20. Revisiting inconsistency in large pharmacogenomic studies

    PubMed Central

    Safikhani, Zhaleh; Smirnov, Petr; Freeman, Mark; El-Hachem, Nehme; She, Adrian; Rene, Quevedo; Goldenberg, Anna; Birkbak, Nicolai J.; Hatzis, Christos; Shi, Leming; Beck, Andrew H.; Aerts, Hugo J.W.L.; Quackenbush, John; Haibe-Kains, Benjamin

    2017-01-01

    In 2013, we published a comparative analysis of mutation and gene expression profiles and drug sensitivity measurements for 15 drugs characterized in the 471 cancer cell lines screened in the Genomics of Drug Sensitivity in Cancer (GDSC) and Cancer Cell Line Encyclopedia (CCLE). While we found good concordance in gene expression profiles, there was substantial inconsistency in the drug responses reported by the GDSC and CCLE projects. We received extensive feedback on the comparisons that we performed. This feedback, along with the release of new data, prompted us to revisit our initial analysis. We present a new analysis using these expanded data, where we address the most significant suggestions for improvements on our published analysis — that targeted therapies and broad cytotoxic drugs should have been treated differently in assessing consistency, that consistency of both molecular profiles and drug sensitivity measurements should be compared across cell lines, and that the software analysis tools provided should have been easier to run, particularly as the GDSC and CCLE released additional data. Our re-analysis supports our previous finding that gene expression data are significantly more consistent than drug sensitivity measurements. Using new statistics to assess data consistency allowed identification of two broad effect drugs and three targeted drugs with moderate to good consistency in drug sensitivity data between GDSC and CCLE. For three other targeted drugs, there were not enough sensitive cell lines to assess the consistency of the pharmacological profiles. We found evidence of inconsistencies in pharmacological phenotypes for the remaining eight drugs. Overall, our findings suggest that the drug sensitivity data in GDSC and CCLE continue to present challenges for robust biomarker discovery. This re-analysis provides additional support for the argument that experimental standardization and validation of pharmacogenomic response will be necessary to advance the broad use of large pharmacogenomic screens. PMID:28928933

  1. Global miRNA expression profile reveals novel molecular players in aneurysmal subarachnoid haemorrhage.

    PubMed

    Lopes, Katia de Paiva; Vinasco-Sandoval, Tatiana; Vialle, Ricardo Assunção; Paschoal, Fernando Mendes; Bastos, Vanessa Albuquerque P Aviz; Bor-Seng-Shu, Edson; Teixeira, Manoel Jacobsen; Yamada, Elizabeth Sumi; Pinto, Pablo; Vidal, Amanda Ferreira; Ribeiro-Dos-Santos, Arthur; Moreira, Fabiano; Santos, Sidney; Paschoal, Eric Homero Albuquerque; Ribeiro-Dos-Santos, Ândrea

    2018-06-08

    The molecular mechanisms behind aneurysmal subarachnoid haemorrhage (aSAH) are still poorly understood. Expression patterns of miRNAs may help elucidate the post-transcriptional gene expression in aSAH. Here, we evaluate the global miRNAs expression profile (miRnome) of patients with aSAH to identify potential biomarkers. We collected 33 peripheral blood samples (27 patients with cerebral aneurysm, collected 7 to 10 days after the haemorrhage, when usually is the cerebral vasospasm risk peak, and six controls). Then, were performed small RNA sequencing using an Illumina Next Generation Sequencing (NGS) platform. Differential expression analysis identified eight differentially expressed miRNAs. Among them, three were identified being up-regulated, and five down-regulated. miR-486-5p was the most abundant expressed and is associated with poor neurological admission status. In silico miRNA gene target prediction showed 148 genes associated with at least two differentially expressed miRNAs. Among these, THBS1 and VEGFA, known to be related to thrombospondin and vascular endothelial growth factor. Moreover, MYC gene was found to be regulated by four miRNAs, suggesting an important role in aneurysmal subarachnoid haemorrhage. Additionally, 15 novel miRNAs were predicted being expressed only in aSAH, suggesting possible involvement in aneurysm pathogenesis. These findings may help the identification of novel biomarkers of clinical interest.

  2. Duplication of Dio3 genes in teleost fish and their divergent expression in skin during flatfish metamorphosis.

    PubMed

    Alves, R N; Cardoso, J C R; Harboe, T; Martins, R S T; Manchado, M; Norberg, B; Power, D M

    2017-05-15

    Deiodinase 3 (Dio3) plays an essential role during early development in vertebrates by controlling tissue thyroid hormone (TH) availability. The Atlantic halibut (Hippoglossus hippoglossus) possesses duplicate dio3 genes (dio3a and dio3b). Expression analysis indicates that dio3b levels change in abocular skin during metamorphosis and this suggests that this enzyme is associated with the divergent development of larval skin to the juvenile phenotype. In larvae exposed to MMI, a chemical that inhibits TH production, expression of dio3b in ocular skin is significantly up-regulated suggesting that THs normally modulate this genes expression during this developmental event. The molecular basis for divergent dio3a and dio3b expression and responsiveness to MMI treatment is explained by the multiple conserved TREs in the proximal promoter region of teleost dio3b and their absence from the promoter of dio3a. We propose that the divergent expression of dio3 in ocular and abocular skin during halibut metamorphosis contributes to the asymmetric pigment development in response to THs. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. Analysis of Sigma Receptor (σR1) expression in retinal ganglion cells cultured under hyperglycemic conditions and in diabetic mice

    PubMed Central

    Ola, M. Shamsul; Moore, Pamela; Maddox, Dennis; El-Sherbeny, Amira; Huang, Wei; Roon, Penny; Agarwal, Neeraj; Ganapathy, Vadivel; Smith, Sylvia B.

    2013-01-01

    Summary The type 1 sigma receptor (σR1) is a nonopiate and nonphencyclidine binding site that has numerous pharmacological and physiological functions. In some studies, agonists for σR1 have been shown to afford neuroprotective against overstimulation of the NMDA receptor. σR1 expression has been demonstrated recently in retinal ganglion cells (RGC). RGCs undergo apoptosis early in diabetic retinopathy via NMDA receptor overstimulation. In the present study we asked whether RGCs cultured under hyperglycemic conditions and RGCs of diabetic mice continue to express σ1. RGCs were cultured 48 h in RPMI medium containing either 45 mM glucose or 11 mM glucose plus 34 mM mannitol (osmolar control). C57BL/6 mice were made diabetic using streptozotocin. The retina was dissected from normal and streptozotocin-induced diabetic mice 3, 6 and 12 weeks post-onset of diabetes. σR1 was analyzed in cells using semiquantitative RT-PCR and in tissues σR1 by semiquantitative RT-PCR, in situ hybridization, western blot analysis and immunolocalization. The RT-PCR analysis of cultured RGCs showed that σR1 mRNA is expressed under hyperglycemic conditions at levels similar to control cells. Similarly, analysis of retinas of diabetic mice showed no difference in levels of mRNA encoding σR1 compared to retinas of control mice. In situ hybridization analysis showed that expression patterns of σR1 mRNA in the ganglion cell layer were similar between diabetic and control mice. Western blot analysis suggested that levels of σR1 in retina were similar between diabetic and control retinas. Immunohistochemical analysis of σR1 showed a similar pattern of σR1 protein expression between control and diabetic retina. These studies demonstrate that σR1 is expressed under hyperglycemic conditions in vitro and in vivo. PMID:12425939

  4. Analysis of sigma receptor (sigmaR1) expression in retinal ganglion cells cultured under hyperglycemic conditions and in diabetic mice.

    PubMed

    Ola, M Shamsul; Moore, Pamela; Maddox, Dennis; El-Sherbeny, Amira; Huang, Wei; Roon, Penny; Agarwal, Neeraj; Ganapathy, Vadivel; Smith, Sylvia B

    2002-11-15

    The type 1 sigma receptor (sigmaR1) is a nonopiate and nonphencyclidine binding site that has numerous pharmacological and physiological functions. In some studies, agonists for sigmaR1 have been shown to afford neuroprotection against overstimulation of the NMDA receptor. sigmaR1 expression has been demonstrated recently in retinal ganglion cells (RGC). RGCs undergo apoptosis early in diabetic retinopathy via NMDA receptor overstimulation. In the present study we asked whether RGCs cultured under hyperglycemic conditions and RGCs of diabetic mice continue to express sigmaR1. RGCs were cultured 48 h in RPMI medium containing either 45 mM glucose or 11 mM glucose plus 34 mM mannitol (osmolar control). C57BL/6 mice were made diabetic using streptozotocin. The retina was dissected from normal and streptozotocin-induced diabetic mice 3, 6 and 12 weeks post-onset of diabetes. sigmaR1 was analyzed in cells using semiquantitative RT-PCR and in tissues by semiquantitative RT-PCR, in situ hybridization, Western blot analysis and immunolocalization. The RT-PCR analysis of cultured RGCs showed that sigmaR1 mRNA is expressed under hyperglycemic conditions at levels similar to control cells. Similarly, analysis of retinas of diabetic mice showed no difference in levels of mRNA encoding sigmaR1 compared to retinas of control mice. In situ hybridization analysis showed that expression patterns of sigmaR1 mRNA in the ganglion cell layer were similar between diabetic and control mice. Western blot analysis suggested that levels of sigmaR1 in retina were similar between diabetic and control retinas. Immunohistochemical analysis of sigmaR1 showed a similar pattern of sigmaR1 protein expression between control and diabetic retina. These studies demonstrate that sigmaR1 is expressed under hyperglycemic conditions in vitro and in vivo.

  5. Folate hydrolase (prostate-specific membrane [corrected] antigen) 1 expression in bladder cancer subtypes and associated tumor neovasculature.

    PubMed

    Samplaski, Mary K; Heston, Warren; Elson, Paul; Magi-Galluzzi, Cristina; Hansel, Donna E

    2011-11-01

    Folate hydrolase (prostate-specific antigen) 1 (FH(PSA)1), also known as prostate-specific membrane antigen (PSMA), is a transmembrane receptor expressed on prostate cancer cells that correlates with a more aggressive phenotype. Recent studies have demonstrated FH(PSA)1 expression in numerous benign and malignant tissue types, as well as the malignant neovasculature. As FH(PSA)1 represents a diagnostic immunomarker for prostate cancer, we explored its expression pattern in various subtypes of bladder cancer. Immunohistochemical analysis (IHC) of FH(PSA)1 was performed using tissue microarrays constructed from 167 bladder cancers, including 96 urothelial carcinomas (UCCs), 37 squamous cell carcinomas, 17 adenocarcinomas and 17 small cell carcinomas. We used a FH(PSA)1 monoclonal antibody obtained from Dako (clone 3E6, dilution 1:100), which recognizes the epitope present in the 57-134 amino acid region of the extracellular portion of the PSMA molecule. Intensity of IHC staining was scored as 0 (no expression) to 3+ (strong expression), with 2-3+ IHC considered a positive result. FH(PSA)1 demonstrated expression in a subset of bladder cancers and was most common in small cell carcinoma (3/17; 18%), with concurrent expression in non-small cell components in a subset of cases (2/6). FH(PSA)1 expression was less frequent in UCC (3/96; 3%) and adenocarcinoma (2/17; 12%). None of the squamous cell carcinomas demonstrated tumor cell expression of FH(PSA)1. However, all bladder cancers examined expressed FH(PSA)1 in the tumor vasculature, suggesting a potential role for this molecule in mediating new vessel ingrowth. FH(PSA)1 may occasionally be expressed in various subtypes of bladder cancer. These findings suggest cautious use of FH(PSA)1 as a diagnostic marker for prostatic tissue invading the bladder. The finding of FH(PSA)1 in the bladder cancer neovasculature suggests that this molecule may promote tumor growth and may represent a potential new vascular target in this disease.

  6. Phytochromes A and C cooperatively regulate early and transient gene expression after red-light irradiation in rice seedlings.

    PubMed

    Kiyota, Seiichiro; Xie, Xianzhi; Takano, Makoto

    2012-02-01

    Phytochromes are red/far-red photoreceptors encoded by a small gene family in higher plants. Differences in phenotype among mutants suggest distinct functions among phytochrome subfamilies. We attempted to find distinct functions among phytochromes by oligo-microarray analysis of single, double, and triple mutants in rice. In most cases, gene expression was redundantly regulated by phytochromes A and B after irradiation by a red light pulse in etiolated rice shoots. However, we found that several genes were specifically regulated by phytochromes A and C. Most of them were expressed immediately after the red light pulse in a transient manner. They are stress-related genes that may be involved in resistance to light stress when etiolated seedlings are exposed to light. These genes were not expressed in green leaves after the red light pulse, suggesting that they have a function specific to etiolated seedlings. Copyright © 2011 Elsevier Masson SAS. All rights reserved.

  7. Misregulation of membrane trafficking processes in human nonalcoholic steatohepatitis.

    PubMed

    Dzierlenga, Anika L; Cherrington, Nathan J

    2018-03-01

    Nonalcoholic steatohepatitis (NASH) remodels the expression and function of genes and proteins that are critical for drug disposition. This study sought to determine whether disruption of membrane protein trafficking pathways in human NASH contributes to altered localization of multidrug resistance-associated protein 2 (MRP2). A comprehensive immunoblot analysis assessed the phosphorylation, membrane translocation, and expression of transporter membrane insertion regulators, including several protein kinases (PK), radixin, MARCKS, and Rab11. Radixin exhibited a decreased phosphorylation and total expression, whereas Rab11 had an increased membrane localization. PKCδ, PKCα, and PKA had increased membrane activation, whereas PKCε had a decreased phosphorylation and membrane expression. Radixin dephosphorylation may activate MRP2 membrane retrieval in NASH; however, the activation of Rab11/PKCδ and PKA/PKCα suggest an activation of membrane insertion pathways as well. Overall these data suggest an altered regulation of protein trafficking in human NASH, although other processes may be involved in the regulation of MRP2 localization. © 2018 Wiley Periodicals, Inc.

  8. Dramatic transcriptional changes in an intracellular parasite enable host switching between plant and insect.

    PubMed

    Oshima, Kenro; Ishii, Yoshiko; Kakizawa, Shigeyuki; Sugawara, Kyoko; Neriya, Yutaro; Himeno, Misako; Minato, Nami; Miura, Chihiro; Shiraishi, Takuya; Yamaji, Yasuyuki; Namba, Shigetou

    2011-01-01

    Phytoplasmas are bacterial plant pathogens that have devastating effects on the yields of crops and plants worldwide. They are intracellular parasites of both plants and insects, and are spread among plants by insects. How phytoplasmas can adapt to two diverse environments is of considerable interest; however, the mechanisms enabling the "host switching" between plant and insect hosts are poorly understood. Here, we report that phytoplasmas dramatically alter their gene expression in response to "host switching" between plant and insect. We performed a detailed characterization of the dramatic change that occurs in the gene expression profile of Candidatus Phytoplasma asteris OY-M strain (approximately 33% of the genes change) upon host switching between plant and insect. The phytoplasma may use transporters, secreted proteins, and metabolic enzymes in a host-specific manner. As phytoplasmas reside within the host cell, the proteins secreted from phytoplasmas are thought to play crucial roles in the interplay between phytoplasmas and host cells. Our microarray analysis revealed that the expression of the gene encoding the secreted protein PAM486 was highly upregulated in the plant host, which is also observed by immunohistochemical analysis, suggesting that this protein functions mainly when the phytoplasma grows in the plant host. Additionally, phytoplasma growth in planta was partially suppressed by an inhibitor of the MscL osmotic channel that is highly expressed in the plant host, suggesting that the osmotic channel might play an important role in survival in the plant host. These results also suggest that the elucidation of "host switching" mechanism may contribute to the development of novel pest controls.

  9. Overexpression of Pofut1 and activated Notch1 may be associated with poor prognosis in breast cancer.

    PubMed

    Wan, Guoxing; Tian, Lin; Yu, Yuandong; Li, Fang; Wang, Xuanbin; Li, Chen; Deng, Shouheng; Yu, Xiongjie; Cai, Xiaojun; Zuo, Zhigang; Cao, Fengjun

    2017-09-09

    The present study was to evaluate the prognostic value of protein expression of Pofut1 and Notch1 signaling in breast cancer. Formalin-fixed paraffin-embedded 314 breast specimens including 174 infiltrating ductal carcinoma(IDC), 50 ductal carcinoma in situ(DCIS) and 90 adjacent normal tissue(ANT) were immunohistochemically examined to evaluate the protein expression of Pofut1, activated Notch1(N1IC) and Slug on specimens. Survival analysis was performed by Kaplan-Meier method and Cox's proportional-hazards model. A online database was computationally used to further explore the prognostic role of Pofut1 and Notch1 mRNA expression by Kaplan-Meier Plotter. Pofut1, Slug and N1IC expression were significantly increased in IDC compared to ANT(all p < 0.05). High expression of Pofut1, Slug and N1IC were associated with tumor aggressiveness including lymph node metastasis (LNM: p = 0.005 for Pofut1, p < 0.001 for N1IC, p = 0.017 for Slug), advanced stage(p = 0.039 for Pofut1, p = 0.025 for N1IC) and higher histological grade(p = 0.001 for N1IC). Additionally, high expression of Pofut1 was found to be significantly associated with high expressions of N1IC and Slug in IDC(r = 0.244, p = 0.001; r = 0.374, p < 0.001, respectively), similar correlation was also observed between high N1IC and Slug expression(r = 0.496, p < 0.001). Moreover, Kaplan-Meier and Cox's regression analysis indicated the significant prognostic value of elevated Pofut1, N1IC, Slug expressions, positive LNM and advanced tumor stage for the prediction of a shorter disease-free survival (DFS) and overall survival(OS). The web-based analysis also suggested a significant association of high Pofut1 and Notch1 mRNA expression with worse survival outcome. Our findings suggested that overexpression of Pofut1 and activated Notch1 signaling may be associated with a poor prognosis in breast cancer. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Transcription profile analysis of Lycopersicum esculentum leaves, unravels volatile emissions and gene expression under salinity stress.

    PubMed

    Zhang, Jihong; Zeng, Li; Chen, Shaoyang; Sun, Helong; Ma, Shuang

    2018-05-01

    Salinity stress can impede development and plant growth adversely. However, there is very little molecular information on NaCl resistance and volatile emissions in Lycopersicum esculentum. In order to investigate the effects of salt stress on the release of volatile compounds, we quantified and compared transcriptome changes by RNA-Seq analysis and volatile constituents with gas chromatography/mass spectrometry (GC/MS) coupled with solid-phase microextraction (SPME) after exposure to continuous salt stress. Chemical analysis by GC-MS analysis revealed that NaCl stress had changed species and quantity of volatile compounds released. In this research, 21,578 unigenes that represented 44,714 assembled unique transcripts were separated from tomato leaves exposed to NaCl stress based on de novo transcriptome assembly. The total number of differentially expressed genes was 7210 after exposure to NaCl, including 6200 down-regulated and 1208 up-regulated genes. Among these differentially expressed genes (DEGs), there were eighteen differentially expressed genes associated with volatile biosynthesis. Of the unigenes, 3454 were mapped to 131 KEGG (Kyoto Encyclopedia of Genes and Genomes) pathways, mainly those are involved in RNA transport, plant-pathogen interactions, and plant hormone signal transduction. qRT-PCR analysis showed that NaCl exposure affected the expression profiles of the biosynthesis genes for eight volatile compounds (IPI, GPS, and TPS, etc.), which corresponded well with the RNA-Seq analysis and GC-MS results. Our results suggest that NaCl stress affects the emission of volatile substances from L. esculentum leaves by regulating the expression of genes that are involved in volatile organic compounds' biosynthesis. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  11. Oligonucleotide microarray analysis of apoptosis induced by 15-methoxypinusolidic acid in microglial BV2 cells

    PubMed Central

    Choi, Y; Lim, SY; Jeong, HS; Koo, KA; Sung, SH; Kim, YC

    2009-01-01

    Background and purpose: We conducted a genome wide gene expression analysis to explore the biological aspects of 15-methoxypinusolidic acid (15-MPA) isolated from Biota orientalis and tried to confirm the suitability of 15-MPA as a therapeutic candidate for CNS injuries focusing on microglia. Experimental approach: Murine microglial BV2 cells were treated with 15-MPA, and their transcriptome was analysed by using oligonucleotide microarrays. Genes differentially expressed upon 15-MPA treatment were selected for RT-PCR (reverse transcription-polymerase chain reaction) analysis to confirm the gene expression. Inhibition of cell proliferation and induction of apoptosis by 15-MPA were examined by bromodeoxyuridine assay, Western blot analysis of poly-ADP-ribose polymerase and flow cytometry. Key results: A total of 514 genes were differentially expressed by 15-MPA treatment. Biological pathway analysis revealed that 15-MPA induced significant changes in expression of genes in the cell cycle pathway. Genes involved in growth arrest and DNA damage [gadd45α, gadd45γ and ddit3 (DNA damage-inducible transcript 3)] and cyclin-dependent kinase inhibitor (cdkn2b) were up-regulated, whereas genes involved in cell cycle progression (ccnd1, ccnd3 and ccne1), DNA replication (mcm4, orc1l and cdc6) and cell proliferation (fos and jun) were down-regulated. RT-PCR analysis for representative genes confirmed the expression levels. 15-MPA significantly reduced bromodeoxyuridine incorporation, increased poly-ADP-ribose polymerase cleavage and the number of apoptotic cells, indicating that 15-MPA induces apoptosis in BV2 cells. Conclusion and implications: 15-MPA induced apoptosis in murine microglial cells, presumably via inhibition of the cell cycle progression. As microglial activation is detrimental in CNS injuries, these data suggest a strong therapeutic potential of 15-MPA. PMID:19466985

  12. Role of ornithine decarboxylase in regulation of estrogen receptor alpha expression and growth in human breast cancer cells

    PubMed Central

    Zhu, Qingsong; Jin, Lihua; Casero, Robert A.

    2013-01-01

    Our previous studies demonstrated that specific polyamine analogues, oligoamines, down-regulated the activity of a key polyamine biosynthesis enzyme, ornithine decarboxylase (ODC), and suppressed expression of estrogen receptor alpha (ERα) in human breast cancer cells. However, the mechanism underlying the potential regulation of ERα expression by polyamine metabolism has not been explored. Here, we demonstrated that RNAi-mediated knockdown of ODC (ODC KD) down-regulated the polyamine pool, and hindered growth in ERα-positive MCF7 and T47D and ERα-negative MDA-MB-231 breast cancer cells. ODC KD significantly induced the expression and activity of the key polyamine catabolism enzymes, spermine oxidase (SMO) and spermidine/spermine N1-acetyltransferase (SSAT). However, ODC KD-induced growth inhibition could not be reversed by exogenous spermidine or overexpression of antizyme inhibitor (AZI), suggesting that regulation of ODC on cell proliferation may involve the signaling pathways independent of polyamine metabolism. In MCF7 and T47D cells, ODC KD, but not DFMO treatment, diminished the mRNA and protein expression of ERα. Overexpression of antizyme (AZ), an ODC inhibitory protein, suppressed ERα expression, suggesting that ODC plays an important role in regulation of ERα expression. Decrease of ERα expression by ODC siRNA altered the mRNA expression of a subset of ERα response genes. Our previous analysis showed that oligoamines disrupt the binding of Sp1 family members to an ERα minimal promoter element containing GC/CA-rich boxes. By using DNA affinity precipitation and mass spectrometry analysis, we identified ZBTB7A, MeCP2, PARP-1, AP2, and MAZ as co-factors of Sp1 family members that are associated with the ERα minimal promoter element. Taken together, these data provide insight into a novel antiestrogenic mechanism for polyamine biosynthesis enzymes in breast cancer. PMID:22976807

  13. EG-05COMBINATION OF GENE COPY GAIN AND EPIGENETIC DEREGULATION ARE ASSOCIATED WITH THE ABERRANT EXPRESSION OF A STEM CELL RELATED HOX-SIGNATURE IN GLIOBLASTOMA

    PubMed Central

    Kurscheid, Sebastian; Bady, Pierre; Sciuscio, Davide; Samarzija, Ivana; Shay, Tal; Vassallo, Irene; Van Criekinge, Wim; Domany, Eytan; Stupp, Roger; Delorenzi, Mauro; Hegi, Monika

    2014-01-01

    We previously reported a stem cell related HOX gene signature associated with resistance to chemo-radiotherapy (TMZ/RT- > TMZ) in glioblastoma. However, underlying mechanisms triggering overexpression remain mostly elusive. Interestingly, HOX genes are neither involved in the developing brain, nor expressed in normal brain, suggestive of an acquired gene expression signature during gliomagenesis. HOXA genes are located on CHR 7 that displays trisomy in most glioblastoma which strongly impacts gene expression on this chromosome, modulated by local regulatory elements. Furthermore we observed more pronounced DNA methylation across the HOXA locus as compared to non-tumoral brain (Human methylation 450K BeadChip Illumina; 59 glioblastoma, 5 non-tumoral brain sampes). CpG probes annotated for HOX-signature genes, contributing most to the variability, served as input into the analysis of DNA methylation and expression to identify key regulatory regions. The structural similarity of the observed correlation matrices between DNA methylation and gene expression in our cohort and an independent data-set from TCGA (106 glioblastoma) was remarkable (RV-coefficient, 0.84; p-value < 0.0001). We identified a CpG located in the promoter region of the HOXA10 locus exerting the strongest mean negative correlation between methylation and expression of the whole HOX-signature. Applying this analysis the same CpG emerged in the external set. We then determined the contribution of both, gene copy aberration (CNA) and methylation at the selected probe to explain expression of the HOX-signature using a linear model. Statistically significant results suggested an additive effect between gene dosage and methylation at the key CpG identified. Similarly, such an additive effect was also observed in the external data-set. Taken together, we hypothesize that overexpression of the stem-cell related HOX signature is triggered by gain of trisomy 7 and escape from compensatory DNA methylation at positions controlling the effect of enhanced gene dose on expression.

  14. Two alternatively spliced GPR39 transcripts in seabream: molecular cloning, genomic organization, and regulation of gene expression by metabolic signals.

    PubMed

    Zhang, Yong; Liu, Yun; Huang, Xigui; Liu, Xiaochun; Jiao, Baowei; Meng, Zining; Zhu, Pei; Li, Shuisheng; Lin, Haoran; Cheng, Christopher H K

    2008-12-01

    Two GPR39 transcripts, designated as sbGPR39-1a and sbGPR39-1b, were identified in black seabream (Acanthopagrus schlegeli). The deduced amino acid (aa) sequence of sbGPR39-1a contains 423 residues with seven putative transmembrane (TM) domains. On the other hand, sbGPR39-1b contains 284 aa residues with only five putative TM domains. Northern blot analysis confirmed the presence of two GPR39 transcripts in the seabream intestine, stomach, and liver. Apart from seabream, the presence of two GPR39 transcripts was also found to exist in a number of teleosts (zebrafish and pufferfish) and mammals (human and mouse). Analysis of the GPR39 gene structure in different species suggests that the two GPR39 transcripts are generated by alternative splicing. When the seabream receptors were expressed in cultured HEK293 cells, Zn(2)(+) could trigger sbGPR39-1a signaling through the serum response element pathway, but no such functionality could be detected for the sbGPR39-1b receptor. The two receptors were found to be differentially expressed in seabream tissues. sbGPR39-1a is predominantly expressed in the gastrointestinal tract. On the other hand, sbGPR39-1b is widely expressed in most central and peripheral tissues except muscle and ovary. The expression of sbGPR39-1a in the intestine and the expression of sbGPR39-1b in the hypothalamus were decreased significantly during food deprivation in seabream. On the contrary, the expression of the GH secretagogue receptors (sbGHSR-1a and sbGHSR-1b) was significantly increased in the hypothalamus of the food-deprived seabream. The reciprocal regulatory patterns of expression of these two genes suggest that both of them are involved in controlling the physiological response of the organism during starvation.

  15. Role of PELP1 in EGFR-ER Signaling Crosstalk in Ovarian Cancer Cells

    DTIC Science & Technology

    2009-04-01

    expression of genes involved in metastasis using a focused microarray approach. We have used Human Tumor Metastasis Microarray (Oligo GE array from...ovarian cancer progression. Analysis of human genome databases and SAGE data suggested deregulation of PELP1 expression in ovarian cancer cells...PI3K, and STAT3 in the cytosol. PELP1/MNAR regulates meiosis via its interactions with heterotimeric Gbc protein, androgen receptor (AR), and by

  16. MURC/cavin-4 Is Co-Expressed with Caveolin-3 in Rhabdomyosarcoma Tumors and Its Silencing Prevents Myogenic Differentiation in the Human Embryonal RD Cell Line

    PubMed Central

    Faggi, Fiorella; Codenotti, Silvia; Poliani, Pietro Luigi; Cominelli, Manuela; Chiarelli, Nicola; Colombi, Marina; Vezzoli, Marika; Monti, Eugenio; Bono, Federica; Tulipano, Giovanni; Fiorentini, Chiara; Zanola, Alessandra; Lo, Harriet P.; Parton, Robert G.; Keller, Charles; Fanzani, Alessandro

    2015-01-01

    The purpose of this study was to investigate whether MURC/cavin-4, a plasma membrane and Z-line associated protein exhibiting an overlapping distribution with Caveolin-3 (Cav-3) in heart and muscle tissues, may be expressed and play a role in rhabdomyosarcoma (RMS), an aggressive myogenic tumor affecting childhood. We found MURC/cavin-4 to be expressed, often concurrently with Cav-3, in mouse and human RMS, as demonstrated through in silico analysis of gene datasets and immunohistochemical analysis of tumor samples. In vitro expression studies carried out using human cell lines and primary mouse tumor cultures showed that expression levels of both MURC/cavin-4 and Cav-3, while being low or undetectable during cell proliferation, became robustly increased during myogenic differentiation, as detected via semi-quantitative RT-PCR and immunoblotting analysis. Furthermore, confocal microscopy analysis performed on human RD and RH30 cell lines confirmed that MURC/cavin-4 mostly marks differentiated cell elements, colocalizing at the cell surface with Cav-3 and labeling myosin heavy chain (MHC) expressing cells. Finally, MURC/cavin-4 silencing prevented the differentiation in the RD cell line, leading to morphological cell impairment characterized by depletion of myogenin, Cav-3 and MHC protein levels. Overall, our data suggest that MURC/cavin-4, especially in combination with Cav-3, may play a consistent role in the differentiation process of RMS. PMID:26086601

  17. MURC/cavin-4 Is Co-Expressed with Caveolin-3 in Rhabdomyosarcoma Tumors and Its Silencing Prevents Myogenic Differentiation in the Human Embryonal RD Cell Line.

    PubMed

    Faggi, Fiorella; Codenotti, Silvia; Poliani, Pietro Luigi; Cominelli, Manuela; Chiarelli, Nicola; Colombi, Marina; Vezzoli, Marika; Monti, Eugenio; Bono, Federica; Tulipano, Giovanni; Fiorentini, Chiara; Zanola, Alessandra; Lo, Harriet P; Parton, Robert G; Keller, Charles; Fanzani, Alessandro

    2015-01-01

    The purpose of this study was to investigate whether MURC/cavin-4, a plasma membrane and Z-line associated protein exhibiting an overlapping distribution with Caveolin-3 (Cav-3) in heart and muscle tissues, may be expressed and play a role in rhabdomyosarcoma (RMS), an aggressive myogenic tumor affecting childhood. We found MURC/cavin-4 to be expressed, often concurrently with Cav-3, in mouse and human RMS, as demonstrated through in silico analysis of gene datasets and immunohistochemical analysis of tumor samples. In vitro expression studies carried out using human cell lines and primary mouse tumor cultures showed that expression levels of both MURC/cavin-4 and Cav-3, while being low or undetectable during cell proliferation, became robustly increased during myogenic differentiation, as detected via semi-quantitative RT-PCR and immunoblotting analysis. Furthermore, confocal microscopy analysis performed on human RD and RH30 cell lines confirmed that MURC/cavin-4 mostly marks differentiated cell elements, colocalizing at the cell surface with Cav-3 and labeling myosin heavy chain (MHC) expressing cells. Finally, MURC/cavin-4 silencing prevented the differentiation in the RD cell line, leading to morphological cell impairment characterized by depletion of myogenin, Cav-3 and MHC protein levels. Overall, our data suggest that MURC/cavin-4, especially in combination with Cav-3, may play a consistent role in the differentiation process of RMS.

  18. Isoflurane is a suitable alternative to ether for anesthetizing rats prior to euthanasia for gene expression analysis.

    PubMed

    Nakatsu, Noriyuki; Igarashi, Yoshinobu; Aoshi, Taiki; Hamaguchi, Isao; Saito, Masumichi; Mizukami, Takuo; Momose, Haruka; Ishii, Ken J; Yamada, Hiroshi

    2017-01-01

    Diethyl ether (ether) had been widely used in Japan for anesthesia, despite its explosive properties and toxicity to both humans and animals. We also had used ether as an anesthetic for euthanizing rats for research in the Toxicogenomics Project (TGP). Because the use of ether for these purposes will likely cease, it is required to select an alternative anesthetic which is validated for consistency with existing TGP data acquired under ether anesthesia. We therefore compared two alternative anesthetic candidates, isoflurane and pentobarbital, with ether in terms of hematological findings, serum biochemical parameters, and gene expressions. As a result, few differences among the three agents were observed. In hematological and serum biochemistry analysis, no significant changes were found. In gene expression analysis, four known genes were extracted as differentially expressed genes in the liver of rats anesthetized with ether, isoflurane, or pentobarbital. However, no significant relationships were detected using gene ontology, pathway, or gene enrichment analyses by DAVID and TargetMine. Surprisingly, although it was expected that the lung would be affected by administration via inhalation, only one differentially expressed gene was extracted in the lung. Taken together, our data indicate that there are no significant differences among ether, isoflurane, and pentobarbital with respect to effects on hematological parameters, serum biochemistry parameters, and gene expression. Based on its smallest affect to existing data and its safety profile for humans and animals, we suggest isoflurane as a suitable alternative anesthetic for use in rat euthanasia in toxicogenomics analysis.

  19. Evolution of developmental regulation in the vertebrate FgfD subfamily.

    PubMed

    Jovelin, Richard; Yan, Yi-Lin; He, Xinjun; Catchen, Julian; Amores, Angel; Canestro, Cristian; Yokoi, Hayato; Postlethwait, John H

    2010-01-15

    Fibroblast growth factors (Fgfs) encode small signaling proteins that help regulate embryo patterning. Fgfs fall into seven families, including FgfD. Nonvertebrate chordates have a single FgfD gene; mammals have three (Fgf8, Fgf17, and Fgf18); and teleosts have six (fgf8a, fgf8b, fgf17, fgf18a, fgf18b, and fgf24). What are the evolutionary processes that led to the structural duplication and functional diversification of FgfD genes during vertebrate phylogeny? To study this question, we investigated conserved syntenies, patterns of gene expression, and the distribution of conserved noncoding elements (CNEs) in FgfD genes of stickleback and zebrafish, and compared them with data from cephalochordates, urochordates, and mammals. Genomic analysis suggests that Fgf8, Fgf17, Fgf18, and Fgf24 arose in two rounds of whole genome duplication at the base of the vertebrate radiation; that fgf8 and fgf18 duplications occurred at the base of the teleost radiation; and that Fgf24 is an ohnolog that was lost in the mammalian lineage. Expression analysis suggests that ancestral subfunctions partitioned between gene duplicates and points to the evolution of novel expression domains. Analysis of CNEs, at least some of which are candidate regulatory elements, suggests that ancestral CNEs partitioned between gene duplicates. These results help explain the evolutionary pathways by which the developmentally important family of FgfD molecules arose and the deduced principles that guided FgfD evolution are likely applicable to the evolution of developmental regulation in many vertebrate multigene families. (c) 2009 Wiley-Liss, Inc.

  20. Prostaglandin metabolizing enzymes in correlation with vitamin D receptor in benign and malignant breast cell lines.

    PubMed

    Thill, Marc; Fischer, Dorothea; Becker, Steffi; Cordes, Tim; Dittmer, Christine; Diedrich, Klaus; Salehin, Darius; Friedrich, Michael

    2009-09-01

    The antiproliferative effects of calcitriol (1,25(OH)2D3) mediated via the vitamin D receptor (VDR), render the biologically active form of vitamin D a promising target in breast cancer therapy. Furthermore, breast cancer is associated with inflammatory processes based on an up-regulation of cyclooxygenase-2 (COX-2) expression, the prostaglandin E2 (PGE2) synthesizing enzyme. The PGE2 metabolizing enzyme, 15-hydroxyprostaglandin dehydrogenase (15-PGDH) is described as a tumor suppressor in cancer. First references suggest a correlation between vitamin D and prostaglandin metabolism through the impact of 1,25(OH)2D3 on the expression of COX-2 and 15-PGDH. The expression of VDR, COX-2 and 15-PGDH in benign MCF-10F and malignant MCF-7 breast cells was determined by real-time PCR (RT-PCR) and Western blot analysis. Although the RT-PCR data were divergent from those obtained from the Western blot analysis, the COX-2 protein expression was MCF-7 2-fold higher in the MCF-7 compared to the MCF-10F cells. Moreover, a correlation of 15-PGDH to VDR by RT-PCR was found in both cell lines. The VDR protein levels were inversely correlated to the 15-PGDH protein levels and revealed that the MCF-10F cells had the highest VDR expression. A possible link between VDR-associated target genes and prostaglandin metabolism is suggested.

  1. Soldier caste-specific gene expression in the mandibular glands of Hodotermopsis japonica (Isoptera: Termopsidae)

    PubMed Central

    Miura, Toru; Kamikouchi, Azusa; Sawata, Miyuki; Takeuchi, Hideaki; Natori, Syunji; Kubo, Takeo; Matsumoto, Tadao

    1999-01-01

    Although “polymorphic castes” in social insects are well known as one of the most important phenomena of polyphenism, few studies of caste-specific gene expressions have been performed in social insects. To identify genes specifically expressed in the soldier caste of the Japanese damp-wood termite Hodotermopsis japonica, we employed the differential-display method using oligo(dT) and arbitrary primers, compared mRNA from the heads of mature soldiers and pseudergates (worker caste), and identified a clone (PCR product) 329 bp in length termed SOL1. Northern blot analysis showed that the SOL1 mRNA is about 1.0 kb in length and is expressed specifically in mature soldiers, but not in pseudergates, even in the presoldier induction by juvenile hormone analogue, suggesting that the product is specific for terminally differentiated soldiers. By using the method of 5′- and 3′-rapid amplification of cDNA ends, we isolated the full length of SOL1 cDNA, which contained an ORF with a putative signal peptide at the N terminus. The sequence showed no significant homology with any other known protein sequences. In situ hybridization analysis showed that SOL1 is expressed specifically in the mandibular glands. These results strongly suggest that the SOL1 gene encodes a secretory protein specifically synthesized in the mandibular glands of the soldiers. Histological observations revealed that the gland actually develops during the differentiation into the soldier caste. PMID:10570166

  2. Development of a cDNA microarray to identify gene expression of Puccinellia tenuiflora under saline-alkali stress.

    PubMed

    Wang, Yucheng; Yang, Chuanping; Liu, Guifeng; Jiang, Jing

    2007-08-01

    Puccinellia tenuiflora is the main grass species growing in the saline-alkali soil of the Songnen plain in northeastern China, suggesting it has a high tolerance to saline stress. In this study, cDNA microarrays containing 1067 clones of P. tenuiflora were constructed to investigate gene expression patterns resulting from saline-alkali (NaHCO(3)) stress. RNA was extracted from P. tenuiflora treated with 400 mmol L(-1) NaHCO(3) for 6, 12, 24 and 48 h. Untreated (no saline-alkali stress) samples were used as control. A total of 95 transcripts were differentially regulated under the conditions studied, and 38, 35, 25 and 49 genes were differentially expressed with NaHCO(3) stress for 6, 12, 24 and 48h, respectively. Among these, approximately 40% were putative novel or functionally unknown genes, and the remainder function in photosynthesis, cell rescue, defense, transport, metabolism, transcription regulation and protein destination, etc. Analysis of the P. tenuiflora genes demonstrated the complexity of, and differences in, gene expression patterns resulting from different NaHCO(3) stress times. The genetic relationship between P. tenuiflora and other plants was investigated by BlastN analysis. The results showed nearly 20% of the expressed sequence tags from P. tenuiflora shared significant similarities with rice Oryza sativa, an important food crop. The close genetic relationship between these two species suggests that P. tenuiflora may be a good plant model for studying saline-alkali tolerance mechanisms in O. sativa.

  3. Long non-coding RNA PVT1 as a novel potential biomarker for predicting the prognosis of colorectal cancer.

    PubMed

    Fan, Heng; Zhu, Jian-Hua; Yao, Xue-Qing

    2018-05-01

    Long non-coding RNA (lncRNA) plays a very important role in the occurrence and development of various tumors, and is a potential biomarker for cancer diagnosis and prognosis. The purpose of this study was to investigate the relationship between the expression of lncRNA plasmacytoma variant translocation 1 (PVT1) and the prognostic significance in patients with colorectal cancer. The expression of PVT1 was measured by real-time quantitative reverse transcription-polymerase chain reaction (qRT-PCR) in cancerous and adjacent tissues of 210 colorectal cancer patients. The disease-free survival and overall survival of colorectal cancer patients were evaluated by Kaplan-Meier analysis, and univariate and multivariate analysis were performed by Cox proportional-hazards model. Our results revealed that PVT1 expression in cancer tissues of colorectal cancer was significantly higher than that of adjacent tissues ( P<0.001). High PVT1 expression was increased by 51.4% (108/210), which was significantly correlated with the tumor differentiation, the depth of invasion, the stage of tumor, node, metastasis (TNM), and lymphatic metastasis. The Kaplan-Meier analysis showed that high PVT1 expression resulted in a shorter disease-free survival (Log-rank test P<0.001) and overall survival (Log-rank test P<0.001) compared with the low PVT1 expression group in colorectal cancer patients, whether at TNM I/II stage or at TNM III/IV stage. A multivariate Cox regression analysis demonstrated that high PVT1 expression was an independent predictor of poor prognosis in colorectal cancer patients. Our results suggest that high PVT1 expression might be a potential biomarker for assessing tumor recurrence and prognosis in colorectal cancer patients.

  4. Epigenetic reprogramming governs EcSOD expression during human mammary epithelial cell differentiation, tumorigenesis and metastasis

    PubMed Central

    Teoh-Fitzgerald, ML; Fitzgerald, MP; Zhong, W; Askeland, RW; Domann, FE

    2013-01-01

    Expression of the antioxidant enzyme EcSOD in normal human mammary epithelial cells was not recognized until recently. Although expression of EcSOD was not detectable in non-malignant human mammary epithelial cells (HMEC) cultured in conventional two-dimensional (2D) culture conditions, EcSOD protein expression was observed in normal human breast tissues, suggesting that the 2D-cultured condition induces a repressive status of EcSOD gene expression in HMEC. With the use of laminin-enriched extracellular matrix (lrECM), we were able to detect expression of EcSOD when HMEC formed polarized acinar structures in a 3D-culture condition. Repression of the EcSOD-gene expression was again seen when the HMEC acini were sub-cultured as a monolayer, implying that lrECM-induced acinar morphogenesis is essential in EcSOD-gene activation. We have further shown the involvement of DNA methylation in regulating EcSOD expression in HMEC under these cell culture conditions. EcSOD mRNA expression was strongly induced in the 2D-cultured HMEC after treatment with a DNA methyltransferase inhibitor. In addition, epigenetic analyses showed a decrease in the degree of CpG methylation in the EcSOD promoter in the 3D versus 2D-cultured HMEC. More importantly, >80% of clinical mammary adenocarcinoma samples showed significantly decreased EcSOD mRNA and protein expression levels compared with normal mammary tissues and there is an inverse correlation between the expression levels of EcSOD and the clinical stages of breast cancer. Combined bisulfite restriction analysis analysis of some of the tumors also revealed an association of DNA methylation with the loss of EcSOD expression in vivo. Furthermore, overexpression of EcSOD inhibited breast cancer metastasis in both the experimental lung metastasis model and the syngeneic mouse model. This study suggests that epigenetic silencing of EcSOD may contribute to mammary tumorigenesis and that restoring the extracellular superoxide scavenging activity could be an effective strategy for breast cancer treatment. PMID:23318435

  5. Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

    2015-04-15

    DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

  6. Decoding facial expressions based on face-selective and motion-sensitive areas.

    PubMed

    Liang, Yin; Liu, Baolin; Xu, Junhai; Zhang, Gaoyan; Li, Xianglin; Wang, Peiyuan; Wang, Bin

    2017-06-01

    Humans can easily recognize others' facial expressions. Among the brain substrates that enable this ability, considerable attention has been paid to face-selective areas; in contrast, whether motion-sensitive areas, which clearly exhibit sensitivity to facial movements, are involved in facial expression recognition remained unclear. The present functional magnetic resonance imaging (fMRI) study used multi-voxel pattern analysis (MVPA) to explore facial expression decoding in both face-selective and motion-sensitive areas. In a block design experiment, participants viewed facial expressions of six basic emotions (anger, disgust, fear, joy, sadness, and surprise) in images, videos, and eyes-obscured videos. Due to the use of multiple stimulus types, the impacts of facial motion and eye-related information on facial expression decoding were also examined. It was found that motion-sensitive areas showed significant responses to emotional expressions and that dynamic expressions could be successfully decoded in both face-selective and motion-sensitive areas. Compared with static stimuli, dynamic expressions elicited consistently higher neural responses and decoding performance in all regions. A significant decrease in both activation and decoding accuracy due to the absence of eye-related information was also observed. Overall, the findings showed that emotional expressions are represented in motion-sensitive areas in addition to conventional face-selective areas, suggesting that motion-sensitive regions may also effectively contribute to facial expression recognition. The results also suggested that facial motion and eye-related information played important roles by carrying considerable expression information that could facilitate facial expression recognition. Hum Brain Mapp 38:3113-3125, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  7. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing.

    PubMed

    Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R

    2015-11-09

    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.

  8. Increased methylation and decreased expression of homeobox genes TLX1, HOXA10 and DLX5 in human placenta are associated with trophoblast differentiation.

    PubMed

    Novakovic, Boris; Fournier, Thierry; Harris, Lynda K; James, Joanna; Roberts, Claire T; Yong, Hannah E J; Kalionis, Bill; Evain-Brion, Danièle; Ebeling, Peter R; Wallace, Euan M; Saffery, Richard; Murthi, Padma

    2017-07-03

    Homeobox genes regulate embryonic and placental development, and are widely expressed in the human placenta, but their regulatory control by DNA methylation is unclear. DNA methylation analysis was performed on human placentae from first, second and third trimesters to determine methylation patterns of homeobox gene promoters across gestation. Most homeobox genes were hypo-methylated throughout gestation, suggesting that DNA methylation is not the primary mechanism involved in regulating HOX genes expression in the placenta. Nevertheless, several genes showed variable methylation patterns across gestation, with a general trend towards an increase in methylation over gestation. Three genes (TLX1, HOXA10 and DLX5) showed inverse gains of methylation with decreasing mRNA expression throughout pregnancy, supporting a role for DNA methylation in their regulation. Proteins encoded by these genes were primarily localised to the syncytiotrophoblast layer, and showed decreased expression later in gestation. siRNA mediated downregulation of DLX5, TLX1 and HOXA10 in primary term villous cytotrophoblast resulted in decreased proliferation and increased expression of differentiation markers, including ERVW-1. Our data suggest that loss of DLX5, TLX1 and HOXA10 expression in late gestation is required for proper placental differentiation and function.

  9. HOXB homeobox gene expression in cervical carcinoma.

    PubMed

    López, R; Garrido, E; Piña, P; Hidalgo, A; Lazos, M; Ochoa, R; Salcedo, M

    2006-01-01

    The homeobox (HOX) genes are a family of transcription factors that bind to specific DNA sequences in target genes regulating gene expression. Thirty-nine HOX genes have been mapped in four conserved clusters: A, B, C, and D; they act as master genes regulating the identity of body segments along the anteroposterior axis of the embryo. The role played by HOX genes in adult cell differentiation is unclear to date, but growing evidence suggests that they may play an important role in the development of cancer. To study the role played by HOX genes in cervical cancer, in the present work, we analyzed the expression of HOXB genes and the localization of their transcripts in human cervical tissues. Reverse transcription-polymerase chain reaction analysis and nonradioactive RNA in situ hybridization were used to detect HOXB expression in 11 normal cervical tissues and 17 cervical carcinomas. It was determined that HOXB1, B3, B5, B6, B7, B8, and B9 genes are expressed in normal adult cervical epithelium and squamous cervical carcinomas. Interestingly, HOXB2, HOXB4, and HOXB13 gene expression was found only in tumor tissues. Our findings suggest that the new expression of HOXB2, HOXB4, and B13 genes is involved in cervical cancer.

  10. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing

    PubMed Central

    Vannette, Rachel L.; Mohamed, Abbas; Johnson, Brian R.

    2015-01-01

    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging. PMID:26549293

  11. Correlation of Versican Expression, Accumulation, and Degradation during Embryonic Development by Quantitative Immunohistochemistry

    PubMed Central

    Snyder, Jessica M.; Washington, Ida M.; Birkland, Timothy; Chang, Mary Y.; Frevert, Charles W.

    2015-01-01

    Versican, a chondroitin sulfate proteoglycan, is important in embryonic development, and disruption of the versican gene is embryonically lethal in the mouse. Although several studies show that versican is increased in various organs during development, a focused quantitative study on versican expression and distribution during lung and central nervous system development in the mouse has not previously been performed. We tracked changes in versican (Vcan) gene expression and in the accumulation and degradation of versican. Vcan expression and quantitative immunohistochemistry performed from embryonic day (E) 11.5 to E15.5 showed peak Vcan expression at E13.5 in the lungs and brain. Quantitative mRNA analysis and versican immunohistochemistry showed differences in the expression of the versican isoforms in the embryonic lung and head. The expression of Vcan mRNA and accumulation of versican in tissues was complementary. Immunohistochemistry demonstrated co-localization of versican accumulation and degradation, suggesting distinct roles of versican deposition and degradation in embryogenesis. Very little versican mRNA or protein was found in the lungs of 12- to 16-week-old mice but versican accumulation was significantly increased in mice with Pseudomonas aeruginosa lung infection. These data suggest that versican plays an important role in fundamental, overlapping cellular processes in lung development and infection. PMID:26385570

  12. Hidden among the crowd: differential DNA methylation-expression correlations in cancer occur at important oncogenic pathways.

    PubMed

    Mosquera Orgueira, Adrián

    2015-01-01

    DNA methylation is a frequent epigenetic mechanism that participates in transcriptional repression. Variations in DNA methylation with respect to gene expression are constant, and, for unknown reasons, some genes with highly methylated promoters are sometimes overexpressed. In this study we have analyzed the expression and methylation patterns of thousands of genes in five groups of cancer and normal tissue samples in order to determine local and genome-wide differences. We observed significant changes in global methylation-expression correlation in all the neoplasms, which suggests that differential correlation events are frequent in cancer. A focused analysis in the breast cancer cohort identified 1662 genes whose correlation varies significantly between normal and cancerous breast, but whose DNA methylation and gene expression patterns do not change substantially. These genes were enriched in cancer-related pathways and repressive chromatin features across various model cell lines, such as PRC2 binding and H3K27me3 marks. Substantial changes in methylation-expression correlation indicate that these genes are subject to epigenetic remodeling, where the differential activity of other factors break the expected relationship between both variables. Our findings suggest a complex regulatory landscape where a redistribution of local and large-scale chromatin repressive domains at differentially correlated genes (DCGs) creates epigenetic hotspots that modulate cancer-specific gene expression.

  13. Vitamin K2 improves proliferation and migration of bovine skeletal muscle cells in vitro.

    PubMed

    Rønning, Sissel Beate; Pedersen, Mona Elisabeth; Berg, Ragnhild Stenberg; Kirkhus, Bente; Rødbotten, Rune

    2018-01-01

    Skeletal muscle function is highly dependent on the ability to regenerate, however, during ageing or disease, the proliferative capacity is reduced, leading to loss of muscle function. We have previously demonstrated the presence of vitamin K2 in bovine skeletal muscles, but whether vitamin K has a role in muscle regulation and function is unknown. In this study, we used primary bovine skeletal muscle cells, cultured in monolayers in vitro, to assess a potential effect of vitamin K2 (MK-4) during myogenesis of muscle cells. Cell viability experiments demonstrate that the amount of ATP produced by the cells was unchanged when MK-4 was added, indicating viable cells. Cytotoxicity analysis show that MK-4 reduced the lactate dehydrogenase (LDH) released into the media, suggesting that MK-4 was beneficial to the muscle cells. Cell migration, proliferation and differentiation was characterised after MK-4 incubation using wound scratch analysis, immunocytochemistry and real-time PCR analysis. Adding MK-4 to the cells led to an increased muscle proliferation, increased gene expression of the myogenic transcription factor myod as well as increased cell migration. In addition, we observed a reduction in the fusion index and relative gene expression of muscle differentiation markers, with fewer complex myotubes formed in MK-4 stimulated cells compared to control cells, indicating that the MK-4 plays a significant role during the early phases of muscle proliferation. Likewise, we see the same pattern for the relative gene expression of collagen 1A, showing increased gene expression in proliferating cells, and reduced expression in differentiating cells. Our results also suggest that MK-4 incubation affect low density lipoprotein receptor-related protein 1 (LRP1) and the low-density lipoprotein receptor (LDLR) with a peak in gene expression after 45 min of MK-4 incubation. Altogether, our experiments show that MK-4 has a positive effect on muscle cell migration and proliferation, which are two important steps during early myogenesis.

  14. Analysis of serotonin receptor 2A gene (HTR2A): association study with autism spectrum disorder in the Indian population and investigation of the gene expression in peripheral blood leukocytes.

    PubMed

    Guhathakurta, Subhrangshu; Singh, Asem Surindro; Sinha, Swagata; Chatterjee, Anindita; Ahmed, Shabina; Ghosh, Saurabh; Usha, Rajamma

    2009-12-01

    Several studies suggest involvement of serotoninergic system in the pathophysiology of Autism Spectrum Disorder (ASD). The 5-HT receptor binding studies using (3)H-lysergic acid diethylamide ((3)H-LSD) and linkage analysis provided evidences to consider HTR2A as a potential candidate gene for ASD. The three SNPs, -1438A/G (rs6311), 102T/C (rs6313) and 1354C/T (rs6314) of HTR2A have been well studied in the etiology of various neuropsychiatric disorders. But studies on association of this gene with ASD are limited to two reports from American and Korean populations. Additionally there are reports, which demonstrated paternal imprinting of HTR2A with expression from only one allele. So far no reports are available on HTR2A and its association with any neuropsychiatric disorders from Indian population. Therefore, the present study investigates association of the above mentioned three markers of HTR2A with ASD in Indian population using population and family-based approaches. The study also deals with allelic expression pattern of HTR2A in Peripheral Blood Leukocytes (PBLs) to understand the parental imprinting status. The genotyping analyses were carried out for probands, parents and controls. The subsequent association analyses did not show association of these markers with ASD. So, HTR2A is unlikely to be a genetic marker for ASD in Indian population. The expression analyses showed absence of monoallelic expression, suggesting lack of parental imprinting of HTR2A gene. However, we noticed methylation of the CpG sites at -1438A/G and 102T/C loci of HTR2A gene. Further bioinformatics analysis revealed absence of CpG islands in the promoter of the gene supporting biallelic expression pattern of HTR2A in PBLs.

  15. Solanum tuberosum StCDPK1 is regulated by miR390 at the posttranscriptional level and phosphorylates the auxin efflux carrier StPIN4 in vitro, a potential downstream target in potato development.

    PubMed

    Santin, Franco; Bhogale, Sneha; Fantino, Elisa; Grandellis, Carolina; Banerjee, Anjan K; Ulloa, Rita M

    2017-02-01

    Among many factors that regulate potato tuberization, calcium and calcium-dependent protein kinases (CDPKs) play an important role. CDPK activity increases at the onset of tuber formation with StCDPK1 expression being strongly induced in swollen stolons. However, not much is known about the transcriptional and posttranscriptional regulation of StCDPK1 or its downstream targets in potato development. To elucidate further, we analyzed its expression in different tissues and stages of the life cycle. Histochemical analysis of StCDPK1::GUS (β-glucuronidase) plants demonstrated that StCDPK1 is strongly associated with the vascular system in stems, roots, during stolon to tuber transition, and in tuber sprouts. In agreement with the observed GUS profile, we found specific cis-acting elements in StCDPK1 promoter. In silico analysis predicted miR390 to be a putative posttranscriptional regulator of StCDPK1. Quantitative real time-polymerase chain reaction (qRT-PCR) analysis showed ubiquitous expression of StCDPK1 in different tissues which correlated well with Western blot data except in leaves. On the contrary, miR390 expression exhibited an inverse pattern in leaves and tuber eyes suggesting a possible regulation of StCDPK1 by miR390. This was further confirmed by Agrobacterium co-infiltration assays. In addition, in vitro assays showed that recombinant StCDPK1-6xHis was able to phosphorylate the hydrophilic loop of the auxin efflux carrier StPIN4. Altogether, these results indicate that StCDPK1 expression is varied in a tissue-specific manner having significant expression in vasculature and in tuber eyes; is regulated by miR390 at posttranscriptional level and suggest that StPIN4 could be one of its downstream targets revealing the overall role of this kinase in potato development. © 2016 Scandinavian Plant Physiology Society.

  16. LncRNA UCA1 promotes proliferation and cisplatin resistance of oral squamous cell carcinoma by sunppressing miR-184 expression.

    PubMed

    Fang, Zheng; Zhao, Junfang; Xie, Weihong; Sun, Qiang; Wang, Haibin; Qiao, Bin

    2017-12-01

    Chemotherapy resistance has become the main obstacle for the effective treatment of human cancers. Long non-coding RNA urothelial cancer associated 1 (UCA1) is generally regarded as an oncogene in some cancers. However, the function and molecular mechanism of UCA1 implicated in cisplatin (CDDP) chemoresistance of oral squamous cell carcinoma (OSCC) is still not fully established. UCA1 expression in tumor tissues and cells was tested by qRT-PCR. MTT, flow cytometry and caspase-3 activity analysis were explored to evaluate the CDDP sensitivity in OSCC cells. Western blot analysis was used to measure BCL2, Bax and SF1 protein expression. Luciferase reporter assay was conducted to investigate the molecular relationship between UCA1, miR-184, and SF1. Nude mice model was used to confirm the functional role of UCA1 in CDDP resistance in vivo. UCA1 expression was upregulated in OSCC tissues, cell lines, and CDDP resistant OSCC cells. Function analysis revealed that UCA1 facilitated proliferation, enhanced CDDP chemoresistance, and suppressed apoptosis in OSCC cells. Mechanisms investigation indicated that UCA1 could interact with miR-184 to repress its expression. Rescue experiments suggested that downregulation of miR-184 partly reversed the tumor suppression effect and CDDP chemosensitivity of UCA1 knockdown in CDDP-resistant OSCC cells. Moreover, UCA1 could perform as a miR-184 sponge to modulate SF1 expression. The OSCC nude mice model experiments demonstrated that depletion of UCA1 further boosted CDDP-mediated repression effect on tumor growth. UCA1 accelerated proliferation, increased CDDP chemoresistance and restrained apoptosis partly through modulating SF1 via sponging miR-184 in OSCC cells, suggesting that targeting UCA1 may be a potential therapeutic strategy for OSCC patients. © 2017 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  17. Genome-wide analysis of WRKY gene family in the sesame genome and identification of the WRKY genes involved in responses to abiotic stresses.

    PubMed

    Li, Donghua; Liu, Pan; Yu, Jingyin; Wang, Linhai; Dossa, Komivi; Zhang, Yanxin; Zhou, Rong; Wei, Xin; Zhang, Xiurong

    2017-09-11

    Sesame (Sesamum indicum L.) is one of the world's most important oil crops. However, it is susceptible to abiotic stresses in general, and to waterlogging and drought stresses in particular. The molecular mechanisms of abiotic stress tolerance in sesame have not yet been elucidated. The WRKY domain transcription factors play significant roles in plant growth, development, and responses to stresses. However, little is known about the number, location, structure, molecular phylogenetics, and expression of the WRKY genes in sesame. We performed a comprehensive study of the WRKY gene family in sesame and identified 71 SiWRKYs. In total, 65 of these genes were mapped to 15 linkage groups within the sesame genome. A phylogenetic analysis was performed using a related species (Arabidopsis thaliana) to investigate the evolution of the sesame WRKY genes. Tissue expression profiles of the WRKY genes demonstrated that six SiWRKY genes were highly expressed in all organs, suggesting that these genes may be important for plant growth and organ development in sesame. Analysis of the SiWRKY gene expression patterns revealed that 33 and 26 SiWRKYs respond strongly to waterlogging and drought stresses, respectively. Changes in the expression of 12 SiWRKY genes were observed at different times after the waterlogging and drought treatments had begun, demonstrating that sesame gene expression patterns vary in response to abiotic stresses. In this study, we analyzed the WRKY family of transcription factors encoded by the sesame genome. Insight was gained into the classification, evolution, and function of the SiWRKY genes, revealing their putative roles in a variety of tissues. Responses to abiotic stresses in different sesame cultivars were also investigated. The results of our study provide a better understanding of the structures and functions of sesame WRKY genes and suggest that manipulating these WRKYs could enhance resistance to waterlogging and drought.

  18. Molecular cloning and functional analysis of nine cinnamyl alcohol dehydrogenase family members in Populus tomentosa.

    PubMed

    Chao, Nan; Liu, Shu-Xin; Liu, Bing-Mei; Li, Ning; Jiang, Xiang-Ning; Gai, Ying

    2014-11-01

    Nine CAD/CAD-like genes in P. tomentosa were classified into four classes based on expression patterns, phylogenetic analysis and biochemical properties with modification for the previous claim of SAD. Cinnamyl alcohol dehydrogenase (CAD) functions in monolignol biosynthesis and plays a critical role in wood development and defense. In this study, we isolated and cloned nine CAD/CAD-like genes in the Populus tomentosa genome. We investigated differential expression using microarray chips and found that PtoCAD1 was highly expressed in bud, root and vascular tissues (xylem and phloem) with the greatest expression in the root. Differential expression in tissues was demonstrated for PtoCAD3, PtoCAD6 and PtoCAD9. Biochemical analysis of purified PtoCADs in vitro indicated PtoCAD1, PtoCAD2 and PtoCAD8 had detectable activity against both coniferaldehyde and sinapaldehyde. PtoCAD1 used both substrates with high efficiency. PtoCAD2 showed no specific requirement for sinapaldehyde in spite of its high identity with so-called PtrSAD (sinapyl alcohol dehydrogenase). In addition, the enzymatic activity of PtoCAD1 and PtoCAD2 was affected by temperature. We classified these nine CAD/CAD-like genes into four classes: class I included PtoCAD1, which was a bone fide CAD with the highest activity; class II included PtoCAD2, -5, -7, -8, which might function in monolignol biosynthesis and defense; class III genes included PtoCAD3, -6, -9, which have a distinct expression pattern; class IV included PtoCAD12, which has a distinct structure. These data suggest divergence of the PtoCADs and its homologs, related to their functions. We propose genes in class II are a subset of CAD genes that evolved before angiosperms appeared. These results suggest CAD/CAD-like genes in classes I and II play a role in monolignol biosynthesis and contribute to our knowledge of lignin biosynthesis in P. tomentosa.

  19. Transcriptome profile analysis reflects rat liver and kidney damage following chronic ultra-low dose Roundup exposure.

    PubMed

    Mesnage, Robin; Arno, Matthew; Costanzo, Manuela; Malatesta, Manuela; Séralini, Gilles-Eric; Antoniou, Michael N

    2015-08-25

    Glyphosate-based herbicides (GBH) are the major pesticides used worldwide. Converging evidence suggests that GBH, such as Roundup, pose a particular health risk to liver and kidneys although low environmentally relevant doses have not been examined. To address this issue, a 2-year study in rats administering 0.1 ppb Roundup (50 ng/L glyphosate equivalent) via drinking water (giving a daily intake of 4 ng/kg bw/day of glyphosate) was conducted. A marked increased incidence of anatomorphological and blood/urine biochemical changes was indicative of liver and kidney structure and functional pathology. In order to confirm these findings we have conducted a transcriptome microarray analysis of the liver and kidneys from these same animals. The expression of 4224 and 4447 transcript clusters (a group of probes corresponding to a known or putative gene) were found to be altered respectively in liver and kidney (p < 0.01, q < 0.08). Changes in gene expression varied from -3.5 to 3.7 fold in liver and from -4.3 to 5.3 in kidneys. Among the 1319 transcript clusters whose expression was altered in both tissues, ontological enrichment in 3 functional categories among 868 genes were found. First, genes involved in mRNA splicing and small nucleolar RNA were mostly upregulated, suggesting disruption of normal spliceosome activity. Electron microscopic analysis of hepatocytes confirmed nucleolar structural disruption. Second, genes controlling chromatin structure (especially histone-lysine N-methyltransferases) were mostly upregulated. Third, genes related to respiratory chain complex I and the tricarboxylic acid cycle were mostly downregulated. Pathway analysis suggests a modulation of the mTOR and phosphatidylinositol signalling pathways. Gene disturbances associated with the chronic administration of ultra-low dose Roundup reflect a liver and kidney lipotoxic condition and increased cellular growth that may be linked with regeneration in response to toxic effects causing damage to tissues. Observed alterations in gene expression were consistent with fibrosis, necrosis, phospholipidosis, mitochondrial membrane dysfunction and ischemia, which correlate with and thus confirm observations of pathology made at an anatomical, histological and biochemical level. Our results suggest that chronic exposure to a GBH in an established laboratory animal toxicity model system at an ultra-low, environmental dose can result in liver and kidney damage with potential significant health implications for animal and human populations.

  20. FAS ligand expression in inflammatory infiltrate lymphoid cells as a prognostic marker in oral squamous cell carcinoma.

    PubMed

    Peterle, G T; Santos, M; Mendes, S O; Carvalho-Neto, P B; Maia, L L; Stur, E; Agostini, L P; Silva, C V M; Trivilin, L O; Nunes, F D; Carvalho, M B; Tajara, E H; Louro, I D; Silva-Conforti, A M A

    2015-09-22

    Currently, the most important prognostic factor in oral squamous cell carcinoma (OSCC) is the presence of regional lymph node metastases, which correlates with a 50% reduction in life expectancy. We have previously observed that expression of hypoxia genes in the tumor inflammatory infiltrate is statistically related to prognosis in OSCC. FAS and FASL expression levels in OSCC have previously been related to patient survival. The present study analyzed the relationship between FASL expression in the inflammatory infiltrate lymphoid cells and clinical variables, tumor histology, and prognosis of OSCC. Strong FASL expression was significantly associated with lymph node metastases (P = 0.035) and disease-specific death (P = 0.014), but multivariate analysis did not confirm FASL expression as an independent death risk factor (OR = 2.78, 95%CI = 0.81-9.55). Disease-free and disease-specific survival were significantly correlated with FASL expression (P = 0.016 and P = 0.005, respectively). Multivariate analysis revealed that strong FASL expression is an independent marker for earlier disease relapse and disease-specific death, with approximately 2.5-fold increased risk compared with weak expression (HR = 2.24, 95%CI = 1.08-4.65 and HR = 2.49, 95%CI = 1.04-5.99, respectively). Our results suggest a potential role for this expression profile as a tumor prognostic marker in OSCC patients.

  1. Interleukin-7-induced Stat-5 acts in synergy with Flt-3 signaling to stimulate expansion of hematopoietic progenitor cells.

    PubMed

    Åhsberg, Josefine; Tsapogas, Panagiotis; Qian, Hong; Zetterblad, Jenny; Zandi, Sasan; Månsson, Robert; Jönsson, Jan-Ingvar; Sigvardsson, Mikael

    2010-11-19

    The development of lymphoid cells from bone marrow progenitors is dictated by interplay between internal cues such as transcription factors and external signals like the cytokines Flt-3 ligand and Il-7. These proteins are both of large importance for normal lymphoid development; however, it is unclear if they act in direct synergy to expand a transient Il-7R(+)Flt-3(+) population or if the collaboration is created through sequential activities. We report here that Flt-3L and Il-7 synergistically stimulated the expansion of primary Il-7R(+)Flt-3(+) progenitor cells and a hematopoietic progenitor cell line ectopically expressing the receptors. The stimulation resulted in a reduced expression of pro-apoptotic genes and also mediated survival of primary progenitor cells in vitro. However, functional analysis of single cells suggested that the anti-apoptotic effect was additive indicating that the synergy observed mainly depends on stimulation of proliferation. Analysis of downstream signaling events suggested that although Il-7 induced Stat-5 phosphorylation, Flt-3L caused activation of the ERK and AKT signaling pathways. Flt-3L could also drive proliferation in synergy with ectopically expressed constitutively active Stat-5. This synergy could be inhibited with either receptor tyrosine kinase or MAPK inhibitors suggesting that Flt-3L and Il-7 act in synergy by activation of independent signaling pathways to expand early hematopoietic progenitors.

  2. Combined image and genomic analysis of high-grade serous ovarian cancer reveals PTEN loss as a common driver event and prognostic classifier.

    PubMed

    Martins, Filipe C; Santiago, Ines de; Trinh, Anne; Xian, Jian; Guo, Anne; Sayal, Karen; Jimenez-Linan, Mercedes; Deen, Suha; Driver, Kristy; Mack, Marie; Aslop, Jennifer; Pharoah, Paul D; Markowetz, Florian; Brenton, James D

    2014-12-17

    TP53 and BRCA1/2 mutations are the main drivers in high-grade serous ovarian carcinoma (HGSOC). We hypothesise that combining tissue phenotypes from image analysis of tumour sections with genomic profiles could reveal other significant driver events. Automatic estimates of stromal content combined with genomic analysis of TCGA HGSOC tumours show that stroma strongly biases estimates of PTEN expression. Tumour-specific PTEN expression was tested in two independent cohorts using tissue microarrays containing 521 cases of HGSOC. PTEN loss or downregulation occurred in 77% of the first cohort by immunofluorescence and 52% of the validation group by immunohistochemistry, and is associated with worse survival in a multivariate Cox-regression model adjusted for study site, age, stage and grade. Reanalysis of TCGA data shows that hemizygous loss of PTEN is common (36%) and expression of PTEN and expression of androgen receptor are positively associated. Low androgen receptor expression was associated with reduced survival in data from TCGA and immunohistochemical analysis of the first cohort. PTEN loss is a common event in HGSOC and defines a subgroup with significantly worse prognosis, suggesting the rational use of drugs to target PI3K and androgen receptor pathways for HGSOC. This work shows that integrative approaches combining tissue phenotypes from images with genomic analysis can resolve confounding effects of tissue heterogeneity and should be used to identify new drivers in other cancers.

  3. International publication trends in the Journal of Applied Behavior Analysis: 2000-2014.

    PubMed

    Martin, Neil T; Nosik, Melissa R; Carr, James E

    2016-06-01

    Dymond, Clarke, Dunlap, and Steiner's (2000) analysis of international publication trends in the Journal of Applied Behavior Analysis (JABA) from 1970 to 1999 revealed low numbers of publications from outside North America, leading the authors to express concern about the lack of international involvement in applied behavior analysis. They suggested that a future review would be necessary to evaluate any changes in international authorship in the journal. As a follow-up, we analyzed non-U.S. publication trends in the most recent 15 years of JABA and found similar results. We discuss potential reasons for the relative paucity of international authors and suggest potential strategies for increasing non-U.S. contributions to the advancement of behavior analysis. © 2015 Society for the Experimental Analysis of Behavior.

  4. A novel highly differentially expressed gene in wheat endosperm associated with bread quality

    PubMed Central

    Furtado, A.; Bundock, P. C.; Banks, P. M.; Fox, G.; Yin, X.; Henry, R. J.

    2015-01-01

    Analysis of gene expression in developing wheat seeds was used to identify a gene, wheat bread making (wbm), with highly differential expression (~1000 fold) in the starchy endosperm of genotypes varying in bread making quality. Several alleles differing in the 5’-upstream region (promoter) of this gene were identified, with one present only in genotypes with high levels of wbm expression. RNA-Seq analysis revealed low or no wbm expression in most genotypes but high expression (0.2-0.4% of total gene expression) in genotypes that had good bread loaf volume. The wbm gene is predicted to encode a mature protein of 48 amino acids (including four cysteine residues) not previously identified in association with wheat quality, possibly because of its small size and low frequency in the wheat gene pool. Genotypes with high wbm expression all had good bread making quality but not always good physical dough qualities. The predicted protein was sulphur rich suggesting the possibility of a contribution to bread loaf volume by supporting the crossing linking of proteins in gluten. Improved understanding of the molecular basis of differences in bread making quality may allow more rapid development of high performing genotypes with acceptable end-use properties and facilitate increased wheat production. PMID:26011437

  5. A novel highly differentially expressed gene in wheat endosperm associated with bread quality.

    PubMed

    Furtado, A; Bundock, P C; Banks, P M; Fox, G; Yin, X; Henry, R J

    2015-05-26

    Analysis of gene expression in developing wheat seeds was used to identify a gene, wheat bread making (wbm), with highly differential expression (~1000 fold) in the starchy endosperm of genotypes varying in bread making quality. Several alleles differing in the 5'-upstream region (promoter) of this gene were identified, with one present only in genotypes with high levels of wbm expression. RNA-Seq analysis revealed low or no wbm expression in most genotypes but high expression (0.2-0.4% of total gene expression) in genotypes that had good bread loaf volume. The wbm gene is predicted to encode a mature protein of 48 amino acids (including four cysteine residues) not previously identified in association with wheat quality, possibly because of its small size and low frequency in the wheat gene pool. Genotypes with high wbm expression all had good bread making quality but not always good physical dough qualities. The predicted protein was sulphur rich suggesting the possibility of a contribution to bread loaf volume by supporting the crossing linking of proteins in gluten. Improved understanding of the molecular basis of differences in bread making quality may allow more rapid development of high performing genotypes with acceptable end-use properties and facilitate increased wheat production.

  6. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori)

    PubMed Central

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-01-01

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family. PMID:27706106

  7. Expression of autophagy-related protein beclin-1 in malignant canine mammary tumors

    PubMed Central

    2013-01-01

    Background Autophagy is a self-catabolic mechanism that degrades unnecessary cellular components through lysosomal enzymes. Beclin-1, an autophagy-related protein, establishes the first connection between autophagy and tumorigenesis. The purpose of this study is to assess the Beclin-1 expression pattern and to determine its prognostic significance in patients with malignant canine mammary tumor (CMT). Results We examined Beclin-1 expression in 70 cases of malignant CMTs by immunohistochemistry. Cytoplasmic Beclin-1 expression was significantly weaker in cancer cells than in nearby normal mammary glands (p < 0.001). Low cytoplasmic expression (57.14%) was associated with older age, lower degree of tubular formation, increased mitotic activity, higher histologic grade, and extensive necrosis. Low nuclear expression (40%) was connected with older age, lower degree of tubular formation, extensive necrosis, and negative for Her2/neu overexpression. Univariate survival analysis showed that Beclin-1 cytoplasmic expression was a poor prognostic factor for overall survival rate (p < 0.001). Multivariate survival analysis demonstrated that Beclin-1 cytoplasmic expression is an independent prognostic factor (p = 0.016). Conclusions Loss of Beclin-1 is associated with aggressive clinicopathologic features and poor overall survival. The results suggest that Beclin-1 plays an important role in tumor progression of malignant CMTs. PMID:23578251

  8. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    PubMed

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  9. The WRKY transcription factor OsWRKY78 regulates stem elongation and seed development in rice.

    PubMed

    Zhang, Chang-Quan; Xu, Yong; Lu, Yan; Yu, Heng-Xiu; Gu, Ming-Hong; Liu, Qiao-Quan

    2011-09-01

    WRKY proteins are a large super family of transcriptional regulators primarily involved in various plant physiological programs. In present study, the expression profile and putative function of the WRKY transcriptional factor, WRKY78, in rice were identified. Real-time RT-PCR analysis showed that OsWRKY78 transcript was most abundant in elongating stems though its expression was detected in all the tested organs. The expression profiles were further confirmed by using promoter-GUS analysis in transgenic rice. OsWRKY78::GFP fusion gene transient expression analysis demonstrated that OsWRKY78 targeted to the nuclei of onion epidermal cell. Furthermore, OsWRKY78 RNAi and overexpression transgenic rice lines were generated. Transgenic plants with OsWRKY78 overexpression exhibited a phenotype identical to the wild type, whereas inhibition of OsWRKY78 expression resulted in a semi-dwarf and small kernel phenotype due to reduced cell length in transgenic plants. In addition, a T-DNA insertion mutant line oswrky78 was identified and a phenotype similar to that of RNAi plants was also observed. Grain quality analysis data showed no significant differences, with the exception of minor changes in endosperm starch crystal structure in RNAi plants. Taken together, these results suggest that OsWRKY78 may acts as a stem elongation and seed development regulator in rice.

  10. Prognostic Significance of MicroRNA-375 Downregulation in Solid Tumors: A Meta-Analysis

    PubMed Central

    Shao, Yingjie; Geng, Yiting; Gu, Wendong; Huang, Jin; Ning, Zhonghua; Pei, Honglei

    2014-01-01

    Objective. Recently, many studies have shown that microRNAs (miRNA) exhibit altered expression in various cancers and may play an important role as prognostic biomarker of cancers. We performed a meta-analysis to evaluate the impact of miR-375 expression in solid tumors on patients' overall survival (OS). Methods. Studies were identified by searching PubMed, Embace, and Cochrane Library (last search update was in May 2014) and were assessed by further quality evaluation. The pooled hazard ratios (HRs) with 95% confidence intervals (CIs) for total and stratified analyses were calculated to investigate the association between miR-375 expression and cancer patients OS. Results. Our analysis results indicated that downregulation of miR-375 predicted poor OS (HR = 1.91, 95% CI 1.48–2.45, P < 0.001). Subgroup analyses showed that lower expression of miR-375 was significantly related with poor OS in patients with esophageal carcinoma (HR = 2.24, 95% CI 1.69–2.96, P < 0.001) and non-small-cell lung cancer (NSCLC) (HR = 1.71, 95% CI 1.31–2.24, P < 0.001). Conclusions. The findings from this meta-analysis suggest that miR-375 expression is associated with OS of patients with malignant tumors and could be a useful clinical prognostic biomarker. PMID:25404787

  11. Identification and expression analysis of an olfactory receptor gene family in green plant bug Apolygus lucorum (Meyer-Dür)

    PubMed Central

    An, Xing-Kui; Sun, Liang; Liu, Hang-Wei; Liu, Dan-Feng; Ding, Yu-Xiao; Li, Le-Mei; Zhang, Yong-Jun; Guo, Yu-Yuan

    2016-01-01

    Olfactory receptors are believed to play a central role in insects host-seeking, mating, and ovipositing. On the basis of male and female antennal transcriptome of adult Apolygus lucorum, a total of 110 candidate A. lucorum odorant receptors (AlucOR) were identified in this study including five previously annotated AlucORs. All the sequences were validated by cloning and sequencing. Tissue expression profiles analysis by RT-PCR indicated most AlucORs were antennal highly expressed genes. The qPCR measurements further revealed 40 AlucORs were significantly higher in the antennae. One AlucOR was primarily expressed in the female antennae, while nine AlucORs exhibited male-biased expression patterns. Additionally, both the RPKM value and RT-qPCR analysis showed AlucOR83 and AlucOR21 were much higher abundant in male antennae than in female antennae, suggesting their different roles in chemoreception of gender. Phylogenetic analysis of ORs from several Hemipteran species demonstrated that most AlucORs had orthologous genes, and five AlucOR-specific clades were defined. In addition, a sub-clade of potential male-based sex pheromone receptors were also identified in the phylogenetic tree of AlucORs. Our results will facilitate the functional studies of AlucORs, and thereby provide a foundation for novel pest management approaches based on these genes. PMID:27892490

  12. A novel approach for human whole transcriptome analysis based on absolute gene expression of microarray data.

    PubMed

    Bikel, Shirley; Jacobo-Albavera, Leonor; Sánchez-Muñoz, Fausto; Cornejo-Granados, Fernanda; Canizales-Quinteros, Samuel; Soberón, Xavier; Sotelo-Mundo, Rogerio R; Del Río-Navarro, Blanca E; Mendoza-Vargas, Alfredo; Sánchez, Filiberto; Ochoa-Leyva, Adrian

    2017-01-01

    In spite of the emergence of RNA sequencing (RNA-seq), microarrays remain in widespread use for gene expression analysis in the clinic. There are over 767,000 RNA microarrays from human samples in public repositories, which are an invaluable resource for biomedical research and personalized medicine. The absolute gene expression analysis allows the transcriptome profiling of all expressed genes under a specific biological condition without the need of a reference sample. However, the background fluorescence represents a challenge to determine the absolute gene expression in microarrays. Given that the Y chromosome is absent in female subjects, we used it as a new approach for absolute gene expression analysis in which the fluorescence of the Y chromosome genes of female subjects was used as the background fluorescence for all the probes in the microarray. This fluorescence was used to establish an absolute gene expression threshold, allowing the differentiation between expressed and non-expressed genes in microarrays. We extracted the RNA from 16 children leukocyte samples (nine males and seven females, ages 6-10 years). An Affymetrix Gene Chip Human Gene 1.0 ST Array was carried out for each sample and the fluorescence of 124 genes of the Y chromosome was used to calculate the absolute gene expression threshold. After that, several expressed and non-expressed genes according to our absolute gene expression threshold were compared against the expression obtained using real-time quantitative polymerase chain reaction (RT-qPCR). From the 124 genes of the Y chromosome, three genes (DDX3Y, TXLNG2P and EIF1AY) that displayed significant differences between sexes were used to calculate the absolute gene expression threshold. Using this threshold, we selected 13 expressed and non-expressed genes and confirmed their expression level by RT-qPCR. Then, we selected the top 5% most expressed genes and found that several KEGG pathways were significantly enriched. Interestingly, these pathways were related to the typical functions of leukocytes cells, such as antigen processing and presentation and natural killer cell mediated cytotoxicity. We also applied this method to obtain the absolute gene expression threshold in already published microarray data of liver cells, where the top 5% expressed genes showed an enrichment of typical KEGG pathways for liver cells. Our results suggest that the three selected genes of the Y chromosome can be used to calculate an absolute gene expression threshold, allowing a transcriptome profiling of microarray data without the need of an additional reference experiment. Our approach based on the establishment of a threshold for absolute gene expression analysis will allow a new way to analyze thousands of microarrays from public databases. This allows the study of different human diseases without the need of having additional samples for relative expression experiments.

  13. Characterization of shark complement factor I gene(s): genomic analysis of a novel shark-specific sequence.

    PubMed

    Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L

    2009-07-01

    Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (

  14. Characterization of shark complement factor I gene(s): genomic analysis of a novel shark-specific sequence

    PubMed Central

    Shin, Dong-Ho; Webb, Barbara M.; Nakao, Miki; Smith, Sylvia L.

    2009-01-01

    Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and –d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (≤) amino acid identities with each other, 35.4 ~ 39.6% and 62.8 ~ 65.9% with factor I of mammals and banded houndshark (Triakis scyllium), respectively. The modular structure of the GcIf is similar to that of mammals with one notable exception, the presence of a novel shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1, 2 and 3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082 bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent. PMID:19423168

  15. High expression of Y-box-binding protein 1 is associated with local recurrence and predicts poor outcome in patients with colorectal cancer

    PubMed Central

    Yan, Xuebing; Yan, Leilei; zhou, Jia; Liu, Sihong; Shan, Zezhi; Jiang, Chunyu; Tian, Yuan; Jin, Zhiming

    2014-01-01

    Colorectal cancer (CRC) is one of the most common and fatal malignancies worldwide. Novel prognostic biomarkers are urgently warranted to help improve the treatment of CRC. Y-box-binding protein 1 (YB-1) has been identified as a multifunctional oncoprotein in various malignancies. Our previous study has suggested that YB-1 may promote malignant progression of CRC cells in vitro. However, its clinical and prognostic significance in CRC patients remains unclear. In this study, the expression of YB-1 was examined in 32 fresh CRC tissues using quantitative real-time polymerase chain reaction (qRT-PCR) and in 170 paraffin-embedded CRC tissues using immunohistochemistry. The result of qRT-PCR demonstrated mRNA expression of YB-1 was increased in 26 of 32 (81.25%) of CRC patients. The statistical analysis based on immunohistochemical staining suggested that YB-1 expression was significantly correlated with tumor differentiation, tumor invasion, lymph node metastasis and Dukes’ classification (all P<0.05). Furthermore, we found that patients with high YB-1 expression had a poorer prognosis and were more likely to undergo local recurrence, compared to those with low YB-1 expression. We also identified that YB-1 expression, together with lymph node metastasis and Dukes’ classification were independent prognostic factors for CRC patients. In conclusion, our study for the first time demonstrated the clinical and prognostic significance of YB-1 in CRC and suggested that YB-1 is of great potential to be an attractive therapeutic target as well as prognostic biomarker for CRC patients. PMID:25674237

  16. Statistical indicators of collective behavior and functional clusters in gene networks of yeast

    NASA Astrophysics Data System (ADS)

    Živković, J.; Tadić, B.; Wick, N.; Thurner, S.

    2006-03-01

    We analyze gene expression time-series data of yeast (S. cerevisiae) measured along two full cell-cycles. We quantify these data by using q-exponentials, gene expression ranking and a temporal mean-variance analysis. We construct gene interaction networks based on correlation coefficients and study the formation of the corresponding giant components and minimum spanning trees. By coloring genes according to their cell function we find functional clusters in the correlation networks and functional branches in the associated trees. Our results suggest that a percolation point of functional clusters can be identified on these gene expression correlation networks.

  17. Genomic characterization, phylogenetic comparison and differential expression of the cyclic nucleotide-gated channels gene family in pear (Pyrus bretchneideri Rehd.).

    PubMed

    Chen, Jianqing; Yin, Hao; Gu, Jinping; Li, Leiting; Liu, Zhe; Jiang, Xueting; Zhou, Hongsheng; Wei, Shuwei; Zhang, Shaoling; Wu, Juyou

    2015-01-01

    The cyclic nucleotide-gated channel (CNGC) family is involved in the uptake of various cations, such as Ca(2+), to regulate plant growth and respond to biotic and abiotic stresses. However, there is far less information about this family in woody plants such as pear. Here, we provided a genome-wide identification and analysis of the CNGC gene family in pear. Phylogenetic analysis showed that the 21 pear CNGC genes could be divided into five groups (I, II, III, IVA and IVB). The majority of gene duplications in pear appeared to have been caused by segmental duplication and occurred 32.94-39.14 million years ago. Evolutionary analysis showed that positive selection had driven the evolution of pear CNGCs. Motif analyses showed that Group I CNGCs generally contained 26 motifs, which was the greatest number of motifs in all CNGC groups. Among these, eight motifs were shared by each group, suggesting that these domains play a conservative role in CNGC activity. Tissue-specific expression analysis indicated that functional diversification of the duplicated CNGC genes was a major feature of long-term evolution. Our results also suggested that the P-S6 and PBC & hinge domains had co-evolved during the evolution. These results provide valuable information to increase our understanding of the function, evolution and expression analyses of the CNGC gene family in higher plants. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Cloning, Characterization, and Expression Analysis of the Novel Acetyltransferase Retrogene Ard1b in the Mouse1

    PubMed Central

    Pang, Alan Lap-Yin; Peacock, Stephanie; Johnson, Warren; Bear, Deborah H.; Rennert, Owen M.; Chan, Wai-Yee

    2009-01-01

    N-alpha-terminal acetylation is a modification process that occurs cotranslationally on most eukaryotic proteins. The major enzyme responsible for this process, N-alpha-terminal acetyltransferase, is composed of the catalytic subunit ARD1A and the auxiliary subunit NAT1. We cloned, characterized, and studied the expression pattern of Ard1b (also known as Ard2), a novel homolog of the mouse Ard1a. Comparison of the genomic structures suggests that the autosomal Ard1b is a retroposed copy of the X-linked Ard1a. Expression analyses demonstrated a testis predominance of Ard1b. A reciprocal expression pattern between Ard1a and Ard1b is also observed during spermatogenesis, suggesting that Ard1b is expressed to compensate for the loss of Ard1a starting from meiosis. Both ARD1A and ARD1B can interact with NAT1 to constitute a functional N-alpha-terminal acetyltransferase in vitro. The expression of ARD1B protein can be detected in mouse testes but is delayed until the first appearance of round spermatids. In a cell culture model, the inclusion of the long 3′ untranslated region of Ard1b leads to reduction of luciferase reporter activity, which implicates its role in translational repression of Ard1b during spermatogenesis. Our results suggest that ARD1B may have an important role in the later course of the spermatogenic process. PMID:19246321

  19. Cloning, characterization, and expression analysis of the novel acetyltransferase retrogene Ard1b in the mouse.

    PubMed

    Pang, Alan Lap-Yin; Peacock, Stephanie; Johnson, Warren; Bear, Deborah H; Rennert, Owen M; Chan, Wai-Yee

    2009-08-01

    N-alpha-terminal acetylation is a modification process that occurs cotranslationally on most eukaryotic proteins. The major enzyme responsible for this process, N-alpha-terminal acetyltransferase, is composed of the catalytic subunit ARD1A and the auxiliary subunit NAT1. We cloned, characterized, and studied the expression pattern of Ard1b (also known as Ard2), a novel homolog of the mouse Ard1a. Comparison of the genomic structures suggests that the autosomal Ard1b is a retroposed copy of the X-linked Ard1a. Expression analyses demonstrated a testis predominance of Ard1b. A reciprocal expression pattern between Ard1a and Ard1b is also observed during spermatogenesis, suggesting that Ard1b is expressed to compensate for the loss of Ard1a starting from meiosis. Both ARD1A and ARD1B can interact with NAT1 to constitute a functional N-alpha-terminal acetyltransferase in vitro. The expression of ARD1B protein can be detected in mouse testes but is delayed until the first appearance of round spermatids. In a cell culture model, the inclusion of the long 3' untranslated region of Ard1b leads to reduction of luciferase reporter activity, which implicates its role in translational repression of Ard1b during spermatogenesis. Our results suggest that ARD1B may have an important role in the later course of the spermatogenic process.

  20. Functional role of Runx3 in the regulation of aggrecan expression during cartilage development.

    PubMed

    Wigner, Nathan A; Soung, Do Y; Einhorn, Thomas A; Drissi, Hicham; Gerstenfeld, Louis C

    2013-11-01

    Runx2 and Runx3 are known to be expressed in the growth plate during endochondral bone formation. Here we addressed the functional role of Runx3 as distinct from Runx2 by using two models of postnatal bone repair: fracture healing that proceeds by an endochondral process and marrow ablation that proceeds by only an intramembranous process. Both Runx2 and Runx3 mRNAs were differentially up regulated during fracture healing. In contrast, only Runx2 showed increased expression after marrow ablation. During fracture healing, Runx3 was expressed earlier than Runx2, was concurrent with the period of chondrogenesis, and coincident with maximal aggrecan expression a protein associated with proliferating and permanent cartilage. Immunohistological analysis showed Runx3 protein was also expressed by chondrocytes in vivo. In contrast, Runx2 was expressed later during chondrocyte hypertrophy, and primary bone formation. The functional activities of Runx3 during chondrocyte differentiation were assessed by examining its regulatory actions on aggrecan gene expression. Aggrecan mRNA levels and aggrecan promoter activity were enhanced in response to the over-expression of either Runx2 and Runx3 in ATDC5 chondrogenic cell line, while sh-RNA knocked down of each Runx protein showed that only Runx3 knock down specifically suppressed aggrecan mRNA expression and promoter activity. ChIP assay demonstrated that Runx3 interactions were selective to sites within the aggrecan promoter and were only observed during early periods of chondrogenesis before hypertrophy. Our studies suggest that Runx3 positively regulates aggrecan expression and suggest that its function is more limited to cartilage development than to bone. In aggregate these data further suggest that the various members of the Runx transcription factors are involved in the coordination of chondrocyte development, maturation, and hypertrophy during endochondral bone formation. Copyright © 2013 Wiley Periodicals, Inc.

  1. Rhox8 Ablation in the Sertoli Cells Using a Tissue-Specific RNAi Approach Results in Impaired Male Fertility in Mice.

    PubMed

    Welborn, Joshua P; Davis, Matthew G; Ebers, Steven D; Stodden, Genna R; Hayashi, Kanako; Cheatwood, Joseph L; Rao, Manjeet K; MacLean, James A

    2015-07-01

    The reproductive homeobox X-linked, Rhox, genes encode transcription factors that are selectively expressed in reproductive tissues. While there are 33 Rhox genes in mice, only Rhox and Rhox8 are expressed in Sertoli cells, suggesting that they may regulate the expression of somatic-cell gene products crucial for germ cell development. We previously characterized Rhox5-null mice, which are subfertile, exhibiting excessive germ cell apoptosis and compromised sperm motility. To assess the role of Rhox8 in Sertoli cells, we used a tissue-specific RNAi approach to knockdown RHOX8 in vivo, in which the Rhox5 promoter was used to drive Rhox8-siRNA transgene expression in the postnatal Sertoli cells. Western and immunohistochemical analysis confirmed Sertoli-specific knockdown of RHOX8. However, other Sertoli markers, Gata1 and Rhox5, maintained normal expression patterns, suggesting that the knockdown was specific. Interestingly, male RHOX8-knockdown animals showed significantly reduced spermatogenic output, increased germ cell apoptosis, and compromised sperm motility, leading to impaired fertility. Importantly, our results revealed that while some RHOX5-dependent factors were also misregulated in Sertoli cells of RHOX8-knockdown animals, the majority were not, and novel putative RHOX8-regulated genes were identified. This suggests that while reduction in levels of RHOX5 and RHOX8 in Sertoli cells elicits similar phenotypes, these genes are not entirely redundant. Taken together, our study underscores the importance of Rhox genes in male fertility and suggests that Sertoli cell-specific expression of Rhox5 and Rhox8 is critical for complete male fertility. © 2015 by the Society for the Study of Reproduction, Inc.

  2. Rhox8 Ablation in the Sertoli Cells Using a Tissue-Specific RNAi Approach Results in Impaired Male Fertility in Mice1

    PubMed Central

    Welborn, Joshua P.; Davis, Matthew G.; Ebers, Steven D.; Stodden, Genna R.; Hayashi, Kanako; Cheatwood, Joseph L.; Rao, Manjeet K.; MacLean, James A.

    2015-01-01

    The reproductive homeobox X-linked, Rhox, genes encode transcription factors that are selectively expressed in reproductive tissues. While there are 33 Rhox genes in mice, only Rhox and Rhox8 are expressed in Sertoli cells, suggesting that they may regulate the expression of somatic-cell gene products crucial for germ cell development. We previously characterized Rhox5-null mice, which are subfertile, exhibiting excessive germ cell apoptosis and compromised sperm motility. To assess the role of Rhox8 in Sertoli cells, we used a tissue-specific RNAi approach to knockdown RHOX8 in vivo, in which the Rhox5 promoter was used to drive Rhox8-siRNA transgene expression in the postnatal Sertoli cells. Western and immunohistochemical analysis confirmed Sertoli-specific knockdown of RHOX8. However, other Sertoli markers, Gata1 and Rhox5, maintained normal expression patterns, suggesting that the knockdown was specific. Interestingly, male RHOX8-knockdown animals showed significantly reduced spermatogenic output, increased germ cell apoptosis, and compromised sperm motility, leading to impaired fertility. Importantly, our results revealed that while some RHOX5-dependent factors were also misregulated in Sertoli cells of RHOX8-knockdown animals, the majority were not, and novel putative RHOX8-regulated genes were identified. This suggests that while reduction in levels of RHOX5 and RHOX8 in Sertoli cells elicits similar phenotypes, these genes are not entirely redundant. Taken together, our study underscores the importance of Rhox genes in male fertility and suggests that Sertoli cell-specific expression of Rhox5 and Rhox8 is critical for complete male fertility. PMID:25972016

  3. The LMNA mutation p.Arg321Ter associated with dilated cardiomyopathy leads to reduced expression and a skewed ratio of lamin A and lamin C proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Al-Saaidi, Rasha; Rasmussen, Torsten B.; Palmfeldt, Johan

    2013-11-15

    Dilated cardiomyopathy (DCM) is a disease of the heart muscle characterized by cardiac chamber enlargement and reduced systolic function of the left ventricle. Mutations in the LMNA gene represent the most frequent known genetic cause of DCM associated with disease of the conduction systems. The LMNA gene generates two major transcripts encoding the nuclear lamina major components lamin A and lamin C by alternative splicing. Both haploinsuffiency and dominant negative effects have been proposed as disease mechanism for premature termination codon (PTC) mutations in LMNA. These mechanisms however are still not clearly established. In this study, we used a representativemore » LMNA nonsense mutation, p.Arg321Ter, to shed light on the molecular disease mechanisms. Cultured fibroblasts from three DCM patients carrying this mutation were analyzed. Quantitative reverse transcriptase PCR and sequencing of these PCR products indicated that transcripts from the mutant allele were degraded by the nonsense-mediated mRNA decay (NMD) mechanism. The fact that no truncated mutant protein was detectable in western blot (WB) analysis strengthens the notion that the mutant transcript is efficiently degraded. Furthermore, WB analysis showed that the expression of lamin C protein was reduced by the expected approximately 50%. Clearly decreased lamin A and lamin C levels were also observed by immunofluorescence microscopy analysis. However, results from both WB and nano-liquid chromatography/mass spectrometry demonstrated that the levels of lamin A protein were more reduced suggesting an effect on expression of lamin A from the wild type allele. PCR analysis of the ratio of lamin A to lamin C transcripts showed unchanged relative amounts of lamin A transcript suggesting that the effect on the wild type allele was operative at the protein level. Immunofluorescence microscopy analysis showed no abnormal nuclear morphology of patient fibroblast cells. Based on these data, we propose that heterozygosity for the nonsense mutation causes NMD degradation of the mutant transcripts blocking expression of the truncated mutant protein and an additional trans effect on lamin A protein levels expressed from the wild type allele. We discuss the possibility that skewing of the lamin A to lamin C ratio may contribute to ensuing processes that destabilize cardiomyocytes and trigger cardiomyopathy - Highlights: • We study disease mechanisms in DCM patients carrying PTC mutations in the LMNA gene. • The mutant transcript is degraded by the nonsense mediated mRNA decay system. • Skewed lamin A to lamin C protein ratio expressed from the wild type allele. • We suggest a combined pathomechanism: haploinsuffiency plus lamin A/C imbalance.« less

  4. Expression of virulence factors by Staphylococcus aureus grown in serum.

    PubMed

    Oogai, Yuichi; Matsuo, Miki; Hashimoto, Masahito; Kato, Fuminori; Sugai, Motoyuki; Komatsuzawa, Hitoshi

    2011-11-01

    Staphylococcus aureus produces many virulence factors, including toxins, immune-modulatory factors, and exoenzymes. Previous studies involving the analysis of virulence expression were mainly performed by in vitro experiments using bacterial medium. However, when S. aureus infects a host, the bacterial growth conditions are quite different from those in a medium, which may be related to the different expression of virulence factors in the host. In this study, we investigated the expression of virulence factors in S. aureus grown in calf serum. The expression of many virulence factors, including hemolysins, enterotoxins, proteases, and iron acquisition factors, was significantly increased compared with that in bacterial medium. In addition, the expression of RNA III, a global regulon for virulence expression, was significantly increased. This effect was partially restored by the addition of 300 μM FeCl₃ into serum, suggesting that iron depletion is associated with the increased expression of virulence factors in serum. In chemically defined medium without iron, a similar effect was observed. In a mutant with agr inactivated grown in serum, the expression of RNA III, psm, and sec4 was not increased, while other factors were still induced in the mutant, suggesting that another regulatory factor(s) is involved. In addition, we found that serum albumin is a major factor for the capture of free iron to prevent the supply of iron to bacteria grown in serum. These results indicate that S. aureus expresses virulence factors in adaptation to the host environment.

  5. Accumulation of p62 in degenerated spinal cord under chronic mechanical compression

    PubMed Central

    Tanabe, Fumito; Yone, Kazunori; Kawabata, Naoya; Sakakima, Harutoshi; Matsuda, Fumiyo; Ishidou, Yasuhiro; Maeda, Shingo; Abematsu, Masahiko; Komiya, Setsuro

    2011-01-01

    Intracellular accumulation of altered proteins, including p62 and ubiquitinated proteins, is the basis of most neurodegenerative disorders. The relationship among the accumulation of altered proteins, autophagy, and spinal cord dysfunction by cervical spondylotic myelopathy has not been clarified. We examined the expression of p62 and autophagy markers in the chronically compressed spinal cord of tiptoe-walking Yoshimura mice. In addition, we examined the expression and roles of p62 and autophagy in hypoxic neuronal cells. Western blot analysis showed the accumulation of p62, ubiquitinated proteins, and microtubule-associated protein 1 light chain 3 (LC3), an autophagic marker, in the compressed spinal cord. Immunohistochemical examinations showed that p62 accumulated in neurons, axons, astrocytes, and oligodendrocytes. Electron microscopy showed the expression of autophagy markers, including autolysosomes and autophagic vesicles, in the compressed spinal cord. These findings suggest the presence of p62 and autophagy in the degenerated compressed spinal cord. Hypoxic stress increased the expression of p62, ubiquitinated proteins, and LC3-II in neuronal cells. In addition, LC3 turnover assay and GFP-LC3 cleavage assay showed that hypoxic stress increased autophagy flux in neuronal cells. These findings suggest that hypoxic stress induces accumulation of p62 and autophagy in neuronal cells. The forced expression of p62 decreased the number of neuronal cells under hypoxic stress. These findings suggest that p62 accumulation under hypoxic stress promotes neuronal cell death. Treatment with 3-methyladenine, an autophagy inhibitor decreased the number of neuronal cells, whereas lithium chloride, an autophagy inducer increased the number of cells under hypoxic stress. These findings suggest that autophagy promotes neuronal cell survival under hypoxic stress. Our findings suggest that pharmacological inducers of autophagy may be useful for treating cervical spondylotic myelopathy patients. PMID:22082874

  6. Transcriptional over-expression of chloride intracellular channels 3 and 4 in malignant pleural mesothelioma.

    PubMed

    Tasiopoulou, Vasiliki; Magouliotis, Dimitrios; Solenov, Evgeniy I; Vavougios, Georgios; Molyvdas, Paschalis-Adam; Gourgoulianis, Konstantinos I; Hatzoglou, Chrissi; Zarogiannis, Sotirios G

    2015-12-01

    Chloride Intracellular Channels (CLICs) are contributing to the regulation of multiple cellular functions. CLICs have been found over-expressed in several malignancies, and therefore they are currently considered as potential drug targets. The goal of our study was to assess the gene expression levels of the CLIC's 1-6 in malignant pleural mesothelioma (MPM) as compared to controls. We used gene expression data from a publicly available microarray dataset comparing MPM versus healthy tissue in order to investigate the differential expression profile of CLIC 1-6. False discovery rates were calculated and the interactome of the significantly differentially expressed CLICs was constructed and Functional Enrichment Analysis for Gene Ontologies (FEAGO) was performed. In MPM, the gene expressions of CLIC3 and CLIC4 were significantly increased compared to controls (p=0.001 and p<0.001 respectively). A significant positive correlation between the gene expressions of CLIC3 and CLIC4 (p=0.0008 and Pearson's r=0.51) was found. Deming regression analysis provided an association equation between the CLIC3 and CLIC4 gene expressions: CLIC3=4.42CLIC4-10.07. Our results indicate that CLIC3 and CLIC4 are over-expressed in human MPM. Moreover, their expressions correlate suggesting that they either share common gene expression inducers or that their products act synergistically. FAEGO showed that CLIC interactome might contribute to TGF beta signaling and water transport. Copyright © 2015 Elsevier Ltd. All rights reserved.

  7. Evolutionarily conserved ELOVL4 gene expression in the vertebrate retina.

    PubMed

    Lagali, Pamela S; Liu, Jiafan; Ambasudhan, Rajesh; Kakuk, Laura E; Bernstein, Steven L; Seigel, Gail M; Wong, Paul W; Ayyagari, Radha

    2003-07-01

    The gene elongation of very long chain fatty acids-4 (ELOVL4) has been shown to underlie phenotypically heterogeneous forms of autosomal dominant macular degeneration. In this study, the extent of evolutionary conservation and the existence and localization of retinal expression of this gene was investigated across a wide variety of species. Southern blot analysis of genomic DNA and bioinformatic analysis using the human ELOVL4 cDNA and protein sequences, respectively, were performed to identify species in which ELOVL4 orthologues and/or homologues are present. Retinal RNA and protein extracts derived from different species were assessed by Northern hybridization and immunoblot techniques to assess evolutionary conservation of gene expression. Immunohistochemical analysis of tissue sections prepared from various mammalian retinas was performed to determine the distribution of ELOVL4 and homologous proteins within specific retinal cell layers. The existence of ELOVL4 sequence orthologues and homologues was confirmed by both Southern blot analysis and in silico searches of protein sequence databases. Phylogenetic analysis places ELOVL4 among a large family of known and putative fatty acid elongase proteins. Northern blot analysis revealed the presence of multiple transcripts corresponding to ELOVL4 homologues expressed in the retina of several different mammalian species. Conserved proteins were also detected among retinal extracts of different mammals and were found to localize predominantly to the photoreceptor cell layer within retinal tissue preparations. The ELOVL4 gene is highly conserved throughout evolution and is expressed in the photoreceptor cells of the retina in a variety of different species, which suggests that it plays a critical role in retinal cell biology.

  8. Evolutionary characterization and transcript profiling of β-tubulin genes in flax (Linum usitatissimum L.) during plant development.

    PubMed

    Gavazzi, Floriana; Pigna, Gaia; Braglia, Luca; Gianì, Silvia; Breviario, Diego; Morello, Laura

    2017-12-08

    Microtubules, polymerized from alpha and beta-tubulin monomers, play a fundamental role in plant morphogenesis, determining the cell division plane, the direction of cell expansion and the deposition of cell wall material. During polarized pollen tube elongation, microtubules serve as tracks for vesicular transport and deposition of proteins/lipids at the tip membrane. Such functions are controlled by cortical microtubule arrays. Aim of this study was to first characterize the flax β-tubulin family by sequence and phylogenetic analysis and to investigate differential expression of β-tubulin genes possibly related to fibre elongation and to flower development. We report the cloning and characterization of the complete flax β-tubulin gene family: exon-intron organization, duplicated gene comparison, phylogenetic analysis and expression pattern during stem and hypocotyl elongation and during flower development. Sequence analysis of the fourteen expressed β-tubulin genes revealed that the recent whole genome duplication of the flax genome was followed by massive retention of duplicated tubulin genes. Expression analysis showed that β-tubulin mRNA profiles gradually changed along with phloem fibre development in both the stem and hypocotyl. In flowers, changes in relative tubulin transcript levels took place at anthesis in anthers, but not in carpels. Phylogenetic analysis supports the origin of extant plant β-tubulin genes from four ancestral genes pre-dating angiosperm separation. Expression analysis suggests that particular tubulin subpopulations are more suitable to sustain different microtubule functions such as cell elongation, cell wall thickening or pollen tube growth. Tubulin genes possibly related to different microtubule functions were identified as candidate for more detailed studies.

  9. Transcription of G-protein coupled receptors in corporal smooth muscle is regulated by sialorphin (an endogenous neutral endopeptidase inhibitor)

    PubMed Central

    Tong, Yuehong; Tiplitsky, Scott I.; Tar, Moses; Melman, Arnold; Davies, Kelvin P.

    2009-01-01

    Purpose Several reports have suggested the rat Vcsa1 gene is down-regulated in models of erectile dysfunction (ED). Vcsa’s protein product, sialorphin, is an endogenous neutral endopeptidase (NEP), and its down-regulation could result in prolonged activation of G-protein activated signaling pathways by their peptide agonists. We investigated if down- regulation of Vcsa1 could result in adaptive change in the expression of G-protein coupled receptors (GPCR). Materials and Methods Gene expression in cultured rat corporal smooth muscle cells (CSM) following treatment with siRNA directed against Vcsa1 or the NEP gene was analyzed using microarray and quantitative RT-PCR. In rats Vcsa1 is one of the most down-regulated genes following bilateral transection of the cavernosal nerves. Using that animal model, we also investigated whether the down-regulation of Vcsa1 is accompanied by similar changes in gene expression observed in the CSM cells where Vcsa1 was knocked-down in vitro. Results Microarray analysis and quantitative RT-PCR demonstrated that CSM cells treated in vitro with siRNA against Vcsa1 resulted in up-regulation of GPCR as a functional group. In contrast, treatment of CSM cells that lowered NEP activity resulted in decreases in GPCR expression. These results suggest that the peptide product of Vcsa1, sialorphin, can effect GPCR expression by acting on NEP. In animals with bilaterally transected cavernous nerves the reduced expression of Vcsa1 is accompanied by increased GPCR expression in cavernosal tissue. Conclusions These experiments suggest that the mechanism by which Vcsa1 modulates erectile function is partly mediated through changes in GPCR expression. PMID:18554633

  10. Transcription of G-protein coupled receptors in corporeal smooth muscle is regulated by the endogenous neutral endopeptidase inhibitor sialorphin.

    PubMed

    Tong, Yuehong; Tiplitsky, Scott I; Tar, Moses; Melman, Arnold; Davies, Kelvin P

    2008-08-01

    Several reports suggest that the rat Vcsa1 gene is down-regulated in models of erectile dysfunction. The Vcsa protein product sialorphin is an endogenous neutral endopeptidase inhibitor and its down-regulation could result in prolonged activation of G-protein activated signaling pathways by their peptide agonists. We investigated whether Vcsa1 down-regulation could result in an adaptive change in GPCR (G-protein coupled receptor) expression. Gene expression in cultured rat corporeal smooth muscle cells following treatment with siRNA directed against Vcsa1 or the neutral endopeptidase gene was analyzed using microarray and quantitative reverse transcriptase-polymerase chain reaction. In rats Vcsa1 is one of the most down-regulated genes following bilateral transection of the cavernous nerves. In that animal model we also investigated whether Vcsa1 down-regulation was accompanied by similar changes in gene expression in corporeal smooth muscle cells in which Vcsa1 was knocked down in vitro. Microarray analysis and quantitative reverse transcriptase-polymerase chain reaction demonstrated that corporeal smooth muscle cells treated in vitro with siRNA against Vcsa1 resulted in GPCR up-regulation as a functional group. In contrast, treatment of corporeal smooth muscle cells that lowered neutral endopeptidase activity resulted in decreased GPCR expression. These results suggest that the peptide product of Vcsa1, sialorphin, can effect GPCR expression by acting on neutral endopeptidase. In animals with bilaterally transected cavernous nerves the decreased Vcsa1 expression is accompanied by increased GPCR expression in cavernous tissue. These experiments suggest that the mechanism by which Vcsa1 modulates erectile function is partly mediated through changes in GPCR expression.

  11. Microbial Disruption of Autophagy Alters Expression of the RISC Component AGO2, a Critical Regulator of the miRNA Silencing Pathway.

    PubMed

    Sibony, Michal; Abdullah, Majd; Greenfield, Laura; Raju, Deepa; Wu, Ted; Rodrigues, David M; Galindo-Mata, Esther; Mascarenhas, Heidi; Philpott, Dana J; Silverberg, Mark S; Jones, Nicola L

    2015-12-01

    Autophagy is implicated in Crohn's disease (CD) pathogenesis. Recent evidence suggests autophagy regulates the microRNA (miRNA)-induced silencing complex (miRISC). Therefore, autophagy may play a novel role in CD by regulating expression of miRISC, thereby altering miRNA silencing. As microbes associated with CD can alter autophagy, we hypothesized that microbial disruption of autophagy affects the critical miRISC component AGO2. AGO2 expression was assessed in epithelial and immune cells, and intestinal organoids with disrupted autophagy. Microarray technology was used to determine the expression of downstream miRNAs in cells with defective autophagy. Increased AGO2 was detected in autophagy-deficient ATG5-/- and ATG16-/- mouse embryonic fibroblast cells (MEFs) in comparison with wild-type MEFs. Chemical agents and VacA toxin, which disrupt autophagy, increased AGO2 expression in MEFs, epithelial cells lines, and human monocytes, respectively. Increased AGO2 was also detected in ATG7-/- intestinal organoids, in comparison with wild-type organoids. Five miRNAs were differentially expressed in autophagy-deficient MEFs. Pathway enrichment analysis of the differentially expressed miRNAs implicated signaling pathways previously associated with CD. Taken together, our results suggest that autophagy is involved in the regulation of the critical miRISC component AGO2 in epithelial and immune cells and primary intestinal epithelial cells. We propose a mechanism by which autophagy alters miRNA expression, which likely impacts the regulation of CD-associated pathways. Furthermore, as enteric microbial products can manipulate autophagy and AGO2, our findings suggest a novel mechanism by which enteric microbes could influence miRNA to promote disease.

  12. Absence of Metallothionein 3 Expression in Breast Cancer is a Rare, But Favorable Marker of Outcome that is Under Epigenetic Control

    PubMed Central

    Somji, Seema; Garrett, Scott H.; Zhou, Xu Dong; Zheng, Yun; Sens, Donald A.; Sens, Mary Ann

    2010-01-01

    Cadmium (Cd+2), a known carcinogen mimics the effects of estrogen in the uterus and mammary gland suggesting its possible involvement in the development and progression of breast cancer. This lab showed through analysis of a small set of archival human diagnostic specimens that the third isoform of the classic Cd+2 binding protein metallothionein (MT-3), is not expressed in normal breast tissue, but is expressed in some breast cancers and that expression tends to correlate with a poor disease outcome. The goals of the present study were to verify that overexpression of MT-3 in a large set of archival human diagnostic specimens tends to correlate with poor disease outcome and define the mechanism of MT-3 gene regulation in the normal breast epithelial cell. The results showed that MT-3 was expressed in approximately 90% of all breast cancers and was absent in normal breast epithelium. The lack of MT-3 staining in some cancers correlated with a favorable patient outcome. High frequency of MT-3 staining was also found for in situ breast cancer suggesting that MT-3 might be an early biomarker for breast cancer. The study also demonstrated that the MCF-10A cell line, an immortalized, non-tumorigenic model of human breast epithelial cells, displayed no basal expression of MT-3, nor was it induced by Cd+2. Treatment of the MCF-10A cells with the demethylation agent, 5-Aza-2′-deoxycytidine, or the histone deacetylase inhibitor, MS-275, restored MT-3 mRNA expression. It was also shown that the MT-3 metal regulatory elements are potentially active binders of protein factors following treatment with these inhibitors suggesting that MT-3 expression may be subject to epigenetic regulation. PMID:21170156

  13. Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

    PubMed

    Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

    2015-06-30

    Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

  14. Ovarian Brenner tumour: a morphologic and immunohistochemical analysis suggesting an origin from fallopian tube epithelium.

    PubMed

    Kuhn, Elisabetta; Ayhan, Ayse; Shih, Ie-Ming; Seidman, Jeffrey D; Kurman, Robert J

    2013-12-01

    Brenner tumours (BTs), like other epithelial ovarian tumours, are thought to develop from the ovarian surface epithelium. We hypothesised that BTs arise from transitional metaplasia near the tuboperitoneal junction which, when embedded in the ovary as Walthard cell nests, may progress to BTs. The aim of this study was to validate this hypothesis by a morphologic and immunohistochemical (IHC) analysis. The IHC analysis revealed that fallopian tube secretory cells, transitional metaplasia, Walthard cell nests and the epithelial component of BTs shared a similar IHC profile, consistently expressing AKR1C3 (an enzyme involved in androgen biosynthesis) and androgen receptor, but not calretinin. The tumour stromal cells that immediately surrounded the epithelial nests showed strong expression of calretinin, inhibin and steroidogenic factor 1 (markers of steroidogenic cells) in the majority of BTs. Using a highly sensitive immunofluorescent staining method, we detected small groups of cilia in transitional metaplasia and Walthard cell nests, multifocal stretches of cilia and/or ciliated vacuoles in benign BTs and well-developed cilia in atypical proliferative BTs. Our findings suggest a tubal origin of BTs through transitional metaplasia and Walthard cell nests, based on their anatomic proximity, similar IHC profile and the presence of cilia. In addition, we hypothesise a role of androgenic stimulation in the pathogenesis of BT, based on the IHC staining pattern of calretinin, inhibin and steroidogenic factor 1 expressed in the luteinised stromal cells surrounding the epithelial nests of the tumours, and AKR1C3 and androgen receptor expressed in both the epithelial and stromal components. Copyright © 2013 Elsevier Ltd. All rights reserved.

  15. In-Silico Integration Approach to Identify a Key miRNA Regulating a Gene Network in Aggressive Prostate Cancer

    PubMed Central

    Colaprico, Antonio; Bontempi, Gianluca; Castiglioni, Isabella

    2018-01-01

    Like other cancer diseases, prostate cancer (PC) is caused by the accumulation of genetic alterations in the cells that drives malignant growth. These alterations are revealed by gene profiling and copy number alteration (CNA) analysis. Moreover, recent evidence suggests that also microRNAs have an important role in PC development. Despite efforts to profile PC, the alterations (gene, CNA, and miRNA) and biological processes that correlate with disease development and progression remain partially elusive. Many gene signatures proposed as diagnostic or prognostic tools in cancer poorly overlap. The identification of co-expressed genes, that are functionally related, can identify a core network of genes associated with PC with a better reproducibility. By combining different approaches, including the integration of mRNA expression profiles, CNAs, and miRNA expression levels, we identified a gene signature of four genes overlapping with other published gene signatures and able to distinguish, in silico, high Gleason-scored PC from normal human tissue, which was further enriched to 19 genes by gene co-expression analysis. From the analysis of miRNAs possibly regulating this network, we found that hsa-miR-153 was highly connected to the genes in the network. Our results identify a four-gene signature with diagnostic and prognostic value in PC and suggest an interesting gene network that could play a key regulatory role in PC development and progression. Furthermore, hsa-miR-153, controlling this network, could be a potential biomarker for theranostics in high Gleason-scored PC. PMID:29562723

  16. Expression levels of transcription factors c-Fos and c-Jun and transmembrane protein HAb18G/CD147 in urothelial carcinoma of the bladder.

    PubMed

    Huhe, Muren; Liu, Shuangshuang; Zhang, Yang; Zhang, Zheng; Chen, Zhinan

    2017-05-01

    The aim of the present study was to investigate the prognostic significance of the expression of transcription factors, c-Fos, c-Jun and transmembrane protein CD147, in urothelial carcinoma of the bladder (UCB). The current study investigated the clinical significance of these factors in the development, progression and survival analysis of UCB. Immunohistochemistry was employed to analyze c‑Fos, c‑Jun and CD147 expression in 41 UCB cases and 34 non‑cancerous human bladder tissues. These results were scored in a semi‑quantitative manner based on the intensity and percentage of tumor cells that presented immunoreactivity. Protein levels of CD147, c‑Fos and c‑Jun expression were upregulated in 22 (53.7%), 10 (24.4%) and 9 (22.0%) UCB cases, respectively. High levels of c‑Jun correlated with the AJCC cancer staging manual (7th edition; P=0.038). Univariate analysis revealed that upregulated CD147 (P=0.038) or c‑Jun (P=0.008) was associated with poor overall survival (OS), respectively. Further analysis revealed that either CD147‑c‑Fos‑c‑Jun co‑expression (P=0.004), or CD147‑c‑Jun co‑expression (P=0.037) and c‑Fos‑c‑Jun co‑expression (P<0.001) were associated with poor OS. Multivariate analysis suggested that either upregulation of CD147, c‑Jun or c‑Fos were independent risk indicators for death in UCB patients. Increased expression of c‑Jun or CD147, as well as co‑expression of CD147‑c‑Jun, c‑Jun‑c‑Fos or CD147‑c‑Jun‑c‑Fos has prognostic significance for UCB patients. Therefore, high CD147 and c‑Jun expression may serve roles in tumor progression and may be diagnostic and therapeutic targets in UCB whether alone or in combination.

  17. A comparison of honeybee (Apis mellifera) queen, worker and drone larvae by RNA-Seq.

    PubMed

    He, Xu-Jiang; Jiang, Wu-Jun; Zhou, Mi; Barron, Andrew B; Zeng, Zhi-Jiang

    2017-11-06

    Honeybees (Apis mellifera) have haplodiploid sex determination: males develop from unfertilized eggs and females develop from fertilized ones. The differences in larval food also determine the development of females. Here we compared the total somatic gene expression profiles of 2-day and 4-day-old drone, queen and worker larvae by RNA-Seq. The results from a co-expression network analysis on all expressed genes showed that 2-day-old drone and worker larvae were closer in gene expression profiles than 2-day-old queen larvae. This indicated that for young larvae (2-day-old) environmental factors such as larval diet have a greater effect on gene expression profiles than ploidy or sex determination. Drones had the most distinct gene expression profiles at the 4-day larval stage, suggesting that haploidy, or sex dramatically affects the gene expression of honeybee larvae. Drone larvae showed fewer differences in gene expression profiles at the 2-day and 4-day time points than the worker and queen larval comparisons (598 against 1190 and 1181), suggesting a different pattern of gene expression regulation during the larval development of haploid males compared to diploid females. This study indicates that early in development the queen caste has the most distinct gene expression profile, perhaps reflecting the very rapid growth and morphological specialization of this caste compared to workers and drones. Later in development the haploid male drones have the most distinct gene expression profile, perhaps reflecting the influence of ploidy or sex determination on gene expression. © 2017 Institute of Zoology, Chinese Academy of Sciences.

  18. CLAVATA3-like genes are differentially expressed in grape vine (Vitis vinifera) tissues.

    PubMed

    Tominaga-Wada, Rumi; Nukumizu, Yuka; Wada, Takuji; Sawa, Shinichiro; Tetsumura, Takuya

    2013-10-15

    The CLAVATA3 (CLV3)/endosperm surrounding region [(ESR) CLE] peptides function as intercellular signaling molecules that regulate various physiological and developmental processes in diverse plant species. We identified five CLV3-like genes from grape vine (Vitis vinifera var. Pinot Noir): VvCLE 6, VvCLE 25-1, VvCLE 25-2, VvCLE 43 and VvCLE TDIF. These CLV3-like genes encode short proteins containing 43-128 amino acids. Except VvCLE TDIF, grape vine CLV3-like proteins possess a consensus amino acid sequence known as the CLE domain. Phylogenic analysis suggests that the VvCLE 6, VvCLE25-1, VvCLE25-2 and VvCLE43 genes have evolved from a single common ancestor to the Arabidopsis CLV3 gene. Expression analyses showed that the five grape CLV3-like genes are expressed in leaves, stems, roots and axillary buds with significant differences in their levels of expression. For example, while all of them were strongly expressed in axillary buds, VvCLE6 and VvCLE43 expression prevailed in roots, and VvCLE25-1, VvCLE25-2 and VvCLE TDIF expression in stems. The differential expression of the five grape CLV3-like peptides suggests that they play different roles in different organs and developmental stages. Copyright © 2013 Elsevier GmbH. All rights reserved.

  19. Identifying the molecular basis of functions in the transcriptome of the social amoeba Dictyostelium discoideum.

    PubMed

    Whitney, T J; Gardner, D G; Mott, M L; Brandon, M

    2010-03-09

    The unusual life cycle of Dictyostelium discoideum, in which an extra-cellular stressor such as starvation induces the development of a multicellular fruiting body consisting of stalk cells and spores from a culture of identical amoebae, provides an excellent model for investigating the molecular control of differentiation and the transition from single- to multi-cellular life, a key transition in development. We utilized serial analysis of gene expression (SAGE), a molecular method that is unbiased by dependence on previously identified genes, to obtain a transcriptome from a high-density culture of amoebae, in order to examine the transition to multi-cellular development. The SAGE method provides relative expression levels, which allows us to rank order the expressed genes. We found that a large number of ribosomal proteins were expressed at high levels, while various components of the proteosome were expressed at low levels. The only identifiable transmembrane signaling system components expressed in amoebae are related to quorum sensing, and their expression levels were relatively low. The most highly expressed gene in the amoeba transcriptome, dutA untranslated RNA, is a molecule with unknown function that may serve as an inhibitor of translation. These results suggest that high-density amoebae have not initiated development, and they also suggest a mechanism by which the transition into the development program is controlled.

  20. Analysis of the Expression of Anthocyanin Pathway Genes in Developing Vitis vinifera L. cv Shiraz Grape Berries and the Implications for Pathway Regulation.

    PubMed Central

    Boss, P. K.; Davies, C.; Robinson, S. P.

    1996-01-01

    Anthocyanin synthesis in Vitis vinifera L. cv Shiraz grape berries began 10 weeks postflowering and continued throughout berry ripening. Expression of seven genes of the anthocyanin biosynthetic pathway (phenylalanine ammonia lyase [PAL], chalcone synthase [CHS], chalcone isomerase [CHI], flavanone-3-hydroxylase [F3H], dihydroflavonol 4-reductase [DFR], leucoanthocyanidin dioxygen-ase [LDOX], and UDP glucose-flavonoid 3-o-glucosyl transferase [UFGT]) was determined. In flowers and grape berry skins, expression of all of the genes, except UFGT, was detected up to 4 weeks postflowering, followed by a reduction in this expression 6 to 8 weeks postflowering. Expression of CHS, CHI, F3H, DFR, LDOX, and UFGT then increased 10 weeks postflowering, coinciding with the onset of anthocyanin synthesis. In grape berry flesh, no PAL or UFGT expression was detected at any stage of development, but CHS, CHI, F3H, DFR, and LDOX were expressed up to 4 weeks postflowering. These results indicate that the onset of anthocyanin synthesis in ripening grape berry skins coincides with a coordinated increase in expression of a number of genes in the anthocyanin biosynthetic pathway, suggesting the involvement of regulatory genes. UFGT is regulated independently of the other genes, suggesting that in grapes the major control point in this pathway is later than that observed in maize, petunia, and snapdragon. PMID:12226348

  1. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  2. Dynamic gene expression changes precede dioxin-induced liver pathogenesis in medaka fish.

    PubMed

    Volz, David C; Hinton, David E; Law, J McHugh; Kullman, Seth W

    2006-02-01

    A major challenge for environmental genomics is linking gene expression to cellular toxicity and morphological alteration. Herein, we address complexities related to hepatic gene expression responses after a single injection of the aryl hydrocarbon receptor (AHR) agonist 2,3,7,8-tetrachlorodibenzo-p-dioxin (dioxin) and illustrate an initial stress response followed by cytologic and adaptive changes in the teleost fish medaka. Using a custom 175-gene array, we find that overall hepatic gene expression and histological changes are strongly dependent on dose and time. The most pronounced dioxin-induced gene expression changes occurred early and preceded morphologic alteration in the liver. Following a systematic search for putative Ah response elements (AHREs) (5'-CACGCA-3') within 2000 bp upstream of the predicted transcriptional start site, the majority (87%) of genes screened in this study did not contain an AHRE, suggesting that gene expression was not solely dependent on AHRE-mediated transcription. Moreover, in the highest dosage, we observed gene expression changes associated with adaptation that persisted for almost two weeks, including induction of a gene putatively identified as ependymin that may function in hepatic injury repair. These data suggest that the cellular response to dioxin involves both AHRE- and non-AHRE-mediated transcription, and that coupling gene expression profiling with analysis of morphologic pathogenesis is essential for establishing temporal relationships between transcriptional changes, toxicity, and adaptation to hepatic injury.

  3. FBXW7 expression affects the response to chemoradiotherapy and overall survival among patients with oral squamous cell carcinoma: A single-center retrospective study.

    PubMed

    Arita, Hidetaka; Nagata, Masashi; Yoshida, Ryoji; Matsuoka, Yuichiro; Hirosue, Akiyuki; Kawahara, Kenta; Sakata, Junki; Nakashima, Hikaru; Kojima, Taku; Toya, Ryo; Murakami, Ryuji; Hiraki, Akimitsu; Shinohara, Masanori; Nakayama, Hideki

    2017-10-01

    FBXW7 (F-box and WD repeat domain containing-7) is a tumor suppressor protein that regulates the degradation of various oncoproteins in several malignancies. However, limited information is available regarding FBXW7 expression in oral squamous cell carcinoma. Therefore, this study aimed to determine the clinical significance of FBXW7 expression in oral squamous cell carcinoma. The FBXW7 expression patterns in oral squamous cell carcinoma and adjacent normal tissues from 15 patients who underwent radical resection were evaluated using quantitative real-time polymerase chain reaction and immunohistochemical staining. In addition, immunohistochemistry was performed using paraffin-embedded sections from biopsy specimens obtained from 110 patients with oral squamous cell carcinoma who underwent surgery after 5 fluorouracil-based chemoradiotherapy. The associations of FBXW7 expression with various clinicopathological features and prognosis were evaluated in these patients. As a results, in the 15 matched samples, the FBXW7 expression was significantly decreased in the oral squamous cell carcinoma tissues compared to that in the adjacent normal tissues. In the clinicopathological analysis, compared to high protein expression, low FBXW7 expression was found to significantly associate with a poor histological response to preoperative chemoradiotherapy. Kaplan-Meier curve analysis revealed that low FBXW7 expression was significantly associated with a poor prognosis, and FBXW7 expression was found to be an independent predictor of overall survival in the multivariate analysis. Our results suggest that FBXW7 may function as a tumor suppressor protein in oral squamous cell carcinoma. In addition, FBXW7 could be a potential biomarker for predicting not only the clinical response to chemoradiotherapy but also overall survival in patients with oral squamous cell carcinoma.

  4. Monoamine oxidase A gene promoter methylation and transcriptional downregulation in an offender population with antisocial personality disorder.

    PubMed

    Checknita, D; Maussion, G; Labonté, B; Comai, S; Tremblay, R E; Vitaro, F; Turecki, N; Bertazzo, A; Gobbi, G; Côté, G; Turecki, G

    2015-03-01

    Antisocial personality disorder (ASPD) is characterised by elevated impulsive aggression and increased risk for criminal behaviour and incarceration. Deficient activity of the monoamine oxidase A (MAOA) gene is suggested to contribute to serotonergic system dysregulation strongly associated with impulsive aggression and antisocial criminality. To elucidate the role of epigenetic processes in altered MAOA expression and serotonin regulation in a population of incarcerated offenders with ASPD compared with a healthy non-incarcerated control population. Participants were 86 incarcerated participants with ASPD and 73 healthy controls. MAOA promoter methylation was compared between case and control groups. We explored the functional impact of MAOA promoter methylation on gene expression in vitro and blood 5-HT levels in a subset of the case group. Results suggest that MAOA promoter hypermethylation is associated with ASPD and may contribute to downregulation of MAOA gene expression, as indicated by functional assays in vitro, and regression analysis with whole-blood serotonin levels in offenders with ASPD. These results are consistent with prior literature suggesting MAOA and serotonergic dysregulation in antisocial populations. Our results offer the first evidence suggesting epigenetic mechanisms may contribute to MAOA dysregulation in antisocial offenders. Royal College of Psychiatrists.

  5. Comparative transcriptome analysis of different chemotypes elucidates withanolide biosynthesis pathway from medicinal plant Withania somnifera

    PubMed Central

    Gupta, Parul; Goel, Ridhi; Agarwal, Aditya Vikram; Asif, Mehar Hasan; Sangwan, Neelam Singh; Sangwan, Rajender Singh; Trivedi, Prabodh Kumar

    2015-01-01

    Withania somnifera is one of the most valuable medicinal plants synthesizing secondary metabolites known as withanolides. Despite pharmaceutical importance, limited information is available about the biosynthesis of withanolides. Chemo-profiling of leaf and root tissues of Withania suggest differences in the content and/or nature of withanolides in different chemotypes. To identify genes involved in chemotype and/or tissue-specific withanolide biosynthesis, we established transcriptomes of leaf and root tissues of distinct chemotypes. Genes encoding enzymes for intermediate steps of terpenoid backbone biosynthesis with their alternatively spliced forms and paralogous have been identified. Analysis suggests differential expression of large number genes among leaf and root tissues of different chemotypes. Study also identified differentially expressing transcripts encoding cytochrome P450s, glycosyltransferases, methyltransferases and transcription factors which might be involved in chemodiversity in Withania. Virus induced gene silencing of the sterol ∆7-reductase (WsDWF5) involved in the synthesis of 24-methylene cholesterol, withanolide backbone, suggests role of this enzyme in biosynthesis of withanolides. Information generated, in this study, provides a rich resource for functional analysis of withanolide-specific genes to elucidate chemotype- as well as tissue-specific withanolide biosynthesis. This genomic resource will also help in development of new tools for functional genomics and breeding in Withania. PMID:26688389

  6. Full Transcriptome Analysis of Early Dorsoventral Patterning in Zebrafish

    PubMed Central

    Horváth, Balázs; Molnár, János; Nagy, István; Tóth, Gábor; Wilson, Stephen W.; Varga, Máté

    2013-01-01

    Understanding the molecular interactions that lead to the establishment of the major body axes during embryogenesis is one of the main goals of developmental biology. Although the past two decades have revolutionized our knowledge about the genetic basis of these patterning processes, the list of genes involved in axis formation is unlikely to be complete. In order to identify new genes involved in the establishment of the dorsoventral (DV) axis during early stages of zebrafish embryonic development, we employed next generation sequencing for full transcriptome analysis of normal embryos and embryos lacking overt DV pattern. A combination of different statistical approaches yielded 41 differentially expressed candidate genes and we confirmed by in situ hybridization the early dorsal expression of 32 genes that are transcribed shortly after the onset of zygotic transcription. Although promoter analysis of the validated genes suggests no general enrichment for the binding sites of early acting transcription factors, most of these genes carry “bivalent” epigenetic histone modifications at the time when zygotic transcription is initiated, suggesting a “poised” transcriptional status. Our results reveal some new candidates of the dorsal gene regulatory network and suggest that a plurality of the earliest upregulated genes on the dorsal side have a role in the modulation of the canonical Wnt pathway. PMID:23922899

  7. Genome-wide analysis of the Solanum tuberosum (potato) trehalose-6-phosphate synthase (TPS) gene family: evolution and differential expression during development and stress.

    PubMed

    Xu, Yingchun; Wang, Yanjie; Mattson, Neil; Yang, Liu; Jin, Qijiang

    2017-12-01

    Trehalose-6-phosphate synthase (TPS) serves important functions in plant desiccation tolerance and response to environmental stimuli. At present, a comprehensive analysis, i.e. functional classification, molecular evolution, and expression patterns of this gene family are still lacking in Solanum tuberosum (potato). In this study, a comprehensive analysis of the TPS gene family was conducted in potato. A total of eight putative potato TPS genes (StTPSs) were identified by searching the latest potato genome sequence. The amino acid identity among eight StTPSs varied from 59.91 to 89.54%. Analysis of d N /d S ratios suggested that regions in the TPP (trehalose-6-phosphate phosphatase) domains evolved faster than the TPS domains. Although the sequence of the eight StTPSs showed high similarity (2571-2796 bp), their gene length is highly differentiated (3189-8406 bp). Many of the regulatory elements possibly related to phytohormones, abiotic stress and development were identified in different TPS genes. Based on the phylogenetic tree constructed using TPS genes of potato, and four other Solanaceae plants, TPS genes could be categorized into 6 distinct groups. Analysis revealed that purifying selection most likely played a major role during the evolution of this family. Amino acid changes detected in specific branches of the phylogenetic tree suggests relaxed constraints might have contributed to functional divergence among groups. Moreover, StTPSs were found to exhibit tissue and treatment specific expression patterns upon analysis of transcriptome data, and performing qRT-PCR. This study provides a reference for genome-wide identification of the potato TPS gene family and sets a framework for further functional studies of this important gene family in development and stress response.

  8. Gene expression analysis of parthenogenetic embryonic development of the pea aphid, Acyrthosiphon pisum, suggests that aphid parthenogenesis evolved from meiotic oogenesis.

    PubMed

    Srinivasan, Dayalan G; Abdelhady, Ahmed; Stern, David L

    2014-01-01

    Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity.

  9. Gene Expression Analysis of Parthenogenetic Embryonic Development of the Pea Aphid, Acyrthosiphon pisum, Suggests That Aphid Parthenogenesis Evolved from Meiotic Oogenesis

    PubMed Central

    Srinivasan, Dayalan G.; Abdelhady, Ahmed; Stern, David L.

    2014-01-01

    Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity. PMID:25501006

  10. Ectopic KNOX Expression Affects Plant Development by Altering Tissue Cell Polarity and Identity[OPEN

    PubMed Central

    Rebocho, Alexandra B.

    2016-01-01

    Plant development involves two polarity types: tissue cell (asymmetries within cells are coordinated across tissues) and regional (identities vary spatially across tissues) polarity. Both appear altered in the barley (Hordeum vulgare) Hooded mutant, in which ectopic expression of the KNOTTED1-like Homeobox (KNOX) gene, BKn3, causes inverted polarity of differentiated hairs and ectopic flowers, in addition to wing-shaped outgrowths. These lemma-specific effects allow the spatiotemporal analysis of events following ectopic BKn3 expression, determining the relationship between KNOXs, polarity, and shape. We show that tissue cell polarity, based on localization of the auxin transporter SISTER OF PINFORMED1 (SoPIN1), dynamically reorients as ectopic BKn3 expression increases. Concurrently, ectopic expression of the auxin importer LIKE AUX1 and boundary gene NO APICAL MERISTEM is activated. The polarity of hairs reflects SoPIN1 patterns, suggesting that tissue cell polarity underpins oriented cell differentiation. Wing cell files reveal an anisotropic growth pattern, and computational modeling shows how polarity guiding growth can account for this pattern and wing emergence. The inverted ectopic flower orientation does not correlate with SoPIN1, suggesting that this form of regional polarity is not controlled by tissue cell polarity. Overall, the results suggest that KNOXs trigger different morphogenetic effects through interplay between tissue cell polarity, identity, and growth. PMID:27553356

  11. Isolation of innate immune response genes, expression analysis, polymorphism identification and development of genetic marker for linkage analysis in common carp (Cyprinus carpio)

    USDA-ARS?s Scientific Manuscript database

    Common carp are economically important foodfish worldwide. Over the past few years, carp aquaculture has suffered from enormous losses to a disease caused by cyprinid herpesvirus 3 (CyHV-3). A recent study reported that common carp strains/crossbreds have differential resistance to CyHV-3, suggest...

  12. Identification of small RNAs abundant in Burkholderia cenocepacia biofilms reveal putative regulators with a potential role in carbon and iron metabolism.

    PubMed

    Sass, Andrea; Kiekens, Sanne; Coenye, Tom

    2017-11-15

    Small RNAs play a regulatory role in many central metabolic processes of bacteria, as well as in developmental processes such as biofilm formation. Small RNAs of Burkholderia cenocepacia, an opportunistic pathogenic beta-proteobacterium, are to date not well characterised. To address that, we performed genome-wide transcriptome structure analysis of biofilm grown B. cenocepacia J2315. 41 unannotated short transcripts were identified in intergenic regions of the B. cenocepacia genome. 15 of these short transcripts, highly abundant in biofilms, widely conserved in Burkholderia sp. and without known function, were selected for in-depth analysis. Expression profiling showed that most of these sRNAs are more abundant in biofilms than in planktonic cultures. Many are also highly abundant in cells grown in minimal media, suggesting they are involved in adaptation to nutrient limitation and growth arrest. Their computationally predicted targets include a high proportion of genes involved in carbon metabolism. Expression and target genes of one sRNA suggest a potential role in regulating iron homoeostasis. The strategy used for this study to detect sRNAs expressed in B. cenocepacia biofilms has successfully identified sRNAs with a regulatory function.

  13. An Effective Model of the Retinoic Acid Induced HL-60 Differentiation Program.

    PubMed

    Tasseff, Ryan; Jensen, Holly A; Congleton, Johanna; Dai, David; Rogers, Katharine V; Sagar, Adithya; Bunaciu, Rodica P; Yen, Andrew; Varner, Jeffrey D

    2017-10-30

    In this study, we present an effective model All-Trans Retinoic Acid (ATRA)-induced differentiation of HL-60 cells. The model describes reinforcing feedback between an ATRA-inducible signalsome complex involving many proteins including Vav1, a guanine nucleotide exchange factor, and the activation of the mitogen activated protein kinase (MAPK) cascade. We decomposed the effective model into three modules; a signal initiation module that sensed and transformed an ATRA signal into program activation signals; a signal integration module that controlled the expression of upstream transcription factors; and a phenotype module which encoded the expression of functional differentiation markers from the ATRA-inducible transcription factors. We identified an ensemble of effective model parameters using measurements taken from ATRA-induced HL-60 cells. Using these parameters, model analysis predicted that MAPK activation was bistable as a function of ATRA exposure. Conformational experiments supported ATRA-induced bistability. Additionally, the model captured intermediate and phenotypic gene expression data. Knockout analysis suggested Gfi-1 and PPARg were critical to the ATRAinduced differentiation program. These findings, combined with other literature evidence, suggested that reinforcing feedback is central to hyperactive signaling in a diversity of cell fate programs.

  14. Pyrethroid Resistance in Malaysian Populations of Dengue Vector Aedes aegypti Is Mediated by CYP9 Family of Cytochrome P450 Genes

    PubMed Central

    Ishak, Intan H.; Kamgang, Basile; Ibrahim, Sulaiman S.; Riveron, Jacob M.; Irving, Helen

    2017-01-01

    Background Dengue control and prevention rely heavily on insecticide-based interventions. However, insecticide resistance in the dengue vector Aedes aegypti, threatens the continued effectiveness of these tools. The molecular basis of the resistance remains uncharacterised in many endemic countries including Malaysia, preventing the design of evidence-based resistance management. Here, we investigated the underlying molecular basis of multiple insecticide resistance in Ae. aegypti populations across Malaysia detecting the major genes driving the metabolic resistance. Methodology/Principal Findings Genome-wide microarray-based transcription analysis was carried out to detect the genes associated with metabolic resistance in these populations. Comparisons of the susceptible New Orleans strain to three non-exposed multiple insecticide resistant field strains; Penang, Kuala Lumpur and Kota Bharu detected 2605, 1480 and 425 differentially expressed transcripts respectively (fold-change>2 and p-value ≤ 0.05). 204 genes were commonly over-expressed with monooxygenase P450 genes (CYP9J27, CYP6CB1, CYP9J26 and CYP9M4) consistently the most up-regulated detoxification genes in all populations, indicating that they possibly play an important role in the resistance. In addition, glutathione S-transferases, carboxylesterases and other gene families commonly associated with insecticide resistance were also over-expressed. Gene Ontology (GO) enrichment analysis indicated an over-representation of GO terms linked to resistance such as monooxygenases, carboxylesterases, glutathione S-transferases and heme-binding. Polymorphism analysis of CYP9J27 sequences revealed a high level of polymorphism (except in Joho Bharu), suggesting a limited directional selection on this gene. In silico analysis of CYP9J27 activity through modelling and docking simulations suggested that this gene is involved in the multiple resistance in Malaysian populations as it is predicted to metabolise pyrethroids, DDT and bendiocarb. Conclusion/significance The predominant over-expression of cytochrome P450s suggests that synergist-based (PBO) control tools could be utilised to improve control of this major dengue vector across Malaysia. PMID:28114328

  15. Cloning and stage-specific expression of CK-M1 gene during metamorphosis of Japanese flounder, Paralichthys olivaceus

    NASA Astrophysics Data System (ADS)

    Chen, Yanjie; Zhang, Quanqi; Qi, Jie; Wang, Zhigang; Wang, Xubo; Sun, Yeying; Zhong, Qiwang; Li, Shuo; Li, Chunmei

    2010-05-01

    The symmetrical body of flatfish larvae changes dramatically into an asymmetrical form after metamorphosis. The molecular mechanisms responsible for this change are poorly understood. As an initial step to clarify these mechanisms, we used representational difference analysis of cDNA for the identification of genes active during metamorphosis in the Japanese flounder, Paralichthys olicaceus. One of the up-regulated genes was identified as creatine kinase muscle type 1 (CK-M1). Sequence analysis of CK-M1 revealed that it spanned 1 708 bp and encoded a protein of 382 amino acids. The overall amino acid sequence of the CK-M1 was highly conserved with those of other organisms. CK-M1 was expressed in adult fish tissues, including skeletal muscle, intestine and gill. Whole mount in-situ hybridization showed that the enhanced expression of CK-M1 expanded from the head to the whole body of larvae as metamorphosis progressed. Quantitative analysis revealed stage-specific high expression of CK-M1 during metamorphosis. The expression level of CK-M1 increased initially and peaked at metamorphosis, decreased afterward, and finally returned to the pre-metamorphosis level. This stage-specific expression pattern suggested strongly that CK-M1 was related to metamorphosis in the Japanese flounder. Its specific role in metamorphosis requires further study.

  16. Defective Cell Cycle Checkpoint Functions in Melanoma Are Associated with Altered Patterns of Gene Expression

    PubMed Central

    Kaufmann, William K.; Nevis, Kathleen R.; Qu, Pingping; Ibrahim, Joseph G.; Zhou, Tong; Zhou, Yingchun; Simpson, Dennis A.; Helms-Deaton, Jennifer; Cordeiro-Stone, Marila; Moore, Dominic T.; Thomas, Nancy E.; Hao, Honglin; Liu, Zhi; Shields, Janiel M.; Scott, Glynis A.; Sharpless, Norman E.

    2009-01-01

    Defects in DNA damage responses may underlie genetic instability and malignant progression in melanoma. Cultures of normal human melanocytes (NHMs) and melanoma lines were analyzed to determine whether global patterns of gene expression could predict the efficacy of DNA damage cell cycle checkpoints that arrest growth and suppress genetic instability. NHMs displayed effective G1 and G2 checkpoint responses to ionizing radiation-induced DNA damage. A majority of melanoma cell lines (11/16) displayed significant quantitative defects in one or both checkpoints. Melanomas with B-RAF mutations as a class displayed a significant defect in DNA damage G2 checkpoint function. In contrast the epithelial-like subtype of melanomas with wild-type N-RAS and B-RAF alleles displayed an effective G2 checkpoint but a significant defect in G1 checkpoint function. RNA expression profiling revealed that melanoma lines with defects in the DNA damage G1 checkpoint displayed reduced expression of p53 transcriptional targets, such as CDKN1A and DDB2, and enhanced expression of proliferation-associated genes, such as CDC7 and GEMININ. A Bayesian analysis tool was more accurate than significance analysis of microarrays for predicting checkpoint function using a leave-one-out method. The results suggest that defects in DNA damage checkpoints may be recognized in melanomas through analysis of gene expression. PMID:17597816

  17. Expression of SLP-2 was associated with invasion of esophageal squamous cell carcinoma.

    PubMed

    Cao, Wenfeng; Zhang, Bin; Ding, Fang; Zhang, Weiran; Sun, Baocun; Liu, Zhihua

    2013-01-01

    Stomatin-like protein 2 (SLP-2), a member of the Stomatin superfamily, has been identified as an oncogenic-related protein and found to be up-regulated in multi-cancers. Nonetheless, the expression pattern and regulation of SLP-2 in human esophageal squamous cell carcinoma (ESCC) remain unexplored. Immunohistochemistry and immunofluorescence staining analysis were performed to show SLP-2 expression and location. RNAi method was used to inhibit specific protein expression. Transwell assay was done to investigate cells invasive capability. RT-PCR and Western blot analysis were used to detect mRNA and protein expression levels. Immunohistochemical analysis showed that up-regulation of SLP-2 was found in invasive front compared with cancer central tissue in ESCC. Inhibition of SLP-2 by SLP-2 siRNA can decrease ESCC cells invasive capability through MMP-2 dependent manner. Up-regulation of SLP-2 was effectively abrogated by the ERK1/2 inhibitors either PD98059 or U0126, but no effect was showed by the treatment of AKT inhibitors either LY294002 or MK-2206. So the regulation of SLP-2 was involved in activation of the MAPK/ERK pathway. We found that PMA/EGF could induce the up-regulated expression of SLP-2 probably through activating ERK signalling. The current study suggests that SLP-2 may represent an important molecular hallmark that is clinically relevant to the invasion of ESCC.

  18. High matrix metalloproteinase activity is a hallmark of periapical granulomas.

    PubMed

    de Paula-Silva, Francisco Wanderley Garcia; D'Silva, Nisha J; da Silva, Léa Assed Bezerra; Kapila, Yvonne Lorraine

    2009-09-01

    The inability to distinguish periapical cysts from granulomas before performing root canal treatment leads to uncertainty in treatment outcomes because cysts have lower healing rates. Searching for differential expression of molecules within cysts or granulomas could provide information with regard to the identity of the lesion or suggest mechanistic differences that may form the basis for future therapeutic intervention. Thus, we investigated whether granulomas and cysts exhibit differential expression of extracellular matrix (ECM) molecules. Human periapical granulomas, periapical cysts, and healthy periodontal ligament tissues were used to investigate the differential expression of ECM molecules by microarray analysis. Because matrix metalloproteinases (MMP) showed the highest differential expression in the microarray analysis, MMPs were further examined by in situ zymography and immunohistochemistry. Data were analyzed by using one-way analysis of variance followed by the Tukey test. We observed that cysts and granulomas differentially expressed several ECM molecules, especially those from the MMP family. Compared with cysts, granulomas exhibited higher MMP enzymatic activity in areas stained for MMP-9. These areas were composed of polymorphonuclear cells (PMNs) in contrast to cysts. Similarly, MMP-13 was expressed by a greater number of cells in granulomas compared with cysts. Our findings indicate that high enzymatic MMP activity in PMNs together with MMP-9 and MMP-13 stained cells could be a molecular signature of granulomas unlike periapical cysts.

  19. Molecular cloning, expression analysis and transcript localization of testicular orphan nuclear receptor 2 in the male catfish, Clarias batrachus.

    PubMed

    Murugananthkumar, R; Akhila, M V; Rajakumar, A; Mamta, S K; Sudhakumari, C C; Senthilkumaran, B

    2016-12-01

    Testicular receptor 2 (TR2; also known as Nr2c1) is one of the first orphan nuclear receptors identified and known to regulate various physiological process with or without any ligand. In this study, we report the cloning of full length nr2c1 and its expression analysis during gonadal development, seasonal testicular cycle and after human chorionic gonadotropin (hCG) induction. In addition, in situ hybridization (ISH) was performed to localize nr2c1 transcripts in adult testis and whole catfish (1day post hatch). Tissue distribution and gonadal ontogeny studies revealed high expression of nr2c1 in developing and adult testis. Early embryonic stage-wise expression of nr2c1 seems to emphasize its importance in cellular differentiation and development. Substantial expression of nr2c1 during pre-spawning phase and localization of nr2c1 transcripts in sperm/spermatids were observed. Significant upregulation after hCG induction indicate that nr2c1 is under the regulation of gonadotropins. Whole mount ISH analysis displayed nr2c1 expression in notochord indicating its role in normal vertebrate development. Taken together, our findings suggest that nr2c1 may have a plausible role in the testicular and embryonic development of catfish. Copyright © 2015. Published by Elsevier Inc.

  20. Characterizing the Grape Transcriptome. Analysis of Expressed Sequence Tags from Multiple Vitis Species and Development of a Compendium of Gene Expression during Berry Development1[w

    PubMed Central

    Silva, Francisco Goes da; Iandolino, Alberto; Al-Kayal, Fadi; Bohlmann, Marlene C.; Cushman, Mary Ann; Lim, Hyunju; Ergul, Ali; Figueroa, Rubi; Kabuloglu, Elif K.; Osborne, Craig; Rowe, Joan; Tattersall, Elizabeth; Leslie, Anna; Xu, Jane; Baek, JongMin; Cramer, Grant R.; Cushman, John C.; Cook, Douglas R.

    2005-01-01

    We report the analysis and annotation of 146,075 expressed sequence tags from Vitis species. The majority of these sequences were derived from different cultivars of Vitis vinifera, comprising an estimated 25,746 unique contig and singleton sequences that survey transcription in various tissues and developmental stages and during biotic and abiotic stress. Putatively homologous proteins were identified for over 17,752 of the transcripts, with 1,962 transcripts further subdivided into one or more Gene Ontology categories. A simple structured vocabulary, with modules for plant genotype, plant development, and stress, was developed to describe the relationship between individual expressed sequence tags and cDNA libraries; the resulting vocabulary provides query terms to facilitate data mining within the context of a relational database. As a measure of the extent to which characterized metabolic pathways were encompassed by the data set, we searched for homologs of the enzymes leading from glycolysis, through the oxidative/nonoxidative pentose phosphate pathway, and into the general phenylpropanoid pathway. Homologs were identified for 65 of these 77 enzymes, with 86% of enzymatic steps represented by paralogous genes. Differentially expressed transcripts were identified by means of a stringent believability index cutoff of ≥98.4%. Correlation analysis and two-dimensional hierarchical clustering grouped these transcripts according to similarity of expression. In the broadest analysis, 665 differentially expressed transcripts were identified across 29 cDNA libraries, representing a range of developmental and stress conditions. The groupings revealed expected associations between plant developmental stages and tissue types, with the notable exception of abiotic stress treatments. A more focused analysis of flower and berry development identified 87 differentially expressed transcripts and provides the basis for a compendium that relates gene expression and annotation to previously characterized aspects of berry development and physiology. Comparison with published results for select genes, as well as correlation analysis between independent data sets, suggests that the inferred in silico patterns of expression are likely to be an accurate representation of transcript abundance for the conditions surveyed. Thus, the combined data set reveals the in silico expression patterns for hundreds of genes in V. vinifera, the majority of which have not been previously studied within this species. PMID:16219919

  1. Cystic fibrosis transmembrane regulator gene (CFTR) is associated with abnormal enamel formation.

    PubMed

    Arquitt, C K; Boyd, C; Wright, J T

    2002-07-01

    Cystic fibrosis (CF), a chloride ion transport disorder, is caused by mutations of the cftr gene and is the most common autosomal-recessive heritable disease in Caucasians. CFTR knockout mice have enamel with crystallite defects, retained protein, and hypomineralization, suggesting a role for CFTR in enamel formation and mineralization. This investigation examined CFTR expression and elemental composition in developing murine incisor teeth. RT-PCR showed cftr mRNA expression in the normal mouse apical incisor tissue but not in the CFTR knockout tissue. Elemental analysis by energy-dispersive x-ray spectroscopy showed relatively decreased chloride in secretory-stage CF enamel. Iron and potassium were significantly increased, and calcium was significantly decreased (p value = 0.05) in the CF mature enamel. Abnormal enamel mineralization, ion concentrations, and molecular evidence of cftr mRNA expression by odontogenic cells strongly suggest that CFTR plays an important role in enamel formation.

  2. Genetic analysis of tumorigenesis: XXXII. Localization of constitutionally amplified KRAS sequences to Chinese hamster chromosomes X and Y by in situ hybridization.

    PubMed

    Stenman, G; Anisowicz, A; Sager, R

    1988-11-01

    The KRAS gene is constitutionally amplified in the Chinese hamster. We have mapped the amplified sequences by in situ hybridization to two major sites on the X and Y chromosomes, Xq4 and Yp2. No autosomal site was detected despite a search under relaxed hybridization conditions. KRAS DNA is amplified about 50-fold compared to a human cell line known to have a diploid number of KRAS sequences, whereas mRNA expression is 5- to 10-fold lower than in normal human cells. While mRNA expression levels do not necessarily parallel gene copy number, the low expression level strongly suggests that the amplified sequences are transcriptionally silent. It is suggested that the amplified sequences arose from the original KRAS gene on chromosome 8 and that the KRAS sequences on the Y chromosome arose by X-Y recombination.

  3. Probable reasons for expressed agitation in persons with dementia.

    PubMed

    Ragneskog, H; Gerdner, L A; Josefsson, K; Kihlgren, M

    1998-05-01

    Nursing home patients with dementia were videotaped in three previous studies. Sixty sequences of nine patients exhibiting agitated behaviors were examined to identify the most probable antecedents to agitation. Probable reasons were interpreted and applied to the Progressively Lowered Stress Threshold model, which suggests that agitation is stress related. Analysis suggests that agitation often serves as a form of communication. Two underlying reasons seem to be that the patient had loss of control over the situation and deficient autonomy. The most common causes for expressed agitation were interpreted as discomfort, a wish to be served immediately, conflict between patients or with nursing staff, reactions to environmental noises or sound, and invasion of personal space. It is recommended that nursing staff promote autonomy and independency for this group of patients whenever possible. By evaluating probable reasons for expressed agitation, the nursing staff can take steps to prevent or alleviate agitation.

  4. Analysis of enzyme production by submerged culture of Aspergillus oryzae using whole barley.

    PubMed

    Masuda, Susumu; Kikuchi, Kaori; Matsumoto, Yuko; Sugimoto, Toshikazu; Shoji, Hiroshi; Tanabe, Masayuki

    2009-10-01

    We have reported on high enzyme production by submerged culture of Aspergillus kawachii using barley with the husk (whole barley). To elucidate the mechanism underlying this high enzyme production, we performed a detailed analysis. Aspergillus oryzae RIB40 was submerged-cultured using whole barley and milled whole barley. Enzyme production was analyzed in terms of changes in medium components and gene expression levels. When whole barley was used, high production of glucoamylase and alpha-amylase and high gene expression levels of these enzymes were observed. Low ammonium concentrations were maintained with nitrate ion uptake continuing into the late stage using whole barley. These findings suggest that the sustainability of nitrogen metabolism is related to high enzyme production, and that a mechanism other than that associated with the conventional amylase expression system is involved in this relationship.

  5. In silico cloning, expression of Rieske-like apoprotein gene and protein subcellular localization in the Pacific oyster, Crassostrea gigas.

    PubMed

    He, Xiaocui; Zhang, Yang; Yu, Ziniu

    2010-10-01

    Rieske protein gene in the Pacific oyster Crassostrea gigas was obtained by in silico cloning for the first time, and its expression profiles and subcellular localization were determined, respectively. The full-length cDNA of Cgisp is 985 bp in length and contains a 5'- and 3'-untranslated regions of 35 and 161 bp, respectively, with an open reading frame of 786 bp encoding a protein of 262 amino acids. The predicted molecular weight of 30 kDa of Cgisp protein was verified by prokaryotic expression. Conserved Rieske [2Fe-2S] cluster binding sites and highly matched-pair tertiary structure with 3CWB_E (Gallus gallus) were revealed by homologous analysis and molecular modeling. Eleven putative SNP sites and two conserved hexapeptide sequences, box I (THLGC) and II (PCHGS), were detected by multiple alignments. Real-time PCR analysis showed that Cgisp is expressed in a wide range of tissues, with adductor muscle exhibiting the top expression level, suggesting its biological function of energy transduction. The GFP tagging Cgisp indicated a mitochondrial localization, further confirming its physiological function.

  6. System Biology Approach: Gene Network Analysis for Muscular Dystrophy.

    PubMed

    Censi, Federica; Calcagnini, Giovanni; Mattei, Eugenio; Giuliani, Alessandro

    2018-01-01

    Phenotypic changes at different organization levels from cell to entire organism are associated to changes in the pattern of gene expression. These changes involve the entire genome expression pattern and heavily rely upon correlation patterns among genes. The classical approach used to analyze gene expression data builds upon the application of supervised statistical techniques to detect genes differentially expressed among two or more phenotypes (e.g., normal vs. disease). The use of an a posteriori, unsupervised approach based on principal component analysis (PCA) and the subsequent construction of gene correlation networks can shed a light on unexpected behaviour of gene regulation system while maintaining a more naturalistic view on the studied system.In this chapter we applied an unsupervised method to discriminate DMD patient and controls. The genes having the highest absolute scores in the discrimination between the groups were then analyzed in terms of gene expression networks, on the basis of their mutual correlation in the two groups. The correlation network structures suggest two different modes of gene regulation in the two groups, reminiscent of important aspects of DMD pathogenesis.

  7. Down-regulation of FcepsilonRI expression by Houttuynia cordata Thunb extract in human basophilic KU812F cells.

    PubMed

    Shim, Sun-Yup; Seo, Young-Kook; Park, Jeong-Ro

    2009-04-01

    Human basophilic KU812F cells express a high-affinity immunoglobulin (Ig) E receptor, FcepsilonRI, which plays an important role in IgE-mediated allergic reactions. Houttuynia cordata Thunb (Family Saururaceae), which is rich in polyphenols, has been shown to have various physiological properties, including antiviral, antioxidative, anticancer, and anti-inflammatory activities. The effect of H. cordata extract on the expression of FcepsilonRI in human KU812F cells was examined. Flow cytometric analysis showed that the FcepsilonRI expression and the IgE binding activity were suppressed when the cells were cultured with H. cordata extract. Reverse transcription-polymerase chain reaction analysis showed that levels of the mRNAs for FcepsilonRI alpha- and gamma-chains were decreased by the treatment of H. cordata extract. Addition of H. cordata extract to culture medium was also observed to result in a reduction in the release of histamine from the cells. These results suggest that H. cordata extract may exert its anti-allergic activity through down-regulation of FcepsilonRI expression and a subsequent decrease in histamine release.

  8. Serum immunoreactivity of cancer/testis antigen OY-TES-1 and its tissues expression in glioma

    PubMed Central

    Li, Xisheng; Yan, Jun; Fan, Rong; Luo, Bin; Zhang, Qingmei; Lin, Yongda; Zhou, Sufang; Luo, Guorong; Xie, Xiaoxun; Xiao, Shaowen

    2017-01-01

    OY-TES-1 is a member of the cancer/testis antigen family that is expressed in healthy testis tissue and certain types of cancerous tissue. The present study aimed to analyze the expression pattern of OY-TES-1 and serum anti-OY-TES-1 antibody concentration in patients with glioma. OY-TES-1 mRNA was detected in 28/36 (78%) of glioma cases using conventional reverse transcription polymerase chain reaction (RT-PCR) analysis. RT-quantitative-PCR revealed that OY-TES-1 was expressed at a higher level in glioma tissues compared with normal adult tissues (with the exception of testis tissue). Anti-OY-TES-1 antibodies were present in the serum of 5/36 (14%) of patients with glioma, but absent in all the serum samples from 107 healthy donors. Immunohistochemical analysis demonstrated that OY-TES-1 protein was expressed in all glioma tissues from patients with anti-OY-TES-1 antibody seropositivity. These results suggest that OY-TES-1 is a novel candidate for glioma immunotherapy. PMID:28529561

  9. Identifying protein biomarkers in predicting disease severity of dengue virus infection using immune-related protein microarray.

    PubMed

    Soe, Hui Jen; Yong, Yean K; Al-Obaidi, Mazen M Jamil; Raju, Chandramathi Samudi; Gudimella, Ranganath; Manikam, Rishya; Sekaran, Shamala Devi

    2018-02-01

    Dengue virus is one of the most widespread flaviviruses that re-emerged throughout recent decades. The progression from mild dengue to severe dengue (SD) with the complications such as vascular leakage and hemorrhage increases the fatality rate of dengue. The pathophysiology of SD is not entirely clear. To investigate potential biomarkers that are suggestive of pathogenesis of SD, a small panel of serum samples selected from 1 healthy individual, 2 dengue patients without warning signs (DWS-), 2 dengue patients with warning signs (DWS+), and 5 patients with SD were subjected to a pilot analysis using Sengenics Immunome protein array. The overall fold changes of protein expressions and clustering heat map revealed that PFKFB4, TPM1, PDCL3, and PTPN20A were elevated among patients with SD. Differential expression analysis identified that 29 proteins were differentially elevated greater than 2-fold in SD groups than DWS- and DWS+. From the 29 candidate proteins, pathways enrichment analysis also identified insulin signaling and cytoskeleton pathways were involved in SD, suggesting that the insulin pathway may play a pivotal role in the pathogenesis of SD.

  10. Insights into TREM2 biology by network analysis of human brain gene expression data

    PubMed Central

    Forabosco, Paola; Ramasamy, Adaikalavan; Trabzuni, Daniah; Walker, Robert; Smith, Colin; Bras, Jose; Levine, Adam P.; Hardy, John; Pocock, Jennifer M.; Guerreiro, Rita; Weale, Michael E.; Ryten, Mina

    2013-01-01

    Rare variants in TREM2 cause susceptibility to late-onset Alzheimer's disease. Here we use microarray-based expression data generated from 101 neuropathologically normal individuals and covering 10 brain regions, including the hippocampus, to understand TREM2 biology in human brain. Using network analysis, we detect a highly preserved TREM2-containing module in human brain, show that it relates to microglia, and demonstrate that TREM2 is a hub gene in 5 brain regions, including the hippocampus, suggesting that it can drive module function. Using enrichment analysis we show significant overrepresentation of genes implicated in the adaptive and innate immune system. Inspection of genes with the highest connectivity to TREM2 suggests that it plays a key role in mediating changes in the microglial cytoskeleton necessary not only for phagocytosis, but also migration. Most importantly, we show that the TREM2-containing module is significantly enriched for genes genetically implicated in Alzheimer's disease, multiple sclerosis, and motor neuron disease, implying that these diseases share common pathways centered on microglia and that among the genes identified are possible new disease-relevant genes. PMID:23855984

  11. Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

    PubMed Central

    Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

    1993-01-01

    A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

  12. Altered Molecular Expression of the TLR4/NF-κB Signaling Pathway in Mammary Tissue of Chinese Holstein Cattle with Mastitis

    PubMed Central

    Wu, Jie; Li, Lian; Sun, Yu; Huang, Shuai; Tang, Juan; Yu, Pan; Wang, Genlin

    2015-01-01

    Toll-like receptor 4 (TLR4) mediated activation of the nuclear transcription factor κB (NF-κB) signaling pathway by mastitis initiates expression of genes associated with inflammation and the innate immune response. In this study, the profile of mastitis-induced differential gene expression in the mammary tissue of Chinese Holstein cattle was investigated by Gene-Chip microarray and bioinformatics. The microarray results revealed that 79 genes associated with the TLR4/NF-κB signaling pathway were differentially expressed. Of these genes, 19 were up-regulated and 29 were down-regulated in mastitis tissue compared to normal, healthy tissue. Statistical analysis of transcript and protein level expression changes indicated that 10 genes, namely TLR4, MyD88, IL-6, and IL-10, were up-regulated, while, CD14, TNF-α, MD-2, IL-β, NF-κB, and IL-12 were significantly down-regulated in mastitis tissue in comparison with normal tissue. Analyses using bioinformatics database resources, such as the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and the Gene Ontology Consortium (GO) for term enrichment analysis, suggested that these differently expressed genes implicate different regulatory pathways for immune function in the mammary gland. In conclusion, our study provides new evidence for better understanding the differential expression and mechanisms of the TLR4 /NF-κB signaling pathway in Chinese Holstein cattle with mastitis. PMID:25706977

  13. Altered molecular expression of the TLR4/NF-κB signaling pathway in mammary tissue of Chinese Holstein cattle with mastitis.

    PubMed

    Wu, Jie; Li, Lian; Sun, Yu; Huang, Shuai; Tang, Juan; Yu, Pan; Wang, Genlin

    2015-01-01

    Toll-like receptor 4 (TLR4) mediated activation of the nuclear transcription factor κB (NF-κB) signaling pathway by mastitis initiates expression of genes associated with inflammation and the innate immune response. In this study, the profile of mastitis-induced differential gene expression in the mammary tissue of Chinese Holstein cattle was investigated by Gene-Chip microarray and bioinformatics. The microarray results revealed that 79 genes associated with the TLR4/NF-κB signaling pathway were differentially expressed. Of these genes, 19 were up-regulated and 29 were down-regulated in mastitis tissue compared to normal, healthy tissue. Statistical analysis of transcript and protein level expression changes indicated that 10 genes, namely TLR4, MyD88, IL-6, and IL-10, were up-regulated, while, CD14, TNF-α, MD-2, IL-β, NF-κB, and IL-12 were significantly down-regulated in mastitis tissue in comparison with normal tissue. Analyses using bioinformatics database resources, such as the Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis and the Gene Ontology Consortium (GO) for term enrichment analysis, suggested that these differently expressed genes implicate different regulatory pathways for immune function in the mammary gland. In conclusion, our study provides new evidence for better understanding the differential expression and mechanisms of the TLR4 /NF-κB signaling pathway in Chinese Holstein cattle with mastitis.

  14. Expression of Inwardly Rectifying Potassium Channel Subunits in Native Human Retinal Pigment Epithelium

    PubMed Central

    Yang, Dongli; Zhang, Xiaoming; Hughes, Bret A.

    2008-01-01

    Previously, we demonstrated that the inwardly rectifying K+ (Kir) channel subunit Kir7.1 is highly expressed in bovine and human retinal pigment epithelium (RPE). The purpose of this study was to determine whether any of the 14 other members of the Kir gene family are expressed in native human RPE. Conventional reverse transcription-polymerase chain reaction (RT-PCR) analysis indicated that in addition to Kir7.1, 7 other Kir channel subunits (Kir1.1, Kir2.1, Kir2.2, Kir3.1, Kir3.4, Kir4.2 and Kir6.1) are expressed in the RPE, whereas in neural retina, all 14 of the Kir channel subunits examined are expressed. The identities of RT-PCR products in the RPE were confirmed by DNA sequencing. Real-time RT-PCR analysis showed, however, that transcripts of these channels are significantly less abundant than Kir7.1 in the RPE. Western blot analysis of the Kir channel subunits detected in the RPE by RT-PCR revealed the expression of Kir2.1, Kir3.1, Kir3.4, Kir4.2, Kir6.1, and possibly Kir2.2, but not Kir1.1, in both human RPE and neural retina. Our results indicate that human RPE expresses at least 5 other Kir channel subtypes in addition to Kir7.1, suggesting that multiple members of the Kir channel family may function in this epithelium. PMID:18653180

  15. Role of PELP1 in EGFR-ER Signaling Crosstalk in Ovarian Cancer Cells

    DTIC Science & Technology

    2007-04-01

    known about PELP1 role in ovarian cancer progression. Analysis of human genome databases and SAGE data suggested deregulation of PELP1 expression in ...Tulane University, New Orleans, LA Introduction PELP1 down regulation reduces tumorigenic potential in vivo PELP1 expression is deregulated in human ...decreases the tumorigenic potential of OVCAR3 cancer cells in nude mice model IHC studies using human ovarian cancer tissue array (n=123) showed that PELP1

  16. Microarray profiles reveal that circular RNA hsa_circ_0007385 functions as an oncogene in non-small cell lung cancer tumorigenesis.

    PubMed

    Jiang, Ming-Ming; Mai, Zhi-Tao; Wan, Shan-Zhi; Chi, Yu-Min; Zhang, Xin; Sun, Bao-Hua; Di, Qing-Guo

    2018-04-01

    Circular RNAs (circRNAs) are a novel class of non-protein-coding RNA. Emerging evidence indicates that circRNAs participate in the regulation of many pathophysiological processes. This study aims to explore the expression profiles and pathological effects of circRNAs in non-small cell lung cancer (NSCLC). Human circRNAs microarray analysis was performed to screen the expression profile of circRNAs in NSCLC tissue. Expressions of circRNA and miRNA in NSCLC tissues and cells were quantified by qRTPCR. Functional experiments were performed to investigate the biological functions of circRNA, including CCK-8 assay, colony formation assay, transwell assay and xenograft in vivo assay. Human circRNAs microarray revealed a total 957 abnormally expressed circRNAs (> twofold, P < 0.05) in NSCLC tissue compared with adjacent normal tissue. In further studies, hsa_circ_0007385 was significantly up regulated in NSCLC tissue and cells. In vitro experiments with hsa_circ_0007385 knockdown resulted in significant suppression of the proliferation, migration and invasion of NSCLC cells. In vivo xenograft assay using hsa_circ_0007385 knockdown, significantly reduced tumor growth. Bioinformatics analysis and luciferase reporter assay verified the potential target miR-181, suggesting a possible regulatory pathway for hsa_circ_0007385. In summary, results suggest hsa_circ_0007385 plays a role in NSCLC tumorigenesis, providing a potential therapeutic target for NSCLC.

  17. Increased expression of glutamic acid decarboxylase mRNA in rat substantia nigra after an ibotenic acid lesion in the caudate-putamen.

    PubMed

    Lindefors, N; Brené, S; Persson, H

    1990-04-01

    In situ hybridization histochemistry and RNA blots were used to study expression of glutamic acid decarboxylase (GAD) mRNA in rat caudate-nucleus and substantia nigra. In situ hybridization combined with computerized image analysis revealed that in the intact substantia nigra reticulata the cross-section area of GAD mRNA positive neurons were 25% larger in the dorsolateral part as compared with the ventromedial part. A unilateral ibotenic acid injection in caudate-putamen lesioned neurons, some of which project to the ipsilateral substantia nigra. An increased level of GAD mRNA was observed in substantia nigra ipsilateral to the lesion. Computerized image analysis of sections from in situ hybridization revealed an increase in the number of silver grains over GAD mRNA positive neurons in the dorsolateral substantia nigra reticulata ipsilateral to the lesion. However, no change was observed in the ventromedial part suggesting that GAD mRNA expression in this part of the nigra is less sensitive to inhibition by caudate-putamen afferents. In agreement with in situ experiments, RNA blots showed a 2-fold increased level of GAD mRNA in substantia nigra ipsilateral to the lesion. The increased GAD mRNA expression in the deafferented substantia nigra suggests a disinhibition of nigral GABA neurons, resulting in an increased utilization of GABA in these substantia nigra neurons.

  18. Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology

    NASA Astrophysics Data System (ADS)

    Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

    2016-11-01

    Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3‧H, F3‧5‧H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

  19. Comparative Transcriptome Analysis of Chinary, Assamica and Cambod tea (Camellia sinensis) Types during Development and Seasonal Variation using RNA-seq Technology.

    PubMed

    Kumar, Ajay; Chawla, Vandna; Sharma, Eshita; Mahajan, Pallavi; Shankar, Ravi; Yadav, Sudesh Kumar

    2016-11-17

    Tea quality and yield is influenced by various factors including developmental tissue, seasonal variation and cultivar type. Here, the molecular basis of these factors was investigated in three tea cultivars namely, Him Sphurti (H), TV23 (T), and UPASI-9 (U) using RNA-seq. Seasonal variation in these cultivars was studied during active (A), mid-dormant (MD), dormant (D) and mid-active (MA) stages in two developmental tissues viz. young and old leaf. Development appears to affect gene expression more than the seasonal variation and cultivar types. Further, detailed transcript and metabolite profiling has identified genes such as F3'H, F3'5'H, FLS, DFR, LAR, ANR and ANS of catechin biosynthesis, while MXMT, SAMS, TCS and XDH of caffeine biosynthesis/catabolism as key regulators during development and seasonal variation among three different tea cultivars. In addition, expression analysis of genes related to phytohormones such as ABA, GA, ethylene and auxin has suggested their role in developmental tissues during seasonal variation in tea cultivars. Moreover, differential expression of genes involved in histone and DNA modification further suggests role of epigenetic mechanism in coordinating global gene expression during developmental and seasonal variation in tea. Our findings provide insights into global transcriptional reprogramming associated with development and seasonal variation in tea.

  20. The NLR-related protein NWD1 is associated with prostate cancer and modulates androgen receptor signaling.

    PubMed

    Correa, Ricardo G; Krajewska, Maryla; Ware, Carl F; Gerlic, Motti; Reed, John C

    2014-03-30

    Prostate cancer (PCa) is among the leading causes of cancer-related death in men. Androgen receptor (AR) signaling plays a seminal role in prostate development and homeostasis, and dysregulation of this pathway is intimately linked to prostate cancer pathogenesis and progression. Here, we identify the cytosolic NLR-related protein NWD1 as a novel modulator of AR signaling. We determined that expression of NWD1 becomes elevated during prostate cancer progression, based on analysis of primary tumor specimens. Experiments with cultured cells showed that NWD1 expression is up-regulated by the sex-determining region Y (SRY) family proteins. Gene silencing procedures, in conjunction with transcriptional profiling, showed that NWD1 is required for expression of PDEF (prostate-derived Ets factor), which is known to bind and co-regulate AR. Of note, NWD1 modulates AR protein levels. Depleting NWD1 in PCa cell lines reduces AR levels and suppresses activity of androgen-driven reporter genes. NWD1 knockdown potently suppressed growth of androgen-dependent LNCaP prostate cancer cells, thus showing its functional importance in an AR-dependent tumor cell model. Proteomic analysis suggested that NWD1 associates with various molecular chaperones commonly related to AR complexes. Altogether, these data suggest a role for tumor-associated over-expression of NWD1 in dysregulation of AR signaling in PCa.

Top