Digital robust active control law synthesis for large order flexible structure using parameter optimization

NASA Technical Reports Server (NTRS)

Mukhopadhyay, V.

1988-01-01

A generic procedure for the parameter optimization of a digital control law for a large-order flexible flight vehicle or large space structure modeled as a sampled data system is presented. A linear quadratic Guassian type cost function was minimized, while satisfying a set of constraints on the steady-state rms values of selected design responses, using a constrained optimization technique to meet multiple design requirements. Analytical expressions for the gradients of the cost function and the design constraints on mean square responses with respect to the control law design variables are presented.

CEM-designer: design of custom expression microarrays in the post-ENCODE Era.

PubMed

Arnold, Christian; Externbrink, Fabian; Hackermüller, Jörg; Reiche, Kristin

2014-11-10

Microarrays are widely used in gene expression studies, and custom expression microarrays are popular to monitor expression changes of a customer-defined set of genes. However, the complexity of transcriptomes uncovered recently make custom expression microarray design a non-trivial task. Pervasive transcription and alternative processing of transcripts generate a wealth of interweaved transcripts that requires well-considered probe design strategies and is largely neglected in existing approaches. We developed the web server CEM-Designer that facilitates microarray platform independent design of custom expression microarrays for complex transcriptomes. CEM-Designer covers (i) the collection and generation of a set of unique target sequences from different sources and (ii) the selection of a set of sensitive and specific probes that optimally represents the target sequences. Probe design itself is left to third party software to ensure that probes meet provider-specific constraints. CEM-Designer is available at http://designpipeline.bioinf.uni-leipzig.de. Copyright © 2014 Elsevier B.V. All rights reserved.

A Language for Specifying Compiler Optimizations for Generic Software

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willcock, Jeremiah J.

2007-01-01

Compiler optimization is important to software performance, and modern processor architectures make optimization even more critical. However, many modern software applications use libraries providing high levels of abstraction. Such libraries often hinder effective optimization — the libraries are difficult to analyze using current compiler technology. For example, high-level libraries often use dynamic memory allocation and indirectly expressed control structures, such as iteratorbased loops. Programs using these libraries often cannot achieve an optimal level of performance. On the other hand, software libraries have also been recognized as potentially aiding in program optimization. One proposed implementation of library-based optimization is to allowmore » the library author, or a library user, to define custom analyses and optimizations. Only limited systems have been created to take advantage of this potential, however. One problem in creating a framework for defining new optimizations and analyses is how users are to specify them: implementing them by hand inside a compiler is difficult and prone to errors. Thus, a domain-specific language for librarybased compiler optimizations would be beneficial. Many optimization specification languages have appeared in the literature, but they tend to be either limited in power or unnecessarily difficult to use. Therefore, I have designed, implemented, and evaluated the Pavilion language for specifying program analyses and optimizations, designed for library authors and users. These analyses and optimizations can be based on the implementation of a particular library, its use in a specific program, or on the properties of a broad range of types, expressed through concepts. The new system is intended to provide a high level of expressiveness, even though the intended users are unlikely to be compiler experts.« less

The Sizing and Optimization Language, (SOL): Computer language for design problems

NASA Technical Reports Server (NTRS)

Lucas, Stephen H.; Scotti, Stephen J.

1988-01-01

The Sizing and Optimization Language, (SOL), a new high level, special purpose computer language was developed to expedite application of numerical optimization to design problems and to make the process less error prone. SOL utilizes the ADS optimization software and provides a clear, concise syntax for describing an optimization problem, the OPTIMIZE description, which closely parallels the mathematical description of the problem. SOL offers language statements which can be used to model a design mathematically, with subroutines or code logic, and with existing FORTRAN routines. In addition, SOL provides error checking and clear output of the optimization results. Because of these language features, SOL is best suited to model and optimize a design concept when the model consits of mathematical expressions written in SOL. For such cases, SOL's unique syntax and error checking can be fully utilized. SOL is presently available for DEC VAX/VMS systems. A SOL package is available which includes the SOL compiler, runtime library routines, and a SOL reference manual.

Complete characterization of the spasing (L-L) curve of a three-level quantum coherence enhanced spaser for design optimization

NASA Astrophysics Data System (ADS)

Kumarapperuma, Lakshitha; Premaratne, Malin; Jha, Pankaj K.; Stockman, Mark I.; Agrawal, Govind P.

2018-05-01

We demonstrate that it is possible to derive an approximate analytical expression to characterize the spasing (L-L) curve of a coherently enhanced spaser with 3-level gain-medium chromophores. The utility of this solution stems from the fact that it enables optimization of the large parameter space associated with spaser designing, a functionality not offered by the methods currently available in the literature. This is vital for the advancement of spaser technology towards the level of device realization. Owing to the compact nature of the analytical expressions, our solution also facilitates the grouping and identification of key processes responsible for the spasing action, whilst providing significant physical insights. Furthermore, we show that our expression generates results within 0.1% error compared to numerically obtained results for pumping rates higher than the spasing threshold, thereby drastically reducing the computational cost associated with spaser designing.

Exploring optimal topology of thermal cloaks by CMA-ES

NASA Astrophysics Data System (ADS)

Fujii, Garuda; Akimoto, Youhei; Takahashi, Masayuki

2018-02-01

This paper presents topology optimization for thermal cloaks expressed by level-set functions and explored using the covariance matrix adaptation evolution strategy (CMA-ES). Designed optimal configurations provide superior performances in thermal cloaks for the steady-state thermal conduction and succeed in realizing thermal invisibility, despite the structures being simply composed of iron and aluminum and without inhomogeneities caused by employing metamaterials. To design thermal cloaks, a prescribed objective function is used to evaluate the difference between the temperature field controlled by a thermal cloak and when no thermal insulator is present. The CMA-ES involves searches for optimal sets of level-set functions as design variables that minimize a regularized fitness involving a perimeter constraint. Through topology optimization subject to structural symmetries about four axes, we obtain a concept design of a thermal cloak that functions in an isotropic heat flux.

Designing a fully automated multi-bioreactor plant for fast DoE optimization of pharmaceutical protein production.

PubMed

Fricke, Jens; Pohlmann, Kristof; Jonescheit, Nils A; Ellert, Andree; Joksch, Burkhard; Luttmann, Reiner

2013-06-01

The identification of optimal expression conditions for state-of-the-art production of pharmaceutical proteins is a very time-consuming and expensive process. In this report a method for rapid and reproducible optimization of protein expression in an in-house designed small-scale BIOSTAT® multi-bioreactor plant is described. A newly developed BioPAT® MFCS/win Design of Experiments (DoE) module (Sartorius Stedim Systems, Germany) connects the process control system MFCS/win and the DoE software MODDE® (Umetrics AB, Sweden) and enables therefore the implementation of fully automated optimization procedures. As a proof of concept, a commercial Pichia pastoris strain KM71H has been transformed for the expression of potential malaria vaccines. This approach has allowed a doubling of intact protein secretion productivity due to the DoE optimization procedure compared to initial cultivation results. In a next step, robustness regarding the sensitivity to process parameter variability has been proven around the determined optimum. Thereby, a pharmaceutical production process that is significantly improved within seven 24-hour cultivation cycles was established. Specifically, regarding the regulatory demands pointed out in the process analytical technology (PAT) initiative of the United States Food and Drug Administration (FDA), the combination of a highly instrumented, fully automated multi-bioreactor platform with proper cultivation strategies and extended DoE software solutions opens up promising benefits and opportunities for pharmaceutical protein production. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A reverse engineering approach to optimize experiments for the construction of biological regulatory networks.

PubMed

Zhang, Xiaomeng; Shao, Bin; Wu, Yangle; Qi, Ouyang

2013-01-01

One of the major objectives in systems biology is to understand the relation between the topological structures and the dynamics of biological regulatory networks. In this context, various mathematical tools have been developed to deduct structures of regulatory networks from microarray expression data. In general, from a single data set, one cannot deduct the whole network structure; additional expression data are usually needed. Thus how to design a microarray expression experiment in order to get the most information is a practical problem in systems biology. Here we propose three methods, namely, maximum distance method, trajectory entropy method, and sampling method, to derive the optimal initial conditions for experiments. The performance of these methods is tested and evaluated in three well-known regulatory networks (budding yeast cell cycle, fission yeast cell cycle, and E. coli. SOS network). Based on the evaluation, we propose an efficient strategy for the design of microarray expression experiments.

DyNAVacS: an integrative tool for optimized DNA vaccine design.

PubMed

Harish, Nagarajan; Gupta, Rekha; Agarwal, Parul; Scaria, Vinod; Pillai, Beena

2006-07-01

DNA vaccines have slowly emerged as keystones in preventive immunology due to their versatility in inducing both cell-mediated as well as humoral immune responses. The design of an efficient DNA vaccine, involves choice of a suitable expression vector, ensuring optimal expression by codon optimization, engineering CpG motifs for enhancing immune responses and providing additional sequence signals for efficient translation. DyNAVacS is a web-based tool created for rapid and easy design of DNA vaccines. It follows a step-wise design flow, which guides the user through the various sequential steps in the design of the vaccine. Further, it allows restriction enzyme mapping, design of primers spanning user specified sequences and provides information regarding the vectors currently used for generation of DNA vaccines. The web version uses Apache HTTP server. The interface was written in HTML and utilizes the Common Gateway Interface scripts written in PERL for functionality. DyNAVacS is an integrated tool consisting of user-friendly programs, which require minimal information from the user. The software is available free of cost, as a web based application at URL: http://miracle.igib.res.in/dynavac/.

Investigation on the use of optimization techniques for helicopter airframe vibrations design studies

NASA Technical Reports Server (NTRS)

Sreekanta Murthy, T.

1992-01-01

Results of the investigation of formal nonlinear programming-based numerical optimization techniques of helicopter airframe vibration reduction are summarized. The objective and constraint function and the sensitivity expressions used in the formulation of airframe vibration optimization problems are presented and discussed. Implementation of a new computational procedure based on MSC/NASTRAN and CONMIN in a computer program system called DYNOPT for optimizing airframes subject to strength, frequency, dynamic response, and dynamic stress constraints is described. An optimization methodology is proposed which is thought to provide a new way of applying formal optimization techniques during the various phases of the airframe design process. Numerical results obtained from the application of the DYNOPT optimization code to a helicopter airframe are discussed.

Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast.

PubMed

Young, Eric M; Zhao, Zheng; Gielesen, Bianca E M; Wu, Liang; Benjamin Gordon, D; Roubos, Johannes A; Voigt, Christopher A

2018-05-09

Metabolic engineering requires multiple rounds of strain construction to evaluate alternative pathways and enzyme concentrations. Optimizing multigene pathways stepwise or by randomly selecting enzymes and expression levels is inefficient. Here, we apply methods from design of experiments (DOE) to guide the construction of strain libraries from which the maximum information can be extracted without sampling every possible combination. We use Saccharomyces cerevisiae as a host for a novel six-gene pathway to itaconic acid, selected by comparing alternative shunt pathways that bypass the mitochondrial TCA cycle. The pathway is distinctive for the use of acetylating acetaldehyde dehydrogenase to increase cytosolic acetyl-CoA pools, a bacterial enzyme to synthesize citrate in the cytosol, and an itaconic acid exporter. Precise control over the expression of each gene is enabled by a set of promoter-terminator pairs that span a 174-fold range. Two large combinatorial libraries (160 variants, 2.4Mb and 32 variants, 0.6Mb) are designed where the expression levels are selected by statistical methods (I-optimal response surface methodology, full factorial, or Plackett-Burman) with the intent of extracting different types of guiding information after the screen. This is applied to the design of a third library (24 variants, 0.5Mb) intended to alleviate a bottleneck in cis-aconitate decarboxylase (CAD) expression. The top strain produces 815mg/l itaconic acid, a 4-fold improvement over the initial strain achieved by iteratively balancing pathway expression. Including a methylated product in the total, the strain produces 1.3g/l combined itaconic acids. Further, a regression analysis of the libraries reveals the optimal expression level of CAD as well as pairwise interdependencies between genes that result in increased titer and purity of itaconic acid. This work demonstrates adapting algorithmic design strategies to guide automated yeast strain construction and learn information after each iteration. Copyright © 2018. Published by Elsevier Inc.

Development of a Multistage Reliability-Based Design Optimization Method

DTIC Science & Technology

2014-01-01

expressed using Eq. (7), where nx is the number of design variables P a0 þ Xnx i¼1 aini þ bið Þxi 0 " # a (7) Figures 3(a)–3(c) illustrates the...constraint equation can be expressed in the gen- eral form of Eq. (16), where again nx is the number of design variables P a0;j þ Xnx i¼1 ai;jnixi

Optimal Design of Litz Wire Coils With Sandwich Structure Wirelessly Powering an Artificial Anal Sphincter System.

PubMed

Ke, Lei; Yan, Guozheng; Yan, Sheng; Wang, Zhiwu; Li, Xiaoyang

2015-07-01

Transcutaneous energy transfer system (TETS) is widely used to energize implantable biomedical devices. As a key part of the TETS, a pair of applicable coils with low losses, high unloaded Q factor, and strong coupling is required to realize an efficient TETS. This article presents an optimal design methodology of planar litz wire coils sandwiched between two ferrite substrates wirelessly powering a novel mechanical artificial anal sphincter system for treating severe fecal incontinence, with focus on the main parameters of the coils such as the wire diameter, number of turns, geometry, and the properties of the ferrite substrate. The theoretical basis of optimal power transfer efficiency in an inductive link was analyzed. A set of analytical expressions are outlined to calculate the winding resistance of a litz wire coil on ferrite substrate, taking into account eddy-current losses, including conduction losses and induction losses. Expressions that describe the geometrical dimension dependence of self- and mutual inductance are derived. The influence of ferrite substrate relative permeability and dimensions is also considered. We have used this foundation to devise an applicable coil design method that starts with a set of realistic constraints and ends with the optimal coil pair geometries. All theoretical predictions are verified with measurements using different types of fabricated coils. The results indicate that the analysis is useful for optimizing the geometry design of windings and the ferrite substrate in a sandwich structure as part of which, in addition to providing design insight, allows speeding up the system efficiency-optimizing design process. Copyright © 2015 International Center for Artificial Organs and Transplantation and Wiley Periodicals, Inc.

Simultaneous structural and control optimization via linear quadratic regulator eigenstructure assignment

NASA Technical Reports Server (NTRS)

Becus, G. A.; Lui, C. Y.; Venkayya, V. B.; Tischler, V. A.

1987-01-01

A method for simultaneous structural and control design of large flexible space structures (LFSS) to reduce vibration generated by disturbances is presented. Desired natural frequencies and damping ratios for the closed loop system are achieved by using a combination of linear quadratic regulator (LQR) synthesis and numerical optimization techniques. The state and control weighing matrices (Q and R) are expressed in terms of structural parameters such as mass and stiffness. The design parameters are selected by numerical optimization so as to minimize the weight of the structure and to achieve the desired closed-loop eigenvalues. An illustrative example of the design of a two bar truss is presented.

Optimization methods applied to hybrid vehicle design

NASA Technical Reports Server (NTRS)

Donoghue, J. F.; Burghart, J. H.

1983-01-01

The use of optimization methods as an effective design tool in the design of hybrid vehicle propulsion systems is demonstrated. Optimization techniques were used to select values for three design parameters (battery weight, heat engine power rating and power split between the two on-board energy sources) such that various measures of vehicle performance (acquisition cost, life cycle cost and petroleum consumption) were optimized. The apporach produced designs which were often significant improvements over hybrid designs already reported on in the literature. The principal conclusions are as follows. First, it was found that the strategy used to split the required power between the two on-board energy sources can have a significant effect on life cycle cost and petroleum consumption. Second, the optimization program should be constructed so that performance measures and design variables can be easily changed. Third, the vehicle simulation program has a significant effect on the computer run time of the overall optimization program; run time can be significantly reduced by proper design of the types of trips the vehicle takes in a one year period. Fourth, care must be taken in designing the cost and constraint expressions which are used in the optimization so that they are relatively smooth functions of the design variables. Fifth, proper handling of constraints on battery weight and heat engine rating, variables which must be large enough to meet power demands, is particularly important for the success of an optimization study. Finally, the principal conclusion is that optimization methods provide a practical tool for carrying out the design of a hybrid vehicle propulsion system.

Results of an integrated structure/control law design sensitivity analysis

NASA Technical Reports Server (NTRS)

Gilbert, Michael G.

1989-01-01

A design sensitivity analysis method for Linear Quadratic Cost, Gaussian (LQG) optimal control laws, which predicts change in the optimal control law due to changes in fixed problem parameters using analytical sensitivity equations is discussed. Numerical results of a design sensitivity analysis for a realistic aeroservoelastic aircraft example are presented. In this example, the sensitivity of the optimally controlled aircraft's response to various problem formulation and physical aircraft parameters is determined. These results are used to predict the aircraft's new optimally controlled response if the parameter was to have some other nominal value during the control law design process. The sensitivity results are validated by recomputing the optimal control law for discrete variations in parameters, computing the new actual aircraft response, and comparing with the predicted response. These results show an improvement in sensitivity accuracy for integrated design purposes over methods which do not include changes in the optimal control law. Use of the analytical LQG sensitivity expressions is also shown to be more efficient than finite difference methods for the computation of the equivalent sensitivity information.

Molecular Cooperativity Governs Diverse and Monoallelic Olfactory Receptor Expression

NASA Astrophysics Data System (ADS)

Xing, Jianhua; Tian, Xiaojun; Zhang, Hang; Sannerud, Jens

Multiple-objective optimization is common in biological systems. In the mammalian olfactory system, each sensory neuron stochastically expresses only one out of up to thousands of olfactory receptor (OR) gene alleles; at organism level the types of expressed ORs need to be maximized. The molecular mechanism of this Nobel-Prize winning puzzle remains unresolved after decades of extensive studies. Existing models focus only on monoallele activation, and cannot explain recent observations in mutants, especially the reduced global diversity of expressed ORs in G9a/GLP knockouts. In this work we integrated existing information on OR expression, and proposed an evolutionarily optimized three-layer regulation mechanism, which includes zonal segregation, epigenetic and enhancer competition coupled to a negative feedback loop. This model not only recapitulates monoallelic OR expression, but also elucidates how the olfactory system maximizes and maintains the diversity of OR expression. The model is validated by several experimental results, and particularly underscores cooperativity and synergy as a general design principle of multi-objective optimization in biology. The work is supported by the NIGMS/DMS Mathematical Biology program.

Theory and design of interferometric synthetic aperture radars

NASA Technical Reports Server (NTRS)

Rodriguez, E.; Martin, J. M.

1992-01-01

A derivation of the signal statistics, an optimal estimator of the interferometric phase, and the expression necessary to calculate the height-error budget are presented. These expressions are used to derive methods of optimizing the parameters of the interferometric synthetic aperture radar system (InSAR), and are then employed in a specific design example for a system to perform high-resolution global topographic mapping with a one-year mission lifetime, subject to current technological constraints. A Monte Carlo simulation of this InSAR system is performed to evaluate its performance for realistic topography. The results indicate that this system has the potential to satisfy the stringent accuracy and resolution requirements for geophysical use of global topographic data.

A stepwise approach for the reproducible optimization of PAMO expression in Escherichia coli for whole-cell biocatalysis

PubMed Central

2012-01-01

Background Baeyer-Villiger monooxygenases (BVMOs) represent a group of enzymes of considerable biotechnological relevance as illustrated by their growing use as biocatalyst in a variety of synthetic applications. However, due to their increased use the reproducible expression of BVMOs and other biotechnologically relevant enzymes has become a pressing matter while knowledge about the factors governing their reproducible expression is scattered. Results Here, we have used phenylacetone monooxygenase (PAMO) from Thermobifida fusca, a prototype Type I BVMO, as a model enzyme to develop a stepwise strategy to optimize the biotransformation performance of recombinant E. coli expressing PAMO in 96-well microtiter plates in a reproducible fashion. Using this system, the best expression conditions of PAMO were investigated first, including different host strains, temperature as well as time and induction period for PAMO expression. This optimized system was used next to improve biotransformation conditions, the PAMO-catalyzed conversion of phenylacetone, by evaluating the best electron donor, substrate concentration, and the temperature and length of biotransformation. Combining all optimized parameters resulted in a more than four-fold enhancement of the biocatalytic performance and, importantly, this was highly reproducible as indicated by the relative standard deviation of 1% for non-washed cells and 3% for washed cells. Furthermore, the optimized procedure was successfully adapted for activity-based mutant screening. Conclusions Our optimized procedure, which provides a comprehensive overview of the key factors influencing the reproducible expression and performance of a biocatalyst, is expected to form a rational basis for the optimization of miniaturized biotransformations and for the design of novel activity-based screening procedures suitable for BVMOs and other NAD(P)H-dependent enzymes as well. PMID:22720747

Results of an integrated structure-control law design sensitivity analysis

NASA Technical Reports Server (NTRS)

Gilbert, Michael G.

1988-01-01

Next generation air and space vehicle designs are driven by increased performance requirements, demanding a high level of design integration between traditionally separate design disciplines. Interdisciplinary analysis capabilities have been developed, for aeroservoelastic aircraft and large flexible spacecraft control for instance, but the requisite integrated design methods are only beginning to be developed. One integrated design method which has received attention is based on hierarchal problem decompositions, optimization, and design sensitivity analyses. This paper highlights a design sensitivity analysis method for Linear Quadratic Cost, Gaussian (LQG) optimal control laws, which predicts change in the optimal control law due to changes in fixed problem parameters using analytical sensitivity equations. Numerical results of a design sensitivity analysis for a realistic aeroservoelastic aircraft example are presented. In this example, the sensitivity of the optimally controlled aircraft's response to various problem formulation and physical aircraft parameters is determined. These results are used to predict the aircraft's new optimally controlled response if the parameter was to have some other nominal value during the control law design process. The sensitivity results are validated by recomputing the optimal control law for discrete variations in parameters, computing the new actual aircraft response, and comparing with the predicted response. These results show an improvement in sensitivity accuracy for integrated design purposes over methods which do not include changess in the optimal control law. Use of the analytical LQG sensitivity expressions is also shown to be more efficient that finite difference methods for the computation of the equivalent sensitivity information.

Optimization of brushless direct current motor design using an intelligent technique.

PubMed

Shabanian, Alireza; Tousiwas, Armin Amini Poustchi; Pourmandi, Massoud; Khormali, Aminollah; Ataei, Abdolhay

2015-07-01

This paper presents a method for the optimal design of a slotless permanent magnet brushless DC (BLDC) motor with surface mounted magnets using an improved bee algorithm (IBA). The characteristics of the motor are expressed as functions of motor geometries. The objective function is a combination of losses, volume and cost to be minimized simultaneously. This method is based on the capability of swarm-based algorithms in finding the optimal solution. One sample case is used to illustrate the performance of the design approach and optimization technique. The IBA has a better performance and speed of convergence compared with bee algorithm (BA). Simulation results show that the proposed method has a very high/efficient performance. Copyright © 2015 ISA. Published by Elsevier Ltd. All rights reserved.

GeMS: an advanced software package for designing synthetic genes.

PubMed

Jayaraj, Sebastian; Reid, Ralph; Santi, Daniel V

2005-01-01

A user-friendly, advanced software package for gene design is described. The software comprises an integrated suite of programs-also provided as stand-alone tools-that automatically performs the following tasks in gene design: restriction site prediction, codon optimization for any expression host, restriction site inclusion and exclusion, separation of long sequences into synthesizable fragments, T(m) and stem-loop determinations, optimal oligonucleotide component design and design verification/error-checking. The output is a complete design report and a list of optimized oligonucleotides to be prepared for subsequent gene synthesis. The user interface accommodates both inexperienced and experienced users. For inexperienced users, explanatory notes are provided such that detailed instructions are not necessary; for experienced users, a streamlined interface is provided without such notes. The software has been extensively tested in the design and successful synthesis of over 400 kb of genes, many of which exceeded 5 kb in length.

On optimal infinite impulse response edge detection filters

NASA Technical Reports Server (NTRS)

Sarkar, Sudeep; Boyer, Kim L.

1991-01-01

The authors outline the design of an optimal, computationally efficient, infinite impulse response edge detection filter. The optimal filter is computed based on Canny's high signal to noise ratio, good localization criteria, and a criterion on the spurious response of the filter to noise. An expression for the width of the filter, which is appropriate for infinite-length filters, is incorporated directly in the expression for spurious responses. The three criteria are maximized using the variational method and nonlinear constrained optimization. The optimal filter parameters are tabulated for various values of the filter performance criteria. A complete methodology for implementing the optimal filter using approximating recursive digital filtering is presented. The approximating recursive digital filter is separable into two linear filters operating in two orthogonal directions. The implementation is very simple and computationally efficient, has a constant time of execution for different sizes of the operator, and is readily amenable to real-time hardware implementation.

[Optimization of prokaryotic expression conditions of Leptospira interrogans trigeminy genus-specific protein antigen based on surface response analysis].

PubMed

Wang, Jiang; Luo, Dongjiao; Sun, Aihua; Yan, Jie

2008-07-01

Lipoproteins LipL32 and LipL21 and transmembrane protein OMPL1 have been confirmed as the superficial genus-specific antigens of Leptospira interrogans, which can be used as antigens for developing a universal genetic engineering vaccine. In order to obtain high expression of an artificial fusion gene lipL32/1-lipL21-ompL1/2, we optimized prokaryotic expression conditions. We used surface response analysis based on the central composite design to optimize culture conditions of a new antigen protein by recombinant Escherichia coli DE3.The culture conditions included initial pH, induction start time, post-induction time, Isopropyl beta-D-thiogalactopyranoside (IPTG) concentration, and temperature. The maximal production of antigen protein was 37.78 mg/l. The optimal culture conditions for high recombinant fusion protein was determined: initial pH 7.9, induction start time 2.5 h, a post-induction time of 5.38 h, 0.20 mM IPTG, and a post-induction temperature of 31 degrees C. Surface response analysis based on CCD increased the target production. This statistical method reduced the number of experiments required for optimization and enabled rapid identification and integration of the key culture condition parameters for optimizing recombinant protein expression.

An efficient strategy for producing a stable, replaceable, highly efficient transgene expression system in silkworm, Bombyx mori

PubMed Central

Long, Dingpei; Lu, Weijian; Zhang, Yuli; Bi, Lihui; Xiang, Zhonghuai; Zhao, Aichun

2015-01-01

We developed an efficient strategy that combines a method for the post-integration elimination of all transposon sequences, a site-specific recombination system, and an optimized fibroin H-chain expression system to produce a stable, replaceable, highly efficient transgene expression system in the silkworm (Bombyx mori) that overcomes the disadvantages of random insertion and post-integration instability of transposons. Here, we generated four different transgenic silkworm strains, and of one the transgenic strains, designated TS1-RgG2, with up to 16% (w/w) of the target protein in the cocoons, was selected. The subsequent elimination of all the transposon sequences from TS1-RgG2 was completed by the heat-shock-induced expression of the transposase in vivo. The resulting transgenic silkworm strain was designated TS3-g2 and contained only the attP-flanked optimized fibroin H-chain expression cassette in its genome. A phiC31/att-system-based recombinase-mediated cassette exchange (RMCE) method could be used to integrate other genes of interest into the same genome locus between the attP sites in TS3-g2. Controlling for position effects with phiC31-mediated RMCE will also allow the optimization of exogenous protein expression and fine gene function analyses in the silkworm. The strategy developed here is also applicable to other lepidopteran insects, to improve the ecological safety of transgenic strains in biocontrol programs. PMID:25739894

Bacterial cell-free expression technology to in vitro systems engineering and optimization.

PubMed

Caschera, Filippo

2017-06-01

Cell-free expression system is a technology for the synthesis of proteins in vitro . The system is a platform for several bioengineering projects, e.g. cell-free metabolic engineering, evolutionary design of experiments, and synthetic minimal cell construction. Bacterial cell-free protein synthesis system (CFPS) is a robust tool for synthetic biology. The bacteria lysate, the DNA, and the energy module, which are the three optimized sub-systems for in vitro protein synthesis, compose the integrated system. Currently, an optimized E. coli cell-free expression system can produce up to ∼2.3 mg/mL of a fluorescent reporter protein. Herein, I will describe the features of ATP-regeneration systems for in vitro protein synthesis, and I will present a machine-learning experiment for optimizing the protein yield of E. coli cell-free protein synthesis systems. Moreover, I will introduce experiments on the synthesis of a minimal cell using liposomes as dynamic containers, and E. coli cell-free expression system as biochemical platform for metabolism and gene expression. CFPS can be further integrated with other technologies for novel applications in environmental, medical and material science.

Transmission loss optimization in acoustic sandwich panels

NASA Astrophysics Data System (ADS)

Makris, S. E.; Dym, C. L.; MacGregor Smith, J.

1986-06-01

Considering the sound transmission loss (TL) of a sandwich panel as the single objective, different optimization techniques are examined and a sophisticated computer program is used to find the optimum TL. Also, for one of the possible case studies such as core optimization, closed-form expressions are given between TL and the core-design variables for different sets of skins. The significance of these functional relationships lies in the fact that the panel designer can bypass the necessity of using a sophisticated software package in order to assess explicitly the dependence of the TL on core thickness and density.

CVXPY: A Python-Embedded Modeling Language for Convex Optimization.

PubMed

Diamond, Steven; Boyd, Stephen

2016-04-01

CVXPY is a domain-specific language for convex optimization embedded in Python. It allows the user to express convex optimization problems in a natural syntax that follows the math, rather than in the restrictive standard form required by solvers. CVXPY makes it easy to combine convex optimization with high-level features of Python such as parallelism and object-oriented design. CVXPY is available at http://www.cvxpy.org/ under the GPL license, along with documentation and examples.

The Inverse Optimal Control Problem for a Three-Loop Missile Autopilot

NASA Astrophysics Data System (ADS)

Hwang, Donghyeok; Tahk, Min-Jea

2018-04-01

The performance characteristics of the autopilot must have a fast response to intercept a maneuvering target and reasonable robustness for system stability under the effect of un-modeled dynamics and noise. By the conventional approach, the three-loop autopilot design is handled by time constant, damping factor and open-loop crossover frequency to achieve the desired performance requirements. Note that the general optimal theory can be also used to obtain the same gain as obtained from the conventional approach. The key idea of using optimal control technique for feedback gain design revolves around appropriate selection and interpretation of the performance index for which the control is optimal. This paper derives an explicit expression, which relates the weight parameters appearing in the quadratic performance index to the design parameters such as open-loop crossover frequency, phase margin, damping factor, or time constant, etc. Since all set of selection of design parameters do not guarantee existence of optimal control law, explicit inequalities, which are named the optimality criteria for the three-loop autopilot (OC3L), are derived to find out all set of design parameters for which the control law is optimal. Finally, based on OC3L, an efficient gain selection procedure is developed, where time constant is set to design objective and open-loop crossover frequency and phase margin as design constraints. The effectiveness of the proposed technique is illustrated through numerical simulations.

Multi-objective design optimization and control of magnetorheological fluid brakes for automotive applications

NASA Astrophysics Data System (ADS)

Shamieh, Hadi; Sedaghati, Ramin

2017-12-01

The magnetorheological brake (MRB) is an electromechanical device that generates a retarding torque through employing magnetorheological (MR) fluids. The objective of this paper is to design, optimize and control an MRB for automotive applications considering. The dynamic range of a disk-type MRB expressing the ratio of generated toque at on and off states has been formulated as a function of the rotational speed, geometrical and material properties, and applied electrical current. Analytical magnetic circuit analysis has been conducted to derive the relation between magnetic field intensity and the applied electrical current as a function of the MRB geometrical and material properties. A multidisciplinary design optimization problem has then been formulated to identify the optimal brake geometrical parameters to maximize the dynamic range and minimize the response time and weight of the MRB under weight, size and magnetic flux density constraints. The optimization problem has been solved using combined genetic and sequential quadratic programming algorithms. Finally, the performance of the optimally designed MRB has been investigated in a quarter vehicle model. A PID controller has been designed to regulate the applied current required by the MRB in order to improve vehicle’s slipping on different road conditions.

Global Search of a Three-dimensional Low Solidity Circular Cascade Diffuser for Centrifugal Blowers by Meta-model Assisted Optimization

NASA Astrophysics Data System (ADS)

Sakaguchi, Daisaku; Sakue, Daiki; Tun, Min Thaw

2018-04-01

A three-dimensional blade of a low solidity circular cascade diffuser in centrifugal blowers is designed by means of a multi-point optimization technique. The optimization aims at improving static pressure coefficient at a design point and at a small flow rate condition. Moreover, a clear definition of secondary flow expressed by positive radial velocity at hub side is taken into consideration in constraints. The number of design parameters for three-dimensional blade reaches to 10 in this study, such as a radial gap, a radial chord length and mean camber angle distribution of the LSD blade with five control points, control point between hub and shroud with two design freedom. Optimization results show clear Pareto front and selected optimum design shows good improvement of pressure rise in diffuser at small flow rate conditions. It is found that three-dimensional blade has advantage to stabilize the secondary flow effect with improving pressure recovery of the low solidity circular cascade diffuser.

Optimal power and efficiency of quantum Stirling heat engines

NASA Astrophysics Data System (ADS)

Yin, Yong; Chen, Lingen; Wu, Feng

2017-01-01

A quantum Stirling heat engine model is established in this paper in which imperfect regeneration and heat leakage are considered. A single particle which contained in a one-dimensional infinite potential well is studied, and the system consists of countless replicas. Each particle is confined in its own potential well, whose occupation probabilities can be expressed by the thermal equilibrium Gibbs distributions. Based on the Schrödinger equation, the expressions of power output and efficiency for the engine are obtained. Effects of imperfect regeneration and heat leakage on the optimal performance are discussed. The optimal performance region and the optimal values of important parameters of the engine cycle are obtained. The results obtained can provide some guidelines for the design of a quantum Stirling heat engine.

CVXPY: A Python-Embedded Modeling Language for Convex Optimization

PubMed Central

Diamond, Steven; Boyd, Stephen

2016-01-01

CVXPY is a domain-specific language for convex optimization embedded in Python. It allows the user to express convex optimization problems in a natural syntax that follows the math, rather than in the restrictive standard form required by solvers. CVXPY makes it easy to combine convex optimization with high-level features of Python such as parallelism and object-oriented design. CVXPY is available at http://www.cvxpy.org/ under the GPL license, along with documentation and examples. PMID:27375369

Expression and Secretion of Endostar Protein by Escherichia Coli: Optimization of Culture Conditions Using the Response Surface Methodology.

PubMed

Mohajeri, Abbas; Abdolalizadeh, Jalal; Pilehvar-Soltanahmadi, Younes; Kiafar, Farhad; Zarghami, Nosratollah

2016-10-01

Endostar as a specific drug in treatment of the nonsmall cell lung cancer is produced using Escherichia coli expression system. Plackett-Burman design (PBD) and response surface methodology (RSM) are statistical tools for experimental design and optimization of biotechnological processes. This investigation aimed to predict and develop the optimal culture condition and its components for expression and secretion of endostar into the culture medium of E. coli. The synthetic endostar coding sequence was fused with PhoA signal peptide. The nine factors involved in the production of recombinant protein-postinduction temperature, cell density, rotation speed, postinduction time, concentration of glycerol, IPTG, peptone, glycine, and triton X-100-were evaluated using PBD. Four significant factors were selected based on PBD results for optimizing culture condition using RSM. Endostar was purified using cation exchange chromatography and size exclusion chromatography. The maximum level of endostar was obtained under the following condition: 13.57-h postinduction time, 0.76 % glycine, 0.7 % triton X-100, and 4.87 % glycerol. The predicted levels of endostar was significantly correlated with experimental levels (R 2 = 0.982, P = 0.00). The obtained results indicated that PBD and RSM are effective tools for optimization of culture condition and its components for endostar production in E. coli. The most important factors in the enhancement of the protein production are glycerol, glycine, and postinduction time.

Bacterial expression of self-assembling peptide hydrogelators

NASA Astrophysics Data System (ADS)

Sonmez, Cem

For tissue regeneration and drug delivery applications, various architectures are explored to serve as biomaterial tools. Via de novo design, functional peptide hydrogel materials have been developed as scaffolds for biomedical applications. The objective of this study is to investigate bacterial expression as an alternative method to chemical synthesis for the recombinant production of self-assembling peptides that can form rigid hydrogels under physiological conditions. The Schneider and Pochan Labs have designed and characterized a 20 amino acid beta-hairpin forming amphiphilic peptide containing a D-residue in its turn region (MAX1). As a result, this peptide must be prepared chemically. Peptide engineering, using the sequence of MAX1 as a template, afforded a small family of peptides for expression (EX peptides) that have different turn sequences consisting of natural amino acids and amenable to bacterial expression. Each sequence was initially chemically synthesized to quickly assess the material properties of its corresponding gel. One model peptide EX1, was chosen to start the bacterial expression studies. DNA constructs facilitating the expression of EX1 were designed in such that the peptide could be expressed with different fusion partners and subsequently cleaved by enzymatic or chemical means to afford the free peptide. Optimization studies were performed to increase the yield of pure peptide that ultimately allowed 50 mg of pure peptide to be harvested from one liter of culture, providing an alternate means to produce this hydrogel-forming peptide. Recombinant production of other self-assembling hairpins with different turn sequences was also successful using this optimized protocol. The studies demonstrate that new beta-hairpin self-assembling peptides that are amenable to bacterial production and form rigid hydrogels at physiological conditions can be designed and produced by fermentation in good yield at significantly reduced cost when compared to chemical synthesis.

A stochastic optimal feedforward and feedback control methodology for superagility

NASA Technical Reports Server (NTRS)

Halyo, Nesim; Direskeneli, Haldun; Taylor, Deborah B.

1992-01-01

A new control design methodology is developed: Stochastic Optimal Feedforward and Feedback Technology (SOFFT). Traditional design techniques optimize a single cost function (which expresses the design objectives) to obtain both the feedforward and feedback control laws. This approach places conflicting demands on the control law such as fast tracking versus noise atttenuation/disturbance rejection. In the SOFFT approach, two cost functions are defined. The feedforward control law is designed to optimize one cost function, the feedback optimizes the other. By separating the design objectives and decoupling the feedforward and feedback design processes, both objectives can be achieved fully. A new measure of command tracking performance, Z-plots, is also developed. By analyzing these plots at off-nominal conditions, the sensitivity or robustness of the system in tracking commands can be predicted. Z-plots provide an important tool for designing robust control systems. The Variable-Gain SOFFT methodology was used to design a flight control system for the F/A-18 aircraft. It is shown that SOFFT can be used to expand the operating regime and provide greater performance (flying/handling qualities) throughout the extended flight regime. This work was performed under the NASA SBIR program. ICS plans to market the software developed as a new module in its commercial CACSD software package: ACET.

Detection of MDR1 mRNA expression with optimized gold nanoparticle beacon

NASA Astrophysics Data System (ADS)

Zhou, Qiumei; Qian, Zhiyu; Gu, Yueqing

2016-03-01

MDR1 (multidrug resistance gene) mRNA expression is a promising biomarker for the prediction of doxorubicin resistance in clinic. However, the traditional technical process in clinic is complicated and cannot perform the real-time detection mRNA in living single cells. In this study, the expression of MDR1 mRNA was analyzed based on optimized gold nanoparticle beacon in tumor cells. Firstly, gold nanoparticle (AuNP) was modified by thiol-PEG, and the MDR1 beacon sequence was screened and optimized using a BLAST bioinformatics strategy. Then, optimized MDR1 molecular beacons were characterized by transmission electron microscope, UV-vis and fluorescence spectroscopies. The cytotoxicity of MDR1 molecular beacon on L-02, K562 and K562/Adr cells were investigated by MTT assay, suggesting that MDR1 molecular beacon was low inherent cytotoxicity. Dark field microscope was used to investigate the cellular uptake of hDAuNP beacon assisted with ultrasound. Finally, laser scanning confocal microscope images showed that there was a significant difference in MDR1 mRNA expression in K562 and K562/Adr cells, which was consistent with the results of q-PCR measurement. In summary, optimized MDR1 molecular beacon designed in this study is a reliable strategy for detection MDR1 mRNA expression in living tumor cells, and will be a promising strategy for in guiding patient treatment and management in individualized medication.

Design optimization of steel frames using an enhanced firefly algorithm

NASA Astrophysics Data System (ADS)

Carbas, Serdar

2016-12-01

Mathematical modelling of real-world-sized steel frames under the Load and Resistance Factor Design-American Institute of Steel Construction (LRFD-AISC) steel design code provisions, where the steel profiles for the members are selected from a table of steel sections, turns out to be a discrete nonlinear programming problem. Finding the optimum design of such design optimization problems using classical optimization techniques is difficult. Metaheuristic algorithms provide an alternative way of solving such problems. The firefly algorithm (FFA) belongs to the swarm intelligence group of metaheuristics. The standard FFA has the drawback of being caught up in local optima in large-sized steel frame design problems. This study attempts to enhance the performance of the FFA by suggesting two new expressions for the attractiveness and randomness parameters of the algorithm. Two real-world-sized design examples are designed by the enhanced FFA and its performance is compared with standard FFA as well as with particle swarm and cuckoo search algorithms.

Expression and immunogenicity of novel subunit enterovirus 71 VP1 antigens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Juan; Department of Microbiology and Immunology, Nanjing Medical University; Wang, Shixia

Highlights: Black-Right-Pointing-Pointer EV71 is a major emerging infectious disease in many Asian countries. Black-Right-Pointing-Pointer Inactivated EV71 vaccines are in clinical studies but their safety and efficacy are unknown. Black-Right-Pointing-Pointer Developing subunit based EV71 vaccines is significant and novel antigen design is needed. Black-Right-Pointing-Pointer DNA immunization is an efficient tool to test the immunogenicity of VP1 based EV71 vaccines. Black-Right-Pointing-Pointer Multiple VP1 antigens are developed showing immunogenic potential. -- Abstract: Hand, foot, and mouth disease (HFMD) is a common viral illness in young children. HFMD is caused by viruses belonging to the enterovirus genus of the picornavirus family. Recently, enterovirus 71more » (EV71) has emerged as a virulent agent for HFMD with severe clinical outcomes. In the current report, we conducted a pilot antigen engineering study to optimize the expression and immunogenicity of subunit VP1 antigen for the design of EV71 vaccines. DNA immunization was adopted as a simple technical approach to test different designs of VP1 antigens without the need to express VP1 protein in vitro first. Our studies indicated that the expression and immunogenicity of VP1 protein can be improved with alternated VP1 antigen designs. Data presented in the current report revealed novel pathways to optimize the design of VP1 antigen-based EV71 vaccines.« less

Optimal Sensor Location Design for Reliable Fault Detection in Presence of False Alarms

PubMed Central

Yang, Fan; Xiao, Deyun; Shah, Sirish L.

2009-01-01

To improve fault detection reliability, sensor location should be designed according to an optimization criterion with constraints imposed by issues of detectability and identifiability. Reliability requires the minimization of undetectability and false alarm probability due to random factors on sensor readings, which is not only related with sensor readings but also affected by fault propagation. This paper introduces the reliability criteria expression based on the missed/false alarm probability of each sensor and system topology or connectivity derived from the directed graph. The algorithm for the optimization problem is presented as a heuristic procedure. Finally, a boiler system is illustrated using the proposed method. PMID:22291524

Optimization of optical systems.

PubMed

Champagne, E B

1966-11-01

The power signal-to-noise ratios for coherent and noncoherent optical detection are presented, with the expression for noncoherent detection being examined in detail. It is found that for the long range optical system to compete with its microwave counterpart it is necessary to optimize the optical system. The optical system may be optimized by using coherent detection, or noncoherent detection if the signal is the dominate noise factor. A design procedure is presented which, in principle, always allows one to obtain signal shot-noise limited operation with noncoherent detection if pulsed operation is used. The technique should make reasonable extremely long range, high data rate systems of relatively simple design.

Parameters optimization for magnetic resonance coupling wireless power transmission.

PubMed

Li, Changsheng; Zhang, He; Jiang, Xiaohua

2014-01-01

Taking maximum power transmission and power stable transmission as research objectives, optimal design for the wireless power transmission system based on magnetic resonance coupling is carried out in this paper. Firstly, based on the mutual coupling model, mathematical expressions of optimal coupling coefficients for the maximum power transmission target are deduced. Whereafter, methods of enhancing power transmission stability based on parameters optimal design are investigated. It is found that the sensitivity of the load power to the transmission parameters can be reduced and the power transmission stability can be enhanced by improving the system resonance frequency or coupling coefficient between the driving/pick-up coil and the transmission/receiving coil. Experiment results are well conformed to the theoretical analysis conclusions.

Patterns of Optimism and Pessimism in Perceptions of Changing Sex Roles.

ERIC Educational Resources Information Center

Marrone, Joseph G.; Rutnik, Carron M.

The utility of a design measuring actual, ideal, and expected sex-role attitudes was demonstrated with a 25-item survey administered to 155 undergraduate men and women under different instructional sets. Although relatively liberal attitudes were expressed overall, men generally expressed less egalitarian attitudes than did women. Moreover,…

Optimization of the Expression Conditions of CGA-N46 in Bacillus subtilis DB1342(p-3N46) by Response Surface Methodology.

PubMed

Li, Rui-Fang; Wang, Bin; Liu, Shuai; Chen, Shi-Hua; Yu, Guang-Hai; Yang, Shuo-Ye; Huang, Liang; Yin, Yan-Li; Lu, Zhi-Fang

2016-09-01

CGA-N46 is a small antifungal-derived peptide and consists of the 31st-76th amino acids of the N-terminus of human chromogranin A. Polycistronic expression of recombinant CGA-N46 in Bacillus subtilis DB1342 was used to improve its production, but the yield of CGA-N46 was still low. In the present study, response surface methodology (RSM) was used to optimize culture medium composition and growth conditions of the engineered strain B. subtilis DB1342(p-3N46) for the further increase in CGA-N46 yield. The results of two-level factorial experiments indicated that dextrin and tryptone were significant factors affecting CGA-N46 expression. Central composite design (CCD) was used to determine the ideal conditions of each significant factors. From the results of CCD, the optimal medium composition was predicted to be dextrin 16.6 g/L, tryptone 19.2 g/L, KH2PO4·H2O 6 g/L, pH 6.5. And the optimal culture process indicated inoculation of B. subtilis DB1342(p-3N46) seed culture into fresh culture medium at 5 % (v/v), followed by expression of CGA-N46 for 56 hours at 30 °C induced by 2 % (v/v) sucrose after one hour of shaking culture. To test optimal CGA-N46 peptide expression, the yeast growth inhibition assay was employed and it was found that under optimal culture conditions, CGA-N46 inhibited the growth of Candida albican by 42.17, 30.86 % more than that in the pre-optimization conditions. In summary, RSM can be used to optimize expression conditions of CGA-N46 in engineered strains B. subtilis DB1342(p-3N46).

Concurrent topology optimization for minimization of total mass considering load-carrying capabilities and thermal insulation simultaneously

NASA Astrophysics Data System (ADS)

Long, Kai; Wang, Xuan; Gu, Xianguang

2017-09-01

The present work introduces a novel concurrent optimization formulation to meet the requirements of lightweight design and various constraints simultaneously. Nodal displacement of macrostructure and effective thermal conductivity of microstructure are regarded as the constraint functions, which means taking into account both the load-carrying capabilities and the thermal insulation properties. The effective properties of porous material derived from numerical homogenization are used for macrostructural analysis. Meanwhile, displacement vectors of macrostructures from original and adjoint load cases are used for sensitivity analysis of the microstructure. Design variables in the form of reciprocal functions of relative densities are introduced and used for linearization of the constraint function. The objective function of total mass is approximately expressed by the second order Taylor series expansion. Then, the proposed concurrent optimization problem is solved using a sequential quadratic programming algorithm, by splitting into a series of sub-problems in the form of the quadratic program. Finally, several numerical examples are presented to validate the effectiveness of the proposed optimization method. The various effects including initial designs, prescribed limits of nodal displacement, and effective thermal conductivity on optimized designs are also investigated. An amount of optimized macrostructures and their corresponding microstructures are achieved.

Optimization of a yeast RNA interference system for controlling gene expression and enabling rapid metabolic engineering.

PubMed

Crook, Nathan C; Schmitz, Alexander C; Alper, Hal S

2014-05-16

Reduction of endogenous gene expression is a fundamental operation of metabolic engineering, yet current methods for gene knockdown (i.e., genome editing) remain laborious and slow, especially in yeast. In contrast, RNA interference allows facile and tunable gene knockdown via a simple plasmid transformation step, enabling metabolic engineers to rapidly prototype knockdown strategies in multiple strains before expending significant cost to undertake genome editing. Although RNAi is naturally present in a myriad of eukaryotes, it has only been recently implemented in Saccharomyces cerevisiae as a heterologous pathway and so has not yet been optimized as a metabolic engineering tool. In this study, we elucidate a set of design principles for the construction of hairpin RNA expression cassettes in yeast and implement RNA interference to quickly identify routes for improvement of itaconic acid production in this organism. The approach developed here enables rapid prototyping of knockdown strategies and thus accelerates and reduces the cost of the design-build-test cycle in yeast.

Development of a Prediction Model Based on RBF Neural Network for Sheet Metal Fixture Locating Layout Design and Optimization.

PubMed

Wang, Zhongqi; Yang, Bo; Kang, Yonggang; Yang, Yuan

2016-01-01

Fixture plays an important part in constraining excessive sheet metal part deformation at machining, assembly, and measuring stages during the whole manufacturing process. However, it is still a difficult and nontrivial task to design and optimize sheet metal fixture locating layout at present because there is always no direct and explicit expression describing sheet metal fixture locating layout and responding deformation. To that end, an RBF neural network prediction model is proposed in this paper to assist design and optimization of sheet metal fixture locating layout. The RBF neural network model is constructed by training data set selected by uniform sampling and finite element simulation analysis. Finally, a case study is conducted to verify the proposed method.

Development of a Prediction Model Based on RBF Neural Network for Sheet Metal Fixture Locating Layout Design and Optimization

PubMed Central

Wang, Zhongqi; Yang, Bo; Kang, Yonggang; Yang, Yuan

2016-01-01

Fixture plays an important part in constraining excessive sheet metal part deformation at machining, assembly, and measuring stages during the whole manufacturing process. However, it is still a difficult and nontrivial task to design and optimize sheet metal fixture locating layout at present because there is always no direct and explicit expression describing sheet metal fixture locating layout and responding deformation. To that end, an RBF neural network prediction model is proposed in this paper to assist design and optimization of sheet metal fixture locating layout. The RBF neural network model is constructed by training data set selected by uniform sampling and finite element simulation analysis. Finally, a case study is conducted to verify the proposed method. PMID:27127499

Design and testing of regulatory cassettes for optimal activity in skeletal and cardiac muscles.

PubMed

Himeda, Charis L; Chen, Xiaolan; Hauschka, Stephen D

2011-01-01

Gene therapy for muscular dystrophies requires efficient gene delivery to the striated musculature and specific, high-level expression of the therapeutic gene in a physiologically diverse array of muscles. This can be achieved by the use of recombinant adeno-associated virus vectors in conjunction with muscle-specific regulatory cassettes. We have constructed several generations of regulatory cassettes based on the enhancer and promoter of the muscle creatine kinase gene, some of which include heterologous enhancers and individual elements from other muscle genes. Since the relative importance of many control elements varies among different anatomical muscles, we are aiming to tailor these cassettes for high-level expression in cardiac muscle, and in fast and slow skeletal muscles. With the achievement of efficient intravascular gene delivery to isolated limbs, selected muscle groups, and heart in large animal models, the design of cassettes optimized for activity in different muscle types is now a practical goal. In this protocol, we outline the key steps involved in the design of regulatory cassettes for optimal activity in skeletal and cardiac muscle, and testing in mature muscle fiber cultures. The basic principles described here can also be applied to engineering tissue-specific regulatory cassettes for other cell types.

A parallel optimization method for product configuration and supplier selection based on interval

NASA Astrophysics Data System (ADS)

Zheng, Jian; Zhang, Meng; Li, Guoxi

2017-06-01

In the process of design and manufacturing, product configuration is an important way of product development, and supplier selection is an essential component of supply chain management. To reduce the risk of procurement and maximize the profits of enterprises, this study proposes to combine the product configuration and supplier selection, and express the multiple uncertainties as interval numbers. An integrated optimization model of interval product configuration and supplier selection was established, and NSGA-II was put forward to locate the Pareto-optimal solutions to the interval multiobjective optimization model.

Low Complexity Models to improve Incomplete Sensitivities for Shape Optimization

NASA Astrophysics Data System (ADS)

Stanciu, Mugurel; Mohammadi, Bijan; Moreau, Stéphane

2003-01-01

The present global platform for simulation and design of multi-model configurations treat shape optimization problems in aerodynamics. Flow solvers are coupled with optimization algorithms based on CAD-free and CAD-connected frameworks. Newton methods together with incomplete expressions of gradients are used. Such incomplete sensitivities are improved using reduced models based on physical assumptions. The validity and the application of this approach in real-life problems are presented. The numerical examples concern shape optimization for an airfoil, a business jet and a car engine cooling axial fan.

Optimizing heat shock protein expression induced by prostate cancer laser therapy through predictive computational models

NASA Astrophysics Data System (ADS)

Rylander, Marissa N.; Feng, Yusheng; Zhang, Yongjie; Bass, Jon; Stafford, Roger J.; Hazle, John D.; Diller, Kenneth R.

2006-07-01

Thermal therapy efficacy can be diminished due to heat shock protein (HSP) induction in regions of a tumor where temperatures are insufficient to coagulate proteins. HSP expression enhances tumor cell viability and imparts resistance to chemotherapy and radiation treatments, which are generally employed in conjunction with hyperthermia. Therefore, an understanding of the thermally induced HSP expression within the targeted tumor must be incorporated into the treatment plan to optimize the thermal dose delivery and permit prediction of the overall tissue response. A treatment planning computational model capable of predicting the temperature, HSP27 and HSP70 expression, and damage fraction distributions associated with laser heating in healthy prostate tissue and tumors is presented. Measured thermally induced HSP27 and HSP70 expression kinetics and injury data for normal and cancerous prostate cells and prostate tumors are employed to create the first HSP expression predictive model and formulate an Arrhenius damage model. The correlation coefficients between measured and model predicted temperature, HSP27, and HSP70 were 0.98, 0.99, and 0.99, respectively, confirming the accuracy of the model. Utilization of the treatment planning model in the design of prostate cancer thermal therapies can enable optimization of the treatment outcome by controlling HSP expression and injury.

Integrated cell and process engineering for improved transient production of a "difficult-to-express" fusion protein by CHO cells.

PubMed

Johari, Yusuf B; Estes, Scott D; Alves, Christina S; Sinacore, Marty S; James, David C

2015-12-01

Based on an optimized electroporation protocol, we designed a rapid, milliliter-scale diagnostic transient production assay to identify limitations in the ability of Chinese hamster ovary (CHO) cells to produce a model "difficult-to-express" homodimeric Fc-fusion protein, Sp35Fc, that exhibited very low volumetric titer and intracellular formation of disulfide-bonded oligomeric aggregates post-transfection. As expression of Sp35Fc induced an unfolded protein response in transfected host cells, we utilized the transient assay to compare, in parallel, multiple functionally diverse strategies to engineer intracellular processing of Sp35Fc in order to increase production and reduce aggregation as two discrete design objectives. Specifically, we compared the effect of (i) co-expression of ER-resident molecular chaperones (BiP, PDI, CypB) or active forms of UPR transactivators (ATF6c, XBP1s) at varying recombinant gene load, (ii) addition of small molecules known to act as chemical chaperones (PBA, DMSO, glycerol, betaine, TMAO) or modulate UPR signaling (PERK inhibitor GSK2606414) at varying concentration, (iii) a reduction in culture temperature to 32°C. Using this information, we designed a biphasic, Sp35Fc-specific transient manufacturing process mediated by lipofection that utilized CypB co-expression at an optimal Sp35Fc:CypB gene ratio of 5:1 to initially maximize transfected cell proliferation, followed by addition of a combination of PBA (0.5 mM) and glycerol (1% v/v) at the onset of stationary phase to maximize cell specific production and eliminate Sp35Fc aggregation. Using this optimal, engineered process transient Sp35Fc production was significantly increased sixfold over a 12 day production process with no evidence of disulfide-bonded aggregates. Finally, transient production in clonally derived sub-populations (derived from parental CHO host) screened for a heritably improved capability to produce Sp35Fc was also significantly improved by the optimized process, showing that protein-specific cell/process engineering can provide a solution that exceeds the limits of genetic/functional diversity within heterogeneous host cell populations. . © 2015 Wiley Periodicals, Inc.

Synthetic biology: tools to design microbes for the production of chemicals and fuels.

PubMed

Seo, Sang Woo; Yang, Jina; Min, Byung Eun; Jang, Sungho; Lim, Jae Hyung; Lim, Hyun Gyu; Kim, Seong Cheol; Kim, Se Yeon; Jeong, Jun Hong; Jung, Gyoo Yeol

2013-11-01

The engineering of biological systems to achieve specific purposes requires design tools that function in a predictable and quantitative manner. Recent advances in the field of synthetic biology, particularly in the programmable control of gene expression at multiple levels of regulation, have increased our ability to efficiently design and optimize biological systems to perform designed tasks. Furthermore, implementation of these designs in biological systems highlights the potential of using these tools to build microbial cell factories for the production of chemicals and fuels. In this paper, we review current developments in the design of tools for controlling gene expression at transcriptional, post-transcriptional and post-translational levels, and consider potential applications of these tools. Copyright © 2013 Elsevier Inc. All rights reserved.

Variable Complexity Structural Optimization of Shells

NASA Technical Reports Server (NTRS)

Haftka, Raphael T.; Venkataraman, Satchi

1999-01-01

Structural designers today face both opportunities and challenges in a vast array of available analysis and optimization programs. Some programs such as NASTRAN, are very general, permitting the designer to model any structure, to any degree of accuracy, but often at a higher computational cost. Additionally, such general procedures often do not allow easy implementation of all constraints of interest to the designer. Other programs, based on algebraic expressions used by designers one generation ago, have limited applicability for general structures with modem materials. However, when applicable, they provide easy understanding of design decisions trade-off. Finally, designers can also use specialized programs suitable for designing efficiently a subset of structural problems. For example, PASCO and PANDA2 are panel design codes, which calculate response and estimate failure much more efficiently than general-purpose codes, but are narrowly applicable in terms of geometry and loading. Therefore, the problem of optimizing structures based on simultaneous use of several models and computer programs is a subject of considerable interest. The problem of using several levels of models in optimization has been dubbed variable complexity modeling. Work under NASA grant NAG1-2110 has been concerned with the development of variable complexity modeling strategies with special emphasis on response surface techniques. In addition, several modeling issues for the design of shells of revolution were studied.

Variable Complexity Structural Optimization of Shells

NASA Technical Reports Server (NTRS)

Haftka, Raphael T.; Venkataraman, Satchi

1998-01-01

Structural designers today face both opportunities and challenges in a vast array of available analysis and optimization programs. Some programs such as NASTRAN, are very general, permitting the designer to model any structure, to any degree of accuracy, but often at a higher computational cost. Additionally, such general procedures often do not allow easy implementation of all constraints of interest to the designer. Other programs, based on algebraic expressions used by designers one generation ago, have limited applicability for general structures with modem materials. However, when applicable, they provide easy understanding of design decisions trade-off. Finally, designers can also use specialized programs suitable for designing efficiently a subset of structural problems. For example, PASCO and PANDA2 are panel design codes, which calculate response and estimate failure much more efficiently than general-purpose codes, but are narrowly applicable in terms of geometry and loading. Therefore, the problem of optimizing structures based on simultaneous use of several models and computer programs is a subject of considerable interest. The problem of using several levels of models in optimization has been dubbed variable complexity modeling. Work under NASA grant NAG1-1808 has been concerned with the development of variable complexity modeling strategies with special emphasis on response surface techniques. In addition several modeling issues for the design of shells of revolution were studied.

Optimization of flexible wing structures subject to strength and induced drag constraints

NASA Technical Reports Server (NTRS)

Haftka, R. T.

1977-01-01

An optimization procedure for designing wing structures subject to stress, strain, and drag constraints is presented. The optimization method utilizes an extended penalty function formulation for converting the constrained problem into a series of unconstrained ones. Newton's method is used to solve the unconstrained problems. An iterative analysis procedure is used to obtain the displacements of the wing structure including the effects of load redistribution due to the flexibility of the structure. The induced drag is calculated from the lift distribution. Approximate expressions for the constraints used during major portions of the optimization process enhance the efficiency of the procedure. A typical fighter wing is used to demonstrate the procedure. Aluminum and composite material designs are obtained. The tradeoff between weight savings and drag reduction is investigated.

Controller design for wind turbine load reduction via multiobjective parameter synthesis

NASA Astrophysics Data System (ADS)

Hoffmann, A. F.; Weiβ, F. A.

2016-09-01

During the design process for a wind turbine load reduction controller many different, sometimes conflicting requirements must be fulfilled simultaneously. If the requirements can be expressed as mathematical criteria, such a design problem can be solved by a criterion-vector and multi-objective design optimization. The software environment MOPS (Multi-Objective Parameter Synthesis) supports the engineer for such a design optimization. In this paper MOPS is applied to design a multi-objective load reduction controller for the well-known DTU 10 MW reference wind turbine. A significant reduction in the fatigue criteria especially the blade damage can be reached by the use of an additional Individual Pitch Controller (IPC) and an additional tower damper. This reduction is reached as a trade-off with an increase of actuator load.

A Novel Method to Predict Highly Expressed Genes Based on Radius Clustering and Relative Synonymous Codon Usage.

PubMed

Tran, Tuan-Anh; Vo, Nam Tri; Nguyen, Hoang Duc; Pham, Bao The

2015-12-01

Recombinant proteins play an important role in many aspects of life and have generated a huge income, notably in the industrial enzyme business. A gene is introduced into a vector and expressed in a host organism-for example, E. coli-to obtain a high productivity of target protein. However, transferred genes from particular organisms are not usually compatible with the host's expression system because of various reasons, for example, codon usage bias, GC content, repetitive sequences, and secondary structure. The solution is developing programs to optimize for designing a nucleotide sequence whose origin is from peptide sequences using properties of highly expressed genes (HEGs) of the host organism. Existing data of HEGs determined by practical and computer-based methods do not satisfy for qualifying and quantifying. Therefore, the demand for developing a new HEG prediction method is critical. We proposed a new method for predicting HEGs and criteria to evaluate gene optimization. Codon usage bias was weighted by amplifying the difference between HEGs and non-highly expressed genes (non-HEGs). The number of predicted HEGs is 5% of the genome. In comparison with Puigbò's method, the result is twice as good as Puigbò's one, in kernel ratio and kernel sensitivity. Concerning transcription/translation factor proteins (TF), the proposed method gives low TF sensitivity, while Puigbò's method gives moderate one. In summary, the results indicated that the proposed method can be a good optional applying method to predict optimized genes for particular organisms, and we generated an HEG database for further researches in gene design.

Recombinant expression, purification, and crystallization of the glutaminyl-tRNA synthetase from Toxoplasma gondii.

PubMed

van Rooyen, Jason M; Hakimi, Mohamed-Ali; Belrhali, Hassan

2015-06-01

Aminoacyl tRNA synthetases play a critical role in protein synthesis by providing precursor transfer-RNA molecules correctly charged with their cognate amino-acids. The essential nature of these enzymes make them attractive targets for designing new drugs against important pathogenic protozoans like Toxoplasma. Because no structural data currently exists for a protozoan glutaminyl-tRNA synthetase (QRS), an understanding of its potential as a drug target and its function in the assembly of the Toxoplasma multi-aminoacyl tRNA (MARS) complex is therefore lacking. Here we describe the optimization of expression and purification conditions that permitted the recovery and crystallization of both domains of the Toxoplasma QRS enzyme from a heterologous Escherichia coli expression system. Expression of full-length QRS was only achieved after the addition of an N-terminal histidine affinity tag and the isolated protein was active on both cellular and in vitro produced Toxoplasma tRNA. Taking advantage of the proteolytic susceptibility of QRS to cleavage into component domains, N-terminal glutathione S-transferase (GST) motif-containing domain fragments were isolated and crystallization conditions discovered. Isolation of the C-terminal catalytic domain was accomplished after subcloning the domain and optimizing expression conditions. Purified catalytic domain survived cryogenic storage and yielded large diffraction-quality crystals over-night after optimization of screening conditions. This work will form the basis of future structural studies into structural-functional relationships of both domains including potential targeted drug-design studies and investigations into the assembly of the Toxoplasma MARS complex. Copyright © 2015 Elsevier Inc. All rights reserved.

Asymptotic Linearity of Optimal Control Modification Adaptive Law with Analytical Stability Margins

NASA Technical Reports Server (NTRS)

Nguyen, Nhan T.

2010-01-01

Optimal control modification has been developed to improve robustness to model-reference adaptive control. For systems with linear matched uncertainty, optimal control modification adaptive law can be shown by a singular perturbation argument to possess an outer solution that exhibits a linear asymptotic property. Analytical expressions of phase and time delay margins for the outer solution can be obtained. Using the gradient projection operator, a free design parameter of the adaptive law can be selected to satisfy stability margins.

Optimization and analysis of large chemical kinetic mechanisms using the solution mapping method - Combustion of methane

NASA Technical Reports Server (NTRS)

Frenklach, Michael; Wang, Hai; Rabinowitz, Martin J.

1992-01-01

A method of systematic optimization, solution mapping, as applied to a large-scale dynamic model is presented. The basis of the technique is parameterization of model responses in terms of model parameters by simple algebraic expressions. These expressions are obtained by computer experiments arranged in a factorial design. The developed parameterized responses are then used in a joint multiparameter multidata-set optimization. A brief review of the mathematical background of the technique is given. The concept of active parameters is discussed. The technique is applied to determine an optimum set of parameters for a methane combustion mechanism. Five independent responses - comprising ignition delay times, pre-ignition methyl radical concentration profiles, and laminar premixed flame velocities - were optimized with respect to thirteen reaction rate parameters. The numerical predictions of the optimized model are compared to those computed with several recent literature mechanisms. The utility of the solution mapping technique in situations where the optimum is not unique is also demonstrated.

Variational Trajectory Optimization Tool Set: Technical description and user's manual

NASA Technical Reports Server (NTRS)

Bless, Robert R.; Queen, Eric M.; Cavanaugh, Michael D.; Wetzel, Todd A.; Moerder, Daniel D.

1993-01-01

The algorithms that comprise the Variational Trajectory Optimization Tool Set (VTOTS) package are briefly described. The VTOTS is a software package for solving nonlinear constrained optimal control problems from a wide range of engineering and scientific disciplines. The VTOTS package was specifically designed to minimize the amount of user programming; in fact, for problems that may be expressed in terms of analytical functions, the user needs only to define the problem in terms of symbolic variables. This version of the VTOTS does not support tabular data; thus, problems must be expressed in terms of analytical functions. The VTOTS package consists of two methods for solving nonlinear optimal control problems: a time-domain finite-element algorithm and a multiple shooting algorithm. These two algorithms, under the VTOTS package, may be run independently or jointly. The finite-element algorithm generates approximate solutions, whereas the shooting algorithm provides a more accurate solution to the optimization problem. A user's manual, some examples with results, and a brief description of the individual subroutines are included.

Best practices for hybridization design in two-colour microarray analysis.

PubMed

Knapen, Dries; Vergauwen, Lucia; Laukens, Kris; Blust, Ronny

2009-07-01

Two-colour microarrays are a popular platform of choice in gene expression studies. Because two different samples are hybridized on a single microarray, and several microarrays are usually needed in a given experiment, there are many possible ways to combine samples on different microarrays. The actual combination employed is commonly referred to as the 'hybridization design'. Different types of hybridization designs have been developed, all aimed at optimizing the experimental setup for the detection of differentially expressed genes while coping with technical noise. Here, we first provide an overview of the different classes of hybridization designs, discussing their advantages and limitations, and then we illustrate the current trends in the use of different hybridization design types in contemporary research.

An expert system for integrated structural analysis and design optimization for aerospace structures

NASA Technical Reports Server (NTRS)

1992-01-01

The results of a research study on the development of an expert system for integrated structural analysis and design optimization is presented. An Object Representation Language (ORL) was developed first in conjunction with a rule-based system. This ORL/AI shell was then used to develop expert systems to provide assistance with a variety of structural analysis and design optimization tasks, in conjunction with procedural modules for finite element structural analysis and design optimization. The main goal of the research study was to provide expertise, judgment, and reasoning capabilities in the aerospace structural design process. This will allow engineers performing structural analysis and design, even without extensive experience in the field, to develop error-free, efficient and reliable structural designs very rapidly and cost-effectively. This would not only improve the productivity of design engineers and analysts, but also significantly reduce time to completion of structural design. An extensive literature survey in the field of structural analysis, design optimization, artificial intelligence, and database management systems and their application to the structural design process was first performed. A feasibility study was then performed, and the architecture and the conceptual design for the integrated 'intelligent' structural analysis and design optimization software was then developed. An Object Representation Language (ORL), in conjunction with a rule-based system, was then developed using C++. Such an approach would improve the expressiveness for knowledge representation (especially for structural analysis and design applications), provide ability to build very large and practical expert systems, and provide an efficient way for storing knowledge. Functional specifications for the expert systems were then developed. The ORL/AI shell was then used to develop a variety of modules of expert systems for a variety of modeling, finite element analysis, and design optimization tasks in the integrated aerospace structural design process. These expert systems were developed to work in conjunction with procedural finite element structural analysis and design optimization modules (developed in-house at SAT, Inc.). The complete software, AutoDesign, so developed, can be used for integrated 'intelligent' structural analysis and design optimization. The software was beta-tested at a variety of companies, used by a range of engineers with different levels of background and expertise. Based on the feedback obtained by such users, conclusions were developed and are provided.

An expert system for integrated structural analysis and design optimization for aerospace structures

NASA Astrophysics Data System (ADS)

1992-04-01

The results of a research study on the development of an expert system for integrated structural analysis and design optimization is presented. An Object Representation Language (ORL) was developed first in conjunction with a rule-based system. This ORL/AI shell was then used to develop expert systems to provide assistance with a variety of structural analysis and design optimization tasks, in conjunction with procedural modules for finite element structural analysis and design optimization. The main goal of the research study was to provide expertise, judgment, and reasoning capabilities in the aerospace structural design process. This will allow engineers performing structural analysis and design, even without extensive experience in the field, to develop error-free, efficient and reliable structural designs very rapidly and cost-effectively. This would not only improve the productivity of design engineers and analysts, but also significantly reduce time to completion of structural design. An extensive literature survey in the field of structural analysis, design optimization, artificial intelligence, and database management systems and their application to the structural design process was first performed. A feasibility study was then performed, and the architecture and the conceptual design for the integrated 'intelligent' structural analysis and design optimization software was then developed. An Object Representation Language (ORL), in conjunction with a rule-based system, was then developed using C++. Such an approach would improve the expressiveness for knowledge representation (especially for structural analysis and design applications), provide ability to build very large and practical expert systems, and provide an efficient way for storing knowledge. Functional specifications for the expert systems were then developed. The ORL/AI shell was then used to develop a variety of modules of expert systems for a variety of modeling, finite element analysis, and design optimization tasks in the integrated aerospace structural design process. These expert systems were developed to work in conjunction with procedural finite element structural analysis and design optimization modules (developed in-house at SAT, Inc.). The complete software, AutoDesign, so developed, can be used for integrated 'intelligent' structural analysis and design optimization. The software was beta-tested at a variety of companies, used by a range of engineers with different levels of background and expertise. Based on the feedback obtained by such users, conclusions were developed and are provided.

A differentiable reformulation for E-optimal design of experiments in nonlinear dynamic biosystems.

PubMed

Telen, Dries; Van Riet, Nick; Logist, Flip; Van Impe, Jan

2015-06-01

Informative experiments are highly valuable for estimating parameters in nonlinear dynamic bioprocesses. Techniques for optimal experiment design ensure the systematic design of such informative experiments. The E-criterion which can be used as objective function in optimal experiment design requires the maximization of the smallest eigenvalue of the Fisher information matrix. However, one problem with the minimal eigenvalue function is that it can be nondifferentiable. In addition, no closed form expression exists for the computation of eigenvalues of a matrix larger than a 4 by 4 one. As eigenvalues are normally computed with iterative methods, state-of-the-art optimal control solvers are not able to exploit automatic differentiation to compute the derivatives with respect to the decision variables. In the current paper a reformulation strategy from the field of convex optimization is suggested to circumvent these difficulties. This reformulation requires the inclusion of a matrix inequality constraint involving positive semidefiniteness. In this paper, this positive semidefiniteness constraint is imposed via Sylverster's criterion. As a result the maximization of the minimum eigenvalue function can be formulated in standard optimal control solvers through the addition of nonlinear constraints. The presented methodology is successfully illustrated with a case study from the field of predictive microbiology. Copyright © 2015. Published by Elsevier Inc.

A synthetic biology approach to the development of transcriptional regulatory models and custom enhancer design☆,☆☆

PubMed Central

Martinez, Carlos A.; Barr, Kenneth; Kim, Ah-Ram; Reinitz, John

2013-01-01

Synthetic biology offers novel opportunities for elucidating transcriptional regulatory mechanisms and enhancer logic. Complex cis-regulatory sequences—like the ones driving expression of the Drosophila even-skipped gene—have proven difficult to design from existing knowledge, presumably due to the large number of protein-protein interactions needed to drive the correct expression patterns of genes in multicellular organisms. This work discusses two novel computational methods for the custom design of enhancers that employ a sophisticated, empirically validated transcriptional model, optimization algorithms, and synthetic biology. These synthetic elements have both utilitarian and academic value, including improving existing regulatory models as well as evolutionary questions. The first method involves the use of simulated annealing to explore the sequence space for synthetic enhancers whose expression output fit a given search criterion. The second method uses a novel optimization algorithm to find functionally accessible pathways between two enhancer sequences. These paths describe a set of mutations wherein the predicted expression pattern does not significantly vary at any point along the path. Both methods rely on a predictive mathematical framework that maps the enhancer sequence space to functional output. PMID:23732772

Gene Architectures that Minimize Cost of Gene Expression.

PubMed

Frumkin, Idan; Schirman, Dvir; Rotman, Aviv; Li, Fangfei; Zahavi, Liron; Mordret, Ernest; Asraf, Omer; Wu, Song; Levy, Sasha F; Pilpel, Yitzhak

2017-01-05

Gene expression burdens cells by consuming resources and energy. While numerous studies have investigated regulation of expression level, little is known about gene design elements that govern expression costs. Here, we ask how cells minimize production costs while maintaining a given protein expression level and whether there are gene architectures that optimize this process. We measured fitness of ∼14,000 E. coli strains, each expressing a reporter gene with a unique 5' architecture. By comparing cost-effective and ineffective architectures, we found that cost per protein molecule could be minimized by lowering transcription levels, regulating translation speeds, and utilizing amino acids that are cheap to synthesize and that are less hydrophobic. We then examined natural E. coli genes and found that highly expressed genes have evolved more forcefully to minimize costs associated with their expression. Our study thus elucidates gene design elements that improve the economy of protein expression in natural and heterologous systems. Copyright © 2017 Elsevier Inc. All rights reserved.

Passive designs and renewable energy systems optimization of a net zero energy building in Embrun/France

NASA Astrophysics Data System (ADS)

Harkouss, F.; Biwole, P. H.; Fardoun, F.

2018-05-01

Buildings’ optimization is a smart method to inspect the available design choices starting from passive strategies, to energy efficient systems and finally towards the adequate renewable energy system to be implemented. This paper outlines the methodology and the cost-effectiveness potential for optimizing the design of net-zero energy building in a French city; Embrun. The non-dominated sorting genetic algorithm is chosen in order to minimize thermal, electrical demands and life cycle cost while reaching the net zero energy balance; and thus getting the Pareto-front. Elimination and Choice Expressing the Reality decision making method is applied to the Pareto-front so as to obtain one optimal solution. A wide range of energy efficiency measures are investigated, besides solar energy systems are employed to produce required electricity and hot water for domestic purposes. The results indicate that the appropriate selection of the passive parameters is very important and critical in reducing the building energy consumption. The optimum design parameters yield to a decrease of building’s thermal loads and life cycle cost by 32.96% and 14.47% respectively.

An Algorithm for the Mixed Transportation Network Design Problem

PubMed Central

Liu, Xinyu; Chen, Qun

2016-01-01

This paper proposes an optimization algorithm, the dimension-down iterative algorithm (DDIA), for solving a mixed transportation network design problem (MNDP), which is generally expressed as a mathematical programming with equilibrium constraint (MPEC). The upper level of the MNDP aims to optimize the network performance via both the expansion of the existing links and the addition of new candidate links, whereas the lower level is a traditional Wardrop user equilibrium (UE) problem. The idea of the proposed solution algorithm (DDIA) is to reduce the dimensions of the problem. A group of variables (discrete/continuous) is fixed to optimize another group of variables (continuous/discrete) alternately; then, the problem is transformed into solving a series of CNDPs (continuous network design problems) and DNDPs (discrete network design problems) repeatedly until the problem converges to the optimal solution. The advantage of the proposed algorithm is that its solution process is very simple and easy to apply. Numerical examples show that for the MNDP without budget constraint, the optimal solution can be found within a few iterations with DDIA. For the MNDP with budget constraint, however, the result depends on the selection of initial values, which leads to different optimal solutions (i.e., different local optimal solutions). Some thoughts are given on how to derive meaningful initial values, such as by considering the budgets of new and reconstruction projects separately. PMID:27626803

Optimization of a chondrogenic medium through the use of factorial design of experiments.

PubMed

Enochson, Lars; Brittberg, Mats; Lindahl, Anders

2012-12-01

The standard culture system for in vitro cartilage research is based on cells in a three-dimensional micromass culture and a defined medium containing the chondrogenic key growth factor, transforming growth factor (TGF)-β1. The aim of this study was to optimize the medium for chondrocyte micromass culture. Human chondrocytes were cultured in different media formulations, designed with a factorial design of experiments (DoE) approach and based on the standard medium for redifferentiation. The significant factors for the redifferentiation of the chondrocytes were determined and optimized in a two-step process through the use of response surface methodology. TGF-β1, dexamethasone, and glucose were significant factors for differentiating the chondrocytes. Compared to the standard medium, TGF-β1 was increased 30%, dexamethasone reduced 50%, and glucose increased 22%. The potency of the optimized medium was validated in a comparative study against the standard medium. The optimized medium resulted in micromass cultures with increased expression of genes important for the articular chondrocyte phenotype and in cultures with increased glycosaminoglycan/DNA content. Optimizing the standard medium with the efficient DoE method, a new medium that gave better redifferentiation for articular chondrocytes was determined.

Approximate analytical relationships for linear optimal aeroelastic flight control laws

NASA Astrophysics Data System (ADS)

Kassem, Ayman Hamdy

1998-09-01

This dissertation introduces new methods to uncover functional relationships between design parameters of a contemporary control design technique and the resulting closed-loop properties. Three new methods are developed for generating such relationships through analytical expressions: the Direct Eigen-Based Technique, the Order of Magnitude Technique, and the Cost Function Imbedding Technique. Efforts concentrated on the linear-quadratic state-feedback control-design technique applied to an aeroelastic flight control task. For this specific application, simple and accurate analytical expressions for the closed-loop eigenvalues and zeros in terms of basic parameters such as stability and control derivatives, structural vibration damping and natural frequency, and cost function weights are generated. These expressions explicitly indicate how the weights augment the short period and aeroelastic modes, as well as the closed-loop zeros, and by what physical mechanism. The analytical expressions are used to address topics such as damping, nonminimum phase behavior, stability, and performance with robustness considerations, and design modifications. This type of knowledge is invaluable to the flight control designer and would be more difficult to formulate when obtained from numerical-based sensitivity analysis.

A level-set procedure for the design of electromagnetic metamaterials.

PubMed

Zhou, Shiwei; Li, Wei; Sun, Guangyong; Li, Qing

2010-03-29

Achieving negative permittivity and negative permeability signifies a key topic of research in the design of metamaterials. This paper introduces a level-set based topology optimization method, in which the interface between the vacuum and metal phases is implicitly expressed by the zero-level contour of a higher dimensional level-set function. Following a sensitivity analysis, the optimization maximizes the objective based on the normal direction of the level-set function and induced current flow, thereby generating the desirable patterns of current flow on metal surface. As a benchmark example, the U-shaped structure and its variations are obtained from the level-set topology optimization. Numerical examples demonstrate that both negative permittivity and negative permeability can be attained.

Gain optimization with non-linear controls

NASA Technical Reports Server (NTRS)

Slater, G. L.; Kandadai, R. D.

1984-01-01

An algorithm has been developed for the analysis and design of controls for non-linear systems. The technical approach is to use statistical linearization to model the non-linear dynamics of a system by a quasi-Gaussian model. A covariance analysis is performed to determine the behavior of the dynamical system and a quadratic cost function. Expressions for the cost function and its derivatives are determined so that numerical optimization techniques can be applied to determine optimal feedback laws. The primary application for this paper is centered about the design of controls for nominally linear systems but where the controls are saturated or limited by fixed constraints. The analysis is general, however, and numerical computation requires only that the specific non-linearity be considered in the analysis.

In vitro DNA SCRaMbLE.

PubMed

Wu, Yi; Zhu, Rui-Ying; Mitchell, Leslie A; Ma, Lu; Liu, Rui; Zhao, Meng; Jia, Bin; Xu, Hui; Li, Yun-Xiang; Yang, Zu-Ming; Ma, Yuan; Li, Xia; Liu, Hong; Liu, Duo; Xiao, Wen-Hai; Zhou, Xiao; Li, Bing-Zhi; Yuan, Ying-Jin; Boeke, Jef D

2018-05-22

The power of synthetic biology has enabled the expression of heterologous pathways in cells, as well as genome-scale synthesis projects. The complexity of biological networks makes rational de novo design a grand challenge. Introducing features that confer genetic flexibility is a powerful strategy for downstream engineering. Here we develop an in vitro method of DNA library construction based on structural variation to accomplish this goal. The "in vitro SCRaMbLE system" uses Cre recombinase mixed in a test tube with purified DNA encoding multiple loxPsym sites. Using a β-carotene pathway designed for expression in yeast as an example, we demonstrate top-down and bottom-up in vitro SCRaMbLE, enabling optimization of biosynthetic pathway flux via the rearrangement of relevant transcription units. We show that our system provides a straightforward way to correlate phenotype and genotype and is potentially amenable to biochemical optimization in ways that the in vivo system cannot achieve.

CONSOLE: A CAD tandem for optimization-based design interacting with user-supplied simulators

NASA Technical Reports Server (NTRS)

Fan, Michael K. H.; Wang, Li-Sheng; Koninckx, Jan; Tits, Andre L.

1989-01-01

CONSOLE employs a recently developed design methodology (International Journal of Control 43:1693-1721) which provides the designer with a congenial environment to express his problem as a multiple ojective constrained optimization problem and allows him to refine his characterization of optimality when a suboptimal design is approached. To this end, in CONSOLE, the designed formulates the design problem using a high-level language and performs design task and explores tradeoff through a few short and clearly defined commands. The range of problems that can be solved efficiently using a CAD tools depends very much on the ability of this tool to be interfaced with user-supplied simulators. For instance, when designing a control system one makes use of the characteristics of the plant, and therefore, a model of the plant under study has to be made available to the CAD tool. CONSOLE allows for an easy interfacing of almost any simulator the user has available. To date CONSOLE has already been used successfully in many applications, including the design of controllers for a flexible arm and for a robotic manipulator and the solution of a parameter selection problem for a neural network.

Functionally Graded Designer Viscoelastic Materials Tailored to Perform Prescribed Tasks with Probabilistic Failures and Lifetimes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hilton, Harry H.

Protocols are developed for formulating optimal viscoelastic designer functionally graded materials tailored to best respond to prescribed loading and boundary conditions. In essence, an inverse approach is adopted where material properties instead of structures per se are designed and then distributed throughout structural elements. The final measure of viscoelastic material efficacy is expressed in terms of failure probabilities vs. survival time000.

Dynamic Decision Making under Uncertainty and Partial Information

DTIC Science & Technology

2013-11-14

integral under the natural filtration generated by the Brownian motions . This compact expression potentially enables us to design sub- optimal penalties...bounds on bermudan option price under jump diffusion processes. Quantitative Finance , 2013. Under review, available at http://arxiv.org/abs/1305.4321... Finance , 19:53 – 71, 2009. [3] D.P. Bertsekas. Dynamic Programming and Optimal Control. Athena Scientific, 4th edition, 2012. [4] D.B. Brown and J.E

Multi Objective Controller Design for Linear System via Optimal Interpolation

NASA Technical Reports Server (NTRS)

Ozbay, Hitay

1996-01-01

We propose a methodology for the design of a controller which satisfies a set of closed-loop objectives simultaneously. The set of objectives consists of: (1) pole placement, (2) decoupled command tracking of step inputs at steady-state, and (3) minimization of step response transients with respect to envelope specifications. We first obtain a characterization of all controllers placing the closed-loop poles in a prescribed region of the complex plane. In this characterization, the free parameter matrix Q(s) is to be determined to attain objectives (2) and (3). Objective (2) is expressed as determining a Pareto optimal solution to a vector valued optimization problem. The solution of this problem is obtained by transforming it to a scalar convex optimization problem. This solution determines Q(O) and the remaining freedom in choosing Q(s) is used to satisfy objective (3). We write Q(s) = (l/v(s))bar-Q(s) for a prescribed polynomial v(s). Bar-Q(s) is a polynomial matrix which is arbitrary except that Q(O) and the order of bar-Q(s) are fixed. Obeying these constraints bar-Q(s) is now to be 'shaped' to minimize the step response characteristics of specific input/output pairs according to the maximum envelope violations. This problem is expressed as a vector valued optimization problem using the concept of Pareto optimality. We then investigate a scalar optimization problem associated with this vector valued problem and show that it is convex. The organization of the report is as follows. The next section includes some definitions and preliminary lemmas. We then give the problem statement which is followed by a section including a detailed development of the design procedure. We then consider an aircraft control example. The last section gives some concluding remarks. The Appendix includes the proofs of technical lemmas, printouts of computer programs, and figures.

Computational design of a pH-sensitive IgG binding protein.

PubMed

Strauch, Eva-Maria; Fleishman, Sarel J; Baker, David

2014-01-14

Computational design provides the opportunity to program protein-protein interactions for desired applications. We used de novo protein interface design to generate a pH-dependent Fc domain binding protein that buries immunoglobulin G (IgG) His-433. Using next-generation sequencing of naïve and selected pools of a library of design variants, we generated a molecular footprint of the designed binding surface, confirming the binding mode and guiding further optimization of the balance between affinity and pH sensitivity. In biolayer interferometry experiments, the optimized design binds IgG with a Kd of ∼ 4 nM at pH 8.2, and approximately 500-fold more weakly at pH 5.5. The protein is extremely stable, heat-resistant and highly expressed in bacteria, and allows pH-based control of binding for IgG affinity purification and diagnostic devices.

Design of optimal hyperthermia protocols for prostate cancer by controlling HSP expression through computer modeling (Invited Paper)

NASA Astrophysics Data System (ADS)

Rylander, Marissa N.; Feng, Yusheng; Diller, Kenneth; Bass, J.

2005-04-01

Heat shock proteins (HSP) are critical components of a complex defense mechanism essential for preserving cell survival under adverse environmental conditions. It is inevitable that hyperthermia will enhance tumor tissue viability, due to HSP expression in regions where temperatures are insufficient to coagulate proteins, and would likely increase the probability of cancer recurrence. Although hyperthermia therapy is commonly used in conjunction with radiotherapy, chemotherapy, and gene therapy to increase therapeutic effectiveness, the efficacy of these therapies can be substantially hindered due to HSP expression when hyperthermia is applied prior to these procedures. Therefore, in planning hyperthermia protocols, prediction of the HSP response of the tumor must be incorporated into the treatment plan to optimize the thermal dose delivery and permit prediction of overall tissue response. In this paper, we present a highly accurate, adaptive, finite element tumor model capable of predicting the HSP expression distribution and tissue damage region based on measured cellular data when hyperthermia protocols are specified. Cubic spline representations of HSP27 and HSP70, and Arrhenius damage models were integrated into the finite element model to enable prediction of the HSP expression and damage distribution in the tissue following laser heating. Application of the model can enable optimized treatment planning by controlling of the tissue response to therapy based on accurate prediction of the HSP expression and cell damage distribution.

Optimum design of a Lanchester damper for a viscously damped single degree of freedom system subjected to inertial excitation

NASA Astrophysics Data System (ADS)

Bapat, V. A.; Prabhu, P.

1980-11-01

The problem of designing an optimum Lanchester damper for a viscously damped single degree of freedom system subjected to inertial harmonic excitation is investigated. Two criteria are used for optimizing the performance of the damper: (i) minimum motion transmissibility; (ii) minimum force transmissibility. Explicit expressions are developed for determining the absorber parameters.

An express method for optimally tuning an analog controller with respect to integral quality criteria

NASA Astrophysics Data System (ADS)

Golinko, I. M.; Kovrigo, Yu. M.; Kubrak, A. I.

2014-03-01

An express method for optimally tuning analog PI and PID controllers is considered. An integral quality criterion with minimizing the control output is proposed for optimizing control systems. The suggested criterion differs from existing ones in that the control output applied to the technological process is taken into account in a correct manner, due to which it becomes possible to maximally reduce the expenditure of material and/or energy resources in performing control of industrial equipment sets. With control organized in such manner, smaller wear and longer service life of control devices are achieved. A unimodal nature of the proposed criterion for optimally tuning a controller is numerically demonstrated using the methods of optimization theory. A functional interrelation between the optimal controller parameters and dynamic properties of a controlled plant is numerically determined for a single-loop control system. The results obtained from simulation of transients in a control system carried out using the proposed and existing functional dependences are compared with each other. The proposed calculation formulas differ from the existing ones by a simple structure and highly accurate search for the optimal controller tuning parameters. The obtained calculation formulas are recommended for being used by specialists in automation for design and optimization of control systems.

SynGenics Optimization System (SynOptSys)

NASA Technical Reports Server (NTRS)

Ventresca, Carol; McMilan, Michelle L.; Globus, Stephanie

2013-01-01

The SynGenics Optimization System (SynOptSys) software application optimizes a product with respect to multiple, competing criteria using statistical Design of Experiments, Response-Surface Methodology, and the Desirability Optimization Methodology. The user is not required to be skilled in the underlying math; thus, SynOptSys can help designers and product developers overcome the barriers that prevent them from using powerful techniques to develop better pro ducts in a less costly manner. SynOpt-Sys is applicable to the design of any product or process with multiple criteria to meet, and at least two factors that influence achievement of those criteria. The user begins with a selected solution principle or system concept and a set of criteria that needs to be satisfied. The criteria may be expressed in terms of documented desirements or defined responses that the future system needs to achieve. Documented desirements can be imported into SynOptSys or created and documented directly within SynOptSys. Subsequent steps include identifying factors, specifying model order for each response, designing the experiment, running the experiment and gathering the data, analyzing the results, and determining the specifications for the optimized system. The user may also enter textual information as the project progresses. Data is easily edited within SynOptSys, and the software design enables full traceability within any step in the process, and facilitates reporting as needed. SynOptSys is unique in the way responses are defined and the nuances of the goodness associated with changes in response values for each of the responses of interest. The Desirability Optimization Methodology provides the basis of this novel feature. Moreover, this is a complete, guided design and optimization process tool with embedded math that can remain invisible to the user. It is not a standalone statistical program; it is a design and optimization system.

Application of a statistical design to the optimization of parameters and culture medium for alpha-amylase production by Aspergillus oryzae CBS 819.72 grown on gruel (wheat grinding by-product).

PubMed

Kammoun, Radhouane; Naili, Belgacem; Bejar, Samir

2008-09-01

The production optimization of alpha-amylase (E.C.3.2.1.1) from Aspergillus oryzae CBS 819.72 fungus, using a by-product of wheat grinding (gruel) as sole carbon source, was performed with statistical methodology based on three experimental designs. The optimisation of temperature, agitation and inoculum size was attempted using a Box-Behnken design under the response surface methodology. The screening of nineteen nutrients for their influence on alpha-amylase production was achieved using a Plackett-Burman design. KH(2)PO(4), urea, glycerol, (NH(4))(2)SO(4), CoCl(2), casein hydrolysate, soybean meal hydrolysate, MgSO(4) were selected based on their positive influence on enzyme formation. The optimized nutrients concentration was obtained using a Taguchi experimental design and the analysis of the data predicts a theoretical increase in the alpha-amylase expression of 73.2% (from 40.1 to 151.1 U/ml). These conditions were validated experimentally and revealed an enhanced alpha-amylase yield of 72.7%.

The Center for Optimized Structural Studies (COSS) platform for automation in cloning, expression, and purification of single proteins and protein-protein complexes.

PubMed

Mlynek, Georg; Lehner, Anita; Neuhold, Jana; Leeb, Sarah; Kostan, Julius; Charnagalov, Alexej; Stolt-Bergner, Peggy; Djinović-Carugo, Kristina; Pinotsis, Nikos

2014-06-01

Expression in Escherichia coli represents the simplest and most cost effective means for the production of recombinant proteins. This is a routine task in structural biology and biochemistry where milligrams of the target protein are required in high purity and monodispersity. To achieve these criteria, the user often needs to screen several constructs in different expression and purification conditions in parallel. We describe a pipeline, implemented in the Center for Optimized Structural Studies, that enables the systematic screening of expression and purification conditions for recombinant proteins and relies on a series of logical decisions. We first use bioinformatics tools to design a series of protein fragments, which we clone in parallel, and subsequently screen in small scale for optimal expression and purification conditions. Based on a scoring system that assesses soluble expression, we then select the top ranking targets for large-scale purification. In the establishment of our pipeline, emphasis was put on streamlining the processes such that it can be easily but not necessarily automatized. In a typical run of about 2 weeks, we are able to prepare and perform small-scale expression screens for 20-100 different constructs followed by large-scale purification of at least 4-6 proteins. The major advantage of our approach is its flexibility, which allows for easy adoption, either partially or entirely, by any average hypothesis driven laboratory in a manual or robot-assisted manner.

Immunotherapy for B-Cell Neoplasms using T Cells expressing Chimeric Antigen Receptors

PubMed Central

Boulassel, Mohamed-Rachid; Galal, Ahmed

2012-01-01

Immunotherapy with T cells expressing chimeric antigen receptors (CAR) is being evaluated as a potential treatment for B-cell neoplasms. In recent clinical trials it has shown promising results. As the number of potential candidate antigens expands, the choice of suitable target antigens becomes more challenging to design studies and to assess optimal efficacy of CAR. Careful evaluation of candidate target antigens is required to ensure that T cells expressing CAR will preferentially kill malignant cells with a minimal toxicity against normal tissues. B cells express specific surface antigens that can theoretically act as targets for CAR design. Although many of these antigens can stimulate effective cellular immune responses in vivo, their implementation in clinical settings remains a challenge. Only targeted B-cell antigens CD19 and CD20 have been tested in clinical trials. This article reviews exploitable B cell surface antigens for CAR design and examines obstacles that could interfere with the identification of potentially useful cellular targets. PMID:23269948

A modular approach to large-scale design optimization of aerospace systems

NASA Astrophysics Data System (ADS)

Hwang, John T.

Gradient-based optimization and the adjoint method form a synergistic combination that enables the efficient solution of large-scale optimization problems. Though the gradient-based approach struggles with non-smooth or multi-modal problems, the capability to efficiently optimize up to tens of thousands of design variables provides a valuable design tool for exploring complex tradeoffs and finding unintuitive designs. However, the widespread adoption of gradient-based optimization is limited by the implementation challenges for computing derivatives efficiently and accurately, particularly in multidisciplinary and shape design problems. This thesis addresses these difficulties in two ways. First, to deal with the heterogeneity and integration challenges of multidisciplinary problems, this thesis presents a computational modeling framework that solves multidisciplinary systems and computes their derivatives in a semi-automated fashion. This framework is built upon a new mathematical formulation developed in this thesis that expresses any computational model as a system of algebraic equations and unifies all methods for computing derivatives using a single equation. The framework is applied to two engineering problems: the optimization of a nanosatellite with 7 disciplines and over 25,000 design variables; and simultaneous allocation and mission optimization for commercial aircraft involving 330 design variables, 12 of which are integer variables handled using the branch-and-bound method. In both cases, the framework makes large-scale optimization possible by reducing the implementation effort and code complexity. The second half of this thesis presents a differentiable parametrization of aircraft geometries and structures for high-fidelity shape optimization. Existing geometry parametrizations are not differentiable, or they are limited in the types of shape changes they allow. This is addressed by a novel parametrization that smoothly interpolates aircraft components, providing differentiability. An unstructured quadrilateral mesh generation algorithm is also developed to automate the creation of detailed meshes for aircraft structures, and a mesh convergence study is performed to verify that the quality of the mesh is maintained as it is refined. As a demonstration, high-fidelity aerostructural analysis is performed for two unconventional configurations with detailed structures included, and aerodynamic shape optimization is applied to the truss-braced wing, which finds and eliminates a shock in the region bounded by the struts and the wing.

Promoter library-based module combination (PLMC) technology for optimization of threonine biosynthesis in Corynebacterium glutamicum.

PubMed

Wei, Liang; Xu, Ning; Wang, Yiran; Zhou, Wei; Han, Guoqiang; Ma, Yanhe; Liu, Jun

2018-05-01

Due to the lack of efficient control elements and tools, the fine-tuning of gene expression in the multi-gene metabolic pathways is still a great challenge for engineering microbial cell factories, especially for the important industrial microorganism Corynebacterium glutamicum. In this study, the promoter library-based module combination (PLMC) technology was developed to efficiently optimize the expression of genes in C. glutamicum. A random promoter library was designed to contain the putative - 10 (NNTANANT) and - 35 (NNGNCN) consensus motifs, and refined through a three-step screening procedure to achieve numerous genetic control elements with different strength levels, including fluorescence-activated cell sorting (FACS) screening, agar plate screening, and 96-well plate screening. Multiple conventional strategies were employed for further precise characterizations of the promoter library, such as real-time quantitative PCR, sodium dodecyl sulfate polyacrylamide gel electrophoresis, FACS analysis, and the lacZ reporter system. These results suggested that the established promoter elements effectively regulated gene expression and showed varying strengths over a wide range. Subsequently, a multi-module combination technology was created based on the efficient promoter elements for combination and optimization of modules in the multi-gene pathways. Using this technology, the threonine biosynthesis pathway was reconstructed and optimized by predictable tuning expression of five modules in C. glutamicum. The threonine titer of the optimized strain was significantly improved to 12.8 g/L, an approximate 6.1-fold higher than that of the control strain. Overall, the PLMC technology presented in this study provides a rapid and effective method for combination and optimization of multi-gene pathways in C. glutamicum.

Digital robust control law synthesis using constrained optimization

NASA Technical Reports Server (NTRS)

Mukhopadhyay, Vivekananda

1989-01-01

Development of digital robust control laws for active control of high performance flexible aircraft and large space structures is a research area of significant practical importance. The flexible system is typically modeled by a large order state space system of equations in order to accurately represent the dynamics. The active control law must satisy multiple conflicting design requirements and maintain certain stability margins, yet should be simple enough to be implementable on an onboard digital computer. Described here is an application of a generic digital control law synthesis procedure for such a system, using optimal control theory and constrained optimization technique. A linear quadratic Gaussian type cost function is minimized by updating the free parameters of the digital control law, while trying to satisfy a set of constraints on the design loads, responses and stability margins. Analytical expressions for the gradients of the cost function and the constraints with respect to the control law design variables are used to facilitate rapid numerical convergence. These gradients can be used for sensitivity study and may be integrated into a simultaneous structure and control optimization scheme.

Dynamic facial expressions of emotion transmit an evolving hierarchy of signals over time.

PubMed

Jack, Rachael E; Garrod, Oliver G B; Schyns, Philippe G

2014-01-20

Designed by biological and social evolutionary pressures, facial expressions of emotion comprise specific facial movements to support a near-optimal system of signaling and decoding. Although highly dynamical, little is known about the form and function of facial expression temporal dynamics. Do facial expressions transmit diagnostic signals simultaneously to optimize categorization of the six classic emotions, or sequentially to support a more complex communication system of successive categorizations over time? Our data support the latter. Using a combination of perceptual expectation modeling, information theory, and Bayesian classifiers, we show that dynamic facial expressions of emotion transmit an evolving hierarchy of "biologically basic to socially specific" information over time. Early in the signaling dynamics, facial expressions systematically transmit few, biologically rooted face signals supporting the categorization of fewer elementary categories (e.g., approach/avoidance). Later transmissions comprise more complex signals that support categorization of a larger number of socially specific categories (i.e., the six classic emotions). Here, we show that dynamic facial expressions of emotion provide a sophisticated signaling system, questioning the widely accepted notion that emotion communication is comprised of six basic (i.e., psychologically irreducible) categories, and instead suggesting four. Copyright © 2014 Elsevier Ltd. All rights reserved.

Independent and high-level dual-gene expression in adult stem-progenitor cells from a single lentiviral vector.

PubMed

Tian, J; Andreadis, S T

2009-07-01

Expression of multiple genes from the same target cell is required in several technological and therapeutic applications such as quantitative measurements of promoter activity or in vivo tracking of stem cells. In spite of such need, reaching independent and high-level dual-gene expression cannot be reliably accomplished by current gene transfer vehicles. To address this issue, we designed a lentiviral vector carrying two transcriptional units separated by polyadenylation, terminator and insulator sequences. With this design, the expression level of both genes was as high as that yielded from lentiviral vectors containing only a single transcriptional unit. Similar results were observed with several promoters and cell types including epidermal keratinocytes, bone marrow mesenchymal stem cells and hair follicle stem cells. Notably, we demonstrated quantitative dynamic monitoring of gene expression in primary cells with no need for selection protocols suggesting that this optimized lentivirus may be useful in high-throughput gene expression profiling studies.

Multi-tasking arbitration and behaviour design for human-interactive robots

NASA Astrophysics Data System (ADS)

Kobayashi, Yuichi; Onishi, Masaki; Hosoe, Shigeyuki; Luo, Zhiwei

2013-05-01

Robots that interact with humans in household environments are required to handle multiple real-time tasks simultaneously, such as carrying objects, collision avoidance and conversation with human. This article presents a design framework for the control and recognition processes to meet these requirements taking into account stochastic human behaviour. The proposed design method first introduces a Petri net for synchronisation of multiple tasks. The Petri net formulation is converted to Markov decision processes and processed in an optimal control framework. Three tasks (safety confirmation, object conveyance and conversation) interact and are expressed by the Petri net. Using the proposed framework, tasks that normally tend to be designed by integrating many if-then rules can be designed in a systematic manner in a state estimation and optimisation framework from the viewpoint of the shortest time optimal control. The proposed arbitration method was verified by simulations and experiments using RI-MAN, which was developed for interactive tasks with humans.

High-level expression of a synthetic gene encoding a sweet protein, monellin, in Escherichia coli.

PubMed

Chen, Zhongjun; Cai, Heng; Lu, Fuping; Du, Lianxiang

2005-11-01

The expression of a synthetic gene encoding monellin, a sweet protein, in E. coli under the control of T7 promoter from phage is described. The single-chain monellin gene was designed based on the biased codons of E. coli so as to optimize its expression. Monellin was produced and accounted for 45% of total soluble proteins. It was purified to yield 43 mg protein per g dry cell wt. The purity of the recombinant protein was confirmed by SDS-PAGE.

Exploring metabolic engineering design principles for the photosynthetic production of lactic acid by Synechocystis sp. PCC6803

PubMed Central

2014-01-01

Background Molecular engineering of the intermediary physiology of cyanobacteria has become important for the sustainable production of biofuels and commodity compounds from CO2 and sunlight by “designer microbes.” The chemical commodity product L-lactic acid can be synthesized in one step from a key intermediary metabolite of these organisms, pyruvate, catalyzed by a lactate dehydrogenase. Synthetic biology engineering to make “designer microbes” includes the introduction and overexpression of the product-forming biochemical pathway. For further optimization of product formation, modifications in the surrounding biochemical network of intermediary metabolism have to be made. Results To improve light-driven L-lactic acid production from CO2, we explored several metabolic engineering design principles, using a previously engineered L-lactic acid producing mutant strain of Synechocystis sp. PCC6803 as the benchmark. These strategies included: (i) increasing the expression level of the relevant product-forming enzyme, lactate dehydrogenase (LDH), for example, via expression from a replicative plasmid; (ii) co-expression of a heterologous pyruvate kinase to increase the flux towards pyruvate; and (iii) knockdown of phosphoenolpyruvate carboxylase to decrease the flux through a competing pathway (from phosphoenolpyruvate to oxaloacetate). In addition, we tested selected lactate dehydrogenases, some of which were further optimized through site-directed mutagenesis to improve the enzyme’s affinity for the co-factor nicotinamide adenine dinucleotide phosphate (NADPH). The carbon partitioning between biomass and lactic acid was increased from about 5% to over 50% by strain optimization. Conclusion An efficient photosynthetic microbial cell factory will display a high rate and extent of conversion of substrate (CO2) into product (here: L-lactic acid). In the existing CO2-based cyanobacterial cell factories that have been described in the literature, by far most of the control over product formation resides in the genetically introduced fermentative pathway. Here we show that a strong promoter, in combination with increased gene expression, can take away a significant part of the control of this step in lactic acid production from CO2. Under these premises, modulation of the intracellular precursor, pyruvate, can significantly increase productivity. Additionally, production enhancement is achieved by protein engineering to increase co-factor specificity of the heterologously expressed LDH. PMID:24991233

New and improved tools and methods for enhanced biosynthesis of natural products in microorganisms.

PubMed

Wang, Zhiqing; Cirino, Patrick C

2016-12-01

Engineering efficient biosynthesis of natural products in microorganisms requires optimizing gene expression levels to balance metabolite flux distributions and to minimize accumulation of toxic intermediates. Such metabolic optimization is challenged with identifying the right gene targets, and then determining and achieving appropriate gene expression levels. After decades of having a relatively limited set of gene regulation tools available, metabolic engineers are recently enjoying an ever-growing repertoire of more precise and tunable gene expression platforms. Here we review recent applications of natural and designed transcriptional and translational regulatory machinery for engineering biosynthesis of natural products in microorganisms. Customized trans-acting RNAs (sgRNA, asRNA and sRNA), along with appropriate accessory proteins, are allowing for unparalleled tuning of gene expression. Meanwhile metabolite-responsive transcription factors and riboswitches have been implemented in strain screening and evolution, and in dynamic gene regulation. Further refinements and expansions on these platform technologies will circumvent many long-term obstacles in natural products biosynthesis. Copyright © 2016 Elsevier Ltd. All rights reserved.

Population Fisher information matrix and optimal design of discrete data responses in population pharmacodynamic experiments.

PubMed

Ogungbenro, Kayode; Aarons, Leon

2011-08-01

In the recent years, interest in the application of experimental design theory to population pharmacokinetic (PK) and pharmacodynamic (PD) experiments has increased. The aim is to improve the efficiency and the precision with which parameters are estimated during data analysis and sometimes to increase the power and reduce the sample size required for hypothesis testing. The population Fisher information matrix (PFIM) has been described for uniresponse and multiresponse population PK experiments for design evaluation and optimisation. Despite these developments and availability of tools for optimal design of population PK and PD experiments much of the effort has been focused on repeated continuous variable measurements with less work being done on repeated discrete type measurements. Discrete data arise mainly in PDs e.g. ordinal, nominal, dichotomous or count measurements. This paper implements expressions for the PFIM for repeated ordinal, dichotomous and count measurements based on analysis by a mixed-effects modelling technique. Three simulation studies were used to investigate the performance of the expressions. Example 1 is based on repeated dichotomous measurements, Example 2 is based on repeated count measurements and Example 3 is based on repeated ordinal measurements. Data simulated in MATLAB were analysed using NONMEM (Laplace method) and the glmmML package in R (Laplace and adaptive Gauss-Hermite quadrature methods). The results obtained for Examples 1 and 2 showed good agreement between the relative standard errors obtained using the PFIM and simulations. The results obtained for Example 3 showed the importance of sampling at the most informative time points. Implementation of these expressions will provide the opportunity for efficient design of population PD experiments that involve discrete type data through design evaluation and optimisation.

Diffractive variable beam splitter: optimal design.

PubMed

Borghi, R; Cincotti, G; Santarsiero, M

2000-01-01

The analytical expression of the phase profile of the optimum diffractive beam splitter with an arbitrary power ratio between the two output beams is derived. The phase function is obtained by an analytical optimization procedure such that the diffraction efficiency of the resulting optical element is the highest for an actual device. Comparisons are presented with the efficiency of a diffractive beam splitter specified by a sawtooth phase function and with the pertinent theoretical upper bound for this type of element.

Development and optimization of a new culture media using extruded bean as nitrogen source.

PubMed

Batista, Karla A; Fernandes, Kátia F

2015-01-01

The composition of a culture medium is one of the most important parameters to be analyzed in biotechnological processes with industrial purposes, because around 30-40% of the production costs were estimated to be accounted for the cost of the growth medium [1]. Since medium optimization using a one-factor-at-a-time approach is time-consuming, expensive, and often leads to misinterpretation of results, statistical experimental design has been applied to medium optimization for growth and metabolite production [2-5]. In this scenario, the use of mixture design to develop a culture medium containing a cheaper nitrogen source seems to be more appropriate and simple. In this sense, the focus of this work is to present a detailed description of the steps involved in the development of a optimized culture medium containing extruded bean as nitrogen source. •In a previous work we tested a development of new culture media based on the composition of YPD medium, aiming to reduce bioprocess costs as well as to improve the biomass production and heterologous expression.•The developed medium was tested for growth of Saccharomyces cerevisiae and Pichia pastoris (GS 115).•The use of culture media containing extruded bean as sole nitrogen source showed better biomass production and protein expression than those observed in the standard YPD medium.

A Recessive Pollination Control System for Wheat Based on Intein-Mediated Protein Splicing.

PubMed

Gils, Mario

2017-01-01

A transgene-expression system for wheat that relies on the complementation of inactive precursor protein fragments through a split-intein system is described. The N- and C-terminal fragments of a barnase gene from Bacillus amyloliquifaciens were fused to intein sequences from Synechocystis sp. and transformed into wheat plants. Upon translation, both barnase fragments are assembled by an autocatalytic intein-mediated trans-splicing reaction, thus forming a cytotoxic enzyme. This chapter focuses on the use of introns and flexible polypeptide linkers to foster the expression of a split-barnase expression system in plants. The methods and protocols that were employed with the objective to test the effects of such genetic elements on transgene expression and to find the optimal design of expression vectors for use in wheat are provided. Split-inteins can be used to form an agriculturally important trait (male sterility) in wheat plants. The use of this principle for the production of hybrid wheat seed is described. The suggested toolbox will hopefully be a valuable contribution to future optimization strategies in this commercially important crop.

Optimization of HTS superconducting magnetic energy storage magnet volume

NASA Astrophysics Data System (ADS)

Korpela, Aki; Lehtonen, Jorma; Mikkonen, Risto

2003-08-01

Nonlinear optimization problems in the field of electromagnetics have been successfully solved by means of sequential quadratic programming (SQP) and the finite element method (FEM). For example, the combination of SQP and FEM has been proven to be an efficient tool in the optimization of low temperature superconductors (LTS) superconducting magnetic energy storage (SMES) magnets. The procedure can also be applied for the optimization of HTS magnets. However, due to a strongly anisotropic material and a slanted electric field, current density characteristic high temperature superconductors HTS optimization is quite different from that of the LTS. In this paper the volumes of solenoidal conduction-cooled Bi-2223/Ag SMES magnets have been optimized at the operation temperature of 20 K. In addition to the electromagnetic constraints the stress caused by the tape bending has also been taken into account. Several optimization runs with different initial geometries were performed in order to find the best possible solution for a certain energy requirement. The optimization constraints describe the steady-state operation, thus the presented coil geometries are designed for slow ramping rates. Different energy requirements were investigated in order to find the energy dependence of the design parameters of optimized solenoidal HTS coils. According to the results, these dependences can be described with polynomial expressions.

Design, Construction and Cloning of Truncated ORF2 and tPAsp-PADRE-Truncated ORF2 Gene Cassette From Hepatitis E Virus in the pVAX1 Expression Vector

PubMed Central

Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza

2015-01-01

Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938

H∞ robust fault-tolerant controller design for an autonomous underwater vehicle's navigation control system

NASA Astrophysics Data System (ADS)

Cheng, Xiang-Qin; Qu, Jing-Yuan; Yan, Zhe-Ping; Bian, Xin-Qian

2010-03-01

In order to improve the security and reliability for autonomous underwater vehicle (AUV) navigation, an H∞ robust fault-tolerant controller was designed after analyzing variations in state-feedback gain. Operating conditions and the design method were then analyzed so that the control problem could be expressed as a mathematical optimization problem. This permitted the use of linear matrix inequalities (LMI) to solve for the H∞ controller for the system. When considering different actuator failures, these conditions were then also mathematically expressed, allowing the H∞ robust controller to solve for these events and thus be fault-tolerant. Finally, simulation results showed that the H∞ robust fault-tolerant controller could provide precise AUV navigation control with strong robustness.

Layout Design of Human-Machine Interaction Interface of Cabin Based on Cognitive Ergonomics and GA-ACA.

PubMed

Deng, Li; Wang, Guohua; Yu, Suihuai

2016-01-01

In order to consider the psychological cognitive characteristics affecting operating comfort and realize the automatic layout design, cognitive ergonomics and GA-ACA (genetic algorithm and ant colony algorithm) were introduced into the layout design of human-machine interaction interface. First, from the perspective of cognitive psychology, according to the information processing process, the cognitive model of human-machine interaction interface was established. Then, the human cognitive characteristics were analyzed, and the layout principles of human-machine interaction interface were summarized as the constraints in layout design. Again, the expression form of fitness function, pheromone, and heuristic information for the layout optimization of cabin was studied. The layout design model of human-machine interaction interface was established based on GA-ACA. At last, a layout design system was developed based on this model. For validation, the human-machine interaction interface layout design of drilling rig control room was taken as an example, and the optimization result showed the feasibility and effectiveness of the proposed method.

Layout Design of Human-Machine Interaction Interface of Cabin Based on Cognitive Ergonomics and GA-ACA

PubMed Central

Deng, Li; Wang, Guohua; Yu, Suihuai

2016-01-01

In order to consider the psychological cognitive characteristics affecting operating comfort and realize the automatic layout design, cognitive ergonomics and GA-ACA (genetic algorithm and ant colony algorithm) were introduced into the layout design of human-machine interaction interface. First, from the perspective of cognitive psychology, according to the information processing process, the cognitive model of human-machine interaction interface was established. Then, the human cognitive characteristics were analyzed, and the layout principles of human-machine interaction interface were summarized as the constraints in layout design. Again, the expression form of fitness function, pheromone, and heuristic information for the layout optimization of cabin was studied. The layout design model of human-machine interaction interface was established based on GA-ACA. At last, a layout design system was developed based on this model. For validation, the human-machine interaction interface layout design of drilling rig control room was taken as an example, and the optimization result showed the feasibility and effectiveness of the proposed method. PMID:26884745

Calibration Modeling Methodology to Optimize Performance for Low Range Applications

NASA Technical Reports Server (NTRS)

McCollum, Raymond A.; Commo, Sean A.; Parker, Peter A.

2010-01-01

Calibration is a vital process in characterizing the performance of an instrument in an application environment and seeks to obtain acceptable accuracy over the entire design range. Often, project requirements specify a maximum total measurement uncertainty, expressed as a percent of full-scale. However in some applications, we seek to obtain enhanced performance at the low range, therefore expressing the accuracy as a percent of reading should be considered as a modeling strategy. For example, it is common to desire to use a force balance in multiple facilities or regimes, often well below its designed full-scale capacity. This paper presents a general statistical methodology for optimizing calibration mathematical models based on a percent of reading accuracy requirement, which has broad application in all types of transducer applications where low range performance is required. A case study illustrates the proposed methodology for the Mars Entry Atmospheric Data System that employs seven strain-gage based pressure transducers mounted on the heatshield of the Mars Science Laboratory mission.

Large Scale Bacterial Colony Screening of Diversified FRET Biosensors

PubMed Central

Litzlbauer, Julia; Schifferer, Martina; Ng, David; Fabritius, Arne; Thestrup, Thomas; Griesbeck, Oliver

2015-01-01

Biosensors based on Förster Resonance Energy Transfer (FRET) between fluorescent protein mutants have started to revolutionize physiology and biochemistry. However, many types of FRET biosensors show relatively small FRET changes, making measurements with these probes challenging when used under sub-optimal experimental conditions. Thus, a major effort in the field currently lies in designing new optimization strategies for these types of sensors. Here we describe procedures for optimizing FRET changes by large scale screening of mutant biosensor libraries in bacterial colonies. We describe optimization of biosensor expression, permeabilization of bacteria, software tools for analysis, and screening conditions. The procedures reported here may help in improving FRET changes in multiple suitable classes of biosensors. PMID:26061878

Optimization of self-acting step thrust bearings for load capacity and stiffness.

NASA Technical Reports Server (NTRS)

Hamrock, B. J.

1972-01-01

Linearized analysis of a finite-width rectangular step thrust bearing. Dimensionless load capacity and stiffness are expressed in terms of a Fourier cosine series. The dimensionless load capacity and stiffness were found to be a function of the dimensionless bearing number, the pad length-to-width ratio, the film thickness ratio, the step location parameter, and the feed groove parameter. The equations obtained in the analysis were verified. The assumptions imposed were substantiated by comparing the results with an existing exact solution for the infinite width bearing. A digital computer program was developed which determines optimal bearing configuration for maximum load capacity or stiffness. Simple design curves are presented. Results are shown for both compressible and incompressible lubrication. Through a parameter transformation the results are directly usable in designing optimal step sector thrust bearings.

D-Optimal Experimental Design for Contaminant Source Identification

NASA Astrophysics Data System (ADS)

Sai Baba, A. K.; Alexanderian, A.

2016-12-01

Contaminant source identification seeks to estimate the release history of a conservative solute given point concentration measurements at some time after the release. This can be mathematically expressed as an inverse problem, with a linear observation operator or a parameter-to-observation map, which we tackle using a Bayesian approach. Acquisition of experimental data can be laborious and expensive. The goal is to control the experimental parameters - in our case, the sparsity of the sensors, to maximize the information gain subject to some physical or budget constraints. This is known as optimal experimental design (OED). D-optimal experimental design seeks to maximize the expected information gain, and has long been considered the gold standard in the statistics community. Our goal is to develop scalable methods for D-optimal experimental designs involving large-scale PDE constrained problems with high-dimensional parameter fields. A major challenge for the OED, is that a nonlinear optimization algorithm for the D-optimality criterion requires repeated evaluation of objective function and gradient involving the determinant of large and dense matrices - this cost can be prohibitively expensive for applications of interest. We propose novel randomized matrix techniques that bring down the computational costs of the objective function and gradient evaluations by several orders of magnitude compared to the naive approach. The effect of randomized estimators on the accuracy and the convergence of the optimization solver will be discussed. The features and benefits of our new approach will be demonstrated on a challenging model problem from contaminant source identification involving the inference of the initial condition from spatio-temporal observations in a time-dependent advection-diffusion problem.

On the design of classifiers for crop inventories

NASA Technical Reports Server (NTRS)

Heydorn, R. P.; Takacs, H. C.

1986-01-01

Crop proportion estimators that use classifications of satellite data to correct, in an additive way, a given estimate acquired from ground observations are discussed. A linear version of these estimators is optimal, in terms of minimum variance, when the regression of the ground observations onto the satellite observations in linear. When this regression is not linear, but the reverse regression (satellite observations onto ground observations) is linear, the estimator is suboptimal but still has certain appealing variance properties. In this paper expressions are derived for those regressions which relate the intercepts and slopes to conditional classification probabilities. These expressions are then used to discuss the question of classifier designs that can lead to low-variance crop proportion estimates. Variance expressions for these estimates in terms of classifier omission and commission errors are also derived.

Fuel-Efficient Descent and Landing Guidance Logic for a Safe Lunar Touchdown

NASA Technical Reports Server (NTRS)

Lee, Allan Y.

2011-01-01

The landing of a crewed lunar lander on the surface of the Moon will be the climax of any Moon mission. At touchdown, the landing mechanism must absorb the load imparted on the lander due to the vertical component of the lander's touchdown velocity. Also, a large horizontal velocity must be avoided because it could cause the lander to tip over, risking the life of the crew. To be conservative, the worst-case lander's touchdown velocity is always assumed in designing the landing mechanism, making it very heavy. Fuel-optimal guidance algorithms for soft planetary landing have been studied extensively. In most of these studies, the lander is constrained to touchdown with zero velocity. With bounds imposed on the magnitude of the engine thrust, the optimal control solutions typically have a "bang-bang" thrust profile: the thrust magnitude "bangs" instantaneously between its maximum and minimum magnitudes. But the descent engine might not be able to throttle between its extremes instantaneously. There is also a concern about the acceptability of "bang-bang" control to the crew. In our study, the optimal control of a lander is formulated with a cost function that penalizes both the touchdown velocity and the fuel cost of the descent engine. In this formulation, there is not a requirement to achieve a zero touchdown velocity. Only a touchdown velocity that is consistent with the capability of the landing gear design is required. Also, since the nominal throttle level for the terminal descent sub-phase is well below the peak engine thrust, no bound on the engine thrust is used in our formulated problem. Instead of bangbang type solution, the optimal thrust generated is a continuous function of time. With this formulation, we can easily derive analytical expressions for the optimal thrust vector, touchdown velocity components, and other system variables. These expressions provide insights into the "physics" of the optimal landing and terminal descent maneuver. These insights could help engineers to achieve a better "balance" between the conflicting needs of achieving a safe touchdown velocity, a low-weight landing mechanism, low engine fuel cost, and other design goals. In comparing the computed optimal control results with the preflight landing trajectory design of the Apollo-11 mission, we noted interesting similarities between the two missions.

Optimal bioprocess design through a gene regulatory network - growth kinetic hybrid model: Towards Replacing Monod kinetics.

PubMed

Tsipa, Argyro; Koutinas, Michalis; Usaku, Chonlatep; Mantalaris, Athanasios

2018-05-02

Currently, design and optimisation of biotechnological bioprocesses is performed either through exhaustive experimentation and/or with the use of empirical, unstructured growth kinetics models. Whereas, elaborate systems biology approaches have been recently explored, mixed-substrate utilisation is predominantly ignored despite its significance in enhancing bioprocess performance. Herein, bioprocess optimisation for an industrially-relevant bioremediation process involving a mixture of highly toxic substrates, m-xylene and toluene, was achieved through application of a novel experimental-modelling gene regulatory network - growth kinetic (GRN-GK) hybrid framework. The GRN model described the TOL and ortho-cleavage pathways in Pseudomonas putida mt-2 and captured the transcriptional kinetics expression patterns of the promoters. The GRN model informed the formulation of the growth kinetics model replacing the empirical and unstructured Monod kinetics. The GRN-GK framework's predictive capability and potential as a systematic optimal bioprocess design tool, was demonstrated by effectively predicting bioprocess performance, which was in agreement with experimental values, when compared to four commonly used models that deviated significantly from the experimental values. Significantly, a fed-batch biodegradation process was designed and optimised through the model-based control of TOL Pr promoter expression resulting in 61% and 60% enhanced pollutant removal and biomass formation, respectively, compared to the batch process. This provides strong evidence of model-based bioprocess optimisation at the gene level, rendering the GRN-GK framework as a novel and applicable approach to optimal bioprocess design. Finally, model analysis using global sensitivity analysis (GSA) suggests an alternative, systematic approach for model-driven strain modification for synthetic biology and metabolic engineering applications. Copyright © 2018. Published by Elsevier Inc.

Genome-Wide Tuning of Protein Expression Levels to Rapidly Engineer Microbial Traits.

PubMed

Freed, Emily F; Winkler, James D; Weiss, Sophie J; Garst, Andrew D; Mutalik, Vivek K; Arkin, Adam P; Knight, Rob; Gill, Ryan T

2015-11-20

The reliable engineering of biological systems requires quantitative mapping of predictable and context-independent expression over a broad range of protein expression levels. However, current techniques for modifying expression levels are cumbersome and are not amenable to high-throughput approaches. Here we present major improvements to current techniques through the design and construction of E. coli genome-wide libraries using synthetic DNA cassettes that can tune expression over a ∼10(4) range. The cassettes also contain molecular barcodes that are optimized for next-generation sequencing, enabling rapid and quantitative tracking of alleles that have the highest fitness advantage. We show these libraries can be used to determine which genes and expression levels confer greater fitness to E. coli under different growth conditions.

Analog design optimization methodology for ultralow-power circuits using intuitive inversion-level and saturation-level parameters

NASA Astrophysics Data System (ADS)

Eimori, Takahisa; Anami, Kenji; Yoshimatsu, Norifumi; Hasebe, Tetsuya; Murakami, Kazuaki

2014-01-01

A comprehensive design optimization methodology using intuitive nondimensional parameters of inversion-level and saturation-level is proposed, especially for ultralow-power, low-voltage, and high-performance analog circuits with mixed strong, moderate, and weak inversion metal-oxide-semiconductor transistor (MOST) operations. This methodology is based on the synthesized charge-based MOST model composed of Enz-Krummenacher-Vittoz (EKV) basic concepts and advanced-compact-model (ACM) physics-based equations. The key concept of this methodology is that all circuit and system characteristics are described as some multivariate functions of inversion-level parameters, where the inversion level is used as an independent variable representative of each MOST. The analog circuit design starts from the first step of inversion-level design using universal characteristics expressed by circuit currents and inversion-level parameters without process-dependent parameters, followed by the second step of foundry-process-dependent design and the last step of verification using saturation-level criteria. This methodology also paves the way to an intuitive and comprehensive design approach for many kinds of analog circuit specifications by optimization using inversion-level log-scale diagrams and saturation-level criteria. In this paper, we introduce an example of our design methodology for a two-stage Miller amplifier.

Establishment and validation for the theoretical model of the vehicle airbag

NASA Astrophysics Data System (ADS)

Zhang, Junyuan; Jin, Yang; Xie, Lizhe; Chen, Chao

2015-05-01

The current design and optimization of the occupant restraint system (ORS) are based on numerous actual tests and mathematic simulations. These two methods are overly time-consuming and complex for the concept design phase of the ORS, though they're quite effective and accurate. Therefore, a fast and directive method of the design and optimization is needed in the concept design phase of the ORS. Since the airbag system is a crucial part of the ORS, in this paper, a theoretical model for the vehicle airbag is established in order to clarify the interaction between occupants and airbags, and further a fast design and optimization method of airbags in the concept design phase is made based on the proposed theoretical model. First, the theoretical expression of the simplified mechanical relationship between the airbag's design parameters and the occupant response is developed based on classical mechanics, then the momentum theorem and the ideal gas state equation are adopted to illustrate the relationship between airbag's design parameters and occupant response. By using MATLAB software, the iterative algorithm method and discrete variables are applied to the solution of the proposed theoretical model with a random input in a certain scope. And validations by MADYMO software prove the validity and accuracy of this theoretical model in two principal design parameters, the inflated gas mass and vent diameter, within a regular range. This research contributes to a deeper comprehension of the relation between occupants and airbags, further a fast design and optimization method for airbags' principal parameters in the concept design phase, and provides the range of the airbag's initial design parameters for the subsequent CAE simulations and actual tests.

Robust Multi Sensor Classification via Jointly Sparse Representation

DTIC Science & Technology

2016-03-14

rank, sensor network, dictionary learning REPORT DOCUMENTATION PAGE 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 10. SPONSOR/MONITOR’S ACRONYM(S) ARO 8...with ultrafast laser pulses, Optics Express, (04 2015): 10521. doi: Xiaoxia Sun, Nasser M. Nasrabadi, Trac D. Tran. Task-Driven Dictionary Learning...in dictionary design, compressed sensors design, and optimization in sparse recovery also helps. We are able to advance the state of the art

A parameter optimization approach to controller partitioning for integrated flight/propulsion control application

NASA Technical Reports Server (NTRS)

Schmidt, Phillip; Garg, Sanjay; Holowecky, Brian

1992-01-01

A parameter optimization framework is presented to solve the problem of partitioning a centralized controller into a decentralized hierarchical structure suitable for integrated flight/propulsion control implementation. The controller partitioning problem is briefly discussed and a cost function to be minimized is formulated, such that the resulting 'optimal' partitioned subsystem controllers will closely match the performance (including robustness) properties of the closed-loop system with the centralized controller while maintaining the desired controller partitioning structure. The cost function is written in terms of parameters in a state-space representation of the partitioned sub-controllers. Analytical expressions are obtained for the gradient of this cost function with respect to parameters, and an optimization algorithm is developed using modern computer-aided control design and analysis software. The capabilities of the algorithm are demonstrated by application to partitioned integrated flight/propulsion control design for a modern fighter aircraft in the short approach to landing task. The partitioning optimization is shown to lead to reduced-order subcontrollers that match the closed-loop command tracking and decoupling performance achieved by a high-order centralized controller.

A parameter optimization approach to controller partitioning for integrated flight/propulsion control application

NASA Technical Reports Server (NTRS)

Schmidt, Phillip H.; Garg, Sanjay; Holowecky, Brian R.

1993-01-01

A parameter optimization framework is presented to solve the problem of partitioning a centralized controller into a decentralized hierarchical structure suitable for integrated flight/propulsion control implementation. The controller partitioning problem is briefly discussed and a cost function to be minimized is formulated, such that the resulting 'optimal' partitioned subsystem controllers will closely match the performance (including robustness) properties of the closed-loop system with the centralized controller while maintaining the desired controller partitioning structure. The cost function is written in terms of parameters in a state-space representation of the partitioned sub-controllers. Analytical expressions are obtained for the gradient of this cost function with respect to parameters, and an optimization algorithm is developed using modern computer-aided control design and analysis software. The capabilities of the algorithm are demonstrated by application to partitioned integrated flight/propulsion control design for a modern fighter aircraft in the short approach to landing task. The partitioning optimization is shown to lead to reduced-order subcontrollers that match the closed-loop command tracking and decoupling performance achieved by a high-order centralized controller.

Optimization of design and operating parameters of a space-based optical-electronic system with a distributed aperture.

PubMed

Tcherniavski, Iouri; Kahrizi, Mojtaba

2008-11-20

Using a gradient optimization method with objective functions formulated in terms of a signal-to-noise ratio (SNR) calculated at given values of the prescribed spatial ground resolution, optimization problems of geometrical parameters of a distributed optical system and a charge-coupled device of a space-based optical-electronic system are solved for samples of the optical systems consisting of two and three annular subapertures. The modulation transfer function (MTF) of the distributed aperture is expressed in terms of an average MTF taking residual image alignment (IA) and optical path difference (OPD) errors into account. The results show optimal solutions of the optimization problems depending on diverse variable parameters. The information on the magnitudes of the SNR can be used to determine the number of the subapertures and their sizes, while the information on the SNR decrease depending on the IA and OPD errors can be useful in design of a beam combination control system to produce the necessary requirements to its accuracy on the basis of the permissible deterioration in the image quality.

The food additive vanillic acid controls transgene expression in mammalian cells and mice.

PubMed

Gitzinger, Marc; Kemmer, Christian; Fluri, David A; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin

2012-03-01

Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells. When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism. Capitalizing on control components that enable Caulobacter crescentus to metabolize vanillic acid originating from lignin degradation that occurs in its oligotrophic freshwater habitat, we have designed synthetic devices that specifically adjust transgene expression in mammalian cells when exposed to vanillic acid. Even in mice transgene expression was robust, precise and tunable in response to vanillic acid. As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

An iterative synthetic approach to engineer a high-performing PhoB-specific reporter.

PubMed

Stoudenmire, Julie L; Essock-Burns, Tara; Weathers, Erena N; Solaimanpour, Sina; Mrázek, Jan; Stabb, Eric V

2018-05-11

Transcriptional reporters are common tools for analyzing either the transcription of a gene of interest or the activity of a specific transcriptional regulator. Unfortunately, the latter application has the shortcoming that native promoters did not evolve as optimal readouts for the activity of a particular regulator. We sought to synthesize an optimized transcriptional reporter for assessing PhoB activity, aiming for maximal "on" expression when PhoB is active, minimal background in the "off" state, and no control elements for other regulators. We designed specific sequences for promoter elements with appropriately spaced PhoB-binding sites, and at nineteen additional intervening nucleotide positions for which we did not predict sequence-specific effects the bases were randomized. Eighty-three such constructs were screened in Vibrio fischeri , enabling us to identify bases at particular randomized positions that significantly correlated with high "on" or low "off" expression. A second round of promoter design rationally constrained thirteen additional positions, leading to a reporter with high PhoB-dependent expression, essentially no background, and no other known regulatory elements. As expressed reporters, we used both stable and destabilized GFP, the latter with a half-life of eighty-one minutes in V. fischeri In culture, PhoB induced the reporter when phosphate was depleted below 10 μM. During symbiotic colonization of its host squid Euprymna scolopes , the reporter indicated heterogeneous phosphate availability in different light-organ microenvironments. Finally, testing this construct in other Proteobacteria demonstrated its broader utility. The results illustrate how a limited ability to predict synthetic promoter-reporter performance can be overcome through iterative screening and re-engineering. IMPORTANCE Transcriptional reporters can be powerful tools for assessing when a particular regulator is active; however, native promoters may not be ideal for this purpose. Optimal reporters should be specific to the regulator being examined and should maximize the difference between "on" and "off" states; however, these properties are distinct from the selective pressures driving the evolution of natural promoters. Synthetic promoters offer a promising alternative, but our understanding often does not enable fully predictive promoter design, and the large number of alternative sequence possibilities can be intractable. In a synthetic promoter region with over thirty-four billion sequence variants, we identified bases correlated with favorable performance by screening only eighty-three candidates, allowing us to rationally constrain our design. We thereby generated an optimized reporter that is induced by PhoB and used it to explore the low-phosphate response of V. fischeri This promoter-design strategy will facilitate the engineering of other regulator-specific reporters. Copyright © 2018 American Society for Microbiology.

Magnetic design for the PediaFlow ventricular assist device.

PubMed

Noh, Myounggyu D; Antaki, James F; Ricci, Michael; Gardiner, Jeff; Paden, Dave; Wu, Jingchun; Prem, Ed; Borovetz, Harvey; Paden, Bradley E

2008-02-01

This article describes a design process for a new pediatric ventricular assist device, the PediaFlow. The pump is embodied in a magnetically levitated turbodynamic design that was developed explicitly based on the requirements for chronic support of infants and small children. The procedure entailed the consideration of multiple pump topologies, from which an axial mixed-flow configuration was chosen for further development. The magnetic design includes permanent-magnet (PM) passive bearings for radial support of the rotor, an actively controlled thrust actuator for axial support, and a brushless direct current (DC) motor for rotation. These components are closely coupled both geometrically and magnetically, and were therefore optimized in parallel, using electromagnetic, rotordynamic models and fluid models, and in consideration of hydrodynamic requirements. Multiple design objectives were considered, including efficiency, size, and margin between critical speeds to operating speed. The former depends upon the radial and yaw stiffnesses of the PM bearings. Analytical expressions for the stiffnesses were derived and verified through finite element analysis (FEA). A toroidally wound motor was designed for high efficiency and minimal additional negative radial stiffness. The design process relies heavily on optimization at the component level and system level. The results of this preliminary design optimization yielded a pump design with an overall stability margin of 15%, based on a pressure rise of 100 mm Hg at 0.5 lpm running at 16,000 rpm.

Factorial experimental design for the culture of human embryonic stem cells as aggregates in stirred suspension bioreactors reveals the potential for interaction effects between bioprocess parameters.

PubMed

Hunt, Megan M; Meng, Guoliang; Rancourt, Derrick E; Gates, Ian D; Kallos, Michael S

2014-01-01

Traditional optimization of culture parameters for the large-scale culture of human embryonic stem cells (ESCs) as aggregates is carried out in a stepwise manner whereby the effect of varying each culture parameter is investigated individually. However, as evidenced by the wide range of published protocols and culture performance indicators (growth rates, pluripotency marker expression, etc.), there is a lack of systematic investigation into the true effect of varying culture parameters especially with respect to potential interactions between culture variables. Here we describe the design and execution of a two-parameter, three-level (3(2)) factorial experiment resulting in nine conditions that were run in duplicate 125-mL stirred suspension bioreactors. The two parameters investigated here were inoculation density and agitation rate, which are easily controlled, but currently, poorly characterized. Cell readouts analyzed included fold expansion, maximum density, and exponential growth rate. Our results reveal that the choice of best case culture parameters was dependent on which cell property was chosen as the primary output variable. Subsequent statistical analyses via two-way analysis of variance indicated significant interaction effects between inoculation density and agitation rate specifically in the case of exponential growth rates. Results indicate that stepwise optimization has the potential to miss out on the true optimal case. In addition, choosing an optimum condition for a culture output of interest from the factorial design yielded similar results when repeated with the same cell line indicating reproducibility. We finally validated that human ESCs remain pluripotent in suspension culture as aggregates under our optimal conditions and maintain their differentiation capabilities as well as a stable karyotype and strong expression levels of specific human ESC markers over several passages in suspension bioreactors.

Describing the What and Why of Students' Difficulties in Boolean Logic

ERIC Educational Resources Information Center

Herman, Geoffrey L.; Loui, Michael C.; Kaczmarczyk, Lisa; Zilles, Craig

2012-01-01

The ability to reason with formal logic is a foundational skill for computer scientists and computer engineers that scaffolds the abilities to design, debug, and optimize. By interviewing students about their understanding of propositional logic and their ability to translate from English specifications to Boolean expressions, we characterized…

Purification optimization for a recombinant single-chain variable fragment against type 1 insulin-like growth factor receptor (IGF-1R) by using design of experiment (DoE).

PubMed

Song, Yong-Hong; Sun, Xue-Wen; Jiang, Bo; Liu, Ji-En; Su, Xian-Hui

2015-12-01

Design of experiment (DoE) is a statistics-based technique for experimental design that could overcome the shortcomings of traditional one-factor-at-a-time (OFAT) approach for protein purification optimization. In this study, a DoE approach was applied for optimizing purification of a recombinant single-chain variable fragment (scFv) against type 1 insulin-like growth factor receptor (IGF-1R) expressed in Escherichia coli. In first capture step using Capto L, a 2-level fractional factorial analysis and successively a central composite circumscribed (CCC) design were used to identify the optimal elution conditions. Two main effects, pH and trehalose, were identified, and high recovery (above 95%) and low aggregates ratio (below 10%) were achieved at the pH range from 2.9 to 3.0 with 32-35% (w/v) trehalose added. In the second step using cation exchange chromatography, an initial screening of media and elution pH and a following CCC design were performed, whereby the optimal selectivity of the scFv was obtained on Capto S at pH near 6.0, and the optimal conditions for fulfilling high DBC and purity were identified as pH range of 5.9-6.1 and loading conductivity range of 5-12.5 mS/cm. Upon a further gel filtration, the final purified scFv with a purity of 98% was obtained. Finally, the optimized conditions were verified by a 20-fold scale-up experiment. The purities and yields of intermediate and final products all fell within the regions predicted by DoE approach, suggesting the robustness of the optimized conditions. We proposed that the DoE approach described here is also applicable in production of other recombinant antibody constructs. Copyright © 2015 Elsevier Inc. All rights reserved.

Characterization of complex systems using the design of experiments approach: transient protein expression in tobacco as a case study.

PubMed

Buyel, Johannes Felix; Fischer, Rainer

2014-01-31

Plants provide multiple benefits for the production of biopharmaceuticals including low costs, scalability, and safety. Transient expression offers the additional advantage of short development and production times, but expression levels can vary significantly between batches thus giving rise to regulatory concerns in the context of good manufacturing practice. We used a design of experiments (DoE) approach to determine the impact of major factors such as regulatory elements in the expression construct, plant growth and development parameters, and the incubation conditions during expression, on the variability of expression between batches. We tested plants expressing a model anti-HIV monoclonal antibody (2G12) and a fluorescent marker protein (DsRed). We discuss the rationale for selecting certain properties of the model and identify its potential limitations. The general approach can easily be transferred to other problems because the principles of the model are broadly applicable: knowledge-based parameter selection, complexity reduction by splitting the initial problem into smaller modules, software-guided setup of optimal experiment combinations and step-wise design augmentation. Therefore, the methodology is not only useful for characterizing protein expression in plants but also for the investigation of other complex systems lacking a mechanistic description. The predictive equations describing the interconnectivity between parameters can be used to establish mechanistic models for other complex systems.

Codon Optimization of the Human Papillomavirus E7 Oncogene Induces a CD8+ T Cell Response to a Cryptic Epitope Not Harbored by Wild-Type E7

PubMed Central

Lorenz, Felix K. M.; Wilde, Susanne; Voigt, Katrin; Kieback, Elisa; Mosetter, Barbara; Schendel, Dolores J.; Uckert, Wolfgang

2015-01-01

Codon optimization of nucleotide sequences is a widely used method to achieve high levels of transgene expression for basic and clinical research. Until now, immunological side effects have not been described. To trigger T cell responses against human papillomavirus, we incubated T cells with dendritic cells that were pulsed with RNA encoding the codon-optimized E7 oncogene. All T cell receptors isolated from responding T cell clones recognized target cells expressing the codon-optimized E7 gene but not the wild type E7 sequence. Epitope mapping revealed recognition of a cryptic epitope from the +3 alternative reading frame of codon-optimized E7, which is not encoded by the wild type E7 sequence. The introduction of a stop codon into the +3 alternative reading frame protected the transgene product from recognition by T cell receptor gene-modified T cells. This is the first experimental study demonstrating that codon optimization can render a transgene artificially immunogenic through generation of a dominant cryptic epitope. This finding may be of great importance for the clinical field of gene therapy to avoid rejection of gene-corrected cells and for the design of DNA- and RNA-based vaccines, where codon optimization may artificially add a strong immunogenic component to the vaccine. PMID:25799237

Design of compact long-period gratings imprinted in optimized photonic crystal fibers

NASA Astrophysics Data System (ADS)

Seraji, F. E.; Chehreghani Anzabi, L.; Farsinezhad, S.

2009-10-01

To imprint a long-period grating (LPG) in a photonic crystal fiber (PCF) with an optimum response, first the parameters of the PCF should be optimized. In this paper, by using a semi-analytical enhanced improved vectorial effective index method, the optimized PCF parameters are determined by dividing the single-mode operation of the PCF into two regions in terms of air-hole spacing Λ ( Λ>3 μm and Λ≤3 μm). For each region appropriate expressions are suggested to evaluate the PCF parameters. By calculating the effective refractive index difference between the optimized core and cladding of the PCF under a phase-matching condition, the optimum grating period in terms of the PCF parameters is obtained.

Automatic Compilation from High-Level Biologically-Oriented Programming Language to Genetic Regulatory Networks

PubMed Central

Beal, Jacob; Lu, Ting; Weiss, Ron

2011-01-01

Background The field of synthetic biology promises to revolutionize our ability to engineer biological systems, providing important benefits for a variety of applications. Recent advances in DNA synthesis and automated DNA assembly technologies suggest that it is now possible to construct synthetic systems of significant complexity. However, while a variety of novel genetic devices and small engineered gene networks have been successfully demonstrated, the regulatory complexity of synthetic systems that have been reported recently has somewhat plateaued due to a variety of factors, including the complexity of biology itself and the lag in our ability to design and optimize sophisticated biological circuitry. Methodology/Principal Findings To address the gap between DNA synthesis and circuit design capabilities, we present a platform that enables synthetic biologists to express desired behavior using a convenient high-level biologically-oriented programming language, Proto. The high level specification is compiled, using a regulatory motif based mechanism, to a gene network, optimized, and then converted to a computational simulation for numerical verification. Through several example programs we illustrate the automated process of biological system design with our platform, and show that our compiler optimizations can yield significant reductions in the number of genes () and latency of the optimized engineered gene networks. Conclusions/Significance Our platform provides a convenient and accessible tool for the automated design of sophisticated synthetic biological systems, bridging an important gap between DNA synthesis and circuit design capabilities. Our platform is user-friendly and features biologically relevant compiler optimizations, providing an important foundation for the development of sophisticated biological systems. PMID:21850228

DOE Office of Scientific and Technical Information (OSTI.GOV)

Piepel, Gregory F.; Pasquini, Benedetta; Cooley, Scott K.

In recent years, multivariate optimization has played an increasing role in analytical method development. ICH guidelines recommend using statistical design of experiments to identify the design space, in which multivariate combinations of composition variables and process variables have been demonstrated to provide quality results. Considering a microemulsion electrokinetic chromatography method (MEEKC), the performance of the electrophoretic run depends on the proportions of mixture components (MCs) of the microemulsion and on the values of process variables (PVs). In the present work, for the first time in the literature, a mixture-process variable (MPV) approach was applied to optimize a MEEKC method formore » the analysis of coenzyme Q10 (Q10), ascorbic acid (AA), and folic acid (FA) contained in nutraceuticals. The MCs (buffer, surfactant-cosurfactant, oil) and the PVs (voltage, buffer concentration, buffer pH) were simultaneously changed according to a MPV experimental design. A 62-run MPV design was generated using the I-optimality criterion, assuming a 46-term MPV model allowing for special-cubic blending of the MCs, quadratic effects of the PVs, and some MC-PV interactions. The obtained data were used to develop MPV models that express the performance of an electrophoretic run (measured as peak efficiencies of Q10, AA, and FA) in terms of the MCs and PVs. Contour and perturbation plots were drawn for each of the responses. Finally, the MPV models and criteria for the peak efficiencies were used to develop the design space and an optimal subregion (i.e., the settings of the mixture MCs and PVs that satisfy the respective criteria), as well as a unique optimal combination of MCs and PVs.« less

Automatic compilation from high-level biologically-oriented programming language to genetic regulatory networks.

PubMed

Beal, Jacob; Lu, Ting; Weiss, Ron

2011-01-01

The field of synthetic biology promises to revolutionize our ability to engineer biological systems, providing important benefits for a variety of applications. Recent advances in DNA synthesis and automated DNA assembly technologies suggest that it is now possible to construct synthetic systems of significant complexity. However, while a variety of novel genetic devices and small engineered gene networks have been successfully demonstrated, the regulatory complexity of synthetic systems that have been reported recently has somewhat plateaued due to a variety of factors, including the complexity of biology itself and the lag in our ability to design and optimize sophisticated biological circuitry. To address the gap between DNA synthesis and circuit design capabilities, we present a platform that enables synthetic biologists to express desired behavior using a convenient high-level biologically-oriented programming language, Proto. The high level specification is compiled, using a regulatory motif based mechanism, to a gene network, optimized, and then converted to a computational simulation for numerical verification. Through several example programs we illustrate the automated process of biological system design with our platform, and show that our compiler optimizations can yield significant reductions in the number of genes (~ 50%) and latency of the optimized engineered gene networks. Our platform provides a convenient and accessible tool for the automated design of sophisticated synthetic biological systems, bridging an important gap between DNA synthesis and circuit design capabilities. Our platform is user-friendly and features biologically relevant compiler optimizations, providing an important foundation for the development of sophisticated biological systems.

Analytical solutions to optimal underactuated spacecraft formation reconfiguration

NASA Astrophysics Data System (ADS)

Huang, Xu; Yan, Ye; Zhou, Yang

2015-11-01

Underactuated systems can generally be defined as systems with fewer number of control inputs than that of the degrees of freedom to be controlled. In this paper, analytical solutions to optimal underactuated spacecraft formation reconfiguration without either the radial or the in-track control are derived. By using a linear dynamical model of underactuated spacecraft formation in circular orbits, controllability analysis is conducted for either underactuated case. Indirect optimization methods based on the minimum principle are then introduced to generate analytical solutions to optimal open-loop underactuated reconfiguration problems. Both fixed and free final conditions constraints are considered for either underactuated case and comparisons between these two final conditions indicate that the optimal control strategies with free final conditions require less control efforts than those with the fixed ones. Meanwhile, closed-loop adaptive sliding mode controllers for both underactuated cases are designed to guarantee optimal trajectory tracking in the presence of unmatched external perturbations, linearization errors, and system uncertainties. The adaptation laws are designed via a Lyapunov-based method to ensure the overall stability of the closed-loop system. The explicit expressions of the terminal convergent regions of each system states have also been obtained. Numerical simulations demonstrate the validity and feasibility of the proposed open-loop and closed-loop control schemes for optimal underactuated spacecraft formation reconfiguration in circular orbits.

Optical properties of InAsBi and optimal designs of lattice-matched and strain-balanced III-V semiconductor superlattices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Webster, P. T., E-mail: preston.t.webster@asu.edu; Riordan, N. A.; Gogineni, C.

The optical properties of bulk InAs{sub 0.936}Bi{sub 0.064} grown by molecular beam epitaxy on a (100)-oriented GaSb substrate are measured using spectroscopic ellipsometry. The index of refraction and absorption coefficient are measured over photon energies ranging from 44 meV to 4.4 eV and are used to identify the room temperature bandgap energy of bulk InAs{sub 0.936}Bi{sub 0.064} as 60.6 meV. The bandgap of InAsBi is expressed as a function of Bi mole fraction using the band anticrossing model and a characteristic coupling strength of 1.529 eV between the Bi impurity state and the InAs valence band. These results are programmed into a software toolmore » that calculates the miniband structure of semiconductor superlattices and identifies optimal designs in terms of maximizing the electron-hole wavefunction overlap as a function of transition energy. These functionalities are demonstrated by mapping the design spaces of lattice-matched GaSb/InAs{sub 0.911}Sb{sub 0.089} and GaSb/InAs{sub 0.932}Bi{sub 0.068} and strain-balanced InAs/InAsSb, InAs/GaInSb, and InAs/InAsBi superlattices on GaSb. The absorption properties of each of these material systems are directly compared by relating the wavefunction overlap square to the absorption coefficient of each optimized design. Optimal design criteria are provided for key detector wavelengths for each superlattice system. The optimal design mid-wave infrared InAs/InAsSb superlattice is grown using molecular beam epitaxy, and its optical properties are evaluated using spectroscopic ellipsometry and photoluminescence spectroscopy.« less

Nomenclature and guideline to express the amount of a membrane protein synthesized in animal cells in view of bioprocess optimization and production monitoring.

PubMed

Augusto, Elisabeth F P; Moraes, Angela M; Piccoli, Rosane A M; Barral, Manuel F; Suazo, Cláudio A T; Tonso, Aldo; Pereira, Carlos A

2010-01-01

Studies of a bioprocess optimization and monitoring for protein synthesis in animal cells face a challenge on how to express in quantitative terms the system performance. It is possible to have a panel of calculated variables that fits more or less appropriately the intended goal. Each mathematical expression approach translates different quantitative aspects. We can basically separate them into two categories: those used for the evaluation of cell physiology in terms of product synthesis, which can be for bioprocess improvement or optimization, and those used for production unit sizing and for bioprocess operation. With these perspectives and based on our own data of kinetic S2 cells growth and metabolism, as well as on their synthesis of the transmembrane recombinant rabies virus glycoprotein, here indicated as P, we show and discuss the main characteristics of calculated variables and their recommended use. Mainly applied to a bioprocess improvement/optimization and that mainly used for operation definition and to design the production unit, we expect these definitions/recommendations would improve the quality of data produced in this field and lead to more standardized procedures. In turn, it would allow a better and easier comprehension of scientific and technological communications for specialized readers. Copyright 2009 The International Association for Biologicals. Published by Elsevier Ltd. All rights reserved.

Mathematical Design Optimization of Wide-Field X-ray Telescopes: Mirror Nodal Positions and Detector Tilts

NASA Technical Reports Server (NTRS)

Elsner, R. F.; O'Dell, S. L.; Ramsey, B. D.; Weisskopf, M. C.

2011-01-01

We describe a mathematical formalism for determining the mirror shell nodal positions and detector tilts that optimize the spatial resolution averaged over a field-of-view for a nested x-ray telescope, assuming known mirror segment surface prescriptions and known detector focal surface. The results are expressed in terms of ensemble averages over variable combinations of the ray positions and wave vectors in the flat focal plane intersecting the optical axis at the nominal on-axis focus, which can be determined by Monte-Carlo ray traces of the individual mirror shells. This work is part of our continuing efforts to provide analytical tools to aid in the design process for wide-field survey x-ray astronomy missions.

Cost-efficiency trade-off and the design of thermoelectric power generators.

PubMed

Yazawa, Kazuaki; Shakouri, Ali

2011-09-01

The energy conversion efficiency of today's thermoelectric generators is significantly lower than that of conventional mechanical engines. Almost all of the existing research is focused on materials to improve the conversion efficiency. Here we propose a general framework to study the cost-efficiency trade-off for thermoelectric power generation. A key factor is the optimization of thermoelectric modules together with their heat source and heat sinks. Full electrical and thermal co-optimization yield a simple analytical expression for optimum design. Based on this model, power output per unit mass can be maximized. We show that the fractional area coverage of thermoelectric elements in a module could play a significant role in reducing the cost of power generation systems.

Mathematical Design Optimization of Wide-Field X-ray Telescopes: Mirror Nodal Positions and Detector Tilts

NASA Technical Reports Server (NTRS)

Elsner, Ronald; O'Dell, Stephen; Ramsey, Brian; Weisskopf, Martin

2011-01-01

We describe a mathematical formalism for determining the mirror shell nodal positions and detector tilts that optimize the spatial resolution averaged over a field-of-view for a nested x-ray telescope, assuming known mirror segment surface prescriptions and known detector focal surface. The results are expressed in terms of ensemble averages over variable combinations of the ray positions and wavevectors in the flat focal plane intersecting the optical axis at the nominal on-axis focus, which can be determined by Monte-Carlo ray traces of the individual mirror shells. This work is part of our continuing efforts to provide analytical tools to aid in the design process for wide-field survey x-ray astronomy missions.

Directed molecular evolution to design advanced red fluorescent proteins.

PubMed

Subach, Fedor V; Piatkevich, Kiryl D; Verkhusha, Vladislav V

2011-11-29

Fluorescent proteins have become indispensable imaging tools for biomedical research. Continuing progress in fluorescence imaging, however, requires probes with additional colors and properties optimized for emerging techniques. Here we summarize strategies for development of red-shifted fluorescent proteins. We discuss possibilities for knowledge-based rational design based on the photochemistry of fluorescent proteins and the position of the chromophore in protein structure. We consider advances in library design by mutagenesis, protein expression systems and instrumentation for high-throughput screening that should yield improved fluorescent proteins for advanced imaging applications.

The quality estimation of exterior wall’s and window filling’s construction design

NASA Astrophysics Data System (ADS)

Saltykov, Ivan; Bovsunovskaya, Maria

2017-10-01

The article reveals the term of “artificial envelope” in dwelling building. Authors offer a complex multifactorial approach to the design quality estimation of external fencing structures, which is based on various parameters impact. These referred parameters are: functional, exploitation, cost, and also, the environmental index is among them. The quality design index Qк is inputting for the complex characteristic of observed above parameters. The mathematical relation of this index from these parameters is the target function for the quality design estimation. For instance, the article shows the search of optimal variant for wall and window designs in small, middle and large square dwelling premises of economic class buildings. The graphs of target function single parameters are expressed for the three types of residual chamber’s dimensions. As a result of the showing example, there is a choice of window opening’s dimensions, which make the wall’s and window’s constructions properly correspondent to the producible complex requirements. The authors reveal the comparison of recommended window filling’s square in accordance with the building standards, and the square, due to the finding of the optimal variant of the design quality index. The multifactorial approach for optimal design searching, which is mentioned in this article, can be used in consideration of various construction elements of dwelling buildings in accounting of suitable climate, social and economic construction area features.

Skin delivery of epigallocatechin-3-gallate (EGCG) and hyaluronic acid loaded nano-transfersomes for antioxidant and anti-aging effects in UV radiation induced skin damage.

PubMed

Avadhani, Kiran S; Manikkath, Jyothsna; Tiwari, Mradul; Chandrasekhar, Misra; Godavarthi, Ashok; Vidya, Shimoga M; Hariharapura, Raghu C; Kalthur, Guruprasad; Udupa, Nayanabhirama; Mutalik, Srinivas

2017-11-01

The present work attempts to develop and statistically optimize transfersomes containing EGCG and hyaluronic acid to synergize the UV radiation-protective ability of both compounds, along with imparting antioxidant and anti-aging effects. Transfersomes were prepared by thin film hydration technique, using soy phosphatidylcholine and sodium cholate, combined with high-pressure homogenization. They were characterized with respect to size, polydispersity index, zeta potential, morphology, entrapment efficiency, Fourier Transform Infrared Spectroscopy (FTIR), Differential Scanning Calorimetry (DSC), X-ray Diffraction (XRD), in vitro antioxidant activity and ex vivo skin permeation studies. Cell viability, lipid peroxidation, intracellular ROS levels and expression of MMPs (2 and 9) were determined in human keratinocyte cell lines (HaCaT). The composition of the transfersomes was statistically optimized by Design of Experiments using Box-Behnken design with four factors at three levels. The optimized transfersome formulation showed vesicle size, polydispersity index and zeta potential of 101.2 ± 6.0 nm, 0.245 ± 0.069 and -44.8 ± 5.24 mV, respectively. FTIR and DSC showed no interaction between EGCG and the selected excipients. XRD results revealed no form conversion of EGCG in its transfersomal form. The optimized transfersomes were found to increase the cell viability and reduce the lipid peroxidation, intracellular ROS and expression of MMPs in HaCaT cells. The optimized transfersomal formulation of EGCG and HA exhibited considerably higher skin permeation and deposition of EGCG than that observed with plain EGCG. The results underline the potential application of the developed transfersomes in sunscreen cream/lotions for improvement of UV radiation-protection along with deriving antioxidant and anti-aging effects.

Molecular design for recombinant adeno-associated virus (rAAV) vector production.

PubMed

Aponte-Ubillus, Juan Jose; Barajas, Daniel; Peltier, Joseph; Bardliving, Cameron; Shamlou, Parviz; Gold, Daniel

2018-02-01

Recombinant adeno-associated virus (rAAV) vectors are increasingly popular tools for gene therapy applications. Their non-pathogenic status, low inflammatory potential, availability of viral serotypes with different tissue tropisms, and prospective long-lasting gene expression are important attributes that make rAAVs safe and efficient therapeutic options. Over the last three decades, several groups have engineered recombinant AAV-producing platforms, yielding high titers of transducing vector particles. Current specific productivity yields from different platforms range from 10 3 to 10 5 vector genomes (vg) per cell, and there is an ongoing effort to improve vector yields in order to satisfy high product demands required for clinical trials and future commercialization.Crucial aspects of vector production include the molecular design of the rAAV-producing host cell line along with the design of AAV genes, promoters, and regulatory elements. Appropriately, configuring and balancing the expression of these elements not only contributes toward high productivity, it also improves process robustness and product quality. In this mini-review, the rational design of rAAV-producing expression systems is discussed, with special attention to molecular strategies that contribute to high-yielding, biomanufacturing-amenable rAAV production processes. Details on molecular optimization from four rAAV expression systems are covered: adenovirus, herpesvirus, and baculovirus complementation systems, as well as a recently explored yeast expression system.

Planar junctionless phototransistor: A potential high-performance and low-cost device for optical-communications

NASA Astrophysics Data System (ADS)

Ferhati, H.; Djeffal, F.

2017-12-01

In this paper, a new junctionless optical controlled field effect transistor (JL-OCFET) and its comprehensive theoretical model is proposed to achieve high optical performance and low cost fabrication process. Exhaustive study of the device characteristics and comparison between the proposed junctionless design and the conventional inversion mode structure (IM-OCFET) for similar dimensions are performed. Our investigation reveals that the proposed design exhibits an outstanding capability to be an alternative to the IM-OCFET due to the high performance and the weak signal detection benefit offered by this design. Moreover, the developed analytical expressions are exploited to formulate the objective functions to optimize the device performance using Genetic Algorithms (GAs) approach. The optimized JL-OCFET not only demonstrates good performance in terms of derived drain current and responsivity, but also exhibits superior signal to noise ratio, low power consumption, high-sensitivity, high ION/IOFF ratio and high-detectivity as compared to the conventional IM-OCFET counterpart. These characteristics make the optimized JL-OCFET potentially suitable for developing low cost and ultrasensitive photodetectors for high-performance and low cost inter-chips data communication applications.

A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina.

PubMed

Bidard, Frédérique; Imbeaud, Sandrine; Reymond, Nancie; Lespinet, Olivier; Silar, Philippe; Clavé, Corinne; Delacroix, Hervé; Berteaux-Lecellier, Véronique; Debuchy, Robert

2010-06-18

The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis.

Optimal placement of tuning masses for vibration reduction in helicopter rotor blades

NASA Technical Reports Server (NTRS)

Pritchard, Jocelyn I.; Adelman, Howard M.

1988-01-01

Described are methods for reducing vibration in helicopter rotor blades by determining optimum sizes and locations of tuning masses through formal mathematical optimization techniques. An optimization procedure is developed which employs the tuning masses and corresponding locations as design variables which are systematically changed to achieve low values of shear without a large mass penalty. The finite-element structural analysis of the blade and the optimization formulation require development of discretized expressions for two performance parameters: modal shaping parameter and modal shear amplitude. Matrix expressions for both quantities and their sensitivity derivatives are developed. Three optimization strategies are developed and tested. The first is based on minimizing the modal shaping parameter which indirectly reduces the modal shear amplitudes corresponding to each harmonic of airload. The second strategy reduces these amplitudes directly, and the third strategy reduces the shear as a function of time during a revolution of the blade. The first strategy works well for reducing the shear for one mode responding to a single harmonic of the airload, but has been found in some cases to be ineffective for more than one mode. The second and third strategies give similar results and show excellent reduction of the shear with a low mass penalty.

Design optimization of transmitting antennas for weakly coupled magnetic induction communication systems

PubMed Central

2017-01-01

This work focuses on the design of transmitting coils in weakly coupled magnetic induction communication systems. We propose several optimization methods that reduce the active, reactive and apparent power consumption of the coil. These problems are formulated as minimization problems, in which the power consumed by the transmitting coil is minimized, under the constraint of providing a required magnetic field at the receiver location. We develop efficient numeric and analytic methods to solve the resulting problems, which are of high dimension, and in certain cases non-convex. For the objective of minimal reactive power an analytic solution for the optimal current distribution in flat disc transmitting coils is provided. This problem is extended to general three-dimensional coils, for which we develop an expression for the optimal current distribution. Considering the objective of minimal apparent power, a method is developed to reduce the computational complexity of the problem by transforming it to an equivalent problem of lower dimension, allowing a quick and accurate numeric solution. These results are verified experimentally by testing a number of coil geometries. The results obtained allow reduced power consumption and increased performances in magnetic induction communication systems. Specifically, for wideband systems, an optimal design of the transmitter coil reduces the peak instantaneous power provided by the transmitter circuitry, and thus reduces its size, complexity and cost. PMID:28192463

Designing deep sequencing experiments: detecting structural variation and estimating transcript abundance.

PubMed

Bashir, Ali; Bansal, Vikas; Bafna, Vineet

2010-06-18

Massively parallel DNA sequencing technologies have enabled the sequencing of several individual human genomes. These technologies are also being used in novel ways for mRNA expression profiling, genome-wide discovery of transcription-factor binding sites, small RNA discovery, etc. The multitude of sequencing platforms, each with their unique characteristics, pose a number of design challenges, regarding the technology to be used and the depth of sequencing required for a particular sequencing application. Here we describe a number of analytical and empirical results to address design questions for two applications: detection of structural variations from paired-end sequencing and estimating mRNA transcript abundance. For structural variation, our results provide explicit trade-offs between the detection and resolution of rearrangement breakpoints, and the optimal mix of paired-read insert lengths. Specifically, we prove that optimal detection and resolution of breakpoints is achieved using a mix of exactly two insert library lengths. Furthermore, we derive explicit formulae to determine these insert length combinations, enabling a 15% improvement in breakpoint detection at the same experimental cost. On empirical short read data, these predictions show good concordance with Illumina 200 bp and 2 Kbp insert length libraries. For transcriptome sequencing, we determine the sequencing depth needed to detect rare transcripts from a small pilot study. With only 1 Million reads, we derive corrections that enable almost perfect prediction of the underlying expression probability distribution, and use this to predict the sequencing depth required to detect low expressed genes with greater than 95% probability. Together, our results form a generic framework for many design considerations related to high-throughput sequencing. We provide software tools http://bix.ucsd.edu/projects/NGS-DesignTools to derive platform independent guidelines for designing sequencing experiments (amount of sequencing, choice of insert length, mix of libraries) for novel applications of next generation sequencing.

Wide-field-of-view millimeter-wave telescope design with ultra-low cross-polarization

NASA Astrophysics Data System (ADS)

Bernacki, Bruce E.; Kelly, James F.; Sheen, David; Hatchell, Brian; Valdez, Patrick; Tedeschi, Jonathan; Hall, Thomas; McMakin, Douglas

2012-06-01

As millimeter-wave arrays become available, off-axis imaging performance of the fore optics increases in importance due to the relatively large physical extent of the arrays. Typically, simple optical telescope designs are adapted to millimeter-wave imaging but single-mirror spherical or classic conic designs cannot deliver adequate image quality except near the optical axis. Since millimeter-wave designs are quasi-optical, optical ray tracing and commercial design software can be used to optimize designs to improve off-axis imaging as well as minimize cross-polarization. Methods that obey the Dragone-Mizuguchi condition for the design of reflective millimeter-wave telescopes with low cross-polarization also provide additional degrees of freedom that offer larger fields of view than possible with single-reflector designs. Dragone's graphical design method does not lend itself readily to computer-based optical design approaches, but subsequent authors expanded on Dragone's geometric design approach with analytic expressions that describe the location, shape, off-axis height and tilt of the telescope elements that satisfy Dragone's design rules and can be used as a first-order design for subsequent computer-based design and optimization. We investigate two design variants that obey the Dragone-Mizuguchi conditions that exhibit ultra-low cross-polarization and a large diffraction-limited field of view well suited to millimeter-wave imaging arrays.

Optimum design of structures subject to general periodic loads

NASA Technical Reports Server (NTRS)

Reiss, Robert; Qian, B.

1989-01-01

A simplified version of Icerman's problem regarding the design of structures subject to a single harmonic load is discussed. The nature of the restrictive conditions that must be placed on the design space in order to ensure an analytic optimum are discussed in detail. Icerman's problem is then extended to include multiple forcing functions with different driving frequencies. And the conditions that now must be placed upon the design space to ensure an analytic optimum are again discussed. An important finding is that all solutions to the optimality condition (analytic stationary design) are local optima, but the global optimum may well be non-analytic. The more general problem of distributing the fixed mass of a linear elastic structure subject to general periodic loads in order to minimize some measure of the steady state deflection is also considered. This response is explicitly expressed in terms of Green's functional and the abstract operators defining the structure. The optimality criterion is derived by differentiating the response with respect to the design parameters. The theory is applicable to finite element as well as distributed parameter models.

Digital robust active control law synthesis for large order systems using constrained optimization

NASA Technical Reports Server (NTRS)

Mukhopadhyay, Vivek

1987-01-01

This paper presents a direct digital control law synthesis procedure for a large order, sampled data, linear feedback system using constrained optimization techniques to meet multiple design requirements. A linear quadratic Gaussian type cost function is minimized while satisfying a set of constraints on the design loads and responses. General expressions for gradients of the cost function and constraints, with respect to the digital control law design variables are derived analytically and computed by solving a set of discrete Liapunov equations. The designer can choose the structure of the control law and the design variables, hence a stable classical control law as well as an estimator-based full or reduced order control law can be used as an initial starting point. Selected design responses can be treated as constraints instead of lumping them into the cost function. This feature can be used to modify a control law, to meet individual root mean square response limitations as well as minimum single value restrictions. Low order, robust digital control laws were synthesized for gust load alleviation of a flexible remotely piloted drone aircraft.

A level set-based topology optimization method for simultaneous design of elastic structure and coupled acoustic cavity using a two-phase material model

NASA Astrophysics Data System (ADS)

Noguchi, Yuki; Yamamoto, Takashi; Yamada, Takayuki; Izui, Kazuhiro; Nishiwaki, Shinji

2017-09-01

This papers proposes a level set-based topology optimization method for the simultaneous design of acoustic and structural material distributions. In this study, we develop a two-phase material model that is a mixture of an elastic material and acoustic medium, to represent an elastic structure and an acoustic cavity by controlling a volume fraction parameter. In the proposed model, boundary conditions at the two-phase material boundaries are satisfied naturally, avoiding the need to express these boundaries explicitly. We formulate a topology optimization problem to minimize the sound pressure level using this two-phase material model and a level set-based method that obtains topologies free from grayscales. The topological derivative of the objective functional is approximately derived using a variational approach and the adjoint variable method and is utilized to update the level set function via a time evolutionary reaction-diffusion equation. Several numerical examples present optimal acoustic and structural topologies that minimize the sound pressure generated from a vibrating elastic structure.

Design and optimization of reverse-transcription quantitative PCR experiments.

PubMed

Tichopad, Ales; Kitchen, Rob; Riedmaier, Irmgard; Becker, Christiane; Ståhlberg, Anders; Kubista, Mikael

2009-10-01

Quantitative PCR (qPCR) is a valuable technique for accurately and reliably profiling and quantifying gene expression. Typically, samples obtained from the organism of study have to be processed via several preparative steps before qPCR. We estimated the errors of sample withdrawal and extraction, reverse transcription (RT), and qPCR that are introduced into measurements of mRNA concentrations. We performed hierarchically arranged experiments with 3 animals, 3 samples, 3 RT reactions, and 3 qPCRs and quantified the expression of several genes in solid tissue, blood, cell culture, and single cells. A nested ANOVA design was used to model the experiments, and relative and absolute errors were calculated with this model for each processing level in the hierarchical design. We found that intersubject differences became easily confounded by sample heterogeneity for single cells and solid tissue. In cell cultures and blood, the noise from the RT and qPCR steps contributed substantially to the overall error because the sampling noise was less pronounced. We recommend the use of sample replicates preferentially to any other replicates when working with solid tissue, cell cultures, and single cells, and we recommend the use of RT replicates when working with blood. We show how an optimal sampling plan can be calculated for a limited budget. .

Streamflow variability and optimal capacity of run-of-river hydropower plants

NASA Astrophysics Data System (ADS)

Basso, S.; Botter, G.

2012-10-01

The identification of the capacity of a run-of-river plant which allows for the optimal utilization of the available water resources is a challenging task, mainly because of the inherent temporal variability of river flows. This paper proposes an analytical framework to describe the energy production and the economic profitability of small run-of-river power plants on the basis of the underlying streamflow regime. We provide analytical expressions for the capacity which maximize the produced energy as a function of the underlying flow duration curve and minimum environmental flow requirements downstream of the plant intake. Similar analytical expressions are derived for the capacity which maximize the economic return deriving from construction and operation of a new plant. The analytical approach is applied to a minihydro plant recently proposed in a small Alpine catchment in northeastern Italy, evidencing the potential of the method as a flexible and simple design tool for practical application. The analytical model provides useful insight on the major hydrologic and economic controls (e.g., streamflow variability, energy price, costs) on the optimal plant capacity and helps in identifying policy strategies to reduce the current gap between the economic and energy optimizations of run-of-river plants.

Optimization of cDNA-AFLP experiments using genomic sequence data.

PubMed

Kivioja, Teemu; Arvas, Mikko; Saloheimo, Markku; Penttilä, Merja; Ukkonen, Esko

2005-06-01

cDNA amplified fragment length polymorphism (cDNA-AFLP) is one of the few genome-wide level expression profiling methods capable of finding genes that have not yet been cloned or even predicted from sequence but have interesting expression patterns under the studied conditions. In cDNA-AFLP, a complex cDNA mixture is divided into small subsets using restriction enzymes and selective PCR. A large cDNA-AFLP experiment can require a substantial amount of resources, such as hundreds of PCR amplifications and gel electrophoresis runs, followed by manual cutting of a large number of bands from the gels. Our aim was to test whether this workload can be reduced by rational design of the experiment. We used the available genomic sequence information to optimize cDNA-AFLP experiments beforehand so that as many transcripts as possible could be profiled with a given amount of resources. Optimization of the selection of both restriction enzymes and selective primers for cDNA-AFLP experiments has not been performed previously. The in silico tests performed suggest that substantial amounts of resources can be saved by the optimization of cDNA-AFLP experiments.

Plate/shell structure topology optimization of orthotropic material for buckling problem based on independent continuous topological variables

NASA Astrophysics Data System (ADS)

Ye, Hong-Ling; Wang, Wei-Wei; Chen, Ning; Sui, Yun-Kang

2017-10-01

The purpose of the present work is to study the buckling problem with plate/shell topology optimization of orthotropic material. A model of buckling topology optimization is established based on the independent, continuous, and mapping method, which considers structural mass as objective and buckling critical loads as constraints. Firstly, composite exponential function (CEF) and power function (PF) as filter functions are introduced to recognize the element mass, the element stiffness matrix, and the element geometric stiffness matrix. The filter functions of the orthotropic material stiffness are deduced. Then these filter functions are put into buckling topology optimization of a differential equation to analyze the design sensitivity. Furthermore, the buckling constraints are approximately expressed as explicit functions with respect to the design variables based on the first-order Taylor expansion. The objective function is standardized based on the second-order Taylor expansion. Therefore, the optimization model is translated into a quadratic program. Finally, the dual sequence quadratic programming (DSQP) algorithm and the global convergence method of moving asymptotes algorithm with two different filter functions (CEF and PF) are applied to solve the optimal model. Three numerical results show that DSQP&CEF has the best performance in the view of structural mass and discretion.

Optimization of extraction conditions for osthol, a melanogenesis inhibitor from Cnidium monnieri fruits.

PubMed

Beom Kim, Seon; Kim, CheongTaek; Liu, Qing; Hee Jo, Yang; Joo Choi, Hak; Hwang, Bang Yeon; Kyum Kim, Sang; Kyeong Lee, Mi

2016-08-01

Coumarin derivatives have been reported to inhibit melanin biosynthesis. The melanogenesis inhibitory activity of osthol, a major coumarin of the fruits of Cnidium monnieri Cusson (Umbelliferae), and optimized extraction conditions for the maximum yield from the isolation of osthol from C. monnieri fruits were investigated. B16F10 melanomas were treated with osthol at concentration of 1, 3, and 10 μM for 72 h. The expression of melanogenesis genes, such as tyrosinase, TRP-1, and TRP-2 was also assessed. For optimization, extraction factors such as extraction solvent, extraction time, and sample/solvent ratio were tested and optimized for maximum yield of osthol using response surface methodology with the Box-Behnken design (BBD). Osthol inhibits melanin content in B16F10 melanoma cells with an IC50 value of 4.9 μM. The melanogenesis inhibitory activity of osthol was achieved not by direct inhibition of tyrosinase activity but by inhibiting melanogenic enzyme expressions, such as tyrosinase, TRP-1, and TRP-2. The optimal condition was obtained as a sample/solvent ratio, 1500 mg/10 ml; an extraction time 30.3 min; and a methanol concentration of 97.7%. The osthol yield under optimal conditions was found to be 15.0 mg/g dried samples, which were well matched with the predicted value of 14.9 mg/g dried samples. These results will provide useful information about optimized extraction conditions for the development of osthol as cosmetic therapeutics to reduce skin hyperpigmentation.

Optimal shutdown management

NASA Astrophysics Data System (ADS)

Bottasso, C. L.; Croce, A.; Riboldi, C. E. D.

2014-06-01

The paper presents a novel approach for the synthesis of the open-loop pitch profile during emergency shutdowns. The problem is of interest in the design of wind turbines, as such maneuvers often generate design driving loads on some of the machine components. The pitch profile synthesis is formulated as a constrained optimal control problem, solved numerically using a direct single shooting approach. A cost function expressing a compromise between load reduction and rotor overspeed is minimized with respect to the unknown blade pitch profile. Constraints may include a load reduction not-to-exceed the next dominating loads, a not-to-be-exceeded maximum rotor speed, and a maximum achievable blade pitch rate. Cost function and constraints are computed over a possibly large number of operating conditions, defined so as to cover as well as possible the operating situations encountered in the lifetime of the machine. All such conditions are simulated by using a high-fidelity aeroservoelastic model of the wind turbine, ensuring the accuracy of the evaluation of all relevant parameters. The paper demonstrates the capabilities of the novel proposed formulation, by optimizing the pitch profile of a multi-MW wind turbine. Results show that the procedure can reliably identify optimal pitch profiles that reduce design-driving loads, in a fully automated way.

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

Automated Protocol for Large-Scale Modeling of Gene Expression Data.

PubMed

Hall, Michelle Lynn; Calkins, David; Sherman, Woody

2016-11-28

With the continued rise of phenotypic- and genotypic-based screening projects, computational methods to analyze, process, and ultimately make predictions in this field take on growing importance. Here we show how automated machine learning workflows can produce models that are predictive of differential gene expression as a function of a compound structure using data from A673 cells as a proof of principle. In particular, we present predictive models with an average accuracy of greater than 70% across a highly diverse ∼1000 gene expression profile. In contrast to the usual in silico design paradigm, where one interrogates a particular target-based response, this work opens the opportunity for virtual screening and lead optimization for desired multitarget gene expression profiles.

Targeting Neutrophil Protease-Mediated Degradation of Tsp-1 to Induce Metastatic Dormancy

DTIC Science & Technology

2017-10-01

have decided to use CRISPR -Cas9 mediated gene knockout as it results in complete depletion of gene products. The sequences for gRNAs (Fig. 1B) have...express Tsp-1 receptor CD36 Fig. 1. (A) Tsp-1 receptor CD36 is expressed by tumor cells. (B) Design of CRISPR -Cas9 gRNAs for generating biallelic...DWLPK peptide solubility were created and optimized. For Aim 1, Subtask 2.1: We have decided to use CRISPR -Cas9 as they are more potent in

Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

PubMed

Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

2001-04-01

Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

High bandwidth all-optical 3×3 switch based on multimode interference structures

NASA Astrophysics Data System (ADS)

Le, Duy-Tien; Truong, Cao-Dung; Le, Trung-Thanh

2017-03-01

A high bandwidth all-optical 3×3 switch based on general interference multimode interference (GI-MMI) structure is proposed in this study. Two 3×3 multimode interference couplers are cascaded to realize an all-optical switch operating at both wavelengths of 1550 nm and 1310 nm. Two nonlinear directional couplers at two outer-arms of the structure are used as all-optical phase shifters to achieve all switching states and to control the switching states. Analytical expressions for switching operation using the transfer matrix method are presented. The beam propagation method (BPM) is used to design and optimize the whole structure. The optimal design of the all-optical phase shifters and 3×3 MMI couplers are carried out to reduce the switching power and loss.

Transmit Designs for the MIMO Broadcast Channel With Statistical CSI

NASA Astrophysics Data System (ADS)

Wu, Yongpeng; Jin, Shi; Gao, Xiqi; McKay, Matthew R.; Xiao, Chengshan

2014-09-01

We investigate the multiple-input multiple-output broadcast channel with statistical channel state information available at the transmitter. The so-called linear assignment operation is employed, and necessary conditions are derived for the optimal transmit design under general fading conditions. Based on this, we introduce an iterative algorithm to maximize the linear assignment weighted sum-rate by applying a gradient descent method. To reduce complexity, we derive an upper bound of the linear assignment achievable rate of each receiver, from which a simplified closed-form expression for a near-optimal linear assignment matrix is derived. This reveals an interesting construction analogous to that of dirty-paper coding. In light of this, a low complexity transmission scheme is provided. Numerical examples illustrate the significant performance of the proposed low complexity scheme.

Study of flutter related computational procedures for minimum weight structural sizing of advanced aircraft, supplemental data

NASA Technical Reports Server (NTRS)

Oconnell, R. F.; Hassig, H. J.; Radovcich, N. A.

1975-01-01

Computational aspects of (1) flutter optimization (minimization of structural mass subject to specified flutter requirements), (2) methods for solving the flutter equation, and (3) efficient methods for computing generalized aerodynamic force coefficients in the repetitive analysis environment of computer-aided structural design are discussed. Specific areas included: a two-dimensional Regula Falsi approach to solving the generalized flutter equation; method of incremented flutter analysis and its applications; the use of velocity potential influence coefficients in a five-matrix product formulation of the generalized aerodynamic force coefficients; options for computational operations required to generate generalized aerodynamic force coefficients; theoretical considerations related to optimization with one or more flutter constraints; and expressions for derivatives of flutter-related quantities with respect to design variables.

Validation of a rapid DNA process with the RapidHIT® ID system using GlobalFiler® Express chemistry, a platform optimized for decentralized testing environments.

PubMed

Salceda, Susana; Barican, Arnaldo; Buscaino, Jacklyn; Goldman, Bruce; Klevenberg, Jim; Kuhn, Melissa; Lehto, Dennis; Lin, Frank; Nguyen, Phong; Park, Charles; Pearson, Francesca; Pittaro, Rick; Salodkar, Sayali; Schueren, Robert; Smith, Corey; Troup, Charles; Tsou, Dean; Vangbo, Mattias; Wunderle, Justus; King, David

2017-05-01

The RapidHIT ® ID is a fully automated sample-to-answer system for short tandem repeat (STR)-based human identification. The RapidHIT ID has been optimized for use in decentralized environments and processes presumed single source DNA samples, generating Combined DNA Index System (CODIS)-compatible DNA profiles in less than 90min. The system is easy to use, requiring less than one minute of hands-on time. Profiles are reviewed using centralized linking software, RapidLINK™ (IntegenX, Pleasanton, CA), a software tool designed to collate DNA profiles from single or multiple RapidHIT ID systems at different geographic locations. The RapidHIT ID has been designed to employ GlobalFiler ® Express and AmpFLSTR ® NGMSElect™, Thermo Fisher Scientific (Waltham, MA) STR chemistries. The Developmental Validation studies were performed using GlobalFiler ® Express with single source reference samples according to Scientific Working Group for DNA Analysis Methods guidelines. These results show that multiple RapidHIT ID systems networked with RapidLINK software form a highly reliable system for wide-scale deployment in locations such as police booking stations and border crossings enabling real-time testing of arrestees, potential human trafficking victims, and other instances where rapid turnaround is essential. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.

[Effect of gene optimization on the expression and purification of HDV small antigen produced by genetic engineering].

PubMed

Ding, Jun-Ying; Meng, Qing-Ling; Guo, Min-Zhuo; Yi, Yao; Su, Qiu-Dong; Lu, Xue-Xin; Qiu, Feng; Bi, Sheng-Li

2012-10-01

To study the effect of gene optimization on the expression and purification of HDV small antigen produced by genetic engineering. Based on the colon preference of E. coli, the HDV small antigen original gene from GenBank was optimized. Both the original gene and the optimized gene expressed in prokaryotic cells, SDS-PAGE was made to analyze the protein expression yield and to decide which protein expression style was more proportion than the other. Furthermore, two antigens were purified by chromatography in order to compare the purity by SDS-PAGE and Image Lab software. SDS-PAGE indicated that the molecular weight of target proteins from two groups were the same as we expected. Gene optimization resulted in the higher yield and it could make the product more soluble. After chromatography, the purity of target protein from optimized gene was up to 96.3%, obviously purer than that from original gene. Gene optimization could increase the protein expression yield and solubility of genetic engineering HDV small antigen. In addition, the product from the optimized gene group was easier to be purified for diagnosis usage.

Cloning, optimization of induction conditions and purification of Mycobacterium tuberculosis Rv1733c protein expressed in Escherichia coli

PubMed Central

Ashayeri-Panah, Mitra; Eftekhar, Fereshteh; Kazemi, Bahram; Joseph, Joan

2017-01-01

Background and Objectives: Rv1733c is a latency antigen from Mycobacterium tuberculosis, a probable integral-membrane protein with promiscuous T-cell and B-cell epitopes, making it a potential vaccine candidate against tuberculosis. This study aimed to clone and optimize the expression of recombinant Rv1733c in Escherichia coli for purification. Materials and Methods: Chemically synthesized rv1733c coding sequence was cloned in pET-23a(+) followed by transforming E. coli BL21 (DE3) cells. To evaluate the induction conditions for optimized expression, factorial design of experiments was employed using four different media as well as four levels of isopropyl-b-D-thiogalactopyranosid [IPTG] concentration and duration of induction. The recombinant protein was then purified using a His-tag purification kit and detected through western blotting. Results: Recombinant Rv1733c (> 24 kDa) was expressed and accumulated in the cytoplasm of the E. coli cells. Medium composition showed the most significant effect on the yield of the recombinant protein (P = 0.000). The highest yield of recombinant Rv1733c occurred in the presence of 0.4 mM of IPTG in Terrific Broth medium (containing 1.2% tryptone, 2.4% yeast extract, 72 mM K 2 HPO 4 , 17 mM KH 2 PO 4 and 0.4% glycerol) after 10 h at 37°C. Under these conditions, the expression level was around 0.5 g/L of culture medium. Purified Rv1733c was detected by an anti-polyhistidine antibody and a tuberculosis patient’s serum. Systematic optimization of induction conditions gave us high yield of recombinant polyhistidine-tagged Rv1733c in E. coli which was successfuly purified. Conclusion: We believe that the purified Rv1733c recombinant protein from M. tuberculosis might be a good candidate for vaccine production against tuberculosis. PMID:29213997

Shape Optimization of Cylindrical Shell for Interior Noise

NASA Technical Reports Server (NTRS)

Robinson, Jay H.

1999-01-01

In this paper an analytic method is used to solve for the cross spectral density of the interior acoustic response of a cylinder with nonuniform thickness subjected to turbulent boundary layer excitation. The cylinder is of honeycomb core construction with the thickness of the core material expressed as a cosine series in the circumferential direction. The coefficients of this series are used as the design variable in the optimization study. The objective function is the space and frequency averaged acoustic response. Results confirm the presence of multiple local minima as previously reported and demonstrate the potential for modest noise reduction.

How precise can atoms of a nanocluster be located in 3D using a tilt series of scanning transmission electron microscopy images?

PubMed

Alania, M; De Backer, A; Lobato, I; Krause, F F; Van Dyck, D; Rosenauer, A; Van Aert, S

2017-10-01

In this paper, we investigate how precise atoms of a small nanocluster can ultimately be located in three dimensions (3D) from a tilt series of images acquired using annular dark field (ADF) scanning transmission electron microscopy (STEM). Therefore, we derive an expression for the statistical precision with which the 3D atomic position coordinates can be estimated in a quantitative analysis. Evaluating this statistical precision as a function of the microscope settings also allows us to derive the optimal experimental design. In this manner, the optimal angular tilt range, required electron dose, optimal detector angles, and number of projection images can be determined. Copyright © 2016 Elsevier B.V. All rights reserved.

A general framework for optimization of probes for gene expression microarray and its application to the fungus Podospora anserina

PubMed Central

2010-01-01

Background The development of new microarray technologies makes custom long oligonucleotide arrays affordable for many experimental applications, notably gene expression analyses. Reliable results depend on probe design quality and selection. Probe design strategy should cope with the limited accuracy of de novo gene prediction programs, and annotation up-dating. We present a novel in silico procedure which addresses these issues and includes experimental screening, as an empirical approach is the best strategy to identify optimal probes in the in silico outcome. Findings We used four criteria for in silico probe selection: cross-hybridization, hairpin stability, probe location relative to coding sequence end and intron position. This latter criterion is critical when exon-intron gene structure predictions for intron-rich genes are inaccurate. For each coding sequence (CDS), we selected a sub-set of four probes. These probes were included in a test microarray, which was used to evaluate the hybridization behavior of each probe. The best probe for each CDS was selected according to three experimental criteria: signal-to-noise ratio, signal reproducibility, and representative signal intensities. This procedure was applied for the development of a gene expression Agilent platform for the filamentous fungus Podospora anserina and the selection of a single 60-mer probe for each of the 10,556 P. anserina CDS. Conclusions A reliable gene expression microarray version based on the Agilent 44K platform was developed with four spot replicates of each probe to increase statistical significance of analysis. PMID:20565839

Optimization of industrial microorganisms: recent advances in synthetic dynamic regulators.

PubMed

Min, Byung Eun; Hwang, Hyun Gyu; Lim, Hyun Gyu; Jung, Gyoo Yeol

2017-01-01

Production of biochemicals by industrial fermentation using microorganisms requires maintaining cellular production capacity, because maximal productivity is economically important. High-productivity microbial strains can be developed using static engineering, but these may not maintain maximal productivity throughout the culture period as culture conditions and cell states change dynamically. Additionally, economic reasons limit heterologous protein expression using inducible promoters to prevent metabolic burden for commodity chemical and biofuel production. Recently, synthetic and systems biology has been used to design genetic circuits, precisely controlling gene expression or influencing genetic behavior toward a desired phenotype. Development of dynamic regulators can maintain cellular phenotype in a maximum production state in response to factors including cell concentration, oxygen, temperature, pH, and metabolites. Herein, we introduce dynamic regulators of industrial microorganism optimization and discuss metabolic flux fine control by dynamic regulators in response to metabolites or extracellular stimuli, robust production systems, and auto-induction systems using quorum sensing.

Increased dipicolinic acid production with an enhanced spoVF operon in Bacillus subtilis and medium optimization.

PubMed

Takahashi, Fumikazu; Sumitomo, Nobuyuki; Hagihara, Hiroshi; Ozaki, Katsuya

2015-01-01

Dipicolinic acid (DPA) is a multi-functional agent for cosmetics, antimicrobial products, detergents, and functional polymers. The aim of this study was to design a new method for producing DPA from renewable material. The Bacillus subtilis spoVF operon encodes enzymes for DPA synthase and the part of lysine biosynthetic pathway. However, DPA is only synthesized in the sporulation phase, so the productivity of DPA is low level. Here, we report that DPA synthase was expressed in vegetative cells, and DPA was produced in the culture medium by replacement of the spoVFA promoter with other highly expressed promoter in B. subtilis vegetative cells, such as spoVG promoter. DPA levels were increased in the culture medium of genetically modified strains. DPA productivity was significantly improved up to 29.14 g/L in 72 h culture by improving the medium composition using a two-step optimization technique with the Taguchi methodology.

Wide-Field-of-View Millimeter-Wave Telescope Design with Ultra-Low Cross-Polarization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bernacki, Bruce E.; Kelly, James F.; Sheen, David M.

2012-05-01

As millimeter-wave arrays become available, off-axis imaging performance of the fore optics increases in importance due to the relatively large physical extent of the arrays. Typically, simple optical telescope designs are adapted to millimeter-wave imaging but single-mirror spherical or classic conic designs cannot deliver adequate image quality except near the optical axis. Since most millimeter-wave designs are quasi-optical, optical ray tracing and commercial design software can be used to optimize designs to improve off-axis imaging as well as minimize cross-polarization. Methods that obey the Dragone-Mizuguchi condition for the design of reflective millimeter-wave telescopes with low cross-polarization also provide additional degreesmore » of freedom that offer larger fields of view than possible with single-reflector designs. Dragone’s graphical design method does not lend itself readily to computer-based optical design approaches, but subsequent authors expanded on Dragone’s geometric design approach with analytic expressions that describe the location, shape, off-axis height and tilt of the telescope elements that satisfy Dragone’s design rules and can be used as a first-order design for subsequent computer-based design and optimization. We investigate two design variants that obey the Dragone-Mizuguchi conditions that exhibit ultra-low polarization crosstalk and a large diffraction-limited field of view well suited to millimeter-wave imaging arrays.« less

Employing epigenetics to augment the expression of therapeutic proteins in mammalian cells.

PubMed

Kwaks, Ted H J; Otte, Arie P

2006-03-01

Recombinant proteins form an increasingly large part of the portfolio of biopharmaceutical companies. Production of these often complex transgenic proteins is achieved predominantly in mammalian cell lines but the process is hampered by low yields and unstable expression. Some of these problems are caused by gene silencing at the level of chromatin - so-called epigenetic gene silencing. Here, we describe approaches, which have emerged during the past few years, designed to interfere with epigenetic gene silencing with the aim of enhancing and stabilizing transgene expression. These include targeting histones, the inclusion of specific DNA elements and targeting sites of high gene-expression. We conclude that employing epigenetic gene regulation tools, in combination with further process optimization, might represent the next step forward in the production of therapeutic proteins.

Identifying the perfect absorption of metamaterial absorbers

NASA Astrophysics Data System (ADS)

Duan, G.; Schalch, J.; Zhao, X.; Zhang, J.; Averitt, R. D.; Zhang, X.

2018-01-01

We present a detailed analysis of the conditions that result in unity absorption in metamaterial absorbers to guide the design and optimization of this important class of functional electromagnetic composites. Multilayer absorbers consisting of a metamaterial layer, dielectric spacer, and ground plane are specifically considered. Using interference theory, the dielectric spacer thickness and resonant frequency for unity absorption can be numerically determined from the functional dependence of the relative phase shift of the total reflection. Further, using transmission line theory in combination with interference theory we obtain analytical expressions for the unity absorption resonance frequency and corresponding spacer layer thickness in terms of the bare resonant frequency of the metamaterial layer and metallic and dielectric losses within the absorber structure. These simple expressions reveal a redshift of the unity absorption frequency with increasing loss that, in turn, necessitates an increase in the thickness of the dielectric spacer. The results of our analysis are experimentally confirmed by performing reflection-based terahertz time-domain spectroscopy on fabricated absorber structures covering a range of dielectric spacer thicknesses with careful control of the loss accomplished through water absorption in a semiporous polyimide dielectric spacer. Our findings can be widely applied to guide the design and optimization of the metamaterial absorbers and sensors.

Determining optimal parameters in magnetic spacecraft stabilization via attitude feedback

NASA Astrophysics Data System (ADS)

Bruni, Renato; Celani, Fabio

2016-10-01

The attitude control of a spacecraft using magnetorquers can be achieved by a feedback control law which has four design parameters. However, the practical determination of appropriate values for these parameters is a critical open issue. We propose here an innovative systematic approach for finding these values: they should be those that minimize the convergence time to the desired attitude. This a particularly diffcult optimization problem, for several reasons: 1) such time cannot be expressed in analytical form as a function of parameters and initial conditions; 2) design parameters may range over very wide intervals; 3) convergence time depends also on the initial conditions of the spacecraft, which are not known in advance. To overcome these diffculties, we present a solution approach based on derivative-free optimization. These algorithms do not need to write analytically the objective function: they only need to compute it in a number of points. We also propose a fast probing technique to identify which regions of the search space have to be explored densely. Finally, we formulate a min-max model to find robust parameters, namely design parameters that minimize convergence time under the worst initial conditions. Results are very promising.

[Optimization of application parameters of soil seed bank in vegetation recovery via response surface methodology].

PubMed

He, Meng-Xuan; Li, Hong-Yuan; Mo, Xun-Qiang; Meng, Wei-Qing; Yang, Jia-Nan

2014-08-01

The thickness of surface soil, the covering thickness and the number of adding arbor seeds are all important factors to be considered in the application of soil seed bank (SSB) for vegetation recovery. To determine the optimal conditions, the Box-Behnken central composite design with three parameters and three levels was conducted and Design-Expert was used for response surface optimization. Finally, the optimal model and optimal level of each parameter were selected. The quadratic model was more suitable for response surface optimization (P < 0.0001), indicating the model had good statistical significance which could express ideal relations between all the independent variable and dependent variable. For the optimum condition, the thickness of surface soil was 4.3 cm, the covering thickness was 2 cm, and the number of adding arbor seeds was 224 ind x m(-2), under which the number of germinated seedlings could be reached up to 6222 plants x m(-2). During the process of seed germination, significant interactions between the thickness of surface soil and the covering thickness, as well as the thickness of surface soil and the number of adding arbor seeds were found, but the relationship between the covering thickness and the number of adding arbor seeds was relatively unremarkable. Among all the parameters, the thickness of surface soil was the most important one, which had the steepest curve and the largest standardized coefficient.

Comparison of fan beam, slit-slat and multi-pinhole collimators for molecular breast tomosynthesis.

PubMed

van Roosmalen, Jarno; Beekman, Freek J; Goorden, Marlies C

2018-05-16

Recently, we proposed and optimized dedicated multi-pinhole molecular breast tomosynthesis (MBT) that images a lightly compressed breast. As MBT may also be performed with other types of collimators, the aim of this paper is to optimize MBT with fan beam and slit-slat collimators and to compare its performance to that of multi-pinhole MBT to arrive at a truly optimized design. Using analytical expressions, we first optimized fan beam and slit-slat collimator parameters to reach maximum sensitivity at a series of given system resolutions. Additionally, we performed full system simulations of a breast phantom containing several tumours for the optimized designs. We found that at equal system resolution the maximum achievable sensitivity increases from pinhole to slit-slat to fan beam collimation with fan beam and slit-slat MBT having on average a 48% and 20% higher sensitivity than multi-pinhole MBT. Furthermore, by inspecting simulated images and applying a tumour-to-background contrast-to-noise (TB-CNR) analysis, we found that slit-slat collimators underperform with respect to the other collimator types. The fan beam collimators obtained a similar TB-CNR as the pinhole collimators, but the optimum was reached at different system resolutions. For fan beam collimators, a 6-8 mm system resolution was optimal in terms of TB-CNR, while with pinhole collimation highest TB-CNR was reached in the 7-10 mm range.

Coach simplified structure modeling and optimization study based on the PBM method

NASA Astrophysics Data System (ADS)

Zhang, Miaoli; Ren, Jindong; Yin, Ying; Du, Jian

2016-09-01

For the coach industry, rapid modeling and efficient optimization methods are desirable for structure modeling and optimization based on simplified structures, especially for use early in the concept phase and with capabilities of accurately expressing the mechanical properties of structure and with flexible section forms. However, the present dimension-based methods cannot easily meet these requirements. To achieve these goals, the property-based modeling (PBM) beam modeling method is studied based on the PBM theory and in conjunction with the characteristics of coach structure of taking beam as the main component. For a beam component of concrete length, its mechanical characteristics are primarily affected by the section properties. Four section parameters are adopted to describe the mechanical properties of a beam, including the section area, the principal moments of inertia about the two principal axles, and the torsion constant of the section. Based on the equivalent stiffness strategy, expressions for the above section parameters are derived, and the PBM beam element is implemented in HyperMesh software. A case is realized using this method, in which the structure of a passenger coach is simplified. The model precision is validated by comparing the basic performance of the total structure with that of the original structure, including the bending and torsion stiffness and the first-order bending and torsional modal frequencies. Sensitivity analysis is conducted to choose design variables. The optimal Latin hypercube experiment design is adopted to sample the test points, and polynomial response surfaces are used to fit these points. To improve the bending and torsion stiffness and the first-order torsional frequency and taking the allowable maximum stresses of the braking and left turning conditions as constraints, the multi-objective optimization of the structure is conducted using the NSGA-II genetic algorithm on the ISIGHT platform. The result of the Pareto solution set is acquired, and the selection strategy of the final solution is discussed. The case study demonstrates that the mechanical performances of the structure can be well-modeled and simulated by PBM beam. Because of the merits of fewer parameters and convenience of use, this method is suitable to be applied in the concept stage. Another merit is that the optimization results are the requirements for the mechanical performance of the beam section instead of those of the shape and dimensions, bringing flexibility to the succeeding design.

Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.

PubMed

Echigoya, Yusuke; Lim, Kenji Rowel Q; Trieu, Nhu; Bao, Bo; Miskew Nichols, Bailey; Vila, Maria Candida; Novak, James S; Hara, Yuko; Lee, Joshua; Touznik, Aleksander; Mamchaoui, Kamel; Aoki, Yoshitsugu; Takeda, Shin'ichi; Nagaraju, Kanneboyina; Mouly, Vincent; Maruyama, Rika; Duddy, William; Yokota, Toshifumi

2017-11-01

Duchenne muscular dystrophy (DMD), the most common lethal genetic disorder, is caused by mutations in the dystrophin (DMD) gene. Exon skipping is a therapeutic approach that uses antisense oligonucleotides (AOs) to modulate splicing and restore the reading frame, leading to truncated, yet functional protein expression. In 2016, the US Food and Drug Administration (FDA) conditionally approved the first phosphorodiamidate morpholino oligomer (morpholino)-based AO drug, eteplirsen, developed for DMD exon 51 skipping. Eteplirsen remains controversial with insufficient evidence of its therapeutic effect in patients. We recently developed an in silico tool to design antisense morpholino sequences for exon skipping. Here, we designed morpholino AOs targeting DMD exon 51 using the in silico tool and quantitatively evaluated the effects in immortalized DMD muscle cells in vitro. To our surprise, most of the newly designed morpholinos induced exon 51 skipping more efficiently compared with the eteplirsen sequence. The efficacy of exon 51 skipping and rescue of dystrophin protein expression were increased by up to more than 12-fold and 7-fold, respectively, compared with the eteplirsen sequence. Significant in vivo efficacy of the most effective morpholino, determined in vitro, was confirmed in mice carrying the human DMD gene. These findings underscore the importance of AO sequence optimization for exon skipping. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Animal component-free Agrobacterium tumefaciens cultivation media for better GMP-compliance increases biomass yield and pharmaceutical protein expression in Nicotiana benthamiana.

PubMed

Houdelet, Marcel; Galinski, Anna; Holland, Tanja; Wenzel, Kathrin; Schillberg, Stefan; Buyel, Johannes Felix

2017-04-01

Transient expression systems allow the rapid production of recombinant proteins in plants. Such systems can be scaled up to several hundred kilograms of biomass, making them suitable for the production of pharmaceutical proteins required at short notice, such as emergency vaccines. However, large-scale transient expression requires the production of recombinant Agrobacterium tumefaciens strains with the capacity for efficient gene transfer to plant cells. The complex media often used for the cultivation of this species typically include animal-derived ingredients that can contain human pathogens, thus conflicting with the requirements of good manufacturing practice (GMP). We replaced all the animal-derived components in yeast extract broth (YEB) cultivation medium with soybean peptone, and then used a design-of-experiments approach to optimize the medium composition, increasing the biomass yield while maintaining high levels of transient expression in subsequent infiltration experiments. The resulting plant peptone Agrobacterium medium (PAM) achieved a two-fold increase in OD 600 compared to YEB medium during a 4-L batch fermentation lasting 18 h. Furthermore, the yields of the monoclonal antibody 2G12 and the fluorescent protein DsRed were maintained when the cells were cultivated in PAM rather than YEB. We have thus demonstrated a simple, efficient and scalable method for medium optimization that reduces process time and costs. The final optimized medium for the cultivation of A. tumefaciens completely lacks animal-derived components, thus facilitating the GMP-compliant large-scale transient expression of recombinant proteins in plants. © 2017 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A New Scheme for the Design of Hilbert Transform Pairs of Biorthogonal Wavelet Bases

NASA Astrophysics Data System (ADS)

Shi, Hongli; Luo, Shuqian

2010-12-01

In designing the Hilbert transform pairs of biorthogonal wavelet bases, it has been shown that the requirements of the equal-magnitude responses and the half-sample phase offset on the lowpass filters are the necessary and sufficient condition. In this paper, the relationship between the phase offset and the vanishing moment difference of biorthogonal scaling filters is derived, which implies a simple way to choose the vanishing moments so that the phase response requirement can be satisfied structurally. The magnitude response requirement is approximately achieved by a constrained optimization procedure, where the objective function and constraints are all expressed in terms of the auxiliary filters of scaling filters rather than the scaling filters directly. Generally, the calculation burden in the design implementation will be less than that of the current schemes. The integral of magnitude response difference between the primal and dual scaling filters has been chosen as the objective function, which expresses the magnitude response requirements in the whole frequency range. Two design examples illustrate that the biorthogonal wavelet bases designed by the proposed scheme are very close to Hilbert transform pairs.

Optimization of Soft Tissue Management, Spacer Design, and Grafting Strategies for Large Segmental Bone Defects using the Chronic Caprine Tibial Defect Model

DTIC Science & Technology

2015-12-01

found with Tukey’s HSD post hoc analysis. Several target genes such as Oct4, Sox2, TGFB, and Col1A1 were generally up-regulated in all sections. In...expression analysis from the Aim 1 samples presented several upregulated target genes such as Oct4, Sox2, TGFB, and Col1A1 in all sections. No...TGFB, and Col1A1 . • Data from cellular analysis, histology, gene expression analysis and microCT are being assembled for the predictive model

OptSSeq: High-throughput sequencing readout of growth enrichment defines optimal gene expression elements for homoethanologenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh, Indro Neil; Landick, Robert

The optimization of synthetic pathways is a central challenge in metabolic engineering. OptSSeq (Optimization by Selection and Sequencing) is one approach to this challenge. OptSSeq couples selection of optimal enzyme expression levels linked to cell growth rate with high-throughput sequencing to track enrichment of gene expression elements (promoters and ribosomebinding sites) from a combinatorial library. OptSSeq yields information on both optimal and suboptimal enzyme levels, and helps identify constraints that limit maximal product formation. Here we report a proof-of-concept implementation of OptSSeq using homoethanologenesis, a two-step pathway consisting of pyruvate decarboxylase (Pdc) and alcohol dehydrogenase (Adh) that converts pyruvate tomore » ethanol and is naturally optimized in the bacterium Zymomonas mobilis. We used OptSSeq to determine optimal gene expression elements and enzyme levels for Z. mobilis Pdc, AdhA, and AdhB expressed in Escherichia coli. By varying both expression signals and gene order, we identified an optimal solution using only Pdc and AdhB. We resolved current uncertainty about the functions of the Fe 2+-dependent AdhB and Zn 2+- dependent AdhA by showing that AdhB is preferred over AdhA for rapid growth in both E. coli and Z. mobilis. Finally, by comparing predictions of growth-linked metabolic flux to enzyme synthesis costs, we established that optimal E. coli homoethanologenesis was achieved by our best pdc-adhB expression cassette and that the remaining constraints lie in the E. coli metabolic network or inefficient Pdc or AdhB function in E. coli. Furthermore, OptSSeq is a general tool for synthetic biology to tune enzyme levels in any pathway whose optimal function can be linked to cell growth or survival.« less

OptSSeq: High-throughput sequencing readout of growth enrichment defines optimal gene expression elements for homoethanologenesis

DOE PAGES

Ghosh, Indro Neil; Landick, Robert

2016-07-16

The optimization of synthetic pathways is a central challenge in metabolic engineering. OptSSeq (Optimization by Selection and Sequencing) is one approach to this challenge. OptSSeq couples selection of optimal enzyme expression levels linked to cell growth rate with high-throughput sequencing to track enrichment of gene expression elements (promoters and ribosomebinding sites) from a combinatorial library. OptSSeq yields information on both optimal and suboptimal enzyme levels, and helps identify constraints that limit maximal product formation. Here we report a proof-of-concept implementation of OptSSeq using homoethanologenesis, a two-step pathway consisting of pyruvate decarboxylase (Pdc) and alcohol dehydrogenase (Adh) that converts pyruvate tomore » ethanol and is naturally optimized in the bacterium Zymomonas mobilis. We used OptSSeq to determine optimal gene expression elements and enzyme levels for Z. mobilis Pdc, AdhA, and AdhB expressed in Escherichia coli. By varying both expression signals and gene order, we identified an optimal solution using only Pdc and AdhB. We resolved current uncertainty about the functions of the Fe 2+-dependent AdhB and Zn 2+- dependent AdhA by showing that AdhB is preferred over AdhA for rapid growth in both E. coli and Z. mobilis. Finally, by comparing predictions of growth-linked metabolic flux to enzyme synthesis costs, we established that optimal E. coli homoethanologenesis was achieved by our best pdc-adhB expression cassette and that the remaining constraints lie in the E. coli metabolic network or inefficient Pdc or AdhB function in E. coli. Furthermore, OptSSeq is a general tool for synthetic biology to tune enzyme levels in any pathway whose optimal function can be linked to cell growth or survival.« less

An integrated biotechnology platform for developing sustainable chemical processes.

PubMed

Barton, Nelson R; Burgard, Anthony P; Burk, Mark J; Crater, Jason S; Osterhout, Robin E; Pharkya, Priti; Steer, Brian A; Sun, Jun; Trawick, John D; Van Dien, Stephen J; Yang, Tae Hoon; Yim, Harry

2015-03-01

Genomatica has established an integrated computational/experimental metabolic engineering platform to design, create, and optimize novel high performance organisms and bioprocesses. Here we present our platform and its use to develop E. coli strains for production of the industrial chemical 1,4-butanediol (BDO) from sugars. A series of examples are given to demonstrate how a rational approach to strain engineering, including carefully designed diagnostic experiments, provided critical insights about pathway bottlenecks, byproducts, expression balancing, and commercial robustness, leading to a superior BDO production strain and process.

Image denoising in mixed Poisson-Gaussian noise.

PubMed

Luisier, Florian; Blu, Thierry; Unser, Michael

2011-03-01

We propose a general methodology (PURE-LET) to design and optimize a wide class of transform-domain thresholding algorithms for denoising images corrupted by mixed Poisson-Gaussian noise. We express the denoising process as a linear expansion of thresholds (LET) that we optimize by relying on a purely data-adaptive unbiased estimate of the mean-squared error (MSE), derived in a non-Bayesian framework (PURE: Poisson-Gaussian unbiased risk estimate). We provide a practical approximation of this theoretical MSE estimate for the tractable optimization of arbitrary transform-domain thresholding. We then propose a pointwise estimator for undecimated filterbank transforms, which consists of subband-adaptive thresholding functions with signal-dependent thresholds that are globally optimized in the image domain. We finally demonstrate the potential of the proposed approach through extensive comparisons with state-of-the-art techniques that are specifically tailored to the estimation of Poisson intensities. We also present denoising results obtained on real images of low-count fluorescence microscopy.

Analysis of the faster-than-Nyquist optimal linear multicarrier system

NASA Astrophysics Data System (ADS)

Marquet, Alexandre; Siclet, Cyrille; Roque, Damien

2017-02-01

Faster-than-Nyquist signalization enables a better spectral efficiency at the expense of an increased computational complexity. Regarding multicarrier communications, previous work mainly relied on the study of non-linear systems exploiting coding and/or equalization techniques, with no particular optimization of the linear part of the system. In this article, we analyze the performance of the optimal linear multicarrier system when used together with non-linear receiving structures (iterative decoding and direct feedback equalization), or in a standalone fashion. We also investigate the limits of the normality assumption of the interference, used for implementing such non-linear systems. The use of this optimal linear system leads to a closed-form expression of the bit-error probability that can be used to predict the performance and help the design of coded systems. Our work also highlights the great performance/complexity trade-off offered by decision feedback equalization in a faster-than-Nyquist context. xml:lang="fr"

Advanced generation anti-prostate specific membrane antigen designer T cells for prostate cancer immunotherapy.

PubMed

Ma, Qiangzhong; Gomes, Erica M; Lo, Agnes Shuk-Yee; Junghans, Richard P

2014-02-01

Adoptive immunotherapy by infusion of designer T cells (dTc) engineered with chimeric antigen receptors (CARs) for tumoricidal activity represents a potentially highly specific modality for the treatment of cancer. In this study, 2nd generation (gen) anti-prostate specific membrane antigen (PSMA) dTc were developed for improving the efficacy of previously developed 1st gen dTc for prostate cancer immunotherapy. The 1st gen dTc are modified with chimeric immunoglobulin-T cell receptor (IgTCR) while the 2nd gen dTc are engineered with an immunoglobulin-CD28-T cell receptor (IgCD28TCR), which incorporates a CD28 costimulatory signal for optimal T cell activation. A 2nd gen anti-PSMA IgCD28TCR CAR was constructed by inserting the CD28 signal domain into the 1st gen CAR. 1st and 2nd gen anti-PSMA dTc were created by transducing human T cells with anti-PSMA CARs and their antitumor efficacy was compared for specific activation on PSMA-expressing tumor contact, cytotoxicity against PSMA-expressing tumor cells in vitro, and suppression of tumor growth in an animal model. The 2nd gen dTc can be optimally activated to secrete larger amounts of cytokines such as IL2 and IFNγ than 1st gen and to proliferate more vigorously on PSMA-expressing tumor contact. More importantly, the 2nd gen dTc preserve the PSMA-specific cytotoxicity in vitro and suppress tumor growth in animal models with significant higher potency. Our results demonstrate that 2nd gen anti-PSMA designer T cells exhibit superior antitumor functions versus 1st gen, providing a rationale for advancing this improved agent toward clinical application in prostate cancer immunotherapy. © 2013 Wiley Periodicals, Inc.

A Genetic Toolbox for Modulating the Expression of Heterologous Genes in the Cyanobacterium Synechocystis sp. PCC 6803

DOE PAGES

Wang, Bo; Eckert, Carrie; Maness, Pin -Ching; ...

2017-12-12

Cyanobacteria, genetic models for photosynthesis research for decades, have recently become attractive hosts for producing renewable fuels and chemicals, owing to their genetic tractability, relatively fast growth, and their ability to utilize sunlight, fix carbon dioxide, and in some cases, fix nitrogen. Despite significant advances, there is still an urgent demand for synthetic biology tools in order to effectively manipulate genetic circuits in cyanobacteria. In this study, we have compared a total of 17 natural and chimeric promoters, focusing on expression of the ethylene-forming enzyme (EFE) in the cyanobacterium Synechocystis sp. PCC 6803. We report the finding that the E.more » coli σ 70 promoter Ptrc is superior compared to the previously reported strong promoters, such as PcpcB and PpsbA, for the expression of EFE. In addition, we found that the EFE expression level was very sensitive to the 5'-untranslated region upstream of the open reading frame. A library of ribosome binding sites (RBSs) was rationally designed and was built and systematically characterized. We demonstrate a strategy complementary to the RBS prediction software to facilitate the rational design of an RBS library to optimize the gene expression in cyanobacteria. Our results show that the EFE expression level is dramatically enhanced through these synthetic biology tools and is no longer the rate-limiting step for cyanobacterial ethylene production. Furthermore, these systematically characterized promoters and the RBS design strategy can serve as useful tools to tune gene expression levels and to identify and mitigate metabolic bottlenecks in cyanobacteria.« less

A Genetic Toolbox for Modulating the Expression of Heterologous Genes in the Cyanobacterium Synechocystis sp. PCC 6803

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Bo; Eckert, Carrie; Maness, Pin -Ching

Cyanobacteria, genetic models for photosynthesis research for decades, have recently become attractive hosts for producing renewable fuels and chemicals, owing to their genetic tractability, relatively fast growth, and their ability to utilize sunlight, fix carbon dioxide, and in some cases, fix nitrogen. Despite significant advances, there is still an urgent demand for synthetic biology tools in order to effectively manipulate genetic circuits in cyanobacteria. In this study, we have compared a total of 17 natural and chimeric promoters, focusing on expression of the ethylene-forming enzyme (EFE) in the cyanobacterium Synechocystis sp. PCC 6803. We report the finding that the E.more » coli σ 70 promoter Ptrc is superior compared to the previously reported strong promoters, such as PcpcB and PpsbA, for the expression of EFE. In addition, we found that the EFE expression level was very sensitive to the 5'-untranslated region upstream of the open reading frame. A library of ribosome binding sites (RBSs) was rationally designed and was built and systematically characterized. We demonstrate a strategy complementary to the RBS prediction software to facilitate the rational design of an RBS library to optimize the gene expression in cyanobacteria. Our results show that the EFE expression level is dramatically enhanced through these synthetic biology tools and is no longer the rate-limiting step for cyanobacterial ethylene production. Furthermore, these systematically characterized promoters and the RBS design strategy can serve as useful tools to tune gene expression levels and to identify and mitigate metabolic bottlenecks in cyanobacteria.« less

A simple method to determine IgG light chain to heavy chain polypeptide ratios expressed by CHO cells.

PubMed

Gerster, Anja; Wodarczyk, Claas; Reichenbächer, Britta; Köhler, Janet; Schulze, Andreas; Krause, Felix; Müller, Dethardt

2016-12-01

To establish a high-throughput method for determination of antibodies intra- and extracellular light chain (LC) to heavy chain (HC) polypeptide ratio as screening parameter during cell line development. Chinese Hamster Ovary (CHO) TurboCell pools containing different designed vectors supposed to result in different LC:HC polypeptide ratios were generated by targeted integration. Cell culture supernatants and cell lysates of a fed batch experiment were purified by combined Protein A and anti-kappa affinity batch purification in 96-well format. Capture of all antibodies and their fragments allowed the determination of the intra- and extracellular LC:HC peptide ratios by reduced SDS capillary electrophoresis. Results demonstrate that the method is suitable to show the significant impact of the vector design on the intra- and extracellular LC:HC polypeptide ratios. Determination of LC:HC polypeptide ratios can give important information in vector design optimization leading to CHO cell lines with optimized antibody assembly and preferred product quality.

Stochastic Control Synthesis of Systems with Structured Uncertainty

NASA Technical Reports Server (NTRS)

Padula, Sharon L. (Technical Monitor); Crespo, Luis G.

2003-01-01

This paper presents a study on the design of robust controllers by using random variables to model structured uncertainty for both SISO and MIMO feedback systems. Once the parameter uncertainty is prescribed with probability density functions, its effects are propagated through the analysis leading to stochastic metrics for the system's output. Control designs that aim for satisfactory performances while guaranteeing robust closed loop stability are attained by solving constrained non-linear optimization problems in the frequency domain. This approach permits not only to quantify the probability of having unstable and unfavorable responses for a particular control design but also to search for controls while favoring the values of the parameters with higher chance of occurrence. In this manner, robust optimality is achieved while the characteristic conservatism of conventional robust control methods is eliminated. Examples that admit closed form expressions for the probabilistic metrics of the output are used to elucidate the nature of the problem at hand and validate the proposed formulations.

Generative Representations for Computer-Automated Evolutionary Design

NASA Technical Reports Server (NTRS)

Hornby, Gregory S.

2006-01-01

With the increasing computational power of computers, software design systems are progressing from being tools for architects and designers to express their ideas to tools capable of creating designs under human guidance. One of the main limitations for these computer-automated design systems is the representation with which they encode designs. If the representation cannot encode a certain design, then the design system cannot produce it. To be able to produce new types of designs, and not just optimize pre-defined parameterizations, evolutionary design systems must use generative representations. Generative representations are assembly procedures, or algorithms, for constructing a design thereby allowing for truly novel design solutions to be encoded. In addition, by enabling modularity, regularity and hierarchy, the level of sophistication that can be evolved is increased. We demonstrate the advantages of generative representations on two different design domains: the evolution of spacecraft antennas and the evolution of 3D objects.

Data Sufficiency Assessment and Pumping Test Design for Groundwater Prediction Using Decision Theory and Genetic Algorithms

NASA Astrophysics Data System (ADS)

McPhee, J.; William, Y. W.

2005-12-01

This work presents a methodology for pumping test design based on the reliability requirements of a groundwater model. Reliability requirements take into consideration the application of the model results in groundwater management, expressed in this case as a multiobjective management model. The pumping test design is formulated as a mixed-integer nonlinear programming (MINLP) problem and solved using a combination of genetic algorithm (GA) and gradient-based optimization. Bayesian decision theory provides a formal framework for assessing the influence of parameter uncertainty over the reliability of the proposed pumping test. The proposed methodology is useful for selecting a robust design that will outperform all other candidate designs under most potential 'true' states of the system

Analysis and design of a genetic circuit for dynamic metabolic engineering.

PubMed

Anesiadis, Nikolaos; Kobayashi, Hideki; Cluett, William R; Mahadevan, Radhakrishnan

2013-08-16

Recent advances in synthetic biology have equipped us with new tools for bioprocess optimization at the genetic level. Previously, we have presented an integrated in silico design for the dynamic control of gene expression based on a density-sensing unit and a genetic toggle switch. In the present paper, analysis of a serine-producing Escherichia coli mutant shows that an instantaneous ON-OFF switch leads to a maximum theoretical productivity improvement of 29.6% compared to the mutant. To further the design, global sensitivity analysis is applied here to a mathematical model of serine production in E. coli coupled with a genetic circuit. The model of the quorum sensing and the toggle switch involves 13 parameters of which 3 are identified as having a significant effect on serine concentration. Simulations conducted in this reduced parameter space further identified the optimal ranges for these 3 key parameters to achieve productivity values close to the maximum theoretical values. This analysis can now be used to guide the experimental implementation of a dynamic metabolic engineering strategy and reduce the time required to design the genetic circuit components.

High-level accumulation of recombinant miraculin protein in transgenic tomatoes expressing a synthetic miraculin gene with optimized codon usage terminated by the native miraculin terminator.

PubMed

Hiwasa-Tanase, Kyoko; Nyarubona, Mpanja; Hirai, Tadayoshi; Kato, Kazuhisa; Ichikawa, Takanari; Ezura, Hiroshi

2011-01-01

In our previous study, a transgenic tomato line that expressed the MIR gene under control of the cauliflower mosaic virus 35S promoter and the nopaline synthase terminator (tNOS) produced the taste-modifying protein miraculin (MIR). However, the concentration of MIR in the tomatoes was lower than that in the MIR gene's native miracle fruit. To increase MIR production, the native MIR terminator (tMIR) was used and a synthetic gene encoding MIR protein (sMIR) was designed to optimize its codon usage for tomato. Four different combinations of these genes and terminators (MIR-tNOS, MIR-tMIR, sMIR-tNOS and sMIR-tMIR) were constructed and used for transformation. The average MIR concentrations in MIR-tNOS, MIR-tMIR, sMIR-tNOS and sMIR-tMIR fruits were 131, 197, 128 and 287 μg/g fresh weight, respectively. The MIR concentrations using tMIR were higher than those using tNOS. The highest MIR accumulation was detected in sMIR-tMIR fruits. On the other hand, the MIR concentration was largely unaffected by sMIR-tNOS. The expression levels of both MIR and sMIR mRNAs terminated by tMIR tended to be higher than those terminated by tNOS. Read-through mRNA transcripts terminated by tNOS were much longer than those terminated by tMIR. These results suggest that tMIR enhances mRNA expression and permits the multiplier effect of optimized codon usage.

Histone-Targeted Nucleic Acid Delivery for Tissue Regenerative Applications

NASA Astrophysics Data System (ADS)

Munsell, Erik V.

Nucleic acid delivery has garnered significant attention as an innovative therapeutic approach for treating a wide variety of diseases. However, the design of non-viral delivery systems that negotiate efficient intracellular trafficking and nuclear entry represents a significant challenge. Overcoming these hurdles requires a combination of well-controlled materials approaches with techniques to understand and direct cellular delivery. Recent investigations have highlighted the roles histone tail sequences play in directing nuclear delivery and retention, as well as activating DNA transcription. We established the ability to recapitulate these natural histone tail activities within non-viral gene nanocarriers, driving gene transfer/expression by enabling effective navigation to the nucleus via retrograde vesicular trafficking. A unique finding of this histone-targeted approach was that nanocarriers gained enhanced access to the nucleus during mitosis. The work described in this dissertation builds off of these fundamental insights to facilitate the translation of this histone-targeted delivery approach toward regenerative medicine applications. During native tissue repair, actively proliferating mesenchymal stem cells (MSCs) respond to a complex series of growth factor signals that direct their differentiation. Accordingly, the investigations in this work focused on utilizing the histone-targeted nanocarriers to enhance osteogenic growth factor gene transfer in dividing MSCs leading to augmented MSC chondrogenic differentiation, an essential first step in skeletal tissue repair. Concurrently, additional studies focused on optimizing the histone-targeted nanocarrier design strategy to enable improved plasmid DNA (pDNA) binding stability and tunable harnessing of native cellular processing pathways for enhanced gene transfer. Overall, the work presented herein demonstrated substantial increases in growth factor expression following histone-targeted gene transfer. This enhanced expression enabled more robust levels of chondrogenesis in MSCs than treatments with equivalent amounts of recombinant growth factor protein. Additionally, nanocarrier design optimization provided effective pDNA condensation and controllable interactions with native histone effectors. Importantly, these optimized nanocarriers conferred stable nanoplex formation and maintained transfection efficiency under physiologically relevant conditions. Taken together, these advances may help drive the clinical translation of histone-targeted nucleic acid delivery strategies for the regeneration of damaged tissue following traumatic injury.

Cloning strategy for producing brush-forming protein-based polymers.

PubMed

Henderson, Douglas B; Davis, Richey M; Ducker, William A; Van Cott, Kevin E

2005-01-01

Brush-forming polymers are being used in a variety of applications, and by using recombinant DNA technology, there exists the potential to produce protein-based polymers that incorporate unique structures and functions in these brush layers. Despite this potential, production of protein-based brush-forming polymers is not routinely performed. For the design and production of new protein-based polymers with optimal brush-forming properties, it would be desirable to have a cloning strategy that allows an iterative approach wherein the protein based-polymer product can be produced and evaluated, and then if necessary, it can be sequentially modified in a controlled manner to obtain optimal surface density and brush extension. In this work, we report on the development of a cloning strategy intended for the production of protein-based brush-forming polymers. This strategy is based on the assembly of modules of DNA that encode for blocks of protein-based polymers into a commercially available expression vector; there is no need for custom-modified vectors and no need for intermediate cloning vectors. Additionally, because the design of new protein-based biopolymers can be an iterative process, our method enables sequential modification of a protein-based polymer product. With at least 21 bacterial expression vectors and 11 yeast expression vectors compatible with this strategy, there are a number of options available for production of protein-based polymers. It is our intent that this strategy will aid in advancing the production of protein-based brush-forming polymers.

Gold nanoparticle-based beacon to detect STAT5b mRNA expression in living cells: a case optimized by bioinformatics screen.

PubMed

Deng, Dawei; Li, Yang; Xue, Jianpeng; Wang, Jie; Ai, Guanhua; Li, Xin; Gu, Yueqing

2015-01-01

Messenger RNA (mRNA), a single-strand ribonucleic acid with functional gene information is usually abnormally expressed in cancer cells and has become a promising biomarker for the study of tumor progress. Hairpin DNA-coated gold nanoparticle (hDAuNP) beacon containing a bare gold nanoparticle (AuNP) as fluorescence quencher and thiol-terminated fluorescently labeled stem-loop-stem oligonucleotide sequences attached by Au-S bond is currently a new nanoscale biodiagnostic platform capable of mRNA detection, in which the design of the loop region sequence is crucial for hybridizing with the target mRNA. Hence, in this study, to improve the sensitivity and selectivity of hDAuNP beacon simultaneously, the loop region of hairpin DNA was screened by bioinformatics strategy. Here, signal transducer and activator of transcription 5b (STAT5b) mRNA was selected and used as a practical example. The results from the combined characterizations using optical techniques, flow cytometry assay, and cell microscopic imaging showed that after optimization, the as-prepared hDAuNP beacon had higher selectivity and sensitivity for the detection of STAT5b mRNA in living cells, as compared with our previous beacon. Thus, the bioinformatics method may be a promising new strategy for assisting in the designing of the hDAuNP beacon, extending its application in the detection of mRNA expression and the resultant mRNA-based biological processes and disease pathogenesis.

Gold nanoparticle-based beacon to detect STAT5b mRNA expression in living cells: a case optimized by bioinformatics screen

PubMed Central

Deng, Dawei; Li, Yang; Xue, Jianpeng; Wang, Jie; Ai, Guanhua; Li, Xin; Gu, Yueqing

2015-01-01

Messenger RNA (mRNA), a single-strand ribonucleic acid with functional gene information is usually abnormally expressed in cancer cells and has become a promising biomarker for the study of tumor progress. Hairpin DNA-coated gold nanoparticle (hDAuNP) beacon containing a bare gold nanoparticle (AuNP) as fluorescence quencher and thiol-terminated fluorescently labeled stem–loop–stem oligonucleotide sequences attached by Au–S bond is currently a new nanoscale biodiagnostic platform capable of mRNA detection, in which the design of the loop region sequence is crucial for hybridizing with the target mRNA. Hence, in this study, to improve the sensitivity and selectivity of hDAuNP beacon simultaneously, the loop region of hairpin DNA was screened by bioinformatics strategy. Here, signal transducer and activator of transcription 5b (STAT5b) mRNA was selected and used as a practical example. The results from the combined characterizations using optical techniques, flow cytometry assay, and cell microscopic imaging showed that after optimization, the as-prepared hDAuNP beacon had higher selectivity and sensitivity for the detection of STAT5b mRNA in living cells, as compared with our previous beacon. Thus, the bioinformatics method may be a promising new strategy for assisting in the designing of the hDAuNP beacon, extending its application in the detection of mRNA expression and the resultant mRNA-based biological processes and disease pathogenesis. PMID:25987838

Expression of codon-optmized phosphoenolpyruvate carboxylase gene from Glaciecola sp. HTCC2999 in Escherichia coli and its application for C4 chemical production.

PubMed

Park, Soohyun; Pack, Seung Pil; Lee, Jinwon

2012-08-01

We examined the expression of the phosphoenolpyruvate carboxylase (PEPC) gene from marine bacteria in Escherichia coli using codon optimization. The codon-optimized PEPC gene was expressed in the E. coli K-12 strain W3110. SDS-PAGE analysis revealed that the codon-optimized PEPC gene was only expressed in E. coli, and measurement of enzyme activity indicated the highest PEPC activity in the E. coli SGJS112 strain that contained the codon-optimized PEPC gene. In fermentation assays, the E. coli SGJS112 produced the highest yield of oxaloacetate using glucose as the source and produced a 20-times increase in the yield of malate compared to the control. We concluded that the codon optimization enabled E. coli to express the PEPC gene derived from the Glaciecola sp. HTCC2999. Also, the expressed protein exhibited an enzymatic activity similar to that of E. coli PEPC and increased the yield of oxaloacetate and malate in an E. coli system.

Multilevel Regulation of Bacterial Gene Expression with the Combined STAR and Antisense RNA System.

PubMed

Lee, Young Je; Kim, Soo-Jung; Moon, Tae Seok

2018-03-16

Synthetic small RNA regulators have emerged as a versatile tool to predictably control bacterial gene expression. Owing to their simple design principles, small size, and highly orthogonal behavior, these engineered genetic parts have been incorporated into genetic circuits. However, efforts to achieve more sophisticated cellular functions using RNA regulators have been hindered by our limited ability to integrate different RNA regulators into complex circuits. Here, we present a combined RNA regulatory system in Escherichia coli that uses small transcription activating RNA (STAR) and antisense RNA (asRNA) to activate or deactivate target gene expression in a programmable manner. Specifically, we demonstrated that the activated target output by the STAR system can be deactivated by expressing two different types of asRNAs: one binds to and sequesters the STAR regulator, affecting the transcription process, while the other binds to the target mRNA, affecting the translation process. We improved deactivation efficiencies (up to 96%) by optimizing each type of asRNA and then integrating the two optimized asRNAs into a single circuit. Furthermore, we demonstrated that the combined STAR and asRNA system can control gene expression in a reversible way and can regulate expression of a gene in the genome. Lastly, we constructed and simultaneously tested two A AND NOT B logic gates in the same cell to show sophisticated multigene regulation by the combined system. Our approach establishes a methodology for integrating multiple RNA regulators to rationally control multiple genes.

Codon Optimizing for Increased Membrane Protein Production: A Minimalist Approach.

PubMed

Mirzadeh, Kiavash; Toddo, Stephen; Nørholm, Morten H H; Daley, Daniel O

2016-01-01

Reengineering a gene with synonymous codons is a popular approach for increasing production levels of recombinant proteins. Here we present a minimalist alternative to this method, which samples synonymous codons only at the second and third positions rather than the entire coding sequence. As demonstrated with two membrane-embedded transporters in Escherichia coli, the method was more effective than optimizing the entire coding sequence. The method we present is PCR based and requires three simple steps: (1) the design of two PCR primers, one of which is degenerate; (2) the amplification of a mini-library by PCR; and (3) screening for high-expressing clones.

Adaptive GSA-based optimal tuning of PI controlled servo systems with reduced process parametric sensitivity, robust stability and controller robustness.

PubMed

Precup, Radu-Emil; David, Radu-Codrut; Petriu, Emil M; Radac, Mircea-Bogdan; Preitl, Stefan

2014-11-01

This paper suggests a new generation of optimal PI controllers for a class of servo systems characterized by saturation and dead zone static nonlinearities and second-order models with an integral component. The objective functions are expressed as the integral of time multiplied by absolute error plus the weighted sum of the integrals of output sensitivity functions of the state sensitivity models with respect to two process parametric variations. The PI controller tuning conditions applied to a simplified linear process model involve a single design parameter specific to the extended symmetrical optimum (ESO) method which offers the desired tradeoff to several control system performance indices. An original back-calculation and tracking anti-windup scheme is proposed in order to prevent the integrator wind-up and to compensate for the dead zone nonlinearity of the process. The minimization of the objective functions is carried out in the framework of optimization problems with inequality constraints which guarantee the robust stability with respect to the process parametric variations and the controller robustness. An adaptive gravitational search algorithm (GSA) solves the optimization problems focused on the optimal tuning of the design parameter specific to the ESO method and of the anti-windup tracking gain. A tuning method for PI controllers is proposed as an efficient approach to the design of resilient control systems. The tuning method and the PI controllers are experimentally validated by the adaptive GSA-based tuning of PI controllers for the angular position control of a laboratory servo system.

Statistical optimization of medium composition and culture condition for the production of recombinant anti-lipopolysaccharide factor of Eriocheir sinensis in Escherichia coli

NASA Astrophysics Data System (ADS)

Jiang, Shan; Liu, Mei; Wang, Baojie; Jiang, Keyong; Wang, Lei

2011-11-01

Anti-lipopolysaccharide factors (ALFs) are important antimicrobial peptides that are isolated from some aquatic species. In a previous study, we isolated ALF genes from Chinese mitten crab, Eriocheir sinensis. In this study, we optimized the production of a recombinant ALF by expressing E. sinensis ALF genes in Escherichia coli maintained in shake-flasks. In particular, we focused on optimization of both the medium composition and the culture condition. Various medium components were analyzed by the Plackett-Burman design, and two significant screened factors, (NH4)2SO4 and KH2PO4, were further optimized via the central composite design (CCD). Based on the CCD analysis, we investigated the induction start-up time, the isopropylthio-D-galactoside (IPTG) concentration, the post-induction time, and the temperature by response surface methodology. We found that the highest level of ALF fusion protein was achieved in the medium containing 1.89 g/L (NH4)2SO4 and 3.18 g/L KH2PO4, with a cell optical density of 0.8 at 600 nm before induction, an IPTG concentration of 0.5 mmol/L, a post-induction temperature of 32.7°C, and a post-induction time of 4 h. Applying the whole optimization strategy using all optimal factors improved the target protein content from 6.1% (without optimization) to 13.2%. We further applied the optimized medium and conditions in high cell density cultivation, and determined that the soluble target protein constituted 10.5% of the total protein. Our identification of the economic medium composition, optimal culture conditions, and details of the fermentation process should facilitate the potential application of ALF for further research.

Sensitivity Analysis and Optimization of Aerodynamic Configurations with Blend Surfaces

NASA Technical Reports Server (NTRS)

Thomas, A. M.; Tiwari, S. N.

1997-01-01

A novel (geometrical) parametrization procedure using solutions to a suitably chosen fourth order partial differential equation is used to define a class of airplane configurations. Inclusive in this definition are surface grids, volume grids, and grid sensitivity. The general airplane configuration has wing, fuselage, vertical tail and horizontal tail. The design variables are incorporated into the boundary conditions, and the solution is expressed as a Fourier series. The fuselage has circular cross section, and the radius is an algebraic function of four design parameters and an independent computational variable. Volume grids are obtained through an application of the Control Point Form method. A graphic interface software is developed which dynamically changes the surface of the airplane configuration with the change in input design variable. The software is made user friendly and is targeted towards the initial conceptual development of any aerodynamic configurations. Grid sensitivity with respect to surface design parameters and aerodynamic sensitivity coefficients based on potential flow is obtained using an Automatic Differentiation precompiler software tool ADIFOR. Aerodynamic shape optimization of the complete aircraft with twenty four design variables is performed. Unstructured and structured volume grids and Euler solutions are obtained with standard software to demonstrate the feasibility of the new surface definition.

Modeling and optimization of a typical fuel cell-heat engine hybrid system and its parametric design criteria

NASA Astrophysics Data System (ADS)

Zhao, Yingru; Chen, Jincan

A theoretical modeling approach is presented, which describes the behavior of a typical fuel cell-heat engine hybrid system in steady-state operating condition based on an existing solid oxide fuel cell model, to provide useful fundamental design characteristics as well as potential critical problems. The different sources of irreversible losses, such as the electrochemical reaction, electric resistances, finite-rate heat transfer between the fuel cell and the heat engine, and heat-leak from the fuel cell to the environment are specified and investigated. Energy and entropy analyses are used to indicate the multi-irreversible losses and to assess the work potentials of the hybrid system. Expressions for the power output and efficiency of the hybrid system are derived and the performance characteristics of the system are presented and discussed in detail. The effects of the design parameters and operating conditions on the system performance are studied numerically. It is found that there exist certain optimum criteria for some important parameters. The results obtained here may provide a theoretical basis for both the optimal design and operation of real fuel cell-heat engine hybrid systems. This new approach can be easily extended to other fuel cell hybrid systems to develop irreversible models suitable for the investigation and optimization of similar energy conversion settings and electrochemistry systems.

Cloning and expression of codon-optimized recombinant darbepoetin alfa in Leishmania tarentolae T7-TR.

PubMed

Kianmehr, Anvarsadat; Golavar, Raziyeh; Rouintan, Mandana; Mahrooz, Abdolkarim; Fard-Esfahani, Pezhman; Oladnabi, Morteza; Khajeniazi, Safoura; Mostafavi, Seyede Samaneh; Omidinia, Eskandar

2016-02-01

Darbepoetin alfa is an engineered and hyperglycosylated analog of recombinant human erythropoietin (EPO) which is used as a drug in treating anemia in patients with chronic kidney failure and cancer. This study desribes the secretory expression of a codon-optimized recombinant form of darbepoetin alfa in Leishmania tarentolae T7-TR. Synthetic codon-optimized gene was amplified by PCR and cloned into the pLEXSY-I-blecherry3 vector. The resultant expression vector, pLEXSYDarbo, was purified, digested, and electroporated into the L. tarentolae. Expression of recombinant darbepoetin alfa was evaluated by ELISA, reverse-transcription PCR (RT-PCR), Western blotting, and biological activity. After codon optimization, codon adaptation index (CAI) of the gene raised from 0.50 to 0.99 and its GC% content changed from 56% to 58%. Expression analysis confirmed the presence of a protein band at 40 kDa. Furthermore, reticulocyte experiment results revealed that the activity of expressed darbepoetin alfa was similar to that of its equivalent expressed in Chinese hamster ovary (CHO) cells. These data suggested that the codon optimization and expression in L. tarentolae host provided an efficient approach for high level expression of darbepoetin alfa. Copyright © 2015 Elsevier Inc. All rights reserved.

Plant cell wall glycosyltransferases: High-throughput recombinant expression screening and general requirements for these challenging enzymes

DOE PAGES

Welner, Ditte Hededam; Shin, David; Tomaleri, Giovani P.; ...

2017-06-09

Molecular characterization of plant cell wall glycosyltransferases is a critical step towards understanding the biosynthesis of the complex plant cell wall, and ultimately for efficient engineering of biofuel and agricultural crops. The majority of these enzymes have proven very difficult to obtain in the needed amount and purity for such molecular studies, and recombinant cell wall glycosyltransferase production efforts have largely failed. A daunting number of strategies can be employed to overcome this challenge, including optimization of DNA and protein sequences, choice of expression organism, expression conditions, coexpression partners, purification methods, and optimization of protein solubility and stability. Hence researchersmore » are presented with thousands of potential conditions to test. Ultimately, the subset of conditions that will be sampled depends on practical considerations and prior knowledge of the enzyme(s) being studied. We have developed a rational approach to this process. We devise a pipeline comprising in silico selection of targets and construct design, and high-throughput expression screening, target enrichment, and hit identification. We have applied this pipeline to a test set of Arabidopsis thaliana cell wall glycosyltransferases known to be challenging to obtain in soluble form, as well as to a library of cell wall glycosyltransferases from other plants including agricultural and biofuel crops. The screening results suggest that recombinant cell wall glycosyltransferases in general have a very low soluble: Insoluble ratio in lysates from heterologous expression cultures, and that co-expression of chaperones as well as lysis buffer optimization can increase this ratio. We have applied the identified preferred conditions to Reversibly Glycosylated Polypeptide 1 from Arabidopsis thaliana, and processed this enzyme to near-purity in unprecedented milligram amounts. The obtained preparation of Reversibly Glycosylated Polypeptide 1 has the expected arabinopyranose mutase and autoglycosylation activities.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.« less

Plant cell wall glycosyltransferases: High-throughput recombinant expression screening and general requirements for these challenging enzymes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Welner, Ditte Hededam; Shin, David; Tomaleri, Giovani P.

Molecular characterization of plant cell wall glycosyltransferases is a critical step towards understanding the biosynthesis of the complex plant cell wall, and ultimately for efficient engineering of biofuel and agricultural crops. The majority of these enzymes have proven very difficult to obtain in the needed amount and purity for such molecular studies, and recombinant cell wall glycosyltransferase production efforts have largely failed. A daunting number of strategies can be employed to overcome this challenge, including optimization of DNA and protein sequences, choice of expression organism, expression conditions, coexpression partners, purification methods, and optimization of protein solubility and stability. Hence researchersmore » are presented with thousands of potential conditions to test. Ultimately, the subset of conditions that will be sampled depends on practical considerations and prior knowledge of the enzyme(s) being studied. We have developed a rational approach to this process. We devise a pipeline comprising in silico selection of targets and construct design, and high-throughput expression screening, target enrichment, and hit identification. We have applied this pipeline to a test set of Arabidopsis thaliana cell wall glycosyltransferases known to be challenging to obtain in soluble form, as well as to a library of cell wall glycosyltransferases from other plants including agricultural and biofuel crops. The screening results suggest that recombinant cell wall glycosyltransferases in general have a very low soluble: Insoluble ratio in lysates from heterologous expression cultures, and that co-expression of chaperones as well as lysis buffer optimization can increase this ratio. We have applied the identified preferred conditions to Reversibly Glycosylated Polypeptide 1 from Arabidopsis thaliana, and processed this enzyme to near-purity in unprecedented milligram amounts. The obtained preparation of Reversibly Glycosylated Polypeptide 1 has the expected arabinopyranose mutase and autoglycosylation activities.This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.« less

Risk assessment and experimental design in the development of a prolonged release drug delivery system with paliperidone.

PubMed

Iurian, Sonia; Turdean, Luana; Tomuta, Ioan

2017-01-01

This study focuses on the development of a drug product based on a risk assessment-based approach, within the quality by design paradigm. A prolonged release system was proposed for paliperidone (Pal) delivery, containing Kollidon ® SR as an insoluble matrix agent and hydroxypropyl cellulose, hydroxypropyl methylcellulose (HPMC), or sodium carboxymethyl cellulose as a hydrophilic polymer. The experimental part was preceded by the identification of potential sources of variability through Ishikawa diagrams, and failure mode and effects analysis was used to deliver the critical process parameters that were further optimized by design of experiments. A D-optimal design was used to investigate the effects of Kollidon SR ratio ( X 1 ), the type of hydrophilic polymer ( X 2 ), and the percentage of hydrophilic polymer ( X 3 ) on the percentages of dissolved Pal over 24 h ( Y 1 - Y 9 ). Effects expressed as regression coefficients and response surfaces were generated, along with a design space for the preparation of a target formulation in an experimental area with low error risk. The optimal formulation contained 27.62% Kollidon SR and 8.73% HPMC and achieved the prolonged release of Pal, with low burst effect, at ratios that were very close to the ones predicted by the model. Thus, the parameters with the highest impact on the final product quality were studied, and safe ranges were established for their variations. Finally, a risk mitigation and control strategy was proposed to assure the quality of the system, by constant process monitoring.

Optimal surveillance strategy for invasive species management when surveys stop after detection.

PubMed

Guillera-Arroita, Gurutzeta; Hauser, Cindy E; McCarthy, Michael A

2014-05-01

Invasive species are a cause for concern in natural and economic systems and require both monitoring and management. There is a trade-off between the amount of resources spent on surveying for the species and conducting early management of occupied sites, and the resources that are ultimately spent in delayed management at sites where the species was present but undetected. Previous work addressed this optimal resource allocation problem assuming that surveys continue despite detection until the initially planned survey effort is consumed. However, a more realistic scenario is often that surveys stop after detection (i.e., follow a "removal" sampling design) and then management begins. Such an approach will indicate a different optimal survey design and can be expected to be more efficient. We analyze this case and compare the expected efficiency of invasive species management programs under both survey methods. We also evaluate the impact of mis-specifying the type of sampling approach during the program design phase. We derive analytical expressions that optimize resource allocation between monitoring and management in surveillance programs when surveys stop after detection. We do this under a scenario of unconstrained resources and scenarios where survey budget is constrained. The efficiency of surveillance programs is greater if a "removal survey" design is used, with larger gains obtained when savings from early detection are high, occupancy is high, and survey costs are not much lower than early management costs at a site. Designing a surveillance program disregarding that surveys stop after detection can result in an efficiency loss. Our results help guide the design of future surveillance programs for invasive species. Addressing program design within a decision-theoretic framework can lead to a better use of available resources. We show how species prevalence, its detectability, and the benefits derived from early detection can be considered.

Semidefinite Relaxation-Based Optimization of Multiple-Input Wireless Power Transfer Systems

NASA Astrophysics Data System (ADS)

Lang, Hans-Dieter; Sarris, Costas D.

2017-11-01

An optimization procedure for multi-transmitter (MISO) wireless power transfer (WPT) systems based on tight semidefinite relaxation (SDR) is presented. This method ensures physical realizability of MISO WPT systems designed via convex optimization -- a robust, semi-analytical and intuitive route to optimizing such systems. To that end, the nonconvex constraints requiring that power is fed into rather than drawn from the system via all transmitter ports are incorporated in a convex semidefinite relaxation, which is efficiently and reliably solvable by dedicated algorithms. A test of the solution then confirms that this modified problem is equivalent (tight relaxation) to the original (nonconvex) one and that the true global optimum has been found. This is a clear advantage over global optimization methods (e.g. genetic algorithms), where convergence to the true global optimum cannot be ensured or tested. Discussions of numerical results yielded by both the closed-form expressions and the refined technique illustrate the importance and practicability of the new method. It, is shown that this technique offers a rigorous optimization framework for a broad range of current and emerging WPT applications.

Creating single-copy genetic circuits

PubMed Central

Lee, Jeong Wook; Gyorgy, Andras; Cameron, D. Ewen; Pyenson, Nora; Choi, Kyeong Rok; Way, Jeffrey C.; Silver, Pamela A.; Del Vecchio, Domitilla; Collins, James J.

2017-01-01

SUMMARY Synthetic biology is increasingly used to develop sophisticated living devices for basic and applied research. Many of these genetic devices are engineered using multi-copy plasmids, but as the field progresses from proof-of-principle demonstrations to practical applications, it is important to develop single-copy synthetic modules that minimize consumption of cellular resources and can be stably maintained as genomic integrants. Here we use empirical design, mathematical modeling and iterative construction and testing to build single-copy, bistable toggle switches with improved performance and reduced metabolic load that can be stably integrated into the host genome. Deterministic and stochastic models led us to focus on basal transcription to optimize circuit performance and helped to explain the resulting circuit robustness across a large range of component expression levels. The design parameters developed here provide important guidance for future efforts to convert functional multi-copy gene circuits into optimized single-copy circuits for practical, real-world use. PMID:27425413

Current fluctuations in quantum absorption refrigerators

NASA Astrophysics Data System (ADS)

Segal, Dvira

2018-05-01

Absorption refrigerators transfer thermal energy from a cold bath to a hot bath without input power by utilizing heat from an additional "work" reservoir. Particularly interesting is a three-level design for a quantum absorption refrigerator, which can be optimized to reach the maximal (Carnot) cooling efficiency. Previous studies of three-level chillers focused on the behavior of the averaged cooling current. Here, we go beyond that and study the full counting statistics of heat exchange in a three-level chiller model. We explain how to obtain the complete cumulant generating function of the refrigerator in a steady state, then derive a partial cumulant generating function, which yields closed-form expressions for both the averaged cooling current and its noise. Our analytical results and simulations are beneficial for the design of nanoscale engines and cooling systems far from equilibrium, with their performance optimized according to different criteria, efficiency, power, fluctuations, and dissipation.

Design and architecture of the Mars relay network planning and analysis framework

NASA Technical Reports Server (NTRS)

Cheung, K. M.; Lee, C. H.

2002-01-01

In this paper we describe the design and architecture of the Mars Network planning and analysis framework that supports generation and validation of efficient planning and scheduling strategy. The goals are to minimize the transmitting time, minimize the delaying time, and/or maximize the network throughputs. The proposed framework would require (1) a client-server architecture to support interactive, batch, WEB, and distributed analysis and planning applications for the relay network analysis scheme, (2) a high-fidelity modeling and simulation environment that expresses link capabilities between spacecraft to spacecraft and spacecraft to Earth stations as time-varying resources, and spacecraft activities, link priority, Solar System dynamic events, the laws of orbital mechanics, and other limiting factors as spacecraft power and thermal constraints, (3) an optimization methodology that casts the resource and constraint models into a standard linear and nonlinear constrained optimization problem that lends itself to commercial off-the-shelf (COTS)planning and scheduling algorithms.

A quantitative framework for the forward design of synthetic miRNA circuits.

PubMed

Bloom, Ryan J; Winkler, Sally M; Smolke, Christina D

2014-11-01

Synthetic genetic circuits incorporating regulatory components based on RNA interference (RNAi) have been used in a variety of systems. A comprehensive understanding of the parameters that determine the relationship between microRNA (miRNA) and target expression levels is lacking. We describe a quantitative framework supporting the forward engineering of gene circuits that incorporate RNAi-based regulatory components in mammalian cells. We developed a model that captures the quantitative relationship between miRNA and target gene expression levels as a function of parameters, including mRNA half-life and miRNA target-site number. We extended the model to synthetic circuits that incorporate protein-responsive miRNA switches and designed an optimized miRNA-based protein concentration detector circuit that noninvasively measures small changes in the nuclear concentration of β-catenin owing to induction of the Wnt signaling pathway. Our results highlight the importance of methods for guiding the quantitative design of genetic circuits to achieve robust, reliable and predictable behaviors in mammalian cells.

Gene gymnastics

PubMed Central

Vijayachandran, Lakshmi S; Thimiri Govinda Raj, Deepak B; Edelweiss, Evelina; Gupta, Kapil; Maier, Josef; Gordeliy, Valentin; Fitzgerald, Daniel J; Berger, Imre

2013-01-01

Most essential activities in eukaryotic cells are catalyzed by large multiprotein assemblies containing up to ten or more interlocking subunits. The vast majority of these protein complexes are not easily accessible for high resolution studies aimed at unlocking their mechanisms, due to their low cellular abundance and high heterogeneity. Recombinant overproduction can resolve this bottleneck and baculovirus expression vector systems (BEVS) have emerged as particularly powerful tools for the provision of eukaryotic multiprotein complexes in high quality and quantity. Recently, synthetic biology approaches have begun to make their mark in improving existing BEVS reagents by de novo design of streamlined transfer plasmids and by engineering the baculovirus genome. Here we present OmniBac, comprising new custom designed reagents that further facilitate the integration of heterologous genes into the baculovirus genome for multiprotein expression. Based on comparative genome analysis and data mining, we herein present a blueprint to custom design and engineer the entire baculovirus genome for optimized production properties using a bottom-up synthetic biology approach. PMID:23328086

Comparison of fan beam, slit-slat and multi-pinhole collimators for molecular breast tomosynthesis

NASA Astrophysics Data System (ADS)

van Roosmalen, Jarno; Beekman, Freek J.; Goorden, Marlies C.

2018-05-01

Recently, we proposed and optimized dedicated multi-pinhole molecular breast tomosynthesis (MBT) that images a lightly compressed breast. As MBT may also be performed with other types of collimators, the aim of this paper is to optimize MBT with fan beam and slit-slat collimators and to compare its performance to that of multi-pinhole MBT to arrive at a truly optimized design. Using analytical expressions, we first optimized fan beam and slit-slat collimator parameters to reach maximum sensitivity at a series of given system resolutions. Additionally, we performed full system simulations of a breast phantom containing several tumours for the optimized designs. We found that at equal system resolution the maximum achievable sensitivity increases from pinhole to slit-slat to fan beam collimation with fan beam and slit-slat MBT having on average a 48% and 20% higher sensitivity than multi-pinhole MBT. Furthermore, by inspecting simulated images and applying a tumour-to-background contrast-to-noise (TB-CNR) analysis, we found that slit-slat collimators underperform with respect to the other collimator types. The fan beam collimators obtained a similar TB-CNR as the pinhole collimators, but the optimum was reached at different system resolutions. For fan beam collimators, a 6–8 mm system resolution was optimal in terms of TB-CNR, while with pinhole collimation highest TB-CNR was reached in the 7–10 mm range.

Preformulation studies and optimization of sodium alginate based floating drug delivery system for eradication of Helicobacter pylori.

PubMed

Diós, Péter; Nagy, Sándor; Pál, Szilárd; Pernecker, Tivadar; Kocsis, Béla; Budán, Ferenc; Horváth, Ildikó; Szigeti, Krisztián; Bölcskei, Kata; Máthé, Domokos; Dévay, Attila

2015-10-01

The aim of this study was to design a local, floating, mucoadhesive drug delivery system containing metronidazole for Helicobacter pylori eradication. Face-centered central composite design (with three factors, in three levels) was used for evaluation and optimization of in vitro floating and dissolution studies. Sodium alginate (X1), low substituted hydroxypropyl cellulose (L-HPC B1, X2) and sodium bicarbonate (X3) concentrations were the independent variables in the development of effervescent floating tablets. All tablets showed acceptable physicochemical properties. Statistical analysis revealed that tablets with 5.00% sodium alginate, 38.63% L-HPC B1 and 8.45% sodium bicarbonate content showed promising in vitro floating and dissolution properties for further examinations. Optimized floating tablets expressed remarkable floating force. Their in vitro dissolution studies were compared with two commercially available non-floating metronidazole products and then microbiologically detected dissolution, ex vivo detachment force, rheological mucoadhesion studies and compatibility studies were carried out. Remarkable similarity (f1, f2) between in vitro spectrophotometrically and microbiologically detected dissolutions was found. Studies revealed significant ex vivo mucoadhesion of optimized tablets, which was considerably increased by L-HPC. In vivo X-ray CT studies of optimized tablets showed 8h gastroretention in rats represented by an animation prepared by special CT technique. Copyright © 2015 Elsevier B.V. All rights reserved.

Optimization of laccase production by Pleurotus ostreatus IMI 395545 using the Taguchi DOE methodology.

PubMed

Periasamy, Rathinasamy; Palvannan, Thayumanavan

2010-12-01

Production of laccase using a submerged culture of Pleurotus orstreatus IMI 395545 was optimized by the Taguchi orthogonal array (OA) design of experiments (DOE) methodology. This approach facilitates the study of the interactions of a large number of variables spanned by factors and their settings, with a small number of experiments, leading to considerable savings in time and cost for process optimization. This methodology optimizes the number of impact factors and enables to calculate their interaction in the production of industrial enzymes. Eight factors, viz. glucose, yeast extract, malt extract, inoculum, mineral solution, inducer (1 mM CuSO₄) and amino acid (l-asparagine) at three levels and pH at two levels, with an OA layout of L18 (2¹ × 3⁷) were selected for the proposed experimental design. The laccase yield obtained from the 18 sets of fermentation experiments performed with the selected factors and levels was further processed with Qualitek-4 software. The optimized conditions shared an enhanced laccase expression of 86.8% (from 485.0 to 906.3 U). The combination of factors was further validated for laccase production and reactive blue 221 decolorization. The results revealed an enhanced laccase yield of 32.6% and dye decolorization up to 84.6%. This methodology allows the complete evaluation of main and interaction factors. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

A condition-specific codon optimization approach for improved heterologous gene expression in Saccharomyces cerevisiae

PubMed Central

2014-01-01

Background Heterologous gene expression is an important tool for synthetic biology that enables metabolic engineering and the production of non-natural biologics in a variety of host organisms. The translational efficiency of heterologous genes can often be improved by optimizing synonymous codon usage to better match the host organism. However, traditional approaches for optimization neglect to take into account many factors known to influence synonymous codon distributions. Results Here we define an alternative approach for codon optimization that utilizes systems level information and codon context for the condition under which heterologous genes are being expressed. Furthermore, we utilize a probabilistic algorithm to generate multiple variants of a given gene. We demonstrate improved translational efficiency using this condition-specific codon optimization approach with two heterologous genes, the fluorescent protein-encoding eGFP and the catechol 1,2-dioxygenase gene CatA, expressed in S. cerevisiae. For the latter case, optimization for stationary phase production resulted in nearly 2.9-fold improvements over commercial gene optimization algorithms. Conclusions Codon optimization is now often a standard tool for protein expression, and while a variety of tools and approaches have been developed, they do not guarantee improved performance for all hosts of applications. Here, we suggest an alternative method for condition-specific codon optimization and demonstrate its utility in Saccharomyces cerevisiae as a proof of concept. However, this technique should be applicable to any organism for which gene expression data can be generated and is thus of potential interest for a variety of applications in metabolic and cellular engineering. PMID:24636000

Co-expression of hepatitis C virus polytope-HBsAg and p19-silencing suppressor protein in tobacco leaves.

PubMed

Mohammadzadeh, Sara; Roohvand, Farzin; Memarnejadian, Arash; Jafari, Anis; Ajdary, Soheila; Salmanian, Ali-Hatef; Ehsani, Parastoo

2016-01-01

Plants transformed by virus-based vectors have emerged as promising tools to rapidly express large amounts and inexpensive antigens in transient condition. We studied the possibility of transient-expression of an HBsAg-fused polytopic construct (HCVpc) [containing H-2d and HLA-A2-restricted CD8+CTL-epitopic peptides of C (Core; aa 132-142), E6 (Envelope2; aa 614-622), N (NS3; aa 1406-1415), and E4 (Envelope2; aa 405-414) in tandem of CE6NE4] in tobacco (Nicotiana tabacum) leaves for the development of a plant-based HCV vaccine. A codon-optimized gene encoding the Kozak sequence, hexahistidine (6×His)-tag peptide, and HCVpc in tandem was designed, chemically synthesized, fused to HBsAg gene, and inserted into Potato virus X (PVX-GW) vector under the control of duplicated PVX coat protein promoter (CPP). The resulted recombinant plasmids (after confirmation by restriction and sequencing analyses) were transferred into Agrobacterium tumefaciens strain GV3101 and vacuum infiltrated into tobacco leaves. The effect of gene-silencing suppressor, p19 protein from tomato bushy stunt virus, on the expression yield of HCVpc-HBsAg was also evaluated by co-infiltration of a p19 expression vector. Codon-optimized gene increased adaptation index (CAI) value (from 0.61 to 0.92) in tobacco. The expression of the HCVpc-HBsAg was confirmed by western blot and HBsAg-based detection ELISA on total extractable proteins of tobacco leaves. The expression level of the fusion protein was significantly higher in p19 co-agroinfiltrated plants. The results indicated the possibility of expression of HCVpc-HBsAg constructs with proper protein conformations in tobacco for final application as a plant-derived HCV vaccine.

Expression of anti-Mullerian hormone in hens selected for different ovulation rates.

PubMed

Johnson, P A; Kent, T R; Urick, M E; Trevino, L S; Giles, J R

2009-05-01

In hens, the granulosa layer is the primary source of anti-Mullerian hormone (AMH), as it is in mammals. Small follicles express the greatest amount of Amh mRNA with less in the larger follicles. Laying hens have a distinct ovarian hierarchy of follicles while broiler breeder hens often have excessive follicle growth with a disrupted hierarchy. The objective of Experiment 1 was to examine Amh expression in two strains of hens differing in ovulatory efficiency. Amh expression was greater (P<0.01) in broiler breeder hens (n=6) as compared with laying hens (n=6). Experiment 2 was designed to examine whether alterations in follicular development due to diet, within the broiler breeder hens, were correlated with changes in the expression of Amh. Restricted feeding (RF) in broiler breeder hens promotes optimal follicular development. Egg production in broiler breeder hens on full feed (FF; n=8) was 78% that of hens on RF (n=9). The number of large follicles (P<0.05), total ovarian weight (P<0.01), and Amh mRNA expression were greater in FF hens as compared with RF hens (P<0.01). There was no difference in FSH receptor expression between the two groups. A direct nutritional effect was not supported because culture of granulosa cells with varying concentrations of glucose and insulin showed no effect on granulosa Amh expression. Finally, testis-conditioned medium resulted in a dose-related increase in granulosa cell proliferation, which could be inhibited by preincubation with AMH antibody. AMH may enhance granulosa cell proliferation through an autocrine or paracrine mechanism although excessive AMH may inhibit optimal follicle selection.

Metabolic engineering of the pentose phosphate pathway for enhanced limonene production in the cyanobacterium Synechocysti s sp. PCC 6803.

PubMed

Lin, Po-Cheng; Saha, Rajib; Zhang, Fuzhong; Pakrasi, Himadri B

2017-12-13

Isoprenoids are diverse natural compounds, which have various applications as pharmaceuticals, fragrances, and solvents. The low yield of isoprenoids in plants makes them difficult for cost-effective production, and chemical synthesis of complex isoprenoids is impractical. Microbial production of isoprenoids has been considered as a promising approach to increase the yield. In this study, we engineered the model cyanobacterium Synechocystis sp. PCC 6803 for sustainable production of a commercially valuable isoprenoid, limonene. Limonene synthases from the plants Mentha spicata and Citrus limon were expressed in cyanobacteria for limonene production. Production of limonene was two-fold higher with limonene synthase from M. spicata than that from C. limon. To enhance isoprenoid production, computational strain design was conducted by applying the OptForce strain design algorithm on Synechocystis 6803. Based on the metabolic interventions suggested by this algorithm, genes (ribose 5-phosphate isomerase and ribulose 5-phosphate 3-epimerase) in the pentose phosphate pathway were overexpressed, and a geranyl diphosphate synthase from the plant Abies grandis was expressed to optimize the limonene biosynthetic pathway. The optimized strain produced 6.7 mg/L of limonene, a 2.3-fold improvement in productivity. Thus, this study presents a feasible strategy to engineer cyanobacteria for photosynthetic production of isoprenoids.

Numerical Computation of a Continuous-thrust State Transition Matrix Incorporating Accurate Hardware and Ephemeris Models

NASA Technical Reports Server (NTRS)

Ellison, Donald; Conway, Bruce; Englander, Jacob

2015-01-01

A significant body of work exists showing that providing a nonlinear programming (NLP) solver with expressions for the problem constraint gradient substantially increases the speed of program execution and can also improve the robustness of convergence, especially for local optimizers. Calculation of these derivatives is often accomplished through the computation of spacecraft's state transition matrix (STM). If the two-body gravitational model is employed as is often done in the context of preliminary design, closed form expressions for these derivatives may be provided. If a high fidelity dynamics model, that might include perturbing forces such as the gravitational effect from multiple third bodies and solar radiation pressure is used then these STM's must be computed numerically. We present a method for the power hardward model and a full ephemeris model. An adaptive-step embedded eight order Dormand-Prince numerical integrator is discussed and a method for the computation of the time of flight derivatives in this framework is presented. The use of these numerically calculated derivatieves offer a substantial improvement over finite differencing in the context of a global optimizer. Specifically the inclusion of these STM's into the low thrust missiondesign tool chain in use at NASA Goddard Spaceflight Center allows for an increased preliminary mission design cadence.

Design of Grid Portal System Based on RIA

NASA Astrophysics Data System (ADS)

Cao, Caifeng; Luo, Jianguo; Qiu, Zhixin

Grid portal is an important branch of grid research. In order to solve the weak expressive force, the poor interaction, the low operating efficiency and other insufficiencies of the first and second generation of grid portal system, RIA technology was introduced to it. A new portal architecture was designed based on RIA and Web service. The concrete realizing scheme of portal system was presented by using Adobe Flex/Flash technology, which formed a new design pattern. In system architecture, the design pattern has B/S and C/S superiorities, balances server and its client side, optimizes the system performance, realizes platform irrelevance. In system function, the design pattern realizes grid service call, provides client interface with rich user experience, integrates local resources by using FABridge, LCDS, Flash player and some other components.

Process optimization for enhancing production of cis-4-hydroxy-L-proline by engineered Escherichia coli.

PubMed

Chen, Kequan; Pang, Yang; Zhang, Bowen; Feng, Jiao; Xu, Sheng; Wang, Xin; Ouyang, Pingkai

2017-11-22

Understanding the bioprocess limitations is critical for the efficient design of biocatalysts to facilitate process feasibility and improve process economics. In this study, a proline hydroxylation process with recombinant Escherichia coli expressing L-proline cis-4-hydroxylase (SmP4H) was investigated. The factors that influencing the metabolism of microbial hosts and process economics were focused on for the optimization of cis-4-hydroxy-L-proline (CHOP) production. In recombinant E. coli, SmP4H synthesis limitation was observed. After the optimization of expression system, CHOP production was improved in accordance with the enhanced SmP4H synthesis. Furthermore, the effects of the regulation of proline uptake and metabolism on whole-cell catalytic activity were investigated. The improved CHOP production by repressing putA gene responsible for L-proline degradation or overexpressing L-proline transporter putP on CHOP production suggested the important role of substrate uptake and metabolism on the whole-cell biocatalyst efficiency. Through genetically modifying these factors, the biocatalyst activity was significantly improved, and CHOP production was increased by twofold. Meanwhile, to further improve process economics, a two-strain coupling whole-cell system was established to supply co-substrate (α-ketoglutarate, α-KG) with a cheaper chemical L-glutamate as a starting material, and 13.5 g/L of CHOP was successfully produced. In this study, SmP4H expression, and L-proline uptake and degradation, were uncovered as the hurdles for microbial production of CHOP. Accordingly, the whole-cell biocatalysts were metabolically engineered for enhancing CHOP production. Meanwhile, a two-strain biotransformation system for CHOP biosynthesis was developed aiming at supplying α-KG more economically. Our work provided valuable insights into the design of recombinant microorganism to improve the biotransformation efficiency that catalyzed by Fe(II)/α-KG-dependent dioxygenase.

Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane

PubMed Central

2014-01-01

Background Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene. Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. Results The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences. Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures. Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes. In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. Conclusions We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred by existing and newly isolated promoters in sugarcane tissues. The strategies used to design the synthetic luciferase transgenes could be applied to other transgenes that are aggressively silenced in sugarcane. PMID:24708613

Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane.

PubMed

Chou, Ting-Chun; Moyle, Richard L

2014-04-08

Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene.Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences.Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures.Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes.In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred by existing and newly isolated promoters in sugarcane tissues. The strategies used to design the synthetic luciferase transgenes could be applied to other transgenes that are aggressively silenced in sugarcane.

Dual genetic selection of synthetic riboswitches in Escherichia coli.

PubMed

Nomura, Yoko; Yokobayashi, Yohei

2014-01-01

This chapter describes a genetic selection strategy to engineer synthetic riboswitches that can chemically regulate gene expression in Escherichia coli. Riboswitch libraries are constructed by randomizing the nucleotides that potentially comprise an expression platform and fused to the hybrid selection/screening marker tetA-gfpuv. Iterative ON and OFF selections are performed under appropriate conditions that favor the survival or the growth of the cells harboring the desired riboswitches. After the selection, rapid screening of individual riboswitch clones is performed by measuring GFPuv fluorescence without subcloning. This optimized dual genetic selection strategy can be used to rapidly develop synthetic riboswitches without detailed computational design or structural knowledge.

Double promoter expression systems for recombinant protein production by industrial microorganisms.

PubMed

Öztürk, Sibel; Ergün, Burcu Gündüz; Çalık, Pınar

2017-10-01

Using double promoter expression systems is a promising approach to increase heterologous protein production. In this review, current double promoter expression systems for the production of recombinant proteins (r-proteins) by industrially important bacteria, Bacillus subtilis and Escherichia coli; and yeasts, Saccharomyces cerevisiae and Pichia pastoris, are discussed by assessing their potentials and drawbacks. Double promoter expression systems need to be designed to maintain a higher specific product formation rate within the production domain. While bacterial double promoter systems have been constructed as chimeric tandem promoters, yeast dual promoter systems have been developed as separate expression cassettes. To increase production and productivity, the optimal transcriptional activity should be justified either by simultaneously satisfying the requirements of both promoters, or by consecutively stimulating the changeover from one to another in a biphasic process or via successive-iterations. Thus, considering the dynamics of a fermentation process, double promoters can be classified according to their operational mechanisms, as: i) consecutively operating double promoter systems, and ii) simultaneously operating double promoter systems. Among these metabolic design strategies, extending the expression period with two promoters activated under different conditions, or enhancing the transcriptional activity with two promoters activated under similar conditions within the production domain, can be applied independently from the host. Novel studies with new insights, which aim a rational systematic design and construction of dual promoter expression vectors with tailored transcriptional activity, will empower r-protein production with enhanced production and productivity. Finally, the current state-of-the-art review emphasizes the advantages of double promoter systems along with the necessity for discovering new promoters for the development of more effective and adaptive processes to meet the increasing demand of r-protein industry.

Optimized invertase expression and secretion cassette for improving Yarrowia lipolytica growth on sucrose for industrial applications.

PubMed

Lazar, Zbigniew; Rossignol, Tristan; Verbeke, Jonathan; Crutz-Le Coq, Anne-Marie; Nicaud, Jean-Marc; Robak, Małgorzata

2013-11-01

Yarrowia lipolytica requires the expression of a heterologous invertase to grow on a sucrose-based substrate. This work reports the construction of an optimized invertase expression cassette composed of Saccharomyces cerevisiae Suc2p secretion signal sequence followed by the SUC2 sequence and under the control of the strong Y. lipolytica pTEF promoter. This new construction allows a fast and optimal cleavage of sucrose into glucose and fructose and allows cells to reach the maximum growth rate. Contrary to pre-existing constructions, the expression of SUC2 is not sensitive to medium composition in this context. The strain JMY2593, expressing this new cassette with an optimized secretion signal sequence and a strong promoter, produces 4,519 U/l of extracellular invertase in bioreactor experiments compared to 597 U/l in a strain expressing the former invertase construction. The expression of this cassette strongly improved production of invertase and is suitable for simultaneously high production level of citric acid from sucrose-based media.

Adnectin-Based Design of Chimeric Antigen Receptor for T Cell Engineering.

PubMed

Han, Xiaolu; Cinay, Gunce E; Zhao, Yifan; Guo, Yunfei; Zhang, Xiaoyang; Wang, Pin

2017-11-01

Although chimeric antigen receptor (CAR)-engineered T cell therapy has achieved encouraging clinical trial results for treating hematological cancers, further optimization can likely expand this therapeutic success to more patients and other cancer types. Most CAR constructs used in clinical trials incorporate single chain variable fragment (scFv) as the extracellular antigen recognition domain. The immunogenicity of nonhuman scFv could cause host rejection against CAR T cells and compromise their persistence and efficacy. The limited availability of scFvs and slow discovery of new monoclonal antibodies also limit the development of novel CAR constructs. Adnectin, a class of affinity molecules derived from the tenth type III domain of human fibronectin, can be an alternative to scFv as an antigen-binding moiety in the design of CAR molecules. We constructed adnectin-based CARs targeting epithelial growth factor receptor (EGFR) and found that compared to scFv-based CAR, T cells engineered with adnectin-based CARs exhibited equivalent cell-killing activity against target H292 lung cancer cells in vitro and had comparable antitumor efficacy in xenograft tumor-bearing mice in vivo. In addition, with optimal affinity tuning, adnectin-based CAR showed higher selectivity on target cells with high EGFR expression than on those with low expression. This new design of adnectin CARs can potentially facilitate the development of T cell immunotherapy for cancer and other diseases. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Emergence of robust growth laws from optimal regulation of ribosome synthesis.

PubMed

Scott, Matthew; Klumpp, Stefan; Mateescu, Eduard M; Hwa, Terence

2014-08-22

Bacteria must constantly adapt their growth to changes in nutrient availability; yet despite large-scale changes in protein expression associated with sensing, adaptation, and processing different environmental nutrients, simple growth laws connect the ribosome abundance and the growth rate. Here, we investigate the origin of these growth laws by analyzing the features of ribosomal regulation that coordinate proteome-wide expression changes with cell growth in a variety of nutrient conditions in the model organism Escherichia coli. We identify supply-driven feedforward activation of ribosomal protein synthesis as the key regulatory motif maximizing amino acid flux, and autonomously guiding a cell to achieve optimal growth in different environments. The growth laws emerge naturally from the robust regulatory strategy underlying growth rate control, irrespective of the details of the molecular implementation. The study highlights the interplay between phenomenological modeling and molecular mechanisms in uncovering fundamental operating constraints, with implications for endogenous and synthetic design of microorganisms. © 2014 The Authors. Published under the terms of the CC BY 4.0 license.

The Study on Network Examinational Database based on ASP Technology

NASA Astrophysics Data System (ADS)

Zhang, Yanfu; Han, Yuexiao; Zhou, Yanshuang

This article introduces the structure of the general test base system based on .NET technology, discussing the design of the function modules and its implementation methods. It focuses on key technology of the system, proposing utilizing the WEB online editor control to solve the input problem and regular expression to solve the problem HTML code, making use of genetic algorithm to optimize test paper and the automated tools of WORD to solve the problem of exporting papers and others. Practical effective design and implementation technology can be used as reference for the development of similar systems.

Three-port beam splitter of a binary fused-silica grating.

PubMed

Feng, Jijun; Zhou, Changhe; Wang, Bo; Zheng, Jiangjun; Jia, Wei; Cao, Hongchao; Lv, Peng

2008-12-10

A deep-etched polarization-independent binary fused-silica phase grating as a three-port beam splitter is designed and manufactured. The grating profile is optimized by use of the rigorous coupled-wave analysis around the 785 nm wavelength. The physical explanation of the grating is illustrated by the modal method. Simple analytical expressions of the diffraction efficiencies and modal guidelines for the three-port beam splitter grating design are given. Holographic recording technology and inductively coupled plasma etching are used to manufacture the fused-silica grating. Experimental results are in good agreement with the theoretical values.

Basic design considerations for free-electron lasers driven by electron beams from RF accelerators

NASA Astrophysics Data System (ADS)

Gover, A.; Freund, H.; Granatstein, V. L.; McAdoo, J. H.; Tang, C.-M.

A design procedure and design criteria are derived for free-electron lasers driven by electron beams from RF accelerators. The procedure and criteria permit an estimate of the oscillation-buildup time and the laser output power of various FEL schemes: with waveguide resonator or open resonator, with initial seed-radiation injection or with spontaneous-emission radiation source, with a linear wiggler or with a helical wiggler. Expressions are derived for computing the various FEL parameters, allowing for the design and optimization of the FEL operational characteristics under ideal conditions or with nonideal design parameters that may be limited by technological or practical constraints. The design procedure enables one to derive engineering curves and scaling laws for the FEL operating parameters. This can be done most conveniently with a computer program based on flowcharts given in the appendices.

Design of open rectangular and trapezoidal channels

NASA Astrophysics Data System (ADS)

González, C. P.; Vera, P. E.; Carrillo, G.; García, S.

2018-04-01

In this work, the results of designing open channels in rectangular and trapezoidal form are presented. For the development of the same important aspects were taken as determination of flows by means of formula of the rational method, area of the surface for its implementation, optimal form of the flow to meet the needs of that environment. In the design the parameter of the hydraulic radius expressed in terms of the hydraulic area and wet perimeter was determined, considering that the surface on which the fluid flows is the product of the perimeter of the section and the length of the channel and where shear is generated by the condition of no slippage.

Analytical thermal model for end-pumped solid-state lasers

NASA Astrophysics Data System (ADS)

Cini, L.; Mackenzie, J. I.

2017-12-01

Fundamentally power-limited by thermal effects, the design challenge for end-pumped "bulk" solid-state lasers depends upon knowledge of the temperature gradients within the gain medium. We have developed analytical expressions that can be used to model the temperature distribution and thermal-lens power in end-pumped solid-state lasers. Enabled by the inclusion of a temperature-dependent thermal conductivity, applicable from cryogenic to elevated temperatures, typical pumping distributions are explored and the results compared with accepted models. Key insights are gained through these analytical expressions, such as the dependence of the peak temperature rise in function of the boundary thermal conductance to the heat sink. Our generalized expressions provide simple and time-efficient tools for parametric optimization of the heat distribution in the gain medium based upon the material and pumping constraints.

RiboMaker: computational design of conformation-based riboregulation.

PubMed

Rodrigo, Guillermo; Jaramillo, Alfonso

2014-09-01

The ability to engineer control systems of gene expression is instrumental for synthetic biology. Thus, bioinformatic methods that assist such engineering are appealing because they can guide the sequence design and prevent costly experimental screening. In particular, RNA is an ideal substrate to de novo design regulators of protein expression by following sequence-to-function models. We have implemented a novel algorithm, RiboMaker, aimed at the computational, automated design of bacterial riboregulation. RiboMaker reads the sequence and structure specifications, which codify for a gene regulatory behaviour, and optimizes the sequences of a small regulatory RNA and a 5'-untranslated region for an efficient intermolecular interaction. To this end, it implements an evolutionary design strategy, where random mutations are selected according to a physicochemical model based on free energies. The resulting sequences can then be tested experimentally, providing a new tool for synthetic biology, and also for investigating the riboregulation principles in natural systems. Web server is available at http://ribomaker.jaramillolab.org/. Source code, instructions and examples are freely available for download at http://sourceforge.net/projects/ribomaker/. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Design of microarray experiments for genetical genomics studies.

PubMed

Bueno Filho, Júlio S S; Gilmour, Steven G; Rosa, Guilherme J M

2006-10-01

Microarray experiments have been used recently in genetical genomics studies, as an additional tool to understand the genetic mechanisms governing variation in complex traits, such as for estimating heritabilities of mRNA transcript abundances, for mapping expression quantitative trait loci, and for inferring regulatory networks controlling gene expression. Several articles on the design of microarray experiments discuss situations in which treatment effects are assumed fixed and without any structure. In the case of two-color microarray platforms, several authors have studied reference and circular designs. Here, we discuss the optimal design of microarray experiments whose goals refer to specific genetic questions. Some examples are used to illustrate the choice of a design for comparing fixed, structured treatments, such as genotypic groups. Experiments targeting single genes or chromosomic regions (such as with transgene research) or multiple epistatic loci (such as within a selective phenotyping context) are discussed. In addition, microarray experiments in which treatments refer to families or to subjects (within family structures or complex pedigrees) are presented. In these cases treatments are more appropriately considered to be random effects, with specific covariance structures, in which the genetic goals relate to the estimation of genetic variances and the heritability of transcriptional abundances.

Usefulness of heterologous promoters in the Pseudozyma flocculosa gene expression system.

PubMed

Avis, Tyler J; Anguenot, Raphaël; Neveu, Bertrand; Bolduc, Sébastien; Zhao, Yingyi; Cheng, Yali; Labbé, Caroline; Belzile, François; Bélanger, Richard R

2008-02-01

The basidiomycetous fungus Pseudozyma flocculosa represents a promising new host for the expression of complex recombinant proteins. Two novel heterologous promoter sequences, the Ustilago maydis glyceraldehyde-3-phosphate dehydrogenase (GPD) and Pseudozyma tsukubaensis alpha-glucosidase promoters, were tested for their ability to provide expression in P. flocculosa. In liquid medium, these two promoters produced lower levels of intracellular green fluorescent protein (GFP) as compared to the U. maydis hsp70 promoter. However, GPD and alpha-glucosidase sequences behaved as constitutive promoters whereas the hsp70 promoter appeared to be morphology-dependent. When using the hsp70 promoter, the expression of GFP increased proportionally to the concentration of hygromycin in the culture medium, indicating possible induction of the promoter by the antibiotic. Optimal solid-state culture conditions were designed for high throughput screening of hygromycin-resistant transformants with the hsp70 promoter in P. flocculosa.

Optimizing antibody expression: The nuts and bolts.

PubMed

Ayyar, B Vijayalakshmi; Arora, Sushrut; Ravi, Shiva Shankar

2017-03-01

Antibodies are extensively utilized entities in biomedical research, and in the development of diagnostics and therapeutics. Many of these applications require high amounts of antibodies. However, meeting this ever-increasing demand of antibodies in the global market is one of the outstanding challenges. The need to maintain a balance between demand and supply of antibodies has led the researchers to discover better means and methods for optimizing their expression. These strategies aim to increase the volumetric productivity of the antibodies along with the reduction of associated manufacturing costs. Recent years have witnessed major advances in recombinant protein technology, owing to the introduction of novel cloning strategies, gene manipulation techniques, and an array of cell and vector engineering techniques, together with the progress in fermentation technologies. These innovations were also highly beneficial for antibody expression. Antibody expression depends upon the complex interplay of multiple factors that may require fine tuning at diverse levels to achieve maximum yields. However, each antibody is unique and requires individual consideration and customization for optimizing the associated expression parameters. This review provides a comprehensive overview of several state-of-the-art approaches, such as host selection, strain engineering, codon optimization, gene optimization, vector modification and process optimization that are deemed suitable for enhancing antibody expression. Copyright © 2017 Elsevier Inc. All rights reserved.

Approaches to Optimizing Animal Cell Culture Process: Substrate Metabolism Regulation and Protein Expression Improvement

NASA Astrophysics Data System (ADS)

Zhang, Yuanxing

Some high value proteins and vaccines for medical and veterinary applications by animal cell culture have an increasing market in China. In order to meet the demands of large-scale productions of proteins and vaccines, animal cell culture technology has been widely developed. In general, an animal cell culture process can be divided into two stages in a batch culture. In cell growth stage a high specific growth rate is expected to achieve a high cell density. In production stage a high specific production rate is stressed for the expression and secretion of qualified protein or replication of virus. It is always critical to maintain high cell viability in fed-batch and perfusion cultures. More concern has been focused on two points by the researchers in China. First, the cell metabolism of substrates is analyzed and the accumulation of toxic by-products is decreased through regulating cell metabolism in the culture process. Second, some important factors effecting protein expression are understood at the molecular level and the production ability of protein is improved. In pace with the rapid development of large-scale cell culture for the production of vaccines, antibodies and other recombinant proteins in China, the medium design and process optimization based on cell metabolism regulation and protein expression improvement will play an important role. The chapter outlines the main advances in metabolic regulation of cell and expression improvement of protein in animal cell culture in recent years.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yazawa, Kazuaki; Shakouri, Ali

The energy conversion efficiency of today’s thermoelectric generators is significantly lower than that of conventional mechanical engines. Almost all of the existing research is focused on materials to improve the conversion efficiency. Here we propose a general framework to study the cost-efficiency trade-off for thermoelectric power generation. A key factor is the optimization of thermoelectric modules together with their heat source and heat sinks. Full electrical and thermal co-optimization yield a simple analytical expression for optimum design. Based on this model, power output per unit mass can be maximized. We show that the fractional area coverage of thermoelectric elements inmore » a module could play a significant role in reducing the cost of power generation systems.« less

The optimal design of stepped wedge trials with equal allocation to sequences and a comparison to other trial designs.

PubMed

Thompson, Jennifer A; Fielding, Katherine; Hargreaves, James; Copas, Andrew

2017-12-01

Background/Aims We sought to optimise the design of stepped wedge trials with an equal allocation of clusters to sequences and explored sample size comparisons with alternative trial designs. Methods We developed a new expression for the design effect for a stepped wedge trial, assuming that observations are equally correlated within clusters and an equal number of observations in each period between sequences switching to the intervention. We minimised the design effect with respect to (1) the fraction of observations before the first and after the final sequence switches (the periods with all clusters in the control or intervention condition, respectively) and (2) the number of sequences. We compared the design effect of this optimised stepped wedge trial to the design effects of a parallel cluster-randomised trial, a cluster-randomised trial with baseline observations, and a hybrid trial design (a mixture of cluster-randomised trial and stepped wedge trial) with the same total cluster size for all designs. Results We found that a stepped wedge trial with an equal allocation to sequences is optimised by obtaining all observations after the first sequence switches and before the final sequence switches to the intervention; this means that the first sequence remains in the control condition and the last sequence remains in the intervention condition for the duration of the trial. With this design, the optimal number of sequences is [Formula: see text], where [Formula: see text] is the cluster-mean correlation, [Formula: see text] is the intracluster correlation coefficient, and m is the total cluster size. The optimal number of sequences is small when the intracluster correlation coefficient and cluster size are small and large when the intracluster correlation coefficient or cluster size is large. A cluster-randomised trial remains more efficient than the optimised stepped wedge trial when the intracluster correlation coefficient or cluster size is small. A cluster-randomised trial with baseline observations always requires a larger sample size than the optimised stepped wedge trial. The hybrid design can always give an equally or more efficient design, but will be at most 5% more efficient. We provide a strategy for selecting a design if the optimal number of sequences is unfeasible. For a non-optimal number of sequences, the sample size may be reduced by allowing a proportion of observations before the first or after the final sequence has switched. Conclusion The standard stepped wedge trial is inefficient. To reduce sample sizes when a hybrid design is unfeasible, stepped wedge trial designs should have no observations before the first sequence switches or after the final sequence switches.

Regional Delivery of Chimeric Antigen Receptor-Engineered T Cells Effectively Targets HER2+ Breast Cancer Metastasis to the Brain.

PubMed

Priceman, Saul J; Tilakawardane, Dileshni; Jeang, Brook; Aguilar, Brenda; Murad, John P; Park, Anthony K; Chang, Wen-Chung; Ostberg, Julie R; Neman, Josh; Jandial, Rahul; Portnow, Jana; Forman, Stephen J; Brown, Christine E

2018-01-01

Purpose: Metastasis to the brain from breast cancer remains a significant clinical challenge, and may be targeted with CAR-based immunotherapy. CAR design optimization for solid tumors is crucial due to the absence of truly restricted antigen expression and potential safety concerns with "on-target off-tumor" activity. Here, we have optimized HER2-CAR T cells for the treatment of breast to brain metastases, and determined optimal second-generation CAR design and route of administration for xenograft mouse models of breast metastatic brain tumors, including multifocal and leptomeningeal disease. Experimental Design: HER2-CAR constructs containing either CD28 or 4-1BB intracellular costimulatory signaling domains were compared for functional activity in vitro by measuring cytokine production, T-cell proliferation, and tumor killing capacity. We also evaluated HER2-CAR T cells delivered by intravenous, local intratumoral, or regional intraventricular routes of administration using in vivo human xenograft models of breast cancer that have metastasized to the brain. Results: Here, we have shown that HER2-CARs containing the 4-1BB costimulatory domain confer improved tumor targeting with reduced T-cell exhaustion phenotype and enhanced proliferative capacity compared with HER2-CARs containing the CD28 costimulatory domain. Local intracranial delivery of HER2-CARs showed potent in vivo antitumor activity in orthotopic xenograft models. Importantly, we demonstrated robust antitumor efficacy following regional intraventricular delivery of HER2-CAR T cells for the treatment of multifocal brain metastases and leptomeningeal disease. Conclusions: Our study shows the importance of CAR design in defining an optimized CAR T cell, and highlights intraventricular delivery of HER2-CAR T cells for treating multifocal brain metastases. Clin Cancer Res; 24(1); 95-105. ©2017 AACR . ©2017 American Association for Cancer Research.

Generalized bipartite quantum state discrimination problems with sequential measurements

NASA Astrophysics Data System (ADS)

Nakahira, Kenji; Kato, Kentaro; Usuda, Tsuyoshi Sasaki

2018-02-01

We investigate an optimization problem of finding quantum sequential measurements, which forms a wide class of state discrimination problems with the restriction that only local operations and one-way classical communication are allowed. Sequential measurements from Alice to Bob on a bipartite system are considered. Using the fact that the optimization problem can be formulated as a problem with only Alice's measurement and is convex programming, we derive its dual problem and necessary and sufficient conditions for an optimal solution. Our results are applicable to various practical optimization criteria, including the Bayes criterion, the Neyman-Pearson criterion, and the minimax criterion. In the setting of the problem of finding an optimal global measurement, its dual problem and necessary and sufficient conditions for an optimal solution have been widely used to obtain analytical and numerical expressions for optimal solutions. Similarly, our results are useful to obtain analytical and numerical expressions for optimal sequential measurements. Examples in which our results can be used to obtain an analytical expression for an optimal sequential measurement are provided.

Isolation, characterization and optimization of culture parameters for production of an alkaline protease isolated from Aspergillus tamarii.

PubMed

Anandan, Dayanandan; Marmer, William N; Dudley, Robert L

2007-05-01

Aspergillus tamarii expresses an extracellular alkaline protease that we show to be effective in removing hair from cattle hide. Large quantities of the enzyme will be required for the optimization of the enzymatic dehairing process so the growth conditions for maximum protease expression by A. tamarii were optimized for both solid-state culture on wheat bran and for broth culture. Optimal protease expression occurred, for both cultural media, at initial pH 9; the culture was incubated at 30 degrees C for 96 h using a 5% inoculum. The crude enzyme was isolated, purified and characterized using MALDI TOF TOF. The alkaline protease was homologous to the alkaline protease expressed by Aspergillus viridinutans.

Covariance expressions for eigenvalue and eigenvector problems

NASA Astrophysics Data System (ADS)

Liounis, Andrew J.

There are a number of important scientific and engineering problems whose solutions take the form of an eigenvalue--eigenvector problem. Some notable examples include solutions to linear systems of ordinary differential equations, controllability of linear systems, finite element analysis, chemical kinetics, fitting ellipses to noisy data, and optimal estimation of attitude from unit vectors. In many of these problems, having knowledge of the eigenvalue and eigenvector Jacobians is either necessary or is nearly as important as having the solution itself. For instance, Jacobians are necessary to find the uncertainty in a computed eigenvalue or eigenvector estimate. This uncertainty, which is usually represented as a covariance matrix, has been well studied for problems similar to the eigenvalue and eigenvector problem, such as singular value decomposition. There has been substantially less research on the covariance of an optimal estimate originating from an eigenvalue-eigenvector problem. In this thesis we develop two general expressions for the Jacobians of eigenvalues and eigenvectors with respect to the elements of their parent matrix. The expressions developed make use of only the parent matrix and the eigenvalue and eigenvector pair under consideration. In addition, they are applicable to any general matrix (including complex valued matrices, eigenvalues, and eigenvectors) as long as the eigenvalues are simple. Alongside this, we develop expressions that determine the uncertainty in a vector estimate obtained from an eigenvalue-eigenvector problem given the uncertainty of the terms of the matrix. The Jacobian expressions developed are numerically validated with forward finite, differencing and the covariance expressions are validated using Monte Carlo analysis. Finally, the results from this work are used to determine covariance expressions for a variety of estimation problem examples and are also applied to the design of a dynamical system.

SGDB: a database of synthetic genes re-designed for optimizing protein over-expression.

PubMed

Wu, Gang; Zheng, Yuanpu; Qureshi, Imran; Zin, Htar Thant; Beck, Tyler; Bulka, Blazej; Freeland, Stephen J

2007-01-01

Here we present the Synthetic Gene Database (SGDB): a relational database that houses sequences and associated experimental information on synthetic (artificially engineered) genes from all peer-reviewed studies published to date. At present, the database comprises information from more than 200 published experiments. This resource not only provides reference material to guide experimentalists in designing new genes that improve protein expression, but also offers a dataset for analysis by bioinformaticians who seek to test ideas regarding the underlying factors that influence gene expression. The SGDB was built under MySQL database management system. We also offer an XML schema for standardized data description of synthetic genes. Users can access the database at http://www.evolvingcode.net/codon/sgdb/index.php, or batch downloads all information through XML files. Moreover, users may visually compare the coding sequences of a synthetic gene and its natural counterpart with an integrated web tool at http://www.evolvingcode.net/codon/sgdb/aligner.php, and discuss questions, findings and related information on an associated e-forum at http://www.evolvingcode.net/forum/viewforum.php?f=27.

5S rRNA Promoter for Guide RNA Expression Enabled Highly Efficient CRISPR/Cas9 Genome Editing in Aspergillus niger.

PubMed

Zheng, Xiaomei; Zheng, Ping; Zhang, Kun; Cairns, Timothy C; Meyer, Vera; Sun, Jibin; Ma, Yanhe

2018-04-30

The CRISPR/Cas9 system is a revolutionary genome editing tool. However, in eukaryotes, search and optimization of a suitable promoter for guide RNA expression is a significant technical challenge. Here we used the industrially important fungus, Aspergillus niger, to demonstrate that the 5S rRNA gene, which is both highly conserved and efficiently expressed in eukaryotes, can be used as a guide RNA promoter. The gene editing system was established with 100% rates of precision gene modifications among dozens of transformants using short (40-bp) homologous donor DNA. This system was also applicable for generation of designer chromosomes, as evidenced by deletion of a 48 kb gene cluster required for biosynthesis of the mycotoxin fumonisin B1. Moreover, this system also facilitated simultaneous mutagenesis of multiple genes in A. niger. We anticipate that the use of the 5S rRNA gene as guide RNA promoter can broadly be applied for engineering highly efficient eukaryotic CRISPR/Cas9 toolkits. Additionally, the system reported here will enable development of designer chromosomes in model and industrially important fungi.

Application of experimental design for the optimization of artificial neural network-based water quality model: a case study of dissolved oxygen prediction.

PubMed

Šiljić Tomić, Aleksandra; Antanasijević, Davor; Ristić, Mirjana; Perić-Grujić, Aleksandra; Pocajt, Viktor

2018-04-01

This paper presents an application of experimental design for the optimization of artificial neural network (ANN) for the prediction of dissolved oxygen (DO) content in the Danube River. The aim of this research was to obtain a more reliable ANN model that uses fewer monitoring records, by simultaneous optimization of the following model parameters: number of monitoring sites, number of historical monitoring data (expressed in years), and number of input water quality parameters used. Box-Behnken three-factor at three levels experimental design was applied for simultaneous spatial, temporal, and input variables optimization of the ANN model. The prediction of DO was performed using a feed-forward back-propagation neural network (BPNN), while the selection of most important inputs was done off-model using multi-filter approach that combines a chi-square ranking in the first step with a correlation-based elimination in the second step. The contour plots of absolute and relative error response surfaces were utilized to determine the optimal values of design factors. From the contour plots, two BPNN models that cover entire Danube flow through Serbia are proposed: an upstream model (BPNN-UP) that covers 8 monitoring sites prior to Belgrade and uses 12 inputs measured in the 7-year period and a downstream model (BPNN-DOWN) which covers 9 monitoring sites and uses 11 input parameters measured in the 6-year period. The main difference between the two models is that BPNN-UP utilizes inputs such as BOD, P, and PO 4 3- , which is in accordance with the fact that this model covers northern part of Serbia (Vojvodina Autonomous Province) which is well-known for agricultural production and extensive use of fertilizers. Both models have shown very good agreement between measured and predicted DO (with R 2  ≥ 0.86) and demonstrated that they can effectively forecast DO content in the Danube River.

Risk assessment and experimental design in the development of a prolonged release drug delivery system with paliperidone

PubMed Central

Iurian, Sonia; Turdean, Luana; Tomuta, Ioan

2017-01-01

This study focuses on the development of a drug product based on a risk assessment-based approach, within the quality by design paradigm. A prolonged release system was proposed for paliperidone (Pal) delivery, containing Kollidon® SR as an insoluble matrix agent and hydroxypropyl cellulose, hydroxypropyl methylcellulose (HPMC), or sodium carboxymethyl cellulose as a hydrophilic polymer. The experimental part was preceded by the identification of potential sources of variability through Ishikawa diagrams, and failure mode and effects analysis was used to deliver the critical process parameters that were further optimized by design of experiments. A D-optimal design was used to investigate the effects of Kollidon SR ratio (X1), the type of hydrophilic polymer (X2), and the percentage of hydrophilic polymer (X3) on the percentages of dissolved Pal over 24 h (Y1–Y9). Effects expressed as regression coefficients and response surfaces were generated, along with a design space for the preparation of a target formulation in an experimental area with low error risk. The optimal formulation contained 27.62% Kollidon SR and 8.73% HPMC and achieved the prolonged release of Pal, with low burst effect, at ratios that were very close to the ones predicted by the model. Thus, the parameters with the highest impact on the final product quality were studied, and safe ranges were established for their variations. Finally, a risk mitigation and control strategy was proposed to assure the quality of the system, by constant process monitoring. PMID:28331293

'Unconventional' experiments in biology and medicine with optimized design based on quantum-like correlations.

PubMed

Beauvais, Francis

2017-02-01

In previous articles, a description of 'unconventional' experiments (e.g. in vitro or clinical studies based on high dilutions, 'memory of water' or homeopathy) using quantum-like probability was proposed. Because the mathematical formulations of quantum logic are frequently an obstacle for physicians and biologists, a modified modeling that rests on classical probability is described in the present article. This modeling is inspired from a relational interpretation of quantum physics that applies not only to microscopic objects, but also to macroscopic structures, including experimental devices and observers. In this framework, any outcome of an experiment is not an absolute property of the observed system as usually considered but is expressed relatively to an observer. A team of interacting observers is thus described from an external view point based on two principles: the outcomes of experiments are expressed relatively to each observer and the observers agree on outcomes when they interact with each other. If probability fluctuations are also taken into account, correlations between 'expected' and observed outcomes emerge. Moreover, quantum-like correlations are predicted in experiments with local blind design but not with centralized blind design. No assumption on 'memory' or other physical modification of water is necessary in the present description although such hypotheses cannot be formally discarded. In conclusion, a simple modeling of 'unconventional' experiments based on classical probability is now available and its predictions can be tested. The underlying concepts are sufficiently intuitive to be spread into the homeopathy community and beyond. It is hoped that this modeling will encourage new studies with optimized designs for in vitro experiments and clinical trials. Copyright © 2017 The Faculty of Homeopathy. Published by Elsevier Ltd. All rights reserved.

Wing Weight Optimization Under Aeroelastic Loads Subject to Stress Constraints

NASA Technical Reports Server (NTRS)

Kapania, Rakesh K.; Issac, J.; Macmurdy, D.; Guruswamy, Guru P.

1997-01-01

A minimum weight optimization of the wing under aeroelastic loads subject to stress constraints is carried out. The loads for the optimization are based on aeroelastic trim. The design variables are the thickness of the wing skins and planform variables. The composite plate structural model incorporates first-order shear deformation theory, the wing deflections are expressed using Chebyshev polynomials and a Rayleigh-Ritz procedure is adopted for the structural formulation. The aerodynamic pressures provided by the aerodynamic code at a discrete number of grid points is represented as a bilinear distribution on the composite plate code to solve for the deflections and stresses in the wing. The lifting-surface aerodynamic code FAST is presently being used to generate the pressure distribution over the wing. The envisioned ENSAERO/Plate is an aeroelastic analysis code which combines ENSAERO version 3.0 (for analysis of wing-body configurations) with the composite plate code.

When is a research question not a research question?

PubMed

Mayo, Nancy E; Asano, Miho; Barbic, Skye Pamela

2013-06-01

Research is undertaken to answer important questions yet often the question is poorly expressed and lacks information on the population, the exposure or intervention, the comparison, and the outcome. An optimal research question sets out what the investigator wants to know, not what the investigator might do, nor what the results of the study might ultimately contribute. The purpose of this paper is to estimate the extent to which rehabilitation scientists optimally define their research questions. A cross-sectional survey of the rehabilitation research articles published during 2008. Two raters independently rated each question according to pre-specified criteria; a third rater adjudicated all discrepant ratings. The proportion of the 258 articles with a question formulated as methods or expected contribution and not as what knowledge was being sought was 65%; 30% of questions required reworking. The designs which most often had poorly formulated research questions were randomized trials, cross-sectional and measurement studies. Formulating the research question is not purely a semantic concern. When the question is poorly formulated, the design, analysis, sample size calculations, and presentation of results may not be optimal. The gap between research and clinical practice could be bridged by a clear, complete, and informative research question.

Consistent integration of experimental and ab initio data into molecular and coarse-grained models

NASA Astrophysics Data System (ADS)

Vlcek, Lukas

As computer simulations are increasingly used to complement or replace experiments, highly accurate descriptions of physical systems at different time and length scales are required to achieve realistic predictions. The questions of how to objectively measure model quality in relation to reference experimental or ab initio data, and how to transition seamlessly between different levels of resolution are therefore of prime interest. To address these issues, we use the concept of statistical distance to define a measure of similarity between statistical mechanical systems, i.e., a model and its target, and show that its minimization leads to general convergence of the systems' measurable properties. Through systematic coarse-graining, we arrive at appropriate expressions for optimization loss functions consistently incorporating microscopic ab initio data as well as macroscopic experimental data. The design of coarse-grained and multiscale models is then based on factoring the model system partition function into terms describing the system at different resolution levels. The optimization algorithm takes advantage of thermodynamic perturbation expressions for fast exploration of the model parameter space, enabling us to scan millions of parameter combinations per hour on a single CPU. The robustness and generality of the new model optimization framework and its efficient implementation are illustrated on selected examples including aqueous solutions, magnetic systems, and metal alloys.

Analytical and experimental design and analysis of an optimal processor for image registration

NASA Technical Reports Server (NTRS)

Mcgillem, C. D. (Principal Investigator); Svedlow, M.; Anuta, P. E.

1976-01-01

The author has identified the following significant results. A quantitative measure of the registration processor accuracy in terms of the variance of the registration error was derived. With the appropriate assumptions, the variance was shown to be inversely proportional to the square of the effective bandwidth times the signal to noise ratio. The final expressions were presented to emphasize both the form and simplicity of their representation. In the situation where relative spatial distortions exist between images to be registered, expressions were derived for estimating the loss in output signal to noise ratio due to these spatial distortions. These results are in terms of a reduction factor.

The effect of waist twisting on walking speed of an amphibious salamander like robot

NASA Astrophysics Data System (ADS)

Yin, Xin-Yan; Jia, Li-Chao; Wang, Chen; Xie, Guang-Ming

2016-06-01

Amphibious salamanders often swing their waist to coordinate quadruped walking in order to improve their crawling speed. A robot with a swing waist joint, like an amphibious salamander, is used to mimic this locomotion. A control method is designed to allow the robot to maintain the rotational speed of its legs continuous and avoid impact between its legs and the ground. An analytical expression is established between the amplitude of the waist joint and the step length. Further, an optimization amplitude is obtained corresponding to the maximum stride. The simulation results based on automatic dynamic analysis of mechanical systems (ADAMS) and physical experiments verify the rationality and validity of this expression.

Comparison of Optimal Design Methods in Inverse Problems

PubMed Central

Banks, H. T.; Holm, Kathleen; Kappel, Franz

2011-01-01

Typical optimal design methods for inverse or parameter estimation problems are designed to choose optimal sampling distributions through minimization of a specific cost function related to the resulting error in parameter estimates. It is hoped that the inverse problem will produce parameter estimates with increased accuracy using data collected according to the optimal sampling distribution. Here we formulate the classical optimal design problem in the context of general optimization problems over distributions of sampling times. We present a new Prohorov metric based theoretical framework that permits one to treat succinctly and rigorously any optimal design criteria based on the Fisher Information Matrix (FIM). A fundamental approximation theory is also included in this framework. A new optimal design, SE-optimal design (standard error optimal design), is then introduced in the context of this framework. We compare this new design criteria with the more traditional D-optimal and E-optimal designs. The optimal sampling distributions from each design are used to compute and compare standard errors; the standard errors for parameters are computed using asymptotic theory or bootstrapping and the optimal mesh. We use three examples to illustrate ideas: the Verhulst-Pearl logistic population model [13], the standard harmonic oscillator model [13] and a popular glucose regulation model [16, 19, 29]. PMID:21857762

Application of D-optimal experimental design method to optimize the formulation of O/W cosmetic emulsions.

PubMed

Djuris, J; Vasiljevic, D; Jokic, S; Ibric, S

2014-02-01

This study investigates the application of D-optimal mixture experimental design in optimization of O/W cosmetic emulsions. Cetearyl glucoside was used as a natural, biodegradable non-ionic emulsifier in the relatively low concentration (1%), and the mixture of co-emulsifiers (stearic acid, cetyl alcohol, stearyl alcohol and glyceryl stearate) was used to stabilize the formulations. To determine the optimal composition of co-emulsifiers mixture, D-optimal mixture experimental design was used. Prepared emulsions were characterized with rheological measurements, centrifugation test, specific conductivity and pH value measurements. All prepared samples appeared as white and homogenous creams, except for one homogenous and viscous lotion co-stabilized by stearic acid alone. Centrifugation testing revealed some phase separation only in the case of sample co-stabilized using glyceryl stearate alone. The obtained pH values indicated that all samples expressed mild acid value acceptable for cosmetic preparations. Specific conductivity values are attributed to the multiple phases O/W emulsions with high percentages of fixed water. Results of the rheological measurements have shown that the investigated samples exhibited non-Newtonian thixotropic behaviour. To determine the influence of each of the co-emulsifiers on emulsions properties, the obtained results were evaluated by the means of statistical analysis (ANOVA test). On the basis of comparison of statistical parameters for each of the studied responses, mixture reduced quadratic model was selected over the linear model implying that interactions between co-emulsifiers play the significant role in overall influence of co-emulsifiers on emulsions properties. Glyceryl stearate was found to be the dominant co-emulsifier affecting emulsions properties. Interactions between the glyceryl stearate and other co-emulsifiers were also found to significantly influence emulsions properties. These findings are especially important as they can be used for development of the product that meets users' requirements, as represented in the study. © 2013 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Improvements on a non-invasive, parameter-free approach to inverse form finding

NASA Astrophysics Data System (ADS)

Landkammer, P.; Caspari, M.; Steinmann, P.

2017-08-01

Our objective is to determine the optimal undeformed workpiece geometry (material configuration) within forming processes when the prescribed deformed geometry (spatial configuration) is given. For solving the resulting shape optimization problem—also denoted as inverse form finding—we use a novel parameter-free approach, which relocates in each iteration the material nodal positions as design variables. The spatial nodal positions computed by an elasto-plastic finite element (FE) forming simulation are compared with their prescribed values. The objective function expresses a least-squares summation of the differences between the computed and the prescribed nodal positions. Here, a recently developed shape optimization approach (Landkammer and Steinmann in Comput Mech 57(2):169-191, 2016) is investigated with a view to enhance its stability and efficiency. Motivated by nonlinear optimization theory a detailed justification of the algorithm is given. Furthermore, a classification according to shape changing design, fixed and controlled nodal coordinates is introduced. Two examples with large elasto-plastic strains demonstrate that using a superconvergent patch recovery technique instead of a least-squares (L2 )-smoothing improves the efficiency. Updating the interior discretization nodes by solving a fictitious elastic problem also reduces the number of required FE iterations and avoids severe mesh distortions. Furthermore, the impact of the inclusion of the second deformation gradient in the Hessian of the Quasi-Newton approach is analyzed. Inverse form finding is a crucial issue in metal forming applications. As a special feature, the approach is designed to be coupled in a non-invasive fashion to arbitrary FE software.

Improvements on a non-invasive, parameter-free approach to inverse form finding

NASA Astrophysics Data System (ADS)

Landkammer, P.; Caspari, M.; Steinmann, P.

2018-04-01

Our objective is to determine the optimal undeformed workpiece geometry (material configuration) within forming processes when the prescribed deformed geometry (spatial configuration) is given. For solving the resulting shape optimization problem—also denoted as inverse form finding—we use a novel parameter-free approach, which relocates in each iteration the material nodal positions as design variables. The spatial nodal positions computed by an elasto-plastic finite element (FE) forming simulation are compared with their prescribed values. The objective function expresses a least-squares summation of the differences between the computed and the prescribed nodal positions. Here, a recently developed shape optimization approach (Landkammer and Steinmann in Comput Mech 57(2):169-191, 2016) is investigated with a view to enhance its stability and efficiency. Motivated by nonlinear optimization theory a detailed justification of the algorithm is given. Furthermore, a classification according to shape changing design, fixed and controlled nodal coordinates is introduced. Two examples with large elasto-plastic strains demonstrate that using a superconvergent patch recovery technique instead of a least-squares (L2)-smoothing improves the efficiency. Updating the interior discretization nodes by solving a fictitious elastic problem also reduces the number of required FE iterations and avoids severe mesh distortions. Furthermore, the impact of the inclusion of the second deformation gradient in the Hessian of the Quasi-Newton approach is analyzed. Inverse form finding is a crucial issue in metal forming applications. As a special feature, the approach is designed to be coupled in a non-invasive fashion to arbitrary FE software.

Rhesus Monkey Rhadinovirus ORF57 Induces gH and gL Glycoprotein Expression through Posttranscriptional Accumulation of Target mRNAs ▿

PubMed Central

Shin, Young C.; Desrosiers, Ronald C.

2011-01-01

Open reading frame 57 (ORF57) of gamma-2 herpesviruses is a key regulator of viral gene expression. It has been reported to enhance the expression of viral genes by transcriptional, posttranscriptional, or translational activation mechanisms. Previously we have shown that the expression of gH and gL of rhesus monkey rhadinovirus (RRV), a close relative of the human Kaposi's sarcoma-associated herpesvirus (KSHV), could be dramatically rescued by codon optimization as well as by ORF57 coexpression (J. P. Bilello, J. S. Morgan, and R. C. Desrosiers, J. Virol. 82:7231–7237, 2008). We show here that ORF57 coexpression and codon optimization had similar effects, except that the rescue of expression by codon optimization was temporally delayed relative to that of ORF57 coexpression. The transfection of gL mRNA directly into cells with or without ORF57 coexpression and with or without codon optimization recapitulated the effects of these modes of induction on transfected DNA. These findings suggested an important role for the enhancement of mRNA stability and/or the translation of mRNA for these very different modes of induced expression. This conclusion was confirmed by several different measures of gH and gL mRNA stability and accumulation with or without ORF57 coexpression and with or without codon optimization. Our results indicate that RRV gH and gL expression is severely limited by the stability of the mRNA and that ORF57 coexpression and codon optimization independently induce gH and gL expression principally by allowing accumulation and translation of these mRNAs. PMID:21613403

Analysis and design of a 3rd order velocity-controlled closed-loop for MEMS vibratory gyroscopes.

PubMed

Wu, Huan-ming; Yang, Hai-gang; Yin, Tao; Jiao, Ji-wei

2013-09-18

The time-average method currently available is limited to analyzing the specific performance of the automatic gain control-proportional and integral (AGC-PI) based velocity-controlled closed-loop in a micro-electro-mechanical systems (MEMS) vibratory gyroscope, since it is hard to solve nonlinear functions in the time domain when the control loop reaches to 3rd order. In this paper, we propose a linearization design approach to overcome this limitation by establishing a 3rd order linear model of the control loop and transferring the analysis to the frequency domain. Order reduction is applied on the built linear model's transfer function by constructing a zero-pole doublet, and therefore mathematical expression of each control loop's performance specification is obtained. Then an optimization methodology is summarized, which reveals that a robust, stable and swift control loop can be achieved by carefully selecting the system parameters following a priority order. Closed-loop drive circuits are designed and implemented using 0.35 μm complementary metal oxide semiconductor (CMOS) process, and experiments carried out on a gyroscope prototype verify the optimization methodology that an optimized stability of the control loop can be achieved by constructing the zero-pole doublet, and disturbance rejection capability (D.R.C) of the control loop can be improved by increasing the integral term.

Structure-based design of novel chemical modification of the 3'-overhang for optimization of short interfering RNA performance.

PubMed

Xu, Lexing; Wang, Xin; He, Hongwei; Zhou, Jinming; Li, Xiaoyu; Ma, Hongtao; Li, Zelin; Zeng, Yi; Shao, Rongguang; Cen, Shan; Wang, Yucheng

2015-02-10

Short interfering RNAs (siRNAs) are broadly used to manipulate gene expression in mammalian cells. Although chemical modification is useful for increasing the potency of siRNAs in vivo, rational optimization of siRNA performance through chemical modification is still a challenge. In this work, we designed and synthesized a set of siRNAs containing modified two-nucleotide 3'-overhangs with the aim of strengthening the interaction between the 3'-end of the siRNA strand and the PAZ domain of Ago2. Their efficiency of binding to the PAZ domain was calculated using a computer modeling program, followed by measurement of RNA-Ago2 interaction in a surface plasmon resonance biochemical assay. The results suggest that increasing the level of binding of the 3'-end of the guiding strand with the PAZ domain, and/or reducing the level of binding of the sense strand through modifying the two-nucleotide 3'-overhangs, affects preferential strand selection and improves siRNA activity, while we cannot exclude the possibility that the modifications at the 3'-end of the sense strand may also affect the recognition of the 5'-end of the guiding strand by the MID domain. Taken together, our work presents a strategy for optimizing siRNA performance through asymmetric chemical modification of 3'-overhangs and also helps to develop the computer modeling method for rational siRNA design.

A new approach to mixed H2/H infinity controller synthesis using gradient-based parameter optimization methods

NASA Technical Reports Server (NTRS)

Ly, Uy-Loi; Schoemig, Ewald

1993-01-01

In the past few years, the mixed H(sub 2)/H-infinity control problem has been the object of much research interest since it allows the incorporation of robust stability into the LQG framework. The general mixed H(sub 2)/H-infinity design problem has yet to be solved analytically. Numerous schemes have considered upper bounds for the H(sub 2)-performance criterion and/or imposed restrictive constraints on the class of systems under investigation. Furthermore, many modern control applications rely on dynamic models obtained from finite-element analysis and thus involve high-order plant models. Hence the capability to design low-order (fixed-order) controllers is of great importance. In this research a new design method was developed that optimizes the exact H(sub 2)-norm of a certain subsystem subject to robust stability in terms of H-infinity constraints and a minimal number of system assumptions. The derived algorithm is based on a differentiable scalar time-domain penalty function to represent the H-infinity constraints in the overall optimization. The scheme is capable of handling multiple plant conditions and hence multiple performance criteria and H-infinity constraints and incorporates additional constraints such as fixed-order and/or fixed structure controllers. The defined penalty function is applicable to any constraint that is expressible in form of a real symmetric matrix-inequity.

Expression profiling of snoRNAs in normal hematopoiesis and AML

PubMed Central

Warner, Wayne A.; Spencer, David H.; Trissal, Maria; White, Brian S.; Helton, Nichole; Ley, Timothy J.

2018-01-01

Small nucleolar RNAs (snoRNAs) are noncoding RNAs that contribute to ribosome biogenesis and RNA splicing by modifying ribosomal RNA and spliceosome RNAs, respectively. We optimized a next-generation sequencing approach and a custom analysis pipeline to identify and quantify expression of snoRNAs in acute myeloid leukemia (AML) and normal hematopoietic cell populations. We show that snoRNAs are expressed in a lineage- and development-specific fashion during hematopoiesis. The most striking examples involve snoRNAs located in 2 imprinted loci, which are highly expressed in hematopoietic progenitors and downregulated during myeloid differentiation. Although most snoRNAs are expressed at similar levels in AML cells compared with CD34+, a subset of snoRNAs showed consistent differential expression, with the great majority of these being decreased in the AML samples. Analysis of host gene expression, splicing patterns, and whole-genome sequence data for mutational events did not identify transcriptional patterns or genetic alterations that account for these expression differences. These data provide a comprehensive analysis of the snoRNA transcriptome in normal and leukemic cells and should be helpful in the design of studies to define the contribution of snoRNAs to normal and malignant hematopoiesis. PMID:29365324

Statistical design of quantitative mass spectrometry-based proteomic experiments.

PubMed

Oberg, Ann L; Vitek, Olga

2009-05-01

We review the fundamental principles of statistical experimental design, and their application to quantitative mass spectrometry-based proteomics. We focus on class comparison using Analysis of Variance (ANOVA), and discuss how randomization, replication and blocking help avoid systematic biases due to the experimental procedure, and help optimize our ability to detect true quantitative changes between groups. We also discuss the issues of pooling multiple biological specimens for a single mass analysis, and calculation of the number of replicates in a future study. When applicable, we emphasize the parallels between designing quantitative proteomic experiments and experiments with gene expression microarrays, and give examples from that area of research. We illustrate the discussion using theoretical considerations, and using real-data examples of profiling of disease.

Beamforming design with proactive interference cancelation in MISO interference channels

NASA Astrophysics Data System (ADS)

Li, Yang; Tian, Yafei; Yang, Chenyang

2015-12-01

In this paper, we design coordinated beamforming at base stations (BSs) to facilitate interference cancelation at users in interference networks, where each BS is equipped with multiple antennas and each user is with a single antenna. By assuming that each user can select the best decoding strategy to mitigate the interference, either canceling the interference after decoding when it is strong or treating it as noise when it is weak, we optimize the beamforming vectors that maximize the sum rate for the networks under different interference scenarios and find the solutions of beamforming with closed-form expressions. The inherent design principles are then analyzed, and the performance gain over passive interference cancelation is demonstrated through simulations in heterogeneous cellular networks.

Automated airplane surface generation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, R.E.; Cordero, Y.; Jones, W.

1996-12-31

An efficient methodology and software axe presented for defining a class of airplane configurations. A small set of engineering design parameters and grid control parameters govern the process. The general airplane configuration has wing, fuselage, vertical tall, horizontal tail, and canard components. Wing, canard, and tail surface grids axe manifested by solving a fourth-order partial differential equation subject to Dirichlet and Neumann boundary conditions. The design variables are incorporated into the boundary conditions, and the solution is expressed as a Fourier series. The fuselage is described by an algebraic function with four design parameters. The computed surface grids are suitablemore » for a wide range of Computational Fluid Dynamics simulation and configuration optimizations. Both batch and interactive software are discussed for applying the methodology.« less

Indazole-based potent and cell-active Mps1 kinase inhibitors: rational design from pan-kinase inhibitor anthrapyrazolone (SP600125).

PubMed

Kusakabe, Ken-ichi; Ide, Nobuyuki; Daigo, Yataro; Tachibana, Yuki; Itoh, Takeshi; Yamamoto, Takahiko; Hashizume, Hiroshi; Hato, Yoshio; Higashino, Kenichi; Okano, Yousuke; Sato, Yuji; Inoue, Makiko; Iguchi, Motofumi; Kanazawa, Takayuki; Ishioka, Yukichi; Dohi, Keiji; Kido, Yasuto; Sakamoto, Shingo; Yasuo, Kazuya; Maeda, Masahiro; Higaki, Masayo; Ueda, Kazuo; Yoshizawa, Hidenori; Baba, Yoshiyasu; Shiota, Takeshi; Murai, Hitoshi; Nakamura, Yusuke

2013-06-13

Monopolar spindle 1 (Mps1) is essential for centrosome duplication, the spindle assembly check point, and the maintenance of chromosomal instability. Mps1 is highly expressed in cancer cells, and its expression levels correlate with the histological grades of cancers. Thus, selective Mps1 inhibitors offer an attractive opportunity for the development of novel cancer therapies. To design novel Mps1 inhibitors, we utilized the pan-kinase inhibitor anthrapyrazolone (4, SP600125) and its crystal structure bound to JNK1. Our design efforts led to the identification of indazole-based lead 6 with an Mps1 IC50 value of 498 nM. Optimization of the 3- and 6-positions on the indazole core of 6 resulted in 23c with improved Mps1 activity (IC50 = 3.06 nM). Finally, application of structure-based design using the X-ray structure of 23d bound to Mps1 culminated in the discovery of 32a and 32b with improved potency for cellular Mps1 and A549 lung cancer cells. Moreover, 32a and 32b exhibited reasonable selectivities over 120 and 166 kinases, respectively.

Prioritizing the Components of Vulnerability: A Genetic Algorithm Minimization of Flood Risk

NASA Astrophysics Data System (ADS)

Bongolan, Vena Pearl; Ballesteros, Florencio; Baritua, Karessa Alexandra; Junne Santos, Marie

2013-04-01

We define a flood resistant city as an optimal arrangement of communities according to their traits, with the goal of minimizing the flooding vulnerability via a genetic algorithm. We prioritize the different components of flooding vulnerability, giving each component a weight, thus expressing vulnerability as a weighted sum. This serves as the fitness function for the genetic algorithm. We also allowed non-linear interactions among related but independent components, viz, poverty and mortality rate, and literacy and radio/ tv penetration. The designs produced reflect the relative importance of the components, and we observed a synchronicity between the interacting components, giving us a more consistent design.

Optimal design of compact spur gear reductions

NASA Technical Reports Server (NTRS)

Savage, M.; Lattime, S. B.; Kimmel, J. A.; Coe, H. H.

1992-01-01

The optimal design of compact spur gear reductions includes the selection of bearing and shaft proportions in addition to gear mesh parameters. Designs for single mesh spur gear reductions are based on optimization of system life, system volume, and system weight including gears, support shafts, and the four bearings. The overall optimization allows component properties to interact, yielding the best composite design. A modified feasible directions search algorithm directs the optimization through a continuous design space. Interpolated polynomials expand the discrete bearing properties and proportions into continuous variables for optimization. After finding the continuous optimum, the designer can analyze near optimal designs for comparison and selection. Design examples show the influence of the bearings on the optimal configurations.

Promoter and Terminator Discovery and Engineering.

PubMed

Deaner, Matthew; Alper, Hal S

Control of gene expression is crucial to optimize metabolic pathways and synthetic gene networks. Promoters and terminators are stretches of DNA upstream and downstream (respectively) of genes that control both the rate at which the gene is transcribed and the rate at which mRNA is degraded. As a result, both of these elements control net protein expression from a synthetic construct. Thus, it is highly important to discover and engineer promoters and terminators with desired characteristics. This chapter highlights various approaches taken to catalogue these important synthetic elements. Specifically, early strategies have focused largely on semi-rational techniques such as saturation mutagenesis to diversify native promoters and terminators. Next, in an effort to reduce the length of the synthetic biology design cycle, efforts in the field have turned towards the rational design of synthetic promoters and terminators. In this vein, we cover recently developed methods such as hybrid engineering, high throughput characterization, and thermodynamic modeling which allow finer control in the rational design of novel promoters and terminators. Emphasis is placed on the methodologies used and this chapter showcases the utility of these methods across multiple host organisms.

Qwest and HyTES: Two New Hyperspectral Thermal Infrared Imaging Spectrometers for Earth Science

DTIC Science & Technology

2009-10-01

and QWIP focal plane arrays. The long wave infrared ( LWIR ) is typically expressed as the wavelength range between 7 and 14 µm. Our current...recently recommended by the National Research Council in their Decadal Survey. The LWIR component of the HyspIRI mission will address science...but extends the Dyson design to work optimally with the LWIR . The savings in physical size for similar F/# systems is dramatic as shown in Figure

Shark: SQL and Rich Analytics at Scale

DTIC Science & Technology

2012-11-26

learning programs up to 100 faster than Hadoop. Unlike previous systems, Shark shows that it is possible to achieve these speedups while retaining a...Shark to run SQL queries up to 100× faster than Apache Hive, and machine learning programs up to 100× faster than Hadoop. Unlike previous systems, Shark...so using a runtime that is optimized for such workloads and a programming model that is designed to express machine learn - ing algorithms. 4.1

Optimal adaptation to extreme rainfalls in current and future climate

NASA Astrophysics Data System (ADS)

Rosbjerg, Dan

2017-01-01

More intense and frequent rainfalls have increased the number of urban flooding events in recent years, prompting adaptation efforts. Economic optimization is considered an efficient tool to decide on the design level for adaptation. The costs associated with a flooding to the T-year level and the annual capital and operational costs of adapting to this level are described with log-linear relations. The total flooding costs are developed as the expected annual damage of flooding above the T-year level plus the annual capital and operational costs for ensuring no flooding below the T-year level. The value of the return period T that corresponds to the minimum of the sum of these costs will then be the optimal adaptation level. The change in climate, however, is expected to continue in the next century, which calls for expansion of the above model. The change can be expressed in terms of a climate factor (the ratio between the future and the current design level) which is assumed to increase in time. This implies increasing costs of flooding in the future for many places in the world. The optimal adaptation level is found for immediate as well as for delayed adaptation. In these cases, the optimum is determined by considering the net present value of the incurred costs during a sufficiently long time-span. Immediate as well as delayed adaptation is considered.

Optimal adaptation to extreme rainfalls under climate change

NASA Astrophysics Data System (ADS)

Rosbjerg, Dan

2017-04-01

More intense and frequent rainfalls have increased the number of urban flooding events in recent years, prompting adaptation efforts. Economic optimization is considered an efficient tool to decide on the design level for adaptation. The costs associated with a flooding to the T-year level and the annual capital and operational costs of adapting to this level are described with log-linear relations. The total flooding costs are developed as the expected annual damage of flooding above the T-year level plus the annual capital and operational costs for ensuring no flooding below the T-year level. The value of the return period T that corresponds to the minimum of the sum of these costs will then be the optimal adaptation level. The change in climate, however, is expected to continue in the next century, which calls for expansion of the above model. The change can be expressed in terms of a climate factor (the ratio between the future and the current design level) which is assumed to increase in time. This implies increasing costs of flooding in the future for many places in the world. The optimal adaptation level is found for immediate as well as for delayed adaptation. In these cases the optimum is determined by considering the net present value of the incurred costs during a sufficiently long time span. Immediate as well as delayed adaptation is considered.

Process for Assembly and Transformation into Saccharomyces cerevisiae of a Synthetic Yeast Artificial Chromosome Containing a Multigene Cassette to Express Enzymes That Enhance Xylose Utilization Designed for an Automated Platform.

PubMed

Hughes, Stephen R; Cox, Elby J; Bang, Sookie S; Pinkelman, Rebecca J; López-Núñez, Juan Carlos; Saha, Badal C; Qureshi, Nasib; Gibbons, William R; Fry, Michelle R; Moser, Bryan R; Bischoff, Kenneth M; Liu, Siqing; Sterner, David E; Butt, Tauseef R; Riedmuller, Steven B; Jones, Marjorie A; Riaño-Herrera, Néstor M

2015-12-01

A yeast artificial chromosome (YAC) containing a multigene cassette for expression of enzymes that enhance xylose utilization (xylose isomerase [XI] and xylulokinase [XKS]) was constructed and transformed into Saccharomyces cerevisiae to demonstrate feasibility as a stable protein expression system in yeast and to design an assembly process suitable for an automated platform. Expression of XI and XKS from the YAC was confirmed by Western blot and PCR analyses. The recombinant and wild-type strains showed similar growth on plates containing hexose sugars, but only recombinant grew on D-xylose and L-arabinose plates. In glucose fermentation, doubling time (4.6 h) and ethanol yield (0.44 g ethanol/g glucose) of recombinant were comparable to wild type (4.9 h and 0.44 g/g). In whole-corn hydrolysate, ethanol yield (0.55 g ethanol/g [glucose + xylose]) and xylose utilization (38%) for recombinant were higher than for wild type (0.47 g/g and 12%). In hydrolysate from spent coffee grounds, yield was 0.46 g ethanol/g (glucose + xylose), and xylose utilization was 93% for recombinant. These results indicate introducing a YAC expressing XI and XKS enhanced xylose utilization without affecting integrity of the host strain, and the process provides a potential platform for automated synthesis of a YAC for expression of multiple optimized genes to improve yeast strains. © 2015 Society for Laboratory Automation and Screening.

Systematic optimization of expression and refolding of the Plasmodium falciparum cysteine protease falcipain-2.

PubMed

Sijwali, P S; Brinen, L S; Rosenthal, P J

2001-06-01

The Plasmodium falciparum cysteine protease falcipain-2 is a potential new target for antimalarial chemotherapy. In order to obtain large quantities of active falcipain-2 for biochemical and structural analysis, a systematic assessment of optimal parameters for the expression and refolding of the protease was carried out. High-yield expression was achieved using M15(pREP4) Escherichia coli transformed with the pQE-30 plasmid containing a truncated profalcipain-2 construct. Recombinant falcipain-2 was expressed as inclusion bodies, solubilized, and purified by nickel affinity chromatography. A systematic approach was then used to optimize refolding parameters. This approach utilized 100-fold dilutions of reduced and denatured falcipain-2 into 203 different buffers in a microtiter plate format. Refolding efficiency varied markedly. Optimal refolding was obtained in an alkaline buffer containing glycerol or sucrose and equal concentrations of reduced and oxidized glutathione. After optimization of the expression and refolding protocols and additional purification with anion-exchange chromatography, 12 mg of falcipain-2 was obtained from 5 liters of E. coli, and crystals of the protease were grown. The systematic approach described here allowed the rapid evaluation of a large number of expression and refolding conditions and provided milligram quantities of recombinant falcipain-2. Copyright 2001 Academic Press.

Analytical Model and Optimized Design of Power Transmitting Coil for Inductively Coupled Endoscope Robot.

PubMed

Ke, Quan; Luo, Weijie; Yan, Guozheng; Yang, Kai

2016-04-01

A wireless power transfer system based on the weakly inductive coupling makes it possible to provide the endoscope microrobot (EMR) with infinite power. To facilitate the patients' inspection with the EMR system, the diameter of the transmitting coil is enlarged to 69 cm. Due to the large transmitting range, a high quality factor of the Litz-wire transmitting coil is a necessity to ensure the intensity of magnetic field generated efficiently. Thus, this paper builds an analytical model of the transmitting coil, and then, optimizes the parameters of the coil by enlarging the quality factor. The lumped model of the transmitting coil includes three parameters: ac resistance, self-inductance, and stray capacitance. Based on the exact two-dimension solution, the accurate analytical expression of ac resistance is derived. Several transmitting coils of different specifications are utilized to verify this analytical expression, being in good agreements with the measured results except the coils with a large number of strands. Then, the quality factor of transmitting coils can be well predicted with the available analytical expressions of self- inductance and stray capacitance. Owing to the exact estimation of quality factor, the appropriate coil turns of the transmitting coil is set to 18-40 within the restrictions of transmitting circuit and human tissue issues. To supply enough energy for the next generation of the EMR equipped with a Ø9.5×10.1 mm receiving coil, the coil turns of the transmitting coil is optimally set to 28, which can transfer a maximum power of 750 mW with the remarkable delivering efficiency of 3.55%.

Qubit absorption refrigerator at strong coupling

NASA Astrophysics Data System (ADS)

Mu, Anqi; Agarwalla, Bijay Kumar; Schaller, Gernot; Segal, Dvira

2017-12-01

We demonstrate that a quantum absorption refrigerator (QAR) can be realized from the smallest quantum system, a qubit, by coupling it in a non-additive (strong) manner to three heat baths. This function is un-attainable for the qubit model under the weak system-bath coupling limit, when the dissipation is additive. In an optimal design, the reservoirs are engineered and characterized by a single frequency component. We then obtain closed expressions for the cooling window and refrigeration efficiency, as well as bounds for the maximal cooling efficiency and the efficiency at maximal power. Our results agree with macroscopic designs and with three-level models for QARs, which are based on the weak system-bath coupling assumption. Beyond the optimal limit, we show with analytical calculations and numerical simulations that the cooling efficiency varies in a non-universal manner with model parameters. Our work demonstrates that strongly-coupled quantum machines can exhibit function that is un-attainable under the weak system-bath coupling assumption.

Characterization and optimization of ArtinM lectin expression in Escherichia coli.

PubMed

Pranchevicius, Maria-Cristina S; Oliveira, Leandro L; Rosa, José C; Avanci, Nilton C; Quiapim, Andréa C; Roque-Barreira, Maria-Cristina; Goldman, Maria-Helena S

2012-08-02

ArtinM is a d-mannose-specific lectin from Artocarpus integrifolia seeds that induces neutrophil migration and activation, degranulation of mast cells, acceleration of wound healing, induction of interleukin-12 production by macrophages and dendritic cells, and protective T helper 1 immune response against Leishmania major, Leishmania amazonensis and Paracoccidioides brasiliensis infections. Considering the important biological properties of ArtinM and its therapeutic applicability, this study was designed to produce high-level expression of active recombinant ArtinM (rArtinM) in Escherichia coli system. The ArtinM coding region was inserted in pET29a(+) vector and expressed in E. coli BL21(DE3)-Codon Plus-RP. The conditions for overexpression of soluble ArtinM were optimized testing different parameters: temperatures (20, 25, 30 or 37°C) and shaking speeds (130, 200 or 220 rpm) during induction, concentrations of the induction agent IPTG (0.01-4 mM) and periods of induction (1-19 h). BL21-CodonPlus(DE3)-RP cells induced under the optimized conditions (incubation at 20°C, at a shaking speed of 130 rpm, induction with 0.4 mM IPTG for 19 h) resulted in the accumulation of large amounts of soluble rArtinM. The culture provided 22.4 mg/L of rArtinM, which activity was determined by its one-step purification through affinity chromatography on immobilized d-mannose and glycoarray analysis. Gel filtration showed that rArtinM is monomeric, contrasting with the tetrameric form of the plant native protein (jArtinM). The analysis of intact rArtinM by mass spectrometry revealed a 16,099.5 Da molecular mass, and the peptide mass fingerprint and esi-cid-ms/ms of amino acid sequences of peptides from a tryptic digest covered 41% of the total ArtinM amino acid sequence. In addition, circular dichroism and fluorescence spectroscopy of rArtinM indicated that its global fold comprises β-sheet structure. Overall, the optimized process to express rArtinM in E. coli provided high amounts of soluble, correctly folded and active recombinant protein, compatible with large scale production of the lectin.

Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

PubMed Central

Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

2016-01-01

ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

A new design approach based on differential evolution algorithm for geometric optimization of magnetorheological brakes

NASA Astrophysics Data System (ADS)

Le-Duc, Thang; Ho-Huu, Vinh; Nguyen-Thoi, Trung; Nguyen-Quoc, Hung

2016-12-01

In recent years, various types of magnetorheological brakes (MRBs) have been proposed and optimized by different optimization algorithms that are integrated in commercial software such as ANSYS and Comsol Multiphysics. However, many of these optimization algorithms often possess some noteworthy shortcomings such as the trap of solutions at local extremes, or the limited number of design variables or the difficulty of dealing with discrete design variables. Thus, to overcome these limitations and develop an efficient computation tool for optimal design of the MRBs, an optimization procedure that combines differential evolution (DE), a gradient-free global optimization method with finite element analysis (FEA) is proposed in this paper. The proposed approach is then applied to the optimal design of MRBs with different configurations including conventional MRBs and MRBs with coils placed on the side housings. Moreover, to approach a real-life design, some necessary design variables of MRBs are considered as discrete variables in the optimization process. The obtained optimal design results are compared with those of available optimal designs in the literature. The results reveal that the proposed method outperforms some traditional approaches.

Designing oligo libraries taking alternative splicing into account

NASA Astrophysics Data System (ADS)

Shoshan, Avi; Grebinskiy, Vladimir; Magen, Avner; Scolnicov, Ariel; Fink, Eyal; Lehavi, David; Wasserman, Alon

2001-06-01

We have designed sequences for DNA microarrays and oligo libraries, taking alternative splicing into account. Alternative splicing is a common phenomenon, occurring in more than 25% of the human genes. In many cases, different splice variants have different functions, are expressed in different tissues or may indicate different stages of disease. When designing sequences for DNA microarrays or oligo libraries, it is very important to take into account the sequence information of all the mRNA transcripts. Therefore, when a gene has more than one transcript (as a result of alternative splicing, alternative promoter sites or alternative poly-adenylation sites), it is very important to take all of them into account in the design. We have used the LEADS transcriptome prediction system to cluster and assemble the human sequences in GenBank and design optimal oligonucleotides for all the human genes with a known mRNA sequence based on the LEADS predictions.

The Relation of Codon Bias to Tissue-Specific Gene Expression in Arabidopsis thaliana

PubMed Central

Camiolo, Salvatore; Farina, Lorenzo; Porceddu, Andrea

2012-01-01

The codon composition of coding sequences plays an important role in the regulation of gene expression. Herein, we report systematic differences in the usage of synonymous codons among Arabidopsis thaliana genes that are expressed specifically in distinct tissues. Although we observed that both regionally and transcriptionally associated mutational biases were associated significantly with codon bias, they could not explain the observed differences fully. Similarly, given that transcript abundances did not account for the differences in codon usage, it is unlikely that selection for translational efficiency can account exclusively for the observed codon bias. Thus, we considered the possible evolution of codon bias as an adaptive response to the different abundances of tRNAs in different tissues. Our analysis demonstrated that in some cases, codon usage in genes that were expressed in a broad range of tissues was influenced primarily by the tissue in which the gene was expressed maximally. On the basis of this finding we propose that genes that are expressed in certain tissues might show a tissue-specific compositional signature in relation to codon usage. These findings might have implications for the design of transgenes in relation to optimizing their expression. PMID:22865738

Host Defense Antimicrobial Peptides as Antibiotics: Design and Application Strategies

PubMed Central

Mishra, Biswajit; Reiling, Scott; Zarena, D.; Wang, Guangshun

2017-01-01

This review deals with the design and application strategies of new antibiotics based on naturally occurring antimicrobial peptides (AMPs). The initial candidate can be designed based on three-dimensional structure or selected from a library of peptides from natural or laboratory sources followed by optimization via structure-activity relationship studies. There are also advanced application strategies such as induction of AMP expression from host cells by various factors (e.g., metals, amino acids, vitamin D and sunlight), the use of engineered probiotic bacteria to deliver peptides, the design of prodrug and peptide conjugates to improve specific targeting. In addition, combined uses of newly developed AMPs with existing antimicrobial agents may provide a practical avenue for effective management of antibiotic-resistant bacteria (superbugs, including biofilm). Finally, we highlight AMPs already in use or under clinical trials. PMID:28399505

Computationally designed high specificity inhibitors delineate the roles of BCL2 family proteins in cancer.

PubMed

Berger, Stephanie; Procko, Erik; Margineantu, Daciana; Lee, Erinna F; Shen, Betty W; Zelter, Alex; Silva, Daniel-Adriano; Chawla, Kusum; Herold, Marco J; Garnier, Jean-Marc; Johnson, Richard; MacCoss, Michael J; Lessene, Guillaume; Davis, Trisha N; Stayton, Patrick S; Stoddard, Barry L; Fairlie, W Douglas; Hockenbery, David M; Baker, David

2016-11-02

Many cancers overexpress one or more of the six human pro-survival BCL2 family proteins to evade apoptosis. To determine which BCL2 protein or proteins block apoptosis in different cancers, we computationally designed three-helix bundle protein inhibitors specific for each BCL2 pro-survival protein. Following in vitro optimization, each inhibitor binds its target with high picomolar to low nanomolar affinity and at least 300-fold specificity. Expression of the designed inhibitors in human cancer cell lines revealed unique dependencies on BCL2 proteins for survival which could not be inferred from other BCL2 profiling methods. Our results show that designed inhibitors can be generated for each member of a closely-knit protein family to probe the importance of specific protein-protein interactions in complex biological processes.

Development of a new model for batch sedimentation and application to secondary settling tanks design.

PubMed

Karamisheva, Ralica D; Islam, M A

2005-01-01

Assuming that settling takes place in two zones (a constant rate zone and a variable rate zone), a model using four parameters accounting for the nature of the water-suspension system has been proposed for describing batch sedimentation processes. The sludge volume index (SVI) has been expressed in terms of these parameters. Some disadvantages of the SVI application as a design parameter have been pointed out, and it has been shown that a relationship between zone settling velocity and sludge concentration is more consistent for describing the settling behavior and for design of settling tanks. The permissible overflow rate has been related to the technological parameters of secondary settling tank by simple working equations. The graphical representations of these equations could be used to optimize the design and operation of secondary settling tanks.

Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process

PubMed Central

Expósito-Rodríguez, Marino; Borges, Andrés A; Borges-Pérez, Andrés; Pérez, José A

2008-01-01

Background The elucidation of gene expression patterns leads to a better understanding of biological processes. Real-time quantitative RT-PCR has become the standard method for in-depth studies of gene expression. A biologically meaningful reporting of target mRNA quantities requires accurate and reliable normalization in order to identify real gene-specific variation. The purpose of normalization is to control several variables such as different amounts and quality of starting material, variable enzymatic efficiencies of retrotranscription from RNA to cDNA, or differences between tissues or cells in overall transcriptional activity. The validity of a housekeeping gene as endogenous control relies on the stability of its expression level across the sample panel being analysed. In the present report we describe the first systematic evaluation of potential internal controls during tomato development process to identify which are the most reliable for transcript quantification by real-time RT-PCR. Results In this study, we assess the expression stability of 7 traditional and 4 novel housekeeping genes in a set of 27 samples representing different tissues and organs of tomato plants at different developmental stages. First, we designed, tested and optimized amplification primers for real-time RT-PCR. Then, expression data from each candidate gene were evaluated with three complementary approaches based on different statistical procedures. Our analysis suggests that SGN-U314153 (CAC), SGN-U321250 (TIP41), SGN-U346908 ("Expressed") and SGN-U316474 (SAND) genes provide superior transcript normalization in tomato development studies. We recommend different combinations of these exceptionally stable housekeeping genes for suited normalization of different developmental series, including the complete tomato development process. Conclusion This work constitutes the first effort for the selection of optimal endogenous controls for quantitative real-time RT-PCR studies of gene expression during tomato development process. From our study a tool-kit of control genes emerges that outperform the traditional genes in terms of expression stability. PMID:19102748

High content analysis platform for optimization of lipid mediated CRISPR-Cas9 delivery strategies in human cells.

PubMed

Steyer, Benjamin; Carlson-Stevermer, Jared; Angenent-Mari, Nicolas; Khalil, Andrew; Harkness, Ty; Saha, Krishanu

2016-04-01

Non-viral gene-editing of human cells using the CRISPR-Cas9 system requires optimized delivery of multiple components. Both the Cas9 endonuclease and a single guide RNA, that defines the genomic target, need to be present and co-localized within the nucleus for efficient gene-editing to occur. This work describes a new high-throughput screening platform for the optimization of CRISPR-Cas9 delivery strategies. By exploiting high content image analysis and microcontact printed plates, multi-parametric gene-editing outcome data from hundreds to thousands of isolated cell populations can be screened simultaneously. Employing this platform, we systematically screened four commercially available cationic lipid transfection materials with a range of RNAs encoding the CRISPR-Cas9 system. Analysis of Cas9 expression and editing of a fluorescent mCherry reporter transgene within human embryonic kidney cells was monitored over several days after transfection. Design of experiments analysis enabled rigorous evaluation of delivery materials and RNA concentration conditions. The results of this analysis indicated that the concentration and identity of transfection material have significantly greater effect on gene-editing than ratio or total amount of RNA. Cell subpopulation analysis on microcontact printed plates, further revealed that low cell number and high Cas9 expression, 24h after CRISPR-Cas9 delivery, were strong predictors of gene-editing outcomes. These results suggest design principles for the development of materials and transfection strategies with lipid-based materials. This platform could be applied to rapidly optimize materials for gene-editing in a variety of cell/tissue types in order to advance genomic medicine, regenerative biology and drug discovery. CRISPR-Cas9 is a new gene-editing technology for "genome surgery" that is anticipated to treat genetic diseases. This technology uses multiple components of the Cas9 system to cut out disease-causing mutations in the human genome and precisely suture in therapeutic sequences. Biomaterials based delivery strategies could help transition these technologies to the clinic. The design space for materials based delivery strategies is vast and optimization is essential to ensuring the safety and efficacy of these treatments. Therefore, new methods are required to rapidly and systematically screen gene-editing efficacy in human cells. This work utilizes an innovative platform to generate and screen many formulations of synthetic biomaterials and components of the CRISPR-Cas9 system in parallel. On this platform, we watch genome surgery in action using high content image analysis. These capabilities enabled us to identify formulation parameters for Cas9-material complexes that can optimize gene-editing in a specific human cell type. Copyright © 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.

A case study on topology optimized design for additive manufacturing

NASA Astrophysics Data System (ADS)

Gebisa, A. W.; Lemu, H. G.

2017-12-01

Topology optimization is an optimization method that employs mathematical tools to optimize material distribution in a part to be designed. Earlier developments of topology optimization considered conventional manufacturing techniques that have limitations in producing complex geometries. This has hindered the topology optimization efforts not to fully be realized. With the emergence of additive manufacturing (AM) technologies, the technology that builds a part layer upon a layer directly from three dimensional (3D) model data of the part, however, producing complex shape geometry is no longer an issue. Realization of topology optimization through AM provides full design freedom for the design engineers. The article focuses on topologically optimized design approach for additive manufacturing with a case study on lightweight design of jet engine bracket. The study result shows that topology optimization is a powerful design technique to reduce the weight of a product while maintaining the design requirements if additive manufacturing is considered.

Thermal Assisted In Vivo Gene Electrotransfer

PubMed Central

Donate, Amy; Bulysheva, Anna; Edelblute, Chelsea; Jung, Derrick; Malik, Mohammad A.; Guo, Siqi; Burcus, Niculina; Schoenbach, Karl; Heller, Richard

2016-01-01

Gene electrotransfer is an effective approach for delivering plasmid DNA to a variety of tissues. Delivery of molecules with electric pulses requires control of the electrical parameters to achieve effective delivery. Since discomfort or tissue damage may occur with high applied voltage, the reduction of the applied voltage while achieving the desired expression may be an important improvement. One possible approach is to combine electrotransfer with exogenously applied heat. Previous work performed in vitro demonstrated that increasing temperature before pulsing can enhance gene expres sion and made it possible to reduce electric fields while maintaining expression levels. In the study reported here, this combination was evaluated in vivo using a novel electrode device designed with an inserted laser for application of heat. The results obtained in this study demonstrated that increased temperature during electrotransfer increased expression or maintained expression with a reduction in applied voltage. With further optimization this approach may provide the basis for both a novel method and a novel instrument that may greatly enhance translation of gene electrotransfer. PMID:27029944

Photomodulating Gene Expression by Using Caged siRNAs with Single-Aptamer Modification.

PubMed

Zhang, Liangliang; Chen, Changmai; Fan, Xinli; Tang, Xinjing

2018-06-18

Caged siRNAs incorporating terminal modification were rationally designed for photochemical regulation of gene silencing induced by RNA interference (RNAi). Through the conjugation of a single oligonucleotide aptamer at the 5' terminus of the antisense RNA strand, enhancement of the blocking effect for RNA-induced silencing complex (RISC) formation/processing was expected, due both/either to the aptamers themselves and/or to their interaction with large binding proteins. Two oligonucleotide aptamers (AS1411 and MUC-1) were chosen for aptamer-siRNA conjugation through a photolabile linker. This caging strategy was successfully used to photoregulate gene expression both of firefly luciferase and of green fluorescent protein (GFP) in cells. Further patterning experiments revealed that spatial regulation of GFP expression was successfully achieved by using the aptamer-modified caged siRNA and light activation. We expect that further optimized caged siRNAs featuring aptamer conjugation will be promising for practical applications to spatiotemporal photoregulation of gene expression in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Generate Optimized Genetic Rhythm for Enzyme Expression in Non-native systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

2016-11-03

Most amino acids are represented by more than one codon, resulting in redundancy in the genetic code. Silent codon substitutions that do not alter the amino acid sequence still have an effect on protein expression. We have developed an algorithm, GoGREEN, to enhance the expression of foreign proteins in a host organism. GoGREEN selects codons according to frequency patterns seen in the gene of interest using the codon usage table from the host organism. GoGREEN is also designed to accommodate gaps in the sequence.This software takes for input (1) the aligned protein sequences for genes the user wishes to express,more » (2) the codon usage table for the host organism, (3) and the DNA sequence for the target protein found in the host organism. The program will select codons based on codon usage patterns for the target DNA sequence. The program will also select codons for “gaps” found in the aligned protein sequences using the codon usage table from the host organism.« less

Fiber coupled diode laser beam parameter product calculation and rules for optimized design

NASA Astrophysics Data System (ADS)

Wang, Zuolan; Segref, Armin; Koenning, Tobias; Pandey, Rajiv

2011-03-01

The Beam Parameter Product (BPP) of a passive, lossless system is a constant and cannot be improved upon but the beams may be reshaped for enhanced coupling performance. The function of the optical designer of fiber coupled diode lasers is to preserve the brightness of the diode sources while maximizing the coupling efficiency. In coupling diode laser power into fiber output, the symmetrical geometry of the fiber core makes it highly desirable to have symmetrical BPPs at the fiber input surface, but this is not always practical. It is therefore desirable to be able to know the 'diagonal' (fiber) BPP, using the BPPs of the fast and slow axes, before detailed design and simulation processes. A commonly used expression for this purpose, i.e. the square root of the sum of the squares of the BPPs in the fast and slow axes, has been found to consistently under-predict the fiber BPP (i.e. better beam quality is predicted than is actually achievable in practice). In this paper, using a simplified model, we provide the proof of the proper calculation of the diagonal (i.e. the fiber) BPP using BPPs of the fast and slow axes as input. Using the same simplified model, we also offer the proof that the fiber BPP can be shown to have a minimum (optimal) value for given diode BPPs and this optimized condition can be obtained before any detailed design and simulation are carried out. Measured and simulated data confirms satisfactory correlation between the BPPs of the diode and the predicted fiber BPP.

Optimal cost design of water distribution networks using a decomposition approach

NASA Astrophysics Data System (ADS)

Lee, Ho Min; Yoo, Do Guen; Sadollah, Ali; Kim, Joong Hoon

2016-12-01

Water distribution network decomposition, which is an engineering approach, is adopted to increase the efficiency of obtaining the optimal cost design of a water distribution network using an optimization algorithm. This study applied the source tracing tool in EPANET, which is a hydraulic and water quality analysis model, to the decomposition of a network to improve the efficiency of the optimal design process. The proposed approach was tested by carrying out the optimal cost design of two water distribution networks, and the results were compared with other optimal cost designs derived from previously proposed optimization algorithms. The proposed decomposition approach using the source tracing technique enables the efficient decomposition of an actual large-scale network, and the results can be combined with the optimal cost design process using an optimization algorithm. This proves that the final design in this study is better than those obtained with other previously proposed optimization algorithms.

Reliability based design optimization: Formulations and methodologies

NASA Astrophysics Data System (ADS)

Agarwal, Harish

Modern products ranging from simple components to complex systems should be designed to be optimal and reliable. The challenge of modern engineering is to ensure that manufacturing costs are reduced and design cycle times are minimized while achieving requirements for performance and reliability. If the market for the product is competitive, improved quality and reliability can generate very strong competitive advantages. Simulation based design plays an important role in designing almost any kind of automotive, aerospace, and consumer products under these competitive conditions. Single discipline simulations used for analysis are being coupled together to create complex coupled simulation tools. This investigation focuses on the development of efficient and robust methodologies for reliability based design optimization in a simulation based design environment. Original contributions of this research are the development of a novel efficient and robust unilevel methodology for reliability based design optimization, the development of an innovative decoupled reliability based design optimization methodology, the application of homotopy techniques in unilevel reliability based design optimization methodology, and the development of a new framework for reliability based design optimization under epistemic uncertainty. The unilevel methodology for reliability based design optimization is shown to be mathematically equivalent to the traditional nested formulation. Numerical test problems show that the unilevel methodology can reduce computational cost by at least 50% as compared to the nested approach. The decoupled reliability based design optimization methodology is an approximate technique to obtain consistent reliable designs at lesser computational expense. Test problems show that the methodology is computationally efficient compared to the nested approach. A framework for performing reliability based design optimization under epistemic uncertainty is also developed. A trust region managed sequential approximate optimization methodology is employed for this purpose. Results from numerical test studies indicate that the methodology can be used for performing design optimization under severe uncertainty.

Analysis of the Pointing Accuracy of a 6U CubeSat Mission for Proximity Operations and Resident Space Object Imaging

DTIC Science & Technology

2013-05-29

not necessarily express the views of and should not be attributed to ESA. 1 and visual navigation to maneuver autonomously to reduce the size of the...successful orbit and three-dimensional imaging of an RSO, using passive visual -only navigation and real-time near-optimal guidance. The mission design...Kit ( STK ) in the Earth-centered Earth-fixed (ECF) co- ordinate system, loaded to Simulink and transformed to the BFF for calculation of the SRP

HOPE: Just-in-time Python compiler for astrophysical computations

NASA Astrophysics Data System (ADS)

Akeret, Joel; Gamper, Lukas; Amara, Adam; Refregier, Alexandre

2014-11-01

HOPE is a specialized Python just-in-time (JIT) compiler designed for numerical astrophysical applications. HOPE focuses on a subset of the language and is able to translate Python code into C++ while performing numerical optimization on mathematical expressions at runtime. To enable the JIT compilation, the user only needs to add a decorator to the function definition. By using HOPE, the user benefits from being able to write common numerical code in Python while getting the performance of compiled implementation.

Flight Test Validation of Optimal Input Design and Comparison to Conventional Inputs

NASA Technical Reports Server (NTRS)

Morelli, Eugene A.

1997-01-01

A technique for designing optimal inputs for aerodynamic parameter estimation was flight tested on the F-18 High Angle of Attack Research Vehicle (HARV). Model parameter accuracies calculated from flight test data were compared on an equal basis for optimal input designs and conventional inputs at the same flight condition. In spite of errors in the a priori input design models and distortions of the input form by the feedback control system, the optimal inputs increased estimated parameter accuracies compared to conventional 3-2-1-1 and doublet inputs. In addition, the tests using optimal input designs demonstrated enhanced design flexibility, allowing the optimal input design technique to use a larger input amplitude to achieve further increases in estimated parameter accuracy without departing from the desired flight test condition. This work validated the analysis used to develop the optimal input designs, and demonstrated the feasibility and practical utility of the optimal input design technique.

Shape Optimization of Supersonic Turbines Using Response Surface and Neural Network Methods

NASA Technical Reports Server (NTRS)

Papila, Nilay; Shyy, Wei; Griffin, Lisa W.; Dorney, Daniel J.

2001-01-01

Turbine performance directly affects engine specific impulse, thrust-to-weight ratio, and cost in a rocket propulsion system. A global optimization framework combining the radial basis neural network (RBNN) and the polynomial-based response surface method (RSM) is constructed for shape optimization of a supersonic turbine. Based on the optimized preliminary design, shape optimization is performed for the first vane and blade of a 2-stage supersonic turbine, involving O(10) design variables. The design of experiment approach is adopted to reduce the data size needed by the optimization task. It is demonstrated that a major merit of the global optimization approach is that it enables one to adaptively revise the design space to perform multiple optimization cycles. This benefit is realized when an optimal design approaches the boundary of a pre-defined design space. Furthermore, by inspecting the influence of each design variable, one can also gain insight into the existence of multiple design choices and select the optimum design based on other factors such as stress and materials considerations.

Optimization of a chemical identification algorithm

NASA Astrophysics Data System (ADS)

Chyba, Thomas H.; Fisk, Brian; Gunning, Christin; Farley, Kevin; Polizzi, Amber; Baughman, David; Simpson, Steven; Slamani, Mohamed-Adel; Almassy, Robert; Da Re, Ryan; Li, Eunice; MacDonald, Steve; Slamani, Ahmed; Mitchell, Scott A.; Pendell-Jones, Jay; Reed, Timothy L.; Emge, Darren

2010-04-01

A procedure to evaluate and optimize the performance of a chemical identification algorithm is presented. The Joint Contaminated Surface Detector (JCSD) employs Raman spectroscopy to detect and identify surface chemical contamination. JCSD measurements of chemical warfare agents, simulants, toxic industrial chemicals, interferents and bare surface backgrounds were made in the laboratory and under realistic field conditions. A test data suite, developed from these measurements, is used to benchmark algorithm performance throughout the improvement process. In any one measurement, one of many possible targets can be present along with interferents and surfaces. The detection results are expressed as a 2-category classification problem so that Receiver Operating Characteristic (ROC) techniques can be applied. The limitations of applying this framework to chemical detection problems are discussed along with means to mitigate them. Algorithmic performance is optimized globally using robust Design of Experiments and Taguchi techniques. These methods require figures of merit to trade off between false alarms and detection probability. Several figures of merit, including the Matthews Correlation Coefficient and the Taguchi Signal-to-Noise Ratio are compared. Following the optimization of global parameters which govern the algorithm behavior across all target chemicals, ROC techniques are employed to optimize chemical-specific parameters to further improve performance.

Robust Airfoil Optimization to Achieve Consistent Drag Reduction Over a Mach Range

NASA Technical Reports Server (NTRS)

Li, Wu; Huyse, Luc; Padula, Sharon; Bushnell, Dennis M. (Technical Monitor)

2001-01-01

We prove mathematically that in order to avoid point-optimization at the sampled design points for multipoint airfoil optimization, the number of design points must be greater than the number of free-design variables. To overcome point-optimization at the sampled design points, a robust airfoil optimization method (called the profile optimization method) is developed and analyzed. This optimization method aims at a consistent drag reduction over a given Mach range and has three advantages: (a) it prevents severe degradation in the off-design performance by using a smart descent direction in each optimization iteration, (b) there is no random airfoil shape distortion for any iterate it generates, and (c) it allows a designer to make a trade-off between a truly optimized airfoil and the amount of computing time consumed. For illustration purposes, we use the profile optimization method to solve a lift-constrained drag minimization problem for 2-D airfoil in Euler flow with 20 free-design variables. A comparison with other airfoil optimization methods is also included.

Synthetic Biology Toolbox for Controlling Gene Expression in the Cyanobacterium Synechococcus sp. strain PCC 7002

DOE Office of Scientific and Technical Information (OSTI.GOV)

Markley, Andrew L.; Begemann, Matthew B.; Clarke, Ryan E.

The application of synthetic biology requires characterized tools to precisely control gene expression. This toolbox of genetic parts previously did not exist for the industrially promising cyanobacterium, Synechococcus sp. strain PCC 7002. To address this gap, two orthogonal constitutive promoter libraries, one based on a cyanobacterial promoter and the other ported from Escherichia coli, were built and tested in PCC 7002. The libraries demonstrated 3 and 2.5 log dynamic ranges, respectively, but correlated poorly with E. coli expression levels. These promoter libraries were then combined to create and optimize a series of IPTG inducible cassettes. The resultant induction system hadmore » a 48-fold dynamic range and was shown to out-perform P trc constructs. Finally, a RBS library was designed and tested in PCC 7002. The presented synthetic biology toolbox will enable accelerated engineering of PCC 7002.« less

Synthetic Biology Toolbox for Controlling Gene Expression in the Cyanobacterium Synechococcus sp. strain PCC 7002

DOE PAGES

Markley, Andrew L.; Begemann, Matthew B.; Clarke, Ryan E.; ...

2014-09-12

The application of synthetic biology requires characterized tools to precisely control gene expression. This toolbox of genetic parts previously did not exist for the industrially promising cyanobacterium, Synechococcus sp. strain PCC 7002. To address this gap, two orthogonal constitutive promoter libraries, one based on a cyanobacterial promoter and the other ported from Escherichia coli, were built and tested in PCC 7002. The libraries demonstrated 3 and 2.5 log dynamic ranges, respectively, but correlated poorly with E. coli expression levels. These promoter libraries were then combined to create and optimize a series of IPTG inducible cassettes. The resultant induction system hadmore » a 48-fold dynamic range and was shown to out-perform P trc constructs. Finally, a RBS library was designed and tested in PCC 7002. The presented synthetic biology toolbox will enable accelerated engineering of PCC 7002.« less

A dynamic multi-level optimal design method with embedded finite-element modeling for power transformers

NASA Astrophysics Data System (ADS)

Zhang, Yunpeng; Ho, Siu-lau; Fu, Weinong

2018-05-01

This paper proposes a dynamic multi-level optimal design method for power transformer design optimization (TDO) problems. A response surface generated by second-order polynomial regression analysis is updated dynamically by adding more design points, which are selected by Shifted Hammersley Method (SHM) and calculated by finite-element method (FEM). The updating stops when the accuracy requirement is satisfied, and optimized solutions of the preliminary design are derived simultaneously. The optimal design level is modulated through changing the level of error tolerance. Based on the response surface of the preliminary design, a refined optimal design is added using multi-objective genetic algorithm (MOGA). The effectiveness of the proposed optimal design method is validated through a classic three-phase power TDO problem.

Generation of a Tet-On Expression System to Study Transactivation Ability of Tax-2.

PubMed

Bignami, Fabio; Sozzi, Riccardo Alessio; Pilotti, Elisabetta

2017-01-01

HTLV Tax proteins (Tax-1 and Tax-2) are known to be able to transactivate several host cellular genes involved in complex molecular pathways. Here, we describe a stable and regulated high-level expression model based on Tet-On system, to study the capacity of Tax-2 to transactivate host genes. In particular, the Jurkat Tet-On cell line suitable for evaluating the ability of Tax-2 to stimulate transactivation of a specific host gene, CCL3L1 (C-C motif chemokine ligand 3 like 1 gene), was selected. Then, a plasmid expressing tax-2 gene under control of a tetracycline-response element was constructed. To avoid the production of a fusion protein between the report gene and the inserted gene, a bidirectional plasmid was designed. Maximum expression and fast response time were achieved by using nucleofection technology as transfection method. After developing an optimized protocol for efficiently transferring tax-2 gene in Jurkat Tet-On cellular model and exposing transfected cells to Dox (doxycycline, a tetracycline derivate), a kinetics of tax-2 expression through TaqMan Real-time PCR assay was determined.

Biomolecular engineering of intracellular switches in eukaryotes

PubMed Central

Pastuszka, M.K.; Mackay, J.A.

2010-01-01

Tools to selectively and reversibly control gene expression are useful to study and model cellular functions. When optimized, these cellular switches can turn a protein's function “on” and “off” based on cues designated by the researcher. These cues include small molecules, drugs, hormones, and even temperature variations. Here we review three distinct areas in gene expression that are commonly targeted when designing cellular switches. Transcriptional switches target gene expression at the level of mRNA polymerization, with examples including the tetracycline gene induction system as well as nuclear receptors. Translational switches target the process of turning the mRNA signal into protein, with examples including riboswitches and RNA interference. Post-translational switches control how proteins interact with one another to attenuate or relay signals. Examples of post-translational modification include dimerization and intein splicing. In general, the delay times between switch and effect decreases from transcription to translation to post-translation; furthermore, the fastest switches may offer the most elegant opportunities to influence and study cell behavior. We discuss the pros and cons of these strategies, which directly influence their usefulness to study and implement drug targeting at the tissue and cellular level. PMID:21209849

High-Yield Resveratrol Production in Engineered Escherichia coli ▿ †

PubMed Central

Lim, Chin Giaw; Fowler, Zachary L.; Hueller, Thomas; Schaffer, Steffen; Koffas, Mattheos A. G.

2011-01-01

Plant polyphenols have been the subject of several recent scientific investigations since many of the molecules in this class have been found to be highly active in the human body, with a plethora of health-promoting activities against a variety of diseases, including heart disease, diabetes, and cancer, and with even the potential to slow aging. Further development of these potent natural therapeutics hinges on the formation of robust industrial production platforms designed using specifically selected as well as engineered protein sources along with the construction of optimal expression platforms. In this work, we first report the investigation of various stilbene synthases from an array of plant species considering structure-activity relationships, their expression efficiency in microorganisms, and their ability to synthesize resveratrol. Second, we looked into the construct environment of recombinantly expressed stilbene synthases, including different promoters, construct designs, and host strains, to create an Escherichia coli strain capable of producing superior resveratrol titers sufficient for commercial usage. Further improvement of metabolic capabilities of the recombinant strain aimed at improving the intracellular malonyl-coenzyme A pool, a resveratrol precursor, resulted in a final improved titer of 2.3 g/liter resveratrol. PMID:21441338

Hard and Soft Constraints in Reliability-Based Design Optimization

NASA Technical Reports Server (NTRS)

Crespo, L.uis G.; Giesy, Daniel P.; Kenny, Sean P.

2006-01-01

This paper proposes a framework for the analysis and design optimization of models subject to parametric uncertainty where design requirements in the form of inequality constraints are present. Emphasis is given to uncertainty models prescribed by norm bounded perturbations from a nominal parameter value and by sets of componentwise bounded uncertain variables. These models, which often arise in engineering problems, allow for a sharp mathematical manipulation. Constraints can be implemented in the hard sense, i.e., constraints must be satisfied for all parameter realizations in the uncertainty model, and in the soft sense, i.e., constraints can be violated by some realizations of the uncertain parameter. In regard to hard constraints, this methodology allows (i) to determine if a hard constraint can be satisfied for a given uncertainty model and constraint structure, (ii) to generate conclusive, formally verifiable reliability assessments that allow for unprejudiced comparisons of competing design alternatives and (iii) to identify the critical combination of uncertain parameters leading to constraint violations. In regard to soft constraints, the methodology allows the designer (i) to use probabilistic uncertainty models, (ii) to calculate upper bounds to the probability of constraint violation, and (iii) to efficiently estimate failure probabilities via a hybrid method. This method integrates the upper bounds, for which closed form expressions are derived, along with conditional sampling. In addition, an l(sub infinity) formulation for the efficient manipulation of hyper-rectangular sets is also proposed.

Engineering growth factors for regenerative medicine applications.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mitchell, Aaron C.; Briquez, Priscilla S.; Hubbell, Jeffrey A.

Growth factors are important morphogenetic proteins that instruct cell behavior and guide tissue repair and renewal. Although their therapeutic potential holds great promise in regenerative medicine applications, translation of growth factors into clinical treatments has been hindered by limitations including poor protein stability, low recombinant expression yield, and suboptimal efficacy. This review highlights current tools, technologies, and approaches to design integrated and effective growth factor-based therapies for regenerative medicine applications. The first section describes rational and combinatorial protein engineering approaches that have been utilized to improve growth factor stability, expression yield, biodistribution, and serum half-life, or alter their cell traffickingmore » behavior or receptor binding affinity. The second section highlights elegant biomaterial-based systems, inspired by the natural extracellular matrix milieu, that have been developed for effective spatial and temporal delivery of growth factors to cell surface receptors. Although appearing distinct, these two approaches are highly complementary and involve principles of molecular design and engineering to be considered in parallel when developing optimal materials for clinical applications.« less

Creep-rupture reliability analysis

NASA Technical Reports Server (NTRS)

Peralta-Duran, A.; Wirsching, P. H.

1984-01-01

A probabilistic approach to the correlation and extrapolation of creep-rupture data is presented. Time temperature parameters (TTP) are used to correlate the data, and an analytical expression for the master curve is developed. The expression provides a simple model for the statistical distribution of strength and fits neatly into a probabilistic design format. The analysis focuses on the Larson-Miller and on the Manson-Haferd parameters, but it can be applied to any of the TTP's. A method is developed for evaluating material dependent constants for TTP's. It is shown that optimized constants can provide a significant improvement in the correlation of the data, thereby reducing modelling error. Attempts were made to quantify the performance of the proposed method in predicting long term behavior. Uncertainty in predicting long term behavior from short term tests was derived for several sets of data. Examples are presented which illustrate the theory and demonstrate the application of state of the art reliability methods to the design of components under creep.

Design and Optimization Method of a Two-Disk Rotor System

NASA Astrophysics Data System (ADS)

Huang, Jingjing; Zheng, Longxi; Mei, Qing

2016-04-01

An integrated analytical method based on multidisciplinary optimization software Isight and general finite element software ANSYS was proposed in this paper. Firstly, a two-disk rotor system was established and the mode, humorous response and transient response at acceleration condition were analyzed with ANSYS. The dynamic characteristics of the two-disk rotor system were achieved. On this basis, the two-disk rotor model was integrated to the multidisciplinary design optimization software Isight. According to the design of experiment (DOE) and the dynamic characteristics, the optimization variables, optimization objectives and constraints were confirmed. After that, the multi-objective design optimization of the transient process was carried out with three different global optimization algorithms including Evolutionary Optimization Algorithm, Multi-Island Genetic Algorithm and Pointer Automatic Optimizer. The optimum position of the two-disk rotor system was obtained at the specified constraints. Meanwhile, the accuracy and calculation numbers of different optimization algorithms were compared. The optimization results indicated that the rotor vibration reached the minimum value and the design efficiency and quality were improved by the multidisciplinary design optimization in the case of meeting the design requirements, which provided the reference to improve the design efficiency and reliability of the aero-engine rotor.

Verification and Optimal Control of Context-Sensitive Probabilistic Boolean Networks Using Model Checking and Polynomial Optimization

PubMed Central

Hiraishi, Kunihiko

2014-01-01

One of the significant topics in systems biology is to develop control theory of gene regulatory networks (GRNs). In typical control of GRNs, expression of some genes is inhibited (activated) by manipulating external stimuli and expression of other genes. It is expected to apply control theory of GRNs to gene therapy technologies in the future. In this paper, a control method using a Boolean network (BN) is studied. A BN is widely used as a model of GRNs, and gene expression is expressed by a binary value (ON or OFF). In particular, a context-sensitive probabilistic Boolean network (CS-PBN), which is one of the extended models of BNs, is used. For CS-PBNs, the verification problem and the optimal control problem are considered. For the verification problem, a solution method using the probabilistic model checker PRISM is proposed. For the optimal control problem, a solution method using polynomial optimization is proposed. Finally, a numerical example on the WNT5A network, which is related to melanoma, is presented. The proposed methods provide us useful tools in control theory of GRNs. PMID:24587766

Multiple-Objective Optimal Designs for Studying the Dose Response Function and Interesting Dose Levels

PubMed Central

Hyun, Seung Won; Wong, Weng Kee

2016-01-01

We construct an optimal design to simultaneously estimate three common interesting features in a dose-finding trial with possibly different emphasis on each feature. These features are (1) the shape of the dose-response curve, (2) the median effective dose and (3) the minimum effective dose level. A main difficulty of this task is that an optimal design for a single objective may not perform well for other objectives. There are optimal designs for dual objectives in the literature but we were unable to find optimal designs for 3 or more objectives to date with a concrete application. A reason for this is that the approach for finding a dual-objective optimal design does not work well for a 3 or more multiple-objective design problem. We propose a method for finding multiple-objective optimal designs that estimate the three features with user-specified higher efficiencies for the more important objectives. We use the flexible 4-parameter logistic model to illustrate the methodology but our approach is applicable to find multiple-objective optimal designs for other types of objectives and models. We also investigate robustness properties of multiple-objective optimal designs to mis-specification in the nominal parameter values and to a variation in the optimality criterion. We also provide computer code for generating tailor made multiple-objective optimal designs. PMID:26565557

Multiple-Objective Optimal Designs for Studying the Dose Response Function and Interesting Dose Levels.

PubMed

Hyun, Seung Won; Wong, Weng Kee

2015-11-01

We construct an optimal design to simultaneously estimate three common interesting features in a dose-finding trial with possibly different emphasis on each feature. These features are (1) the shape of the dose-response curve, (2) the median effective dose and (3) the minimum effective dose level. A main difficulty of this task is that an optimal design for a single objective may not perform well for other objectives. There are optimal designs for dual objectives in the literature but we were unable to find optimal designs for 3 or more objectives to date with a concrete application. A reason for this is that the approach for finding a dual-objective optimal design does not work well for a 3 or more multiple-objective design problem. We propose a method for finding multiple-objective optimal designs that estimate the three features with user-specified higher efficiencies for the more important objectives. We use the flexible 4-parameter logistic model to illustrate the methodology but our approach is applicable to find multiple-objective optimal designs for other types of objectives and models. We also investigate robustness properties of multiple-objective optimal designs to mis-specification in the nominal parameter values and to a variation in the optimality criterion. We also provide computer code for generating tailor made multiple-objective optimal designs.

Cloning, Codon Optimization, and Expression of Yersinia intermedia Phytase Gene in E. coli.

PubMed

Mirzaei, Maryam; Saffar, Behnaz; Shareghi, Behzad

2016-06-01

Phytate is an anti-nutritional factor in plants, which catches the most phosphorus contents and some vital minerals. Therefore, Phytase is added mainly as an additive to the monogastric animals' foods to hydrolyze phytate and increase absorption of phosphorus. Y. intermedia phytase is a new phytase with special characteristics such as high specific activity, pH stability, and thermostability. Our aim was to clone, express, and characterizea codon optimized Y. intermedia phytase gene in E. coli . The Y. intermedia phytase gene was optimized according to the codon usage in E. coli . The sequence was synthesized and sub-cloned in pET-22b (+) vector and transformed into E. coli Bl21 (DE3). The protein was expressed in the presence of IPTG at a final concentration of 1 mM at 30°C. The purification of recombinant protein was performed by Ni 2+ affinity chromatography. Phytase activity and stability were determined in various pH and temperatures. The codon optimized Y. intermedia phytase gene was sub-cloned successfully.The expression was confirmed by SDS-PAGE and Western blot analysis. The recombinant enzyme (approximately 45 kDa) was purified. Specific activity of enzyme was 3849 (U.mg -1 ) with optimal pH 5 and optimal temperature of 55°C. Thermostability (80°C for 15 min) and pH stability (3-6) of the enzyme were 56 and more than 80%, respectively. The results of the expression and enzyme characterization revealed that the optimized Y. intermedia phytase gene has a good potential to be produced commercially andto be applied in animals' foodsindustry.

The Sizing and Optimization Language (SOL): A computer language to improve the user/optimizer interface

NASA Technical Reports Server (NTRS)

Lucas, S. H.; Scotti, S. J.

1989-01-01

The nonlinear mathematical programming method (formal optimization) has had many applications in engineering design. A figure illustrates the use of optimization techniques in the design process. The design process begins with the design problem, such as the classic example of the two-bar truss designed for minimum weight as seen in the leftmost part of the figure. If formal optimization is to be applied, the design problem must be recast in the form of an optimization problem consisting of an objective function, design variables, and constraint function relations. The middle part of the figure shows the two-bar truss design posed as an optimization problem. The total truss weight is the objective function, the tube diameter and truss height are design variables, with stress and Euler buckling considered as constraint function relations. Lastly, the designer develops or obtains analysis software containing a mathematical model of the object being optimized, and then interfaces the analysis routine with existing optimization software such as CONMIN, ADS, or NPSOL. This final state of software development can be both tedious and error-prone. The Sizing and Optimization Language (SOL), a special-purpose computer language whose goal is to make the software implementation phase of optimum design easier and less error-prone, is presented.

Fracture stimulation treatment design optimization: What can the NPV vs X{sub f} plot tell us?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huffman, C.H.; Harkrider, J.D.; Thompson, R.S.

1996-12-31

Fracture stimulation production response coupled with the hydrocarbon sales price determines the value of a fracture stimulation treatment. Many factors can significantly effect the production response of a fracture stimulated well. Some examples include stimulation fluid selection, proppant selection, pumping rates, rock properties, reservoir fluid properties, in-situ stresses, stress variations, on-site execution, post-treatment stimulation fluid recovery, and operating practices. The production response in economic terms portrays the net effect of these variables. This paper presents a case study that demonstrates how post-treatment evaluations expressed in economic terms can be used to assess the performance of stimulations and to guide futuremore » design choices.« less

Finite linear diffusion model for design of overcharge protection for rechargeable lithium batteries

NASA Technical Reports Server (NTRS)

Narayanan, S. R.; Surampudi, S.; Attia, A. I.

1991-01-01

The overcharge condition in secondary lithium batteries employing redox additives for overcharge protection has been theoretically analyzed in terms of a finite linear diffusion model. The analysis leads to expressions relating the steady-state overcharge current density and cell voltage to the concentration, diffusion coefficient, standard reduction potential of the redox couple, and interelectrode distance. The model permits the estimation of the maximum permissible overcharge rate for any chosen set of system conditions. The model has been experimentally verified using 1,1-prime-dimethylferrocene as a redox additive. The theoretical results may be exploited in the design and optimization of overcharge protection by the redox additive approach.

Comparison of optimal design methods in inverse problems

NASA Astrophysics Data System (ADS)

Banks, H. T.; Holm, K.; Kappel, F.

2011-07-01

Typical optimal design methods for inverse or parameter estimation problems are designed to choose optimal sampling distributions through minimization of a specific cost function related to the resulting error in parameter estimates. It is hoped that the inverse problem will produce parameter estimates with increased accuracy using data collected according to the optimal sampling distribution. Here we formulate the classical optimal design problem in the context of general optimization problems over distributions of sampling times. We present a new Prohorov metric-based theoretical framework that permits one to treat succinctly and rigorously any optimal design criteria based on the Fisher information matrix. A fundamental approximation theory is also included in this framework. A new optimal design, SE-optimal design (standard error optimal design), is then introduced in the context of this framework. We compare this new design criterion with the more traditional D-optimal and E-optimal designs. The optimal sampling distributions from each design are used to compute and compare standard errors; the standard errors for parameters are computed using asymptotic theory or bootstrapping and the optimal mesh. We use three examples to illustrate ideas: the Verhulst-Pearl logistic population model (Banks H T and Tran H T 2009 Mathematical and Experimental Modeling of Physical and Biological Processes (Boca Raton, FL: Chapman and Hall/CRC)), the standard harmonic oscillator model (Banks H T and Tran H T 2009) and a popular glucose regulation model (Bergman R N, Ider Y Z, Bowden C R and Cobelli C 1979 Am. J. Physiol. 236 E667-77 De Gaetano A and Arino O 2000 J. Math. Biol. 40 136-68 Toffolo G, Bergman R N, Finegood D T, Bowden C R and Cobelli C 1980 Diabetes 29 979-90).

Topology Optimization using the Level Set and eXtended Finite Element Methods: Theory and Applications

NASA Astrophysics Data System (ADS)

Villanueva Perez, Carlos Hernan

Computational design optimization provides designers with automated techniques to develop novel and non-intuitive optimal designs. Topology optimization is a design optimization technique that allows for the evolution of a broad variety of geometries in the optimization process. Traditional density-based topology optimization methods often lack a sufficient resolution of the geometry and physical response, which prevents direct use of the optimized design in manufacturing and the accurate modeling of the physical response of boundary conditions. The goal of this thesis is to introduce a unified topology optimization framework that uses the Level Set Method (LSM) to describe the design geometry and the eXtended Finite Element Method (XFEM) to solve the governing equations and measure the performance of the design. The methodology is presented as an alternative to density-based optimization approaches, and is able to accommodate a broad range of engineering design problems. The framework presents state-of-the-art methods for immersed boundary techniques to stabilize the systems of equations and enforce the boundary conditions, and is studied with applications in 2D and 3D linear elastic structures, incompressible flow, and energy and species transport problems to test the robustness and the characteristics of the method. A comparison of the framework against density-based topology optimization approaches is studied with regards to convergence, performance, and the capability to manufacture the designs. Furthermore, the ability to control the shape of the design to operate within manufacturing constraints is developed and studied. The analysis capability of the framework is validated quantitatively through comparison against previous benchmark studies, and qualitatively through its application to topology optimization problems. The design optimization problems converge to intuitive designs and resembled well the results from previous 2D or density-based studies.

Optimal CCD readout by digital correlated double sampling

NASA Astrophysics Data System (ADS)

Alessandri, C.; Abusleme, A.; Guzman, D.; Passalacqua, I.; Alvarez-Fontecilla, E.; Guarini, M.

2016-01-01

Digital correlated double sampling (DCDS), a readout technique for charge-coupled devices (CCD), is gaining popularity in astronomical applications. By using an oversampling ADC and a digital filter, a DCDS system can achieve a better performance than traditional analogue readout techniques at the expense of a more complex system analysis. Several attempts to analyse and optimize a DCDS system have been reported, but most of the work presented in the literature has been experimental. Some approximate analytical tools have been presented for independent parameters of the system, but the overall performance and trade-offs have not been yet modelled. Furthermore, there is disagreement among experimental results that cannot be explained by the analytical tools available. In this work, a theoretical analysis of a generic DCDS readout system is presented, including key aspects such as the signal conditioning stage, the ADC resolution, the sampling frequency and the digital filter implementation. By using a time-domain noise model, the effect of the digital filter is properly modelled as a discrete-time process, thus avoiding the imprecision of continuous-time approximations that have been used so far. As a result, an accurate, closed-form expression for the signal-to-noise ratio at the output of the readout system is reached. This expression can be easily optimized in order to meet a set of specifications for a given CCD, thus providing a systematic design methodology for an optimal readout system. Simulated results are presented to validate the theory, obtained with both time- and frequency-domain noise generation models for completeness.

Optimal design and dispatch of a system of diesel generators, photovoltaics and batteries for remote locations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Scioletti, Michael S.; Newman, Alexandra M.; Goodman, Johanna K.

Renewable energy technologies, specifically, solar photovoltaic cells, combined with battery storage and diesel generators, form a hybrid system capable of independently powering remote locations, i.e., those isolated from larger grids. If sized correctly, hybrid systems reduce fuel consumption compared to diesel generator-only alternatives. We present an optimization model for establishing a hybrid power design and dispatch strategy for remote locations, such as a military forward operating base, that models the acquisition of different power technologies as integer variables and their operation using nonlinear expressions. Our cost-minimizing, nonconvex, mixed-integer, nonlinear program contains a detailed battery model. Due to its complexities, wemore » present linearizations, which include exact and convex under-estimation techniques, and a heuristic, which determines an initial feasible solution to serve as a “warm start” for the solver. We determine, in a few hours at most, solutions within 5% of optimality for a candidate set of technologies; these solutions closely resemble those from the nonlinear model. Lastly, our instances contain real data spanning a yearly horizon at hour fidelity and demonstrate that a hybrid system could reduce fuel consumption by as much as 50% compared to a generator-only solution.« less

Optimal design and dispatch of a system of diesel generators, photovoltaics and batteries for remote locations

DOE PAGES

Scioletti, Michael S.; Newman, Alexandra M.; Goodman, Johanna K.; ...

2017-05-08

Renewable energy technologies, specifically, solar photovoltaic cells, combined with battery storage and diesel generators, form a hybrid system capable of independently powering remote locations, i.e., those isolated from larger grids. If sized correctly, hybrid systems reduce fuel consumption compared to diesel generator-only alternatives. We present an optimization model for establishing a hybrid power design and dispatch strategy for remote locations, such as a military forward operating base, that models the acquisition of different power technologies as integer variables and their operation using nonlinear expressions. Our cost-minimizing, nonconvex, mixed-integer, nonlinear program contains a detailed battery model. Due to its complexities, wemore » present linearizations, which include exact and convex under-estimation techniques, and a heuristic, which determines an initial feasible solution to serve as a “warm start” for the solver. We determine, in a few hours at most, solutions within 5% of optimality for a candidate set of technologies; these solutions closely resemble those from the nonlinear model. Lastly, our instances contain real data spanning a yearly horizon at hour fidelity and demonstrate that a hybrid system could reduce fuel consumption by as much as 50% compared to a generator-only solution.« less

Exploration of alternate catalytic mechanisms and optimization strategies for retroaldolase design.

PubMed

Bjelic, Sinisa; Kipnis, Yakov; Wang, Ling; Pianowski, Zbigniew; Vorobiev, Sergey; Su, Min; Seetharaman, Jayaraman; Xiao, Rong; Kornhaber, Gregory; Hunt, John F; Tong, Liang; Hilvert, Donald; Baker, David

2014-01-09

Designed retroaldolases have utilized a nucleophilic lysine to promote carbon-carbon bond cleavage of β-hydroxy-ketones via a covalent Schiff base intermediate. Previous computational designs have incorporated a water molecule to facilitate formation and breakdown of the carbinolamine intermediate to give the Schiff base and to function as a general acid/base. Here we investigate an alternative active-site design in which the catalytic water molecule was replaced by the side chain of a glutamic acid. Five out of seven designs expressed solubly and exhibited catalytic efficiencies similar to previously designed retroaldolases for the conversion of 4-hydroxy-4-(6-methoxy-2-naphthyl)-2-butanone to 6-methoxy-2-naphthaldehyde and acetone. After one round of site-directed saturation mutagenesis, improved variants of the two best designs, RA114 and RA117, exhibited among the highest kcat (>10(-3)s(-1)) and kcat/KM (11-25M(-1)s(-1)) values observed for retroaldolase designs prior to comprehensive directed evolution. In both cases, the >10(5)-fold rate accelerations that were achieved are within 1-3 orders of magnitude of the rate enhancements reported for the best catalysts for related reactions, including catalytic antibodies (kcat/kuncat=10(6) to 10(8)) and an extensively evolved computational design (kcat/kuncat>10(7)). The catalytic sites, revealed by X-ray structures of optimized versions of the two active designs, are in close agreement with the design models except for the catalytic lysine in RA114. We further improved the variants by computational remodeling of the loops and yeast display selection for reactivity of the catalytic lysine with a diketone probe, obtaining an additional order of magnitude enhancement in activity with both approaches. © 2013.

Efficient Coproduction of Mannanase and Cellulase by the Transformation of a Codon-Optimized Endomannanase Gene from Aspergillus niger into Trichoderma reesei.

PubMed

Sun, Xianhua; Xue, Xianli; Li, Mengzhu; Gao, Fei; Hao, Zhenzhen; Huang, Huoqing; Luo, Huiying; Qin, Lina; Yao, Bin; Su, Xiaoyun

2017-12-20

Cellulase and mannanase are both important enzyme additives in animal feeds. Expressing the two enzymes simultaneously within one microbial host could potentially lead to cost reductions in the feeding of animals. For this purpose, we codon-optimized the Aspergillus niger Man5A gene to the codon-usage bias of Trichoderma reesei. By comparing the free energies and the local structures of the nucleotide sequences, one optimized sequence was finally selected and transformed into the T. reesei pyridine-auxotrophic strain TU-6. The codon-optimized gene was expressed to a higher level than the original one. Further expressing the codon-optimized gene in a mutated T. reesei strain through fed-batch cultivation resulted in coproduction of cellulase and mannanase up to 1376 U·mL -1 and 1204 U·mL -1 , respectively.

Optimal designs based on the maximum quasi-likelihood estimator

PubMed Central

Shen, Gang; Hyun, Seung Won; Wong, Weng Kee

2016-01-01

We use optimal design theory and construct locally optimal designs based on the maximum quasi-likelihood estimator (MqLE), which is derived under less stringent conditions than those required for the MLE method. We show that the proposed locally optimal designs are asymptotically as efficient as those based on the MLE when the error distribution is from an exponential family, and they perform just as well or better than optimal designs based on any other asymptotically linear unbiased estimators such as the least square estimator (LSE). In addition, we show current algorithms for finding optimal designs can be directly used to find optimal designs based on the MqLE. As an illustrative application, we construct a variety of locally optimal designs based on the MqLE for the 4-parameter logistic (4PL) model and study their robustness properties to misspecifications in the model using asymptotic relative efficiency. The results suggest that optimal designs based on the MqLE can be easily generated and they are quite robust to mis-specification in the probability distribution of the responses. PMID:28163359

Optimized molecular design of ADAPT-based HER2-imaging probes labelled with 111In and 68Ga.

PubMed

Lindbo, Sarah; Garousi, Javad; Mitran, Bogdan; Vorobyeva, Anzhelika; Oroujeni, Maryam; Orlova, Anna; Hober, Sophia; Tolmachev, Vladimir

2018-06-04

Radionuclide molecular imaging is a promising tool for visualization of cancer associated molecular abnormalities in vivo and stratification of patients for specific therapies. ADAPT is a new type of small engineered proteins based on the scaffold of an albumin binding domain of protein G. ADAPTs have been utilized to select and develop high affinity binders to different proteinaceous targets. ADAPT6 binds to human epidermal growth factor 2 (HER2) with low nanomolar affinity and can be used for its in vivo visualization. Molecular design of 111 In-labeled anti-HER2 ADAPT has been optimized in several earlier studies. In this study, we made a direct comparison of two of the most promising variants, having either a DEAVDANS or a (HE) 3 DANS sequence at the N-terminus, conjugated with a maleimido derivative of DOTA to a GSSC amino acids sequence at the C-terminus. The variants (designated DOTA-C 59 - DEAVDANS-ADAPT6-GSSC and DOTA-C 61 -(HE) 3 DANS-ADAPT6-GSSC) were stably labeled with 111 In for SPECT and 68 Ga for PET. Biodistribution of labeled ADAPT variants was evaluated in nude mice bearing human tumor xenografts with different levels of HER2 expression. Both variants enabled clear discrimination between tumors with high and low levels of HER2 expression. 111 In-labeled ADAPT6 derivatives provided higher tumor-to-organ ratios compared to 68 Ga-labeled counterparts. The best performing variant was DOTA-C 61 -(HE) 3 DANS-ADAPT6-GSSC, providing tumor-to-blood ratios of 208±36 and 109±17 at 3 h for 111 In and 68 Ga labels, respectively.

Analysis of Obesity-Related Factors and their Association with Aromatase Expression in Canine Malignant Mammary Tumours.

PubMed

Shin, J-I; Lim, H-Y; Kim, H-W; Seung, B-J; Ju, J-H; Sur, J-H

2016-07-01

This study was designed to investigate the role of obesity in canine malignant mammary tumours (CMMTs), by assessing aromatase expression and the regulatory roles of immune mediators such as cyclo-oxygenase-2 (COX2), prostaglandin E2 (PGE2), nuclear factor kappa beta (NF-κB), hypoxia inducible factor-1α (HIF-1α) and adipokines (i.e. leptin) in lean, optimal body weight, overweight and obese animals. Clinicopathological data, including the breed, body weight, body condition score and age and neutering status, were collected, together with histopathological characteristics (i.e. histological types, grading and lymphatic invasion). To determine the expression of each factor, immunohistochemistry was conducted with 60 samples of malignant CMMTs. CMMTs from overweight and obese animals had significantly elevated levels of PGE2, and aromatase expression correlated significantly with PGE2, NF-κB and leptin expression. However, no significant difference was observed in terms of histopathological characteristics. The results suggest that PGE2, a known obesity-related immune mediator, could be upregulated in CMMTs from overweight and obese animals. In addition, PGE2, NF-κB and leptin influenced the expression of aromatase, as observed in women. Copyright © 2016 Elsevier Ltd. All rights reserved.

The level of HER2 expression is a predictor of antibody-HER2 trafficking behavior in cancer cells

PubMed Central

Ram, Sripad; Kim, Dongyoung; Ober, Raimund J; Ward, E Sally

2014-01-01

The receptor tyrosine kinase HER2 is known to play a central role in mitogenic signaling, motivating the development of targeted, HER2-specific therapies. However, despite the longstanding use of antibodies to target HER2, controversies remain concerning antibody/HER2 trafficking behavior in cancer cells. Understanding this behavior has direct relevance to the mechanism of action and effective design of such antibodies. In the current study, we analyzed the intracellular dynamics of trastuzumab, a marketed HER2-targeting antibody, in a panel of breast and prostate cancer cell lines that have a wide range of HER2 expression levels. Our results reveal distinct post-endocytic trafficking behavior of antibody-HER2 complexes in cells with different HER2 expression levels. In particular, HER2-overexpressing cells exhibit efficient HER2 recycling and limited reductions in HER2 levels upon antibody treatment, and consequently display a high level of antibody persistence on their plasma membrane. By contrast, in cells with low HER2 expression, trastuzumab treatment results in rapid antibody clearance from the plasma membrane combined with substantial decreases in HER2 levels and undetectable levels of recycling. A cell line with intermediate levels of HER2 expression exhibits both antibody recycling and clearance from the cell surface. Significantly, these analyses demonstrate that HER2 expression levels, rather than cell origin (breast or prostate), is a determinant of subcellular trafficking properties. Such studies have relevance to optimizing the design of antibodies to target HER2. PMID:25517306

[Prokaryotic expression of the major antigenic domain of equine arteritis virus GL protein and the establishment of putative indirect ELISA assay].

PubMed

Liang, Cheng-Zhu; Cao, Rui-Bing; Wei, Jian-Chao; Zhu, Lai-Hua; Chen, Pu-Yan

2006-06-01

According to the antigenic analysis of equine arteritis virus (EAV) GL protein, one pair of primers were designed, with which the gene fragment coding the high antigenic domain of EAV GL protein was amplified from the EAV genome. The cloned gene was digested with BamH I and Xho I and then inserted into pET-32a and resulted pET-GL1. The pET-GL1 was transformed into the host cell BL21(DE3) and the expression was optimized including cultivation temperature and concentration of IPTG. The aim protein was highly expressed and the obtained recombinant protein manifested well reactiongenicity as was confirmed by Western blot. The recombinant GL1 protein was purified by the means of His * Bind resin protein purification procedure. Then an indirect ELISA was established to detect antibody against EAV with the purified GL1 protein as the coating antigen. The result showed that the optimal concentration of coated antigen was 9.65 microg/mL and the optimal dilution of serum was 1:80. The positive criterion of this ELISA assay is OD (the tested serum) > 0.4 and OD (the tested serum) /OD (the negative serum) > 2.0. The iGL-ELISA was evaluated versus micro-virus neutralization test. The ELISA was performed on 900 sera from which were preserved by this lab during horse entry/exit inspection, the agreement (94.1%) of these test were considered suitable for individual serological detection. In another test which 180 sera samples were detected by iGL-ELISA and INGEZIM ELISA kit respectively. The agreement ratio between the two methods is 95.6%.

Globally optimal trial design for local decision making.

PubMed

Eckermann, Simon; Willan, Andrew R

2009-02-01

Value of information methods allows decision makers to identify efficient trial design following a principle of maximizing the expected value to decision makers of information from potential trial designs relative to their expected cost. However, in health technology assessment (HTA) the restrictive assumption has been made that, prospectively, there is only expected value of sample information from research commissioned within jurisdiction. This paper extends the framework for optimal trial design and decision making within jurisdiction to allow for optimal trial design across jurisdictions. This is illustrated in identifying an optimal trial design for decision making across the US, the UK and Australia for early versus late external cephalic version for pregnant women presenting in the breech position. The expected net gain from locally optimal trial designs of US$0.72M is shown to increase to US$1.14M with a globally optimal trial design. In general, the proposed method of globally optimal trial design improves on optimal trial design within jurisdictions by: (i) reflecting the global value of non-rival information; (ii) allowing optimal allocation of trial sample across jurisdictions; (iii) avoiding market failure associated with free-rider effects, sub-optimal spreading of fixed costs and heterogeneity of trial information with multiple trials. Copyright (c) 2008 John Wiley & Sons, Ltd.

Integrated topology and shape optimization in structural design

NASA Technical Reports Server (NTRS)

Bremicker, M.; Chirehdast, M.; Kikuchi, N.; Papalambros, P. Y.

1990-01-01

Structural optimization procedures usually start from a given design topology and vary its proportions or boundary shapes to achieve optimality under various constraints. Two different categories of structural optimization are distinguished in the literature, namely sizing and shape optimization. A major restriction in both cases is that the design topology is considered fixed and given. Questions concerning the general layout of a design (such as whether a truss or a solid structure should be used) as well as more detailed topology features (e.g., the number and connectivities of bars in a truss or the number of holes in a solid) have to be resolved by design experience before formulating the structural optimization model. Design quality of an optimized structure still depends strongly on engineering intuition. This article presents a novel approach for initiating formal structural optimization at an earlier stage, where the design topology is rigorously generated in addition to selecting shape and size dimensions. A three-phase design process is discussed: an optimal initial topology is created by a homogenization method as a gray level image, which is then transformed to a realizable design using computer vision techniques; this design is then parameterized and treated in detail by sizing and shape optimization. A fully automated process is described for trusses. Optimization of two dimensional solid structures is also discussed. Several application-oriented examples illustrate the usefulness of the proposed methodology.

Development of an efficient E. coli expression and purification system for a catalytically active, human Cullin3-RINGBox1 protein complex and elucidation of its quaternary structure with Keap1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Small, Evan; Eggler, Aimee; Mesecar, Andrew D., E-mail: amesecar@purdue.edu

2010-10-01

Research highlights: {yields} A novel expression strategy was used to purify Cul3-Rbx1 from E. coli. {yields} The Cul3-Rbx1 complex is fully active and catalyzes ubiquitination of Nrf2 in vitro. {yields} Cul3, Rbx1, and Keap1 form a complex with unique stoichiometry of 1:1:2. -- Abstract: The Cullin3-based E3 ubiquitin ligase complex is thought to play an important role in the cellular response to oxidative stress and xenobiotic assault. While limited biochemical studies of the ligase's role in these complex signaling pathways are beginning to emerge, structural studies are lagging far behind due to the inability to acquire sufficient quantities of full-length,more » highly pure and active Cullin3. Here we describe the design and construction of an optimized expression and purification system for the full-length, human Cullin3-RINGBox 1 (Rbx1) protein complex from Escherichia coli. The dual-expression system is comprised of codon-optimized Cullin3 and Rbx1 genes co-expressed from a single pET-Duet-1 plasmid. Rapid purification of the Cullin3-Rbx1 complex is achieved in two steps via an affinity column followed by size-exclusion chromatography. Approximately 15 mg of highly pure and active Cullin3-Rbx1 protein from 1 L of E. coli culture can be achieved. Analysis of the quaternary structure of the Cullin3-Rbx1 and Cullin3-Rbx1-Keap1 complexes by size-exclusion chromatography and analytical ultracentrifugation indicates a 1:1 stoichiometry for the Cullin3-Rbx1 complex (MW = 111 kDa), and a 1:1:2 stoichiometry for the Cullin3-Rbx1-Keap1 complex (MW = 280 kDa). This latter complex has a novel quaternary structural organization for cullin E3 ligases, and it is fully active based on an in vitro Cullin3-Rbx1-Keap1-Nrf2 ubiquitination activity assay that was developed and optimized in this study.« less

Multidisciplinary Analysis and Optimal Design: As Easy as it Sounds?

NASA Technical Reports Server (NTRS)

Moore, Greg; Chainyk, Mike; Schiermeier, John

2004-01-01

The viewgraph presentation examines optimal design for precision, large aperture structures. Discussion focuses on aspects of design optimization, code architecture and current capabilities, and planned activities and collaborative area suggestions. The discussion of design optimization examines design sensitivity analysis; practical considerations; and new analytical environments including finite element-based capability for high-fidelity multidisciplinary analysis, design sensitivity, and optimization. The discussion of code architecture and current capabilities includes basic thermal and structural elements, nonlinear heat transfer solutions and process, and optical modes generation.

Review of design optimization methods for turbomachinery aerodynamics

NASA Astrophysics Data System (ADS)

Li, Zhihui; Zheng, Xinqian

2017-08-01

In today's competitive environment, new turbomachinery designs need to be not only more efficient, quieter, and ;greener; but also need to be developed at on much shorter time scales and at lower costs. A number of advanced optimization strategies have been developed to achieve these requirements. This paper reviews recent progress in turbomachinery design optimization to solve real-world aerodynamic problems, especially for compressors and turbines. This review covers the following topics that are important for optimizing turbomachinery designs. (1) optimization methods, (2) stochastic optimization combined with blade parameterization methods and the design of experiment methods, (3) gradient-based optimization methods for compressors and turbines and (4) data mining techniques for Pareto Fronts. We also present our own insights regarding the current research trends and the future optimization of turbomachinery designs.

Optimizing promoters for recombinant adeno-associated virus-mediated gene expression in the peripheral and central nervous system using self-complementary vectors.

PubMed

Gray, Steven J; Foti, Stacey B; Schwartz, Joel W; Bachaboina, Lavanya; Taylor-Blake, Bonnie; Coleman, Jennifer; Ehlers, Michael D; Zylka, Mark J; McCown, Thomas J; Samulski, R Jude

2011-09-01

With the increased use of small self-complementary adeno-associated viral (AAV) vectors, the design of compact promoters becomes critical for packaging and expressing larger transgenes under ubiquitous or cell-specific control. In a comparative study of commonly used 800-bp cytomegalovirus (CMV) and chicken β-actin (CBA) promoters, we report significant differences in the patterns of cell-specific gene expression in the central and peripheral nervous systems. The CMV promoter provides high initial neural expression that diminishes over time. The CBA promoter displayed mostly ubiquitous and high neural expression, but substantially lower expression in motor neurons (MNs). We report the creation of a novel hybrid form of the CBA promoter (CBh) that provides robust long-term expression in all cells observed with CMV or CBA, including MNs. To develop a short neuronal promoter to package larger transgenes into AAV vectors, we also found that a 229-bp fragment of the mouse methyl-CpG-binding protein-2 (MeCP2) promoter was able to drive neuron-specific expression within the CNS. Thus the 800-bp CBh promoter provides strong, long-term, and ubiquitous CNS expression whereas the MeCP2 promoter allows an extra 570-bp packaging capacity, with low and mostly neuronal expression within the CNS, similar to the MeCP2 transcription factor.

Design Optimisation of a Magnetic Field Based Soft Tactile Sensor

PubMed Central

Raske, Nicholas; Kow, Junwai; Alazmani, Ali; Ghajari, Mazdak; Culmer, Peter; Hewson, Robert

2017-01-01

This paper investigates the design optimisation of a magnetic field based soft tactile sensor, comprised of a magnet and Hall effect module separated by an elastomer. The aim was to minimise sensitivity of the output force with respect to the input magnetic field; this was achieved by varying the geometry and material properties. Finite element simulations determined the magnetic field and structural behaviour under load. Genetic programming produced phenomenological expressions describing these responses. Optimisation studies constrained by a measurable force and stable loading conditions were conducted; these produced Pareto sets of designs from which the optimal sensor characteristics were selected. The optimisation demonstrated a compromise between sensitivity and the measurable force, a fabricated version of the optimised sensor validated the improvements made using this methodology. The approach presented can be applied in general for optimising soft tactile sensor designs over a range of applications and sensing modes. PMID:29099787

Design and Fabrication of Aspheric Microlens Array for Optical Read-Only-Memory Card System

NASA Astrophysics Data System (ADS)

Kim, Hongmin; Jeong, Gibong; Kim, Young‑Joo; Kang, Shinill

2006-08-01

An optical head based on the Talbot effect with an aspheric microlens array for an optical read-only-memory (ROM) card system was designed and fabricated. The mathematical expression for the wavefield diffracted by a periodic microlens array showed that the amplitude distribution at the Talbot plane from the focal plane of the microlens array was identically equal to that at the focal plane. To use a reflow microlens array as a master pattern of an ultraviolet-imprinted (UV-imprinted) microlens array, the reflow microlens was defined as having an aspheric shape. To obtain optical probes with good optical qualities, a microlens array with the minimum spherical aberration was designed by ray tracing. The reflow condition was optimized to realize the master pattern of a microlens with a designed aspheric shape. The intensity distribution of the optical probes at the Talbot plane from the focal plane showed a diffraction-limited shape.

Computationally designed high specificity inhibitors delineate the roles of BCL2 family proteins in cancer

PubMed Central

Berger, Stephanie; Procko, Erik; Margineantu, Daciana; Lee, Erinna F; Shen, Betty W; Zelter, Alex; Silva, Daniel-Adriano; Chawla, Kusum; Herold, Marco J; Garnier, Jean-Marc; Johnson, Richard; MacCoss, Michael J; Lessene, Guillaume; Davis, Trisha N; Stayton, Patrick S; Stoddard, Barry L; Fairlie, W Douglas; Hockenbery, David M; Baker, David

2016-01-01

Many cancers overexpress one or more of the six human pro-survival BCL2 family proteins to evade apoptosis. To determine which BCL2 protein or proteins block apoptosis in different cancers, we computationally designed three-helix bundle protein inhibitors specific for each BCL2 pro-survival protein. Following in vitro optimization, each inhibitor binds its target with high picomolar to low nanomolar affinity and at least 300-fold specificity. Expression of the designed inhibitors in human cancer cell lines revealed unique dependencies on BCL2 proteins for survival which could not be inferred from other BCL2 profiling methods. Our results show that designed inhibitors can be generated for each member of a closely-knit protein family to probe the importance of specific protein-protein interactions in complex biological processes. DOI: http://dx.doi.org/10.7554/eLife.20352.001 PMID:27805565

In vitro optimization of antisense oligodeoxynucleotide design: an example using the connexin gene family.

PubMed

Law, Lee Yong; Zhang, Wei V; Stott, N Susan; Becker, David L; Green, Colin R

2006-09-01

The completion of the human and mouse genomes has identified at least 20 connexin isomers in this family of intercellular channel proteins. However, there are no specific gap junction blockers or channel-blocking mimetic peptides available for the study of specific connexins. We designed antisense oligodeoxynucleotides that functionally reduce targeted connexin protein expression and can be used to reveal the biological function of individual connexins in vivo. Connexin mRNA was firstly exposed in vitro to deoxyribozymes complementing the sense coding sequence. Those that cleaved the target connexin mRNA in defined regions were used as the basis to design oligodeoxynucleotides to the accessible sites, thus taking into account tertiary mRNA configurations rather than relying on computed predictions. Antisense oligodeoxynucleotides designed to bind to accessible mRNA sites selectively reduced connexin26 and -43 mRNA expression in a corneal epithelium ex vivo model. Connexin43 protein levels were reduced correlating with the knockdown in mRNA and the protein's rapid turnover; protein levels of connexin26 did not alter, supporting lower turnover rates reported for that protein. We show, for the first time, an inexpensive and empirical approach to the preparation of specific and functional antisense oligodeoxynucleotides against known gene targets in the post-genomic era.

High levels of bioplastic are produced in fertile transplastomic tobacco plants engineered with a synthetic operon for the production of polyhydroxybutyrate.

PubMed

Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P; Snell, Kristi D

2011-04-01

An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5' end by the host plant's psbA coding sequence and at the 3' end by the host plant's 3' psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated.

Selective arylsulfonamide inhibitors of ADAM-17: hit optimization and activity in ovarian cancer cell models.

PubMed

Nuti, Elisa; Casalini, Francesca; Santamaria, Salvatore; Fabbi, Marina; Carbotti, Grazia; Ferrini, Silvano; Marinelli, Luciana; La Pietra, Valeria; Novellino, Ettore; Camodeca, Caterina; Orlandini, Elisabetta; Nencetti, Susanna; Rossello, Armando

2013-10-24

Activated leukocyte cell adhesion molecule (ALCAM) is expressed at the surface of epithelial ovarian cancer (EOC) cells and is released in a soluble form (sALCAM) by ADAM-17-mediated shedding. This process is relevant to EOC cell motility and invasiveness, which is reduced by inhibitors of ADAM-17. In addition, ADAM-17 plays a key role in EGFR signaling and thus may represent a useful target in anticancer therapy. Herein we report our hit optimization effort to identify potent and selective ADAM-17 inhibitors, starting with previously identified inhibitor 1. A new series of secondary sulfonamido-based hydroxamates was designed and synthesized. The biological activity of the newly synthesized compounds was tested in vitro on isolated enzymes and human EOC cell lines. The optimization process led to compound 21, which showed an IC50 of 1.9 nM on ADAM-17 with greatly increased selectivity. This compound maintained good inhibitory properties on sALCAM shedding in several in vitro assays.

Optimal design criteria - prediction vs. parameter estimation

NASA Astrophysics Data System (ADS)

Waldl, Helmut

2014-05-01

G-optimality is a popular design criterion for optimal prediction, it tries to minimize the kriging variance over the whole design region. A G-optimal design minimizes the maximum variance of all predicted values. If we use kriging methods for prediction it is self-evident to use the kriging variance as a measure of uncertainty for the estimates. Though the computation of the kriging variance and even more the computation of the empirical kriging variance is computationally very costly and finding the maximum kriging variance in high-dimensional regions can be time demanding such that we cannot really find the G-optimal design with nowadays available computer equipment in practice. We cannot always avoid this problem by using space-filling designs because small designs that minimize the empirical kriging variance are often non-space-filling. D-optimality is the design criterion related to parameter estimation. A D-optimal design maximizes the determinant of the information matrix of the estimates. D-optimality in terms of trend parameter estimation and D-optimality in terms of covariance parameter estimation yield basically different designs. The Pareto frontier of these two competing determinant criteria corresponds with designs that perform well under both criteria. Under certain conditions searching the G-optimal design on the above Pareto frontier yields almost as good results as searching the G-optimal design in the whole design region. In doing so the maximum of the empirical kriging variance has to be computed only a few times though. The method is demonstrated by means of a computer simulation experiment based on data provided by the Belgian institute Management Unit of the North Sea Mathematical Models (MUMM) that describe the evolution of inorganic and organic carbon and nutrients, phytoplankton, bacteria and zooplankton in the Southern Bight of the North Sea.

A method to facilitate and monitor expression of exogenous genes in the rat kidney using plasmid and viral vectors

PubMed Central

Corridon, Peter R.; Rhodes, George J.; Leonard, Ellen C.; Basile, David P.; Gattone, Vincent H.; Bacallao, Robert L.

2013-01-01

Gene therapy has been proposed as a novel alternative to treat kidney disease. This goal has been hindered by the inability to reliably deliver transgenes to target cells throughout the kidney, while minimizing injury. Since hydrodynamic forces have previously shown promising results, we optimized this approach and designed a method that utilizes retrograde renal vein injections to facilitate transgene expression in rat kidneys. We show, using intravital fluorescence two-photon microscopy, that fluorescent albumin and dextrans injected into the renal vein under defined conditions of hydrodynamic pressure distribute broadly throughout the kidney in live animals. We found injection parameters that result in no kidney injury as determined by intravital microscopy, histology, and serum creatinine measurements. Plasmids, baculovirus, and adenovirus vectors, designed to express EGFP, EGFP-actin, EGFP-occludin, EGFP-tubulin, tdTomato-H2B, or RFP-actin fusion proteins, were introduced into live kidneys in a similar fashion. Gene expression was then observed in live and ex vivo kidneys using two-photon imaging and confocal laser scanning microscopy. We recorded widespread fluorescent protein expression lasting more than 1 mo after introduction of transgenes. Plasmid and adenovirus vectors provided gene transfer efficiencies ranging from 50 to 90%, compared with 10–50% using baculovirus. Using plasmids and adenovirus, fluorescent protein expression was observed 1) in proximal and distal tubule epithelial cells; 2) within glomeruli; and 3) within the peritubular interstitium. In isolated kidneys, fluorescent protein expression was observed from the cortex to the papilla. These results provide a robust approach for gene delivery and the study of protein function in live mammal kidneys. PMID:23467422

Analysis of temporal gene expression profiles: clustering by simulated annealing and determining the optimal number of clusters.

PubMed

Lukashin, A V; Fuchs, R

2001-05-01

Cluster analysis of genome-wide expression data from DNA microarray hybridization studies has proved to be a useful tool for identifying biologically relevant groupings of genes and samples. In the present paper, we focus on several important issues related to clustering algorithms that have not yet been fully studied. We describe a simple and robust algorithm for the clustering of temporal gene expression profiles that is based on the simulated annealing procedure. In general, this algorithm guarantees to eventually find the globally optimal distribution of genes over clusters. We introduce an iterative scheme that serves to evaluate quantitatively the optimal number of clusters for each specific data set. The scheme is based on standard approaches used in regular statistical tests. The basic idea is to organize the search of the optimal number of clusters simultaneously with the optimization of the distribution of genes over clusters. The efficiency of the proposed algorithm has been evaluated by means of a reverse engineering experiment, that is, a situation in which the correct distribution of genes over clusters is known a priori. The employment of this statistically rigorous test has shown that our algorithm places greater than 90% genes into correct clusters. Finally, the algorithm has been tested on real gene expression data (expression changes during yeast cell cycle) for which the fundamental patterns of gene expression and the assignment of genes to clusters are well understood from numerous previous studies.

Finite burn maneuver modeling for a generalized spacecraft trajectory design and optimization system.

PubMed

Ocampo, Cesar

2004-05-01

The modeling, design, and optimization of finite burn maneuvers for a generalized trajectory design and optimization system is presented. A generalized trajectory design and optimization system is a system that uses a single unified framework that facilitates the modeling and optimization of complex spacecraft trajectories that may operate in complex gravitational force fields, use multiple propulsion systems, and involve multiple spacecraft. The modeling and optimization issues associated with the use of controlled engine burn maneuvers of finite thrust magnitude and duration are presented in the context of designing and optimizing a wide class of finite thrust trajectories. Optimal control theory is used examine the optimization of these maneuvers in arbitrary force fields that are generally position, velocity, mass, and are time dependent. The associated numerical methods used to obtain these solutions involve either, the solution to a system of nonlinear equations, an explicit parameter optimization method, or a hybrid parameter optimization that combines certain aspects of both. The theoretical and numerical methods presented here have been implemented in copernicus, a prototype trajectory design and optimization system under development at the University of Texas at Austin.

Advanced Information Technology in Simulation Based Life Cycle Design

NASA Technical Reports Server (NTRS)

Renaud, John E.

2003-01-01

In this research a Collaborative Optimization (CO) approach for multidisciplinary systems design is used to develop a decision based design framework for non-deterministic optimization. To date CO strategies have been developed for use in application to deterministic systems design problems. In this research the decision based design (DBD) framework proposed by Hazelrigg is modified for use in a collaborative optimization framework. The Hazelrigg framework as originally proposed provides a single level optimization strategy that combines engineering decisions with business decisions in a single level optimization. By transforming this framework for use in collaborative optimization one can decompose the business and engineering decision making processes. In the new multilevel framework of Decision Based Collaborative Optimization (DBCO) the business decisions are made at the system level. These business decisions result in a set of engineering performance targets that disciplinary engineering design teams seek to satisfy as part of subspace optimizations. The Decision Based Collaborative Optimization framework more accurately models the existing relationship between business and engineering in multidisciplinary systems design.

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

Design and construction of a first-generation high-throughput integrated robotic molecular biology platform for bioenergy applications.

PubMed

Hughes, Stephen R; Butt, Tauseef R; Bartolett, Scott; Riedmuller, Steven B; Farrelly, Philip

2011-08-01

The molecular biological techniques for plasmid-based assembly and cloning of gene open reading frames are essential for elucidating the function of the proteins encoded by the genes. High-throughput integrated robotic molecular biology platforms that have the capacity to rapidly clone and express heterologous gene open reading frames in bacteria and yeast and to screen large numbers of expressed proteins for optimized function are an important technology for improving microbial strains for biofuel production. The process involves the production of full-length complementary DNA libraries as a source of plasmid-based clones to express the desired proteins in active form for determination of their functions. Proteins that were identified by high-throughput screening as having desired characteristics are overexpressed in microbes to enable them to perform functions that will allow more cost-effective and sustainable production of biofuels. Because the plasmid libraries are composed of several thousand unique genes, automation of the process is essential. This review describes the design and implementation of an automated integrated programmable robotic workcell capable of producing complementary DNA libraries, colony picking, isolating plasmid DNA, transforming yeast and bacteria, expressing protein, and performing appropriate functional assays. These operations will allow tailoring microbial strains to use renewable feedstocks for production of biofuels, bioderived chemicals, fertilizers, and other coproducts for profitable and sustainable biorefineries. Published by Elsevier Inc.

Multiobjective Optimization of Rocket Engine Pumps Using Evolutionary Algorithm

NASA Technical Reports Server (NTRS)

Oyama, Akira; Liou, Meng-Sing

2001-01-01

A design optimization method for turbopumps of cryogenic rocket engines has been developed. Multiobjective Evolutionary Algorithm (MOEA) is used for multiobjective pump design optimizations. Performances of design candidates are evaluated by using the meanline pump flow modeling method based on the Euler turbine equation coupled with empirical correlations for rotor efficiency. To demonstrate the feasibility of the present approach, a single stage centrifugal pump design and multistage pump design optimizations are presented. In both cases, the present method obtains very reasonable Pareto-optimal solutions that include some designs outperforming the original design in total head while reducing input power by one percent. Detailed observation of the design results also reveals some important design criteria for turbopumps in cryogenic rocket engines. These results demonstrate the feasibility of the EA-based design optimization method in this field.

Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins.

PubMed

Sequeira, Ana Filipa; Brás, Joana L A; Guerreiro, Catarina I P D; Vincentelli, Renaud; Fontes, Carlos M G A

2016-12-01

Gene synthesis is becoming an important tool in many fields of recombinant DNA technology, including recombinant protein production. De novo gene synthesis is quickly replacing the classical cloning and mutagenesis procedures and allows generating nucleic acids for which no template is available. In addition, when coupled with efficient gene design algorithms that optimize codon usage, it leads to high levels of recombinant protein expression. Here, we describe the development of an optimized gene synthesis platform that was applied to the large scale production of small genes encoding venom peptides. This improved gene synthesis method uses a PCR-based protocol to assemble synthetic DNA from pools of overlapping oligonucleotides and was developed to synthesise multiples genes simultaneously. This technology incorporates an accurate, automated and cost effective ligation independent cloning step to directly integrate the synthetic genes into an effective Escherichia coli expression vector. The robustness of this technology to generate large libraries of dozens to thousands of synthetic nucleic acids was demonstrated through the parallel and simultaneous synthesis of 96 genes encoding animal toxins. An automated platform was developed for the large-scale synthesis of small genes encoding eukaryotic toxins. Large scale recombinant expression of synthetic genes encoding eukaryotic toxins will allow exploring the extraordinary potency and pharmacological diversity of animal venoms, an increasingly valuable but unexplored source of lead molecules for drug discovery.

Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast

PubMed Central

MacDonald, Chris; Piper, Robert C.

2015-01-01

Here we expand the set of tools for genetically manipulating Saccharomyces cerevisiae. We show that puromycin-resistance can be achieved in yeast through expression of a bacterial puromycin-resistance gene optimized to the yeast codon bias, which in turn serves as an easy to use dominant genetic marker suitable for gene disruption. We have constructed a similar DNA cassette expressing yeast codon-optimized mutant human dihydrofolate reductase (DHFR) that confers resistance to methotrexate and can also be used as a dominant selectable marker. Both of these drug-resistant marker cassettes are flanked by loxP sites allowing for their excision from the genome following expression of cre-recombinase. Finally, we have created a series of plasmids for low-level constitutive expression of cre-recombinase in yeast that allows for efficient excision of loxP-flanked markers. PMID:25688547

Multidisciplinary design optimization of aircraft wing structures with aeroelastic and aeroservoelastic constraints

NASA Astrophysics Data System (ADS)

Jung, Sang-Young

Design procedures for aircraft wing structures with control surfaces are presented using multidisciplinary design optimization. Several disciplines such as stress analysis, structural vibration, aerodynamics, and controls are considered simultaneously and combined for design optimization. Vibration data and aerodynamic data including those in the transonic regime are calculated by existing codes. Flutter analyses are performed using those data. A flutter suppression method is studied using control laws in the closed-loop flutter equation. For the design optimization, optimization techniques such as approximation, design variable linking, temporary constraint deletion, and optimality criteria are used. Sensitivity derivatives of stresses and displacements for static loads, natural frequency, flutter characteristics, and control characteristics with respect to design variables are calculated for an approximate optimization. The objective function is the structural weight. The design variables are the section properties of the structural elements and the control gain factors. Existing multidisciplinary optimization codes (ASTROS* and MSC/NASTRAN) are used to perform single and multiple constraint optimizations of fully built up finite element wing structures. Three benchmark wing models are developed and/or modified for this purpose. The models are tested extensively.

Development of a codon optimization strategy using the efor RED reporter gene as a test case

NASA Astrophysics Data System (ADS)

Yip, Chee-Hoo; Yarkoni, Orr; Ajioka, James; Wan, Kiew-Lian; Nathan, Sheila

2018-04-01

Synthetic biology is a platform that enables high-level synthesis of useful products such as pharmaceutically related drugs, bioplastics and green fuels from synthetic DNA constructs. Large-scale expression of these products can be achieved in an industrial compliant host such as Escherichia coli. To maximise the production of recombinant proteins in a heterologous host, the genes of interest are usually codon optimized based on the codon usage of the host. However, the bioinformatics freeware available for standard codon optimization might not be ideal in determining the best sequence for the synthesis of synthetic DNA. Synthesis of incorrect sequences can prove to be a costly error and to avoid this, a codon optimization strategy was developed based on the E. coli codon usage using the efor RED reporter gene as a test case. This strategy replaces codons encoding for serine, leucine, proline and threonine with the most frequently used codons in E. coli. Furthermore, codons encoding for valine and glycine are substituted with the second highly used codons in E. coli. Both the optimized and original efor RED genes were ligated to the pJS209 plasmid backbone using Gibson Assembly and the recombinant DNAs were transformed into E. coli E. cloni 10G strain. The fluorescence intensity per cell density of the optimized sequence was improved by 20% compared to the original sequence. Hence, the developed codon optimization strategy is proposed when designing an optimal sequence for heterologous protein production in E. coli.

A Declarative Design Approach to Modeling Traditional and Non-Traditional Space Systems

NASA Astrophysics Data System (ADS)

Hoag, Lucy M.

The space system design process is known to be laborious, complex, and computationally demanding. It is highly multi-disciplinary, involving several interdependent subsystems that must be both highly optimized and reliable due to the high cost of launch. Satellites must also be capable of operating in harsh and unpredictable environments, so integrating high-fidelity analysis is important. To address each of these concerns, a holistic design approach is necessary. However, while the sophistication of space systems has evolved significantly in the last 60 years, improvements in the design process have been comparatively stagnant. Space systems continue to be designed using a procedural, subsystem-by-subsystem approach. This method is inadequate since it generally requires extensive iteration and limited or heuristic-based search, which can be slow, labor-intensive, and inaccurate. The use of a declarative design approach can potentially address these inadequacies. In the declarative programming style, the focus of a problem is placed on what the objective is, and not necessarily how it should be achieved. In the context of design, this entails knowledge expressed as a declaration of statements that are true about the desired artifact instead of explicit instructions on how to implement it. A well-known technique is through constraint-based reasoning, where a design problem is represented as a network of rules and constraints that are reasoned across by a solver to dynamically discover the optimal candidate(s). This enables implicit instantiation of the tradespace and allows for automatic generation of all feasible design candidates. As such, this approach also appears to be well-suited to modeling adaptable space systems, which generally have large tradespaces and possess configurations that are not well-known a priori. This research applied a declarative design approach to holistic satellite design and to tradespace exploration for adaptable space systems. The approach was tested during the design of USC's Aeneas nanosatellite project, and a case study was performed to assess the advantages of the new approach over past procedural approaches. It was found that use of the declarative approach improved design accuracy through exhaustive tradespace search and provable optimality; decreased design time through improved model generation, faster run time, and reduction in time and number of iteration cycles; and enabled modular and extensible code. Observed weaknesses included non-intuitive model abstraction; increased debugging time; and difficulty of data extrapolation and analysis.

An optimized expression vector for improving the yield of dengue virus-like particles from transfected insect cells.

PubMed

Charoensri, Nicha; Suphatrakul, Amporn; Sriburi, Rungtawan; Yasanga, Thippawan; Junjhon, Jiraphan; Keelapang, Poonsook; Utaipat, Utaiwan; Puttikhunt, Chunya; Kasinrerk, Watchara; Malasit, Prida; Sittisombut, Nopporn

2014-09-01

Recombinant virus-like particles (rVLPs) of flaviviruses are non-infectious particles released from cells expressing the envelope glycoproteins prM and E. Dengue virus rVLPs are recognized as a potential vaccine candidate, but large scale production of these particles is hindered by low yields and the occurrence of cytopathic effects. In an approach to improve the yield of rVLPs from transfected insect cells, several components of a dengue serotype 2 virus prM+E expression cassette were modified and the effect of these modifications was assessed during transient expression. Enhancement of extracellular rVLP levels by simultaneous substitutions of the prM signal peptide and the stem-anchor region of E with homologous cellular and viral counterparts, respectively, was further augmented by codon optimization. Extensive formation of multinucleated cells following transfection with the codon-optimized expression cassette was abrogated by introducing an E fusion loop mutation. This mutation also helped restore the extracellular E levels affected negatively by alteration of a charged residue at the pr-M junction, which was intended to promote maturation of rVLPs during export. Optimized expression cassettes generated in this multiple add-on modification approach should be useful in the generation of stably expressing clones and production of dengue virus rVLPs for immunogenicity studies. Copyright © 2014 Elsevier B.V. All rights reserved.

Evolution of Synonymous Codon Usage in Neurospora tetrasperma and Neurospora discreta

PubMed Central

Whittle, C. A.; Sun, Y.; Johannesson, H.

2011-01-01

Neurospora comprises a primary model system for the study of fungal genetics and biology. In spite of this, little is known about genome evolution in Neurospora. For example, the evolution of synonymous codon usage is largely unknown in this genus. In the present investigation, we conducted a comprehensive analysis of synonymous codon usage and its relationship to gene expression and gene length (GL) in Neurospora tetrasperma and Neurospora discreta. For our analysis, we examined codon usage among 2,079 genes per organism and assessed gene expression using large-scale expressed sequenced tag (EST) data sets (279,323 and 453,559 ESTs for N. tetrasperma and N. discreta, respectively). Data on relative synonymous codon usage revealed 24 codons (and two putative codons) that are more frequently used in genes with high than with low expression and thus were defined as optimal codons. Although codon-usage bias was highly correlated with gene expression, it was independent of selectively neutral base composition (introns); thus demonstrating that translational selection drives synonymous codon usage in these genomes. We also report that GL (coding sequences [CDS]) was inversely associated with optimal codon usage at each gene expression level, with highly expressed short genes having the greatest frequency of optimal codons. Optimal codon frequency was moderately higher in N. tetrasperma than in N. discreta, which might be due to variation in selective pressures and/or mating systems. PMID:21402862

Structural Optimization in automotive design

NASA Technical Reports Server (NTRS)

Bennett, J. A.; Botkin, M. E.

1984-01-01

Although mathematical structural optimization has been an active research area for twenty years, there has been relatively little penetration into the design process. Experience indicates that often this is due to the traditional layout-analysis design process. In many cases, optimization efforts have been outgrowths of analysis groups which are themselves appendages to the traditional design process. As a result, optimization is often introduced into the design process too late to have a significant effect because many potential design variables have already been fixed. A series of examples are given to indicate how structural optimization has been effectively integrated into the design process.

Genetic algorithm to optimize the design of main combustor and gas generator in liquid rocket engines

NASA Astrophysics Data System (ADS)

Son, Min; Ko, Sangho; Koo, Jaye

2014-06-01

A genetic algorithm was used to develop optimal design methods for the regenerative cooled combustor and fuel-rich gas generator of a liquid rocket engine. For the combustor design, a chemical equilibrium analysis was applied, and the profile was calculated using Rao's method. One-dimensional heat transfer was assumed along the profile, and cooling channels were designed. For the gas-generator design, non-equilibrium properties were derived from a counterflow analysis, and a vaporization model for the fuel droplet was adopted to calculate residence time. Finally, a genetic algorithm was adopted to optimize the designs. The combustor and gas generator were optimally designed for 30-tonf, 75-tonf, and 150-tonf engines. The optimized combustors demonstrated superior design characteristics when compared with previous non-optimized results. Wall temperatures at the nozzle throat were optimized to satisfy the requirement of 800 K, and specific impulses were maximized. In addition, the target turbine power and a burned-gas temperature of 1000 K were obtained from the optimized gas-generator design.

Optimal tumor sampling for immunostaining of biomarkers in breast carcinoma

PubMed Central

2011-01-01

Introduction Biomarkers, such as Estrogen Receptor, are used to determine therapy and prognosis in breast carcinoma. Immunostaining assays of biomarker expression have a high rate of inaccuracy; for example, estimates are as high as 20% for Estrogen Receptor. Biomarkers have been shown to be heterogeneously expressed in breast tumors and this heterogeneity may contribute to the inaccuracy of immunostaining assays. Currently, no evidence-based standards exist for the amount of tumor that must be sampled in order to correct for biomarker heterogeneity. The aim of this study was to determine the optimal number of 20X fields that are necessary to estimate a representative measurement of expression in a whole tissue section for selected biomarkers: ER, HER-2, AKT, ERK, S6K1, GAPDH, Cytokeratin, and MAP-Tau. Methods Two collections of whole tissue sections of breast carcinoma were immunostained for biomarkers. Expression was quantified using the Automated Quantitative Analysis (AQUA) method of quantitative immunofluorescence. Simulated sampling of various numbers of fields (ranging from one to thirty five) was performed for each marker. The optimal number was selected for each marker via resampling techniques and minimization of prediction error over an independent test set. Results The optimal number of 20X fields varied by biomarker, ranging between three to fourteen fields. More heterogeneous markers, such as MAP-Tau protein, required a larger sample of 20X fields to produce representative measurement. Conclusions The optimal number of 20X fields that must be sampled to produce a representative measurement of biomarker expression varies by marker with more heterogeneous markers requiring a larger number. The clinical implication of these findings is that breast biopsies consisting of a small number of fields may be inadequate to represent whole tumor biomarker expression for many markers. Additionally, for biomarkers newly introduced into clinical use, especially if therapeutic response is dictated by level of expression, the optimal size of tissue sample must be determined on a marker-by-marker basis. PMID:21592345

An approach for aerodynamic optimization of transonic fan blades

NASA Astrophysics Data System (ADS)

Khelghatibana, Maryam

Aerodynamic design optimization of transonic fan blades is a highly challenging problem due to the complexity of flow field inside the fan, the conflicting design requirements and the high-dimensional design space. In order to address all these challenges, an aerodynamic design optimization method is developed in this study. This method automates the design process by integrating a geometrical parameterization method, a CFD solver and numerical optimization methods that can be applied to both single and multi-point optimization design problems. A multi-level blade parameterization is employed to modify the blade geometry. Numerical analyses are performed by solving 3D RANS equations combined with SST turbulence model. Genetic algorithms and hybrid optimization methods are applied to solve the optimization problem. In order to verify the effectiveness and feasibility of the optimization method, a singlepoint optimization problem aiming to maximize design efficiency is formulated and applied to redesign a test case. However, transonic fan blade design is inherently a multi-faceted problem that deals with several objectives such as efficiency, stall margin, and choke margin. The proposed multi-point optimization method in the current study is formulated as a bi-objective problem to maximize design and near-stall efficiencies while maintaining the required design pressure ratio. Enhancing these objectives significantly deteriorate the choke margin, specifically at high rotational speeds. Therefore, another constraint is embedded in the optimization problem in order to prevent the reduction of choke margin at high speeds. Since capturing stall inception is numerically very expensive, stall margin has not been considered as an objective in the problem statement. However, improving near-stall efficiency results in a better performance at stall condition, which could enhance the stall margin. An investigation is therefore performed on the Pareto-optimal solutions to demonstrate the relation between near-stall efficiency and stall margin. The proposed method is applied to redesign NASA rotor 67 for single and multiple operating conditions. The single-point design optimization showed +0.28 points improvement of isentropic efficiency at design point, while the design pressure ratio and mass flow are, respectively, within 0.12% and 0.11% of the reference blade. Two cases of multi-point optimization are performed: First, the proposed multi-point optimization problem is relaxed by removing the choke margin constraint in order to demonstrate the relation between near-stall efficiency and stall margin. An investigation on the Pareto-optimal solutions of this optimization shows that the stall margin has been increased with improving near-stall efficiency. The second multi-point optimization case is performed with considering all the objectives and constraints. One selected optimized design on the Pareto front presents +0.41, +0.56 and +0.9 points improvement in near-peak efficiency, near-stall efficiency and stall margin, respectively. The design pressure ratio and mass flow are, respectively, within 0.3% and 0.26% of the reference blade. Moreover the optimized design maintains the required choking margin. Detailed aerodynamic analyses are performed to investigate the effect of shape optimization on shock occurrence, secondary flows, tip leakage and shock/tip-leakage interactions in both single and multi-point optimizations.

High Speed Civil Transport Design Using Collaborative Optimization and Approximate Models

NASA Technical Reports Server (NTRS)

Manning, Valerie Michelle

1999-01-01

The design of supersonic aircraft requires complex analysis in multiple disciplines, posing, a challenge for optimization methods. In this thesis, collaborative optimization, a design architecture developed to solve large-scale multidisciplinary design problems, is applied to the design of supersonic transport concepts. Collaborative optimization takes advantage of natural disciplinary segmentation to facilitate parallel execution of design tasks. Discipline-specific design optimization proceeds while a coordinating mechanism ensures progress toward an optimum and compatibility between disciplinary designs. Two concepts for supersonic aircraft are investigated: a conventional delta-wing design and a natural laminar flow concept that achieves improved performance by exploiting properties of supersonic flow to delay boundary layer transition. The work involves the development of aerodynamics and structural analyses, and integration within a collaborative optimization framework. It represents the most extensive application of the method to date.

Optimal design of isotope labeling experiments.

PubMed

Yang, Hong; Mandy, Dominic E; Libourel, Igor G L

2014-01-01

Stable isotope labeling experiments (ILE) constitute a powerful methodology for estimating metabolic fluxes. An optimal label design for such an experiment is necessary to maximize the precision with which fluxes can be determined. But often, precision gained in the determination of one flux comes at the expense of the precision of other fluxes, and an appropriate label design therefore foremost depends on the question the investigator wants to address. One could liken ILE to shadows that metabolism casts on products. Optimal label design is the placement of the lamp; creating clear shadows for some parts of metabolism and obscuring others.An optimal isotope label design is influenced by: (1) the network structure; (2) the true flux values; (3) the available label measurements; and, (4) commercially available substrates. The first two aspects are dictated by nature and constrain any optimal design. The second two aspects are suitable design parameters. To create an optimal label design, an explicit optimization criterion needs to be formulated. This usually is a property of the flux covariance matrix, which can be augmented by weighting label substrate cost. An optimal design is found by using such a criterion as an objective function for an optimizer. This chapter uses a simple elementary metabolite units (EMU) representation of the TCA cycle to illustrate the process of experimental design of isotope labeled substrates.

Automated Design Framework for Synthetic Biology Exploiting Pareto Optimality.

PubMed

Otero-Muras, Irene; Banga, Julio R

2017-07-21

In this work we consider Pareto optimality for automated design in synthetic biology. We present a generalized framework based on a mixed-integer dynamic optimization formulation that, given design specifications, allows the computation of Pareto optimal sets of designs, that is, the set of best trade-offs for the metrics of interest. We show how this framework can be used for (i) forward design, that is, finding the Pareto optimal set of synthetic designs for implementation, and (ii) reverse design, that is, analyzing and inferring motifs and/or design principles of gene regulatory networks from the Pareto set of optimal circuits. Finally, we illustrate the capabilities and performance of this framework considering four case studies. In the first problem we consider the forward design of an oscillator. In the remaining problems, we illustrate how to apply the reverse design approach to find motifs for stripe formation, rapid adaption, and fold-change detection, respectively.

Nuclear Electric Vehicle Optimization Toolset (NEVOT)

NASA Technical Reports Server (NTRS)

Tinker, Michael L.; Steincamp, James W.; Stewart, Eric T.; Patton, Bruce W.; Pannell, William P.; Newby, Ronald L.; Coffman, Mark E.; Kos, Larry D.; Qualls, A. Lou; Greene, Sherrell

2004-01-01

The Nuclear Electric Vehicle Optimization Toolset (NEVOT) optimizes the design of all major nuclear electric propulsion (NEP) vehicle subsystems for a defined mission within constraints and optimization parameters chosen by a user. The tool uses a genetic algorithm (GA) search technique to combine subsystem designs and evaluate the fitness of the integrated design to fulfill a mission. The fitness of an individual is used within the GA to determine its probability of survival through successive generations in which the designs with low fitness are eliminated and replaced with combinations or mutations of designs with higher fitness. The program can find optimal solutions for different sets of fitness metrics without modification and can create and evaluate vehicle designs that might never be considered through traditional design techniques. It is anticipated that the flexible optimization methodology will expand present knowledge of the design trade-offs inherent in designing nuclear powered space vehicles and lead to improved NEP designs.

Design optimization of axial flow hydraulic turbine runner: Part II - multi-objective constrained optimization method

NASA Astrophysics Data System (ADS)

Peng, Guoyi; Cao, Shuliang; Ishizuka, Masaru; Hayama, Shinji

2002-06-01

This paper is concerned with the design optimization of axial flow hydraulic turbine runner blade geometry. In order to obtain a better design plan with good performance, a new comprehensive performance optimization procedure has been presented by combining a multi-variable multi-objective constrained optimization model with a Q3D inverse computation and a performance prediction procedure. With careful analysis of the inverse design of axial hydraulic turbine runner, the total hydraulic loss and the cavitation coefficient are taken as optimization objectives and a comprehensive objective function is defined using the weight factors. Parameters of a newly proposed blade bound circulation distribution function and parameters describing positions of blade leading and training edges in the meridional flow passage are taken as optimization variables.The optimization procedure has been applied to the design optimization of a Kaplan runner with specific speed of 440 kW. Numerical results show that the performance of designed runner is successfully improved through optimization computation. The optimization model is found to be validated and it has the feature of good convergence. With the multi-objective optimization model, it is possible to control the performance of designed runner by adjusting the value of weight factors defining the comprehensive objective function. Copyright

Experimental validation of structural optimization methods

NASA Technical Reports Server (NTRS)

Adelman, Howard M.

1992-01-01

The topic of validating structural optimization methods by use of experimental results is addressed. The need for validating the methods as a way of effecting a greater and an accelerated acceptance of formal optimization methods by practicing engineering designers is described. The range of validation strategies is defined which includes comparison of optimization results with more traditional design approaches, establishing the accuracy of analyses used, and finally experimental validation of the optimization results. Examples of the use of experimental results to validate optimization techniques are described. The examples include experimental validation of the following: optimum design of a trussed beam; combined control-structure design of a cable-supported beam simulating an actively controlled space structure; minimum weight design of a beam with frequency constraints; minimization of the vibration response of helicopter rotor blade; minimum weight design of a turbine blade disk; aeroelastic optimization of an aircraft vertical fin; airfoil shape optimization for drag minimization; optimization of the shape of a hole in a plate for stress minimization; optimization to minimize beam dynamic response; and structural optimization of a low vibration helicopter rotor.

PopED lite: An optimal design software for preclinical pharmacokinetic and pharmacodynamic studies.

PubMed

Aoki, Yasunori; Sundqvist, Monika; Hooker, Andrew C; Gennemark, Peter

2016-04-01

Optimal experimental design approaches are seldom used in preclinical drug discovery. The objective is to develop an optimal design software tool specifically designed for preclinical applications in order to increase the efficiency of drug discovery in vivo studies. Several realistic experimental design case studies were collected and many preclinical experimental teams were consulted to determine the design goal of the software tool. The tool obtains an optimized experimental design by solving a constrained optimization problem, where each experimental design is evaluated using some function of the Fisher Information Matrix. The software was implemented in C++ using the Qt framework to assure a responsive user-software interaction through a rich graphical user interface, and at the same time, achieving the desired computational speed. In addition, a discrete global optimization algorithm was developed and implemented. The software design goals were simplicity, speed and intuition. Based on these design goals, we have developed the publicly available software PopED lite (http://www.bluetree.me/PopED_lite). Optimization computation was on average, over 14 test problems, 30 times faster in PopED lite compared to an already existing optimal design software tool. PopED lite is now used in real drug discovery projects and a few of these case studies are presented in this paper. PopED lite is designed to be simple, fast and intuitive. Simple, to give many users access to basic optimal design calculations. Fast, to fit a short design-execution cycle and allow interactive experimental design (test one design, discuss proposed design, test another design, etc). Intuitive, so that the input to and output from the software tool can easily be understood by users without knowledge of the theory of optimal design. In this way, PopED lite is highly useful in practice and complements existing tools. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Ribozyme-based aminoglycoside switches of gene expression engineered by genetic selection in S. cerevisiae.

PubMed

Klauser, Benedikt; Atanasov, Janina; Siewert, Lena K; Hartig, Jörg S

2015-05-15

Systems for conditional gene expression are powerful tools in basic research as well as in biotechnology. For future applications, it is of great importance to engineer orthogonal genetic switches that function reliably in diverse contexts. RNA-based switches have the advantage that effector molecules interact immediately with regulatory modules inserted into the target RNAs, getting rid of the need of transcription factors usually mediating genetic control. Artificial riboswitches are characterized by their simplicity and small size accompanied by a high degree of modularity. We have recently reported a series of hammerhead ribozyme-based artificial riboswitches that allow for post-transcriptional regulation of gene expression via switching mRNA, tRNA, or rRNA functions. A more widespread application was so far hampered by moderate switching performances and a limited set of effector molecules available. Here, we report the re-engineering of hammerhead ribozymes in order to respond efficiently to aminoglycoside antibiotics. We first established an in vivo selection protocol in Saccharomyces cerevisiae that enabled us to search large sequence spaces for optimized switches. We then envisioned and characterized a novel strategy of attaching the aptamer to the ribozyme catalytic core, increasing the design options for rendering the ribozyme ligand-dependent. These innovations enabled the development of neomycin-dependent RNA modules that switch gene expression up to 25-fold. The presented aminoglycoside-responsive riboswitches belong to the best-performing RNA-based genetic regulators reported so far. The developed in vivo selection protocol should allow for sampling of large sequence spaces for engineering of further optimized riboswitches.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Optimal design of geodesically stiffened composite cylindrical shells

NASA Technical Reports Server (NTRS)

Gendron, G.; Guerdal, Z.

1992-01-01

An optimization system based on the finite element code Computations Structural Mechanics (CSM) Testbed and the optimization program, Automated Design Synthesis (ADS), is described. The optimization system can be used to obtain minimum-weight designs of composite stiffened structures. Ply thickness, ply orientations, and stiffener heights can be used as design variables. Buckling, displacement, and material failure constraints can be imposed on the design. The system is used to conduct a design study of geodesically stiffened shells. For comparison purposes, optimal designs of unstiffened shells and shells stiffened by rings and stingers are also obtained. Trends in the design of geodesically stiffened shells are identified. An approach to include local stress concentrations during the design optimization process is then presented. The method is based on a global/local analysis technique. It employs spline interpolation functions to determine displacements and rotations from a global model which are used as 'boundary conditions' for the local model. The organization of the strategy in the context of an optimization process is described. The method is validated with an example.

Improved alternating gradient transport and focusing of neutral molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kalnins, Juris; Lambertson, Glen; Gould, Harvey

2001-12-02

Polar molecules, in strong-field seeking states, can be transported and focused by an alternating sequence of electric field gradients that focus in one transverse direction while defocusing in the other. We show by calculation and numerical simulation, how one may greatly improve the alternating gradient transport and focusing of molecules. We use a new optimized multipole lens design, a FODO lattice beam transport line, and lenses to match the beam transport line to the beam source and the final focus. We derive analytic expressions for the potentials, fields, and gradients that may be used to design these lenses. We describemore » a simple lens optimization procedure and derive the equations of motion for tracking molecules through a beam transport line. As an example, we model a straight beamline that transports a 560 m/s jet-source beam of methyl fluoride molecules 15 m from its source and focuses it to 2 mm diameter. We calculate the beam transport line acceptance and transmission, for a beam with velocity spread, and estimate the transmitted intensity for specified source conditions. Possible applications are discussed.« less

Metabolic engineering of E. coli top 10 for production of vanillin through FA catabolic pathway and bioprocess optimization using RSM.

PubMed

Chakraborty, Debkumar; Gupta, Gaganjot; Kaur, Baljinder

2016-12-01

Metabolic engineering and construction of recombinant Escherichia coli strains carrying feruloyl-CoA synthetase and enoyl-CoA hydratase genes for the bioconversion of ferulic acid to vanillin offers an alternative way to produce vanillin. Isolation and designing of fcs and ech genes was carried out using computer assisted protocol and the designed vanillin biosynthetic gene cassette was cloned in pCCIBAC expression vector for introduction in E. coli top 10. Recombinant strain was implemented for the statistical optimization of process parameters influencing F A to vanillin biotransformation. CCD matrix constituted of process variables like FA concentration, time, temperature and biomass with intracellular, extracellular and total vanillin productions as responses. Production was scaled up and 68 mg/L of vanillin was recovered from 10 mg/L of FA using cell extracts from 1 mg biomass within 30 min. Kinetic activity of enzymes were characterized. From LCMS-ESI analysis a metabolic pathway of FA degradation and vanillin production was predicted. Copyright © 2016 Elsevier Inc. All rights reserved.

Machine Learning Techniques in Optimal Design

NASA Technical Reports Server (NTRS)

Cerbone, Giuseppe

1992-01-01

Many important applications can be formalized as constrained optimization tasks. For example, we are studying the engineering domain of two-dimensional (2-D) structural design. In this task, the goal is to design a structure of minimum weight that bears a set of loads. A solution to a design problem in which there is a single load (L) and two stationary support points (S1 and S2) consists of four members, E1, E2, E3, and E4 that connect the load to the support points is discussed. In principle, optimal solutions to problems of this kind can be found by numerical optimization techniques. However, in practice [Vanderplaats, 1984] these methods are slow and they can produce different local solutions whose quality (ratio to the global optimum) varies with the choice of starting points. Hence, their applicability to real-world problems is severely restricted. To overcome these limitations, we propose to augment numerical optimization by first performing a symbolic compilation stage to produce: (a) objective functions that are faster to evaluate and that depend less on the choice of the starting point and (b) selection rules that associate problem instances to a set of recommended solutions. These goals are accomplished by successive specializations of the problem class and of the associated objective functions. In the end, this process reduces the problem to a collection of independent functions that are fast to evaluate, that can be differentiated symbolically, and that represent smaller regions of the overall search space. However, the specialization process can produce a large number of sub-problems. This is overcome by deriving inductively selection rules which associate problems to small sets of specialized independent sub-problems. Each set of candidate solutions is chosen to minimize a cost function which expresses the tradeoff between the quality of the solution that can be obtained from the sub-problem and the time it takes to produce it. The overall solution to the problem, is then obtained by solving in parallel each of the sub-problems in the set and computing the one with the minimum cost. In addition to speeding up the optimization process, our use of learning methods also relieves the expert from the burden of identifying rules that exactly pinpoint optimal candidate sub-problems. In real engineering tasks it is usually too costly to the engineers to derive such rules. Therefore, this paper also contributes to a further step towards the solution of the knowledge acquisition bottleneck [Feigenbaum, 1977] which has somewhat impaired the construction of rulebased expert systems.

Collective intelligence for control of distributed dynamical systems

NASA Astrophysics Data System (ADS)

Wolpert, D. H.; Wheeler, K. R.; Tumer, K.

2000-03-01

We consider the El Farol bar problem, also known as the minority game (W. B. Arthur, The American Economic Review, 84 (1994) 406; D. Challet and Y. C. Zhang, Physica A, 256 (1998) 514). We view it as an instance of the general problem of how to configure the nodal elements of a distributed dynamical system so that they do not "work at cross purposes", in that their collective dynamics avoids frustration and thereby achieves a provided global goal. We summarize a mathematical theory for such configuration applicable when (as in the bar problem) the global goal can be expressed as minimizing a global energy function and the nodes can be expressed as minimizers of local free energy functions. We show that a system designed with that theory performs nearly optimally for the bar problem.

Gene Suppression of Mouse Testis In Vivo Using Small Interfering RNA Derived from Plasmid Vectors

PubMed Central

Takizawa, Takami; Ishikawa, Tomoko; Kosuge, Takuji; Mizuguchi, Yoshiaki; Sato, Yoko; Koji, Takehiko; Araki, Yoshihiko; Takizawa, Toshihiro

2012-01-01

We evaluated whether inhibiting gene expression by small interfering RNA (siRNA) can be used for an in vivo model using a germ cell-specific gene (Tex101) as a model target in mouse testis. We generated plasmid-based expression vectors of siRNA targeting the Tex101 gene and transfected them into postnatal day 10 mouse testes by in vivo electroporation. After optimizing the electroporation conditions using a vector transfected into the mouse testis, a combination of high- and low-voltage pulses showed excellent transfection efficiency for the vectors with minimal tissue damage, but gene suppression was transient. Gene suppression by in vivo electroporation may be helpful as an alternative approach when designing experiments to unravel the basic role of testicular molecules. PMID:22489107

RNAi or overexpression: Alternative therapies for Spinocerebellar Ataxia Type 1

PubMed Central

Keiser, Megan S.; Geoghegan, James C.; Boudreau, Ryan L.; Lennox, Kim A.; Davidson, Beverly L.

2014-01-01

Spinocerebellar Ataxia Type 1 (SCA1) is an autosomal dominant late onset neurodegenerative disease caused by an expanded polyglutamine tract in ataxin-1. Here, we compared the protective effects of overexpressing ataxin-1-like using recombinant AAVs, or reducing expression of mutant ataxin-1 using virally delivered RNA interference (RNAi), in a transgenic mouse model of SCA1. For the latter, we used an artificial microRNA (miR) design that optimizes potency, efficacy and safety to suppress ataxin-1 expression (miS1). Delivery of either ataxin-1-like or miS1 viral vectors to SCA1 mice cerebella resulted in widespread cerebellar Purkinje cell transduction and improved behavioral and histological phenotypes. Our data indicate the utility of either approach as a possible therapy for SCA1 patients. PMID:23583610

Analysis and design of a standardized control module for switching regulators

NASA Astrophysics Data System (ADS)

Lee, F. C.; Mahmoud, M. F.; Yu, Y.; Kolecki, J. C.

1982-07-01

Three basic switching regulators: buck, boost, and buck/boost, employing a multiloop standardized control module (SCM) were characterized by a common small signal block diagram. Employing the unified model, regulator performances such as stability, audiosusceptibility, output impedance, and step load transient are analyzed and key performance indexes are expressed in simple analytical forms. More importantly, the performance characteristics of all three regulators are shown to enjoy common properties due to the unique SCM control scheme which nullifies the positive zero and provides adaptive compensation to the moving poles of the boost and buck/boost converters. This allows a simple unified design procedure to be devised for selecting the key SCM control parameters for an arbitrarily given power stage configuration and parameter values, such that all regulator performance specifications can be met and optimized concurrently in a single design attempt.

Flat-plate photovoltaic array design optimization

NASA Technical Reports Server (NTRS)

Ross, R. G., Jr.

1980-01-01

An analysis is presented which integrates the results of specific studies in the areas of photovoltaic structural design optimization, optimization of array series/parallel circuit design, thermal design optimization, and optimization of environmental protection features. The analysis is based on minimizing the total photovoltaic system life-cycle energy cost including repair and replacement of failed cells and modules. This approach is shown to be a useful technique for array optimization, particularly when time-dependent parameters such as array degradation and maintenance are involved.

An Integrated Optimization Design Method Based on Surrogate Modeling Applied to Diverging Duct Design

NASA Astrophysics Data System (ADS)

Hanan, Lu; Qiushi, Li; Shaobin, Li

2016-12-01

This paper presents an integrated optimization design method in which uniform design, response surface methodology and genetic algorithm are used in combination. In detail, uniform design is used to select the experimental sampling points in the experimental domain and the system performance is evaluated by means of computational fluid dynamics to construct a database. After that, response surface methodology is employed to generate a surrogate mathematical model relating the optimization objective and the design variables. Subsequently, genetic algorithm is adopted and applied to the surrogate model to acquire the optimal solution in the case of satisfying some constraints. The method has been applied to the optimization design of an axisymmetric diverging duct, dealing with three design variables including one qualitative variable and two quantitative variables. The method of modeling and optimization design performs well in improving the duct aerodynamic performance and can be also applied to wider fields of mechanical design and seen as a useful tool for engineering designers, by reducing the design time and computation consumption.

The role of the optimization process in illumination design

NASA Astrophysics Data System (ADS)

Gauvin, Michael A.; Jacobsen, David; Byrne, David J.

2015-07-01

This paper examines the role of the optimization process in illumination design. We will discuss why the starting point of the optimization process is crucial to a better design and why it is also important that the user understands the basic design problem and implements the correct merit function. Both a brute force method and the Downhill Simplex method will be used to demonstrate optimization methods with focus on using interactive design tools to create better starting points to streamline the optimization process.

Optimal design of gene knockout experiments for gene regulatory network inference

PubMed Central

Ud-Dean, S. M. Minhaz; Gunawan, Rudiyanto

2016-01-01

Motivation: We addressed the problem of inferring gene regulatory network (GRN) from gene expression data of knockout (KO) experiments. This inference is known to be underdetermined and the GRN is not identifiable from data. Past studies have shown that suboptimal design of experiments (DOE) contributes significantly to the identifiability issue of biological networks, including GRNs. However, optimizing DOE has received much less attention than developing methods for GRN inference. Results: We developed REDuction of UnCertain Edges (REDUCE) algorithm for finding the optimal gene KO experiment for inferring directed graphs (digraphs) of GRNs. REDUCE employed ensemble inference to define uncertain gene interactions that could not be verified by prior data. The optimal experiment corresponds to the maximum number of uncertain interactions that could be verified by the resulting data. For this purpose, we introduced the concept of edge separatoid which gave a list of nodes (genes) that upon their removal would allow the verification of a particular gene interaction. Finally, we proposed a procedure that iterates over performing KO experiments, ensemble update and optimal DOE. The case studies including the inference of Escherichia coli GRN and DREAM 4 100-gene GRNs, demonstrated the efficacy of the iterative GRN inference. In comparison to systematic KOs, REDUCE could provide much higher information return per gene KO experiment and consequently more accurate GRN estimates. Conclusions: REDUCE represents an enabling tool for tackling the underdetermined GRN inference. Along with advances in gene deletion and automation technology, the iterative procedure brings an efficient and fully automated GRN inference closer to reality. Availability and implementation: MATLAB and Python scripts of REDUCE are available on www.cabsel.ethz.ch/tools/REDUCE. Contact: rudi.gunawan@chem.ethz.ch Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26568633

A Robust Design Methodology for Optimal Microscale Secondary Flow Control in Compact Inlet Diffusers

NASA Technical Reports Server (NTRS)

Anderson, Bernhard H.; Keller, Dennis J.

2001-01-01

It is the purpose of this study to develop an economical Robust design methodology for microscale secondary flow control in compact inlet diffusers. To illustrate the potential of economical Robust Design methodology, two different mission strategies were considered for the subject inlet, namely Maximum Performance and Maximum HCF Life Expectancy. The Maximum Performance mission maximized total pressure recovery while the Maximum HCF Life Expectancy mission minimized the mean of the first five Fourier harmonic amplitudes, i.e., 'collectively' reduced all the harmonic 1/2 amplitudes of engine face distortion. Each of the mission strategies was subject to a low engine face distortion constraint, i.e., DC60<0.10, which is a level acceptable for commercial engines. For each of these missions strategies, an 'Optimal Robust' (open loop control) and an 'Optimal Adaptive' (closed loop control) installation was designed over a twenty degree angle-of-incidence range. The Optimal Robust installation used economical Robust Design methodology to arrive at a single design which operated over the entire angle-of-incident range (open loop control). The Optimal Adaptive installation optimized all the design parameters at each angle-of-incidence. Thus, the Optimal Adaptive installation would require a closed loop control system to sense a proper signal for each effector and modify that effector device, whether mechanical or fluidic, for optimal inlet performance. In general, the performance differences between the Optimal Adaptive and Optimal Robust installation designs were found to be marginal. This suggests, however, that Optimal Robust open loop installation designs can be very competitive with Optimal Adaptive close loop designs. Secondary flow control in inlets is inherently robust, provided it is optimally designed. Therefore, the new methodology presented in this paper, combined array 'Lower Order' approach to Robust DOE, offers the aerodynamicist a very viable and economical way of exploring the concept of Robust inlet design, where the mission variables are brought directly into the inlet design process and insensitivity or robustness to the mission variables becomes a design objective.

Design optimization studies using COSMIC NASTRAN

NASA Technical Reports Server (NTRS)

Pitrof, Stephen M.; Bharatram, G.; Venkayya, Vipperla B.

1993-01-01

The purpose of this study is to create, test and document a procedure to integrate mathematical optimization algorithms with COSMIC NASTRAN. This procedure is very important to structural design engineers who wish to capitalize on optimization methods to ensure that their design is optimized for its intended application. The OPTNAST computer program was created to link NASTRAN and design optimization codes into one package. This implementation was tested using two truss structure models and optimizing their designs for minimum weight, subject to multiple loading conditions and displacement and stress constraints. However, the process is generalized so that an engineer could design other types of elements by adding to or modifying some parts of the code.

Optimization in the systems engineering process

NASA Technical Reports Server (NTRS)

Lemmerman, L. A.

1984-01-01

The objective is to look at optimization as it applies to the design process at a large aircraft company. The design process at Lockheed-Georgia is described. Some examples of the impact that optimization has had on that process are given, and then some areas that must be considered if optimization is to be successful and supportive in the total design process are indicated. Optimization must continue to be sold and this selling is best done by consistent good performance. For this good performance to occur, the future approaches must be clearly thought out so that the optimization methods solve the problems that actually occur during design. The visibility of the design process must be maintained as further developments are proposed. Careful attention must be given to the management of data in the optimization process, both for technical reasons and for administrative purposes. Finally, to satisfy program needs, provisions must be included to supply data to support program decisions, and to communicate with design processes outside of the optimization process. If designers fail to adequately consider all of these needs, the future acceptance of optimization will be impeded.

Nutrigenomics and nutrigenetics.

PubMed

Farhud, Dd; Zarif Yeganeh, M; Zarif Yeganeh, M

2010-01-01

The nutrients are able to interact with molecular mechanisms and modulate the physiological functions in the body. The Nutritional Genomics focuses on the interaction between bioactive food components and the genome, which includes Nutrigenetics and Nutrigenomics. The influence of nutrients on f genes expression is called Nutrigenomics, while the heterogeneous response of gene variants to nutrients, dietary components and developing nutraceticals is called Nutrigenetics. Genetic variation is known to affect food tolerances among human subpopulations and may also influence dietary requirements and raising the possibility of individualizing nutritional intake for optimal health and disease prevention on the basis of an individual's genome. Nutrigenomics provides a genetic understanding for how common dietary components affect the balance between health and disease by altering the expression and/or structure of an individual's genetic makeup. Nutrigenetics describes that the genetic profile have impact on the response of body to bioactive food components by influencing their absorption, metabolism, and site of action.In this way, considering different aspects of gene-nutrient interaction and designing appropriate diet for every specific genotype that optimize individual health, diagnosis and nutritional treatment of genome instability, we could prevent and control conversion of healthy phenotype to diseases.

Nutrigenomics and Nutrigenetics

PubMed Central

Farhud, DD; Zarif Yeganeh, M; Zarif Yeganeh, M

2010-01-01

The nutrients are able to interact with molecular mechanisms and modulate the physiological functions in the body. The Nutritional Genomics focuses on the interaction between bioactive food components and the genome, which includes Nutrigenetics and Nutrigenomics. The influence of nutrients on f genes expression is called Nutrigenomics, while the heterogeneous response of gene variants to nutrients, dietary components and developing nutraceticals is called Nutrigenetics. Genetic variation is known to affect food tolerances among human subpopulations and may also influence dietary requirements and raising the possibility of individualizing nutritional intake for optimal health and disease prevention on the basis of an individual’s genome. Nutrigenomics provides a genetic understanding for how common dietary components affect the balance between health and disease by altering the expression and/or structure of an individual’s genetic makeup. Nutrigenetics describes that the genetic profile have impact on the response of body to bioactive food components by influencing their absorption, metabolism, and site of action. In this way, considering different aspects of gene–nutrient interaction and designing appropriate diet for every specific genotype that optimize individual health, diagnosis and nutritional treatment of genome instability, we could prevent and control conversion of healthy phenotype to diseases. PMID:23113033

Elevation of the Yields of Very Long Chain Polyunsaturated Fatty Acids via Minimal Codon Optimization of Two Key Biosynthetic Enzymes

PubMed Central

Zheng, Desong; Sun, Quanxi; Liu, Jiang; Li, Yaxiao; Hua, Jinping

2016-01-01

Eicosapentaenoic acid (EPA, 20:5Δ5,8,11,14,17) and Docosahexaenoic acid (DHA, 22:6Δ4,7,10,13,16,19) are nutritionally beneficial to human health. Transgenic production of EPA and DHA in oilseed crops by transferring genes originating from lower eukaryotes, such as microalgae and fungi, has been attempted in recent years. However, the low yield of EPA and DHA produced in these transgenic crops is a major hurdle for the commercialization of these transgenics. Many factors can negatively affect transgene expression, leading to a low level of converted fatty acid products. Among these the codon bias between the transgene donor and the host crop is one of the major contributing factors. Therefore, we carried out codon optimization of a fatty acid delta-6 desaturase gene PinD6 from the fungus Phytophthora infestans, and a delta-9 elongase gene, IgASE1 from the microalga Isochrysis galbana for expression in Saccharomyces cerevisiae and Arabidopsis respectively. These are the two key genes encoding enzymes for driving the first catalytic steps in the Δ6 desaturation/Δ6 elongation and the Δ9 elongation/Δ8 desaturation pathways for EPA/DHA biosynthesis. Hence expression levels of these two genes are important in determining the final yield of EPA/DHA. Via PCR-based mutagenesis we optimized the least preferred codons within the first 16 codons at their N-termini, as well as the most biased CGC codons (coding for arginine) within the entire sequences of both genes. An expression study showed that transgenic Arabidopsis plants harbouring the codon-optimized IgASE1 contained 64% more elongated fatty acid products than plants expressing the native IgASE1 sequence, whilst Saccharomyces cerevisiae expressing the codon optimized PinD6 yielded 20 times more desaturated products than yeast expressing wild-type (WT) PinD6. Thus the codon optimization strategy we developed here offers a simple, effective and low-cost alternative to whole gene synthesis for high expression of foreign genes in yeast and Arabidopsis. PMID:27433934

Design of clinical trials involving multiple hypothesis tests with a common control.

PubMed

Schou, I Manjula; Marschner, Ian C

2017-07-01

Randomized clinical trials comparing several treatments to a common control are often reported in the medical literature. For example, multiple experimental treatments may be compared with placebo, or in combination therapy trials, a combination therapy may be compared with each of its constituent monotherapies. Such trials are typically designed using a balanced approach in which equal numbers of individuals are randomized to each arm, however, this can result in an inefficient use of resources. We provide a unified framework and new theoretical results for optimal design of such single-control multiple-comparator studies. We consider variance optimal designs based on D-, A-, and E-optimality criteria, using a general model that allows for heteroscedasticity and a range of effect measures that include both continuous and binary outcomes. We demonstrate the sensitivity of these designs to the type of optimality criterion by showing that the optimal allocation ratios are systematically ordered according to the optimality criterion. Given this sensitivity to the optimality criterion, we argue that power optimality is a more suitable approach when designing clinical trials where testing is the objective. Weighted variance optimal designs are also discussed, which, like power optimal designs, allow the treatment difference to play a major role in determining allocation ratios. We illustrate our methods using two real clinical trial examples taken from the medical literature. Some recommendations on the use of optimal designs in single-control multiple-comparator trials are also provided. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Analytical design of an industrial two-term controller for optimal regulatory control of open-loop unstable processes under operational constraints.

PubMed

Tchamna, Rodrigue; Lee, Moonyong

2018-01-01

This paper proposes a novel optimization-based approach for the design of an industrial two-term proportional-integral (PI) controller for the optimal regulatory control of unstable processes subjected to three common operational constraints related to the process variable, manipulated variable and its rate of change. To derive analytical design relations, the constrained optimal control problem in the time domain was transformed into an unconstrained optimization problem in a new parameter space via an effective parameterization. The resulting optimal PI controller has been verified to yield optimal performance and stability of an open-loop unstable first-order process under operational constraints. The proposed analytical design method explicitly takes into account the operational constraints in the controller design stage and also provides useful insights into the optimal controller design. Practical procedures for designing optimal PI parameters and a feasible constraint set exclusive of complex optimization steps are also proposed. The proposed controller was compared with several other PI controllers to illustrate its performance. The robustness of the proposed controller against plant-model mismatch has also been investigated. Copyright © 2018 ISA. Published by Elsevier Ltd. All rights reserved.

Topology optimization based design of unilateral NMR for generating a remote homogeneous field.

PubMed

Wang, Qi; Gao, Renjing; Liu, Shutian

2017-06-01

This paper presents a topology optimization based design method for the design of unilateral nuclear magnetic resonance (NMR), with which a remote homogeneous field can be obtained. The topology optimization is actualized by seeking out the optimal layout of ferromagnetic materials within a given design domain. The design objective is defined as generating a sensitive magnetic field with optimal homogeneity and maximal field strength within a required region of interest (ROI). The sensitivity of the objective function with respect to the design variables is derived and the method for solving the optimization problem is presented. A design example is provided to illustrate the utility of the design method, specifically the ability to improve the quality of the magnetic field over the required ROI by determining the optimal structural topology for the ferromagnetic poles. Both in simulations and experiments, the sensitive region of the magnetic field achieves about 2 times larger than that of the reference design, validating validates the feasibility of the design method. Copyright © 2017. Published by Elsevier Inc.

Numerical simulation of dynamics of brushless dc motors for aerospace and other applications. Volume 1: Model development and applications, part A

NASA Technical Reports Server (NTRS)

Demerdash, N. A. O.; Nehl, T. W.

1979-01-01

The development, fabrication and evaluation of a prototype electromechanical actuator (EMA) is discussed. Application of the EMA as a motor for control surfaces in aerospace flight is examined. A mathematical model of the EMA is developed for design optimization. Nonlinearities which complicate the mathematical model are discussed. The dynamics of the EMA from the underlying physical principles are determined and a discussion of similating the control logic by means of equivalent boolean expressions is presented.

Dynamics of a Two-Link Vehicle in an L-Shaped Corridor Revisited

NASA Astrophysics Data System (ADS)

Antonyuk, E. Ya.; Zabuga, A. T.

2014-03-01

The kinematics of a two-link mobile robot with three steerable wheels moving in an L-shaped corridor is analyzed. A smooth (with continuous first derivative) path is designed maintaining the optimal maneuverability of the vehicle. The motion of the vehicle along this path is planned. Analytical expressions for the reactions at the contact of the wheels with the ground are given in the general case of motion. The radius of curvature of the programmed path is shown to have a strong influence on the reactions.

Control of linear uncertain systems utilizing mismatched state observers

NASA Technical Reports Server (NTRS)

Goldstein, B.

1972-01-01

The control of linear continuous dynamical systems is investigated as a problem of limited state feedback control. The equations which describe the structure of an observer are developed constrained to time-invarient systems. The optimal control problem is formulated, accounting for the uncertainty in the design parameters. Expressions for bounds on closed loop stability are also developed. The results indicate that very little uncertainty may be tolerated before divergence occurs in the recursive computation algorithms, and the derived stability bound yields extremely conservative estimates of regions of allowable parameter variations.

Optimal Designs for the Rasch Model

ERIC Educational Resources Information Center

Grasshoff, Ulrike; Holling, Heinz; Schwabe, Rainer

2012-01-01

In this paper, optimal designs will be derived for estimating the ability parameters of the Rasch model when difficulty parameters are known. It is well established that a design is locally D-optimal if the ability and difficulty coincide. But locally optimal designs require that the ability parameters to be estimated are known. To attenuate this…

Optimal flexible sample size design with robust power.

PubMed

Zhang, Lanju; Cui, Lu; Yang, Bo

2016-08-30

It is well recognized that sample size determination is challenging because of the uncertainty on the treatment effect size. Several remedies are available in the literature. Group sequential designs start with a sample size based on a conservative (smaller) effect size and allow early stop at interim looks. Sample size re-estimation designs start with a sample size based on an optimistic (larger) effect size and allow sample size increase if the observed effect size is smaller than planned. Different opinions favoring one type over the other exist. We propose an optimal approach using an appropriate optimality criterion to select the best design among all the candidate designs. Our results show that (1) for the same type of designs, for example, group sequential designs, there is room for significant improvement through our optimization approach; (2) optimal promising zone designs appear to have no advantages over optimal group sequential designs; and (3) optimal designs with sample size re-estimation deliver the best adaptive performance. We conclude that to deal with the challenge of sample size determination due to effect size uncertainty, an optimal approach can help to select the best design that provides most robust power across the effect size range of interest. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Nuclear Electric Vehicle Optimization Toolset (NEVOT): Integrated System Design Using Genetic Algorithms

NASA Technical Reports Server (NTRS)

Tinker, Michael L.; Steincamp, James W.; Stewart, Eric T.; Patton, Bruce W.; Pannell, William P.; Newby, Ronald L.; Coffman, Mark E.; Qualls, A. L.; Bancroft, S.; Molvik, Greg

2003-01-01

The Nuclear Electric Vehicle Optimization Toolset (NEVOT) optimizes the design of all major Nuclear Electric Propulsion (NEP) vehicle subsystems for a defined mission within constraints and optimization parameters chosen by a user. The tool uses a Genetic Algorithm (GA) search technique to combine subsystem designs and evaluate the fitness of the integrated design to fulfill a mission. The fitness of an individual is used within the GA to determine its probability of survival through successive generations in which the designs with low fitness are eliminated and replaced with combinations or mutations of designs with higher fitness. The program can find optimal solutions for different sets of fitness metrics without modification and can create and evaluate vehicle designs that might never be conceived of through traditional design techniques. It is anticipated that the flexible optimization methodology will expand present knowledge of the design trade-offs inherent in designing nuclear powered space vehicles and lead to improved NEP designs.

Design of siRNA Therapeutics from the Molecular Scale

PubMed Central

Angart, Phillip; Vocelle, Daniel; Chan, Christina; Walton, S. Patrick

2013-01-01

While protein-based therapeutics is well-established in the market, development of nucleic acid therapeutics has lagged. Short interfering RNAs (siRNAs) represent an exciting new direction for the pharmaceutical industry. These small, chemically synthesized RNAs can knock down the expression of target genes through the use of a native eukaryotic pathway called RNA interference (RNAi). Though siRNAs are routinely used in research studies of eukaryotic biological processes, transitioning the technology to the clinic has proven challenging. Early efforts to design an siRNA therapeutic have demonstrated the difficulties in generating a highly-active siRNA with good specificity and a delivery vehicle that can protect the siRNA as it is transported to a specific tissue. In this review article, we discuss design considerations for siRNA therapeutics, identifying criteria for choosing therapeutic targets, producing highly-active siRNA sequences, and designing an optimized delivery vehicle. Taken together, these design considerations provide logical guidelines for generating novel siRNA therapeutics. PMID:23976875

A Stream lined Approach for the Payload Customer in Identifying Payload Design Requirements

NASA Technical Reports Server (NTRS)

Miller, Ladonna J.; Schneider, Walter F.; Johnson, Dexer E.; Roe, Lesa B.

2001-01-01

NASA payload developers from across various disciplines were asked to identify areas where process changes would simplify their task of developing and flying flight hardware. Responses to this query included a central location for consistent hardware design requirements for middeck payloads. The multidisciplinary team assigned to review the numerous payload interface design documents is assessing the Space Shuttle middeck, the SPACEHAB Inc. locker, as well as the MultiPurpose Logistics Module (MPLM) and EXpedite the PRocessing of Experiments to Space Station (EXPRESS) rack design requirements for the payloads. They are comparing the multiple carriers and platform requirements and developing a matrix which illustrates the individual requirements, and where possible, the envelope that encompasses all of the possibilities. The matrix will be expanded to form an overall envelope that the payload developers will have the option to utilize when designing their payload's hardware. This will optimize the flexibility for payload hardware and ancillary items to be manifested on multiple carriers and platforms with minimal impact to the payload developer.

Small, synthetic, GC-rich mRNA stem-loop modules 5' proximal to the AUG start-codon predictably tune gene expression in yeast.

PubMed

Lamping, Erwin; Niimi, Masakazu; Cannon, Richard D

2013-07-29

A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5' UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5' UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = -15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (∆G = -4.4 kcal/mol) inhibited Cdr1p expression by ~50%. We have developed a simple cloning strategy to fine-tune protein expression levels in yeast that has many potential applications in metabolic engineering and the optimization of protein expression in yeast. This study also highlights the importance of considering the use of multiple cloning-sites carefully to preclude unwanted effects on gene expression.

Small, synthetic, GC-rich mRNA stem-loop modules 5′ proximal to the AUG start-codon predictably tune gene expression in yeast

PubMed Central

2013-01-01

Background A large range of genetic tools has been developed for the optimal design and regulation of complex metabolic pathways in bacteria. However, fewer tools exist in yeast that can precisely tune the expression of individual enzymes in novel metabolic pathways suitable for industrial-scale production of non-natural compounds. Tuning expression levels is critical for reducing the metabolic burden of over-expressed proteins, the accumulation of toxic intermediates, and for redirecting metabolic flux from native pathways involving essential enzymes without negatively affecting the viability of the host. We have developed a yeast membrane protein hyper-expression system with critical advantages over conventional, plasmid-based, expression systems. However, expression levels are sometimes so high that they adversely affect protein targeting/folding or the growth and/or phenotype of the host. Here we describe the use of small synthetic mRNA control modules that allowed us to predictably tune protein expression levels to any desired level. Down-regulation of expression was achieved by engineering small GC-rich mRNA stem-loops into the 5′ UTR that inhibited translation initiation of the yeast ribosomal 43S preinitiation complex (PIC). Results Exploiting the fact that the yeast 43S PIC has great difficulty scanning through GC-rich mRNA stem-loops, we created yeast strains containing 17 different RNA stem-loop modules in the 5′ UTR that expressed varying amounts of the fungal multidrug efflux pump reporter Cdr1p from Candida albicans. Increasing the length of mRNA stem-loops (that contained only GC-pairs) near the AUG start-codon led to a surprisingly large decrease in Cdr1p expression; ~2.7-fold for every additional GC-pair added to the stem, while the mRNA levels remained largely unaffected. An mRNA stem-loop of seven GC-pairs (∆G = −15.8 kcal/mol) reduced Cdr1p expression levels by >99%, and even the smallest possible stem-loop of only three GC-pairs (∆G = −4.4 kcal/mol) inhibited Cdr1p expression by ~50%. Conclusion We have developed a simple cloning strategy to fine-tune protein expression levels in yeast that has many potential applications in metabolic engineering and the optimization of protein expression in yeast. This study also highlights the importance of considering the use of multiple cloning-sites carefully to preclude unwanted effects on gene expression. PMID:23895661

Post-translational intracellular trafficking determines the type of immune response elicited by DNA vaccines expressing Gag antigen of Human Immunodeficiency Virus Type 1 (HIV-1).

PubMed

Wallace, Aaron; West, Kim; Rothman, Alan L; Ennis, Francis A; Lu, Shan; Wang, Shixia

2013-10-01

In the current study, immune responses induced by Gag DNA vaccines with different designs were evaluated in Balb/C mice. The results demonstrated that the DNA vaccine with the full length wild type gag gene (Wt-Gag) mainly produced Gag antigens intracellularly and induced a higher level of cell-mediated immune (CMI) responses, as measured by IFN-gamma ELISPOT, intracellular cytokine staining (ICS), and cytotoxic T lymphocytes (CTL) assays against a dominant CD8(+) T cell epitope (AMQMLKETI). In contrast, the addition of a tissue plasminogen activator (tPA) leader sequence significantly improved overall Gag protein expression/secretion and Gag-specific antibody responses; however, Gag-specific CMI responses were decreased. The mutation of zinc-finger motif changed Gag protein expression patterns and reduced the ability to generate both CMI and antibody responses against Gag. These findings indicate that the structure and post-translational processing of antigens expressed by DNA vaccines play a critical role in eliciting optimal antibody or CMI responses.

Energy solutions in rural Africa: mapping electrification costs of distributed solar and diesel generation versus grid extension

NASA Astrophysics Data System (ADS)

Szabó, S.; Bódis, K.; Huld, T.; Moner-Girona, M.

2011-07-01

Three rural electrification options are analysed showing the cost optimal conditions for a sustainable energy development applying renewable energy sources in Africa. A spatial electricity cost model has been designed to point out whether diesel generators, photovoltaic systems or extension of the grid are the least-cost option in off-grid areas. The resulting mapping application offers support to decide in which regions the communities could be electrified either within the grid or in an isolated mini-grid. Donor programs and National Rural Electrification Agencies (or equivalent governmental departments) could use this type of delineation for their program boundaries and then could use the local optimization tools adapted to the prevailing parameters. The views expressed in this paper are those of the authors and do not necessarily represent European Commission and UNEP policy.

Cluster Size Optimization in Sensor Networks with Decentralized Cluster-Based Protocols

PubMed Central

Amini, Navid; Vahdatpour, Alireza; Xu, Wenyao; Gerla, Mario; Sarrafzadeh, Majid

2011-01-01

Network lifetime and energy-efficiency are viewed as the dominating considerations in designing cluster-based communication protocols for wireless sensor networks. This paper analytically provides the optimal cluster size that minimizes the total energy expenditure in such networks, where all sensors communicate data through their elected cluster heads to the base station in a decentralized fashion. LEACH, LEACH-Coverage, and DBS comprise three cluster-based protocols investigated in this paper that do not require any centralized support from a certain node. The analytical outcomes are given in the form of closed-form expressions for various widely-used network configurations. Extensive simulations on different networks are used to confirm the expectations based on the analytical results. To obtain a thorough understanding of the results, cluster number variability problem is identified and inspected from the energy consumption point of view. PMID:22267882

A stochastic model for optimizing composite predictors based on gene expression profiles.

PubMed

Ramanathan, Murali

2003-07-01

This project was done to develop a mathematical model for optimizing composite predictors based on gene expression profiles from DNA arrays and proteomics. The problem was amenable to a formulation and solution analogous to the portfolio optimization problem in mathematical finance: it requires the optimization of a quadratic function subject to linear constraints. The performance of the approach was compared to that of neighborhood analysis using a data set containing cDNA array-derived gene expression profiles from 14 multiple sclerosis patients receiving intramuscular inteferon-beta1a. The Markowitz portfolio model predicts that the covariance between genes can be exploited to construct an efficient composite. The model predicts that a composite is not needed for maximizing the mean value of a treatment effect: only a single gene is needed, but the usefulness of the effect measure may be compromised by high variability. The model optimized the composite to yield the highest mean for a given level of variability or the least variability for a given mean level. The choices that meet this optimization criteria lie on a curve of composite mean vs. composite variability plot referred to as the "efficient frontier." When a composite is constructed using the model, it outperforms the composite constructed using the neighborhood analysis method. The Markowitz portfolio model may find potential applications in constructing composite biomarkers and in the pharmacogenomic modeling of treatment effects derived from gene expression endpoints.

Using Aerospace Technology To Design Orthopedic Implants

NASA Technical Reports Server (NTRS)

Saravanos, D. A.; Mraz, P. J.; Davy, D. T.

1996-01-01

Technology originally developed to optimize designs of composite-material aerospace structural components used to develop method for optimizing designs of orthopedic implants. Development effort focused on designing knee implants, long-term goal to develop method for optimizing designs of orthopedic implants in general.

Decentralized control of large-scale systems: Fixed modes, sensitivity and parametric robustness. Ph.D. Thesis - Universite Paul Sabatier, 1985

NASA Technical Reports Server (NTRS)

Tarras, A.

1987-01-01

The problem of stabilization/pole placement under structural constraints of large scale linear systems is discussed. The existence of a solution to this problem is expressed in terms of fixed modes. The aim is to provide a bibliographic survey of the available results concerning the fixed modes (characterization, elimination, control structure selection to avoid them, control design in their absence) and to present the author's contribution to this problem which can be summarized by the use of the mode sensitivity concept to detect or to avoid them, the use of vibrational control to stabilize them, and the addition of parametric robustness considerations to design an optimal decentralized robust control.

Designing microarray and RNA-Seq experiments for greater systems biology discovery in modern plant genomics.

PubMed

Yang, Chuanping; Wei, Hairong

2015-02-01

Microarray and RNA-seq experiments have become an important part of modern genomics and systems biology. Obtaining meaningful biological data from these experiments is an arduous task that demands close attention to many details. Negligence at any step can lead to gene expression data containing inadequate or composite information that is recalcitrant for pattern extraction. Therefore, it is imperative to carefully consider experimental design before launching a time-consuming and costly experiment. Contemporarily, most genomics experiments have two objectives: (1) to generate two or more groups of comparable data for identifying differentially expressed genes, gene families, biological processes, or metabolic pathways under experimental conditions; (2) to build local gene regulatory networks and identify hierarchically important regulators governing biological processes and pathways of interest. Since the first objective aims to identify the active molecular identities and the second provides a basis for understanding the underlying molecular mechanisms through inferring causality relationships mediated by treatment, an optimal experiment is to produce biologically relevant and extractable data to meet both objectives without substantially increasing the cost. This review discusses the major issues that researchers commonly face when embarking on microarray or RNA-seq experiments and summarizes important aspects of experimental design, which aim to help researchers deliberate how to generate gene expression profiles with low background noise but with more interaction to facilitate novel biological discoveries in modern plant genomics. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.

Chemical stress sensitive luminescent human cells: Molecular biology approach using inducible Drosophila melanogaster hsp22 promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mandon, C.A.; Diaz, C.; Arrigo, A.-P.

2005-09-23

A whole-cell bioassay has been developed for the total toxicity testing of liquid samples. The method is based on the induction of the bioluminescent activity of genetically manipulated mammalian cells. For that purpose, transfection was used to introduce, in HeLa cells, a DNA sensing element that responds to chemical stress agents (heavy metals, genotoxic agents, and endocrine-disrupting chemicals). Such element was designed to direct the expression of a reporting gene (firefly luciferase) through the activation of Drosophila melanogaster hsp22 promoter. A molecular approach was conducted to optimize hsp22 promoter element in order to decrease the background expression level of themore » reporting gene and to increase the sensitivity of the bioassay for testing endocrine disruptors. As a result, in the presence of 20-100 {mu}M cadmium chloride, a 6-fold increase in luciferase expression was obtained using a specially designed truncated hsp22 promoter construction. The following chemicals known to be found in the polluted samples were tested: CdCl{sub 2}, Cd(NO{sub 3}){sub 2}, NaAsO{sub 2}, alachlore, fentine acetate, thiram, and maneb. The stressing effect of each of them was sensitively detected by the present bioassay in the 0.05-50 {mu}M concentration range.« less

An ant colony optimization based algorithm for identifying gene regulatory elements.

PubMed

Liu, Wei; Chen, Hanwu; Chen, Ling

2013-08-01

It is one of the most important tasks in bioinformatics to identify the regulatory elements in gene sequences. Most of the existing algorithms for identifying regulatory elements are inclined to converge into a local optimum, and have high time complexity. Ant Colony Optimization (ACO) is a meta-heuristic method based on swarm intelligence and is derived from a model inspired by the collective foraging behavior of real ants. Taking advantage of the ACO in traits such as self-organization and robustness, this paper designs and implements an ACO based algorithm named ACRI (ant-colony-regulatory-identification) for identifying all possible binding sites of transcription factor from the upstream of co-expressed genes. To accelerate the ants' searching process, a strategy of local optimization is presented to adjust the ants' start positions on the searched sequences. By exploiting the powerful optimization ability of ACO, the algorithm ACRI can not only improve precision of the results, but also achieve a very high speed. Experimental results on real world datasets show that ACRI can outperform other traditional algorithms in the respects of speed and quality of solutions. Copyright © 2013 Elsevier Ltd. All rights reserved.

Optimization design of wind turbine drive train based on Matlab genetic algorithm toolbox

NASA Astrophysics Data System (ADS)

Li, R. N.; Liu, X.; Liu, S. J.

2013-12-01

In order to ensure the high efficiency of the whole flexible drive train of the front-end speed adjusting wind turbine, the working principle of the main part of the drive train is analyzed. As critical parameters, rotating speed ratios of three planetary gear trains are selected as the research subject. The mathematical model of the torque converter speed ratio is established based on these three critical variable quantity, and the effect of key parameters on the efficiency of hydraulic mechanical transmission is analyzed. Based on the torque balance and the energy balance, refer to hydraulic mechanical transmission characteristics, the transmission efficiency expression of the whole drive train is established. The fitness function and constraint functions are established respectively based on the drive train transmission efficiency and the torque converter rotating speed ratio range. And the optimization calculation is carried out by using MATLAB genetic algorithm toolbox. The optimization method and results provide an optimization program for exact match of wind turbine rotor, gearbox, hydraulic mechanical transmission, hydraulic torque converter and synchronous generator, ensure that the drive train work with a high efficiency, and give a reference for the selection of the torque converter and hydraulic mechanical transmission.

Construction of recombinant Mip-FlaA dominant epitope vaccine against Legionella pneumophila and evaluation of the immunogenicity and protective immunity.

PubMed

He, Jinlei; Zhang, Junrong; He, Yanxia; Huang, Fan; Li, Jiao; Chen, Qiwei; Chen, Dali; Chen, Jianping

2016-02-01

Legionnaires' disease, a kind of systemic disease with pneumonia as the main manifestation, is caused by Legionella pneumophila (L. pneumophila). In order to prevent the disease, we optimized Mip and FlaA, the virulence factors of L. pneumophila, to design recombinant Mip-FlaA dominant epitope vaccine against the pathogen. Firstly, the coding sequences of mip and flaA were optimized by DNAStar software and Expasy protein analysis system, and then, the tertiary structure and function of recombinant Mip-FlaA were predicted by PHYRE2 Protein Fold Recognition Server. After that, the optimized mip, flaA and mip-flaA were cloned, expressed and purified, and the proteins were used as dominant epitope vaccines to immunize BABL/c mice. Moreover, the IgG titers, histological changes in lung and the level of TNF-α, IFN-γ, IL-6 and IL-1β were detected to reflect the immunogenicity and protective immunity of the vaccines. The results of SDS-PAGE and Western blot proved the recombinant Mip-FlaA was successfully expressed. ELISA results of IgG titers and these cytokines showed Mip-FlaA group was capable to induce the strongest immune response, compared to PBS, Mip and FlaA groups. In addition, histopathology analysis demonstrated the mice immunized with Mip-FlaA showed better immune protection. Therefore, the work indicated that the above-described biological tools were useful in optimization of epitope vaccine. Antigenic characterization and immune protection of recombinant Mip-FlaA would be of great value in understanding the immunopathogenesis of the disease and in developing possible vaccine against the pathogen.

Optimization of conditions for transient Agrobacterium-mediated gene expression assays in Arabidopsis.

PubMed

Kim, Mi Jung; Baek, Kon; Park, Chung-Mo

2009-08-01

Transient genetic transformation of plant organs is an indispensable way of studying gene function in plants. This study was aimed to develop an optimized system for transient Agrobacterium-mediated transformation of the Arabidopsis leaves. The beta-glucuronidase (GUS) reporter gene was employed to evaluate growth and biochemical parameters that influence the levels of transient expression. The effects of plant culture conditions, Agrobacterial genetic backgrounds, densities of Agrobacterial cell suspensions, and of several detergents were analyzed. We found that optimization of plant culture conditions is the most critical factor among the parameters analyzed. Higher levels of transient expression were observed in plants grown under short day conditions (SDs) than in plants grown under long day conditions (LDs). Furthermore, incubation of the plants under SDs at high relative humidity (85-90%) for 24 h after infiltration greatly improved the levels of transient expression. Under the optimized culture conditions, expression of the reporter gene reached the peak 3 days after infiltration and was rapidly decreased after the peak. Among the five Agrobacterial strains examined, LAB4404 produced the highest levels of expression. We also examined the effects of detergents, including Triton X-100, Tween-20, and Silwet L-77. Supplementation of the infiltration media either with 0.01% Triton X-100 or 0.01% Tween-20 improved the levels of expression by approximately 1.6-fold. Our observations indicate that transient transformation of the Arabidopsis leaves in the infiltration media supplemented with 0.01% Triton X-100 and incubation of the infiltrated plants under SDs at high relative humidity are necessary for maximal levels of expression.

Conceptual design optimization study

NASA Technical Reports Server (NTRS)

Hollowell, S. J.; Beeman, E. R., II; Hiyama, R. M.

1990-01-01

The feasibility of applying multilevel functional decomposition and optimization techniques to conceptual design of advanced fighter aircraft was investigated. Applying the functional decomposition techniques to the conceptual design phase appears to be feasible. The initial implementation of the modified design process will optimize wing design variables. A hybrid approach, combining functional decomposition techniques for generation of aerodynamic and mass properties linear sensitivity derivatives with existing techniques for sizing mission performance and optimization, is proposed.

An approach to the design of wide-angle optical systems with special illumination and IFOV requirements

NASA Astrophysics Data System (ADS)

Pravdivtsev, Andrey V.

2012-06-01

The article presents the approach to the design wide-angle optical systems with special illumination and instantaneous field of view (IFOV) requirements. The unevenness of illumination reduces the dynamic range of the system, which negatively influence on the system ability to perform their task. The result illumination on the detector depends among other factors from the IFOV changes. It is also necessary to consider IFOV in the synthesis of data processing algorithms, as it directly affects to the potential "signal/background" ratio for the case of statistically homogeneous backgrounds. A numerical-analytical approach that simplifies the design of wideangle optical systems with special illumination and IFOV requirements is presented. The solution can be used for optical systems which field of view greater than 180 degrees. Illumination calculation in optical CAD is based on computationally expensive tracing of large number of rays. The author proposes to use analytical expression for some characteristics which illumination depends on. The rest characteristic are determined numerically in calculation with less computationally expensive operands, the calculation performs not every optimization step. The results of analytical calculation inserts in the merit function of optical CAD optimizer. As a result we reduce the optimizer load, since using less computationally expensive operands. It allows reducing time and resources required to develop a system with the desired characteristics. The proposed approach simplifies the creation and understanding of the requirements for the quality of the optical system, reduces the time and resources required to develop an optical system, and allows creating more efficient EOS.

Fusion expression of the PGLa-AM1 with native structure and evaluation of its anti-Helicobacter pylori activity.

PubMed

Zhang, Xiaolin; Jiang, Anmin; Wang, Guisheng; Yu, Hao; Qi, Banghua; Xiong, Youyi; Zhou, Guoliang; Qin, Meisong; Dou, Jinfeng; Wang, Jianfei

2017-07-01

Helicobacter pylori (H. pylori) shows increasingly enhanced resistance to various antibiotics, and its eradication has become a major problem in medicine. The antimicrobial peptide PGLa-AM1 is a short peptide with 22 amino acids and exhibits strong antibacterial activity. In this study, we investigated whether it has anti-H. pylori activity for the further development of anti-H. pylori drugs to replace existing antibiotics. However, the natural antimicrobial peptide PGLa-AM1 shows a low yield and is difficult to separate, limiting its application. A good strategy to solve this problem is to express the antimicrobial peptide PGLa-AM1 using gene engineering at a high level and low cost. For getting PGLa-AM1 with native structure, in this study, a specific protease cleavage site of tobacco etch virus (TEV) was designed before the PGLa-AM1 peptide. For convenience to purify and identify high-efficiency expression PGLa-AM1, the PGLa-AM1 gene was fused with the polyhedrin gene of Bombyx mori (B. mori), and a 6 × His tag was designed to insert before the amino terminus of the fusion protein. The fusion antibacterial peptide PGLa-AM1 (FAMP) gene codon was optimized, and the gene was synthesized and cloned into the Escherichia coli (E. coli) pET-30a (+) expression vector. The results showed that the FAMP was successfully expressed in E. coli. Its molecular weight was approximately 34 kDa, and its expression level was approximately 30 mg/L. After the FAMP was purified, it was further digested with TEV protease. The acquired recombinant antimicrobial peptide PGLa-AM1 exerted strong anti-H. pylori activity and therapeutic effect in vitro and in vivo.

Localization and distribution of neurons that co-express xeroderma pigmentosum-A and epidermal growth factor receptor within Rosenthal's canal.

PubMed

Guthrie, O'neil W

2015-10-01

Xeroderma pigmentosum-A (XPA) is a C4-type zinc-finger scaffolding protein that regulates the removal of bulky-helix distorting DNA damage products from the genome. Phosphorylation of serine residues within the XPA protein is associated with improved protection of genomic DNA and cell death resistance. Therefore, kinase signaling is one important mechanism for regulating the protective function of XPA. Previous experiments have shown that spiral ganglion neurons (SGNs) may mobilize XPA as a general stress response to chemical and physical ototoxicants. Therapeutic optimization of XPA via kinase signaling could serve as a means to improve DNA repair capacity within neurons following injury. The kinase signaling activity of the epidermal growth factor receptor (EGFR) has been shown in tumor cell lines to increase the repair of DNA damage products that are primarily repaired by XPA. Such observations suggest that EGFR may regulate the protective function of XPA. However, it is not known whether SGNs in particular or neurons in general could co-express XPA and EGFR. In the current study gene and protein expression of XPA and EGFR were determined from cochlear homogenates. Immunofluorescence assays were then employed to localize neurons expressing both EGFR and XPA within the ganglion. This work was then confirmed with double-immunohistochemistry. Rosenthal's canal served as the reference space in these experiments and design-based stereology was employed in first-order stereology quantification of immunoreactive neurons. The results confirmed that a population of SGNs that constitutively express XPA may also express the EGFR. These results provide the basis for future experiments designed to therapeutically manipulate the EGFR in order to regulate XPA activity and restore gene function in neurons following DNA damage. Copyright © 2015 Elsevier GmbH. All rights reserved.

A unified, multifidelity quasi-newton optimization method with application to aero-structural designa

NASA Astrophysics Data System (ADS)

Bryson, Dean Edward

A model's level of fidelity may be defined as its accuracy in faithfully reproducing a quantity or behavior of interest of a real system. Increasing the fidelity of a model often goes hand in hand with increasing its cost in terms of time, money, or computing resources. The traditional aircraft design process relies upon low-fidelity models for expedience and resource savings. However, the reduced accuracy and reliability of low-fidelity tools often lead to the discovery of design defects or inadequacies late in the design process. These deficiencies result either in costly changes or the acceptance of a configuration that does not meet expectations. The unknown opportunity cost is the discovery of superior vehicles that leverage phenomena unknown to the designer and not illuminated by low-fidelity tools. Multifidelity methods attempt to blend the increased accuracy and reliability of high-fidelity models with the reduced cost of low-fidelity models. In building surrogate models, where mathematical expressions are used to cheaply approximate the behavior of costly data, low-fidelity models may be sampled extensively to resolve the underlying trend, while high-fidelity data are reserved to correct inaccuracies at key locations. Similarly, in design optimization a low-fidelity model may be queried many times in the search for new, better designs, with a high-fidelity model being exercised only once per iteration to evaluate the candidate design. In this dissertation, a new multifidelity, gradient-based optimization algorithm is proposed. It differs from the standard trust region approach in several ways, stemming from the new method maintaining an approximation of the inverse Hessian, that is the underlying curvature of the design problem. Whereas the typical trust region approach performs a full sub-optimization using the low-fidelity model at every iteration, the new technique finds a suitable descent direction and focuses the search along it, reducing the number of low-fidelity evaluations required. This narrowing of the search domain also alleviates the burden on the surrogate model corrections between the low- and high-fidelity data. Rather than requiring the surrogate to be accurate in a hyper-volume bounded by the trust region, the model needs only to be accurate along the forward-looking search direction. Maintaining the approximate inverse Hessian also allows the multifidelity algorithm to revert to high-fidelity optimization at any time. In contrast, the standard approach has no memory of the previously-computed high-fidelity data. The primary disadvantage of the proposed algorithm is that it may require modifications to the optimization software, whereas standard optimizers may be used as black-box drivers in the typical trust region method. A multifidelity, multidisciplinary simulation of aeroelastic vehicle performance is developed to demonstrate the optimization method. The numerical physics models include body-fitted Euler computational fluid dynamics; linear, panel aerodynamics; linear, finite-element computational structural mechanics; and reduced, modal structural bases. A central element of the multifidelity, multidisciplinary framework is a shared parametric, attributed geometric representation that ensures the analysis inputs are consistent between disciplines and fidelities. The attributed geometry also enables the transfer of data between disciplines. The new optimization algorithm, a standard trust region approach, and a single-fidelity quasi-Newton method are compared for a series of analytic test functions, using both polynomial chaos expansions and kriging to correct discrepancies between fidelity levels of data. In the aggregate, the new method requires fewer high-fidelity evaluations than the trust region approach in 51% of cases, and the same number of evaluations in 18%. The new approach also requires fewer low-fidelity evaluations, by up to an order of magnitude, in almost all cases. The efficacy of both multifidelity methods compared to single-fidelity optimization depends significantly on the behavior of the high-fidelity model and the quality of the low-fidelity approximation, though savings are realized in a large number of cases. The multifidelity algorithm is also compared to the single-fidelity quasi-Newton method for complex aeroelastic simulations. The vehicle design problem includes variables for planform shape, structural sizing, and cruise condition with constraints on trim and structural stresses. Considering the objective function reduction versus computational expenditure, the multifidelity process performs better in three of four cases in early iterations. However, the enforcement of a contracting trust region slows the multifidelity progress. Even so, leveraging the approximate inverse Hessian, the optimization can be seamlessly continued using high-fidelity data alone. Ultimately, the proposed new algorithm produced better designs in all four cases. Investigating the return on investment in terms of design improvement per computational hour confirms that the multifidelity advantage is greatest in early iterations, and managing the transition to high-fidelity optimization is critical.

Aerodynamic Design Using Neural Networks

NASA Technical Reports Server (NTRS)

Rai, Man Mohan; Madavan, Nateri K.

2003-01-01

The design of aerodynamic components of aircraft, such as wings or engines, involves a process of obtaining the most optimal component shape that can deliver the desired level of component performance, subject to various constraints, e.g., total weight or cost, that the component must satisfy. Aerodynamic design can thus be formulated as an optimization problem that involves the minimization of an objective function subject to constraints. A new aerodynamic design optimization procedure based on neural networks and response surface methodology (RSM) incorporates the advantages of both traditional RSM and neural networks. The procedure uses a strategy, denoted parameter-based partitioning of the design space, to construct a sequence of response surfaces based on both neural networks and polynomial fits to traverse the design space in search of the optimal solution. Some desirable characteristics of the new design optimization procedure include the ability to handle a variety of design objectives, easily impose constraints, and incorporate design guidelines and rules of thumb. It provides an infrastructure for variable fidelity analysis and reduces the cost of computation by using less-expensive, lower fidelity simulations in the early stages of the design evolution. The initial or starting design can be far from optimal. The procedure is easy and economical to use in large-dimensional design space and can be used to perform design tradeoff studies rapidly. Designs involving multiple disciplines can also be optimized. Some practical applications of the design procedure that have demonstrated some of its capabilities include the inverse design of an optimal turbine airfoil starting from a generic shape and the redesign of transonic turbines to improve their unsteady aerodynamic characteristics.

Optimal design of structures for earthquake loads by a hybrid RBF-BPSO method

NASA Astrophysics Data System (ADS)

Salajegheh, Eysa; Gholizadeh, Saeed; Khatibinia, Mohsen

2008-03-01

The optimal seismic design of structures requires that time history analyses (THA) be carried out repeatedly. This makes the optimal design process inefficient, in particular, if an evolutionary algorithm is used. To reduce the overall time required for structural optimization, two artificial intelligence strategies are employed. In the first strategy, radial basis function (RBF) neural networks are used to predict the time history responses of structures in the optimization flow. In the second strategy, a binary particle swarm optimization (BPSO) is used to find the optimum design. Combining the RBF and BPSO, a hybrid RBF-BPSO optimization method is proposed in this paper, which achieves fast optimization with high computational performance. Two examples are presented and compared to determine the optimal weight of structures under earthquake loadings using both exact and approximate analyses. The numerical results demonstrate the computational advantages and effectiveness of the proposed hybrid RBF-BPSO optimization method for the seismic design of structures.

Design and Optimization of Composite Gyroscope Momentum Wheel Rings

NASA Technical Reports Server (NTRS)

Bednarcyk, Brett A.; Arnold, Steven M.

2007-01-01

Stress analysis and preliminary design/optimization procedures are presented for gyroscope momentum wheel rings composed of metallic, metal matrix composite, and polymer matrix composite materials. The design of these components involves simultaneously minimizing both true part volume and mass, while maximizing angular momentum. The stress analysis results are combined with an anisotropic failure criterion to formulate a new sizing procedure that provides considerable insight into the design of gyroscope momentum wheel ring components. Results compare the performance of two optimized metallic designs, an optimized SiC/Ti composite design, and an optimized graphite/epoxy composite design. The graphite/epoxy design appears to be far superior to the competitors considered unless a much greater premium is placed on volume efficiency compared to mass efficiency.

The Efficiency of Split Panel Designs in an Analysis of Variance Model

PubMed Central

Wang, Wei-Guo; Liu, Hai-Jun

2016-01-01

We consider split panel design efficiency in analysis of variance models, that is, the determination of the cross-sections series optimal proportion in all samples, to minimize parametric best linear unbiased estimators of linear combination variances. An orthogonal matrix is constructed to obtain manageable expression of variances. On this basis, we derive a theorem for analyzing split panel design efficiency irrespective of interest and budget parameters. Additionally, relative estimator efficiency based on the split panel to an estimator based on a pure panel or a pure cross-section is present. The analysis shows that the gains from split panel can be quite substantial. We further consider the efficiency of split panel design, given a budget, and transform it to a constrained nonlinear integer programming. Specifically, an efficient algorithm is designed to solve the constrained nonlinear integer programming. Moreover, we combine one at time designs and factorial designs to illustrate the algorithm’s efficiency with an empirical example concerning monthly consumer expenditure on food in 1985, in the Netherlands, and the efficient ranges of the algorithm parameters are given to ensure a good solution. PMID:27163447

Multidisciplinary design optimization using genetic algorithms

NASA Technical Reports Server (NTRS)

Unal, Resit

1994-01-01

Multidisciplinary design optimization (MDO) is an important step in the conceptual design and evaluation of launch vehicles since it can have a significant impact on performance and life cycle cost. The objective is to search the system design space to determine values of design variables that optimize the performance characteristic subject to system constraints. Gradient-based optimization routines have been used extensively for aerospace design optimization. However, one limitation of gradient based optimizers is their need for gradient information. Therefore, design problems which include discrete variables can not be studied. Such problems are common in launch vehicle design. For example, the number of engines and material choices must be integer values or assume only a few discrete values. In this study, genetic algorithms are investigated as an approach to MDO problems involving discrete variables and discontinuous domains. Optimization by genetic algorithms (GA) uses a search procedure which is fundamentally different from those gradient based methods. Genetic algorithms seek to find good solutions in an efficient and timely manner rather than finding the best solution. GA are designed to mimic evolutionary selection. A population of candidate designs is evaluated at each iteration, and each individual's probability of reproduction (existence in the next generation) depends on its fitness value (related to the value of the objective function). Progress toward the optimum is achieved by the crossover and mutation operations. GA is attractive since it uses only objective function values in the search process, so gradient calculations are avoided. Hence, GA are able to deal with discrete variables. Studies report success in the use of GA for aircraft design optimization studies, trajectory analysis, space structure design and control systems design. In these studies reliable convergence was achieved, but the number of function evaluations was large compared with efficient gradient methods. Applicaiton of GA is underway for a cost optimization study for a launch-vehicle fuel-tank and structural design of a wing. The strengths and limitations of GA for launch vehicle design optimization is studied.

Cationic microbubbles and antibiotic-free miniplasmid for sustained ultrasound-mediated transgene expression in liver.

PubMed

Manta, Simona; Renault, Gilles; Delalande, Anthony; Couture, Olivier; Lagoutte, Isabelle; Seguin, Johanne; Lager, Franck; Houzé, Pascal; Midoux, Patrick; Bessodes, Michel; Scherman, Daniel; Bureau, Michel-Francis; Marie, Corinne; Pichon, Chantal; Mignet, Nathalie

2017-09-28

Despite the increasing number of clinical trials in gene therapy, no ideal methods still allow non-viral gene transfer in deep tissues such as the liver. We were interested in ultrasound (US)-mediated gene delivery to provide long term liver expression. For this purpose, new positively charged microbubbles were designed and complexed with pFAR4, a highly efficient small length miniplasmid DNA devoid of antibiotic resistance sequence. Sonoporation parameters, such as insonation time, acoustic pressure and duration of plasmid injection were controlled under ultrasound imaging guidance. The optimization of these various parameters was performed by bioluminescence optical imaging of luciferase reporter gene expression in the liver. Mice were injected with 50μg pFAR4-LUC either alone, or complexed with positively charged microbubbles, or co-injected with neutral MicroMarker™ microbubbles, followed by low ultrasound energy application to the liver. Injection of the pFAR4 encoding luciferase alone led to a transient transgene expression that lasted only for two days. The significant luciferase signal obtained with neutral microbubbles decreased over 2days and reached a plateau with a level around 1 log above the signal obtained with pFAR4 alone. With the newly designed positively charged microbubbles, we obtained a much stronger bioluminescence signal which increased over 2days. The 12-fold difference (p<0.05) between MicroMarker™ and our positively charged microbubbles was maintained over a period of 6months. Noteworthy, the positively charged microbubbles led to an improvement of 180-fold (p<0.001) as regard to free pDNA using unfocused ultrasound performed at clinically tolerated ultrasound amplitude. Transient liver damage was observed when using the cationic microbubble-pFAR4 complexes and the optimized sonoporation parameters. Immunohistochemistry analyses were performed to determine the nature of cells transfected. The pFAR4 miniplasmid complexed with cationic microbubbles allowed to transfect mostly hepatocytes compared to its co-injection with MicroMarker™ which transfected more preferentially endothelial cells. Copyright © 2017 Elsevier B.V. All rights reserved.

Post-Optimality Analysis In Aerospace Vehicle Design

NASA Technical Reports Server (NTRS)

Braun, Robert D.; Kroo, Ilan M.; Gage, Peter J.

1993-01-01

This analysis pertains to the applicability of optimal sensitivity information to aerospace vehicle design. An optimal sensitivity (or post-optimality) analysis refers to computations performed once the initial optimization problem is solved. These computations may be used to characterize the design space about the present solution and infer changes in this solution as a result of constraint or parameter variations, without reoptimizing the entire system. The present analysis demonstrates that post-optimality information generated through first-order computations can be used to accurately predict the effect of constraint and parameter perturbations on the optimal solution. This assessment is based on the solution of an aircraft design problem in which the post-optimality estimates are shown to be within a few percent of the true solution over the practical range of constraint and parameter variations. Through solution of a reusable, single-stage-to-orbit, launch vehicle design problem, this optimal sensitivity information is also shown to improve the efficiency of the design process, For a hierarchically decomposed problem, this computational efficiency is realized by estimating the main-problem objective gradient through optimal sep&ivity calculations, By reducing the need for finite differentiation of a re-optimized subproblem, a significant decrease in the number of objective function evaluations required to reach the optimal solution is obtained.

An information driven strategy to support multidisciplinary design

NASA Technical Reports Server (NTRS)

Rangan, Ravi M.; Fulton, Robert E.

1990-01-01

The design of complex engineering systems such as aircraft, automobiles, and computers is primarily a cooperative multidisciplinary design process involving interactions between several design agents. The common thread underlying this multidisciplinary design activity is the information exchange between the various groups and disciplines. The integrating component in such environments is the common data and the dependencies that exist between such data. This may be contrasted to classical multidisciplinary analyses problems where there is coupling between distinct design parameters. For example, they may be expressed as mathematically coupled relationships between aerodynamic and structural interactions in aircraft structures, between thermal and structural interactions in nuclear plants, and between control considerations and structural interactions in flexible robots. These relationships provide analytical based frameworks leading to optimization problem formulations. However, in multidisciplinary design problems, information based interactions become more critical. Many times, the relationships between different design parameters are not amenable to analytical characterization. Under such circumstances, information based interactions will provide the best integration paradigm, i.e., there is a need to model the data entities and their dependencies between design parameters originating from different design agents. The modeling of such data interactions and dependencies forms the basis for integrating the various design agents.

A Matrix-Free Algorithm for Multidisciplinary Design Optimization

NASA Astrophysics Data System (ADS)

Lambe, Andrew Borean

Multidisciplinary design optimization (MDO) is an approach to engineering design that exploits the coupling between components or knowledge disciplines in a complex system to improve the final product. In aircraft design, MDO methods can be used to simultaneously design the outer shape of the aircraft and the internal structure, taking into account the complex interaction between the aerodynamic forces and the structural flexibility. Efficient strategies are needed to solve such design optimization problems and guarantee convergence to an optimal design. This work begins with a comprehensive review of MDO problem formulations and solution algorithms. First, a fundamental MDO problem formulation is defined from which other formulations may be obtained through simple transformations. Using these fundamental problem formulations, decomposition methods from the literature are reviewed and classified. All MDO methods are presented in a unified mathematical notation to facilitate greater understanding. In addition, a novel set of diagrams, called extended design structure matrices, are used to simultaneously visualize both data communication and process flow between the many software components of each method. For aerostructural design optimization, modern decomposition-based MDO methods cannot efficiently handle the tight coupling between the aerodynamic and structural states. This fact motivates the exploration of methods that can reduce the computational cost. A particular structure in the direct and adjoint methods for gradient computation motivates the idea of a matrix-free optimization method. A simple matrix-free optimizer is developed based on the augmented Lagrangian algorithm. This new matrix-free optimizer is tested on two structural optimization problems and one aerostructural optimization problem. The results indicate that the matrix-free optimizer is able to efficiently solve structural and multidisciplinary design problems with thousands of variables and constraints. On the aerostructural test problem formulated with thousands of constraints, the matrix-free optimizer is estimated to reduce the total computational time by up to 90% compared to conventional optimizers.

A Matrix-Free Algorithm for Multidisciplinary Design Optimization

NASA Astrophysics Data System (ADS)

Lambe, Andrew Borean

Multidisciplinary design optimization (MDO) is an approach to engineering design that exploits the coupling between components or knowledge disciplines in a complex system to improve the final product. In aircraft design, MDO methods can be used to simultaneously design the outer shape of the aircraft and the internal structure, taking into account the complex interaction between the aerodynamic forces and the structural flexibility. Efficient strategies are needed to solve such design optimization problems and guarantee convergence to an optimal design. This work begins with a comprehensive review of MDO problem formulations and solution algorithms. First, a fundamental MDO problem formulation is defined from which other formulations may be obtained through simple transformations. Using these fundamental problem formulations, decomposition methods from the literature are reviewed and classified. All MDO methods are presented in a unified mathematical notation to facilitate greater understanding. In addition, a novel set of diagrams, called extended design structure matrices, are used to simultaneously visualize both data communication and process flow between the many software components of each method. For aerostructural design optimization, modern decomposition-based MDO methods cannot efficiently handle the tight coupling between the aerodynamic and structural states. This fact motivates the exploration of methods that can reduce the computational cost. A particular structure in the direct and adjoint methods for gradient computation. motivates the idea of a matrix-free optimization method. A simple matrix-free optimizer is developed based on the augmented Lagrangian algorithm. This new matrix-free optimizer is tested on two structural optimization problems and one aerostructural optimization problem. The results indicate that the matrix-free optimizer is able to efficiently solve structural and multidisciplinary design problems with thousands of variables and constraints. On the aerostructural test problem formulated with thousands of constraints, the matrix-free optimizer is estimated to reduce the total computational time by up to 90% compared to conventional optimizers.

Robust input design for nonlinear dynamic modeling of AUV.

PubMed

Nouri, Nowrouz Mohammad; Valadi, Mehrdad

2017-09-01

Input design has a dominant role in developing the dynamic model of autonomous underwater vehicles (AUVs) through system identification. Optimal input design is the process of generating informative inputs that can be used to generate the good quality dynamic model of AUVs. In a problem with optimal input design, the desired input signal depends on the unknown system which is intended to be identified. In this paper, the input design approach which is robust to uncertainties in model parameters is used. The Bayesian robust design strategy is applied to design input signals for dynamic modeling of AUVs. The employed approach can design multiple inputs and apply constraints on an AUV system's inputs and outputs. Particle swarm optimization (PSO) is employed to solve the constraint robust optimization problem. The presented algorithm is used for designing the input signals for an AUV, and the estimate obtained by robust input design is compared with that of the optimal input design. According to the results, proposed input design can satisfy both robustness of constraints and optimality. Copyright © 2017 ISA. Published by Elsevier Ltd. All rights reserved.

Multidisciplinary Optimization Approach for Design and Operation of Constrained and Complex-shaped Space Systems

NASA Astrophysics Data System (ADS)

Lee, Dae Young

The design of a small satellite is challenging since they are constrained by mass, volume, and power. To mitigate these constraint effects, designers adopt deployable configurations on the spacecraft that result in an interesting and difficult optimization problem. The resulting optimization problem is challenging due to the computational complexity caused by the large number of design variables and the model complexity created by the deployables. Adding to these complexities, there is a lack of integration of the design optimization systems into operational optimization, and the utility maximization of spacecraft in orbit. The developed methodology enables satellite Multidisciplinary Design Optimization (MDO) that is extendable to on-orbit operation. Optimization of on-orbit operations is possible with MDO since the model predictive controller developed in this dissertation guarantees the achievement of the on-ground design behavior in orbit. To enable the design optimization of highly constrained and complex-shaped space systems, the spherical coordinate analysis technique, called the "Attitude Sphere", is extended and merged with an additional engineering tools like OpenGL. OpenGL's graphic acceleration facilitates the accurate estimation of the shadow-degraded photovoltaic cell area. This technique is applied to the design optimization of the satellite Electric Power System (EPS) and the design result shows that the amount of photovoltaic power generation can be increased more than 9%. Based on this initial methodology, the goal of this effort is extended from Single Discipline Optimization to Multidisciplinary Optimization, which includes the design and also operation of the EPS, Attitude Determination and Control System (ADCS), and communication system. The geometry optimization satisfies the conditions of the ground development phase; however, the operation optimization may not be as successful as expected in orbit due to disturbances. To address this issue, for the ADCS operations, controllers based on Model Predictive Control that are effective for constraint handling were developed and implemented. All the suggested design and operation methodologies are applied to a mission "CADRE", which is space weather mission scheduled for operation in 2016. This application demonstrates the usefulness and capability of the methodology to enhance CADRE's capabilities, and its ability to be applied to a variety of missions.

Engineering low-temperature expression systems for heterologous production of cold-adapted enzymes.

PubMed

Bjerga, Gro Elin Kjæreng; Lale, Rahmi; Williamson, Adele Kim

2016-01-01

Production of psychrophilic enzymes in the commonly used mesophilic expression systems is hampered by low intrinsic stability of the recombinant enzymes at the optimal host growth temperatures. Unless strategies for low-temperature expression are advanced, research on psychrophilic enzymes may end up being biased toward those that can be stably produced in commonly used mesophilic host systems. Two main strategies are currently being explored for the development of low-temperature expression in bacterial hosts: (i) low-temperature adaption of existing mesophilic expression systems, and (ii) development of new psychrophilic hosts. These developments include genetic engineering of the expression cassettes to optimize the promoter/operator systems that regulate heterologous expression. In this addendum we present our efforts in the development of such low-temperature expression systems, and speculate about future advancements in the field and potential applications.

A Modified Particle Swarm Optimization Technique for Finding Optimal Designs for Mixture Models

PubMed Central

Wong, Weng Kee; Chen, Ray-Bing; Huang, Chien-Chih; Wang, Weichung

2015-01-01

Particle Swarm Optimization (PSO) is a meta-heuristic algorithm that has been shown to be successful in solving a wide variety of real and complicated optimization problems in engineering and computer science. This paper introduces a projection based PSO technique, named ProjPSO, to efficiently find different types of optimal designs, or nearly optimal designs, for mixture models with and without constraints on the components, and also for related models, like the log contrast models. We also compare the modified PSO performance with Fedorov's algorithm, a popular algorithm used to generate optimal designs, Cocktail algorithm, and the recent algorithm proposed by [1]. PMID:26091237

Improved Prefusion Stability, Optimized Codon Usage, and Augmented Virion Packaging Enhance the Immunogenicity of Respiratory Syncytial Virus Fusion Protein in a Vectored-Vaccine Candidate

PubMed Central

Liang, Bo; Ngwuta, Joan O.; Surman, Sonja; Kabatova, Barbora; Liu, Xiang; Lingemann, Matthias; Liu, Xueqiao; Yang, Lijuan; Herbert, Richard; Swerczek, Joanna; Chen, Man; Moin, Syed M.; Kumar, Azad; McLellan, Jason S.; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.

2017-01-01

ABSTRACT Respiratory syncytial virus (RSV) is the most important viral agent of severe pediatric respiratory tract disease worldwide, but it lacks a licensed vaccine or suitable antiviral drug. A live attenuated chimeric bovine/human parainfluenza virus type 3 (rB/HPIV3) was developed previously as a vector expressing RSV fusion (F) protein to confer bivalent protection against RSV and HPIV3. In a previous clinical trial in virus-naive children, rB/HPIV3 was well tolerated but the immunogenicity of wild-type RSV F was unsatisfactory. We previously modified RSV F with a designed disulfide bond (DS) to increase stability in the prefusion (pre-F) conformation and to be efficiently packaged in the vector virion. Here, we further stabilized pre-F by adding both disulfide and cavity-filling mutations (DS-Cav1), and we also modified RSV F codon usage to have a lower CpG content and a higher level of expression. This RSV F open reading frame was evaluated in rB/HPIV3 in three forms: (i) pre-F without vector-packaging signal, (ii) pre-F with vector-packaging signal, and (iii) secreted pre-F ectodomain trimer. Despite being efficiently expressed, the secreted pre-F was poorly immunogenic. DS-Cav1 stabilized pre-F, with or without packaging, induced higher titers of pre-F specific antibodies in hamsters, and improved the quality of RSV-neutralizing serum antibodies. Codon-optimized RSV F containing fewer CpG dinucleotides had higher F expression, replicated more efficiently in vivo, and was more immunogenic. The combination of DS-Cav1 pre-F stabilization, optimized codon usage, reduced CpG content, and vector packaging significantly improved vector immunogenicity and protective efficacy against RSV. This provides an improved vectored RSV vaccine candidate suitable for pediatric clinical evaluation. IMPORTANCE RSV and HPIV3 are the first and second leading viral causes of severe pediatric respiratory disease worldwide. Licensed vaccines or suitable antiviral drugs are not available. We are developing a chimeric rB/HPIV3 vector expressing RSV F as a bivalent RSV/HPIV3 vaccine and have been evaluating means to increase RSV F immunogenicity. In this study, we evaluated the effects of improved stabilization of F in the pre-F conformation and of codon optimization resulting in reduced CpG content and greater pre-F expression. Reduced CpG content dampened the interferon response to infection, promoting higher replication and increased F expression. We demonstrate that improved pre-F stabilization and strategic manipulation of codon usage, together with efficient pre-F packaging into vector virions, significantly increased F immunogenicity in the bivalent RSV/HPIV3 vaccine. The improved immunogenicity included induction of increased titers of high-quality complement-independent antibodies with greater pre-F site Ø binding and greater protection against RSV challenge. PMID:28539444

Dynamic optimization of metabolic networks coupled with gene expression.

PubMed

Waldherr, Steffen; Oyarzún, Diego A; Bockmayr, Alexander

2015-01-21

The regulation of metabolic activity by tuning enzyme expression levels is crucial to sustain cellular growth in changing environments. Metabolic networks are often studied at steady state using constraint-based models and optimization techniques. However, metabolic adaptations driven by changes in gene expression cannot be analyzed by steady state models, as these do not account for temporal changes in biomass composition. Here we present a dynamic optimization framework that integrates the metabolic network with the dynamics of biomass production and composition. An approximation by a timescale separation leads to a coupled model of quasi-steady state constraints on the metabolic reactions, and differential equations for the substrate concentrations and biomass composition. We propose a dynamic optimization approach to determine reaction fluxes for this model, explicitly taking into account enzyme production costs and enzymatic capacity. In contrast to the established dynamic flux balance analysis, our approach allows predicting dynamic changes in both the metabolic fluxes and the biomass composition during metabolic adaptations. Discretization of the optimization problems leads to a linear program that can be efficiently solved. We applied our algorithm in two case studies: a minimal nutrient uptake network, and an abstraction of core metabolic processes in bacteria. In the minimal model, we show that the optimized uptake rates reproduce the empirical Monod growth for bacterial cultures. For the network of core metabolic processes, the dynamic optimization algorithm predicted commonly observed metabolic adaptations, such as a diauxic switch with a preference ranking for different nutrients, re-utilization of waste products after depletion of the original substrate, and metabolic adaptation to an impending nutrient depletion. These examples illustrate how dynamic adaptations of enzyme expression can be predicted solely from an optimization principle. Copyright © 2014 Elsevier Ltd. All rights reserved.

Protein expression of preferred human codon-optimized Gaussia luciferase genes with an artificial open-reading frame in mammalian and bacterial cells.

PubMed

Inouye, Satoshi; Suzuki, Takahiro

2016-12-01

The protein expressions of three preferred human codon-optimized Gaussia luciferase genes (pGLuc, EpGLuc, and KpGLuc) were characterized in mammalian and bacterial cells by comparing them with those of wild-type Gaussia luciferase gene (wGLuc) and human codon-optimized Gaussia luciferase gene (hGLuc). Two synthetic genes of EpGLuc and KpGLuc containing the complete preferred human codons have an artificial open-reading frame; however, they had the similar protein expression levels to those of pGLuc and hGLuc in mammalian cells. In bacterial cells, the protein expressions of pGLuc, EpGLuc, and KpGLuc with approximately 65% GC content were the same and showed approximately 60% activities of wGLuc and hGLuc. The artificial open-reading frame in EpGLuc and KpGLuc did not affect the protein expression in mammalian and bacterial cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Optimization of the production and purification processes of carnobacteriocins Cbn BM1 and Cbn B2 from Carnobacterium maltaromaticum CP5 by heterologous expression in Escherichia coli.

PubMed

Jasniewski, Jordane; Cailliez-Grimal, Catherine; Gelhaye, Eric; Revol-Junelles, Anne-Marie

2008-04-01

An optimization of the production and purification processes of carnobacteriocins Cbn BM1 and Cbn B2 from Carnobacterium maltaromaticum CP5, by heterologous expression in Escherichia coli is described. The genes encoding mature bacteriocin were cloned into an E. coli expression system and expressed as a fusion protein with a thermostable thioredoxin. Recombinant E. coli were cultivated following a fed-batch fermentation process with pH, temperature and oxygenation regulation. The overexpression of the fusion proteins was improved by replacing IPTG by lactose. The fusion proteins were purified by thermal coagulation followed by affinity chromatography. The thioredoxin fusion protein was removed by using CNBr instead of enterokinase and the carnobacteriocins were recovered by reverse-phase chromatography. These optimizations led us to produce up to 320 mg of pure protein per liter of culture, which is four to ten fold higher than what is described for other heterologous expression systems.

The use of optimization techniques to design controlled diffusion compressor blading

NASA Technical Reports Server (NTRS)

Sanger, N. L.

1982-01-01

A method for automating compressor blade design using numerical optimization, and applied to the design of a controlled diffusion stator blade row is presented. A general purpose optimization procedure is employed, based on conjugate directions for locally unconstrained problems and on feasible directions for locally constrained problems. Coupled to the optimizer is an analysis package consisting of three analysis programs which calculate blade geometry, inviscid flow, and blade surface boundary layers. The optimizing concepts and selection of design objective and constraints are described. The procedure for automating the design of a two dimensional blade section is discussed, and design results are presented.

The effect of Fisher information matrix approximation methods in population optimal design calculations.

PubMed

Strömberg, Eric A; Nyberg, Joakim; Hooker, Andrew C

2016-12-01

With the increasing popularity of optimal design in drug development it is important to understand how the approximations and implementations of the Fisher information matrix (FIM) affect the resulting optimal designs. The aim of this work was to investigate the impact on design performance when using two common approximations to the population model and the full or block-diagonal FIM implementations for optimization of sampling points. Sampling schedules for two example experiments based on population models were optimized using the FO and FOCE approximations and the full and block-diagonal FIM implementations. The number of support points was compared between the designs for each example experiment. The performance of these designs based on simulation/estimations was investigated by computing bias of the parameters as well as through the use of an empirical D-criterion confidence interval. Simulations were performed when the design was computed with the true parameter values as well as with misspecified parameter values. The FOCE approximation and the Full FIM implementation yielded designs with more support points and less clustering of sample points than designs optimized with the FO approximation and the block-diagonal implementation. The D-criterion confidence intervals showed no performance differences between the full and block diagonal FIM optimal designs when assuming true parameter values. However, the FO approximated block-reduced FIM designs had higher bias than the other designs. When assuming parameter misspecification in the design evaluation, the FO Full FIM optimal design was superior to the FO block-diagonal FIM design in both of the examples.

Optimization applications in aircraft engine design and test

NASA Technical Reports Server (NTRS)

Pratt, T. K.

1984-01-01

Starting with the NASA-sponsored STAEBL program, optimization methods based primarily upon the versatile program COPES/CONMIN were introduced over the past few years to a broad spectrum of engineering problems in structural optimization, engine design, engine test, and more recently, manufacturing processes. By automating design and testing processes, many repetitive and costly trade-off studies have been replaced by optimization procedures. Rather than taking engineers and designers out of the loop, optimization has, in fact, put them more in control by providing sophisticated search techniques. The ultimate decision whether to accept or reject an optimal feasible design still rests with the analyst. Feedback obtained from this decision process has been invaluable since it can be incorporated into the optimization procedure to make it more intelligent. On several occasions, optimization procedures have produced novel designs, such as the nonsymmetric placement of rotor case stiffener rings, not anticipated by engineering designers. In another case, a particularly difficult resonance contraint could not be satisfied using hand iterations for a compressor blade, when the STAEBL program was applied to the problem, a feasible solution was obtained in just two iterations.

Fine-tuning gene networks using simple sequence repeats

PubMed Central

Egbert, Robert G.; Klavins, Eric

2012-01-01

The parameters in a complex synthetic gene network must be extensively tuned before the network functions as designed. Here, we introduce a simple and general approach to rapidly tune gene networks in Escherichia coli using hypermutable simple sequence repeats embedded in the spacer region of the ribosome binding site. By varying repeat length, we generated expression libraries that incrementally and predictably sample gene expression levels over a 1,000-fold range. We demonstrate the utility of the approach by creating a bistable switch library that programmatically samples the expression space to balance the two states of the switch, and we illustrate the need for tuning by showing that the switch’s behavior is sensitive to host context. Further, we show that mutation rates of the repeats are controllable in vivo for stability or for targeted mutagenesis—suggesting a new approach to optimizing gene networks via directed evolution. This tuning methodology should accelerate the process of engineering functionally complex gene networks. PMID:22927382

Guidelines for the successful generation of protein–ligand complex crystals

PubMed Central

Müller, Ilka

2017-01-01

With continuous technical improvements at synchrotron facilities, data-collection rates have increased dramatically. This makes it possible to collect diffraction data for hundreds of protein–ligand complexes within a day, provided that a suitable crystal system is at hand. However, developing a suitable crystal system can prove challenging, exceeding the timescale of data collection by several orders of magnitude. Firstly, a useful crystallization construct of the protein of interest needs to be chosen and its expression and purification optimized, before screening for suitable crystallization and soaking conditions can start. This article reviews recent publications analysing large data sets of crystallization trials, with the aim of identifying factors that do or do not make a good crystallization construct, and gives guidance in the design of an expression construct. It provides an overview of common protein-expression systems, addresses how ligand binding can be both help and hindrance for protein purification, and describes ligand co-crystallization and soaking, with an emphasis on troubleshooting. PMID:28177304

On the Probabilistic Deployment of Smart Grid Networks in TV White Space.

PubMed

Cacciapuoti, Angela Sara; Caleffi, Marcello; Paura, Luigi

2016-05-10

To accommodate the rapidly increasing demand for wireless broadband communications in Smart Grid (SG) networks, research efforts are currently ongoing to enable the SG networks to utilize the TV spectrum according to the Cognitive Radio paradigm. To this aim, in this letter, we develop an analytical framework for the optimal deployment of multiple closely-located SG Neighborhood Area Networks (NANs) concurrently using the same TV spectrum. The objective is to derive the optimal values for both the number of NANs and their coverage. More specifically, regarding the number of NANs, we derive the optimal closed-form expression, i.e., the closed-form expression that assures the deployment of the maximum number of NANs in the considered region satisfying a given collision constraint on the transmissions of the NANs. Regarding the NAN coverage, we derive the optimal closed-form expression, i.e., the closed-form expression of the NAN transmission range that assures the maximum coverage of each NAN in the considered region satisfying the given collision constraint. All the theoretical results are derived by adopting a stochastic approach. Finally, numerical results validate the theoretical analysis.

Knowledge-based system for detailed blade design of turbines

NASA Astrophysics Data System (ADS)

Goel, Sanjay; Lamson, Scott

1994-03-01

A design optimization methodology that couples optimization techniques to CFD analysis for design of airfoils is presented. This technique optimizes 2D airfoil sections of a blade by minimizing the deviation of the actual Mach number distribution on the blade surface from a smooth fit of the distribution. The airfoil is not reverse engineered by specification of a precise distribution of the desired Mach number plot, only general desired characteristics of the distribution are specified for the design. Since the Mach number distribution is very complex, and cannot be conveniently represented by a single polynomial, it is partitioned into segments, each of which is characterized by a different order polynomial. The sum of the deviation of all the segments is minimized during optimization. To make intelligent changes to the airfoil geometry, it needs to be associated with features observed in the Mach number distribution. Associating the geometry parameters with independent features of the distribution is a fairly complex task. Also, for different optimization techniques to work efficiently the airfoil geometry needs to be parameterized into independent parameters, with enough degrees of freedom for adequate geometry manipulation. A high-pressure, low reaction steam turbine blade section was optimized using this methodology. The Mach number distribution was partitioned into pressure and suction surfaces and the suction surface distribution was further subdivided into leading edge, mid section and trailing edge sections. Two different airfoil representation schemes were used for defining the design variables of the optimization problem. The optimization was performed by using a combination of heuristic search and numerical optimization. The optimization results for the two schemes are discussed in the paper. The results are also compared to a manual design improvement study conducted independently by an experienced airfoil designer. The turbine blade optimization system (TBOS) is developed using the described methodology of coupling knowledge engineering with multiple search techniques for blade shape optimization. TBOS removes a major bottleneck in the design cycle by performing multiple design optimizations in parallel, and improves design quality at the same time. TBOS not only improves the design but also the designers' quality of work by taking the mundane repetitive task of design iterations away and leaving them more time for innovative design.

Semirational Approach for Ultrahigh Poly(3-hydroxybutyrate) Accumulation in Escherichia coli by Combining One-Step Library Construction and High-Throughput Screening.

PubMed

Li, Teng; Ye, Jianwen; Shen, Rui; Zong, Yeqing; Zhao, Xuejin; Lou, Chunbo; Chen, Guo-Qiang

2016-11-18

As a product of a multistep enzymatic reaction, accumulation of poly(3-hydroxybutyrate) (PHB) in Escherichia coli (E. coli) can be achieved by overexpression of the PHB synthesis pathway from a native producer involving three genes phbC, phbA, and phbB. Pathway optimization by adjusting expression levels of the three genes can influence properties of the final product. Here, we reported a semirational approach for highly efficient PHB pathway optimization in E. coli based on a phbCAB operon cloned from the native producer Ralstonia entropha (R. entropha). Rationally designed ribosomal binding site (RBS) libraries with defined strengths for each of the three genes were constructed based on high or low copy number plasmids in a one-pot reaction by an oligo-linker mediated assembly (OLMA) method. Strains with desired properties were evaluated and selected by three different methodologies, including visual selection, high-throughput screening, and detailed in-depth analysis. Applying this approach, strains accumulating 0%-92% PHB contents in cell dry weight (CDW) were achieved. PHB with various weight-average molecular weights (M w ) of 2.7-6.8 × 10 6 were also efficiently produced in relatively high contents. These results suggest that the semirational approach combining library design, construction, and proper screening is an efficient way to optimize PHB and other multienzyme pathways.

Rapid design and optimization of low-thrust rendezvous/interception trajectory for asteroid deflection missions

NASA Astrophysics Data System (ADS)

Li, Shuang; Zhu, Yongsheng; Wang, Yukai

2014-02-01

Asteroid deflection techniques are essential in order to protect the Earth from catastrophic impacts by hazardous asteroids. Rapid design and optimization of low-thrust rendezvous/interception trajectories is considered as one of the key technologies to successfully deflect potentially hazardous asteroids. In this paper, we address a general framework for the rapid design and optimization of low-thrust rendezvous/interception trajectories for future asteroid deflection missions. The design and optimization process includes three closely associated steps. Firstly, shape-based approaches and genetic algorithm (GA) are adopted to perform preliminary design, which provides a reasonable initial guess for subsequent accurate optimization. Secondly, Radau pseudospectral method is utilized to transcribe the low-thrust trajectory optimization problem into a discrete nonlinear programming (NLP) problem. Finally, sequential quadratic programming (SQP) is used to efficiently solve the nonlinear programming problem and obtain the optimal low-thrust rendezvous/interception trajectories. The rapid design and optimization algorithms developed in this paper are validated by three simulation cases with different performance indexes and boundary constraints.

Converging Towards the Optimal Path to Extinction

DTIC Science & Technology

2011-01-01

the reproductive rate R0 should be greater than but very close to 1. However, most real diseases have R0 larger than 1.5, which translates into a...can analytically find an expression for the action along the optimal path. The expression for the action is a function of k and the reproductive number...the optimal path for a range of values of the reproductive number R0. In contrast to the prior two examples, here the action must be computed

The effect of dropout on the efficiency of D-optimal designs of linear mixed models.

PubMed

Ortega-Azurduy, S A; Tan, F E S; Berger, M P F

2008-06-30

Dropout is often encountered in longitudinal data. Optimal designs will usually not remain optimal in the presence of dropout. In this paper, we study D-optimal designs for linear mixed models where dropout is encountered. Moreover, we estimate the efficiency loss in cases where a D-optimal design for complete data is chosen instead of that for data with dropout. Two types of monotonically decreasing response probability functions are investigated to describe dropout. Our results show that the location of D-optimal design points for the dropout case will shift with respect to that for the complete and uncorrelated data case. Owing to this shift, the information collected at the D-optimal design points for the complete data case does not correspond to the smallest variance. We show that the size of the displacement of the time points depends on the linear mixed model and that the efficiency loss is moderate.

A Computational/Experimental Study of Two Optimized Supersonic Transport Designs and the Reference H Baseline

NASA Technical Reports Server (NTRS)

Cliff, Susan E.; Baker, Timothy J.; Hicks, Raymond M.; Reuther, James J.

1999-01-01

Two supersonic transport configurations designed by use of non-linear aerodynamic optimization methods are compared with a linearly designed baseline configuration. One optimized configuration, designated Ames 7-04, was designed at NASA Ames Research Center using an Euler flow solver, and the other, designated Boeing W27, was designed at Boeing using a full-potential method. The two optimized configurations and the baseline were tested in the NASA Langley Unitary Plan Supersonic Wind Tunnel to evaluate the non-linear design optimization methodologies. In addition, the experimental results are compared with computational predictions for each of the three configurations from the Enter flow solver, AIRPLANE. The computational and experimental results both indicate moderate to substantial performance gains for the optimized configurations over the baseline configuration. The computed performance changes with and without diverters and nacelles were in excellent agreement with experiment for all three models. Comparisons of the computational and experimental cruise drag increments for the optimized configurations relative to the baseline show excellent agreement for the model designed by the Euler method, but poorer comparisons were found for the configuration designed by the full-potential code.

Model-based optimal design of experiments - semidefinite and nonlinear programming formulations

PubMed Central

Duarte, Belmiro P.M.; Wong, Weng Kee; Oliveira, Nuno M.C.

2015-01-01

We use mathematical programming tools, such as Semidefinite Programming (SDP) and Nonlinear Programming (NLP)-based formulations to find optimal designs for models used in chemistry and chemical engineering. In particular, we employ local design-based setups in linear models and a Bayesian setup in nonlinear models to find optimal designs. In the latter case, Gaussian Quadrature Formulas (GQFs) are used to evaluate the optimality criterion averaged over the prior distribution for the model parameters. Mathematical programming techniques are then applied to solve the optimization problems. Because such methods require the design space be discretized, we also evaluate the impact of the discretization scheme on the generated design. We demonstrate the techniques for finding D–, A– and E–optimal designs using design problems in biochemical engineering and show the method can also be directly applied to tackle additional issues, such as heteroscedasticity in the model. Our results show that the NLP formulation produces highly efficient D–optimal designs but is computationally less efficient than that required for the SDP formulation. The efficiencies of the generated designs from the two methods are generally very close and so we recommend the SDP formulation in practice. PMID:26949279

Model-based optimal design of experiments - semidefinite and nonlinear programming formulations.

PubMed

Duarte, Belmiro P M; Wong, Weng Kee; Oliveira, Nuno M C

2016-02-15

We use mathematical programming tools, such as Semidefinite Programming (SDP) and Nonlinear Programming (NLP)-based formulations to find optimal designs for models used in chemistry and chemical engineering. In particular, we employ local design-based setups in linear models and a Bayesian setup in nonlinear models to find optimal designs. In the latter case, Gaussian Quadrature Formulas (GQFs) are used to evaluate the optimality criterion averaged over the prior distribution for the model parameters. Mathematical programming techniques are then applied to solve the optimization problems. Because such methods require the design space be discretized, we also evaluate the impact of the discretization scheme on the generated design. We demonstrate the techniques for finding D -, A - and E -optimal designs using design problems in biochemical engineering and show the method can also be directly applied to tackle additional issues, such as heteroscedasticity in the model. Our results show that the NLP formulation produces highly efficient D -optimal designs but is computationally less efficient than that required for the SDP formulation. The efficiencies of the generated designs from the two methods are generally very close and so we recommend the SDP formulation in practice.

Design of helicopter rotor blades for optimum dynamic characteristics

NASA Technical Reports Server (NTRS)

Peters, D. A.; Ko, T.; Korn, A.; Rossow, M. P.

1984-01-01

The optimal design of helicopter rotor blades is addressed. The forced response of an initial (i.e., non-optimized) blade to those of a final (optimized) blade are compared. Response of starting design and optimal designs for varying forcing frequencies, blade response to harmonics of rotor speed, and derivation of mass and stiffness matrices or functions of natural frequencies are discussed.

Detailed design of a lattice composite fuselage structure by a mixed optimization method

NASA Astrophysics Data System (ADS)

Liu, D.; Lohse-Busch, H.; Toropov, V.; Hühne, C.; Armani, U.

2016-10-01

In this article, a procedure for designing a lattice fuselage barrel is developed. It comprises three stages: first, topology optimization of an aircraft fuselage barrel is performed with respect to weight and structural performance to obtain the conceptual design. The interpretation of the optimal result is given to demonstrate the development of this new lattice airframe concept for the fuselage barrel. Subsequently, parametric optimization of the lattice aircraft fuselage barrel is carried out using genetic algorithms on metamodels generated with genetic programming from a 101-point optimal Latin hypercube design of experiments. The optimal design is achieved in terms of weight savings subject to stability, global stiffness and strain requirements, and then verified by the fine mesh finite element simulation of the lattice fuselage barrel. Finally, a practical design of the composite skin complying with the aircraft industry lay-up rules is presented. It is concluded that the mixed optimization method, combining topology optimization with the global metamodel-based approach, allows the problem to be solved with sufficient accuracy and provides the designers with a wealth of information on the structural behaviour of the novel anisogrid composite fuselage design.

A combinatorial approach towards the design of nanofibrous scaffolds for chondrogenesis

NASA Astrophysics Data System (ADS)

Ahmed, Maqsood; Ramos, Tiago André Da Silva; Damanik, Febriyani; Quang Le, Bach; Wieringa, Paul; Bennink, Martin; van Blitterswijk, Clemens; de Boer, Jan; Moroni, Lorenzo

2015-10-01

The extracellular matrix (ECM) is a three-dimensional (3D) structure composed of proteinaceous fibres that provide physical and biological cues to direct cell behaviour. Here, we build a library of hybrid collagen-polymer fibrous scaffolds with nanoscale dimensions and screen them for their ability to grow chondrocytes for cartilage repair. Poly(lactic acid) and poly (lactic-co-glycolic acid) at two different monomer ratios (85:15 and 50:50) were incrementally blended with collagen. Physical properties (wettability and stiffness) of the scaffolds were characterized and related to biological performance (proliferation, ECM production, and gene expression) and structure-function relationships were developed. We found that soft scaffolds with an intermediate wettability composed of the highly biodegradable PLGA50:50 and collagen, in two ratios (40:60 and 60:40), were optimal for chondrogenic differentiation of ATDC5 cells as determined by increased ECM production and enhanced cartilage specific gene expression. Long-term cultures indicated a stable phenotype with minimal de-differentiation or hypertrophy. The combinatorial methodology applied herein is a promising approach for the design and development of scaffolds for regenerative medicine.

A combinatorial approach towards the design of nanofibrous scaffolds for chondrogenesis.

PubMed

Ahmed, Maqsood; Ramos, Tiago André da Silva; Damanik, Febriyani; Quang Le, Bach; Wieringa, Paul; Bennink, Martin; van Blitterswijk, Clemens; de Boer, Jan; Moroni, Lorenzo

2015-10-07

The extracellular matrix (ECM) is a three-dimensional (3D) structure composed of proteinaceous fibres that provide physical and biological cues to direct cell behaviour. Here, we build a library of hybrid collagen-polymer fibrous scaffolds with nanoscale dimensions and screen them for their ability to grow chondrocytes for cartilage repair. Poly(lactic acid) and poly (lactic-co-glycolic acid) at two different monomer ratios (85:15 and 50:50) were incrementally blended with collagen. Physical properties (wettability and stiffness) of the scaffolds were characterized and related to biological performance (proliferation, ECM production, and gene expression) and structure-function relationships were developed. We found that soft scaffolds with an intermediate wettability composed of the highly biodegradable PLGA50:50 and collagen, in two ratios (40:60 and 60:40), were optimal for chondrogenic differentiation of ATDC5 cells as determined by increased ECM production and enhanced cartilage specific gene expression. Long-term cultures indicated a stable phenotype with minimal de-differentiation or hypertrophy. The combinatorial methodology applied herein is a promising approach for the design and development of scaffolds for regenerative medicine.

Putative carotenoid genes expressed under the regulation of Shine-Dalgarno regions in Escherichia coli for efficient lycopene production.

PubMed

Jin, Weiyue; Xu, Xian; Jiang, Ling; Zhang, Zhidong; Li, Shuang; Huang, He

2015-11-01

Putative genes crtE, crtB, and crtI from Deinococcus wulumiqiensis R12, a novel species, were identified by genome mining and were co-expressed using the optimized Shine-Dalgarno (SD) regions to improve lycopene yield. A lycopene biosynthesis pathway was constructed by co-expressing these three genes in Escherichia coli. After optimizing the upstream SD regions and the culture medium, the recombinant strain EDW11 produced 88 mg lycopene g(-1) dry cell wt (780 mg lycopene l(-1)) after 40 h fermentation without IPTG induction, while the strain EDW without optimized SD regions only produced 49 mg lycopene g(-1) dry cell wt (417 mg lycopene l(-1)). Based on the optimization of the upstream SD regions and culture medium, the yield of the strain EDW11 reached a high level during microbial lycopene production until now.

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases

PubMed Central

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.

PubMed

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.

The Topology Optimization Design Research for Aluminum Inner Panel of Automobile Engine Hood

NASA Astrophysics Data System (ADS)

Li, Minhao; Hu, Dongqing; Liu, Xiangzheng; Yuan, Huanquan

2017-11-01

This article discusses the topology optimization methods for automobile engine hood design. The aluminum inner panel of engine hood and mucilage glue regions are set as design areas, and the static performances of engine hood included modal frequency, lateral stiffness, torsional stiffness and indentation stiffness are set as the optimization objectives. The topology optimization results about different objective functions are contrasted for analysis. And based on the reasonable topology optimization result, a suited automobile engine hood designs are raised to further study. Finally, an automobile engine hood that good at all of static performances is designed, and a favorable topology optimization method is put forward for discussion.

Design optimization of hydraulic turbine draft tube based on CFD and DOE method

NASA Astrophysics Data System (ADS)

Nam, Mun chol; Dechun, Ba; Xiangji, Yue; Mingri, Jin

2018-03-01

In order to improve performance of the hydraulic turbine draft tube in its design process, the optimization for draft tube is performed based on multi-disciplinary collaborative design optimization platform by combining the computation fluid dynamic (CFD) and the design of experiment (DOE) in this paper. The geometrical design variables are considered as the median section in the draft tube and the cross section in its exit diffuser and objective function is to maximize the pressure recovery factor (Cp). Sample matrixes required for the shape optimization of the draft tube are generated by optimal Latin hypercube (OLH) method of the DOE technique and their performances are evaluated through computational fluid dynamic (CFD) numerical simulation. Subsequently the main effect analysis and the sensitivity analysis of the geometrical parameters of the draft tube are accomplished. Then, the design optimization of the geometrical design variables is determined using the response surface method. The optimization result of the draft tube shows a marked performance improvement over the original.

Conceptual Design Optimization of an Augmented Stability Aircraft Incorporating Dynamic Response Performance Constraints

NASA Technical Reports Server (NTRS)

Welstead, Jason

2014-01-01

This research focused on incorporating stability and control into a multidisciplinary de- sign optimization on a Boeing 737-class advanced concept called the D8.2b. A new method of evaluating the aircraft handling performance using quantitative evaluation of the sys- tem to disturbances, including perturbations, continuous turbulence, and discrete gusts, is presented. A multidisciplinary design optimization was performed using the D8.2b transport air- craft concept. The con guration was optimized for minimum fuel burn using a design range of 3,000 nautical miles. Optimization cases were run using xed tail volume coecients, static trim constraints, and static trim and dynamic response constraints. A Cessna 182T model was used to test the various dynamic analysis components, ensuring the analysis was behaving as expected. Results of the optimizations show that including stability and con- trol in the design process drastically alters the optimal design, indicating that stability and control should be included in conceptual design to avoid system level penalties later in the design process.

Cryogenic Tank Structure Sizing With Structural Optimization Method

NASA Technical Reports Server (NTRS)

Wang, J. T.; Johnson, T. F.; Sleight, D. W.; Saether, E.

2001-01-01

Structural optimization methods in MSC /NASTRAN are used to size substructures and to reduce the weight of a composite sandwich cryogenic tank for future launch vehicles. Because the feasible design space of this problem is non-convex, many local minima are found. This non-convex problem is investigated in detail by conducting a series of analyses along a design line connecting two feasible designs. Strain constraint violations occur for some design points along the design line. Since MSC/NASTRAN uses gradient-based optimization procedures. it does not guarantee that the lowest weight design can be found. In this study, a simple procedure is introduced to create a new starting point based on design variable values from previous optimization analyses. Optimization analysis using this new starting point can produce a lower weight design. Detailed inputs for setting up the MSC/NASTRAN optimization analysis and final tank design results are presented in this paper. Approaches for obtaining further weight reductions are also discussed.

Design optimization for permanent magnet machine with efficient slot per pole ratio

NASA Astrophysics Data System (ADS)

Potnuru, Upendra Kumar; Rao, P. Mallikarjuna

2018-04-01

This paper presents a methodology for the enhancement of a Brush Less Direct Current motor (BLDC) with 6Poles and 8slots. In particular; it is focused on amulti-objective optimization using a Genetic Algorithmand Grey Wolf Optimization developed in MATLAB. The optimization aims to maximize the maximum output power value and minimize the total losses of a motor. This paper presents an application of the MATLAB optimization algorithms to brushless DC (BLDC) motor design, with 7 design parameters chosen to be free. The optimal design parameters of the motor derived by GA are compared with those obtained by Grey Wolf Optimization technique. A comparative report on the specified enhancement approaches appearsthat Grey Wolf Optimization technique has a better convergence.

Advanced Structural Optimization Under Consideration of Cost Tracking

NASA Astrophysics Data System (ADS)

Zell, D.; Link, T.; Bickelmaier, S.; Albinger, J.; Weikert, S.; Cremaschi, F.; Wiegand, A.

2014-06-01

In order to improve the design process of launcher configurations in the early development phase, the software Multidisciplinary Optimization (MDO) was developed. The tool combines different efficient software tools such as Optimal Design Investigations (ODIN) for structural optimizations, Aerospace Trajectory Optimization Software (ASTOS) for trajectory and vehicle design optimization for a defined payload and mission.The present paper focuses to the integration and validation of ODIN. ODIN enables the user to optimize typical axis-symmetric structures by means of sizing the stiffening designs concerning strength and stability while minimizing the structural mass. In addition a fully automatic finite element model (FEM) generator module creates ready-to-run FEM models of a complete stage or launcher assembly.Cost tracking respectively future improvements concerning cost optimization are indicated.

Gradient design for liquid chromatography using multi-scale optimization.

PubMed

López-Ureña, S; Torres-Lapasió, J R; Donat, R; García-Alvarez-Coque, M C

2018-01-26

In reversed phase-liquid chromatography, the usual solution to the "general elution problem" is the application of gradient elution with programmed changes of organic solvent (or other properties). A correct quantification of chromatographic peaks in liquid chromatography requires well resolved signals in a proper analysis time. When the complexity of the sample is high, the gradient program should be accommodated to the local resolution needs of each analyte. This makes the optimization of such situations rather troublesome, since enhancing the resolution for a given analyte may imply a collateral worsening of the resolution of other analytes. The aim of this work is to design multi-linear gradients that maximize the resolution, while fulfilling some restrictions: all peaks should be eluted before a given maximal time, the gradient should be flat or increasing, and sudden changes close to eluting peaks are penalized. Consequently, an equilibrated baseline resolution for all compounds is sought. This goal is achieved by splitting the optimization problem in a multi-scale framework. In each scale κ, an optimization problem is solved with N κ  ≈ 2 κ variables that are used to build the gradients. The N κ variables define cubic splines written in terms of a B-spline basis. This allows expressing gradients as polygonals of M points approximating the splines. The cubic splines are built using subdivision schemes, a technique of fast generation of smooth curves, compatible with the multi-scale framework. Owing to the nature of the problem and the presence of multiple local maxima, the algorithm used in the optimization problem of each scale κ should be "global", such as the pattern-search algorithm. The multi-scale optimization approach is successfully applied to find the best multi-linear gradient for resolving a mixture of amino acid derivatives. Copyright © 2017 Elsevier B.V. All rights reserved.

Optimal design of low-density SNP arrays for genomic prediction: algorithm and applications

USDA-ARS?s Scientific Manuscript database

Low-density (LD) single nucleotide polymorphism (SNP) arrays provide a cost-effective solution for genomic prediction and selection, but algorithms and computational tools are needed for their optimal design. A multiple-objective, local optimization (MOLO) algorithm was developed for design of optim...

Codon optimization of the adenoviral fiber negatively impacts structural protein expression and viral fitness

NASA Astrophysics Data System (ADS)

Villanueva, Eneko; Martí-Solano, Maria; Fillat, Cristina

2016-06-01

Codon usage adaptation of lytic viruses to their hosts is determinant for viral fitness. In this work, we analyzed the codon usage of adenoviral proteins by principal component analysis and assessed their codon adaptation to the host. We observed a general clustering of adenoviral proteins according to their function. However, there was a significant variation in the codon preference between the host-interacting fiber protein and the rest of structural late phase proteins, with a non-optimal codon usage of the fiber. To understand the impact of codon bias in the fiber, we optimized the Adenovirus-5 fiber to the codon usage of the hexon structural protein. The optimized fiber displayed increased expression in a non-viral context. However, infection with adenoviruses containing the optimized fiber resulted in decreased expression of the fiber and of wild-type structural proteins. Consequently, this led to a drastic reduction in viral release. The insertion of an exogenous optimized protein as a late gene in the adenovirus with the optimized fiber further interfered with viral fitness. These results highlight the importance of balancing codon usage in viral proteins to adequately exploit cellular resources for efficient infection and open new opportunities to regulate viral fitness for virotherapy and vaccine development.

Targeted drug delivery and enhanced intracellular release using functionalized liposomes

NASA Astrophysics Data System (ADS)

Garg, Ashish

The ability to target cancer cells using an appropriate drug delivery system can significantly reduce the associated side effects from cancer therapies and can help in improving the overall quality of life, post cancer survival. Integrin alpha5beta1 is expressed on several types of cancer cells, including colon cancer and plays an important role in tumor growth and metastasis. Thus, the ability to target the integrin alpha 5beta1 using an appropriate drug delivery nano-vector can significantly help in inhibiting tumor growth and reducing tumor metastasis. The work in this thesis focuses on designing and optimizing, functionalized stealth liposomes (liposomes covered with polyethylene glycol (PEG)) that specifically target the integrin alpha5beta1. The PEG provides a steric barrier allowing the liposomes to circulate in the blood for longer duration and the functionalizing moiety, PR_b peptide specifically recognizes and binds to integrin alpha5beta1 expressing cells. The work demonstrates that by optimizing the amount of PEG and PR_b on the liposomal interface, nano-vectors can be engineered that bind to CT26.WT colon cancer cells in a specific manner and internalize through alpha 5beta1-mediated endocytosis. To further improve the efficacy of the system, PR_b functionalized pH-sensitive stealth liposomes that exhibit triggered release under mild acidic conditions present in endocytotic vesicles were designed. The study showed that PR_b functionalized pH-sensitive stealth liposomes, undergo destabilization under mildly acidic conditions and incorporation of the PR_b peptide does not significantly affect the pH-sensitivity of the liposomes. PR_b functionalized pH-sensitive stealth liposomes bind to CT26.WT colon carcinoma cells that express integrin alpha5beta 1, undergo cellular internalization, and release their load intracellularly in a short period of time as compared to other formulations. PR_b-targeted pH-sensitive stealth liposomes encapsulating 5-fluorouracil (5-FU) show significantly higher cytotoxicity than the PR_b-targeted inert stealth liposomes and the non-targeted stealth liposomes (both pH-sensitive and inert). The studies demonstrated that optimized PR_b functionalized pH sensitive liposomes have the potential to deliver a payload, such as chemotherapeutic agents, directly to colon cancer cells in an efficient and specific manner.

An Expert System-Driven Method for Parametric Trajectory Optimization During Conceptual Design

NASA Technical Reports Server (NTRS)

Dees, Patrick D.; Zwack, Mathew R.; Steffens, Michael; Edwards, Stephen; Diaz, Manuel J.; Holt, James B.

2015-01-01

During the early phases of engineering design, the costs committed are high, costs incurred are low, and the design freedom is high. It is well documented that decisions made in these early design phases drive the entire design's life cycle cost. In a traditional paradigm, key design decisions are made when little is known about the design. As the design matures, design changes become more difficult in both cost and schedule to enact. The current capability-based paradigm, which has emerged because of the constrained economic environment, calls for the infusion of knowledge usually acquired during later design phases into earlier design phases, i.e. bringing knowledge acquired during preliminary and detailed design into pre-conceptual and conceptual design. An area of critical importance to launch vehicle design is the optimization of its ascent trajectory, as the optimal trajectory will be able to take full advantage of the launch vehicle's capability to deliver a maximum amount of payload into orbit. Hence, the optimal ascent trajectory plays an important role in the vehicle's affordability posture yet little of the information required to successfully optimize a trajectory is known early in the design phase. Thus, the current paradigm of optimizing ascent trajectories involves generating point solutions for every change in a vehicle's design parameters. This is often a very tedious, manual, and time-consuming task for the analysts. Moreover, the trajectory design space is highly non-linear and multi-modal due to the interaction of various constraints. When these obstacles are coupled with the Program to Optimize Simulated Trajectories (POST), an industry standard program to optimize ascent trajectories that is difficult to use, expert trajectory analysts are required to effectively optimize a vehicle's ascent trajectory. Over the course of this paper, the authors discuss a methodology developed at NASA Marshall's Advanced Concepts Office to address these issues. The methodology is two-fold: first, capture the heuristics developed by human analysts over their many years of experience; and secondly, leverage the power of modern computing to evaluate multiple trajectories simultaneously and therefore enable the exploration of the trajectory's design space early during the pre- conceptual and conceptual phases of design. This methodology is coupled with design of experiments in order to train surrogate models, which enables trajectory design space visualization and parametric optimal ascent trajectory information to be available when early design decisions are being made.

High Levels of Bioplastic Are Produced in Fertile Transplastomic Tobacco Plants Engineered with a Synthetic Operon for the Production of Polyhydroxybutyrate1[C][OA

PubMed Central

Bohmert-Tatarev, Karen; McAvoy, Susan; Daughtry, Sean; Peoples, Oliver P.; Snell, Kristi D.

2011-01-01

An optimized genetic construct for plastid transformation of tobacco (Nicotiana tabacum) for the production of the renewable, biodegradable plastic polyhydroxybutyrate (PHB) was designed using an operon extension strategy. Bacterial genes encoding the PHB pathway enzymes were selected for use in this construct based on their similarity to the codon usage and GC content of the tobacco plastome. Regulatory elements with limited homology to the host plastome yet known to yield high levels of plastidial recombinant protein production were used to enhance the expression of the transgenes. A partial transcriptional unit, containing genes of the PHB pathway and a selectable marker gene encoding spectinomycin resistance, was flanked at the 5′ end by the host plant’s psbA coding sequence and at the 3′ end by the host plant’s 3′ psbA untranslated region. This design allowed insertion of the transgenes into the plastome as an extension of the psbA operon, rendering the addition of a promoter to drive the expression of the transgenes unnecessary. Transformation of the optimized construct into tobacco and subsequent spectinomycin selection of transgenic plants yielded T0 plants that were capable of producing up to 18.8% dry weight PHB in samples of leaf tissue. These plants were fertile and produced viable seed. T1 plants producing up to 17.3% dry weight PHB in samples of leaf tissue and 8.8% dry weight PHB in the total biomass of the plant were also isolated. PMID:21325565

Aeroelastic Optimization Study Based on X-56A Model

NASA Technical Reports Server (NTRS)

Li, Wesley; Pak, Chan-Gi

2014-01-01

A design process which incorporates the object-oriented multidisciplinary design, analysis, and optimization (MDAO) tool and the aeroelastic effects of high fidelity finite element models to characterize the design space was successfully developed and established. Two multidisciplinary design optimization studies using an object-oriented MDAO tool developed at NASA Armstrong Flight Research Center were presented. The first study demonstrates the use of aeroelastic tailoring concepts to minimize the structural weight while meeting the design requirements including strength, buckling, and flutter. A hybrid and discretization optimization approach was implemented to improve accuracy and computational efficiency of a global optimization algorithm. The second study presents a flutter mass balancing optimization study. The results provide guidance to modify the fabricated flexible wing design and move the design flutter speeds back into the flight envelope so that the original objective of X-56A flight test can be accomplished.

Production of human interferon alfa 2b in plants of Nicotiana excelsior by Agrobacterium-mediated transient expression.

PubMed

Sindarovska, Y R; Gerasymenko, I M; Sheludko, Y V; Olevinskaya, Z M; Spivak, N Y; Kuchuk, N V

2010-01-01

Human interferon alpha2b gene was transiently expressed in Nicotiana excelsior plants. Fusion with N. plumbaginifolia calreticulin signal peptide for improved apoplast targeting and carrying out the expression under optimized conditions resulted in maximal interferon activity of 3.2 x 10(3) IU/g fresh weight (FW) with an average of 2.1 +/- 0.8 x 10(3) IU/g FW. It proves that N. excelsior is a suitable host for Agrobacterium-mediated transient expression of genes encoding physiologically active human proteins. The transient expression conditions optimized for GFP marker protein were confirmed to be preferable for hIFN alpha2b.

Optimal control, optimization and asymptotic analysis of Purcell's microswimmer model

NASA Astrophysics Data System (ADS)

Wiezel, Oren; Or, Yizhar

2016-11-01

Purcell's swimmer (1977) is a classic model of a three-link microswimmer that moves by performing periodic shape changes. Becker et al. (2003) showed that the swimmer's direction of net motion is reversed upon increasing the stroke amplitude of joint angles. Tam and Hosoi (2007) used numerical optimization in order to find optimal gaits for maximizing either net displacement or Lighthill's energetic efficiency. In our work, we analytically derive leading-order expressions as well as next-order corrections for both net displacement and energetic efficiency of Purcell's microswimmer. Using these expressions enables us to explicitly show the reversal in direction of motion, as well as obtaining an estimate for the optimal stroke amplitude. We also find the optimal swimmer's geometry for maximizing either displacement or energetic efficiency. Additionally, the gait optimization problem is revisited and analytically formulated as an optimal control system with only two state variables, which can be solved using Pontryagin's maximum principle. It can be shown that the optimal solution must follow a "singular arc". Numerical solution of the boundary value problem is obtained, which exactly reproduces Tam and Hosoi's optimal gait.