RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

PubMed

Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

2004-02-01

An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

Analysis of multiplex gene expression maps obtained by voxelation.

PubMed

An, Li; Xie, Hongbo; Chin, Mark H; Obradovic, Zoran; Smith, Desmond J; Megalooikonomou, Vasileios

2009-04-29

Gene expression signatures in the mammalian brain hold the key to understanding neural development and neurological disease. Researchers have previously used voxelation in combination with microarrays for acquisition of genome-wide atlases of expression patterns in the mouse brain. On the other hand, some work has been performed on studying gene functions, without taking into account the location information of a gene's expression in a mouse brain. In this paper, we present an approach for identifying the relation between gene expression maps obtained by voxelation and gene functions. To analyze the dataset, we chose typical genes as queries and aimed at discovering similar gene groups. Gene similarity was determined by using the wavelet features extracted from the left and right hemispheres averaged gene expression maps, and by the Euclidean distance between each pair of feature vectors. We also performed a multiple clustering approach on the gene expression maps, combined with hierarchical clustering. Among each group of similar genes and clusters, the gene function similarity was measured by calculating the average gene function distances in the gene ontology structure. By applying our methodology to find similar genes to certain target genes we were able to improve our understanding of gene expression patterns and gene functions. By applying the clustering analysis method, we obtained significant clusters, which have both very similar gene expression maps and very similar gene functions respectively to their corresponding gene ontologies. The cellular component ontology resulted in prominent clusters expressed in cortex and corpus callosum. The molecular function ontology gave prominent clusters in cortex, corpus callosum and hypothalamus. The biological process ontology resulted in clusters in cortex, hypothalamus and choroid plexus. Clusters from all three ontologies combined were most prominently expressed in cortex and corpus callosum. The experimental results confirm the hypothesis that genes with similar gene expression maps might have similar gene functions. The voxelation data takes into account the location information of gene expression level in mouse brain, which is novel in related research. The proposed approach can potentially be used to predict gene functions and provide helpful suggestions to biologists.

MARQ: an online tool to mine GEO for experiments with similar or opposite gene expression signatures.

PubMed

Vazquez, Miguel; Nogales-Cadenas, Ruben; Arroyo, Javier; Botías, Pedro; García, Raul; Carazo, Jose M; Tirado, Francisco; Pascual-Montano, Alberto; Carmona-Saez, Pedro

2010-07-01

The enormous amount of data available in public gene expression repositories such as Gene Expression Omnibus (GEO) offers an inestimable resource to explore gene expression programs across several organisms and conditions. This information can be used to discover experiments that induce similar or opposite gene expression patterns to a given query, which in turn may lead to the discovery of new relationships among diseases, drugs or pathways, as well as the generation of new hypotheses. In this work, we present MARQ, a web-based application that allows researchers to compare a query set of genes, e.g. a set of over- and under-expressed genes, against a signature database built from GEO datasets for different organisms and platforms. MARQ offers an easy-to-use and integrated environment to mine GEO, in order to identify conditions that induce similar or opposite gene expression patterns to a given experimental condition. MARQ also includes additional functionalities for the exploration of the results, including a meta-analysis pipeline to find genes that are differentially expressed across different experiments. The application is freely available at http://marq.dacya.ucm.es.

Comparative analysis of cadherin expression and connectivity patterns in the cerebellar system of ferret and mouse.

PubMed

Neudert, Franziska; Nuernberger, Krishna-K Monique; Redies, Christoph

2008-12-20

The cerebellum shows remarkable variations in the relative size of its divisions among vertebrate species. In the present study, we compare the cerebella of two mammals (ferret and mouse) by mapping the expression of three cadherins (cadherin-8, protocadherin-7, and protocadherin-10) at similar postnatal stages. The three cadherins are expressed differentially in parasagittal stripes in the cerebellar cortex, in the portions of the deep cerebellar nuclei, in the divisions of the inferior olivary nucleus, and in the lateral vestibular nucleus. The expression profiles suggest that the cadherin-positive structures are interconnected. The expression patterns resemble each other in ferret and mouse, although some differences can be observed. The general resemblance indicates that cerebellar organization is based on a common set of embryonic divisions in the two species. Consequently, the large differences in cerebellar morphology between the two species are more likely caused by differential growth of these embryonic divisions than by differences in early embryonic patterning. Based on the cadherin expression patterns, a model of corticonuclear projection territories in ferret and mouse is proposed. In summary, our results indicate that the cerebellar systems of rodents and carnivores display a relatively large degree of similarity in their molecular and functional organization.

Sex bias and dosage compensation in the zebra finch versus chicken genomes: General and specialized patterns among birds

PubMed Central

Itoh, Yuichiro; Replogle, Kirstin; Kim, Yong-Hwan; Wade, Juli; Clayton, David F.; Arnold, Arthur P.

2010-01-01

We compared global patterns of gene expression between two bird species, the chicken and zebra finch, with regard to sex bias of autosomal versus Z chromosome genes, dosage compensation, and evolution of sex bias. Both species appear to lack a Z chromosome–wide mechanism of dosage compensation, because both have a similar pattern of significantly higher expression of Z genes in males relative to females. Unlike the chicken Z chromosome, which has female-specific expression of the noncoding RNA MHM (male hypermethylated) and acetylation of histone 4 lysine 16 (H4K16) near MHM, the zebra finch Z chromosome appears to lack the MHM sequence and acetylation of H4K16. The zebra finch also does not show the reduced male-to-female (M:F) ratio of gene expression near MHM similar to that found in the chicken. Although the M:F ratios of Z chromosome gene expression are similar across tissues and ages within each species, they differ between the two species. Z genes showing the greatest species difference in M:F ratio were concentrated near the MHM region of the chicken Z chromosome. This study shows that the zebra finch differs from the chicken because it lacks a specialized region of greater dosage compensation along the Z chromosome, and shows other differences in sex bias. These patterns suggest that different avian taxa may have evolved specific compensatory mechanisms. PMID:20357053

GEM-TREND: a web tool for gene expression data mining toward relevant network discovery

PubMed Central

Feng, Chunlai; Araki, Michihiro; Kunimoto, Ryo; Tamon, Akiko; Makiguchi, Hiroki; Niijima, Satoshi; Tsujimoto, Gozoh; Okuno, Yasushi

2009-01-01

Background DNA microarray technology provides us with a first step toward the goal of uncovering gene functions on a genomic scale. In recent years, vast amounts of gene expression data have been collected, much of which are available in public databases, such as the Gene Expression Omnibus (GEO). To date, most researchers have been manually retrieving data from databases through web browsers using accession numbers (IDs) or keywords, but gene-expression patterns are not considered when retrieving such data. The Connectivity Map was recently introduced to compare gene expression data by introducing gene-expression signatures (represented by a set of genes with up- or down-regulated labels according to their biological states) and is available as a web tool for detecting similar gene-expression signatures from a limited data set (approximately 7,000 expression profiles representing 1,309 compounds). In order to support researchers to utilize the public gene expression data more effectively, we developed a web tool for finding similar gene expression data and generating its co-expression networks from a publicly available database. Results GEM-TREND, a web tool for searching gene expression data, allows users to search data from GEO using gene-expression signatures or gene expression ratio data as a query and retrieve gene expression data by comparing gene-expression pattern between the query and GEO gene expression data. The comparison methods are based on the nonparametric, rank-based pattern matching approach of Lamb et al. (Science 2006) with the additional calculation of statistical significance. The web tool was tested using gene expression ratio data randomly extracted from the GEO and with in-house microarray data, respectively. The results validated the ability of GEM-TREND to retrieve gene expression entries biologically related to a query from GEO. For further analysis, a network visualization interface is also provided, whereby genes and gene annotations are dynamically linked to external data repositories. Conclusion GEM-TREND was developed to retrieve gene expression data by comparing query gene-expression pattern with those of GEO gene expression data. It could be a very useful resource for finding similar gene expression profiles and constructing its gene co-expression networks from a publicly available database. GEM-TREND was designed to be user-friendly and is expected to support knowledge discovery. GEM-TREND is freely available at . PMID:19728865

GEM-TREND: a web tool for gene expression data mining toward relevant network discovery.

PubMed

Feng, Chunlai; Araki, Michihiro; Kunimoto, Ryo; Tamon, Akiko; Makiguchi, Hiroki; Niijima, Satoshi; Tsujimoto, Gozoh; Okuno, Yasushi

2009-09-03

DNA microarray technology provides us with a first step toward the goal of uncovering gene functions on a genomic scale. In recent years, vast amounts of gene expression data have been collected, much of which are available in public databases, such as the Gene Expression Omnibus (GEO). To date, most researchers have been manually retrieving data from databases through web browsers using accession numbers (IDs) or keywords, but gene-expression patterns are not considered when retrieving such data. The Connectivity Map was recently introduced to compare gene expression data by introducing gene-expression signatures (represented by a set of genes with up- or down-regulated labels according to their biological states) and is available as a web tool for detecting similar gene-expression signatures from a limited data set (approximately 7,000 expression profiles representing 1,309 compounds). In order to support researchers to utilize the public gene expression data more effectively, we developed a web tool for finding similar gene expression data and generating its co-expression networks from a publicly available database. GEM-TREND, a web tool for searching gene expression data, allows users to search data from GEO using gene-expression signatures or gene expression ratio data as a query and retrieve gene expression data by comparing gene-expression pattern between the query and GEO gene expression data. The comparison methods are based on the nonparametric, rank-based pattern matching approach of Lamb et al. (Science 2006) with the additional calculation of statistical significance. The web tool was tested using gene expression ratio data randomly extracted from the GEO and with in-house microarray data, respectively. The results validated the ability of GEM-TREND to retrieve gene expression entries biologically related to a query from GEO. For further analysis, a network visualization interface is also provided, whereby genes and gene annotations are dynamically linked to external data repositories. GEM-TREND was developed to retrieve gene expression data by comparing query gene-expression pattern with those of GEO gene expression data. It could be a very useful resource for finding similar gene expression profiles and constructing its gene co-expression networks from a publicly available database. GEM-TREND was designed to be user-friendly and is expected to support knowledge discovery. GEM-TREND is freely available at http://cgs.pharm.kyoto-u.ac.jp/services/network.

Identification of an intact ParaHox cluster with temporal colinearity but altered spatial colinearity in the hemichordate Ptychodera flava

PubMed Central

2013-01-01

Background ParaHox and Hox genes are thought to have evolved from a common ancestral ProtoHox cluster or from tandem duplication prior to the divergence of cnidarians and bilaterians. Similar to Hox clusters, chordate ParaHox genes including Gsx, Xlox, and Cdx, are clustered and their expression exhibits temporal and spatial colinearity. In non-chordate animals, however, studies on the genomic organization of ParaHox genes are limited to only a few animal taxa. Hemichordates, such as the Enteropneust acorn worms, have been used to gain insights into the origins of chordate characters. In this study, we investigated the genomic organization and expression of ParaHox genes in the indirect developing hemichordate acorn worm Ptychodera flava. Results We found that P. flava contains an intact ParaHox cluster with a similar arrangement to that of chordates. The temporal expression order of the P. flava ParaHox genes is the same as that of the chordate ParaHox genes. During embryogenesis, the spatial expression pattern of PfCdx in the posterior endoderm represents a conserved feature similar to the expression of its orthologs in other animals. On the other hand, PfXlox and PfGsx show a novel expression pattern in the blastopore. Nevertheless, during metamorphosis, PfXlox and PfCdx are expressed in the endoderm in a spatially staggered pattern similar to the situation in chordates. Conclusions Our study shows that P. flava ParaHox genes, despite forming an intact cluster, exhibit temporal colinearity but lose spatial colinearity during embryogenesis. During metamorphosis, partial spatial colinearity is retained in the transforming larva. These results strongly suggest that intact ParaHox gene clustering was retained in the deuterostome ancestor and is correlated with temporal colinearity. PMID:23802544

Fungal and host transcriptome analysis of pH-regulated genes during colonization of apple fruits by Penicillium expansum.

PubMed

Barad, Shiri; Sela, Noa; Kumar, Dilip; Kumar-Dubey, Amit; Glam-Matana, Nofar; Sherman, Amir; Prusky, Dov

2016-05-04

Penicillium expansum is a destructive phytopathogen that causes decay in deciduous fruits during postharvest handling and storage. During colonization the fungus secretes D-gluconic acid (GLA), which modulates environmental pH and regulates mycotoxin accumulation in colonized tissue. Till now no transcriptomic analysis has addressed the specific contribution of the pathogen's pH regulation to the P. expansum colonization process. For this purpose total RNA from the leading edge of P. expansum-colonized apple tissue of cv. 'Golden Delicious' and from fungal cultures grown under pH 4 or 7 were sequenced and their gene expression patterns were compared. We present a large-scale analysis of the transcriptome data of P. expansum and apple response to fungal colonization. The fungal analysis revealed nine different clusters of gene expression patterns that were divided among three major groups in which the colonized tissue showed, respectively: (i) differing transcript expression patterns between mycelial growth at pH 4 and pH 7; (ii) similar transcript expression patterns of mycelial growth at pH 4; and (iii) similar transcript expression patterns of mycelial growth at pH 7. Each group was functionally characterized in order to decipher genes that are important for pH regulation and also for colonization of apple fruits by Penicillium. Furthermore, comparison of gene expression of healthy apple tissue with that of colonized tissue showed that differentially expressed genes revealed up-regulation of the jasmonic acid and mevalonate pathways, and also down-regulation of the glycogen and starch biosynthesis pathways. Overall, we identified important genes and functionalities of P. expansum that were controlled by the environmental pH. Differential expression patterns of genes belonging to the same gene family suggest that genes were selectively activated according to their optimal environmental conditions (pH, in vitro or in vivo) to enable the fungus to cope with varying conditions and to make optimal use of available enzymes. Comparison between the activation of the colonized host's gene responses by alkalizing Colletotrichum gloeosporioides and acidifying P. expansum pathogens indicated similar gene response patterns, but stronger responses to P. expansum, suggesting the importance of acidification by P. expansum as a factor in its increased aggressiveness.

Complex genomic rearrangement in CCS-LacZ transgenic mice.

PubMed

Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

2007-02-01

The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

PubMed Central

Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

2012-01-01

Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

Average correlation clustering algorithm (ACCA) for grouping of co-regulated genes with similar pattern of variation in their expression values.

PubMed

Bhattacharya, Anindya; De, Rajat K

2010-08-01

Distance based clustering algorithms can group genes that show similar expression values under multiple experimental conditions. They are unable to identify a group of genes that have similar pattern of variation in their expression values. Previously we developed an algorithm called divisive correlation clustering algorithm (DCCA) to tackle this situation, which is based on the concept of correlation clustering. But this algorithm may also fail for certain cases. In order to overcome these situations, we propose a new clustering algorithm, called average correlation clustering algorithm (ACCA), which is able to produce better clustering solution than that produced by some others. ACCA is able to find groups of genes having more common transcription factors and similar pattern of variation in their expression values. Moreover, ACCA is more efficient than DCCA with respect to the time of execution. Like DCCA, we use the concept of correlation clustering concept introduced by Bansal et al. ACCA uses the correlation matrix in such a way that all genes in a cluster have the highest average correlation values with the genes in that cluster. We have applied ACCA and some well-known conventional methods including DCCA to two artificial and nine gene expression datasets, and compared the performance of the algorithms. The clustering results of ACCA are found to be more significantly relevant to the biological annotations than those of the other methods. Analysis of the results show the superiority of ACCA over some others in determining a group of genes having more common transcription factors and with similar pattern of variation in their expression profiles. Availability of the software: The software has been developed using C and Visual Basic languages, and can be executed on the Microsoft Windows platforms. The software may be downloaded as a zip file from http://www.isical.ac.in/~rajat. Then it needs to be installed. Two word files (included in the zip file) need to be consulted before installation and execution of the software. Copyright 2010 Elsevier Inc. All rights reserved.

Identification of rice genes associated with cosmic-ray response via co-expression gene network analysis.

PubMed

Hwang, Sun-Goo; Kim, Dong Sub; Hwang, Jung Eun; Han, A-Reum; Jang, Cheol Seong

2014-05-15

In order to better understand the biological systems that are affected in response to cosmic ray (CR), we conducted weighted gene co-expression network analysis using the module detection method. By using the Pearson's correlation coefficient (PCC) value, we evaluated complex gene-gene functional interactions between 680 CR-responsive probes from integrated microarray data sets, which included large-scale transcriptional profiling of 1000 microarray samples. These probes were divided into 6 distinct modules that contained 20 enriched gene ontology (GO) functions, such as oxidoreductase activity, hydrolase activity, and response to stimulus and stress. In particular, modules 1 and 2 commonly showed enriched annotation categories such as oxidoreductase activity, including enriched cis-regulatory elements known as ROS-specific regulators. These results suggest that the ROS-mediated irradiation response pathway is affected by CR in modules 1 and 2. We found 243 ionizing radiation (IR)-responsive probes that exhibited similarities in expression patterns in various irradiation microarray data sets. The expression patterns of 6 randomly selected IR-responsive genes were evaluated by quantitative reverse transcription polymerase chain reaction following treatment with CR, gamma rays (GR), and ion beam (IB); similar patterns were observed among these genes under these 3 treatments. Moreover, we constructed subnetworks of IR-responsive genes and evaluated the expression levels of their neighboring genes following GR treatment; similar patterns were observed among them. These results of network-based analyses might provide a clue to understanding the complex biological system related to the CR response in plants. Copyright © 2014 Elsevier B.V. All rights reserved.

Transcriptional expression analysis of genes involved in regulation of calcium translocation and storage in finger millet (Eleusine coracana L. Gartn.).

PubMed

Mirza, Neelofar; Taj, Gohar; Arora, Sandeep; Kumar, Anil

2014-10-25

Finger millet (Eleusine coracana) variably accumulates calcium in different tissues, due to differential expression of genes involved in uptake, translocation and accumulation of calcium. Ca(2+)/H(+) antiporter (CAX1), two pore channel (TPC1), CaM-stimulated type IIB Ca(2+) ATPase and two CaM dependent protein kinase (CaMK1 and 2) homologs were studied in finger millet. Two genotypes GP-45 and GP-1 (high and low calcium accumulating, respectively) were used to understand the role of these genes in differential calcium accumulation. For most of the genes higher expression was found in the high calcium accumulating genotype. CAX1 was strongly expressed in the late stages of spike development and could be responsible for accumulating high concentrations of calcium in seeds. TPC1 and Ca(2+) ATPase homologs recorded strong expression in the root, stem and developing spike and signify their role in calcium uptake and translocation, respectively. Calmodulin showed strong expression and a similar expression pattern to the type IIB ATPase in the developing spike only and indicating developing spike or even seed specific isoform of CaM affecting the activity of downstream target of calcium transportation. Interestingly, CaMK1 and CaMK2 had expression patterns similar to ATPase and TPC1 in various tissues raising a possibility of their respective regulation via CaM kinase. Expression pattern of 14-3-3 gene was observed to be similar to CAX1 gene in leaf and developing spike inferring a surprising possibility of CAX1 regulation through 14-3-3 protein. Our results provide a molecular insight for explaining the mechanism of calcium accumulation in finger millet. Copyright © 2014 Elsevier B.V. All rights reserved.

Gene expression signatures in tree shrew choroid in response to three myopiagenic conditions

PubMed Central

He, Li; Frost, Michael R.; Siegwart, John T.; Norton, Thomas T.

2014-01-01

We examined gene expression in tree shrew choroid in response to three different myopiagenic conditions: minus lens (ML) wear, form deprivation (FD), and continuous darkness (DK). Four groups of tree shrews (n = 7 per group) were used. Starting 24 days after normal eye opening (days of visual experience [DVE]), the ML group wore a monocular −5 D lens for 2 days. The FD group wore a monocular translucent diffuser for 2 days. The DK group experienced continuous darkness binocularly for 11 days, starting at 17 DVE. An age-matched normal group was examined at 26 DVE. Quantitative PCR was used to measure the relative (treated eye vs. control eye) differences in mRNA levels in the choroid for 77 candidate genes. Small myopic changes were observed in the treated eyes (relative to the control eyes) of the ML group (−1.0 ± 0.2 D; mean ± SEM) and FD group (−1.9 ± 0.2 D). A larger myopia developed in the DK group (−4.4 ± 1.0 D) relative to Normal eyes (both groups, mean of right and left eyes). In the ML group, 28 genes showed significant differential mRNA expression; eighteen were down-regulated. A very similar pattern occurred in the FD group; twenty-seven of the same genes were similarly regulated, along with five additional genes. Fewer expression differences in the DK group were significant compared to normal or the control eyes of the ML and FD groups, but the pattern was similar to that of the ML and FD differential expression patterns. These data suggest that, at the level of the choroid, the gene expression signatures produced by “GO” emmetropization signals are highly similar despite the different visual conditions. PMID:25072854

Molecular anatomy of the developing limb in the coquí frog, Eleutherodactylus coqui.

PubMed

Gross, Joshua B; Kerney, Ryan; Hanken, James; Tabin, Clifford J

2011-01-01

The vertebrate limb demonstrates remarkable similarity in basic organization across phylogenetically disparate groups. To gain further insight into how this morphological similarity is maintained in different developmental contexts, we explored the molecular anatomy of size-reduced embryos of the Puerto Rican coquí frog, Eleutherodactylus coqui. This animal demonstrates direct development, a life-history strategy marked by rapid progression from egg to adult and absence of a free-living, aquatic larva. Nonetheless, coquí exhibits a basal anuran limb structure, with four toes on the forelimb and five toes on the hind limb. We investigated the extent to which coquí limb bud development conforms to the model of limb development derived from amniote studies. Toward this end, we characterized dynamic patterns of expression for 13 critical patterning genes across three principle stages of limb development. As expected, most genes demonstrate expression patterns that are essentially unchanged compared to amniote species. For example, we identified an EcFgf8-expression domain within the apical ectodermal ridge (AER). This expression pattern defines a putatively functional AER signaling domain, despite the absence of a morphological ridge in coquí embryos. However, two genes, EcMeis2 and EcAlx4, demonstrate altered domains of expression, which imply a potential shift in gene function between coquí frogs and amniote model systems. Unexpectedly, several genes thought to be critical for limb patterning in other systems, including EcFgf4, EcWnt3a, EcWnt7a, and EcGremlin, demonstrated no evident expression pattern in the limb at the three stages we analyzed. The absence of EcFgf4 and EcWnt3a expression during limb patterning is perhaps not surprising, given that neither gene is critical for proper limb development in the mouse, based on knockout and expression analyses. In contrast, absence of EcWnt7a and EcGremlin is surprising, given that expression of these molecules appears to be absolutely essential in all other model systems so far examined. Although this analysis substantiates the existence of a core set of ancient limb-patterning molecules, which likely mediate identical functions across highly diverse vertebrate forms, it also reveals remarkable evolutionary flexibility in the genetic control of a conserved morphological pattern across evolutionary time. © 2011 Wiley Periodicals, Inc.

Discovering high-resolution patterns of differential DNA methylation that correlate with gene expression changes

PubMed Central

VanderKraats, Nathan D.; Hiken, Jeffrey F.; Decker, Keith F.; Edwards, John R.

2013-01-01

Methylation of the CpG-rich region (CpG island) overlapping a gene’s promoter is a generally accepted mechanism for silencing expression. While recent technological advances have enabled measurement of DNA methylation and expression changes genome-wide, only modest correlations between differential methylation at gene promoters and expression have been found. We hypothesize that stronger associations are not observed because existing analysis methods oversimplify their representation of the data and do not capture the diversity of existing methylation patterns. Recently, other patterns such as CpG island shore methylation and long partially hypomethylated domains have also been linked with gene silencing. Here, we detail a new approach for discovering differential methylation patterns associated with expression change using genome-wide high-resolution methylation data: we represent differential methylation as an interpolated curve, or signature, and then identify groups of genes with similarly shaped signatures and corresponding expression changes. Our technique uncovers a diverse set of patterns that are conserved across embryonic stem cell and cancer data sets. Overall, we find strong associations between these methylation patterns and expression. We further show that an extension of our method also outperforms other approaches by generating a longer list of genes with higher quality associations between differential methylation and expression. PMID:23748561

Clustering of change patterns using Fourier coefficients.

PubMed

Kim, Jaehee; Kim, Haseong

2008-01-15

To understand the behavior of genes, it is important to explore how the patterns of gene expression change over a time period because biologically related gene groups can share the same change patterns. Many clustering algorithms have been proposed to group observation data. However, because of the complexity of the underlying functions there have not been many studies on grouping data based on change patterns. In this study, the problem of finding similar change patterns is induced to clustering with the derivative Fourier coefficients. The sample Fourier coefficients not only provide information about the underlying functions, but also reduce the dimension. In addition, as their limiting distribution is a multivariate normal, a model-based clustering method incorporating statistical properties would be appropriate. This work is aimed at discovering gene groups with similar change patterns that share similar biological properties. We developed a statistical model using derivative Fourier coefficients to identify similar change patterns of gene expression. We used a model-based method to cluster the Fourier series estimation of derivatives. The model-based method is advantageous over other methods in our proposed model because the sample Fourier coefficients asymptotically follow the multivariate normal distribution. Change patterns are automatically estimated with the Fourier representation in our model. Our model was tested in simulations and on real gene data sets. The simulation results showed that the model-based clustering method with the sample Fourier coefficients has a lower clustering error rate than K-means clustering. Even when the number of repeated time points was small, the same results were obtained. We also applied our model to cluster change patterns of yeast cell cycle microarray expression data with alpha-factor synchronization. It showed that, as the method clusters with the probability-neighboring data, the model-based clustering with our proposed model yielded biologically interpretable results. We expect that our proposed Fourier analysis with suitably chosen smoothing parameters could serve as a useful tool in classifying genes and interpreting possible biological change patterns. The R program is available upon the request.

Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia

PubMed Central

Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J. V.; Schulz, Marcel H.; Simon, Martin

2015-01-01

Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. PMID:26231545

The homeobox gene mirror links EGF signalling to embryonic dorso-ventral axis formation through notch activation.

PubMed

Jordan, K C; Clegg, N J; Blasi, J A; Morimoto, A M; Sen, J; Stein, D; McNeill, H; Deng, W M; Tworoger, M; Ruohola-Baker, H

2000-04-01

Recent studies in vertebrates and Drosophila melanogaster have revealed that Fringe-mediated activation of the Notch pathway has a role in patterning cell layers during organogenesis. In these processes, a homeobox-containing transcription factor is responsible for spatially regulating fringe (fng) expression and thus directing activation of the Notch pathway along the fng expression border. Here we show that this may be a general mechanism for patterning epithelial cell layers. At three stages in Drosophila oogenesis, mirror (mirr) and fng have complementary expression patterns in the follicle-cell epithelial layer, and at all three stages loss of mirr enlarges, and ectopic expression of mirr restricts, fng expression, with consequences for follicle-cell patterning. These morphological changes are similar to those caused by Notch mutations. Ectopic expression of mirr in the posterior follicle cells induces a stripe of rhomboid (rho) expression and represses pipe (pip), a gene with a role in the establishment of the dorsal-ventral axis, at a distance. Ectopic Notch activation has a similar long-range effect on pip. Our results suggest that Mirror and Notch induce secretion of diffusible morphogens and we have identified TGF-beta (encoded by dpp) as such a molecule in germarium. We also found that mirr expression in dorsal follicle cells is induced by the EGF-receptor (EGFR) pathway and that mirr then represses pip expression in all but the ventral follicle cells, connecting EGFR activation in the dorsal follicle cells to repression of pip in the dorsal and lateral follicle cells. Our results suggest that the differentiation of ventral follicle cells is not a direct consequence of germline signalling, but depends on long-range signals from dorsal follicle cells, and provide a link between early and late events in Drosophila embryonic dorsal-ventral axis formation.

Development of the central nervous system in the larvacean Oikopleura dioica and the evolution of the chordate brain.

PubMed

Cañestro, Cristian; Bassham, Susan; Postlethwait, John

2005-09-15

In non-vertebrate chordates, central nervous system (CNS) development has been studied in only two taxa, the Cephalochordata and a single Class (Ascidiacea) of the morphologically diverse Urochordata. To understand development and molecular regionalization of the brain in a different deeply diverging chordate clade, we isolated and determined the expression patterns of orthologs of vertebrate CNS markers (otxa, otxb, otxc, pax6, pax2/5/8a, pax2/5/8b, engrailed, and hox1) in Oikopleura dioica (Subphylum Urochordata, Class Larvacea). The three Oikopleura otx genes are expressed similarly to vertebrate Otx paralogs, demonstrating that trans-homologs converged on similar evolutionary outcomes by independent neo- or subfunctionalization processes during the evolution of the two taxa. This work revealed that the Oikopleura CNS possesses homologs of the vertebrate forebrain, hindbrain, and spinal cord, but not the midbrain. Comparing larvacean gene expression patterns to published results in ascidians disclosed important developmental differences and similarities that suggest mechanisms of development likely present in their last common ancestor. In contrast to ascidians, the lack of a radical reorganization of the CNS as larvaceans become adults allows us to relate embryonic gene expression patterns to three subdivisions of the adult anterior brain. Our study of the Oikopleura brain provides new insights into chordate CNS evolution: first, the absence of midbrain is a urochordate synapomorphy and not a peculiarity of ascidians, perhaps resulting from their drastic CNS metamorphosis; second, there is no convincing evidence for a homolog of a midbrain-hindbrain boundary (MHB) organizer in urochordates; and third, the expression pattern of "MHB-genes" in the urochordate hindbrain suggests that they function in the development of specific neurons rather than in an MHB organizer.

Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

PubMed

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-12-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

Expression and evolution of Tiki1 and Tiki2 genes in vertebrates

PubMed Central

FEISTEL, KERSTIN; BRITO, JOSE M.; AMADO, NATHALIA G.; XU, CHIWEI; ABREU, JOSE G.; HE, XI

2015-01-01

Tiki1 is a Wnt protease and antagonist specifically expressed in the Spemann-Mangold Organizer and is required for head formation in Xenopus embryos. Here we report neighbor-joining phylogenetic analysis of vertebrate Tiki genes and their mRNA expression patterns in chick, mouse, and rabbit embryos. Tiki1 and Tiki2 orthologues are highly conserved, and exhibit similar but also different developmental expression patterns among the vertebrate/mammalian species analyzed. The Tiki1 gene is noticeably absent in the rodent lineage, but is present in lagomorphs and all other vertebrate/mammalian species examined. Expression in Hensen’s node, the equivalent of the Xenopus Organizer, was observed for Chick Tiki2 and Rabbit Tiki1 and Tiki2. Mouse Tiki2 was detected at low levels at gastrulation and head fold stages, but not in the node. Mouse Tiki2 and chick Tiki1 display similar expression in the dorsal spinal cord. Chick Tiki1 expression was also detected in the surface ectoderm and maxillary bud, while chick Tiki2 was found in the anterior intestinal portal, head mensenchyme and primitive atrium. Our expression analyses provide evidence that Tiki1 and Tiki2 are evolutionary conserved among vertebrate species and their expression in the Organizer and other regions suggests contributions of these Wnt inhibitors to embryonic patterning as well as organogenesis. Our analyses further reveal mis-regulation of TIKI1 and TIKI2 in human cancer and diseases. PMID:25354456

Hedgehog signaling regulates segment formation in the annelid Platynereis.

PubMed

Dray, Nicolas; Tessmar-Raible, Kristin; Le Gouar, Martine; Vibert, Laura; Christodoulou, Foteini; Schipany, Katharina; Guillou, Aurélien; Zantke, Juliane; Snyman, Heidi; Béhague, Julien; Vervoort, Michel; Arendt, Detlev; Balavoine, Guillaume

2010-07-16

Annelids and arthropods share a similar segmented organization of the body whose evolutionary origin remains unclear. The Hedgehog signaling pathway, prominent in arthropod embryonic segment patterning, has not been shown to have a similar function outside arthropods. We show that the ligand Hedgehog, the receptor Patched, and the transcription factor Gli are all expressed in striped patterns before the morphological appearance of segments in the annelid Platynereis dumerilii. Treatments with small molecules antagonistic to Hedgehog signaling disrupt segment formation. Platynereis Hedgehog is not necessary to establish early segment patterns but is required to maintain them. The molecular similarity of segment patterning functions of the Hedgehog pathway in an annelid and in arthropods supports a common origin of segmentation in protostomes.

Specifying and Sustaining Pigmentation Patterns in Domestic and Wild Cats

PubMed Central

Kaelin, Christopher B.; Xu, Xiao; Hong, Lewis Z.; David, Victor A.; McGowan, Kelly A.; Schmidt-Küntzel, Anne; Roelke, Melody E.; Pino, Javier; Pontius, Joan; Cooper, Gregory M.; Manuel, Hermogenes; Swanson, William F.; Marker, Laurie; Harper, Cindy K.; van Dyk, Ann; Yue, Bisong; Mullikin, James C.; Warren, Wesley C.; Eizirik, Eduardo; Kos, Lidia; O’Brien, Stephen J.; Barsh, Gregory S.; Menotti-Raymond, Marilyn

2013-01-01

Color markings among felid species display both a remarkable diversity and a common underlying periodicity. A similar range of patterns in domestic cats suggests a conserved mechanism whose appearance can be altered by selection. We identified the gene responsible for tabby pattern variation in domestic cats as Transmembrane aminopeptidase Q (Taqpep), which encodes a membrane-bound metalloprotease. Analyzing 31 other felid species, we identified Taqpep as the cause of the rare king cheetah phenotype, in which spots coalesce into blotches and stripes. Histologic, genomic expression, and transgenic mouse studies indicate that paracrine expression of Endothelin3 (Edn3) coordinates localized color differences. We propose a two-stage model in which Taqpep helps to establish a periodic pre-pattern during skin development that is later implemented by differential expression of Edn3. PMID:22997338

Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia.

PubMed

Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J V; Schulz, Marcel H; Simon, Martin

2015-08-01

Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

PubMed

Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

2015-12-01

The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.

Sho-saiko-to, a traditional herbal medicine, regulates gene expression and biological function by way of microRNAs in primary mouse hepatocytes

PubMed Central

2014-01-01

Background Sho-saiko-to (SST) (also known as so-shi-ho-tang or xiao-chai-hu-tang) has been widely prescribed for chronic liver diseases in traditional Oriental medicine. Despite the substantial amount of clinical evidence for SST, its molecular mechanism has not been clearly identified at a genome-wide level. Methods By using a microarray, we analyzed the temporal changes of messenger RNA (mRNA) and microRNA expression in primary mouse hepatocytes after SST treatment. The pattern of genes regulated by SST was identified by using time-series microarray analysis. The biological function of genes was measured by pathway analysis. For the identification of the exact targets of the microRNAs, a permutation-based correlation method was implemented in which the temporal expression of mRNAs and microRNAs were integrated. The similarity of the promoter structure between temporally regulated genes was measured by analyzing the transcription factor binding sites in the promoter region. Results The SST-regulated gene expression had two major patterns: (1) a temporally up-regulated pattern (463 genes) and (2) a temporally down-regulated pattern (177 genes). The integration of the genes and microRNA demonstrated that 155 genes could be the targets of microRNAs from the temporally up-regulated pattern and 19 genes could be the targets of microRNAs from the temporally down-regulated pattern. The temporally up-regulated pattern by SST was associated with signaling pathways such as the cell cycle pathway, whereas the temporally down-regulated pattern included drug metabolism-related pathways and immune-related pathways. All these pathways could be possibly associated with liver regenerative activity of SST. Genes targeted by microRNA were moreover associated with different biological pathways from the genes not targeted by microRNA. An analysis of promoter similarity indicated that co-expressed genes after SST treatment were clustered into subgroups, depending on the temporal expression patterns. Conclusions We are the first to identify that SST regulates temporal gene expression by way of microRNA. MicroRNA targets and non-microRNA targets moreover have different biological roles. This functional segregation by microRNA would be critical for the elucidation of the molecular activities of SST. PMID:24410935

Sho-saiko-to, a traditional herbal medicine, regulates gene expression and biological function by way of microRNAs in primary mouse hepatocytes.

PubMed

Song, Kwang Hoon; Kim, Yun Hee; Kim, Bu-Yeo

2014-01-11

Sho-saiko-to (SST) (also known as so-shi-ho-tang or xiao-chai-hu-tang) has been widely prescribed for chronic liver diseases in traditional Oriental medicine. Despite the substantial amount of clinical evidence for SST, its molecular mechanism has not been clearly identified at a genome-wide level. By using a microarray, we analyzed the temporal changes of messenger RNA (mRNA) and microRNA expression in primary mouse hepatocytes after SST treatment. The pattern of genes regulated by SST was identified by using time-series microarray analysis. The biological function of genes was measured by pathway analysis. For the identification of the exact targets of the microRNAs, a permutation-based correlation method was implemented in which the temporal expression of mRNAs and microRNAs were integrated. The similarity of the promoter structure between temporally regulated genes was measured by analyzing the transcription factor binding sites in the promoter region. The SST-regulated gene expression had two major patterns: (1) a temporally up-regulated pattern (463 genes) and (2) a temporally down-regulated pattern (177 genes). The integration of the genes and microRNA demonstrated that 155 genes could be the targets of microRNAs from the temporally up-regulated pattern and 19 genes could be the targets of microRNAs from the temporally down-regulated pattern. The temporally up-regulated pattern by SST was associated with signaling pathways such as the cell cycle pathway, whereas the temporally down-regulated pattern included drug metabolism-related pathways and immune-related pathways. All these pathways could be possibly associated with liver regenerative activity of SST. Genes targeted by microRNA were moreover associated with different biological pathways from the genes not targeted by microRNA. An analysis of promoter similarity indicated that co-expressed genes after SST treatment were clustered into subgroups, depending on the temporal expression patterns. We are the first to identify that SST regulates temporal gene expression by way of microRNA. MicroRNA targets and non-microRNA targets moreover have different biological roles. This functional segregation by microRNA would be critical for the elucidation of the molecular activities of SST.

Communication of emotions in vocal expression and music performance: different channels, same code?

PubMed

Juslin, Patrik N; Laukka, Petri

2003-09-01

Many authors have speculated about a close relationship between vocal expression of emotions and musical expression of emotions. but evidence bearing on this relationship has unfortunately been lacking. This review of 104 studies of vocal expression and 41 studies of music performance reveals similarities between the 2 channels concerning (a) the accuracy with which discrete emotions were communicated to listeners and (b) the emotion-specific patterns of acoustic cues used to communicate each emotion. The patterns are generally consistent with K. R. Scherer's (1986) theoretical predictions. The results can explain why music is perceived as expressive of emotion, and they are consistent with an evolutionary perspective on vocal expression of emotions. Discussion focuses on theoretical accounts and directions for future research.

Non-Smad TGF-β signaling components are possible biomarkers of tamoxifen resistance

NASA Astrophysics Data System (ADS)

Babyshkina, N.; Zavyalova, M.; Patalyak, S.; Dronova, T.; Slonimskaya, E.; Cherdyntseva, N.

2017-09-01

A crosstalk between the estrogen receptor alpha (ERα) and tyrosine kinase receptors contribute to endocrine resistance. We investigated the effect of the four Smad-independent TGF-β signaling components and the distribution pattern of ERα expression on the response to adjuvant tamoxifen treatment in 122 estrogen positive breast cancer patients. We identified a low mRNA expression of TGF-βR1 in tamoxifen resistant group patients (TR) in contrast to tamoxifen sensitive group (TS). Similarly, negative TGF-βR1 expression was significantly higher in TR patients than in TS patients. The expression of TGF-βR1 was strongly correlated with the distribution pattern of ERα expression, level of CD44+/CD24-/low cells and Akt (pS473) expression. The patients with a low mRNA expression of TGF-βR1 as well as with a negative TGF-βR1 expression had an unfavorable prognosis concerning progression-free survival. The expression of TGF-βR1 and the distribution pattern of ERα expression can be considered as additional molecular predictive markers for estrogen positive breast cancer patients treated with adjuvant tamoxifen.

A fuzzy pattern matching method based on graph kernel for lithography hotspot detection

NASA Astrophysics Data System (ADS)

Nitta, Izumi; Kanazawa, Yuzi; Ishida, Tsutomu; Banno, Koji

2017-03-01

In advanced technology nodes, lithography hotspot detection has become one of the most significant issues in design for manufacturability. Recently, machine learning based lithography hotspot detection has been widely investigated, but it has trade-off between detection accuracy and false alarm. To apply machine learning based technique to the physical verification phase, designers require minimizing undetected hotspots to avoid yield degradation. They also need a ranking of similar known patterns with a detected hotspot to prioritize layout pattern to be corrected. To achieve high detection accuracy and to prioritize detected hotspots, we propose a novel lithography hotspot detection method using Delaunay triangulation and graph kernel based machine learning. Delaunay triangulation extracts features of hotspot patterns where polygons locate irregularly and closely one another, and graph kernel expresses inner structure of graphs. Additionally, our method provides similarity between two patterns and creates a list of similar training patterns with a detected hotspot. Experiments results on ICCAD 2012 benchmarks show that our method achieves high accuracy with allowable range of false alarm. We also show the ranking of the similar known patterns with a detected hotspot.

Understanding human activity patterns based on space-time-semantics

NASA Astrophysics Data System (ADS)

Huang, Wei; Li, Songnian

2016-11-01

Understanding human activity patterns plays a key role in various applications in an urban environment, such as transportation planning and traffic forecasting, urban planning, public health and safety, and emergency response. Most existing studies in modeling human activity patterns mainly focus on spatiotemporal dimensions, which lacks consideration of underlying semantic context. In fact, what people do and discuss at some places, inferring what is happening at the places, cannot be simple neglected because it is the root of human mobility patterns. We believe that the geo-tagged semantic context, representing what individuals do and discuss at a place and a specific time, drives a formation of specific human activity pattern. In this paper, we aim to model human activity patterns not only based on space and time but also with consideration of associated semantics, and attempt to prove a hypothesis that similar mobility patterns may have different motivations. We develop a spatiotemporal-semantic model to quantitatively express human activity patterns based on topic models, leading to an analysis of space, time and semantics. A case study is conducted using Twitter data in Toronto based on our model. Through computing the similarities between users in terms of spatiotemporal pattern, semantic pattern and spatiotemporal-semantic pattern, we find that only a small number of users (2.72%) have very similar activity patterns, while the majority (87.14%) show different activity patterns (i.e., similar spatiotemporal patterns and different semantic patterns, similar semantic patterns and different spatiotemporal patterns, or different in both). The population of users that has very similar activity patterns is decreased by 56.41% after incorporating semantic information in the corresponding spatiotemporal patterns, which can quantitatively prove the hypothesis.

Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken.

PubMed

Yokoyama, Shigetoshi; Hashimoto, Megumi; Shimizu, Hirohito; Ueno-Kudoh, Hiroe; Uchibe, Kenta; Kimura, Ichiro; Asahara, Hiroshi

2008-02-01

The Caenorhabditis elegans heterochronic gene lin-28 regulates developmental timing in the nematode trunk. We report the dynamic expression patterns of Lin-28 homologues in mouse and chick embryos. Whole mount in situ hybridization revealed specific and intriguing expression patterns of Lin-28 in the developing mouse and chick limb bud. Mouse Lin-28 expression was detected in both the forelimb and hindlimb at E9.5, but disappeared from the forelimb at E10.5, and finally from the forelimb and hindlimb at E11.5. Chicken Lin-28, which was first detected in the limb primordium at stage 15/16, was also downregulated as the stage proceeded. The amino acid sequences of mouse and chicken Lin-28 genes are highly conserved and the similar expression patterns of Lin-28 during limb development in mouse and chicken suggest that this heterochronic gene is also conserved during vertebrate limb development.

Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

PubMed Central

Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

2002-01-01

The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

Patterns of Expression in the Matrix Proteins Responsible for Nucleation and Growth of Aragonite Crystals in Flat Pearls of Pinctada fucata

PubMed Central

Xiang, Liang; Su, Jingtan; Zheng, Guilan; Liang, Jian; Zhang, Guiyou; Wang, Hongzhong; Xie, Liping; Zhang, Rongqing

2013-01-01

The initial growth of the nacreous layer is crucial for comprehending the formation of nacreous aragonite. A flat pearl method in the presence of the inner-shell film was conducted to evaluate the role of matrix proteins in the initial stages of nacre biomineralization in vivo. We examined the crystals deposited on a substrate and the expression patterns of the matrix proteins in the mantle facing the substrate. In this study, the aragonite crystals nucleated on the surface at 5 days in the inner-shell film system. In the film-free system, the calcite crystals nucleated at 5 days, a new organic film covered the calcite, and the aragonite nucleated at 10 days. This meant that the nacre lamellae appeared in the inner-shell film system 5 days earlier than that in the film-free system, timing that was consistent with the maximum level of matrix proteins during the first 20 days. In addition, matrix proteins (Nacrein, MSI60, N19, N16 and Pif80) had similar expression patterns in controlling the sequential morphologies of the nacre growth in the inner-film system, while these proteins in the film-free system also had similar patterns of expression. These results suggest that matrix proteins regulate aragonite nucleation and growth with the inner-shell film in vivo. PMID:23776687

Differential expression and activation of Rab27A in human eosinophils: relationship to blood eosinophilia.

PubMed

Coughlin, Jason J; Odemuyiwa, Solomon O; Davidson, Courtney E; Moqbel, Redwan

2008-08-29

Eosinophil degranulation is thought to play a pathophysiological role in asthma. Rab27A is a GTP-binding protein that is known to be essential for the degranulation of several leukocyte subsets and thus may be essential for eosinophil granule exocytosis. Here, we show that Rab27A mRNA and protein are expressed in human eosinophils. We have developed a novel assay to assess Rab27A activation and have found a similar activation pattern of this protein upon stimulation of eosinophils, neutrophils and NK cells suggesting a similar function in these cell types. Interestingly, Rab27A expression was elevated in eosinophils from asthmatic donors. Furthermore, eosinophils from eosinophilic donors displayed more rapid Rab27A activation kinetics than those from donors with lower eosinophil counts. Given that elevated blood eosinophil numbers correlate with increased priming of eosinophils, this pattern of Rab27A activation suggests differential protein expression in activated cells may allow eosinophils to degranulate more rapidly upon stimulation.

Characterization of basal gene expression trends over a diurnal cycle in Xiphophorus maculatus skin, brain and liver.

PubMed

Lu, Yuan; Reyes, Jose; Walter, Sean; Gonzalez, Trevor; Medrano, Geraldo; Boswell, Mikki; Boswell, William; Savage, Markita; Walter, Ronald

2018-06-01

Evolutionarily conserved diurnal circadian mechanisms maintain oscillating patterns of gene expression based on the day-night cycle. Xiphophorus fish have been used to evaluate transcriptional responses after exposure to various light sources and it was determined that each source incites distinct genetic responses in skin tissue. However, basal expression levels of genes that show oscillating expression patterns in day-night cycle, may affect the outcomes of such experiments, since basal gene expression levels at each point in the circadian path may influence the profile of identified light responsive genes. Lack of knowledge regarding diurnal fluctuations in basal gene expression patterns may confound the understanding of genetic responses to external stimuli (e.g., light) since the dynamic nature of gene expression implies animals subjected to stimuli at different times may be at very different stages within the continuum of genetic homeostasis. We assessed basal gene expression changes over a 24-hour period in 200 select Xiphophorus gene targets known to transcriptionally respond to various types of light exposure. We identified 22 genes in skin, 36 genes in brain and 28 genes in liver that exhibit basal oscillation of expression patterns. These genes, including known circadian regulators, produced the expected expression patterns over a 24-hour cycle when compared to circadian regulatory genes identified in other species, especially human and other vertebrate animal models. Our results suggest the regulatory network governing diurnal oscillating gene expression is similar between Xiphophorus and other vertebrates for the three Xiphophorus organs tested. In addition, we were able to categorize light responsive gene sets in Xiphophorus that do, and do not, exhibit circadian based oscillating expression patterns. Copyright © 2017 Elsevier Inc. All rights reserved.

Evidence of drug-response heterogeneity rapidly generated from a single cancer cell.

PubMed

Wang, Rong; Jin, Chengmeng; Hu, Xun

2017-06-20

One cancer cell line is believed to be composed of numerous clones with different drug sensitivity. We sought to investigate the difference of drug-response pattern in clones from a cell line or from a single cell. We showed that 22 clones derived from 4T1 cells were drastically different from each other with respect to drug-response pattern against 11 anticancer drugs and expression profile of 19 genes associated with drug resistance or sensitivity. Similar results were obtained using daughter clones derived from a single 4T1 cell. Each daughter clone showed distinct drug-response pattern and gene expression profile. Similar results were also obtained using Bcap37 cells. We conclude that a single cancer cell can rapidly produce a population of cells with high heterogeneity of drug response and the acquisition of drug-response heterogeneity is random.

Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

PubMed Central

Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

2013-01-01

The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

Modelling the perceptual similarity of facial expressions from image statistics and neural responses.

PubMed

Sormaz, Mladen; Watson, David M; Smith, William A P; Young, Andrew W; Andrews, Timothy J

2016-04-01

The ability to perceive facial expressions of emotion is essential for effective social communication. We investigated how the perception of facial expression emerges from the image properties that convey this important social signal, and how neural responses in face-selective brain regions might track these properties. To do this, we measured the perceptual similarity between expressions of basic emotions, and investigated how this is reflected in image measures and in the neural response of different face-selective regions. We show that the perceptual similarity of different facial expressions (fear, anger, disgust, sadness, happiness) can be predicted by both surface and feature shape information in the image. Using block design fMRI, we found that the perceptual similarity of expressions could also be predicted from the patterns of neural response in the face-selective posterior superior temporal sulcus (STS), but not in the fusiform face area (FFA). These results show that the perception of facial expression is dependent on the shape and surface properties of the image and on the activity of specific face-selective regions. Copyright © 2016 Elsevier Inc. All rights reserved.

Cultural similarities and differences in perceiving and recognizing facial expressions of basic emotions.

PubMed

Yan, Xiaoqian; Andrews, Timothy J; Young, Andrew W

2016-03-01

The ability to recognize facial expressions of basic emotions is often considered a universal human ability. However, recent studies have suggested that this commonality has been overestimated and that people from different cultures use different facial signals to represent expressions (Jack, Blais, Scheepers, Schyns, & Caldara, 2009; Jack, Caldara, & Schyns, 2012). We investigated this possibility by examining similarities and differences in the perception and categorization of facial expressions between Chinese and white British participants using whole-face and partial-face images. Our results showed no cultural difference in the patterns of perceptual similarity of expressions from whole-face images. When categorizing the same expressions, however, both British and Chinese participants were slightly more accurate with whole-face images of their own ethnic group. To further investigate potential strategy differences, we repeated the perceptual similarity and categorization tasks with presentation of only the upper or lower half of each face. Again, the perceptual similarity of facial expressions was similar between Chinese and British participants for both the upper and lower face regions. However, participants were slightly better at categorizing facial expressions of their own ethnic group for the lower face regions, indicating that the way in which culture shapes the categorization of facial expressions is largely driven by differences in information decoding from this part of the face. (c) 2016 APA, all rights reserved).

Gene expression profiling in Ishikawa cells: A fingerprint for estrogen active compounds

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boehme, Kathleen; Simon, Stephanie; Mueller, Stefan O.

2009-04-01

Several anthropogenous and naturally occurring substances, referred to as estrogen active compounds (EACs), are able to interfere with hormone and in particular estrogen receptor signaling. EACs can either cause adverse health effects in humans and wildlife populations or have beneficial effects on estrogen-dependent diseases. The aim of this study was to examine global gene expression profiles in estrogen receptor (ER)-proficient Ishikawa plus and ER-deficient Ishikawa minus endometrial cancer cells treated with selected well-known EACs (Diethylstilbestrol, Genistein, Zearalenone, Resveratrol, Bisphenol A and o,p'-DDT). We also investigated the effect of the pure antiestrogen ICI 182,780 (ICI) on the expression patterns caused bymore » these compounds. Transcript levels were quantified 24 h after compound treatment using Illumina BeadChip Arrays. We identified 87 genes with similar expression changes in response to all EAC treatments in Ishikawa plus. ICI lowered the magnitude or reversed the expression of these genes, indicating ER dependent regulation. Apart from estrogenic gene regulation, Bisphenol A, o,p'-DDT, Zearalenone, Genistein and Resveratrol displayed similarities to ICI in their expression patterns, suggesting mixed estrogenic/antiestrogenic properties. In particular, the predominant antiestrogenic expression response of Resveratrol could be clearly distinguished from the other test compounds, indicating a distinct mechanism of action. Divergent gene expression patterns of the phytoestrogens, as well as weaker estrogenic gene expression regulation determined for the anthropogenous chemicals Bisphenol A and o,p'-DDT, warrants a careful assessment of potential detrimental and/or beneficial effects of EACs. The characteristic expression fingerprints and the identified subset of putative marker genes can be used for screening chemicals with an unknown mode of action and for predicting their potential to exert endocrine disrupting effects.« less

Rheumatic Heart Disease and Myxomatous Degeneration: Differences and Similarities of Valve Damage Resulting from Autoimmune Reactions and Matrix Disorganization.

PubMed

Martins, Carlo de Oliveira; Demarchi, Lea; Ferreira, Frederico Moraes; Pomerantzeff, Pablo Maria Alberto; Brandao, Carlos; Sampaio, Roney Orismar; Spina, Guilherme Sobreira; Kalil, Jorge; Cunha-Neto, Edecio; Guilherme, Luiza

2017-01-01

Autoimmune inflammatory reactions leading to rheumatic fever (RF) and rheumatic heart disease (RHD) result from untreated Streptococcus pyogenes throat infections in individuals who exhibit genetic susceptibility. Immune effector mechanisms have been described that lead to heart tissue damage culminating in mitral and aortic valve dysfunctions. In myxomatous valve degeneration (MXD), the mitral valve is also damaged due to non-inflammatory mechanisms. Both diseases are characterized by structural valve disarray and a previous proteomic analysis of them has disclosed a distinct profile of matrix/structural proteins differentially expressed. Given their relevance in organizing valve tissue, we quantitatively evaluated the expression of vimentin, collagen VI, lumican, and vitronectin as well as performed immunohistochemical analysis of their distribution in valve tissue lesions of patients in both diseases. We identified abundant expression of two isoforms of vimentin (45 kDa, 42 kDa) with reduced expression of the full-size protein (54 kDa) in RHD valves. We also found increased vitronectin expression, reduced collagen VI expression and similar lumican expression between RHD and MXD valves. Immunohistochemical analysis indicated disrupted patterns of these proteins in myxomatous degeneration valves and disorganized distribution in rheumatic heart disease valves that correlated with clinical manifestations such as valve regurgitation or stenosis. Confocal microscopy analysis revealed a diverse pattern of distribution of collagen VI and lumican into RHD and MXD valves. Altogether, these results demonstrated distinct patterns of altered valve expression and tissue distribution/organization of structural/matrix proteins that play important pathophysiological roles in both valve diseases.

Alternative splicing of the tyrosinase gene transcript in normal human melanocytes and lymphocytes.

PubMed

Fryer, J P; Oetting, W S; Brott, M J; King, R A

2001-11-01

We have identified and isolated ectopically expressed tyrosinase transcripts in normal human melanocytes and lymphocytes and in a human melanoma (MNT-1) cell line to establish a baseline for the expression pattern of this gene in normal tissue. Tyrosinase mRNA from human lymphoblastoid cell lines was reverse transcribed and amplified using specific "nested" primers. This amplification yielded eight identifiable transcripts; five that resulted from alternative splicing patterns arising from the utilization of normal and alternative splice sequences. Identical splicing patterns were found in transcripts from human primary melanocytes in culture and a melanoma cell line, indicating that lymphoblastoid cell lines provide an accurate reflection of transcript processing in melanocytes. Similar splicing patterns have also been found with murine melanocyte tyrosinase transcripts. Our results demonstrate that alternative splicing of human tyrosinase gene transcript produces a number of predictable and identifiable transcripts, and that human lymphoblastoid cell lines provide a source of ectopically expressed transcripts that can be used to study the biology of tyrosinase gene expression in humans.

Stem Cell-Associated Marker Expression in Canine Hair Follicles

PubMed Central

Gerhards, Nora M.; Sayar, Beyza S.; Origgi, Francesco C.; Galichet, Arnaud; Müller, Eliane J.; Welle, Monika M.; Wiener, Dominique J.

2016-01-01

Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. PMID:26739040

Stem Cell-Associated Marker Expression in Canine Hair Follicles.

PubMed

Gerhards, Nora M; Sayar, Beyza S; Origgi, Francesco C; Galichet, Arnaud; Müller, Eliane J; Welle, Monika M; Wiener, Dominique J

2016-03-01

Functional hair follicle (HF) stem cells (SCs) are crucial to maintain the constant recurring growth of hair. In mice and humans, SC subpopulations with different biomarker expression profiles have been identified in discrete anatomic compartments of the HF. The rare studies investigating canine HF SCs have shown similarities in biomarker expression profiles to that of mouse and human SCs. The aim of our study was to broaden the current repertoire of SC-associated markers and their expression patterns in the dog. We combined analyses on the expression levels of CD34, K15, Sox9, CD200, Nestin, LGR5 and LGR6 in canine skin using RT-qPCR, the corresponding proteins in dog skin lysates, and their expression patterns in canine HFs using immunohistochemistry. Using validated antibodies, we were able to define the location of CD34, Sox9, Keratin15, LGR5 and Nestin in canine HFs and confirm that all tested biomarkers are expressed in canine skin. Our results show similarities between the expression profile of canine, human and mouse HF SC markers. This repertoire of biomarkers will allow us to conduct functional studies and investigate alterations in the canine SC compartment of different diseases, like alopecia or skin cancer with the possibility to extend relevant findings to human patients. © 2016 The Histochemical Society.

Identification and analysis of CYP450 genes from transcriptome of Lonicera japonica and expression analysis of chlorogenic acid biosynthesis related CYP450s.

PubMed

Qi, Xiwu; Yu, Xu; Xu, Daohua; Fang, Hailing; Dong, Ke; Li, Weilin; Liang, Chengyuan

2017-01-01

Lonicera japonica is an important medicinal plant that has been widely used in traditional Chinese medicine for thousands of years. The pharmacological activities of L. japonica are mainly due to its rich natural active ingredients, most of which are secondary metabolites. CYP450s are a large, complex, and widespread superfamily of proteins that participate in many endogenous and exogenous metabolic reactions, especially secondary metabolism. Here, we identified CYP450s in L. japonica transcriptome and analyzed CYP450s that may be involved in chlorogenic acid (CGA) biosynthesis. The recent availability of L. japonica transcriptome provided opportunity to identify CYP450s in this herb. BLAST based method and HMM based method were used to identify CYP450s in L. japonica transcriptome. Then, phylogenetic analysis, conserved motifs analysis, GO annotation, and KEGG annotation analyses were conducted to characterize the identified CYP450s. qRT-PCR was used to explore expression patterns of five CGA biosynthesis related CYP450s. In this study, 151 putative CYP450s with complete cytochrome P450 domain, which belonged to 10 clans, 45 families and 76 subfamilies, were identified in L. japonica transcriptome. Phylogenetic analysis classified these CYP450s into two major branches, A-type (47%) and non-A type (53%). Both types of CYP450s had conserved motifs in L. japonica . The differences of typical motif sequences between A-type and non-A type CYP450s in L. japonica were similar with other plants. GO classification indicated that non-A type CYP450s participated in more molecular functions and biological processes than A-type. KEGG pathway annotation totally assigned 47 CYP450s to 25 KEGG pathways. From these data, we cloned two LjC3Hs (CYP98A subfamily) and three LjC4Hs (CYP73A subfamily) that may be involved in biosynthesis of CGA, the major ingredient for pharmacological activities of L. japonica . qRT-PCR results indicated that two LjC3Hs exhibited oppositing expression patterns during the flower development and LjC3H2 exhibited a similar expression pattern with CGA concentration measured by HPLC. The expression patterns of three LjC4Hs were quite different and the expression pattern of LjC4H3 was quite similar with that of LjC3H1 . Our results provide a comprehensive identification and characterization of CYP450s in L. japonica . Five CGA biosynthesis related CYP450s were cloned and their expression patterns were explored. The different expression patterns of two LjC3Hs and three LjC4Hs may be due to functional divergence of both substrate and catalytic specificity during plant evolution. The co-expression pattern of LjC3H1 and LjC4H3 strongly suggested that they were under coordinated regulation by the same transcription factors due to same cis elements in their promoters. In conclusion, this study provides insight into CYP450s and will effectively facilitate the research of biosynthesis of CGA in L. japonica .

A dehydration-inducible gene in the truffle Tuber borchii identifies a novel group of dehydrins

PubMed Central

Abba', Simona; Ghignone, Stefano; Bonfante, Paola

2006-01-01

Background The expressed sequence tag M6G10 was originally isolated from a screening for differentially expressed transcripts during the reproductive stage of the white truffle Tuber borchii. mRNA levels for M6G10 increased dramatically during fruiting body maturation compared to the vegetative mycelial stage. Results Bioinformatics tools, phylogenetic analysis and expression studies were used to support the hypothesis that this sequence, named TbDHN1, is the first dehydrin (DHN)-like coding gene isolated in fungi. Homologs of this gene, all defined as "coding for hypothetical proteins" in public databases, were exclusively found in ascomycetous fungi and in plants. Although complete (or almost complete) fungal genomes and EST collections of some Basidiomycota and Glomeromycota are already available, DHN-like proteins appear to be represented only in Ascomycota. A new and previously uncharacterized conserved signature pattern was identified and proposed to Uniprot database as the main distinguishing feature of this new group of DHNs. Expression studies provide experimental evidence of a transcript induction of TbDHN1 during cellular dehydration. Conclusion Expression pattern and sequence similarities to known plant DHNs indicate that TbDHN1 is the first characterized DHN-like protein in fungi. The high similarity of TbDHN1 with homolog coding sequences implies the existence of a novel fungal/plant group of LEA Class II proteins characterized by a previously undescribed signature pattern. PMID:16512918

Isolation of a transcription factor expressed in neural crest from the region of 22q11 deleted in DiGeorge syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wadey, R.; Roberts, C.; Daw, S.

1994-09-01

Deletions within chromosome 22q11 cause a wide variety of birth defects including DiGeorge syndrome and Shprintzen syndrome. We have defined a commonly deleted region of over 2 Mb, and a critical region of 300 kb. A gene, TUPLE1, has been isolated from this critical region encoding a transcriptional regulator similar to the yeast HIR1 histone regulator gene. Since it has been suggested that DGS results from a defective neural crest, the expression of Tuple1 was examined in whole mouse and chick embryos, tissue sections and neural tube explants: Tuple1 is expressed in a dynamic pattern with high levels in regionsmore » containing migrating crest. Prior to crest migration Tuple1 is expressed in a rhombomere-specific expression pattern. Later Tuple1 is expressed in discrete domains within the developing neural tube. A remarkable feature of the experiments was the detection of a similar dynamic pattern with sense probe; i.e., there is an antisense Tuple1 transcript. This was confirmed using RPA. Tuple1 is being screened for mutations in non-deletion patients and constructs assembled for homologous recombination in ES cells. Tuple1 maps to MMU16 extending the homology of linkage with human chromosome 22. From these data we predict that the human homologue of the murine scid mutation maps to 22q11.« less

Gene expression analysis of the ovary of hybrid females of Xenopus laevis and X. muelleri

PubMed Central

2008-01-01

Background Interspecific hybrids of frogs of the genus Xenopus result in sterile hybrid males and fertile hybrid females. Previous work has demonstrated a dramatic asymmetrical pattern of misexpression in hybrid males compared to the two parental species with relatively few genes misexpressed in comparisons of hybrids and the maternal species (X. laevis) and dramatically more genes misexpressed in hybrids compared to the paternal species (X. muelleri). In this work, we examine the gene expression pattern in hybrid females of X. laevis × X. muelleri to determine if this asymmetrical pattern of expression also occurs in hybrid females. Results We find a similar pattern of asymmetry in expression compared to males in that there were more genes differentially expressed between hybrids and X. muelleri compared to hybrids and X. laevis. We also found a dramatic increase in the number of misexpressed genes with hybrid females having about 20 times more genes misexpressed in ovaries compared to testes of hybrid males and therefore the match between phenotype and expression pattern is not supported. Conclusion We discuss these intriguing findings in the context of reproductive isolation and suggest that divergence in female expression may be involved in sterility of hybrid males due to the inherent sensitivity of spermatogenesis as defined by the faster male evolution hypothesis for Haldane's rule. PMID:18331635

Arabidopsis gene expression patterns during spaceflight

NASA Astrophysics Data System (ADS)

Paul, A.-L.; Ferl, R. J.

The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments resulted in the differential expression of hundreds of genes. A 5 day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β -Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on two fronts. First, expression patterns visualized with the Adh/GUS transgene were used to address specifically the possibility that spaceflight induces a hypoxic stress response, and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. (Paul et al., Plant Physiol. 2001, 126:613). Second, genome-wide patterns of native gene expression were evaluated utilizing the Affymetrix ATH1 GeneChip? array of 8,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes identified with the arrays was further characterized with quantitative Real-Time RT PCR (ABI - TaqmanTM). Comparison of the patterns of expression for arrays of hybridized with RNA isolated from plants exposed to spaceflight compared to the control arrays revealed hundreds of genes that were differentially expressed in response to spaceflight, yet most genes that are hallmarks of hypoxic stress were unaffected. These results will be discussed in light of current models for plant responses to the spaceflight environment, and with regard to potential future flight opportunities.

Imprinted expression in cystic embryoid bodies shows an embryonic and not an extra-embryonic pattern

PubMed Central

Kulinski, Tomasz M.; Casari, M. Rita T.; Guenzl, Philipp M.; Wenzel, Daniel; Andergassen, Daniel; Hladik, Anastasiya; Datlinger, Paul; Farlik, Matthias; Theussl, H. -Christian; Penninger, Josef M.; Knapp, Sylvia; Bock, Christoph; Barlow, Denise P.; Hudson, Quanah J.

2015-01-01

A large subset of mammalian imprinted genes show extra-embryonic lineage (EXEL) specific imprinted expression that is restricted to placental trophectoderm lineages and to visceral yolk sac endoderm (ysE). Isolated ysE provides a homogenous in vivo model of a mid-gestation extra-embryonic tissue to examine the mechanism of EXEL-specific imprinted gene silencing, but an in vitro model of ysE to facilitate more rapid and cost-effective experiments is not available. Reports indicate that ES cells differentiated into cystic embryoid bodies (EBs) contain ysE, so here we investigate if cystic EBs model ysE imprinted expression. The imprinted expression pattern of cystic EBs is shown to resemble fetal liver and not ysE. To investigate the reason for this we characterized the methylome and transcriptome of cystic EBs in comparison to fetal liver and ysE, by whole genome bisulphite sequencing and RNA-seq. Cystic EBs show a fetal liver pattern of global hypermethylation and low expression of repeats, while ysE shows global hypomethylation and high expression of IAPEz retroviral repeats, as reported for placenta. Transcriptome analysis confirmed that cystic EBs are more similar to fetal liver than ysE and express markers of early embryonic endoderm. Genome-wide analysis shows that ysE shares epigenetic and repeat expression features with placenta. Contrary to previous reports, we show that cystic EBs do not contain ysE, but are more similar to the embryonic endoderm of fetal liver. This explains why cystic EBs reproduce the imprinted expression seen in the embryo but not that seen in the ysE. PMID:25912690

Microarray and comparative genomics-based identification of genes and gene regulatory regions of the mouse immune system

PubMed Central

Hutton, John J; Jegga, Anil G; Kong, Sue; Gupta, Ashima; Ebert, Catherine; Williams, Sarah; Katz, Jonathan D; Aronow, Bruce J

2004-01-01

Background In this study we have built and mined a gene expression database composed of 65 diverse mouse tissues for genes preferentially expressed in immune tissues and cell types. Using expression pattern criteria, we identified 360 genes with preferential expression in thymus, spleen, peripheral blood mononuclear cells, lymph nodes (unstimulated or stimulated), or in vitro activated T-cells. Results Gene clusters, formed based on similarity of expression-pattern across either all tissues or the immune tissues only, had highly significant associations both with immunological processes such as chemokine-mediated response, antigen processing, receptor-related signal transduction, and transcriptional regulation, and also with more general processes such as replication and cell cycle control. Within-cluster gene correlations implicated known associations of known genes, as well as immune process-related roles for poorly described genes. To characterize regulatory mechanisms and cis-elements of genes with similar patterns of expression, we used a new version of a comparative genomics-based cis-element analysis tool to identify clusters of cis-elements with compositional similarity among multiple genes. Several clusters contained genes that shared 5–6 cis-elements that included ETS and zinc-finger binding sites. cis-Elements AP2 EGRF ETSF MAZF SP1F ZF5F and AREB ETSF MZF1 PAX5 STAT were shared in a thymus-expressed set; AP4R E2FF EBOX ETSF MAZF SP1F ZF5F and CREB E2FF MAZF PCAT SP1F STAT cis-clusters occurred in activated T-cells; CEBP CREB NFKB SORY and GATA NKXH OCT1 RBIT occurred in stimulated lymph nodes. Conclusion This study demonstrates a series of analytic approaches that have allowed the implication of genes and regulatory elements that participate in the differentiation, maintenance, and function of the immune system. Polymorphism or mutation of these could adversely impact immune system functions. PMID:15504237

Dual odontogenic origins develop at the early stage of rat maxillary incisor development.

PubMed

Kriangkrai, Rungarun; Iseki, Sachiko; Eto, Kazuhiro; Chareonvit, Suconta

2006-03-01

Developmental process of rat maxillary incisor has been studied through histological analysis and investigation of tooth-related gene expression patterns at initial tooth development. The tooth-related genes studied here are fibroblast growth factor-8 (Fgf-8), pituitary homeobox gene-2 (Pitx-2), sonic hedgehog (Shh), muscle segment homeobox-1 (Msx-1), paired box-9 (Pax-9) and bone morphogenetic protein-4 (Bmp-4). The genes are expressed in oral epithelium and/or ectomesenchyme at the stage of epithelial thickening to the early bud stage of tooth development. Both the histological observation and tooth-related gene expression patterns during early stage of maxillary incisor development demonstrate that dual odontogenic origins aligned medio-laterally in the medial nasal process develop, subsequently only single functional maxillary incisor dental placode forms. The cascade of tooth-related gene expression patterns in rat maxillary incisor studied here is quite similar to those of the previous studies in mouse mandibular molar, even though the origins of oral epithelium and ectomesenchyme involved in development of maxillary incisor and mandibular molar are different. Thus, we conclude that maxillary incisor and mandibular molar share a similar signaling control of Fgf-8, Pitx-2, Shh, Msx-1, Pax-9 and Bmp-4 genes at the stage of oral epithelial thickening to the early bud stage of tooth development.

Analysis of Sigma Receptor (σR1) expression in retinal ganglion cells cultured under hyperglycemic conditions and in diabetic mice

PubMed Central

Ola, M. Shamsul; Moore, Pamela; Maddox, Dennis; El-Sherbeny, Amira; Huang, Wei; Roon, Penny; Agarwal, Neeraj; Ganapathy, Vadivel; Smith, Sylvia B.

2013-01-01

Summary The type 1 sigma receptor (σR1) is a nonopiate and nonphencyclidine binding site that has numerous pharmacological and physiological functions. In some studies, agonists for σR1 have been shown to afford neuroprotective against overstimulation of the NMDA receptor. σR1 expression has been demonstrated recently in retinal ganglion cells (RGC). RGCs undergo apoptosis early in diabetic retinopathy via NMDA receptor overstimulation. In the present study we asked whether RGCs cultured under hyperglycemic conditions and RGCs of diabetic mice continue to express σ1. RGCs were cultured 48 h in RPMI medium containing either 45 mM glucose or 11 mM glucose plus 34 mM mannitol (osmolar control). C57BL/6 mice were made diabetic using streptozotocin. The retina was dissected from normal and streptozotocin-induced diabetic mice 3, 6 and 12 weeks post-onset of diabetes. σR1 was analyzed in cells using semiquantitative RT-PCR and in tissues σR1 by semiquantitative RT-PCR, in situ hybridization, western blot analysis and immunolocalization. The RT-PCR analysis of cultured RGCs showed that σR1 mRNA is expressed under hyperglycemic conditions at levels similar to control cells. Similarly, analysis of retinas of diabetic mice showed no difference in levels of mRNA encoding σR1 compared to retinas of control mice. In situ hybridization analysis showed that expression patterns of σR1 mRNA in the ganglion cell layer were similar between diabetic and control mice. Western blot analysis suggested that levels of σR1 in retina were similar between diabetic and control retinas. Immunohistochemical analysis of σR1 showed a similar pattern of σR1 protein expression between control and diabetic retina. These studies demonstrate that σR1 is expressed under hyperglycemic conditions in vitro and in vivo. PMID:12425939

Analysis of sigma receptor (sigmaR1) expression in retinal ganglion cells cultured under hyperglycemic conditions and in diabetic mice.

PubMed

Ola, M Shamsul; Moore, Pamela; Maddox, Dennis; El-Sherbeny, Amira; Huang, Wei; Roon, Penny; Agarwal, Neeraj; Ganapathy, Vadivel; Smith, Sylvia B

2002-11-15

The type 1 sigma receptor (sigmaR1) is a nonopiate and nonphencyclidine binding site that has numerous pharmacological and physiological functions. In some studies, agonists for sigmaR1 have been shown to afford neuroprotection against overstimulation of the NMDA receptor. sigmaR1 expression has been demonstrated recently in retinal ganglion cells (RGC). RGCs undergo apoptosis early in diabetic retinopathy via NMDA receptor overstimulation. In the present study we asked whether RGCs cultured under hyperglycemic conditions and RGCs of diabetic mice continue to express sigmaR1. RGCs were cultured 48 h in RPMI medium containing either 45 mM glucose or 11 mM glucose plus 34 mM mannitol (osmolar control). C57BL/6 mice were made diabetic using streptozotocin. The retina was dissected from normal and streptozotocin-induced diabetic mice 3, 6 and 12 weeks post-onset of diabetes. sigmaR1 was analyzed in cells using semiquantitative RT-PCR and in tissues by semiquantitative RT-PCR, in situ hybridization, Western blot analysis and immunolocalization. The RT-PCR analysis of cultured RGCs showed that sigmaR1 mRNA is expressed under hyperglycemic conditions at levels similar to control cells. Similarly, analysis of retinas of diabetic mice showed no difference in levels of mRNA encoding sigmaR1 compared to retinas of control mice. In situ hybridization analysis showed that expression patterns of sigmaR1 mRNA in the ganglion cell layer were similar between diabetic and control mice. Western blot analysis suggested that levels of sigmaR1 in retina were similar between diabetic and control retinas. Immunohistochemical analysis of sigmaR1 showed a similar pattern of sigmaR1 protein expression between control and diabetic retina. These studies demonstrate that sigmaR1 is expressed under hyperglycemic conditions in vitro and in vivo.

Expression patterns of the aquaporin gene family during renal development: influence of genetic variability.

PubMed

Parreira, Kleber S; Debaix, Huguette; Cnops, Yvette; Geffers, Lars; Devuyst, Olivier

2009-08-01

High-throughput analyses have shown that aquaporins (AQPs) belong to a cluster of genes that are differentially expressed during kidney organogenesis. However, the spatiotemporal expression patterns of the AQP gene family during tubular maturation and the potential influence of genetic variation on these patterns and on water handling remain unknown. We investigated the expression patterns of all AQP isoforms in fetal (E13.5 to E18.5), postnatal (P1 to P28), and adult (9 weeks) kidneys of inbred (C57BL/6J) and outbred (CD-1) mice. Using quantitative polymerase chain reaction (PCR), we evidenced two mRNA patterns during tubular maturation in C57 mice. The AQPs 1-7-11 showed an early (from E14.5) and progressive increase to adult levels, similar to the mRNA pattern observed for proximal tubule markers (Megalin, NaPi-IIa, OAT1) and reflecting the continuous increase in renal cortical structures during development. By contrast, AQPs 2-3-4 showed a later (E15.5) and more abrupt increase, with transient postnatal overexpression. Most AQP genes were expressed earlier and/or stronger in maturing CD-1 kidneys. Furthermore, adult CD-1 kidneys expressed more AQP2 in the collecting ducts, which was reflected by a significant delay in excreting a water load. The expression patterns of proximal vs. distal AQPs and the earlier expression in the CD-1 strain were confirmed by immunoblotting and immunostaining. These data (1) substantiate the clustering of important genes during tubular maturation and (2) demonstrate that genetic variability influences the regulation of the AQP gene family during tubular maturation and water handling by the mature kidney.

Systems analysis of cis-regulatory motifs in C4 photosynthesis genes using maize and rice leaf transcriptomic data during a process of de-etiolation

PubMed Central

Xu, Jiajia; Bräutigam, Andrea; Weber, Andreas P. M.; Zhu, Xin-Guang

2016-01-01

Identification of potential cis-regulatory motifs controlling the development of C4 photosynthesis is a major focus of current research. In this study, we used time-series RNA-seq data collected from etiolated maize and rice leaf tissues sampled during a de-etiolation process to systematically characterize the expression patterns of C4-related genes and to further identify potential cis elements in five different genomic regions (i.e. promoter, 5′UTR, 3′UTR, intron, and coding sequence) of C4 orthologous genes. The results demonstrate that although most of the C4 genes show similar expression patterns, a number of them, including chloroplast dicarboxylate transporter 1, aspartate aminotransferase, and triose phosphate transporter, show shifted expression patterns compared with their C3 counterparts. A number of conserved short DNA motifs between maize C4 genes and their rice orthologous genes were identified not only in the promoter, 5′UTR, 3′UTR, and coding sequences, but also in the introns of core C4 genes. We also identified cis-regulatory motifs that exist in maize C4 genes and also in genes showing similar expression patterns as maize C4 genes but that do not exist in rice C3 orthologs, suggesting a possible recruitment of pre-existing cis-elements from genes unrelated to C4 photosynthesis into C4 photosynthesis genes during C4 evolution. PMID:27436282

Neuronal expression of fibroblast growth factor receptors in zebrafish.

PubMed

Rohs, Patricia; Ebert, Alicia M; Zuba, Ania; McFarlane, Sarah

2013-12-01

Fibroblast growth factor (FGF) signaling is important for a host of developmental processes such as proliferation, differentiation, tissue patterning, and morphogenesis. In vertebrates, FGFs signal through a family of four fibroblast growth factor receptors (FGFR 1-4), one of which is duplicated in zebrafish (FGFR1). Here we report the mRNA expression of the five known zebrafish fibroblast growth factor receptors at five developmental time points (24, 36, 48, 60, and 72h postfertilization), focusing on expression within the central nervous system. We show that the receptors have distinct and dynamic expression in the developing zebrafish brain, eye, inner ear, lateral line, and pharynx. In many cases, the expression patterns are similar to those of homologous FGFRs in mouse, chicken, amphibians, and other teleosts. Copyright © 2013 Elsevier B.V. All rights reserved.

Analysis of TLR7, SOCS1 and ISG15 immune genes expression in the peripheral blood of responder and non-responder patients with chronic Hepatitis C

PubMed Central

Dowran, Razieh; Sarvari, Jamal; Moattari, Afagh; Fattahi, Mohammad-Reza; Ramezani, Amin; Hosseini, Seyed Younes

2017-01-01

Aim: To evaluate the baseline expression of the immune genes in PBMCs of responder and non-responder patients with chronic Hepatitis C. Background: Although the contribution of peripheral blood mononuclear cell (PBMC) gene expression in treatment outcome of hepatitis C virus (HCV) infection is supposed, it has remained to be distinctly delineated. The baseline expression of the immune genes inside PBMCs may reflect the responsiveness status following IFN treatment. Methods: Totally, 22 chronic HCV encompasses 10 responders and 12 non-responsive cases enrolled randomly regarding medical records. The PBMCs from the peripheral blood samples were isolated and then incubated for 6 hours in the culture media. The baseline expression of TLR7, SOCS1 and ISG15 was measured by Real time PCR. Results: The gene expression pattern in PBMCs of both groups showed a similar trend. The expression of SOCS1 and TLR7 genes showed higher levels in non-responder group (P>0.05). The result of ISG15 showed a higher but non-significant expression in the responder group (P>0.05). Conclusion: The similar pattern of TLR7, SOCS1 and ISG15 expression in the responder and non-responder patients indicated their poor discriminating and predictive value in PBMCs sample. PMID:29379591

Unstable genomes elevate transcriptome dynamics

PubMed Central

Stevens, Joshua B.; Liu, Guo; Abdallah, Batoul Y.; Horne, Steven D.; Ye, Karen J.; Bremer, Steven W.; Ye, Christine J.; Krawetz, Stephen A.; Heng, Henry H.

2015-01-01

The challenge of identifying common expression signatures in cancer is well known, however the reason behind this is largely unclear. Traditionally variation in expression signatures has been attributed to technological problems, however recent evidence suggests that chromosome instability (CIN) and resultant karyotypic heterogeneity may be a large contributing factor. Using a well-defined model of immortalization, we systematically compared the pattern of genome alteration and expression dynamics during somatic evolution. Co-measurement of global gene expression and karyotypic alteration throughout the immortalization process reveals that karyotype changes influence gene expression as major structural and numerical karyotypic alterations result in large gene expression deviation. Replicate samples from stages with stable genomes are more similar to each other than are replicate samples with karyotypic heterogeneity. Karyotypic and gene expression change during immortalization is dynamic as each stage of progression has a unique expression pattern. This was further verified by comparing global expression in two replicates grown in one flask with known karyotypes. Replicates with higher karyotypic instability were found to be less similar than replicates with stable karyotypes. This data illustrates the karyotype, transcriptome, and transcriptome determined pathways are in constant flux during somatic cellular evolution (particularly during the macroevolutionary phase) and this flux is an inextricable feature of CIN and essential for cancer formation. The findings presented here underscore the importance of understanding the evolutionary process of cancer in order to design improved treatment modalities. PMID:24122714

Microarray Analysis Gene Expression Profiles in Laryngeal Muscle After Recurrent Laryngeal Nerve Injury.

PubMed

Bijangi-Vishehsaraei, Khadijeh; Blum, Kevin; Zhang, Hongji; Safa, Ahmad R; Halum, Stacey L

2016-03-01

The pathophysiology of recurrent laryngeal nerve (RLN) transection injury is rare in that it is characteristically followed by a high degree of spontaneous reinnervation, with reinnervation of the laryngeal adductor complex (AC) preceding that of the abducting posterior cricoarytenoid (PCA) muscle. Here, we aim to elucidate the differentially expressed myogenic factors following RLN injury that may be at least partially responsible for the spontaneous reinnervation. F344 male rats underwent RLN injury (n = 12) or sham surgery (n = 12). One week after RLN injury, larynges were harvested following euthanasia. The mRNA was extracted from PCA and AC muscles bilaterally, and microarray analysis was performed using a full rat genome array. Microarray analysis of denervated AC and PCA muscles demonstrated dramatic differences in gene expression profiles, with 205 individual probes that were differentially expressed between the denervated AC and PCA muscles and only 14 genes with similar expression patterns. The differential expression patterns of the AC and PCA suggest different mechanisms of reinnervation. The PCA showed the gene patterns of Wallerian degeneration, while the AC expressed the gene patterns of reinnervation by adjacent axonal sprouting. This finding may reveal important therapeutic targets applicable to RLN and other peripheral nerve injuries. © The Author(s) 2015.

Mono-allelic expression of variegating transgene locus in the mouse.

PubMed

Opsahl, Margaret L; Springbett, Anthea; Lathe, Richard; Colman, Alan; McClenaghan, Margaret; Whitelaw, C Bruce A

2003-12-01

We have generated transgenic mice which express an ovine beta-lactoglobulin transgene during lactation. In two transgenic lines, BLG/7 and BLG/45, beta-lactoglobulin protein levels vary between siblings, reflected at the cellular level by a mosaic transgene expression pattern in the mammary tissue that is reminiscent of position effect variegation. To investigate whether this variegating expression profile can be affected by the introduction of an identical variegating locus on the homologous chromosome, we compared the beta-lactoglobulin expression profiles in mice hemizygous or homozygous for the transgene locus. In BLG/45 mice, milk protein analysis revealed that transgene expression was effectively doubled in homozygous compared to hemizygous mice. In contrast, beta-lactoglobulin protein in hemizygous and homozygous BLG/7 mice displayed a similar range; although minimum expression levels were doubled in the homozygous population, the maximum level of expression was indistinguishable between the two populations. Fluorescent in situ hybridisation (FISH) for transgene mRNA indicated that for a given protein level, the extent of cellular expression is similar in both BLG/7 populations. In homozygous mice genomic DNA and nuclear RNA FISH demonstrated that only one of the two BLG/7 loci is active in expressing cells, while two transcription foci were present in BLG/45 homozygous mice. This mono-allelic transgene expression pattern is not inherited through the germline, as hemizygous mice bred from homozygous parents expressed at the expected hemizygous population level. We discuss these observations in the context of known epigenetic events such as imprinting and trans-inactivation.

Patterning of anteroposterior body axis displayed in the expression of Hox genes in sea cucumber Apostichopus japonicus.

PubMed

Kikuchi, Mani; Omori, Akihito; Kurokawa, Daisuke; Akasaka, Koji

2015-09-01

The presence of an anteroposterior body axis is a fundamental feature of bilateria. Within this group, echinoderms have secondarily evolved pentameral symmetric body plans. Although all echinoderms present bilaterally symmetric larval stages, they dramatically rearrange their body axis and develop a pentaradial body plan during metamorphosis. Therefore, the location of their anteroposterior body axis in adult forms remains a contentious issue. Unlike other echinoderms, sea cucumbers present an obvious anteroposterior axis not rearranged during metamorphosis, thus representing an interesting group to study their anteroposterior axis patterning. Hox genes are known to play a broadly conserved role in anteroposterior axis patterning in deuterostomes. Here, we report the expression patterns of Hox genes from early development to pentactula stage in sea cucumber. In early larval stages, five Hox genes (AjHox1, AjHox7, AjHox8, AjHox11/13a, and AjHox11/13b) were expressed sequentially along the archenteron, suggesting that the role of anteroposterior patterning of the Hox genes is conserved in bilateral larvae of echinoderms. In doliolaria and pentactula stages, eight Hox genes (AjHox1, AjHox5, AjHox7, AjHox8, AjHox9/10, AjHox11/13a, AjHox11/13b, and AjHox11/13c) were expressed sequentially along the digestive tract, following a similar expression pattern to that found in the visceral mesoderm of other bilateria. Unlike other echinoderms, pentameral expression patterns of AjHox genes were not observed in sea cucumber. Altogether, we concluded that AjHox genes are involved in the patterning of the digestive tract in both larvae and metamorphosis of sea cucumbers. In addition, the anteroposterior axis in sea cucumbers might be patterned like that of other bilateria.

Expression of ABA Metabolism-Related Genes Suggests Similarities and Differences Between Seed Dormancy and Bud Dormancy of Peach (Prunus persica)

PubMed Central

Wang, Dongling; Gao, Zhenzhen; Du, Peiyong; Xiao, Wei; Tan, Qiuping; Chen, Xiude; Li, Ling; Gao, Dongsheng

2016-01-01

Dormancy inhibits seed and bud growth of perennial plants until the environmental conditions are optimal for survival. Previous studies indicated that certain co-regulation pathways exist in seed and bud dormancy. In our study, we found that seed and bud dormancy are similar to some extent but show different reactions to chemical treatments that induce breaking of dormancy. Whether the abscisic acid (ABA) regulatory networks are similar in dormant peach seeds and buds is not well known; however, ABA is generally believed to play a critical role in seed and bud dormancy. In peach, some genes putatively involved in ABA synthesis and catabolism were identified and their expression patterns were studied to learn more about ABA homeostasis and the possible crosstalk between bud dormancy and seed dormancy mechanisms. The analysis demonstrated that two 9-cis-epoxycarotenoid dioxygenase-encoding genes seem to be key in regulating ABA biosynthesis to induce seed and bud dormancy. Three CYP707As play an overlapping role in controlling ABA inactivation, resulting in dormancy-release. In addition, Transcript analysis of ABA metabolism-related genes was much similar demonstrated that ABA pathways was similar in the regulation of vegetative and flower bud dormancy, whereas, expression patterns of ABA metabolism-related genes were different in seed dormancy showed that ABA pathway maybe different in regulating seed dormancy in peach. PMID:26793222

Cortical responses to dynamic emotional facial expressions generalize across stimuli, and are sensitive to task-relevance, in adults with and without Autism.

PubMed

Kliemann, Dorit; Richardson, Hilary; Anzellotti, Stefano; Ayyash, Dima; Haskins, Amanda J; Gabrieli, John D E; Saxe, Rebecca R

2018-06-01

Individuals with Autism Spectrum Disorders (ASD) report difficulties extracting meaningful information from dynamic and complex social cues, like facial expressions. The nature and mechanisms of these difficulties remain unclear. Here we tested whether that difficulty can be traced to the pattern of activity in "social brain" regions, when viewing dynamic facial expressions. In two studies, adult participants (male and female) watched brief videos of a range of positive and negative facial expressions, while undergoing functional magnetic resonance imaging (Study 1: ASD n = 16, control n = 21; Study 2: ASD n = 22, control n = 30). Patterns of hemodynamic activity differentiated among facial emotional expressions in left and right superior temporal sulcus, fusiform gyrus, and parts of medial prefrontal cortex. In both control participants and high-functioning individuals with ASD, we observed (i) similar responses to emotional valence that generalized across facial expressions and animated social events; (ii) similar flexibility of responses to emotional valence, when manipulating the task-relevance of perceived emotions; and (iii) similar responses to a range of emotions within valence. Altogether, the data indicate that there was little or no group difference in cortical responses to isolated dynamic emotional facial expressions, as measured with fMRI. Difficulties with real-world social communication and social interaction in ASD may instead reflect differences in initiating and maintaining contingent interactions, or in integrating social information over time or context. Copyright © 2018 Elsevier Ltd. All rights reserved.

Dynamic expression of the LAP family of genes during early development of Xenopus tropicalis.

PubMed

Yang, Qiutan; Lv, Xiaoyan; Kong, Qinghua; Li, Chaocui; Zhou, Qin; Mao, Bingyu

2011-10-01

The leucine-rich repeats and PDZ (LAP) family of genes are crucial for the maintenance of cell polarity as well as for epithelial homeostasis and tumor suppression in both vertebrates and invertebrates. Four members of this gene family are known: densin, erbin, scribble and lano. Here, we identified the four members of the LAP gene family in Xenopus tropicalis and studied their expression patterns during embryonic development. The Xenopus LAP proteins show a conserved domain structure that is similar to their homologs in other vertebrates. In Xenopus embryos, these genes were detected in animal cap cells at the early gastrula stage. At later stages of development, they were widely expressed in epithelial tissues that are highly polar in nature, including the neural epithelia, optic and otic vesicles, and in the pronephros. These data suggest that the roles of the Xenopus LAP genes in the control of cell polarity and morphogenesis are conserved during early development. Erbin and lano show similar expression patterns in the developing head, suggesting potential functional interactions between the two molecules in vivo.

Divergent T-Cell Cytokine Patterns in Inflammatory Arthritis

NASA Astrophysics Data System (ADS)

Simon, A. K.; Seipelt, E.; Sieper, J.

1994-08-01

A major immunoregulatory mechanism in inflammatory infections and allergic diseases is the control of the balance of cytokines secreted by Th1/Th2 subsets of T helper (Th) cells. This might also be true in autoimmune diseases; a Th2 pattern that prevents an effective immune response in infections with intracellular bacteria may favor immunosuppression in autoimmune diseases. The pattern of cytokine expression was compared in the synovial tissue from patients with a typical autoimmune disease, rheumatoid arthritis, and with a disorder with similar synovial pathology but driven by persisting exogenous antigen, reactive arthritis. We screened 12 rheumatoid and 9 reactive arthritis synovial tissues by PCR and in situ hybridization for their expression of T-cell cytokines. The cytokine pattern differs significantly between the two diseases; rheumatoid arthritis samples express a Th1-like pattern whereas in reactive arthritis interferon γ expression is accompanied by that of interleukin 4. Studying the expression of cytokines by in situ hybridization confirmed the results found by PCR; they also show an extremely low frequency of cytokine-transcribing cells. In a double-staining experiment, it was demonstrated that interleukin 4 is made by CD4 cells. These experiments favor the possibility of therapeutic intervention in inflammatory rheumatic diseases by means of inhibitory cytokines.

Genome-wide analyses of four major histone modifications in Arabidopsis hybrids at the germinating seed stage.

PubMed

Zhu, Anyu; Greaves, Ian K; Dennis, Elizabeth S; Peacock, W James

2017-02-07

Hybrid vigour (heterosis) has been used for decades in cropping agriculture, especially in the production of maize and rice, because hybrid varieties exceed their parents in plant biomass and seed yield. The molecular basis of hybrid vigour is not fully understood. Previous studies have suggested that epigenetic systems could play a role in heterosis. In this project, we investigated genome-wide patterns of four histone modifications in Arabidopsis hybrids in germinating seeds. We found that although hybrids have similar histone modification patterns to the parents in most regions of the genome, they have altered patterns at specific loci. A small subset of genes show changes in histone modifications in the hybrids that correlate with changes in gene expression. Our results also show that genome-wide patterns of histone modifications in geminating seeds parallel those at later developmental stages of seedlings. Ler/C24 hybrids showed similar genome-wide patterns of histone modifications as the parents at an early germination stage. However, a small subset of genes, such as FLC, showed correlated changes in histone modification and in gene expression in the hybrids. The altered patterns of histone modifications for those genes in hybrids could be related to some heterotic traits in Arabidopsis, such as flowering time, and could play a role in hybrid vigour establishment.

In vitro patterning of pluripotent stem cell-derived intestine recapitulates in vivo human development.

PubMed

Tsai, Yu-Hwai; Nattiv, Roy; Dedhia, Priya H; Nagy, Melinda S; Chin, Alana M; Thomson, Matthew; Klein, Ophir D; Spence, Jason R

2017-03-15

The intestine plays a central role in digestion, nutrient absorption and metabolism, with individual regions of the intestine having distinct functional roles. Many examples of region-specific gene expression in the adult intestine are known, but how intestinal regional identity is established during development is a largely unresolved issue. Here, we have identified several genes that are expressed in a region-specific manner in the developing human intestine. Using human embryonic stem cell-derived intestinal organoids, we demonstrate that the duration of exposure to active FGF and WNT signaling controls regional identity. Short-term exposure to FGF4 and CHIR99021 (a GSK3β inhibitor that stabilizes β-catenin) resulted in organoids with gene expression patterns similar to developing human duodenum, whereas longer exposure resulted in organoids similar to ileum. When region-specific organoids were transplanted into immunocompromised mice, duodenum-like organoids and ileum-like organoids retained their regional identity, demonstrating that regional identity of organoids is stable after initial patterning occurs. This work provides insights into the mechanisms that control regional specification of the developing human intestine and provides new tools for basic and translational research. © 2017. Published by The Company of Biologists Ltd.

Pigment cell interactions and differential xanthophore recruitment underlying zebrafish stripe reiteration and Danio pattern evolution

PubMed Central

Patterson, Larissa B.; Bain, Emily J.; Parichy, David M.

2014-01-01

Fishes have diverse pigment patterns, yet mechanisms of pattern evolution remain poorly understood. In zebrafish, Danio rerio, pigment-cell autonomous interactions generate dark stripes of melanophores that alternate with light interstripes of xanthophores and iridophores. Here, we identify mechanisms underlying the evolution of a uniform pattern in D. albolineatus in which all three pigment cell classes are intermingled. We show that in this species xanthophores differentiate precociously over a wider area, and that cis regulatory evolution has increased expression of xanthogenic Colony Stimulating Factor-1 (Csf1). Expressing Csf1 similarly in D. rerio has cascading effects, driving the intermingling of all three pigment cell classes and resulting in the loss of stripes, as in D. albolineatus. Our results identify novel mechanisms of pattern development and illustrate how pattern diversity can be generated when a core network of pigment-cell autonomous interactions is coupled with changes in pigment cell differentiation. PMID:25374113

A gene expression profile indicative of early stage HER2 targeted therapy response.

PubMed

O'Neill, Fiona; Madden, Stephen F; Clynes, Martin; Crown, John; Doolan, Padraig; Aherne, Sinéad T; O'Connor, Robert

2013-07-01

Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor.Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents.

A gene expression profile indicative of early stage HER2 targeted therapy response

PubMed Central

2013-01-01

Background Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Results Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. Conclusions In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor. Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents. PMID:23816254

Circadian Clock Gene Expression in the Coral Favia fragum over Diel and Lunar Reproductive Cycles

PubMed Central

Hoadley, Kenneth D.; Szmant, Alina M.; Pyott, Sonja J.

2011-01-01

Natural light cycles synchronize behavioral and physiological cycles over varying time periods in both plants and animals. Many scleractinian corals exhibit diel cycles of polyp expansion and contraction entrained by diel sunlight patterns, and monthly cycles of spawning or planulation that correspond to lunar moonlight cycles. The molecular mechanisms for regulating such cycles are poorly understood. In this study, we identified four molecular clock genes (cry1, cry2, clock and cycle) in the scleractinian coral, Favia fragum, and investigated patterns of gene expression hypothesized to be involved in the corals' diel polyp behavior and lunar reproductive cycles. Using quantitative PCR, we measured fluctuations in expression of these clock genes over both diel and monthly spawning timeframes. Additionally, we assayed gene expression and polyp expansion-contraction behavior in experimental corals in normal light:dark (control) or constant dark treatments. Well-defined and reproducible diel patterns in cry1, cry2, and clock expression were observed in both field-collected and the experimental colonies maintained under control light:dark conditions, but no pattern was observed for cycle. Colonies in the control light:dark treatment also displayed diel rhythms of tentacle expansion and contraction. Experimental colonies in the constant dark treatment lost diel patterns in cry1, cry2, and clock expression and displayed a diminished and less synchronous pattern of tentacle expansion and contraction. We observed no pattern in cry1, cry2, clock, or cycle expression correlated with monthly spawning events suggesting these genes are not involved in the entrainment of reproductive cycles to lunar light cycles in F. fragum. Our results suggest a molecular clock mechanism, potentially similar to that in described in fruit flies, exists within F. fragum. PMID:21573070

An immunohistochemical study of APG-2 protein in the rat hippocampus after transient forebrain ischemia.

PubMed

Lee, Mun-Yong; Choi, Yun-Sik; Choi, Jeong-Sun; Min, Do Sik; Chun, Myung-Hoon; Kim, Ok Nyu; Lee, Sang Bok; Kim, Seong Yun

2002-01-11

The cellular localization and spatiotemporal expression pattern of APG-2 protein, a member of the heat shock protein 110 family, were investigated in the rat hippocampus after transient forebrain ischemia. The spatiotemporal patterns of immunoreactivity of both APG-2 and glial fibrillary acidic protein were very similar, indicating that reactive astrocytes express APG-2, which was confirmed by double immunofluorescence histochemistry. Colocalization of APG-2 and a neuronal marker NeuN in the neurons of the CA2 and CA3 subfields was also confirmed.

Psychosocial and Biological Markers of Daily Lives of Midlife Parents of Children with Disabilities*

PubMed Central

Seltzer, Marsha Mailick; Almeida, David M.; Greenberg, Jan S.; Savla, Jyoti; Stawski, Robert S.; Hong, Jinkuk; Taylor, Julie Lounds

2009-01-01

Using daily telephone interviews, 82 midlife parents (mean age = 57.4) of children with disabilities (mean age = 29.9) were compared with a closely matched sample of unaffected parents (n = 82) to elucidate the daily experience of nonnormative parenting. In addition, salivary cortisol samples were obtained to examine whether parents of children with disabilities had dysregulated diurnal rhythms and the extent to which the amount of time spent with children was associated with divergent patterns of cortisol expression. We found that parents of children with disabilities had similar patterns of daily time use and similar likelihood of positive daily events as the comparison group, but they had elevated levels of stress, negative affect, and physical symptoms, all reported on a daily basis. In addition, their diurnal rhythm of cortisol expression differed significantly from the comparison group, a pattern that was strongest for parents of children with disabilities on days when they spent more time with their children. PMID:19413131

Three-Dimensional Gene Map of Cancer Cell Types: Structural Entropy Minimisation Principle for Defining Tumour Subtypes

PubMed Central

Li, Angsheng; Yin, Xianchen; Pan, Yicheng

2016-01-01

In this study, we propose a method for constructing cell sample networks from gene expression profiles, and a structural entropy minimisation principle for detecting natural structure of networks and for identifying cancer cell subtypes. Our method establishes a three-dimensional gene map of cancer cell types and subtypes. The identified subtypes are defined by a unique gene expression pattern, and a three-dimensional gene map is established by defining the unique gene expression pattern for each identified subtype for cancers, including acute leukaemia, lymphoma, multi-tissue, lung cancer and healthy tissue. Our three-dimensional gene map demonstrates that a true tumour type may be divided into subtypes, each defined by a unique gene expression pattern. Clinical data analyses demonstrate that most cell samples of an identified subtype share similar survival times, survival indicators and International Prognostic Index (IPI) scores and indicate that distinct subtypes identified by our algorithms exhibit different overall survival times, survival ratios and IPI scores. Our three-dimensional gene map establishes a high-definition, one-to-one map between the biologically and medically meaningful tumour subtypes and the gene expression patterns, and identifies remarkable cells that form singleton submodules. PMID:26842724

Establishment of embryonic neuroepithelial cell lines exhibiting an epiplastic expression pattern of region specific markers.

PubMed

Nardelli, Jeannette; Catala, Martin; Charnay, Patrick

2003-09-15

Neuroepithelial b2T cells were derived from the hindbrain and the spinal cord of mouse transgenic embryos, which expressed SV40 T antigen under the control of a Hoxb2 enhancer. Strikingly, b2T cell lines of either origin exhibit a very similar gene expression pattern, including markers of the hindbrain and the spinal cord, such as Hox genes, but not of more anterior cephalic regions. In addition, the broad expression pattern of b2T cells, probably linked to culture conditions, appeared to be appropriately modulated when the cells were reimplanted at different longitudinal levels into chick host embryos, suggesting that these cells are responsive to exogenous signalling mechanisms. Further support for these allegations was obtained by culturing b2T cells in defined medium and by assessing the expression of Krox20, an odd-numbered rhombomere marker, which appeared to be modulated by a complex interplay between FGF, retinoic acid (RA), and noggin. With respect to these as yet unique properties, b2T cells constitute an original alternative tool to in vivo models for the analysis of molecular pathways involved in the patterning of the neural tube. Copyright 2003 Wiley-Liss, Inc.

Diametrical clustering for identifying anti-correlated gene clusters.

PubMed

Dhillon, Inderjit S; Marcotte, Edward M; Roshan, Usman

2003-09-01

Clustering genes based upon their expression patterns allows us to predict gene function. Most existing clustering algorithms cluster genes together when their expression patterns show high positive correlation. However, it has been observed that genes whose expression patterns are strongly anti-correlated can also be functionally similar. Biologically, this is not unintuitive-genes responding to the same stimuli, regardless of the nature of the response, are more likely to operate in the same pathways. We present a new diametrical clustering algorithm that explicitly identifies anti-correlated clusters of genes. Our algorithm proceeds by iteratively (i). re-partitioning the genes and (ii). computing the dominant singular vector of each gene cluster; each singular vector serving as the prototype of a 'diametric' cluster. We empirically show the effectiveness of the algorithm in identifying diametrical or anti-correlated clusters. Testing the algorithm on yeast cell cycle data, fibroblast gene expression data, and DNA microarray data from yeast mutants reveals that opposed cellular pathways can be discovered with this method. We present systems whose mRNA expression patterns, and likely their functions, oppose the yeast ribosome and proteosome, along with evidence for the inverse transcriptional regulation of a number of cellular systems.

MicroRNA expression patterns in indeterminate inflammatory bowel disease.

PubMed

Lin, Jingmei; Cao, Qi; Zhang, Jianjun; Li, Yong; Shen, Bo; Zhao, Zijin; Chinnaiyan, Arul M; Bronner, Mary P

2013-01-01

A diagnosis of idiopathic inflammatory bowel disease requires synthesis of clinical, radiographic, endoscopic, surgical, and histologic data. While most cases of inflammatory bowel disease can be specifically classified as either ulcerative colitis or Crohns disease, 5-10% of patients have equivocal features placing them into the indeterminate colitis category. This study examines whether microRNA biomarkers assist in the classification of classically diagnosed indeterminate inflammatory bowel disease. Fresh frozen colonic mucosa from the distal-most part of the colectomy from 53 patients was used (16 indeterminate colitis, 14 Crohns disease, 12 ulcerative colitis, and 11 diverticular disease controls). Total RNA extraction and quantitative reverse-transcription-PCR was performed using five pairs of microRNA primers (miR-19b, miR-23b, miR-106a, miR-191, and miR-629). Analysis of variance was performed assessing differences among the groups. A significant difference in expressions of miR-19b, miR-106a, and miR-629 was detected between ulcerative colitis and Crohns disease groups (P<0.05). The average expression level of all five microRNAs was statistically different between indeterminate colitis and Crohns disease groups (P<0.05); no significant difference was present between indeterminate and ulcerative colitis groups. Among the 16 indeterminate colitis patients, 15 showed ulcerative colitis-like and one Crohns disease-like microRNA pattern. MicroRNA expression patterns in indeterminate colitis are far more similar to those of ulcerative colitis than Crohns disease. MicroRNA expression patterns of indeterminate colitis provide molecular evidence indicating that most cases are probably ulcerative colitis-similar to the data from long-term clinical follow-up studies. Validation of microRNA results by additional long-term outcome data is needed, but the data presented show promise for improved classification of indeterminate inflammatory bowel disease.

Self-similar transmission patterns induced by magnetic field effects in graphene

NASA Astrophysics Data System (ADS)

Rodríguez-González, R.; Rodríguez-Vargas, I.; Díaz-Guerrero, D. S.; Gaggero-Sager, L. M.

2018-07-01

In this work we study the propagation of Dirac electrons through Cantor-like structures in graphene. In concrete, we are considering structures with magnetic and electrostatic barriers arrange in Cantor-like fashion. The Dirac-like equation and the transfer matrix approach have been used to obtain the transmission properties. We found self-similar patterns in the transmission probability or transmittance once the magnetic field is incorporated. Moreover, these patterns can be connected with other ones at different scales through well-defined scaling rules. In particular, we have found two scaling rules that become a useful tool to describe the self-similarity of our system. The first expression is related to the generation and the second one to the length of the Cantor-like structure. As far as we know it is the first time that a special self-similar structure in conjunction with magnetic field effects give rise to self-similar transmission patterns. It is also important to remark that according to our knowledge it is fundamental to break some symmetry of graphene in order to obtain self-similar transmission properties. In fact, in our case the time-reversal symmetry is broken by the magnetic field effects.

EXTRA-EMBRYONIC-SPECIFIC IMPRINTED EXPRESSION IS RESTRICTED TO DEFINED LINEAGES IN THE POST-IMPLANTATION EMBRYO

PubMed Central

Hudson, Quanah J.; Seidl, Christine I.M.; Kulinski, Tomasz M.; Huang, Ru; Warczok, Katarzyna E.; Bittner, Romana; Bartolomei, Marisa S.; Barlow, Denise P.

2011-01-01

A subset of imprinted genes in the mouse have been reported to show imprinted expression that is restricted to the placenta, a short-lived extra-embryonic organ. Notably these so-called 'placental-specific' imprinted genes are expressed from both parental alleles in embryo and adult tissues. The placenta is an embryonic-derived organ that is closely associated with maternal tissue and as a consequence, maternal contamination can be mistaken for maternal-specific imprinted expression. The complexity of the placenta, which arises from multiple embryonic lineages, poses additional problems in accurately assessing allele-specific repressive epigenetic modifications in genes that also show lineage-specific silencing in this organ. These problems require that extra evidence be obtained to support the imprinted status of genes whose imprinted expression is restricted to the placenta. We show here that the extra-embryonic visceral yolk sac (VYS), a nutritive membrane surrounding the developing embryo, shows a similar 'extra-embryonic-lineage-specific' pattern of imprinted expression. We present an improved enzymatic technique for separating the bilaminar VYS and show that this pattern of imprinted expression is restricted to the endoderm layer. Finally, we show that VYS 'extra-embryonic-lineage-specific' imprinted expression is regulated by DNA methylation in a similar manner as shown for genes showing multi-lineage imprinted expression in extra-embryonic, embryonic and adult tissues. These results show that the VYS is an improved model for studying the epigenetic mechanisms regulating extra-embryonic-lineage-specific imprinted expression. PMID:21354127

Deep sequencing of the Mexican avocado transcriptome, an ancient angiosperm with a high content of fatty acids.

PubMed

Ibarra-Laclette, Enrique; Méndez-Bravo, Alfonso; Pérez-Torres, Claudia Anahí; Albert, Victor A; Mockaitis, Keithanne; Kilaru, Aruna; López-Gómez, Rodolfo; Cervantes-Luevano, Jacob Israel; Herrera-Estrella, Luis

2015-08-13

Avocado (Persea americana) is an economically important tropical fruit considered to be a good source of fatty acids. Despite its importance, the molecular and cellular characterization of biochemical and developmental processes in avocado is limited due to the lack of transcriptome and genomic information. The transcriptomes of seeds, roots, stems, leaves, aerial buds and flowers were determined using different sequencing platforms. Additionally, the transcriptomes of three different stages of fruit ripening (pre-climacteric, climacteric and post-climacteric) were also analyzed. The analysis of the RNAseqatlas presented here reveals strong differences in gene expression patterns between different organs, especially between root and flower, but also reveals similarities among the gene expression patterns in other organs, such as stem, leaves and aerial buds (vegetative organs) or seed and fruit (storage organs). Important regulators, functional categories, and differentially expressed genes involved in avocado fruit ripening were identified. Additionally, to demonstrate the utility of the avocado gene expression atlas, we investigated the expression patterns of genes implicated in fatty acid metabolism and fruit ripening. A description of transcriptomic changes occurring during fruit ripening was obtained in Mexican avocado, contributing to a dynamic view of the expression patterns of genes involved in fatty acid biosynthesis and the fruit ripening process.

Evolution of bilaterian central nervous systems: a single origin?

PubMed Central

2013-01-01

The question of whether the ancestral bilaterian had a central nervous system (CNS) or a diffuse ectodermal nervous system has been hotly debated. Considerable evidence supports the theory that a CNS evolved just once. However, an alternative view proposes that the chordate CNS evolved from the ectodermal nerve net of a hemichordate-like ancestral deuterostome, implying independent evolution of the CNS in chordates and protostomes. To specify morphological divisions along the anterior/posterior axis, this ancestor used gene networks homologous to those patterning three organizing centers in the vertebrate brain: the anterior neural ridge, the zona limitans intrathalamica and the isthmic organizer, and subsequent evolution of the vertebrate brain involved elaboration of these ancestral signaling centers; however, all or part of these signaling centers were lost from the CNS of invertebrate chordates. The present review analyzes the evidence for and against these theories. The bulk of the evidence indicates that a CNS evolved just once – in the ancestral bilaterian. Importantly, in both protostomes and deuterostomes, the CNS represents a portion of a generally neurogenic ectoderm that is internalized and receives and integrates inputs from sensory cells in the remainder of the ectoderm. The expression patterns of genes involved in medio/lateral (dorso/ventral) patterning of the CNS are similar in protostomes and chordates; however, these genes are not similarly expressed in the ectoderm outside the CNS. Thus, their expression is a better criterion for CNS homologs than the expression of anterior/posterior patterning genes, many of which (for example, Hox genes) are similarly expressed both in the CNS and in the remainder of the ectoderm in many bilaterians. The evidence leaves hemichordates in an ambiguous position – either CNS centralization was lost to some extent at the base of the hemichordates, or even earlier, at the base of the hemichordates + echinoderms, or one of the two hemichordate nerve cords is homologous to the CNS of protostomes and chordates. In any event, the presence of part of the genetic machinery for the anterior neural ridge, the zona limitans intrathalamica and the isthmic organizer in invertebrate chordates together with similar morphology indicates that these organizers were present, at least in part, at the base of the chordates and were probably elaborated upon in the vertebrate lineage. PMID:24098981

Computational gene expression profiling under salt stress reveals patterns of co-expression

PubMed Central

Sanchita; Sharma, Ashok

2016-01-01

Plants respond differently to environmental conditions. Among various abiotic stresses, salt stress is a condition where excess salt in soil causes inhibition of plant growth. To understand the response of plants to the stress conditions, identification of the responsible genes is required. Clustering is a data mining technique used to group the genes with similar expression. The genes of a cluster show similar expression and function. We applied clustering algorithms on gene expression data of Solanum tuberosum showing differential expression in Capsicum annuum under salt stress. The clusters, which were common in multiple algorithms were taken further for analysis. Principal component analysis (PCA) further validated the findings of other cluster algorithms by visualizing their clusters in three-dimensional space. Functional annotation results revealed that most of the genes were involved in stress related responses. Our findings suggest that these algorithms may be helpful in the prediction of the function of co-expressed genes. PMID:26981411

Within and between Whorls: Comparative Transcriptional Profiling of Aquilegia and Arabidopsis

PubMed Central

Voelckel, Claudia; Borevitz, Justin O.; Kramer, Elena M.; Hodges, Scott A.

2010-01-01

Background The genus Aquilegia is an emerging model system in plant evolutionary biology predominantly because of its wide variation in floral traits and associated floral ecology. The anatomy of the Aquilegia flower is also very distinct. There are two whorls of petaloid organs, the outer whorl of sepals and the second whorl of petals that form nectar spurs, as well as a recently evolved fifth whorl of staminodia inserted between stamens and carpels. Methodology/Principal Findings We designed an oligonucleotide microarray based on EST sequences from a mixed tissue, normalized cDNA library of an A. formosa x A. pubescens F2 population representing 17,246 unigenes. We then used this array to analyze floral gene expression in late pre-anthesis stage floral organs from a natural A. formosa population. In particular, we tested for gene expression patterns specific to each floral whorl and to combinations of whorls that correspond to traditional and modified ABC model groupings. Similar analyses were performed on gene expression data of Arabidopsis thaliana whorls previously obtained using the Ath1 gene chips (data available through The Arabidopsis Information Resource). Conclusions/Significance Our comparative gene expression analyses suggest that 1) petaloid sepals and petals of A. formosa share gene expression patterns more than either have organ-specific patterns, 2) petals of A. formosa and A. thaliana may be independently derived, 3) staminodia express B and C genes similar to stamens but the staminodium genetic program has also converged on aspects of the carpel program and 4) staminodia have unique up-regulation of regulatory genes and genes that have been implicated with defense against microbial infection and herbivory. Our study also highlights the value of comparative gene expression profiling and the Aquilegia microarray in particular for the study of floral evolution and ecology. PMID:20352114

HLA-C expression pattern is spatially different between psoriasis and eczema skin lesions.

PubMed

Carlén, Lina; Sakuraba, Kazuko; Ståhle, Mona; Sánchez, Fabio

2007-02-01

Interactions between genetic and environmental factors underlie the immune dysregulation and keratinocyte abnormalities that characterize psoriasis. Among known psoriasis susceptibility loci (PSORS), PSORS1 on chromosome 6 has the strongest association to disease. Altered expression of some PSORS1 candidate genes has been reported but little is known about HLA-C expression in psoriasis. This study compared expression of major histocompatibility complex class Ia and HLA-C in psoriasis, allergic contact eczema, and normal skin. Although HLA-C was abundant in protein extracts from both eczema and psoriasis, a consistent and intriguing difference in the expression pattern was observed; strong immunoreactivity in the basal cell layer, polarized towards the basement membrane in psoriasis, whereas in eczema lesions HLA-C immunostaining was present mostly in suprabasal cells. Inflammatory cells in the dermis were strongly stained in both diseases. Normal skin epithelium showed less intense but similar HLA-C staining as eczema lesions. HLA class Ia expression overall resembled that of HLA-C in all samples. The distinct HLA-C expression patterns in psoriasis and eczema suggest a functional role in the specific psoriasis immune response and not only a general feature of inflammation.

Too much data, but little inter-changeability: a lesson learned from mining public data on tissue specificity of gene expression.

PubMed

Li, Shuyu; Li, Yiqun Helen; Wei, Tao; Su, Eric Wen; Duffin, Kevin; Liao, Birong

2006-10-25

The tissue expression pattern of a gene often provides an important clue to its potential role in a biological process. A vast amount of gene expression data have been and are being accumulated in public repository through different technology platforms. However, exploitations of these rich data sources remain limited in part due to issues of technology standardization. Our objective is to test the data comparability between SAGE and microarray technologies, through examining the expression pattern of genes under normal physiological states across variety of tissues. There are 42-54% of genes showing significant correlations in tissue expression patterns between SAGE and GeneChip, with 30-40% of genes whose expression patterns are positively correlated and 10-15% of genes whose expression patterns are negatively correlated at a statistically significant level (p = 0.05). Our analysis suggests that the discrepancy on the expression patterns derived from technology platforms is not likely from the heterogeneity of tissues used in these technologies, or other spurious correlations resulting from microarray probe design, abundance of genes, or gene function. The discrepancy can be partially explained by errors in the original assignment of SAGE tags to genes due to the evolution of sequence databases. In addition, sequence analysis has indicated that many SAGE tags and Affymetrix array probe sets are mapped to different splice variants or different sequence regions although they represent the same gene, which also contributes to the observed discrepancies between SAGE and array expression data. To our knowledge, this is the first report attempting to mine gene expression patterns across tissues using public data from different technology platforms. Unlike previous similar studies that only demonstrated the discrepancies between the two gene expression platforms, we carried out in-depth analysis to further investigate the cause for such discrepancies. Our study shows that the exploitation of rich public expression resource requires extensive knowledge about the technologies, and experiment. Informatic methodologies for better interoperability among platforms still remain a gap. One of the areas that can be improved practically is the accurate sequence mapping of SAGE tags and array probes to full-length genes.

Systems analysis of cis-regulatory motifs in C4 photosynthesis genes using maize and rice leaf transcriptomic data during a process of de-etiolation.

PubMed

Xu, Jiajia; Bräutigam, Andrea; Weber, Andreas P M; Zhu, Xin-Guang

2016-09-01

Identification of potential cis-regulatory motifs controlling the development of C4 photosynthesis is a major focus of current research. In this study, we used time-series RNA-seq data collected from etiolated maize and rice leaf tissues sampled during a de-etiolation process to systematically characterize the expression patterns of C4-related genes and to further identify potential cis elements in five different genomic regions (i.e. promoter, 5'UTR, 3'UTR, intron, and coding sequence) of C4 orthologous genes. The results demonstrate that although most of the C4 genes show similar expression patterns, a number of them, including chloroplast dicarboxylate transporter 1, aspartate aminotransferase, and triose phosphate transporter, show shifted expression patterns compared with their C3 counterparts. A number of conserved short DNA motifs between maize C4 genes and their rice orthologous genes were identified not only in the promoter, 5'UTR, 3'UTR, and coding sequences, but also in the introns of core C4 genes. We also identified cis-regulatory motifs that exist in maize C4 genes and also in genes showing similar expression patterns as maize C4 genes but that do not exist in rice C3 orthologs, suggesting a possible recruitment of pre-existing cis-elements from genes unrelated to C4 photosynthesis into C4 photosynthesis genes during C4 evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

PubMed

Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

2015-06-01

Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Expression patterns of WRKY genes in di-haploid Populus simonii × P. nigra in response to salinity stress revealed by quantitative real-time PCR and RNA sequencing.

PubMed

Wang, Shengji; Wang, Jiying; Yao, Wenjing; Zhou, Boru; Li, Renhua; Jiang, Tingbo

2014-10-01

Spatio-temporal expression patterns of 13 out of 119 poplar WRKY genes indicated dynamic and tissue-specific roles of WRKY family proteins in salinity stress tolerance. To understand the expression patterns of poplar WRKY genes under salinity stress, 51 of the 119 WRKY genes were selected from di-haploid Populus simonii × P. nigra by quantitative real-time PCR (qRT-PCR). We used qRT-PCR to profile the expression of the top 13 genes under salinity stress across seven time points, and employed RNA-Seq platforms to cross-validate it. Results demonstrated that all the 13 WRKY genes were expressed in root, stem, and leaf tissues, but their expression levels and overall patterns varied notably in these tissues. Regarding overall gene expression in roots, the 13 genes were significantly highly expressed at all six time points after the treatment, reaching the plateau of expression at hour 9. In leaves, the 13 genes were similarly up-regulated from 3 to 12 h in response to NaCl treatment. In stems, however, expression levels of the 13 genes did not show significant changes after the NaCl treatment. Regarding individual gene expression across the time points and the three tissues, the 13 genes can be classified into three clusters: the lowly expressed Cluster 1 containing PthWRKY28, 45 and 105; intermediately expressed Clusters 2 including PthWRKY56, 88 and 116; and highly expressed Cluster 3 consisting of PthWRKY41, 44, 51, 61, 62, 75 and 106. In general, genes in Cluster 2 and 3 displayed a dynamic pattern of "induced amplification-recovering", suggesting that these WRKY genes and corresponding pathways may play a critical role in mediating salt response and tolerance in a dynamic and tissue-specific manner.

Tissue-Specific, Development-Dependent Phenolic Compounds Accumulation Profile and Gene Expression Pattern in Tea Plant [Camellia sinensis

PubMed Central

Li, Weiwei; Zhao, Lei; Meng, Fei; Wang, Yunsheng; Tan, Huarong; Yang, Hua; Wei, Chaoling; Wan, Xiaochun; Gao, Liping; Xia, Tao

2013-01-01

Phenolic compounds in tea plant [Camellia sinensis (L.)] play a crucial role in dominating tea flavor and possess a number of key pharmacological benefits on human health. The present research aimed to study the profile of tissue-specific, development-dependent accumulation pattern of phenolic compounds in tea plant. A total of 50 phenolic compounds were identified qualitatively using liquid chromatography in tandem mass spectrometry technology. Of which 29 phenolic compounds were quantified based on their fragmentation behaviors. Most of the phenolic compounds were higher in the younger leaves than that in the stem and root, whereas the total amount of proanthocyanidins were unexpectedly higher in the root. The expression patterns of 63 structural and regulator genes involved in the shikimic acid, phenylpropanoid, and flavonoid pathways were analyzed by quantitative real-time polymerase chain reaction and cluster analysis. Based on the similarity of their expression patterns, the genes were classified into two main groups: C1 and C2; and the genes in group C1 had high relative expression level in the root or low in the bud and leaves. The expression patterns of genes in C2-2-1 and C2-2-2-1 groups were probably responsible for the development-dependent accumulation of phenolic compounds in the leaves. Enzymatic analysis suggested that the accumulation of catechins was influenced simultaneously by catabolism and anabolism. Further research is recommended to know the expression patterns of various genes and the reason for the variation in contents of different compounds in different growth stages and also in different organs. PMID:23646127

Emotional Faces in Context: Age Differences in Recognition Accuracy and Scanning Patterns

PubMed Central

Noh, Soo Rim; Isaacowitz, Derek M.

2014-01-01

While age-related declines in facial expression recognition are well documented, previous research relied mostly on isolated faces devoid of context. We investigated the effects of context on age differences in recognition of facial emotions and in visual scanning patterns of emotional faces. While their eye movements were monitored, younger and older participants viewed facial expressions (i.e., anger, disgust) in contexts that were emotionally congruent, incongruent, or neutral to the facial expression to be identified. Both age groups had highest recognition rates of facial expressions in the congruent context, followed by the neutral context, and recognition rates in the incongruent context were worst. These context effects were more pronounced for older adults. Compared to younger adults, older adults exhibited a greater benefit from congruent contextual information, regardless of facial expression. Context also influenced the pattern of visual scanning characteristics of emotional faces in a similar manner across age groups. In addition, older adults initially attended more to context overall. Our data highlight the importance of considering the role of context in understanding emotion recognition in adulthood. PMID:23163713

MAEWEST expression in flower development of two petunia species.

PubMed

Segatto, Ana Lúcia A; Turchetto-Zolet, Andreia Carina; Aizza, Lilian Cristina B; Monte-Bello, Carolina C; Dornelas, Marcelo C; Margis, Rogerio; Freitas, Loreta B

2013-07-03

Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae), adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW) homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox) transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively) by reverse transcriptase polymerase chain reaction (RT-PCR), reverse transcription-quantitative PCR (qRT-PCR) and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions.

Perineurial-like Cells and EMA Expression in the Suprachoroidal Region of the Human Eye.

PubMed

Gilbert, Andrea R; Chévez-Barrios, Patricia; Cykowski, Matthew D

2018-05-01

The suprachoroidal region of the eye comprises vascular channels, melanocytes, and thin fibroblasts with elongated cytoplasm that are positioned directly adjacent to the densely collagenous sclera. Morphological similarities between these suprachoroidal fibroblasts and arachnoid cells and perineurial cells have been recognized, but whether these fibroblasts have a perineurial cell-like immunophenotype is not known. To further examine the relationship of these three cell types, we investigated the comparative expression of epithelial membrane antigen (EMA), the tight junction protein claudin-1, glucose transporter-1 (Glut-1), and CD34 in suprachoroidal fibroblasts, arachnoid of the optic nerve sheath, and perineurium of ciliary nerves in eight human eye specimens. Granular, diffuse, and cytoplasmic EMA expression was seen in suprachoroidal fibroblasts, but this was not contiguous with the similar pattern of EMA expression in adjacent perineurium and arachnoid. CD34 expression in suprachoroidal fibroblasts was also seen, similar to arachnoid and perineurium. Claudin-1 and Glut-1 were not consistently expressed in suprachoroidal fibroblasts, distinguishing them from perineurial cells in particular and suggesting that these fibroblasts do not arise directly from adjacent arachnoid or perineurium. Nonetheless, the overlapping morphology and protein expression suggest phenotypic similarities in these cells that protect and support adjacent retina, optic nerve, and peripheral nerve.

Tissue-specific NETs alter genome organization and regulation even in a heterologous system.

PubMed

de Las Heras, Jose I; Zuleger, Nikolaj; Batrakou, Dzmitry G; Czapiewski, Rafal; Kerr, Alastair R W; Schirmer, Eric C

2017-01-02

Different cell types exhibit distinct patterns of 3D genome organization that correlate with changes in gene expression in tissue and differentiation systems. Several tissue-specific nuclear envelope transmembrane proteins (NETs) have been found to influence the spatial positioning of genes and chromosomes that normally occurs during tissue differentiation. Here we study 3 such NETs: NET29, NET39, and NET47, which are expressed preferentially in fat, muscle and liver, respectively. We found that even when exogenously expressed in a heterologous system they can specify particular genome organization patterns and alter gene expression. Each NET affected largely different subsets of genes. Notably, the liver-specific NET47 upregulated many genes in HT1080 fibroblast cells that are normally upregulated in hepatogenesis, showing that tissue-specific NETs can favor expression patterns associated with the tissue where the NET is normally expressed. Similarly, global profiling of peripheral chromatin after exogenous expression of these NETs using lamin B1 DamID revealed that each NET affected the nuclear positioning of distinct sets of genomic regions with a significant tissue-specific component. Thus NET influences on genome organization can contribute to gene expression changes associated with differentiation even in the absence of other factors and overt cellular differentiation changes.

Multiple abiotic stimuli are integrated in the regulation of rice gene expression under field conditions.

PubMed

Plessis, Anne; Hafemeister, Christoph; Wilkins, Olivia; Gonzaga, Zennia Jean; Meyer, Rachel Sarah; Pires, Inês; Müller, Christian; Septiningsih, Endang M; Bonneau, Richard; Purugganan, Michael

2015-11-26

Plants rely on transcriptional dynamics to respond to multiple climatic fluctuations and contexts in nature. We analyzed the genome-wide gene expression patterns of rice (Oryza sativa) growing in rainfed and irrigated fields during two distinct tropical seasons and determined simple linear models that relate transcriptomic variation to climatic fluctuations. These models combine multiple environmental parameters to account for patterns of expression in the field of co-expressed gene clusters. We examined the similarities of our environmental models between tropical and temperate field conditions, using previously published data. We found that field type and macroclimate had broad impacts on transcriptional responses to environmental fluctuations, especially for genes involved in photosynthesis and development. Nevertheless, variation in solar radiation and temperature at the timescale of hours had reproducible effects across environmental contexts. These results provide a basis for broad-based predictive modeling of plant gene expression in the field.

On Expression Patterns and Developmental Origin of Human Brain Regions.

PubMed

Kirsch, Lior; Chechik, Gal

2016-08-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

On Expression Patterns and Developmental Origin of Human Brain Regions

PubMed Central

Kirsch, Lior; Chechik, Gal

2016-01-01

Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

Sox genes in the coral Acropora millepora: divergent expression patterns reflect differences in developmental mechanisms within the Anthozoa

PubMed Central

2008-01-01

Background Sox genes encode transcription factors that function in a wide range of developmental processes across the animal kingdom. To better understand both the evolution of the Sox family and the roles of these genes in cnidarians, we are studying the Sox gene complement of the coral, Acropora millepora (Class Anthozoa). Results Based on overall domain structures and HMG box sequences, the Acropora Sox genes considered here clearly fall into four of the five major Sox classes. AmSoxC is expressed in the ectoderm during development, in cells whose morphology is consistent with their assignment as sensory neurons. The expression pattern of the Nematostella ortholog of this gene is broadly similar to that of AmSoxC, but there are subtle differences – for example, expression begins significantly earlier in Acropora than in Nematostella. During gastrulation, AmSoxBb and AmSoxB1 transcripts are detected only in the presumptive ectoderm while AmSoxE1 transcription is restricted to the presumptive endoderm, suggesting that these Sox genes might play roles in germ layer specification. A third type B Sox gene, AmSoxBa, and a Sox F gene AmSoxF also have complex and specific expression patterns during early development. Each of these genes has a clear Nematostella ortholog, but in several cases the expression pattern observed in Acropora differs significantly from that reported in Nematostella. Conclusion These differences in expression patterns between Acropora and Nematostella largely reflect fundamental differences in developmental processes, underscoring the diversity of mechanisms within the anthozoan Sub-Class Hexacorallia (Zoantharia). PMID:19014479

A microcosm of musical expression: II. Quantitative analysis of pianists' dynamics in the initial measures of Chopin's Etude in E major.

PubMed

Repp, B H

1999-03-01

Patterns of expressive dynamics were measured in bars 1-5 of 115 commercially recorded performances of Chopin's Etude in E major, op. 10, No. 3. The grand average pattern (or dynamic profile) was representative of many performances and highly similar to the average dynamic profile of a group of advanced student performances, which suggests a widely shared central norm of expressive dynamics. The individual dynamic profiles were subjected to principal components analysis, which yielded Varimax-rotated components, each representing a different, nonstandard dynamic profile associated with a small subset of performances. Most performances had dynamic patterns resembling a mixture of several components, and no clustering of of performances into distinct groups was apparent. Some weak relationships of dynamic profiles with sociocultural variables were found, most notably a tendency of female pianists to exhibit a greater dynamic range in the melody. Within the melody, there were no significant relationships between expressive timing [Repp, J. Acoust. Soc. Am. 104, 1085-1100 (1998)] and expressive dynamics. These two important dimensions seemed to be controlled independently at this local level and thus offer the artist many degrees of freedom in giving a melody expressive shape.

Epidermal gene expression and ethnic pigmentation variations among individuals of Asian, European and African ancestry.

PubMed

Yin, Lanlan; Coelho, Sergio G; Ebsen, Dominik; Smuda, Christoph; Mahns, Andre; Miller, Sharon A; Beer, Janusz Z; Kolbe, Ludger; Hearing, Vincent J

2014-10-01

Differences in visible skin pigmentation give rise to the wide variation of skin colours seen in racial/ethnic populations. Skin pigmentation is important not only from cosmetic and psychological points of view, but more importantly because of its implications for the risk of all types of skin cancers, on photoaging, etc. Despite differences in those parameters in Caucasian and Asian skin types, they are remarkably similar in their production and distribution of melanins, and the mechanism(s) underlying their different characteristics have remained obscure. In this study, we used microarray analysis of skin suction blisters to investigate molecular differences underlying the determination of pigmentation in various skin types, and we used immunohistochemistry to validate the expression patterns of several interesting targets that were identified. Intriguingly, Caucasian and Asian skins had highly similar gene expression patterns that differed significantly from the pattern of African skin. The results of this study suggest the dynamic interactions of different types of cells in human skin that regulate its pigmentation, reveal that the known pigmentation genes have a limited contribution and uncover a new array of genes, including NINL and S100A4, that might be involved in that regulation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Finding gene clusters for a replicated time course study

PubMed Central

2014-01-01

Background Finding genes that share similar expression patterns across samples is an important question that is frequently asked in high-throughput microarray studies. Traditional clustering algorithms such as K-means clustering and hierarchical clustering base gene clustering directly on the observed measurements and do not take into account the specific experimental design under which the microarray data were collected. A new model-based clustering method, the clustering of regression models method, takes into account the specific design of the microarray study and bases the clustering on how genes are related to sample covariates. It can find useful gene clusters for studies from complicated study designs such as replicated time course studies. Findings In this paper, we applied the clustering of regression models method to data from a time course study of yeast on two genotypes, wild type and YOX1 mutant, each with two technical replicates, and compared the clustering results with K-means clustering. We identified gene clusters that have similar expression patterns in wild type yeast, two of which were missed by K-means clustering. We further identified gene clusters whose expression patterns were changed in YOX1 mutant yeast compared to wild type yeast. Conclusions The clustering of regression models method can be a valuable tool for identifying genes that are coordinately transcribed by a common mechanism. PMID:24460656

The regulation of MADS-box gene expression during ripening of banana and their regulatory interation with ethylene

USDA-ARS?s Scientific Manuscript database

MADS-box genes (MaMADS1-6), potential components of the developmental control of ripening have been cloned from Grand Nain banana cultivar. Similarity of these genes to tomato LeRIN is very low and neither MaMADS2 nor MaMADS1 complement the tomato rin mutation. Nevertheless, the expression patterns...

FoxP2 protein levels regulate cell morphology changes and migration patterns in the vertebrate developing telencephalon.

PubMed

Garcia-Calero, Elena; Botella-Lopez, Arancha; Bahamonde, Olga; Perez-Balaguer, Ariadna; Martinez, Salvador

2016-07-01

In the mammalian telencephalon, part of the progenitor cells transition from multipolar to bipolar morphology as they invade the mantle zone. This associates with changing patterns of radial migration. However, the molecules implicated in these morphology transitions are not well known. In the present work, we analyzed the function of FoxP2 protein in this process during telencephalic development in vertebrates. We analyzed the expression of FoxP2 protein and its relation with cell morphology and migratory patterns in mouse and chicken developing striatum. We observed FoxP2 protein expressed in a gradient from the subventricular zone to the mantle layer in mice embryos. In the FoxP2 low domain cells showed multipolar migration. In the striatal mantle layer where FoxP2 protein expression is higher, cells showed locomoting migration and bipolar morphology. In contrast, FoxP2 showed a high and homogenous expression pattern in chicken striatum, thus bipolar morphology predominated. Elevation of FoxP2 in the striatal subventricular zone by in utero electroporation promoted bipolar morphology and impaired multipolar radial migration. In mouse cerebral cortex we obtained similar results. FoxP2 promotes transition from multipolar to bipolar morphology by means of gradiental expression in mouse striatum and cortex. Together these results indicate a role of FoxP2 differential expression in cell morphology control of the vertebrate telencephalon.

Expression of c-Fes protein isoforms correlates with differentiation in myeloid leukemias.

PubMed

Carlson, Anne; Berkowitz, Jeanne McAdara; Browning, Damaris; Slamon, Dennis J; Gasson, Judith C; Yates, Karen E

2005-05-01

The cellular fes gene encodes a 93-kilodalton protein-tyrosine kinase (p93) that is expressed in both normal and neoplastic myeloid cells. Increased c-Fes expression is associated with differentiation in normal myeloid cells and cell lines. Our hypothesis was that primary leukemia cells would show a similar pattern of increased expression in more differentiated cells. Therefore, we compared c-Fes expression in cells with an undifferentiated, blast phenotype (acute myelogenous leukemia--AML) to cells with a differentiated phenotype (chronic myelogenous leukemia--CML). Instead of differences in p93 expression levels, we found complex patterns of c-Fes immunoreactive proteins that corresponded with differentiation in normal and leukemic myeloid cells. The "blast" pattern consisted of c-Fes immunoreactive proteins p93, p74, and p70; the "differentiated" pattern showed two additional c-Fes immunoreactive proteins, p67 and p62. Using mRNA from mouse and human cell lines, we found deletion of one or more exons in the c-fes mRNA. Those deletions predicted truncation of conserved domains (CDC15/FCH and SH2) involved in protein-protein interactions. No deletions were found, however, within the kinase domain. We infer that alternative splicing generates a family of c-Fes proteins. This may be a mechanism to direct the c-Fes kinase domain to different subcellular locations and/or substrates at specific stages of myeloid cell differentiation.

Sodium butyrate improves the cloned yak embryo viability and corrects gene expression patterns.

PubMed

Xiong, Xian-rong; Lan, Dao-liang; Li, Jian; Wang, Yong; Zhong, Jin-cheng

2015-02-01

Interspecies somatic cell nuclear transfer (iSCNT), a powerful tool in basic scientific research, has been used widely to increase and preserve the population of endangered species. Yak (Bos grunniens) is one of these species. Development to term of interspecies cloned yak embryos has not been achieved, possibly due to abnormal epigenetic reprogramming. Previous studies have demonstrated that treatment of intraspecies cloned embryos with (NaBu) significantly improves nuclear-cytoplasmic reprogramming and viability in vitro. Therefore, in this study, we evaluated the effect of optimal NaBu concentration and exposure time on preimplantation development of yak iSCNT embryos and on the expression patterns of developmentally important genes. The results showed that 8-cell rate, blastocyst formation rate and total cell number increased significantly compared with their untreated counterparts when yak iSCNT embryos were treated with 5 nM NaBu for 12 h after activation, but that the 2-cell stage embryo rate was not significantly different. The treatment of NaBu also increased significantly the expression levels of Oct-4 and decreased the expression levels of HDAC-2, Dnmt-1 and IGF-1; the expression patterns of these genes were more similar to that of their bovine-yak in vitro fertilization (BY-IVF) counterparts. The results described above indicated that NaBu treatment improved developmental competence in vitro and 'corrected' the gene expression patterns of yak iSCNT embryos.

Structure and Function of the Splice Variants of TMPRSS2-ERG, a Prevalent Genomic Alteration in Prostate Cancer

DTIC Science & Technology

2011-09-01

the ETS family of transcription factors showing diverse expression patterns in human tissues (Turner and Watson, 2008). ERG, similar to other...and adult mouse tissues . Most striking of these observations was highly selective and abundant expression of erg protein in endothelial cells of...mouse tissues . We for the first time clarified that endogenous ERG was not expressed in normal mouse prostate epithelium (Mohamed et al., 2010

The Written Expression Abilities of Adolescents with Attention-Deficit/Hyperactivity Disorder

PubMed Central

Molitor, Stephen J.; Langberg, Joshua M.; Evans, Steve W.

2016-01-01

Students with Attention-Deficit/Hyperactivity Disorder (ADHD) often experience deficits in academic achievement. Written expression abilities in this population have not been extensively studied but existing prevalence estimates suggest that rates of comorbid writing underachievement may be substantially higher than rates of comorbid reading and mathematics underachievement. The current study examined written expression abilities in a school-based sample of 326 middle school age students with ADHD. The prevalence of written expression impairment, the associations between written expression and academic outcomes, and specific patterns of written expression were investigated. Students with ADHD in this sample experienced written expression impairment (17.2% – 22.4%) at a similar rate to reading impairment (17.0% – 24.3%) and at a slightly lower rate than mathematics impairment (24.7% – 36.3%). Students’ written expression abilities were significantly associated with school grades and parent ratings of academic functioning, above and beyond the influence of intelligence. Analyses of patterns suggest that students with ADHD exhibit greater deficits in written expression tasks requiring organization and attention to detail, especially in the context of a complex task. PMID:26802631

Expression of Glutamate and Inhibitory Amino Acid Vesicular Transporters in the Rodent Auditory Brainstem

PubMed Central

Ito, Tetsufumi; Bishop, Deborah C.; Oliver, Douglas L.

2011-01-01

Glutamate is the main excitatory neurotransmitter in the auditory system, but associations between glutamatergic neuronal populations and the distribution of their synaptic terminations have been difficult. Different subsets of glutamatergic terminals employ one of three vesicular glutamate transporters (VGLUT) to load synaptic vesicles. Recently, VGLUT1 and VGLUT2 terminals were found to have different patterns of organization in the inferior colliculus suggesting that there are different types of glutamatergic neurons in the brainstem auditory system with projections to the colliculus. To positively identify VGLUT-expressing neurons as well as inhibitory neurons in the auditory brainstem, we used in situ hybridization to identify the mRNA for VGLUT1, VGLUT2, and VIAAT (the vesicular inhibitory amino acid transporter used by GABAergic and glycinergic terminals). Similar expression patterns were found in subsets of glutamatergic and inhibitory neurons in the auditory brainstem and thalamus of adult rats and mice. Four patterns of gene expression were seen in individual neurons. 1) VGLUT2 expressed alone was the prevalent pattern. 2) VGLUT1 co-expressed with VGLUT2 was seen in scattered neurons in most nuclei but was common in the medial geniculate body and ventral cochlear nucleus. 3) VGLUT1 expressed alone was found only in granule cells. 4) VIAAT expression was common in most nuclei but dominated in some. These data show that the expression of the VGLUT1/2 and VIAAT genes can identify different subsets of auditory neurons. This may facilitate the identification of different components in auditory circuits. PMID:21165977

A transversal approach to predict gene product networks from ontology-based similarity

PubMed Central

Chabalier, Julie; Mosser, Jean; Burgun, Anita

2007-01-01

Background Interpretation of transcriptomic data is usually made through a "standard" approach which consists in clustering the genes according to their expression patterns and exploiting Gene Ontology (GO) annotations within each expression cluster. This approach makes it difficult to underline functional relationships between gene products that belong to different expression clusters. To address this issue, we propose a transversal analysis that aims to predict functional networks based on a combination of GO processes and data expression. Results The transversal approach presented in this paper consists in computing the semantic similarity between gene products in a Vector Space Model. Through a weighting scheme over the annotations, we take into account the representativity of the terms that annotate a gene product. Comparing annotation vectors results in a matrix of gene product similarities. Combined with expression data, the matrix is displayed as a set of functional gene networks. The transversal approach was applied to 186 genes related to the enterocyte differentiation stages. This approach resulted in 18 functional networks proved to be biologically relevant. These results were compared with those obtained through a standard approach and with an approach based on information content similarity. Conclusion Complementary to the standard approach, the transversal approach offers new insight into the cellular mechanisms and reveals new research hypotheses by combining gene product networks based on semantic similarity, and data expression. PMID:17605807

Differential expression of decorin and biglycan genes during mouse tooth development

NASA Technical Reports Server (NTRS)

Matsuura, T.; Duarte, W. R.; Cheng, H.; Uzawa, K.; Yamauchi, M.

2001-01-01

Small leucine-rich proteoglycans (SLRPs) have a number of biological functions and some of them are thought to regulate collagen mineralizaton in bone and tooth. We have previously identified and immunolocalized two members of the SLRPs family, decorin and biglycan, in bovine tooth/periodontium. To investigate their potential roles in tooth development, we examined the mRNA expression patterns of decorin, biglycan and type I collagen in newborn (day 19) mice tooth germs by in situ hybridization. At this developmental stage, the first maxillary and mandibular molars include stages before and after secretion of the predentin matrix, respectively. The expression of decorin mRNA coincided with that of type I collagen mRNA and was mostly observed in secretory odontoblasts, while the biglycan mRNA was expressed throughout the tooth germ, including pre-secretory odontoblasts/ameloblasts, dental papilla and stellate reticulum. However, its signal in secretory odontoblasts was not as evident as that of decorin. In mandibular incisors, where a significant amount of predentin matrix and a small amount of enamel matrix were already secreted, a similar differential expression pattern was observed. In secretory ameloblasts the biglycan mRNA expression was apparent, while that of decorin was not. These differential expression patterns suggest the distinct roles of biglycan and decorin in the process of tooth development.

Expression analysis of the speech-related genes FoxP1 and FoxP2 and their relation to singing behavior in two songbird species.

PubMed

Chen, Qianqian; Heston, Jonathan B; Burkett, Zachary D; White, Stephanie A

2013-10-01

Humans and songbirds are among the rare animal groups that exhibit socially learned vocalizations: speech and song, respectively. These vocal-learning capacities share a reliance on audition and cortico-basal ganglia circuitry, as well as neurogenetic mechanisms. Notably, the transcription factors Forkhead box proteins 1 and 2 (FoxP1, FoxP2) exhibit similar expression patterns in the cortex and basal ganglia of humans and the zebra finch species of songbird, among other brain regions. Mutations in either gene are associated with language disorders in humans. Experimental knock-down of FoxP2 in the basal ganglia song control region Area X during song development leads to imprecise copying of tutor songs. Moreover, FoxP2 levels decrease naturally within Area X when zebra finches sing. Here, we examined neural expression patterns of FoxP1 and FoxP2 mRNA in adult Bengalese finches, a songbird species whose songs exhibit greater sequence complexity and increased reliance on audition for maintaining their quality. We found that FoxP1 and FoxP2 expression in Bengalese finches is similar to that in zebra finches, including strong mRNA signals for both factors in multiple song control nuclei and enhancement of FoxP1 in these regions relative to surrounding brain tissue. As with zebra finches, when Bengalese finches sing, FoxP2 is behaviorally downregulated within basal ganglia Area X over a similar time course, and expression negatively correlates with the amount of singing. This study confirms that in multiple songbird species, FoxP1 expression highlights song control regions, and regulation of FoxP2 is associated with motor control of song.

Expression analysis of the speech-related genes FoxP1 and FoxP2 and their relation to singing behavior in two songbird species

PubMed Central

Chen, Qianqian; Heston, Jonathan B.; Burkett, Zachary D.; White, Stephanie A.

2013-01-01

SUMMARY Humans and songbirds are among the rare animal groups that exhibit socially learned vocalizations: speech and song, respectively. These vocal-learning capacities share a reliance on audition and cortico-basal ganglia circuitry, as well as neurogenetic mechanisms. Notably, the transcription factors Forkhead box proteins 1 and 2 (FoxP1, FoxP2) exhibit similar expression patterns in the cortex and basal ganglia of humans and the zebra finch species of songbird, among other brain regions. Mutations in either gene are associated with language disorders in humans. Experimental knock-down of FoxP2 in the basal ganglia song control region Area X during song development leads to imprecise copying of tutor songs. Moreover, FoxP2 levels decrease naturally within Area X when zebra finches sing. Here, we examined neural expression patterns of FoxP1 and FoxP2 mRNA in adult Bengalese finches, a songbird species whose songs exhibit greater sequence complexity and increased reliance on audition for maintaining their quality. We found that FoxP1 and FoxP2 expression in Bengalese finches is similar to that in zebra finches, including strong mRNA signals for both factors in multiple song control nuclei and enhancement of FoxP1 in these regions relative to surrounding brain tissue. As with zebra finches, when Bengalese finches sing, FoxP2 is behaviorally downregulated within basal ganglia Area X over a similar time course, and expression negatively correlates with the amount of singing. This study confirms that in multiple songbird species, FoxP1 expression highlights song control regions, and regulation of FoxP2 is associated with motor control of song. PMID:24006346

Direct multiplexed measurement of gene expression with color-coded probe pairs.

PubMed

Geiss, Gary K; Bumgarner, Roger E; Birditt, Brian; Dahl, Timothy; Dowidar, Naeem; Dunaway, Dwayne L; Fell, H Perry; Ferree, Sean; George, Renee D; Grogan, Tammy; James, Jeffrey J; Maysuria, Malini; Mitton, Jeffrey D; Oliveri, Paola; Osborn, Jennifer L; Peng, Tao; Ratcliffe, Amber L; Webster, Philippa J; Davidson, Eric H; Hood, Leroy; Dimitrov, Krassen

2008-03-01

We describe a technology, the NanoString nCounter gene expression system, which captures and counts individual mRNA transcripts. Advantages over existing platforms include direct measurement of mRNA expression levels without enzymatic reactions or bias, sensitivity coupled with high multiplex capability, and digital readout. Experiments performed on 509 human genes yielded a replicate correlation coefficient of 0.999, a detection limit between 0.1 fM and 0.5 fM, and a linear dynamic range of over 500-fold. Comparison of the NanoString nCounter gene expression system with microarrays and TaqMan PCR demonstrated that the nCounter system is more sensitive than microarrays and similar in sensitivity to real-time PCR. Finally, a comparison of transcript levels for 21 genes across seven samples measured by the nCounter system and SYBR Green real-time PCR demonstrated similar patterns of gene expression at all transcript levels.

Molecular cloning and developmental expression of Tlx (Hox11) genes in zebrafish (Danio rerio).

PubMed

Langenau, D M; Palomero, T; Kanki, J P; Ferrando, A A; Zhou, Y; Zon, L I; Look, A T

2002-09-01

Tlx (Hox11) genes are orphan homeobox genes that play critical roles in the regulation of early developmental processes in vertebrates. Here, we report the identification and expression patterns of three members of the zebrafish Tlx family. These genes share similar, but not identical, expression patterns with other vertebrate Tlx-1 and Tlx-3 genes. Tlx-1 is expressed early in the developing hindbrain and pharyngeal arches, and later in the putative splenic primordium. However, unlike its orthologues, zebrafish Tlx-1 is not expressed in the cranial sensory ganglia or spinal cord. Two homologues of Tlx-3 were identified: Tlx-3a and Tlx-3b, which are both expressed in discrete regions of the developing nervous system, including the cranial sensory ganglia and Rohon-Beard neurons. However, only Tlx-3a is expressed in the statoacoustic cranial ganglia, enteric neurons and non-neural tissues such as the fin bud and pharyngeal arches and Tlx-3b is only expressed in the dorsal root ganglia. Copyright 2002 Elsevier Science Ireland Ltd.

Over-expression of thymosin β4 in granulomatous lung tissue with active pulmonary tuberculosis.

PubMed

Kang, Yun-Jeong; Jo, Jin-Ok; Ock, Mee Sun; Yoo, Young-Bin; Chun, Bong-Kwon; Oak, Chul-Ho; Cha, Hee-Jae

2014-05-01

Recent studies have shown that thymosin β4 (Tβ4) stimulates angiogenesis by inducing vascular endothelial growth factor (VEGF) expression and stabilizing hypoxia inducible factor-1α (HIF-1α) protein. Pulmonary tuberculosis (TB), a type of granulomatous disease, is accompanied by intense angiogenesis and VEGF levels have been reported to be elevated in serum or tissue inflamed by pulmonary tuberculosis. We investigated the expression of Tβ4 in granulomatous lung tissues at various stages of active pulmonary tuberculosis, and we also examined the expression patterns of VEGF and HIF-1α to compare their Tβ4 expression patterns in patients' tissues and in the tissue microarray of TB patients. Tβ4 was highly expressed in both granulomas and surrounding lymphocytes in nascent granulomatous lung tissue, but was expressed only surrounding tissues of necrotic or caseous necrotic regions. The expression pattern of HIF-1α was similar to that of Tβ4. VEGF was expressed in both granulomas and blood vessels surrounding granulomas. The expression pattern of VEGF co-localized with CD31 (platelet endothelial cell adhesion molecule, PECAM-1), a blood endothelial cell marker, and partially co-localized with Tβ4. However, the expression of Tβ4 did not co-localize with alveolar macrophages. Stained alveolar macrophages were present surrounding regions of granuloma highly expressing Tβ4. We also analyzed mRNA expression in the sputum of 10 normal and 19 pulmonary TB patients. Expression of Tβ4 was significantly higher in patients with pulmonary tuberculosis than in normal controls. These data suggest that Tβ4 is highly expressed in granulomatous lung tissue with active pulmonary TB and is associated with HIF-1α- and VEGF-mediated inflammation and angiogenesis. Furthermore, the expression of Tβ4 in the sputum of pulmonary tuberculosis patients can be used as a potential marker for diagnosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

Adolescent Self-Esteem and Gender: Exploring Relations to Sexual Harassment, Body Image, Media Influence, and Emotional Expression.

ERIC Educational Resources Information Center

Polce-Lynch, Mary; Myers, Barbara J.; Kliewer, Wendy; Kilmartin, Christopher

2001-01-01

Evaluated self-reported influences on self-esteem involving the media, sexual harassment, body image, family and peer relationships, and emotional expression for 93 boys and 116 girls in grades 5, 8, and 12. Results generally supported a pattern in which boys and girls were most similar in late childhood and again in late adolescence. Discusses…

BAC Recombineering of the Agouti Loci from Spotted Gar and Zebrafish Reveals the Evolutionary Ancestry of Dorsal-Ventral Pigment Asymmetry in Fish.

PubMed

Cal, Laura; MegÍas, Manuel; Cerdá-Reverter, José Miguel; Postlethwait, John H; Braasch, Ingo; Rotllant, Josep

2017-11-01

Dorsoventral pigment patterning, characterized by a light ventrum and a dark dorsum, is one of the most widespread chromatic adaptations in vertebrate body coloration. In mammals, this countershading depends on differential expression of agouti-signaling protein (ASIP), which drives a switch of synthesis of one type of melanin to another within melanocytes. Teleost fish share countershading, but the pattern results from a differential distribution of multiple types of chromatophores, with black-brown melanophores most abundant in the dorsal body and reflective iridophores most abundant in the ventral body. We previously showed that Asip1 (a fish ortholog of mammalian ASIP) plays a role in patterning melanophores. This observation leads to the surprising hypothesis that agouti may control an evolutionarily conserved pigment pattern by regulating different mechanisms in mammals and fish. To test this hypothesis, we compared two ray-finned fishes: the teleost zebrafish and the nonteleost spotted gar (Lepisosteus oculatus). By examining the endogenous pattern of asip1 expression in gar, we demonstrate a dorsoventral-graded distribution of asip1 expression that is highest ventrally, similar to teleosts. Additionally, in the first reported experiments to generate zebrafish transgenic lines carrying a bacterial artificial chromosome (BAC) from spotted gar, we show that both transgenic zebrafish lines embryos replicate the endogenous asip1 expression pattern in adult zebrafish, showing that BAC transgenes from both species contain all of the regulatory elements required for regular asip1 expression within adult ray-finned fishes. These experiments provide evidence that the mechanism leading to an environmentally important pigment pattern was likely in place before the origin of teleosts. © 2017 Wiley Periodicals, Inc.

Detection of changes in gene regulatory patterns, elicited by perturbations of the Hsp90 molecular chaperone complex, by visualizing multiple experiments with an animation

PubMed Central

2011-01-01

Background To make sense out of gene expression profiles, such analyses must be pushed beyond the mere listing of affected genes. For example, if a group of genes persistently display similar changes in expression levels under particular experimental conditions, and the proteins encoded by these genes interact and function in the same cellular compartments, this could be taken as very strong indicators for co-regulated protein complexes. One of the key requirements is having appropriate tools to detect such regulatory patterns. Results We have analyzed the global adaptations in gene expression patterns in the budding yeast when the Hsp90 molecular chaperone complex is perturbed either pharmacologically or genetically. We integrated these results with publicly accessible expression, protein-protein interaction and intracellular localization data. But most importantly, all experimental conditions were simultaneously and dynamically visualized with an animation. This critically facilitated the detection of patterns of gene expression changes that suggested underlying regulatory networks that a standard analysis by pairwise comparison and clustering could not have revealed. Conclusions The results of the animation-assisted detection of changes in gene regulatory patterns make predictions about the potential roles of Hsp90 and its co-chaperone p23 in regulating whole sets of genes. The simultaneous dynamic visualization of microarray experiments, represented in networks built by integrating one's own experimental with publicly accessible data, represents a powerful discovery tool that allows the generation of new interpretations and hypotheses. PMID:21672238

Transcriptomic Analysis of Lung Tissue from Cigarette Smoke-Induced Emphysema Murine Models and Human Chronic Obstructive Pulmonary Disease Show Shared and Distinct Pathways.

PubMed

Yun, Jeong H; Morrow, Jarrett; Owen, Caroline A; Qiu, Weiliang; Glass, Kimberly; Lao, Taotao; Jiang, Zhiqiang; Perrella, Mark A; Silverman, Edwin K; Zhou, Xiaobo; Hersh, Craig P

2017-07-01

Although cigarette smoke (CS) is the primary risk factor for chronic obstructive pulmonary disease (COPD), the underlying molecular mechanisms for the significant variability in developing COPD in response to CS are incompletely understood. We performed lung gene expression profiling of two different wild-type murine strains (C57BL/6 and NZW/LacJ) and two genetic models with mutations in COPD genome-wide association study genes (HHIP and FAM13A) after 6 months of chronic CS exposure and compared the results to human COPD lung tissues. We identified gene expression patterns that correlate with severity of emphysema in murine and human lungs. Xenobiotic metabolism and nuclear erythroid 2-related factor 2-mediated oxidative stress response were commonly regulated molecular response patterns in C57BL/6, Hhip +/- , and Fam13a -/- murine strains exposed chronically to CS. The CS-resistant Fam13a -/- mouse and NZW/LacJ strain revealed gene expression response pattern differences. The Fam13a -/- strain diverged in gene expression compared with C57BL/6 control only after CS exposure. However, the NZW/LacJ strain had a unique baseline expression pattern, enriched for nuclear erythroid 2-related factor 2-mediated oxidative stress response and xenobiotic metabolism, and converged to a gene expression pattern similar to the more susceptible wild-type C57BL/6 after CS exposure. These results suggest that distinct molecular pathways may account for resistance to emphysema. Surprisingly, there were few genes commonly modulated in mice and humans. Our study suggests that gene expression responses to CS may be largely species and model dependent, yet shared pathways could provide biologically significant insights underlying individual susceptibility to CS.

A formal approach to the analysis of clinical computer-interpretable guideline modeling languages.

PubMed

Grando, M Adela; Glasspool, David; Fox, John

2012-01-01

To develop proof strategies to formally study the expressiveness of workflow-based languages, and to investigate their applicability to clinical computer-interpretable guideline (CIG) modeling languages. We propose two strategies for studying the expressiveness of workflow-based languages based on a standard set of workflow patterns expressed as Petri nets (PNs) and notions of congruence and bisimilarity from process calculus. Proof that a PN-based pattern P can be expressed in a language L can be carried out semi-automatically. Proof that a language L cannot provide the behavior specified by a PNP requires proof by exhaustion based on analysis of cases and cannot be performed automatically. The proof strategies are generic but we exemplify their use with a particular CIG modeling language, PROforma. To illustrate the method we evaluate the expressiveness of PROforma against three standard workflow patterns and compare our results with a previous similar but informal comparison. We show that the two proof strategies are effective in evaluating a CIG modeling language against standard workflow patterns. We find that using the proposed formal techniques we obtain different results to a comparable previously published but less formal study. We discuss the utility of these analyses as the basis for principled extensions to CIG modeling languages. Additionally we explain how the same proof strategies can be reused to prove the satisfaction of patterns expressed in the declarative language CIGDec. The proof strategies we propose are useful tools for analysing the expressiveness of CIG modeling languages. This study provides good evidence of the benefits of applying formal methods of proof over semi-formal ones. Copyright © 2011 Elsevier B.V. All rights reserved.

KIT gene mutations and patterns of protein expression in mucosal and acral melanoma.

PubMed

Abu-Abed, Suzan; Pennell, Nancy; Petrella, Teresa; Wright, Frances; Seth, Arun; Hanna, Wedad

2012-01-01

Recently characterized KIT (CD117) gene mutations have revealed new pathways involved in melanoma pathogenesis. In particular, certain subtypes harbor mutations similar to those observed in gastrointestinal stromal tumors, which are sensitive to treatment with tyrosine kinase inhibitors. The purpose of this study was to characterize KIT gene mutations and patterns of protein expression in mucosal and acral melanoma. Formalin-fixed, paraffin-embedded tissues were retrieved from our archives. Histologic assessment included routine hematoxylin-eosin stains and immunohistochemical staining for KIT. Genomic DNA was used for polymerase chain reaction-based amplification of exons 11 and 13. We identified 59 acral and mucosal melanoma cases, of which 78% showed variable levels of KIT expression. Sequencing of exons 11 and 13 was completed on all cases, and 4 (6.8%) mutant cases were isolated. We successfully optimized conditions for the detection of KIT mutations and showed that 8.6% of mucosal and 4.2% of acral melanoma cases at our institution harbor KIT mutations; all mutant cases showed strong, diffuse KIT protein expression. Our case series represents the first Canadian study to characterize KIT gene mutations and patterns of protein expression in acral and mucosal melanoma.

MAEWEST Expression in Flower Development of Two Petunia Species

PubMed Central

Segatto, Ana Lúcia A.; Turchetto-Zolet, Andreia Carina; Aizza, Lilian Cristina B.; Monte-Bello, Carolina C.; Dornelas, Marcelo C.; Margis, Rogerio; Freitas, Loreta B.

2013-01-01

Changes in flower morphology may influence the frequency and specificity of animal visitors. In Petunia (Solanaceae), adaptation to different pollinators is one of the factors leading to species diversification within the genus. This study provides evidence that differential expression patterns of MAWEWEST (MAW) homologs in different Petunia species may be associated with adaptive changes in floral morphology. The Petunia × hybrida MAW gene belongs to the WOX (WUSCHEL-related homeobox) transcription factor family and has been identified as a controller of petal fusion during corolla formation. We analyzed the expression patterns of P. inflata and P. axillaris MAW orthologs (PiMAW and PaMAW, respectively) by reverse transcriptase polymerase chain reaction (RT-PCR), reverse transcription–quantitative PCR (qRT-PCR) and in situ hybridization in different tissues and different developmental stages of flowers in both species. The spatial expression patterns of PiMAW and PaMAW were similar in P. inflata and P. axillaris. Nevertheless, PaMAW expression level in P. axillaris was higher during the late bud development stage as compared to PiMAW in P. inflata. This work represents an expansion of petunia developmental research to wild accessions. PMID:23823801

Expression and regulation of Sef, a novel signaling inhibitor of receptor tyrosine kinases-mediated signaling in the nervous system.

PubMed

Grothe, Claudia; Claus, Peter; Haastert, Kirsten; Lutwak, Ela; Ron, Dina

2008-01-01

Fibroblast growth factors (FGFs) signal via four distinct high affinity cell surface tyrosine kinase receptors, termed FGFR1-FGFR4 (FGFR-FGF-receptor). Recently, a new modulator of the FGF signaling pathway, the transmembrane protein 'similar expression to FGF genes' (Sef), has been identified in zebrafish and subsequently in mammals. Sef from mouse and human inhibits FGF mitogenic activity. In the present study, we analyzed the expression of Sef in distinct rat brain areas, in the spinal cord and in peripheral nerves and spinal ganglia using semi-quantitative RT-PCR. Furthermore, we studied the cellular expression pattern of Sef in intact spinal ganglia and sciatic nerves and, in addition, after crush lesion, using in situ hybridization and immunohistochemistry. Sef transcripts were expressed in all brain areas evaluated and in the spinal cord. A neuronal expression was found in both intact and injured spinal ganglia. Intact sciatic nerves, however, showed little or no Sef expression. Seven days after injury, high Sef expression was concentrated to the crush site, and Schwann cells seemed to be the source of Sef. The labeling pattern of up-regulated Sef was complementary to the patterns of FGF-2 and FGFR1-3, which were localized proximal and distal to the crush site. These results suggest an involvement of Sef during the nerve regeneration process, possibly by fine-tuning the effects of FGF signaling.

Dynamic patterns of expression for genes regulating cytokinin metabolism and signaling during rice inflorescence development.

PubMed

Yamburenko, Maria V; Kieber, Joseph J; Schaller, G Eric

2017-01-01

Inflorescence development in cereals, including such important crops as rice, maize, and wheat, directly affects grain number and size and is a key determinant of yield. Cytokinin regulates meristem size and activity and, as a result, has profound effects on inflorescence development and architecture. To clarify the role of cytokinin action in inflorescence development, we used the NanoString nCounter system to analyze gene expression in the early stages of rice panicle development, focusing on 67 genes involved in cytokinin biosynthesis, degradation, and signaling. Results point toward key members of these gene families involved in panicle development and indicate that the expression of many genes involved in cytokinin action differs between the panicle and vegetative tissues. Dynamic patterns of gene expression suggest that subnetworks mediate cytokinin action during different stages of panicle development. The variation of expression during panicle development is greater among genes encoding proteins involved in cytokinin metabolism and negative regulators of the pathway than for the genes in the primary response pathway. These results provide insight into the expression patterns of genes involved in cytokinin action during inflorescence development in a crop of agricultural importance, with relevance to similar processes in other monocots. The identification of subnetworks of genes expressed at different stages of early panicle development suggests that manipulation of their expression could have substantial effects on inflorescence architecture.

Initial leukemic gene expression profiles of patients with poor in vivo prednisone response are similar to those of blasts persisting under prednisone treatment in childhood acute lymphoblastic leukemia.

PubMed

Cario, Gunnar; Fetz, Andrea; Bretscher, Christian; Möricke, Anja; Schrauder, Andre; Stanulla, Martin; Schrappe, Martin

2008-09-01

Response to initial glucocorticoid (GC) treatment is a strong prognostic factor in childhood acute lymphoblastic leukemia (ALL). Patients with a poor prednisone response (PPR) have a poor event-free survival as compared to those with a good prednisone response (PGR). Causes of prednisone resistance are still not well understood. We hypothesized that GC resistance is an intrinsic feature of ALL cells which is reflected in the gene expression pattern and analyzed genome-wide gene expression using microarrays. A case-control study was performed comparing gene expression profiles from initial ALL samples of 20 patients with PPR and those of 20 patients with PGR. Differential gene expression of a subset of genes was confirmed by real-time quantitative polymerase chain reaction analysis and validation was performed in a second independent patient sample (n=20). We identified 121 genes that clearly distinguished prednisone-resistant from sensitive ALL samples (FDR<5%, fold change>or=1.5). Differential gene expression of 21 of these genes could be validated in a second independent set. Of importance, there was a remarkable concordance of genes identified by comparing expression signatures of PPR and PGR cells at diagnosis and those previously described to be up- or downregulated in leukemic cells persisting under GC treatment. Thus, GC resistance seems at least in part to be an intrinsic feature of leukemic cells. Leukemic cells of patients with PPR are characterized by gene expression pattern which are similar to those of resistant cells persisting under glucocorticoid treatment.

The polarized distribution of poly(A+)-mRNA-induced functional ion channels in the Xenopus oocyte plasma membrane is prevented by anticytoskeletal drugs.

PubMed

Peter, A B; Schittny, J C; Niggli, V; Reuter, H; Sigel, E

1991-08-01

Foreign mRNA was expressed in Xenopus laevis oocytes. Newly expressed ion currents localized in defined plasma membrane areas were measured using the two-electrode voltage clamp technique in combination with a specially designed chamber, that exposed only part of the surface on the oocytes to channel agonists or inhibitors. Newly expressed currents were found to be unequally distributed in the surface membrane of the oocyte. This asymmetry was most pronounced during the early phase of expression, when channels could almost exclusively be detected in the animal hemisphere of the oocyte. 4 d after injection of the mRNA, or later, channels could be found at a threefold higher density at the animal than at the vegetal pole area. The pattern of distribution was observed to be similar with various ion channels expressed from crude tissue mRNA and from cRNAs coding for rat GABAA receptor channel subunits. Electron microscopical analysis revealed very similar microvilli patterns at both oocyte pole areas. Thus, the asymmetric current distribution is not due to asymmetric surface structure. Upon incubation during the expression period in either colchicine or cytochalasin D, the current density was found to be equal in both pole areas. The inactive control substance beta-lumicolchicine had no effect on the asymmetry of distribution. Colchicine was without effect on the amplitude of the expressed whole cell current. Our measurements reveal a pathway for plasma membrane protein expression endogenous to the Xenopus oocyte, that may contribute to the formation and maintenance of polarity of this highly organized cell.

Functional conservation between rodents and chicken of regulatory sequences driving skeletal muscle gene expression in transgenic chickens

PubMed Central

2010-01-01

Background Regulatory elements that control expression of specific genes during development have been shown in many cases to contain functionally-conserved modules that can be transferred between species and direct gene expression in a comparable developmental pattern. An example of such a module has been identified at the rat myosin light chain (MLC) 1/3 locus, which has been well characterised in transgenic mouse studies. This locus contains two promoters encoding two alternatively spliced isoforms of alkali myosin light chain. These promoters are differentially regulated during development through the activity of two enhancer elements. The MLC3 promoter alone has been shown to confer expression of a reporter gene in skeletal and cardiac muscle in transgenic mice and the addition of the downstream MLC enhancer increased expression levels in skeletal muscle. We asked whether this regulatory module, sufficient for striated muscle gene expression in the mouse, would drive expression in similar domains in the chicken. Results We have observed that a conserved downstream MLC enhancer is present in the chicken MLC locus. We found that the rat MLC1/3 regulatory elements were transcriptionally active in chick skeletal muscle primary cultures. We observed that a single copy lentiviral insert containing this regulatory cassette was able to drive expression of a lacZ reporter gene in the fast-fibres of skeletal muscle in chicken in three independent transgenic chicken lines in a pattern similar to the endogenous MLC locus. Reporter gene expression in cardiac muscle tissues was not observed for any of these lines. Conclusions From these results we conclude that skeletal expression from this regulatory module is conserved in a genomic context between rodents and chickens. This transgenic module will be useful in future investigations of muscle development in avian species. PMID:20184756

Whole Genome Gene Expression Meta-Analysis of Inflammatory Bowel Disease Colon Mucosa Demonstrates Lack of Major Differences between Crohn's Disease and Ulcerative Colitis

PubMed Central

Østvik, Ann E.; Drozdov, Ignat; Gustafsson, Bjørn I.; Kidd, Mark; Beisvag, Vidar; Torp, Sverre H.; Waldum, Helge L.; Martinsen, Tom Christian; Damås, Jan Kristian; Espevik, Terje; Sandvik, Arne K.

2013-01-01

Background In inflammatory bowel disease (IBD), genetic susceptibility together with environmental factors disturbs gut homeostasis producing chronic inflammation. The two main IBD subtypes are Ulcerative colitis (UC) and Crohn’s disease (CD). We present the to-date largest microarray gene expression study on IBD encompassing both inflamed and un-inflamed colonic tissue. A meta-analysis including all available, comparable data was used to explore important aspects of IBD inflammation, thereby validating consistent gene expression patterns. Methods Colon pinch biopsies from IBD patients were analysed using Illumina whole genome gene expression technology. Differential expression (DE) was identified using LIMMA linear model in the R statistical computing environment. Results were enriched for gene ontology (GO) categories. Sets of genes encoding antimicrobial proteins (AMP) and proteins involved in T helper (Th) cell differentiation were used in the interpretation of the results. All available data sets were analysed using the same methods, and results were compared on a global and focused level as t-scores. Results Gene expression in inflamed mucosa from UC and CD are remarkably similar. The meta-analysis confirmed this. The patterns of AMP and Th cell-related gene expression were also very similar, except for IL23A which was consistently higher expressed in UC than in CD. Un-inflamed tissue from patients demonstrated minimal differences from healthy controls. Conclusions There is no difference in the Th subgroup involvement between UC and CD. Th1/Th17 related expression, with little Th2 differentiation, dominated both diseases. The different IL23A expression between UC and CD suggests an IBD subtype specific role. AMPs, previously little studied, are strongly overexpressed in IBD. The presented meta-analysis provides a sound background for further research on IBD pathobiology. PMID:23468882

Whole genome gene expression meta-analysis of inflammatory bowel disease colon mucosa demonstrates lack of major differences between Crohn's disease and ulcerative colitis.

PubMed

Granlund, Atle van Beelen; Flatberg, Arnar; Østvik, Ann E; Drozdov, Ignat; Gustafsson, Bjørn I; Kidd, Mark; Beisvag, Vidar; Torp, Sverre H; Waldum, Helge L; Martinsen, Tom Christian; Damås, Jan Kristian; Espevik, Terje; Sandvik, Arne K

2013-01-01

In inflammatory bowel disease (IBD), genetic susceptibility together with environmental factors disturbs gut homeostasis producing chronic inflammation. The two main IBD subtypes are Ulcerative colitis (UC) and Crohn's disease (CD). We present the to-date largest microarray gene expression study on IBD encompassing both inflamed and un-inflamed colonic tissue. A meta-analysis including all available, comparable data was used to explore important aspects of IBD inflammation, thereby validating consistent gene expression patterns. Colon pinch biopsies from IBD patients were analysed using Illumina whole genome gene expression technology. Differential expression (DE) was identified using LIMMA linear model in the R statistical computing environment. Results were enriched for gene ontology (GO) categories. Sets of genes encoding antimicrobial proteins (AMP) and proteins involved in T helper (Th) cell differentiation were used in the interpretation of the results. All available data sets were analysed using the same methods, and results were compared on a global and focused level as t-scores. Gene expression in inflamed mucosa from UC and CD are remarkably similar. The meta-analysis confirmed this. The patterns of AMP and Th cell-related gene expression were also very similar, except for IL23A which was consistently higher expressed in UC than in CD. Un-inflamed tissue from patients demonstrated minimal differences from healthy controls. There is no difference in the Th subgroup involvement between UC and CD. Th1/Th17 related expression, with little Th2 differentiation, dominated both diseases. The different IL23A expression between UC and CD suggests an IBD subtype specific role. AMPs, previously little studied, are strongly overexpressed in IBD. The presented meta-analysis provides a sound background for further research on IBD pathobiology.

Recrudescence Mechanisms and Gene Expression Profile of the Reproductive Tracts from Chickens during the Molting Period

PubMed Central

Ahn, Suzie E.; Lim, Chul-Hong; Lee, Jin-Young; Bae, Seung-Min; Kim, Jinyoung; Bazer, Fuller W.; Song, Gwonhwa

2013-01-01

The reproductive system of chickens undergoes dynamic morphological and functional tissue remodeling during the molting period. The present study identified global gene expression profiles following oviductal tissue regression and regeneration in laying hens in which molting was induced by feeding high levels of zinc in the diet. During the molting and recrudescence processes, progressive morphological and physiological changes included regression and re-growth of reproductive organs and fluctuations in concentrations of testosterone, progesterone, estradiol and corticosterone in blood. The cDNA microarray analysis of oviductal tissues revealed the biological significance of gene expression-based modulation in oviductal tissue during its remodeling. Based on the gene expression profiles, expression patterns of selected genes such as, TF, ANGPTL3, p20K, PTN, AvBD11 and SERPINB3 exhibited similar patterns in expression with gradual decreases during regression of the oviduct and sequential increases during resurrection of the functional oviduct. Also, miR-1689* inhibited expression of Sp1, while miR-17-3p, miR-22* and miR-1764 inhibited expression of STAT1. Similarly, chicken miR-1562 and miR-138 reduced the expression of ANGPTL3 and p20K, respectively. These results suggest that these differentially regulated genes are closely correlated with the molecular mechanism(s) for development and tissue remodeling of the avian female reproductive tract, and that miRNA-mediated regulation of key genes likely contributes to remodeling of the avian reproductive tract by controlling expression of those genes post-transcriptionally. The discovered global gene profiles provide new molecular candidates responsible for regulating morphological and functional recrudescence of the avian reproductive tract, and provide novel insights into understanding the remodeling process at the genomic and epigenomic levels. PMID:24098561

Juxtaposed genes in 7q21-22 amplicon contribute for two major gastric cancer sub-Types by mutual exclusive expression.

PubMed

Tamilzhalagan, Sembulingam; Muthuswami, Muthulakshmi; Ganesan, Kumaresan

2017-04-01

Genomic Copy Number Variations (CNV) and the associated gene signatures are useful for cancer prognosis, diagnosis, and targeted therapeutics. Earlier, 7q21-22 region was reported for frequent amplification in gastric cancer and potential candidate genes were identified. An analysis of the expression pattern of the 159 genes located in this amplicon revealed the consistent elevated expression of 21 genes in gastric tumors. These genes are closely arranged within the 20 Mb region, and they showed a bimodal expression pattern. SHFM1 and 14 other genes are expressed in intestinal type gastric tumors. COL1A2 and PCOLCE genes of this region are expressed in diffuse type gastric tumors. Similarly, genome-wide expression neighbors of SHFM1 and COL1A2 also showed mutually exclusive expression pattern, and stratify intestinal and diffuse type gastric tumors. The expression of COL1A2 gene-set is associated with poor prognosis, whereas the SHFM1 gene-set is associated with better prognosis among the gastric cancer patients. Despite being physical neighbors, the SHFM1 and COL1A2 genes express differentially in the two major clinical sub-types of gastric cancer in a mutually exclusive manner. The tight gene regulations operating between these juxtaposed genes deserve investigation to understand the molecular regulatory switch defining the determinants of the gastric cancer sub-types. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Multilayered epithelium in a rat model and human Barrett's esophagus: Similar expression patterns of transcription factors and differentiation markers

PubMed Central

Chen, Xiaoxin; Qin, Rong; Liu, Ba; Ma, Yan; Su, Yinghao; Yang, Chung S; Glickman, Jonathan N; Odze, Robert D; Shaheen, Nicholas J

2008-01-01

Background In rats, esophagogastroduodenal anastomosis (EGDA) without concomitant chemical carcinogen treatment leads to gastroesophageal reflux disease, multilayered epithelium (MLE, a presumed precursor in intestinal metaplasia), columnar-lined esophagus, dysplasia, and esophageal adenocarcinoma. Previously we have shown that columnar-lined esophagus in EGDA rats resembled human Barrett's esophagus (BE) in its morphology, mucin features and expression of differentiation markers (Lab. Invest. 2004;84:753–765). The purpose of this study was to compare the phenotype of rat MLE with human MLE, in order to gain insight into the nature of MLE and its potential role in the development of BE. Methods Serial sectioning was performed on tissue samples from 32 EGDA rats and 13 patients with established BE. Tissue sections were immunohistochemically stained for a variety of transcription factors and differentiation markers of esophageal squamous epithelium and intestinal columnar epithelium. Results We detected MLE in 56.3% (18/32) of EGDA rats, and in all human samples. As expected, both rat and human squamous epithelium, but not intestinal metaplasia, expressed squamous transcription factors and differentiation markers (p63, Sox2, CK14 and CK4) in all cases. Both rat and human intestinal metaplasia, but not squamous epithelium, expressed intestinal transcription factors and differentiation markers (Cdx2, GATA4, HNF1α, villin and Muc2) in all cases. Rat MLE shared expression patterns of Sox2, CK4, Cdx2, GATA4, villin and Muc2 with human MLE. However, p63 and CK14 were expressed in a higher proportion of rat MLE compared to humans. Conclusion These data indicate that rat MLE shares similar properties to human MLE in its expression pattern of these markers, not withstanding small differences, and support the concept that MLE may be a transitional stage in the metaplastic conversion of squamous to columnar epithelium in BE. PMID:18190713

Multilayered epithelium in a rat model and human Barrett's esophagus: similar expression patterns of transcription factors and differentiation markers.

PubMed

Chen, Xiaoxin; Qin, Rong; Liu, Ba; Ma, Yan; Su, Yinghao; Yang, Chung S; Glickman, Jonathan N; Odze, Robert D; Shaheen, Nicholas J

2008-01-11

In rats, esophagogastroduodenal anastomosis (EGDA) without concomitant chemical carcinogen treatment leads to gastroesophageal reflux disease, multilayered epithelium (MLE, a presumed precursor in intestinal metaplasia), columnar-lined esophagus, dysplasia, and esophageal adenocarcinoma. Previously we have shown that columnar-lined esophagus in EGDA rats resembled human Barrett's esophagus (BE) in its morphology, mucin features and expression of differentiation markers (Lab. Invest. 2004;84:753-765). The purpose of this study was to compare the phenotype of rat MLE with human MLE, in order to gain insight into the nature of MLE and its potential role in the development of BE. Serial sectioning was performed on tissue samples from 32 EGDA rats and 13 patients with established BE. Tissue sections were immunohistochemically stained for a variety of transcription factors and differentiation markers of esophageal squamous epithelium and intestinal columnar epithelium. We detected MLE in 56.3% (18/32) of EGDA rats, and in all human samples. As expected, both rat and human squamous epithelium, but not intestinal metaplasia, expressed squamous transcription factors and differentiation markers (p63, Sox2, CK14 and CK4) in all cases. Both rat and human intestinal metaplasia, but not squamous epithelium, expressed intestinal transcription factors and differentiation markers (Cdx2, GATA4, HNF1alpha, villin and Muc2) in all cases. Rat MLE shared expression patterns of Sox2, CK4, Cdx2, GATA4, villin and Muc2 with human MLE. However, p63 and CK14 were expressed in a higher proportion of rat MLE compared to humans. These data indicate that rat MLE shares similar properties to human MLE in its expression pattern of these markers, not withstanding small differences, and support the concept that MLE may be a transitional stage in the metaplastic conversion of squamous to columnar epithelium in BE.

Reciprocal transcriptional regulation of metabolic and signaling pathways correlates with disease severity in heart failure.

PubMed

Barth, Andreas S; Kumordzie, Ami; Frangakis, Constantine; Margulies, Kenneth B; Cappola, Thomas P; Tomaselli, Gordon F

2011-10-01

Systolic heart failure (HF) is a complex systemic syndrome that can result from a wide variety of clinical conditions and gene mutations. Despite phenotypic similarities, characterized by ventricular dilatation and reduced contractility, the extent of common and divergent gene expression between different forms of HF remains a matter of intense debate. Using a meta-analysis of 28 experimental (mouse, rat, dog) and human HF microarray studies, we demonstrate that gene expression changes are characterized by a coordinated and reciprocal regulation of major metabolic and signaling pathways. In response to a wide variety of stressors in animal models of HF, including ischemia, pressure overload, tachypacing, chronic isoproterenol infusion, Chagas disease, and transgenic mouse models, major metabolic pathways are invariably downregulated, whereas cell signaling pathways are upregulated. In contrast to this uniform transcriptional pattern that recapitulates a fetal gene expression program in experimental animal models of HF, human HF microarray studies displayed a greater heterogeneity, with some studies even showing upregulation of metabolic and downregulation of signaling pathways in end-stage human hearts. These discrepant results between animal and human studies are due to a number of factors, prominently cardiac disease and variable exposure to cold cardioplegic solution in nonfailing human samples, which can downregulate transcripts involved in oxidative phosphorylation (OXPHOS), thus mimicking gene expression patterns observed in failing samples. Additionally, β-blockers and ACE inhibitor use in end-stage human HF was associated with higher levels of myocardial OXPHOS transcripts, thus partially reversing the fetal gene expression pattern. In human failing samples, downregulation of metabolism was associated with hemodynamic markers of disease severity. Irrespective of the etiology, gene expression in failing myocardium is characterized by downregulation of metabolic transcripts and concomitant upregulation of cell signaling pathways. Gene expression changes along this metabolic-signaling axis in mammalian myocardium are a consistent feature in the heterogeneous transcriptional response observed in phenotypically similar models of HF.

Knockdown of connexin43-mediated regulation of the zone of polarizing activity in the developing chick limb leads to digit truncation.

PubMed

Law, Lee Yong; Lin, Jun Sheng; Becker, David L; Green, Colin R

2002-12-01

In the developing chick wing, the use of antisense oligodeoxynucleotides to transiently knock down the expression of the gap junction protein, connexin43 (Cx43), results in limb patterning defects, including deletion of the anterior digits. To understand more about how such defects arise, the effects of transient Cx43 knockdown on the expression patterns of several genes known to play pivotal roles in limb formation were examined. Sonic hedgehog (Shh), which is normally expressed in the zone of polarizing activity (ZPA) and is required to maintain both the ZPA and the apical ectodermal ridge (AER), was found to be downregulated in treated limbs within 30 h. Bone morphogenetic protein-2 (Bmp-2), a gene downstream of Shh, was similarly downregulated. Fibroblast growth factor-8 expression, however, was unaltered 30 h after treatment but was greatly reduced at 48 h post-treatment, when the AER begins to regress. Expressions of Bmp-4 and Muscle segment homeobox-like gene (Msx-1) were not affected at any of the time points examined. Cx43 expression is therefore involved in some, but not all patterning cascades, and appears to play a role in the regulation of ZPA activity.

Ectopic Six3 expression in the dragon eye goldfish.

PubMed

Ma, Dong-Mei; Zhu, Hua-Ping; Gui, Jian-Fang

2008-02-01

For goldfish (Carassius auratus), there are many varieties with different eye phenotypes due to artificial selection and adaptive evolution. Dragon eye is a variant eye characterized by a large-size eyeball protruding out of the socket similar to the eye of dragon in Chinese legends. In this study, anatomical structure of the goldfish dragon eye was compared with that of the common eye, and a stretching of the retina was observed in the enlarged dragon eye. Moreover, the homeobox-containing transcription factor Six3 cDNAs were cloned from the two types of goldfish, and the expression patterns were analyzed in both normal eye and dragon eye goldfish. No amino acid sequence differences were observed between the two deduced peptides, and the expression pattern of Six3 protein in dragon eye is quite similar to common eye during embryogenesis, but from 2 days after hatching, ectopic Six3 expression began to occur in the dragon eye, especially in the outer nuclear layer cells. With eye development, more predominant Six3 distribution was detected in the outer nuclear layer cells of dragon eye than that of normal eye, and fewer cell-layers in outer nuclear layer were observed in dragon eye retina than in normal eye retina. The highlight of this study is that higher Six3 expression occurs in dragon eye goldfish than in normal eye goldfish during retinal development of larvae.

Characterization of distinct classes of differential gene expression in osteoblast cultures from non-syndromic craniosynostosis bone.

PubMed

Rojas-Peña, Monica L; Olivares-Navarrete, Rene; Hyzy, Sharon; Arafat, Dalia; Schwartz, Zvi; Boyan, Barbara D; Williams, Joseph; Gibson, Greg

2014-01-01

Craniosynostosis, the premature fusion of one or more skull sutures, occurs in approximately 1 in 2500 infants, with the majority of cases non-syndromic and of unknown etiology. Two common reasons proposed for premature suture fusion are abnormal compression forces on the skull and rare genetic abnormalities. Our goal was to evaluate whether different sub-classes of disease can be identified based on total gene expression profiles. RNA-Seq data were obtained from 31 human osteoblast cultures derived from bone biopsy samples collected between 2009 and 2011, representing 23 craniosynostosis fusions and 8 normal cranial bones or long bones. No differentiation between regions of the skull was detected, but variance component analysis of gene expression patterns nevertheless supports transcriptome-based classification of craniosynostosis. Cluster analysis showed 4 distinct groups of samples; 1 predominantly normal and 3 craniosynostosis subtypes. Similar constellations of sub-types were also observed upon re-analysis of a similar dataset of 199 calvarial osteoblast cultures. Annotation of gene function of differentially expressed transcripts strongly implicates physiological differences with respect to cell cycle and cell death, stromal cell differentiation, extracellular matrix (ECM) components, and ribosomal activity. Based on these results, we propose non-syndromic craniosynostosis cases can be classified by differences in their gene expression patterns and that these may provide targets for future clinical intervention.

Characterization of Distinct Classes of Differential Gene Expression in Osteoblast Cultures from Non-Syndromic Craniosynostosis Bone

PubMed Central

Rojas-Peña, Monica L.; Olivares-Navarrete, Rene; Hyzy, Sharon; Arafat, Dalia; Schwartz, Zvi; Boyan, Barbara D.; Williams, Joseph; Gibson, Greg

2014-01-01

Craniosynostosis, the premature fusion of one or more skull sutures, occurs in approximately 1 in 2500 infants, with the majority of cases non-syndromic and of unknown etiology. Two common reasons proposed for premature suture fusion are abnormal compression forces on the skull and rare genetic abnormalities. Our goal was to evaluate whether different sub-classes of disease can be identified based on total gene expression profiles. RNA-Seq data were obtained from 31 human osteoblast cultures derived from bone biopsy samples collected between 2009 and 2011, representing 23 craniosynostosis fusions and 8 normal cranial bones or long bones. No differentiation between regions of the skull was detected, but variance component analysis of gene expression patterns nevertheless supports transcriptome-based classification of craniosynostosis. Cluster analysis showed 4 distinct groups of samples; 1 predominantly normal and 3 craniosynostosis subtypes. Similar constellations of sub-types were also observed upon re-analysis of a similar dataset of 199 calvarial osteoblast cultures. Annotation of gene function of differentially expressed transcripts strongly implicates physiological differences with respect to cell cycle and cell death, stromal cell differentiation, extracellular matrix (ECM) components, and ribosomal activity. Based on these results, we propose non-syndromic craniosynostosis cases can be classified by differences in their gene expression patterns and that these may provide targets for future clinical intervention. PMID:25184005

Construction and development of an auto-regulatory gene expression system in Bacillus subtilis.

PubMed

Guan, Chengran; Cui, Wenjing; Cheng, Jintao; Zhou, Li; Guo, Junling; Hu, Xu; Xiao, Guoping; Zhou, Zhemin

2015-09-21

Bacillus subtilis is an all-important Gram-positive bacterium of valuable biotechnological utility that has been widely used to over-produce industrially and pharmaceutically relevant proteins. There are a variety of expression systems in terms of types of transcriptional patterns, among which the auto-inducible and growth-phase-dependent promoters are gaining increasing favor due to their inducer-independent feature, allowing for the potential to industrially scale-up. To expand the applicability of the auto-inducible expression system, a novel auto-regulatory expression system coupled with cell density was constructed and developed in B. subtilis using the quorum-sensing related promoter srfA (PsrfA). The promoter of the srf operon was used to construct an expression plasmid with the green fluorescent protein (GFP) downstream of PsrfA. The expression displayed a cell-density-dependent pattern in that GFP had a fairly low expression level at the early exponential stage and was highly expressed at the late exponential as well as the stationary stages. Moreover, the recombinant system had a similar expression pattern in wild-type B. subtilis 168, WB600, and WB800, as well as in B. subtilis 168 derivative strain 1681, with the complete deletion of PsrfA, indicating the excellent compatibility of this system. Noticeably, the expression strength of PsrfA was enhanced by optimizing the -10 and -35 core sequence by substituting both sequences with consensus sequences. Importantly, the expression pattern was successfully developed in an auto-regulatory cell-density coupling system by the simple addition of glucose in which GFP could not be strongly expressed until glucose was depleted, resulting in a greater amount of the GFP product and increased cell density. The expression system was eventually tested by the successful over-production of aminopeptidase to a desired level. The auto-regulatory cell density coupling system that is mediated by PsrfA is a novel expression system that has an expression pattern that is split between cell-growth and over-expression, leading to an increase in cell density and elevating the overall expression levels of heterologously expressed proteins. The broad applicability of this system and inducer-free expression property in B. subtilis facilitate the industrial scale-up and medical applications for the over-production of a variety of desired proteins.

Expression Profile of Cytokines and Enzymes mRNA in Blood Leukocytes of Dogs with Leptospirosis and Its Associated Pulmonary Hemorrhage Syndrome.

PubMed

Maissen-Villiger, Carla A; Schweighauser, Ariane; van Dorland, H Anette; Morel, Claudine; Bruckmaier, Rupert M; Zurbriggen, Andreas; Francey, Thierry

2016-01-01

Dogs with leptospirosis show similar organ manifestations and disease course as human patients, including acute kidney injury and pulmonary hemorrhage, making this naturally-occurring infection a good animal model for human leptospirosis. Expression patterns of cytokines and enzymes have been correlated with disease manifestations and clinical outcome in humans and animals. The aim of this study was to describe mRNA expression of pro- and anti-inflammatory mediators in canine leptospirosis and to compare it with other renal diseases to identify patterns characterizing the disease and especially its pulmonary form. The mRNA abundance of cytokines (IL-1α, IL-1β, IL-8, IL-10, TNF-α, TGF-β) and enzymes (5-LO, iNOS) was measured prospectively in blood leukocytes from 34 dogs with severe leptospirosis and acute kidney injury, including 22 dogs with leptospirosis-associated pulmonary hemorrhages. Dogs with leptospirosis were compared to 14 dogs with acute kidney injury of other origin than leptospirosis, 8 dogs with chronic kidney disease, and 10 healthy control dogs. Canine leptospirosis was characterized by high 5-LO and low TNF-α expression compared to other causes of acute kidney injury, although the decreased TNF-α expression was also seen in chronic kidney disease. Leptospirosis-associated pulmonary hemorrhage was not characterized by a specific pattern, with only mild changes noted, including increased IL-10 and decreased 5-LO expression on some days in affected dogs. Fatal outcome from pulmonary hemorrhages was associated with low TNF-α, high IL-1β, and high iNOS expression, a pattern possibly expressed also in dogs with other forms of acute kidney injury. The patterns of cytokine and enzyme expression observed in the present study indicate a complex pro- and anti-inflammatory response to the infection with leptospires. The recognition of these signatures may be of diagnostic and prognostic relevance for affected individuals and they may indicate options for newer therapies targeting the identified pathways.

Morphological diversity of the avian foot is related with the pattern of msx gene expression in the developing autopod.

PubMed

Gañan, Y; Macias, D; Basco, R D; Merino, R; Hurle, J M

1998-04-01

The formation of the digits in amniota embryos is accompanied by apoptotic cell death of the interdigital mesoderm triggered through BMP signaling. Differences in the intensity of this apoptotic process account for the establishment of the different morphological types of feet observed in amniota (i.e., free-digits, webbed digits, lobulated digits). The molecular basis accounting for the differential pattern of interdigital cell death remains uncertain since the reduction of cell death in species with webbed digits is not accompanied by a parallel reduction in the pattern of expression of bmp genes in the interdigital regions. In this study we show that the duck interdigital web mesoderm exhibits an attenuated response to both BMP-induced apoptosis and TGFbeta-induced chondrogenesis in comparison with species with free digits. The attenuated response to these signals is accompanied by a reduced pattern of expression of msx-1 and msx-2 genes. Local application of FGF in the duck interdigit expands the domain of msx-2 expression but not the domain of msx-1 expression. This change in the expression of msx-2 is followed by a parallel increase in spontaneous and exogenous BMP-induced interdigital cell death, while the chondrogenic response to TGFbetas is unchanged. The regression of AER, as deduced by the pattern of extinction of fgf-8 expression, takes place in a similar fashion in the chick and duck regardless of the differences in interdigital cell death and msx gene expression. Implantation of BMP-beads in the distal limb mesoderm induces AER regression in both the chick and duck. This finding suggests an additional role for BMPs in the physiological regression of the AER. It is proposed that the formation of webbed vs free-digit feet in amniota results from a premature differentiation of the interdigital mesoderm into connective tissue caused by a reduced expression of msx genes in the developing autopod. Copyright 1998 Academic Press.

Evolving doublesex expression correlates with the origin and diversification of male sexual ornaments in the Drosophila immigrans species group.

PubMed

Rice, Gavin; Barmina, Olga; Hu, Kevin; Kopp, Artyom

2018-03-01

Male ornaments and other sex-specific traits present some of the most dramatic examples of evolutionary innovations. Comparative studies of similar but independently evolved traits are particularly important for identifying repeated patterns in the evolution of these traits. Male-specific modifications of the front legs have evolved repeatedly in Drosophilidae and other Diptera. The best understood of these novel structures is the sex comb of Drosophila melanogaster and its close relatives. Here, we examine the evolution of another male foreleg modification, the sex brush, found in the distantly related Drosophila immigrans species group. Similar to the sex comb, we find that the origin of the sex brush correlates with novel, spatially restricted expression of the doublesex (dsx) transcription factor, the primary effector of the Drosophila sex determination pathway. The diversity of Dsx expression patterns in the immigrans species group closely reflects the differences in the presence, position, and size of the sex brush. Together with previous work on sex comb evolution, these observations suggest that tissue-specific activation of dsx expression may be a common mechanism responsible for the evolution of sexual dimorphism and particularly for the origin of novel male-specific ornaments. © 2018 Wiley Periodicals, Inc.

Expression of Steroid Receptors in Ameloblasts during Amelogenesis in Rat Incisors.

PubMed

Houari, Sophia; Loiodice, Sophia; Jedeon, Katia; Berdal, Ariane; Babajko, Sylvie

2016-01-01

Endocrine disrupting chemicals (EDCs) play a part in the modern burst of diseases and interfere with the steroid hormone axis. Bisphenol A (BPA), one of the most active and widely used EDCs, affects ameloblast functions, leading to an enamel hypomineralization pattern similar to that of Molar Incisor Hypomineralization (MIH). In order to explore the molecular pathways stimulated by BPA during amelogenesis, we thoroughly investigated the receptors known to directly or indirectly mediate the effects of BPA. The expression patterns of high affinity BPA receptors (ERRγ, GPR30), of ketosteroid receptors (ERs, AR, PGR, GR, MR), of the retinoid receptor RXRα, and PPARγ were established using RT-qPCR analysis of RNAs extracted from microdissected enamel organ of adult rats. Their expression was dependent on the stage of ameloblast differentiation, except that of ERβ and PPARγ which remained undetectable. An additional large scale microarray analysis revealed three main groups of receptors according to their level of expression in maturation-stage ameloblasts. The expression level of RXRα was the highest, similar to the vitamin D receptor (VDR), whereas the others were 13 to 612-fold lower, with AR and GR being intermediate. Immunofluorescent analysis of VDR, ERα and AR confirmed their presence mainly in maturation- stage ameloblasts. These data provide further evidence that ameloblasts express a specific combination of hormonal receptors depending on their developmental stage. This study represents the first step toward understanding dental endocrinology as well as some of the effects of EDCs on the pathophysiology of amelogenesis.

Expression of Steroid Receptors in Ameloblasts during Amelogenesis in Rat Incisors

PubMed Central

Houari, Sophia; Loiodice, Sophia; Jedeon, Katia; Berdal, Ariane; Babajko, Sylvie

2016-01-01

Endocrine disrupting chemicals (EDCs) play a part in the modern burst of diseases and interfere with the steroid hormone axis. Bisphenol A (BPA), one of the most active and widely used EDCs, affects ameloblast functions, leading to an enamel hypomineralization pattern similar to that of Molar Incisor Hypomineralization (MIH). In order to explore the molecular pathways stimulated by BPA during amelogenesis, we thoroughly investigated the receptors known to directly or indirectly mediate the effects of BPA. The expression patterns of high affinity BPA receptors (ERRγ, GPR30), of ketosteroid receptors (ERs, AR, PGR, GR, MR), of the retinoid receptor RXRα, and PPARγ were established using RT-qPCR analysis of RNAs extracted from microdissected enamel organ of adult rats. Their expression was dependent on the stage of ameloblast differentiation, except that of ERβ and PPARγ which remained undetectable. An additional large scale microarray analysis revealed three main groups of receptors according to their level of expression in maturation-stage ameloblasts. The expression level of RXRα was the highest, similar to the vitamin D receptor (VDR), whereas the others were 13 to 612-fold lower, with AR and GR being intermediate. Immunofluorescent analysis of VDR, ERα and AR confirmed their presence mainly in maturation- stage ameloblasts. These data provide further evidence that ameloblasts express a specific combination of hormonal receptors depending on their developmental stage. This study represents the first step toward understanding dental endocrinology as well as some of the effects of EDCs on the pathophysiology of amelogenesis. PMID:27853434

Multiple abiotic stimuli are integrated in the regulation of rice gene expression under field conditions

PubMed Central

Plessis, Anne; Hafemeister, Christoph; Wilkins, Olivia; Gonzaga, Zennia Jean; Meyer, Rachel Sarah; Pires, Inês; Müller, Christian; Septiningsih, Endang M; Bonneau, Richard; Purugganan, Michael

2015-01-01

Plants rely on transcriptional dynamics to respond to multiple climatic fluctuations and contexts in nature. We analyzed the genome-wide gene expression patterns of rice (Oryza sativa) growing in rainfed and irrigated fields during two distinct tropical seasons and determined simple linear models that relate transcriptomic variation to climatic fluctuations. These models combine multiple environmental parameters to account for patterns of expression in the field of co-expressed gene clusters. We examined the similarities of our environmental models between tropical and temperate field conditions, using previously published data. We found that field type and macroclimate had broad impacts on transcriptional responses to environmental fluctuations, especially for genes involved in photosynthesis and development. Nevertheless, variation in solar radiation and temperature at the timescale of hours had reproducible effects across environmental contexts. These results provide a basis for broad-based predictive modeling of plant gene expression in the field. DOI: http://dx.doi.org/10.7554/eLife.08411.001 PMID:26609814

Local Context Finder (LCF) reveals multidimensional relationships among mRNA expression profiles of Arabidopsis responding to pathogen infection

PubMed Central

Katagiri, Fumiaki; Glazebrook, Jane

2003-01-01

A major task in computational analysis of mRNA expression profiles is definition of relationships among profiles on the basis of similarities among them. This is generally achieved by pattern recognition in the distribution of data points representing each profile in a high-dimensional space. Some drawbacks of commonly used pattern recognition algorithms stem from their use of a globally linear space and/or limited degrees of freedom. A pattern recognition method called Local Context Finder (LCF) is described here. LCF uses nonlinear dimensionality reduction for pattern recognition. Then it builds a network of profiles based on the nonlinear dimensionality reduction results. LCF was used to analyze mRNA expression profiles of the plant host Arabidopsis interacting with the bacterial pathogen Pseudomonas syringae. In one case, LCF revealed two dimensions essential to explain the effects of the NahG transgene and the ndr1 mutation on resistant and susceptible responses. In another case, plant mutants deficient in responses to pathogen infection were classified on the basis of LCF analysis of their profiles. The classification by LCF was consistent with the results of biological characterization of the mutants. Thus, LCF is a powerful method for extracting information from expression profile data. PMID:12960373

Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis.

PubMed

Paul, A L; Daugherty, C J; Bihn, E A; Chapman, D K; Norwood, K L; Ferl, R J

2001-06-01

The use of plants as integral components of life support systems remains a cornerstone of strategies for long-term human habitation of space and extraterrestrial colonization. Spaceflight experiments over the past few decades have refined the hardware required to grow plants in low-earth orbit and have illuminated fundamental issues regarding spaceflight effects on plant growth and development. Potential incipient hypoxia, resulting from the lack of convection-driven gas movement, has emerged as a possible major impact of microgravity. We developed transgenic Arabidopsis containing the alcohol dehydrogenase (Adh) gene promoter linked to the beta-glucuronidase (GUS) reporter gene to address specifically the possibility that spaceflight induces the plant hypoxia response and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. The staining patterns resulting from a 5-d mission on the orbiter Columbia during mission STS-93 indicate that the Adh/GUS reporter gene was activated in roots during the flight. However, the patterns of expression were not identical to terrestrial control inductions. Moreover, although terrestrial hypoxia induces Adh/GUS expression in the shoot apex, no apex staining was observed in the spaceflight plants. This indicates that either the normal hypoxia response signaling is impaired in spaceflight or that spaceflight inappropriately induces Adh/GUS activity for reasons other than hypoxia.

Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis

NASA Technical Reports Server (NTRS)

Paul, A. L.; Daugherty, C. J.; Bihn, E. A.; Chapman, D. K.; Norwood, K. L.; Ferl, R. J.

2001-01-01

The use of plants as integral components of life support systems remains a cornerstone of strategies for long-term human habitation of space and extraterrestrial colonization. Spaceflight experiments over the past few decades have refined the hardware required to grow plants in low-earth orbit and have illuminated fundamental issues regarding spaceflight effects on plant growth and development. Potential incipient hypoxia, resulting from the lack of convection-driven gas movement, has emerged as a possible major impact of microgravity. We developed transgenic Arabidopsis containing the alcohol dehydrogenase (Adh) gene promoter linked to the beta-glucuronidase (GUS) reporter gene to address specifically the possibility that spaceflight induces the plant hypoxia response and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. The staining patterns resulting from a 5-d mission on the orbiter Columbia during mission STS-93 indicate that the Adh/GUS reporter gene was activated in roots during the flight. However, the patterns of expression were not identical to terrestrial control inductions. Moreover, although terrestrial hypoxia induces Adh/GUS expression in the shoot apex, no apex staining was observed in the spaceflight plants. This indicates that either the normal hypoxia response signaling is impaired in spaceflight or that spaceflight inappropriately induces Adh/GUS activity for reasons other than hypoxia.

A Single-Wing Removal Method to Assess Correspondence Between Gene Expression and Phenotype in Butterflies: The Case of Distal-less.

PubMed

Adhikari, Kiran; Otaki, Joji M

2016-02-01

It is often desirable but difficult to retrieve information on the mature phenotype of an immature tissue sample that has been subjected to gene expression analysis. This problem cannot be ignored when individual variation within a species is large. To circumvent this problem in the butterfly wing system, we developed a new surgical method for removing a single forewing from a pupa using Junonia orithya; the operated pupa was left to develop to an adult without eclosion. The removed right forewing was subjected to gene expression analysis, whereas the non-removed left forewing was examined for color patterns. As a test case, we focused on Distal-less (Dll), which likely plays an active role in inducing elemental patterns, including eyespots. The Dll expression level in forewings was paired with eyespot size data from the same individual. One third of the operated pupae survived and developed wing color patterns. Dll expression levels were significantly higher in males than in females, although male eyespots were smaller in size than female eyespots. Eyespot size data showed weak but significant correlations with the Dll expression level in females. These results demonstrate that a single-wing removal method was successfully applied to the butterfly wing system and suggest the weak and non-exclusive contribution of Dll to eyespot size determination in this butterfly. Our novel methodology for establishing correspondence between gene expression and phenotype can be applied to other candidate genes for color pattern development in butterflies. Conceptually similar methods may also be applicable in other developmental systems.

Expression of SHOOT MERISTEMLESS, WUSCHEL, and ASYMMETRIC LEAVES1 Homologs in the Shoots of Podostemaceae: Implications for the Evolution of Novel Shoot Organogenesis[W

PubMed Central

Katayama, Natsu; Koi, Satoshi; Kato, Masahiro

2010-01-01

Podostemaceae (the river weeds) are ecologically and morphologically unusual angiosperms. The subfamily Tristichoideae has typical shoot apical meristems (SAMs) that produce leaves, but Podostemoideae is devoid of SAMs and new leaves arise below the base of older leaves. To reveal the genetic basis for the evolution of novel shoot organogenesis in Podostemaceae, we examined the expression patterns of key regulatory genes for shoot development (i.e., SHOOT MERISTEMLESS (STM), WUSCHEL (WUS), and ASYMMETRIC LEAVES1/ROUGH SHEATH2/PHANTASTICA (ARP) orthologs) in Tristichoideae and Podostemoideae. In the SAM-mediated shoots of Tristichoideae, like in model plants, STM and WUS orthologs were expressed in the SAM. In the SAM-less shoots of Podostemoideae, STM and WUS orthologs were expressed in the initiating leaf/bract primordium. In older leaf/bract primordia, WUS expression disappeared and STM expression became restricted to the basal part, whereas ARP was expressed in the distal part in a complementary pattern to STM expression. In the reproductive shoots of Podostemoideae with a normal mode of flower development, STM and WUS were expressed in the floral meristem, but not in the floral organs, similar to the pattern in model plants. These results suggest that the leaf/bract of Podostemoideae is initiated as a SAM and differentiates into a single apical leaf/bract, resulting in the evolution of novel shoot-leaf mixed organs in Podostemaceae. PMID:20647344

Brain c-fos expression patterns induced by emotional stressors differing in nature and intensity.

PubMed

Úbeda-Contreras, Jesús; Marín-Blasco, Ignacio; Nadal, Roser; Armario, Antonio

2018-06-01

Regardless of its particular nature, emotional stressors appear to elicit a widespread and roughly similar brain activation pattern as evaluated by c-fos expression. However, their behavioral and physiological consequences may strongly differ. Here we addressed in adult male rats the contribution of the intensity and the particular nature of stressors by comparing, in a set of brain areas, the number of c-fos expressing neurons in response to open-field, cat odor or immobilization on boards (IMO). These are qualitatively different stressors that are known to differ in terms of intensity, as evaluated by biological markers. In the present study, plasma levels of the adrenocorticotropic hormone (ACTH) demonstrated that intensity increases in the following order: open-field, cat odor and IMO. Four different c-fos activation patterns emerged among all areas studied: (i) positive relationship with intensity (posterior-dorsal medial amygdala, dorsomedial hypothalamus, lateral septum ventral and paraventricular nucleus of the hypothalamus), (ii) negative relationship with intensity (cingulate cortex 1, posterior insular cortex, dorsal striatum, nucleus accumbens and some subdivisions of the hippocampal formation); (iii) activation not dependent on the intensity of the stressor (prelimbic and infralimbic cortex and lateral and basolateral amygdala); and (iv) activation specifically associated with cat odor (ventromedial amygdala and ventromedial hypothalamus). Histone 3 phosphorylation at serine 10, another neuronal activation marker, corroborated c-fos results. Summarizing, deepest analysis of the brain activation pattern elicit by emotional stressor indicated that, in spite of activating similar areas, each stressor possess their own brain activation signature, mediated mainly by qualitative aspects but also by intensity.

Plant adaptive radiation mediated by polyploid plasticity in transcriptomes.

PubMed

Shimizu-Inatsugi, Rie; Terada, Aika; Hirose, Kyosuke; Kudoh, Hiroshi; Sese, Jun; Shimizu, Kentaro K

2017-01-01

The habitats of polyploid species are generally distinct from their parental species. Stebbins described polyploids as 'general purpose genotypes', which can tolerate a wide range of environmental conditions. However, little is known about its molecular basis because of the complexity of polyploid genomes. We hypothesized that allopolyploid species might utilize the expression patterns of both parents depending on environments (polyploid plasticity hypothesis). We focused on hydrological niche segregation along fine-scale soil moisture and waterlogging gradients. Two diploid species, Cardamine amara and Cardamine hirsuta, grew best in submerged and unsubmerged conditions, respectively, consistent with their natural habitats. Interestingly, the allotetraploid Cardamine flexuosa derived from them grew similarly in fluctuating as well as submerged and unsubmerged conditions, consistent with its wide environmental tolerance. A similar pattern was found in another species trio: allotetraploid Cardamine scutata and its parents. Using the close relatedness of Cardamine and Arabidopsis, we quantified genomewide expression patterns following dry and wet treatments using an Arabidopsis microarray. Hierarchical clustering analysis revealed that the expression pattern of C. flexuosa clustered with C. hirsuta in the dry condition and with C. amara in the wet condition, supporting our hypothesis. Furthermore, the induction levels of most genes in the allopolyploid were lower than in a specialist diploid species. This reflects a disadvantage of being allopolyploid arising from fixed heterozygosity. We propose that recurrent allopolyploid speciation along soil moisture and waterlogging gradients confers niche differentiation and reproductive isolation simultaneously and serves as a model for studying the molecular basis of ecological speciation and adaptive radiation. © 2016 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

Gene expression patterns and dynamics of the colonization of common bean (Phaseolus vulgaris L.) by highly virulent and weakly virulent strains of Fusarium oxysporum

PubMed Central

Niño-Sánchez, Jonathan; Tello, Vega; Casado-del Castillo, Virginia; Thon, Michael R.; Benito, Ernesto P.; Díaz-Mínguez, José María

2015-01-01

The dynamics of root and hypocotyl colonization, and the gene expression patterns of several fungal virulence factors and plant defense factors have been analyzed and compared in the interaction of two Fusarium oxysporum f. sp. phaseoli strains displaying clear differences in virulence, with a susceptible common bean cultivar. The growth of the two strains on the root surface and the colonization of the root was quantitatively similar although the highly virulent (HV) strain was more efficient reaching the central root cylinder. The main differences between both strains were found in the temporal and spatial dynamics of crown root and hypocotyl colonization. The increase of fungal biomass in the crown root was considerably larger for the HV strain, which, after an initial stage of global colonization of both the vascular cylinder and the parenchymal cells, restricted its growth to the newly differentiated xylem vessels. The weakly virulent (WV) strain was a much slower and less efficient colonizer of the xylem vessels, showing also growth in the intercellular spaces of the parenchyma. Most of the virulence genes analyzed showed similar expression patterns in both strains, except SIX1, SIX6 and the gene encoding the transcription factor FTF1, which were highly upregulated in root crown and hypocotyl. The response induced in the infected plant showed interesting differences for both strains. The WV strain induced an early and strong transcription of the PR1 gene, involved in SAR response, while the HV strain preferentially induced the early expression of the ethylene responsive factor ERF2. PMID:25883592

Patterning C. elegans: homeotic cluster genes, cell fates and cell migrations.

PubMed

Salser, S J; Kenyon, C

1994-05-01

Despite its simple body form, the nematode C. elegans expresses homeotic cluster genes similar to those of insects and vertebrates in the patterning of many cell types and tissues along the anteroposterior axis. In the ventral nerve cord, these genes program spatial patterns of cell death, fusion, division and neurotransmitter production; in migrating cells they regulate the direction and extent of movement. Nematode development permits an analysis at the cellular level of how homeotic cluster genes interact to specify cell fates, and how cell behavior can be regulated to assemble an organism.

Global Gene Expression Change Induced by Major Thoracoabdominal Surgery.

PubMed

Allen, Casey J; Griswold, Anthony J; Schulman, Carl I; Sleeman, Danny; Levi, Joe U; Livingstone, Alan S; Proctor, Kenneth G

2017-12-01

To test the hypothesis that major thoracoabdominal surgery induces gene expression changes associated with adverse outcomes. Widely different traumatic injuries evoke surprisingly similar gene expression profiles, but there is limited information on whether the iatrogenic injury caused by major surgery is associated with similar patterns. With informed consent, blood samples were obtained from 50 patients before and after open transhiatal esophagectomy or pancreaticoduodenectomy. Twelve cases with complicated recoveries (death, infection, venous thromboembolism) were matched with 12 cases with uneventful recoveries. Global gene expression was assayed using human microarray chips. A 2-fold change with a corrected P < 0.05 was considered differentially expressed. In these 24 patients, 522 genes were differentially expressed after surgery; 248 (48%) were upregulated (innate immunity and inflammation) and 274 (52%) were downregulated [adaptive immunity (antigen presentation, T-cell function)]. Hierarchical clustering of the profile reliably predicted pre- and postoperative status. The within-patient change was 3.08 ± 0.91-fold. There was no measurable association with age, malignancy, procedure, surgery length, operative blood loss, or transfusion requirements, but was positively associated with postoperative infection (3.81 ± 0.97 vs 2.79 ± 0.73; P = 0.009) and hospital length of stay (r = 0.583, P = 0.003). Venous thromboembolism and mortality each occurred in one patient, thus no associations were possible. Major surgery induces a quantifiable pattern of gene expression change that is associated with adverse outcome. This could reflect early impaired adaptive immunity and suggests potential therapeutic targets to improve postoperative recovery.

An anterior signaling center patterns and sizes the anterior neuroectoderm of the sea urchin embryo.

PubMed

Range, Ryan C; Wei, Zheng

2016-05-01

Anterior signaling centers help specify and pattern the early anterior neuroectoderm (ANE) in many deuterostomes. In sea urchin the ANE is restricted to the anterior of the late blastula stage embryo, where it forms a simple neural territory comprising several types of neurons as well as the apical tuft. Here, we show that during early development, the sea urchin ANE territory separates into inner and outer regulatory domains that express the cardinal ANE transcriptional regulators FoxQ2 and Six3, respectively. FoxQ2 drives this patterning process, which is required to eliminate six3 expression from the inner domain and activate the expression of Dkk3 and sFRP1/5, two secreted Wnt modulators. Dkk3 and low expression levels of sFRP1/5 act additively to potentiate the Wnt/JNK signaling pathway governing the positioning of the ANE territory around the anterior pole, whereas high expression levels of sFRP1/5 antagonize Wnt/JNK signaling. sFRP1/5 and Dkk3 levels are rigidly maintained via autorepressive and cross-repressive interactions with Wnt signaling components and additional ANE transcription factors. Together, these data support a model in which FoxQ2 initiates an anterior patterning center that implements correct size and positions of ANE structures. Comparisons of functional and expression studies in sea urchin, hemichordate and chordate embryos reveal striking similarities among deuterostome ANE regulatory networks and the molecular mechanism that positions and defines ANE borders. These data strongly support the idea that the sea urchin embryo uses an ancient anterior patterning system that was present in the common ambulacrarian/chordate ancestor. © 2016. Published by The Company of Biologists Ltd.

Meta-Profiles of Gene Expression during Aging: Limited Similarities between Mouse and Human and an Unexpectedly Decreased Inflammatory Signature

PubMed Central

Swindell, William R.; Johnston, Andrew; Sun, Liou; Xing, Xianying; Fisher, Gary J.; Bulyk, Martha L.; Elder, James T.; Gudjonsson, Johann E.

2012-01-01

Background Skin aging is associated with intrinsic processes that compromise the structure of the extracellular matrix while promoting loss of functional and regenerative capacity. These processes are accompanied by a large-scale shift in gene expression, but underlying mechanisms are not understood and conservation of these mechanisms between humans and mice is uncertain. Results We used genome-wide expression profiling to investigate the aging skin transcriptome. In humans, age-related shifts in gene expression were sex-specific. In females, aging increased expression of transcripts associated with T-cells, B-cells and dendritic cells, and decreased expression of genes in regions with elevated Zeb1, AP-2 and YY1 motif density. In males, however, these effects were contrasting or absent. When age-associated gene expression patterns in human skin were compared to those in tail skin from CB6F1 mice, overall human-mouse correspondence was weak. Moreover, inflammatory gene expression patterns were not induced with aging of mouse tail skin, and well-known aging biomarkers were in fact decreased (e.g., Clec7a, Lyz1 and Lyz2). These unexpected patterns and weak human-mouse correspondence may be due to decreased abundance of antigen presenting cells in mouse tail skin with age. Conclusions Aging is generally associated with a pro-inflammatory state, but we have identified an exception to this pattern with aging of CB6F1 mouse tail skin. Aging therefore does not uniformly heighten inflammatory status across all mouse tissues. Furthermore, we identified both intercellular and intracellular mechanisms of transcriptome aging, including those that are sex- and species-specific. PMID:22413003

Heterogeneous conservation of Dlx paralog co-expression in jawed vertebrates.

PubMed

Debiais-Thibaud, Mélanie; Metcalfe, Cushla J; Pollack, Jacob; Germon, Isabelle; Ekker, Marc; Depew, Michael; Laurenti, Patrick; Borday-Birraux, Véronique; Casane, Didier

2013-01-01

The Dlx gene family encodes transcription factors involved in the development of a wide variety of morphological innovations that first evolved at the origins of vertebrates or of the jawed vertebrates. This gene family expanded with the two rounds of genome duplications that occurred before jawed vertebrates diversified. It includes at least three bigene pairs sharing conserved regulatory sequences in tetrapods and teleost fish, but has been only partially characterized in chondrichthyans, the third major group of jawed vertebrates. Here we take advantage of developmental and molecular tools applied to the shark Scyliorhinus canicula to fill in the gap and provide an overview of the evolution of the Dlx family in the jawed vertebrates. These results are analyzed in the theoretical framework of the DDC (Duplication-Degeneration-Complementation) model. The genomic organisation of the catshark Dlx genes is similar to that previously described for tetrapods. Conserved non-coding elements identified in bony fish were also identified in catshark Dlx clusters and showed regulatory activity in transgenic zebrafish. Gene expression patterns in the catshark showed that there are some expression sites with high conservation of the expressed paralog(s) and other expression sites with events of paralog sub-functionalization during jawed vertebrate diversification, resulting in a wide variety of evolutionary scenarios within this gene family. Dlx gene expression patterns in the catshark show that there has been little neo-functionalization in Dlx genes over gnathostome evolution. In most cases, one tandem duplication and two rounds of vertebrate genome duplication have led to at least six Dlx coding sequences with redundant expression patterns followed by some instances of paralog sub-functionalization. Regulatory constraints such as shared enhancers, and functional constraints including gene pleiotropy, may have contributed to the evolutionary inertia leading to high redundancy between gene expression patterns.

High-mobility group B1 (HMGB1) and receptor for advanced glycation end-products (RAGE) expression in canine lymphoma.

PubMed

Sterenczak, Katharina A; Joetzke, Alexa E; Willenbrock, Saskia; Eberle, Nina; Lange, Sandra; Junghanss, Christian; Nolte, Ingo; Bullerdiek, Jörn; Simon, Daniela; Murua Escobar, Hugo

2010-12-01

Canine lymphoma is a commonly occurring, spontaneously developing neoplasia similar to human non-Hodgkin's lymphoma and, thus, is used as a valuable model for human malignancy. HMGB1 and RAGE are strongly associated with tumour progression and vascularisation. Consequently, deregulated RAGE and HMGB1 may play an important role in the mechanisms involved in lymphoma progression. Expression patterns of HMGB1 and RAGE were analysed in 22 canine lymphoma and three canine non-neoplastic control samples via real time PCR and canine beta-glucuronidase gene (GUSB) as endogenous control. HMGB1 was up-regulated in the neoplastic samples, while RAGE expression remained inconspicuous. This study demonstrated similar mechanisms in lymphoma progression in humans and dogs due to overexpression of HMGB1, which was described in human lymphomas. RAGE remained stable in terms of expression indicating that the extracellular HMGB1-induced effects are regulated by HMGB1 itself.

Circadian expression of clock and putative clock-controlled genes in skeletal muscle of the zebrafish.

PubMed

Amaral, Ian P G; Johnston, Ian A

2012-01-01

To identify circadian patterns of gene expression in skeletal muscle, adult male zebrafish were acclimated for 2 wk to a 12:12-h light-dark photoperiod and then exposed to continuous darkness for 86 h with ad libitum feeding. The increase in gut food content associated with the subjective light period was much diminished by the third cycle, enabling feeding and circadian rhythms to be distinguished. Expression of zebrafish paralogs of mammalian transcriptional activators of the circadian mechanism (bmal1, clock1, and rora) followed a rhythmic pattern with a ∼24-h periodicity. Peak expression of rora paralogs occurred at the beginning of the subjective light period [Zeitgeber time (ZT)07 and ZT02 for roraa and rorab], whereas the highest expression of bmal1 and clock paralogs occurred 12 h later (ZT13-15 and ZT16 for bmal and clock paralogs). Expression of the transcriptional repressors cry1a, per1a/1b, per2, per3, nr1d2a/2b, and nr1d1 also followed a circadian pattern with peak expression at ZT0-02. Expression of the two paralogs of cry2 occurred in phase with clock1a/1b. Duplicated genes had a high correlation of expression except for paralogs of clock1, nr1d2, and per1, with cry1b showing no circadian pattern. The highest expression difference was 9.2-fold for the activator bmal1b and 51.7-fold for the repressor per1a. Out of 32 candidate clock-controlled genes, only myf6, igfbp3, igfbp5b, and hsf2 showed circadian expression patterns. Igfbp3, igfbp5b, and myf6 were expressed in phase with clock1a/1b and had an average of twofold change in expression from peak to trough, whereas hsf2 transcripts were expressed in phase with cry1a and had a 7.2-fold-change in expression. The changes in expression of clock and clock-controlled genes observed during continuous darkness were also observed at similar ZTs in fish exposed to a normal photoperiod in a separate control experiment. The role of circadian clocks in regulating muscle maintenance and growth are discussed.

Expression profiling of snoRNAs in normal hematopoiesis and AML

PubMed Central

Warner, Wayne A.; Spencer, David H.; Trissal, Maria; White, Brian S.; Helton, Nichole; Ley, Timothy J.

2018-01-01

Small nucleolar RNAs (snoRNAs) are noncoding RNAs that contribute to ribosome biogenesis and RNA splicing by modifying ribosomal RNA and spliceosome RNAs, respectively. We optimized a next-generation sequencing approach and a custom analysis pipeline to identify and quantify expression of snoRNAs in acute myeloid leukemia (AML) and normal hematopoietic cell populations. We show that snoRNAs are expressed in a lineage- and development-specific fashion during hematopoiesis. The most striking examples involve snoRNAs located in 2 imprinted loci, which are highly expressed in hematopoietic progenitors and downregulated during myeloid differentiation. Although most snoRNAs are expressed at similar levels in AML cells compared with CD34+, a subset of snoRNAs showed consistent differential expression, with the great majority of these being decreased in the AML samples. Analysis of host gene expression, splicing patterns, and whole-genome sequence data for mutational events did not identify transcriptional patterns or genetic alterations that account for these expression differences. These data provide a comprehensive analysis of the snoRNA transcriptome in normal and leukemic cells and should be helpful in the design of studies to define the contribution of snoRNAs to normal and malignant hematopoiesis. PMID:29365324

Involvement of chemokine receptors in breast cancer metastasis

NASA Astrophysics Data System (ADS)

Müller, Anja; Homey, Bernhard; Soto, Hortensia; Ge, Nianfeng; Catron, Daniel; Buchanan, Matthew E.; McClanahan, Terri; Murphy, Erin; Yuan, Wei; Wagner, Stephan N.; Barrera, Jose Luis; Mohar, Alejandro; Verástegui, Emma; Zlotnik, Albert

2001-03-01

Breast cancer is characterized by a distinct metastatic pattern involving the regional lymph nodes, bone marrow, lung and liver. Tumour cell migration and metastasis share many similarities with leukocyte trafficking, which is critically regulated by chemokines and their receptors. Here we report that the chemokine receptors CXCR4 and CCR7 are highly expressed in human breast cancer cells, malignant breast tumours and metastases. Their respective ligands CXCL12/SDF-1α and CCL21/6Ckine exhibit peak levels of expression in organs representing the first destinations of breast cancer metastasis. In breast cancer cells, signalling through CXCR4 or CCR7 mediates actin polymerization and pseudopodia formation, and subsequently induces chemotactic and invasive responses. In vivo, neutralizing the interactions of CXCL12/CXCR4 significantly impairs metastasis of breast cancer cells to regional lymph nodes and lung. Malignant melanoma, which has a similar metastatic pattern as breast cancer but also a high incidence of skin metastases, shows high expression levels of CCR10 in addition to CXCR4 and CCR7. Our findings indicate that chemokines and their receptors have a critical role in determining the metastatic destination of tumour cells.

Ecological and evolutionary drivers of the elevational gradient of diversity.

PubMed

Laiolo, Paola; Pato, Joaquina; Obeso, José Ramón

2018-05-02

Ecological, evolutionary, spatial and neutral theories make distinct predictions and provide distinct explanations for the mechanisms that control the relationship between diversity and the environment. Here, we test predictions of the elevational diversity gradient focusing on Iberian bumblebees, grasshoppers and birds. Processes mediated by local abundance and regional diversity concur in explaining local diversity patterns along elevation. Effects expressed through variation in abundance were similar among taxa and point to the overriding role of a physical factor, temperature. This determines how energy is distributed among individuals and ultimately how the resulting pattern of abundance affects species incidence. Effects expressed through variation in regional species pools depended instead on taxon-specific evolutionary history, and lead to diverging responses under similar environmental pressures. Local filters and regional variation also explain functional diversity gradients, in line with results from species richness that indicate an (local) ecological and (regional) historical unfolding of diversity-elevation relationships. © 2018 John Wiley & Sons Ltd/CNRS.

Transcriptional architecture of the primate neocortex.

PubMed

Bernard, Amy; Lubbers, Laura S; Tanis, Keith Q; Luo, Rui; Podtelezhnikov, Alexei A; Finney, Eva M; McWhorter, Mollie M E; Serikawa, Kyle; Lemon, Tracy; Morgan, Rebecca; Copeland, Catherine; Smith, Kimberly; Cullen, Vivian; Davis-Turak, Jeremy; Lee, Chang-Kyu; Sunkin, Susan M; Loboda, Andrey P; Levine, David M; Stone, David J; Hawrylycz, Michael J; Roberts, Christopher J; Jones, Allan R; Geschwind, Daniel H; Lein, Ed S

2012-03-22

Genome-wide transcriptional profiling was used to characterize the molecular underpinnings of neocortical organization in rhesus macaque, including cortical areal specialization and laminar cell-type diversity. Microarray analysis of individual cortical layers across sensorimotor and association cortices identified robust and specific molecular signatures for individual cortical layers and areas, prominently involving genes associated with specialized neuronal function. Overall, transcriptome-based relationships were related to spatial proximity, being strongest between neighboring cortical areas and between proximal layers. Primary visual cortex (V1) displayed the most distinctive gene expression compared to other cortical regions in rhesus and human, both in the specialized layer 4 as well as other layers. Laminar patterns were more similar between macaque and human compared to mouse, as was the unique V1 profile that was not observed in mouse. These data provide a unique resource detailing neocortical transcription patterns in a nonhuman primate with great similarity in gene expression to human. Copyright © 2012 Elsevier Inc. All rights reserved.

AFLP-based transcript profiling for cassava genome-wide expression analysis in the onset of storage root formation.

PubMed

Sojikul, Punchapat; Kongsawadworakul, Panida; Viboonjun, Unchera; Thaiprasit, Jittrawan; Intawong, Burapat; Narangajavana, Jarunya; Svasti, Mom Rajawong Jisnuson

2010-10-01

Cassava (Manihot esculenta Crantz) is a root crop that accumulates large quantities of starch, and it is an important source of carbohydrate. Study on gene expressions during storage root development provides important information on storage root formation and starch accumulation as well as unlock new traits for improving of starch yield. cDNA-Amplified Fragment Length Polymorphism (AFLP) was used to compare gene expression profiles in fibrous and storage roots of cassava cultivar Kasetsart 50. Total of 155 differentially expressed transcript-derived fragments with undetectable or low expression in leaves were characterized and classified into 11 groups regarding to their functions. The four major groups were no similarity (20%), hypothetical or unknown proteins (17%), cellular metabolism and biosynthesis (17%) and cellular communication and signaling (14%). Interestingly, sulfite reductase (MeKD82), calcium-dependent protein kinase (CDPK) (MeKD83), ent-kaurene synthase (KS) (MeKD106) and hexose transporter (HT) (MeKD154) showed root-specific expression patterns. This finding is consistent with previously reported genes involved in the initiation of potato tuber. Semi-quantitative reverse transcription polymerase chain reaction of early-developed root samples confirmed that those four genes exhibited significant expression with similar pattern in the storage root initiation and early developmental stages. We proposed that KS and HT may involve in transient induction of CDPK expression, which may play an important role in the signaling pathway of storage root initiation. Sulfite reductase, on the other hand, may involve in storage root development by facilitating sulfur-containing protein biosynthesis or detoxifying the cyanogenic glucoside content through aspartate biosynthesis. Copyright © Physiologia Plantarum 2010.

IL-8 Expression in Granulocytic Epithelial Lesions of Idiopathic Duct-centric Pancreatitis (Type 2 Autoimmune Pancreatitis).

PubMed

Ku, Yuna; Hong, Seung-Mo; Fujikura, Kohei; Kim, Sung Joo; Akita, Masayuki; Abe-Suzuki, Shiho; Shiomi, Hideyuki; Masuda, Atsuhiro; Itoh, Tomoo; Azuma, Takeshi; Kim, Myung-Hwan; Zen, Yoh

2017-08-01

Type 2 autoimmune pancreatitis (type 2 AIP) develops in isolation or sometimes in association with ulcerative colitis. Its diagnosis requires the histologic confirmation of granulocytic epithelial lesions (GELs) with no diagnostic biomarker currently available. This study aimed to elucidate the tissue expression of cytokines and their diagnostic value in this condition. In quantitative polymerase chain reaction for multiple cytokines using tissue-derived mRNA, the expression level of interleukin (IL)-8 was markedly higher in type 2 AIP than in type 1 AIP (P<0.001). In immunostaining, IL-8 expression was detected in the ductal/ductular epithelium (11/13; 85%) and infiltrating neutrophils or lymphocytes (12/12; 100%) in type 2 AIP, but was almost entirely negative in type 1 AIP (n=13; both, P<0.001). Although obstructive pancreatitis adjacent to pancreatic cancers (peritumoral pancreatitis) exhibited IL-8 expression in the epithelium (3/12; 25%) and inflammatory cells (10/12; 83%), expression levels were significantly lower than those in type 2 AIP (P<0.001 and 0.020, respectively). The presence of either GELs or IL-8-positive epithelium discriminated type 2 AIP from type 1 AIP or obstructive pancreatitis with 92% sensitivity and 92% to 100% specificity. Furthermore, CD3/IL-8-coexpressing lymphocytes were almost restricted to type 2 AIP. Interestingly, a similar pattern of IL-8 expression was also observed in colonic biopsies of ulcerative colitis. In conclusion, the overexpression of IL-8 may underlie the development of GELs in type 2 AIP, and IL-8 immunostaining or IL-8/CD3 double staining may become an ancillary method for its diagnosis. The similar expression pattern of IL-8 in ulcerative colitis also suggests a pathogenetic link between the 2 conditions.

Evidence that PC2 is the endogenous pro-neurotensin convertase in rMTC 6-23 cells and that PC1- and PC2-transfected PC12 cells differentially process pro-neurotensin.

PubMed

Rovère, C; Barbero, P; Kitabgi, P

1996-05-10

The neuropeptide precursor proneurotensin/neuromedin N (pro-NT/NN) is mainly expressed and differentially processed in the brain and in the small intestine. We showed previously that rMTC 6-23 cells process pro-NT/NN with a pattern similar to brain tissue and increase pro-NT/NN expression in response to dexamethasone, and that PC12 cells also produce pro-NT/NN but are virtually unable to process it. In addition, PC12 cells were reported to be devoid of the prohormone convertases PC1 and PC2. The present study was designed to identify the proprotein convertase(s) (PC) involved in pro-NT/NN processing in rMTC 6-23 cells and to compare PC1- and PC2-transfected PC12 cells for their ability to process pro-NT/NN. rMTC 6-23 cells were devoid of PC1, PC4, and PC5 but expressed furin and PC2. Stable expression of antisense PC2 RNA in rMTC 6-23 cells led to a 90% decrease in PC2 protein levels that correlated with a > 80% reduction of pro-NT/NN processing. PC2 expression was stimulated by dexamethasone in a time- and concentration-dependent manner. Stable PC12/PC2 transfectants processed pro-NT/NN with a pattern similar to that observed in the brain and in rMTC 6-23 cells. In contrast, stable PC12/PC1 transfectants reproduced the pro-NT/NN processing pattern seen in the gut. We conclude that (i) PC2 is the major pro-NT/NN convertase in rMTC 6-23 cells; (ii) its expression is coregulated with that of pro-NT/NN in this cell line; and (iii) PC2 and PC1 differentially process pro-NT/NN with brain and intestinal phenotype, respectively.

Comparative gene expression profiling of ADAMs, MMPs, TIMPs, EMMPRIN, EGF-R and VEGFA in low grade meningioma.

PubMed

Rooprai, Harcharan K; Martin, Andrew J; King, Andrew; Appadu, Usha D; Jones, Huw; Selway, Richard P; Gullan, Richard W; Pilkington, Geoffrey J

2016-12-01

MMPs (matrix metalloproteinases), ADAMs (a disintegrin and metalloproteinase) and TIMPs (tissue inhibitors of metalloproteinases) are implicated in invasion and angiogenesis: both are tissue remodeling processes involving regulated proteolysis of the extracellular matrix, growth factors and their receptors. The expression of these three groups and their correlations with clinical behaviour has been reported in gliomas but a similar comprehensive study in meningiomas is lacking. In this study, we aimed to evaluate the patterns of expression of 23 MMPs, 4 TIMPs, 8 ADAMs, selective growth factors and their receptors in 17 benign meningiomas using a quantitative real-time polymerase chain reaction (qPCR). Results indicated very high gene expression of 13 proteases, inhibitors and growth factors studied: MMP2 and MMP14, TIMP-1, -2 and -3, ADAM9, 10, 12, 15 and 17, EGF-R, EMMPRIN and VEGF-A, in almost every meningioma. Expression pattern analysis showed several positive correlations between MMPs, ADAMs, TIMPs and growth factors. Furthermore, our findings suggest that expression of MMP14, ADAM9, 10, 12, 15 and 17, TIMP-2, EGF-R and EMMPRIN reflects histological subtype of meningioma such that fibroblastic subtype had the highest mRNA expression, transitional subtype was intermediate and meningothelial type had the lowest expression. In conclusion, this is the first comprehensive study characterizing gene expression of 8 ADAMs in meningiomas. These neoplasms, although by histological definition benign, have invasive potential. Taken together, the selected elevated gene expression pattern may serve to identify targets for therapeutic intervention or indicators of biological progression and recurrence.

Evolutionary divergence of vertebrate Hoxb2 expression patterns and transcriptional regulatory loci.

PubMed

Scemama, Jean-Luc; Hunter, Michael; McCallum, Jeff; Prince, Victoria; Stellwag, Edmund

2002-10-15

Hox gene expression is regulated by a complex array of cis-acting elements that control spatial and temporal gene expression in developing embryos. Here, we report the isolation of the striped bass Hoxb2a gene, comparison of its expression to the orthologous gene from zebrafish, and comparative genomic analysis of the upstream regulatory region to that of other vertebrates. Comparison of the Hoxb2a gene expression patterns from striped bass to zebrafish revealed similar expression patterns within rhombomeres 3, 4, and 5 of the hindbrain but a notable absence of expression in neural crest tissues of striped bass while neural crest expression is observed in zebrafish and common to other vertebrates. Comparative genomic analysis of the striped bass Hoxb2a-b3a intergenic region to those from zebrafish, pufferfish, human, and mouse demonstrated the presence of common Meis, Hox/Pbx, Krox-20, and Box 1 elements, which are necessary for rhombomere 3, 4, and 5 expression. Despite their common occurrence, the location and orientation of these transcription elements differed among the five species analyzed, such that Krox-20 and Box 1 elements are located 3' to the Meis, Hox/Pbx elements in striped bass, pufferfish, and human while they are located 5' of this r4 enhancer in zebrafish and mouse. Our results suggest that the plasticity exhibited in the organization of key regulatory elements responsible for rhombomere-specific Hoxb2a expression may reflect the effects of stabilizing selection in the evolution cis-acting elements. Copyright 2002 Wiley-Liss, Inc.

Expression of the glutamine metabolism-related proteins glutaminase 1 and glutamate dehydrogenase in canine mammary tumours.

PubMed

Ryu, J-E; Park, H-K; Choi, H-J; Lee, H-B; Lee, H-J; Lee, H; Yu, E-S; Son, W-C

2018-06-01

Glutamine metabolism is an important metabolic pathway for cancer cell survival, and there is a critical connection between tumour growth and glutamine metabolism. Because of their similarities, canine mammary carcinomas are useful for studying human breast cancer. Accordingly, we investigated the correlations between the expression of glutamine metabolism-related proteins and the pathological features of canine mammary tumours. We performed immunohistochemical and western blot analysis of 39 mammary tumour tissues. In immunohistochemical analysis, the expression of glutaminase 1 (GLS1) in the epithelial region increased according to the histological grade (P < .005). In the stromal region, complex-type tumours displayed significantly higher GLS1 intensity than simple-type tumours. However, glutamate dehydrogenase expression did not show the same tendencies as GLS1. The western blot results were consistent with the immunohistochemical findings. These results suggest that the expression of GLS1 is correlates with clinicopathological factors in canine mammary tumours and shows a similar pattern to human breast cancer. © 2017 John Wiley & Sons Ltd.

Diurnal lighting patterns and habitat alter opsin expression and colour preferences in a killifish

PubMed Central

Johnson, Ashley M.; Stanis, Shannon; Fuller, Rebecca C.

2013-01-01

Spatial variation in lighting environments frequently leads to population variation in colour patterns, colour preferences and visual systems. Yet lighting conditions also vary diurnally, and many aspects of visual systems and behaviour vary over this time scale. Here, we use the bluefin killifish (Lucania goodei) to compare how diurnal variation and habitat variation (clear versus tannin-stained water) affect opsin expression and the preference to peck at different-coloured objects. Opsin expression was generally lowest at midnight and dawn, and highest at midday and dusk, and this diurnal variation was many times greater than variation between habitats. Pecking preference was affected by both diurnal and habitat variation but did not correlate with opsin expression. Rather, pecking preference matched lighting conditions, with higher preferences for blue at noon and for red at dawn/dusk, when these wavelengths are comparatively scarce. Similarly, blue pecking preference was higher in tannin-stained water where blue wavelengths are reduced. In conclusion, L. goodei exhibits strong diurnal cycles of opsin expression, but these are not tightly correlated with light intensity or colour. Temporally variable pecking preferences probably result from lighting environment rather than from opsin production. These results may have implications for the colour pattern diversity observed in these fish. PMID:23698009

Identification and handling of artifactual gene expression profiles emerging in microarray hybridization experiments

PubMed Central

Brodsky, Leonid; Leontovich, Andrei; Shtutman, Michael; Feinstein, Elena

2004-01-01

Mathematical methods of analysis of microarray hybridizations deal with gene expression profiles as elementary units. However, some of these profiles do not reflect a biologically relevant transcriptional response, but rather stem from technical artifacts. Here, we describe two technically independent but rationally interconnected methods for identification of such artifactual profiles. Our diagnostics are based on detection of deviations from uniformity, which is assumed as the main underlying principle of microarray design. Method 1 is based on detection of non-uniformity of microarray distribution of printed genes that are clustered based on the similarity of their expression profiles. Method 2 is based on evaluation of the presence of gene-specific microarray spots within the slides’ areas characterized by an abnormal concentration of low/high differential expression values, which we define as ‘patterns of differentials’. Applying two novel algorithms, for nested clustering (method 1) and for pattern detection (method 2), we can make a dual estimation of the profile’s quality for almost every printed gene. Genes with artifactual profiles detected by method 1 may then be removed from further analysis. Suspicious differential expression values detected by method 2 may be either removed or weighted according to the probabilities of patterns that cover them, thus diminishing their input in any further data analysis. PMID:14999086

Transition from two to one integument in Prunus species: expression pattern of INNER NO OUTER (INO), ABERRANT TESTA SHAPE (ATS) and ETTIN (ETT).

PubMed

Lora, Jorge; Hormaza, José I; Herrero, Maria

2015-10-01

While gymnosperm ovules have one integument, in most angiosperms two integuments surround the ovules. Unitegmic ovules have arisen independently several times during the evolution of angiosperms, but the ultimate genetic cause of the presence of a single integument remains elusive. We compared species of the genus Prunus that have different numbers of integuments: bitegmic species, such as Prunus armeniaca (apricot) and Prunus persica (peach), and unitegmic species, such as Prunus incisa, analyzing the expression pattern of genes that are involved in integument development in Arabidopsis thaliana: INNER NO OUTER (INO), ABERRANT TESTA SHAPE (ATS) and ETTIN (ETT). Bitegmic and unitegmic species showed similar INO expression patterns, indicative of the conservation of an outer integument. However, expression of ETT, which occurs in the boundary of the outer and inner integuments, was altered in unitegmic ovules, which showed lack of ETT expression. These results strongly suggest that the presence of a single integument could be attributable to the amalgamation of two integuments and support the role of ETT in the fusion of the outer and inner integuments in unitegmic ovules, a situation that could be widespread in other unitegmic species of angiosperms. © 2015 Consejo Superior de Investigaciones Cientificas. New Phytologist © 2015 New Phytologist Trust.

Foxi2 Is an Animally Localized Maternal mRNA in Xenopus, and an Activator of the Zygotic Ectoderm Activator Foxi1e

PubMed Central

Cha, Sang-Wook; McAdams, Meredith; Kormish, Jay; Wylie, Christopher; Kofron, Matthew

2012-01-01

Foxi1e is a zygotic transcription factor that is essential for the expression of early ectodermal genes. It is expressed in a highly specific pattern, only in the deep cell layers of the animal hemisphere, and in a mosaic pattern in which expressing cells are interspersed with non-expressing cells. Previous work has shown that several signals in the blastula control this expression pattern, including nodals, the TGFβ family member Vg1, and Notch. However, these are all inhibitory, which raises the question of what activates Foxi1e. In this work, we show that a related Forkhead family protein, Foxi2, is a maternal activator of Foxi1e. Foxi2 mRNA is maternally encoded, and highly enriched in animal hemisphere cells of the blastula. ChIP assays show that it acts directly on upstream regulatory elements of Foxi1e. Its effect is specific, since animal cells depleted of Foxi2 are able to respond normally to mesoderm inducing signals from vegetal cells. Foxi2 thus acts as a link between the oocyte and the early pathway to ectoderm, in a similar fashion to the vegetally localized VegT acts to initiate endoderm and mesoderm formation. PMID:22848601

Cell Fusion Reprogramming Leads to a Specific Hepatic Expression Pattern during Mouse Bone Marrow Derived Hepatocyte Formation In Vivo

PubMed Central

Arza, Elvira; Alvarez-Barrientos, Alberto; Fabregat, Isabel; Garcia-Bravo, Maria; Meza, Nestor W.; Segovia, Jose C.

2012-01-01

The fusion of bone marrow (BM) hematopoietic cells with hepatocytes to generate BM derived hepatocytes (BMDH) is a natural process, which is enhanced in damaged tissues. However, the reprogramming needed to generate BMDH and the identity of the resultant cells is essentially unknown. In a mouse model of chronic liver damage, here we identify a modification in the chromatin structure of the hematopoietic nucleus during BMDH formation, accompanied by the loss of the key hematopoietic transcription factor PU.1/Sfpi1 (SFFV proviral integration 1) and gain of the key hepatic transcriptional regulator HNF-1A homeobox A (HNF-1A/Hnf1a). Through genome-wide expression analysis of laser captured BMDH, a differential gene expression pattern was detected and the chromatin changes observed were confirmed at the level of chromatin regulator genes. Similarly, Tranforming Growth Factor-β1 (TGF-β1) and neurotransmitter (e.g. Prostaglandin E Receptor 4 [Ptger4]) pathway genes were over-expressed. In summary, in vivo BMDH generation is a process in which the hematopoietic cell nucleus changes its identity and acquires hepatic features. These BMDHs have their own cell identity characterized by an expression pattern different from hematopoietic cells or hepatocytes. The role of these BMDHs in the liver requires further investigation. PMID:22457803

A face versus non-face context influences amygdala responses to masked fearful eye whites.

PubMed

Kim, M Justin; Solomon, Kimberly M; Neta, Maital; Davis, F Caroline; Oler, Jonathan A; Mazzulla, Emily C; Whalen, Paul J

2016-12-01

The structure of the mask stimulus is crucial in backward masking studies and we recently demonstrated such an effect when masking faces. Specifically, we showed that activity of the amygdala is increased to fearful facial expressions masked with neutral faces and decreased to fearful expressions masked with a pattern mask-but critically both masked conditions discriminated fearful expressions from happy expressions. Given this finding, we sought to test whether masked fearful eye whites would produce a similar profile of amygdala response in a face vs non-face context. During functional magnetic resonance imaging scanning sessions, 30 participants viewed fearful or happy eye whites masked with either neutral faces or pattern images. Results indicated amygdala activity was increased to fearful vs happy eye whites in the face mask condition, but decreased to fearful vs happy eye whites in the pattern mask condition-effectively replicating and expanding our previous report. Our data support the idea that the amygdala is responsive to fearful eye whites, but that the nature of this activity observed in a backward masking design depends on the mask stimulus. © The Author (2016). Published by Oxford University Press.

Tissue distribution and early developmental expression patterns of aldolase A, B, and C in grass carp Ctenopharyngodon idellus.

PubMed

Fan, J J; Bai, J J; Ma, D M; Yu, L Y; Jiang, P

2017-09-27

Aldolase is a key enzyme involved in glycolysis, gluconeogenesis, and the pentose phosphate pathway. To establish the expression patterns of all three aldolase isozyme genes in different tissues and during early embryogenesis in lower vertebrates, as well as to explore the functional differences between these three isozymes, the grass carp was selected as a model owing to its relatively high glucose-metabolizing capability. Based on the cDNA sequences of the aldolase A, B, and C genes, the expression patterns of these three isozymes were analyzed in different tissues and during early embryogenesis using quantitative real-time polymerase chain reaction (qRT-PCR). Sequence analysis of cDNAs indicated that aldolase A, B, and C (GenBank accession numbers: KM192250, KM192251, and KM192252) consist of 364, 364, and 363 amino acids, respectively. The qRT-PCR results showed that the expression levels of aldolase A, B, and C were highest in the muscle, liver, and brain, respectively. Aldolase A and C exhibited similar expression patterns during embryogenesis, with high levels observed in unfertilized and fertilized eggs and at the blastocyst stage, followed by a decline and then increase after organogenesis. In contrast, aldolase B transcript was not detected during the unfertilized egg stage, and appeared only from gastrulation; the expression increased markedly during the feeding period (72 h after hatching), at which point the level was higher than those of aldolase A and C. These data suggest that the glucose content of grass carp starter feed should be adjusted according to the metabolic activity of aldolase B.

Divergent patterns of age-dependence in ornamental and reproductive traits in the collared flycatcher.

PubMed

Evans, Simon R; Gustafsson, Lars; Sheldon, Ben C

2011-06-01

Sexual ornaments are predicted to honestly signal individual condition. We might therefore expect ornament expression to show a senescent decline, in parallel with late-life deterioration of other characters. Conversely, life-history theory predicts the reduced residual reproductive value of older individuals will favor increased investment in sexually attractive traits. Using a 25-year dataset of more than 5000 records of breeding collared flycatchers (Ficedula albicollis) of known age, we quantify cross-sectional patterns of age-dependence in ornamental plumage traits and report long-term declines in expression that mask highly significant positive age-dependency. We partition this population-level age-dependency into its between- and within-individual components and show expression of ornamental white plumage patches exhibits within-individual increases with age in both sexes, consistent with life-history theory. For males, ornament expression also covaries with life span, such that, within a cohort, ornamentation indicates survival. Finally, we compared longitudinal age-dependency of reproductive traits and ornamental traits in both sexes, to assess whether these two trait types exhibit similar age-dependency. These analyses revealed contrasting patterns: reproductive traits showed within-individual declines in late-life females consistent with senescence; ornamental traits showed the opposite pattern in both males and females. Hence, our results for both sexes suggest that age-dependent ornament expression is consistent with life-history models of optimal signaling and, unlike reproductive traits, proof against senescence. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

Genome-wide characterization of the Pectate Lyase-like (PLL) genes in Brassica rapa.

PubMed

Jiang, Jingjing; Yao, Lina; Miao, Ying; Cao, Jiashu

2013-11-01

Pectate lyases (PL) depolymerize demethylated pectin (pectate, EC 4.2.2.2) by catalyzing the eliminative cleavage of α-1,4-glycosidic linked galacturonan. Pectate Lyase-like (PLL) genes are one of the largest and most complex families in plants. However, studies on the phylogeny, gene structure, and expression of PLL genes are limited. To understand the potential functions of PLL genes in plants, we characterized their intron-exon structure, phylogenetic relationships, and protein structures, and measured their expression patterns in various tissues, specifically the reproductive tissues in Brassica rapa. Sequence alignments revealed two characteristic motifs in PLL genes. The chromosome location analysis indicated that 18 of the 46 PLL genes were located in the least fractionated sub-genome (LF) of B. rapa, while 16 were located in the medium fractionated sub-genome (MF1) and 12 in the more fractionated sub-genome (MF2). Quantitative RT-PCR analysis showed that BrPLL genes were expressed in various tissues, with most of them being expressed in flowers. Detailed qRT-PCR analysis identified 11 pollen specific PLL genes and several other genes with unique spatial expression patterns. In addition, some duplicated genes showed similar expression patterns. The phylogenetic analysis identified three PLL gene subfamilies in plants, among which subfamily II might have evolved from gene neofunctionalization or subfunctionalization. Therefore, this study opens the possibility for exploring the roles of PLL genes during plant development.

Neuropathic pain promotes adaptive changes in gene expression in brain networks involved in stress and depression.

PubMed

Descalzi, Giannina; Mitsi, Vasiliki; Purushothaman, Immanuel; Gaspari, Sevasti; Avrampou, Kleopatra; Loh, Yong-Hwee Eddie; Shen, Li; Zachariou, Venetia

2017-03-21

Neuropathic pain is a complex chronic condition characterized by various sensory, cognitive, and affective symptoms. A large percentage of patients with neuropathic pain are also afflicted with depression and anxiety disorders, a pattern that is also seen in animal models. Furthermore, clinical and preclinical studies indicate that chronic pain corresponds with adaptations in several brain networks involved in mood, motivation, and reward. Chronic stress is also a major risk factor for depression. We investigated whether chronic pain and stress affect similar molecular mechanisms and whether chronic pain can affect gene expression patterns that are involved in depression. Using two mouse models of neuropathic pain and depression [spared nerve injury (SNI) and chronic unpredictable stress (CUS)], we performed next-generation RNA sequencing and pathway analysis to monitor changes in gene expression in the nucleus accumbens (NAc), the medial prefrontal cortex (mPFC), and the periaqueductal gray (PAG). In addition to finding unique transcriptome profiles across these regions, we identified a substantial number of signaling pathway-associated genes with similar changes in expression in both SNI and CUS mice. Many of these genes have been implicated in depression, anxiety, and chronic pain in patients. Our study provides a resource of the changes in gene expression induced by long-term neuropathic pain in three distinct brain regions and reveals molecular connections between pain and chronic stress. Copyright © 2017, American Association for the Advancement of Science.

In the eye of the beholder? Universality and cultural specificity in the expression and perception of emotion.

PubMed

Scherer, Klaus R; Clark-Polner, Elizabeth; Mortillaro, Marcello

2011-12-01

Do members of different cultures express (or "encode") emotions in the same fashion? How well can members of distinct cultures recognize (or "decode") each other's emotion expressions? The question of cultural universality versus specificity in emotional expression has been a hot topic of debate for more than half a century, but, despite a sizeable amount of empirical research produced to date, no convincing answers have emerged. We suggest that this unsatisfactory state of affairs is due largely to a lack of concern with the precise mechanisms involved in emotion expression and perception, and propose to use a modified Brunswikian lens model as an appropriate framework for research in this area. On this basis we provide a comprehensive review of the existing literature and point to research paradigms that are likely to provide the evidence required to resolve the debate on universality vs. cultural specificity of emotional expression. Applying this fresh perspective, our analysis reveals that, given the paucity of pertinent data, no firm conclusions can be drawn on actual expression (encoding) patterns across cultures (although there appear to be more similarities than differences), but that there is compelling evidence for intercultural continuity in decoding, or recognition, ability. We also note a growing body of research on the notion of ingroup advantage due to expression "dialects," above and beyond the general encoding or decoding patterns. We furthermore suggest that these empirical patterns could be explained by both universality in the underlying mechanisms and cultural specificity in the input to, and the regulation of, these expression and perception mechanisms. Overall, more evidence is needed, both to further elucidate these mechanisms and to inventory the patterns of cultural effects. We strongly recommend using more solid conceptual and theoretical perspectives, as well as more ecologically valid approaches, in designing future studies in emotion expression and perception research.

Homeotic genes and the arthropod head: Expression patterns of the labial, proboscipedia, and Deformed genes in crustaceans and insects

PubMed Central

Abzhanov, Arhat; Kaufman, Thomas C.

1999-01-01

cDNA fragments of the homologues of the Drosophila head homeotic genes labial (lab), proboscipedia (pb), and Deformed (Dfd) have been isolated from the crustacean Porcellio scaber. Because the accumulation domains of the head homeotic complex (Hox) genes had not been previously reported for crustaceans, we studied the expression patterns of these genes in P. scaber embryos by using in situ hybridization. The P. scaber lab homologue is expressed in the developing second antennal segment and its appendages. This expression domain in crustaceans and in the homologous intercalary segment of insects suggests that the lab gene specified this metamere in the last common ancestor of these two groups. The expression domain of the P. scaber pb gene is in the posterior part of the second antennal segment. This domain, in contrast to that in insects, is colinear with the domains of other head genes in P. scaber, and it differs from the insect pb gene expression domain in the posterior mouthparts, suggesting that the insect and crustacean patterns evolved independently from a broader ancestral domain similar to that found in modern chelicerates. P. scaber Dfd is expressed in the mandibular segment and paragnaths (a pair of ventral mouthpart structures associated with the stomodeum) and differs from insects, where expression is in the mandibular and maxillary segments. Thus, like pb, Dfd shows a divergent Hox gene deployment. We conclude that homologous structures of the mandibulate head display striking differences in their underlying developmental programs related to Hox gene expression. PMID:10468590

Patterns of Bacterial and Archaeal Gene Expression through the Lower Amazon River

DOE Office of Scientific and Technical Information (OSTI.GOV)

Satinsky, Brandon M.; Smith, Christa B.; Sharma, Shalabh

Analysis of metatranscriptomic and metagenomic datasets from the lower reaches of the Amazon River between Obidos and the river mouth revealed microbial transcript and gene pools dominated by Actinobacteria, Thaumarchaeota, Bacteroidetes, Acidobacteria, Betaproteobacteria, and Planctomycetes. Three mainstem stations spanning a 625 km reach had similar gene expression patterns (transcripts gene copy-1) across a diverse suite of element cycling genes, but two tributary-influenced stations at the mouth of the Tapajos River and near the Tocantins River at Belem had distinct transcriptome composition and expression ratios, particularly for genes encoding light-related energy capture (higher) and iron acquisition and ammonia oxidation (lower). Environmentalmore » parameters that were useful predictors of gene expression ratios included concentrations of lignin phenols, suspended sediments, nitrate, phosphate, and particulate organic carbon and nitrogen. Similar to the gene expression data, these chemical properties reflected highly homogeneous mainstem stations punctuated by distinct tributary- influenced stations at Tapajos and Belem. Although heterotrophic processes were expected to dominate in the lower Amazon, transcripts from photosynthetic bacteria were abundant in tributary-influenced regions, and transcripts from Thaumarcheota taxa genetically capable of chemosynthetic ammonia oxidation accounted for up to 21% of the transcriptome at others. Based on regressions of transcript numbers against gene numbers, expression ratios of Thaumarchaeota populations were largely unchanged within the mainstem, suggesting a relatively minor role for gene regulation. These quantitative gene and transcript inventories detail a diverse array of energy acquisition strategies and metabolic capabilities for bacteria and archaea populations of the world’s largest river system.« less

The yan gene is highly conserved in Drosophila and its expression suggests a complex role throughout development.

PubMed

Price, M D; Lai, Z

1999-04-01

Competence for cell fate determination and cellular differentiation is under tight control of regulatory genes. Yan, a nuclear target of receptor tyrosine kinase (RTK) signaling, is an E twenty six (ETS) DNA-binding protein that functions as a negative regulator of cell differentiation and proliferation in Drosophila. Most members of RTK signaling pathways are highly conserved through evolution, yet no yan orthologues have been identified to date in vertebrates. To investigate the degree of yan conservation during evolution, we have characterized a yan homologue from a sibling species of D. melanogaster, D. virilis. Our results show that the organization, primary structure and expression pattern of yan are highly conserved. Both genes span over 20 kb and contain four exons with introns at identical positions. The areas with highest amino acid similarity include the Pointed and ETS domain but there are other discrete regions with a high degree of similarity. Phylogenetic analysis reveals that yan's closest relative is the human tel gene, a negative regulator of differentiation in hematopoetic precursors. In both species, Yan is dynamically expressed beginning as early as stage 4/5 and persisting throughout embryogenesis. In third instar larvae, Yan is expressed in and behind the morphogenetic furrow of the eye imaginal disc as well as in the laminar precursor cells of the brain. Ovarian follicle cells also contain Yan protein. Conservation of the structure and expression patterns of yan genes strongly suggests that regulatory mechanisms for their expression are also conserved in these two species.

Circadian gene expression regulates pulsatile gonadotropin-releasing hormone (GnRH) secretory patterns in the hypothalamic GnRH-secreting GT1-7 cell line.

PubMed

Chappell, Patrick E; White, Rachel S; Mellon, Pamela L

2003-12-03

Although it has long been established that episodic secretion of gonadotropin-releasing hormone (GnRH) from the hypothalamus is required for normal gonadotropin release, the molecular and cellular mechanisms underlying the synchronous release of GnRH are primarily unknown. We used the GT1-7 mouse hypothalamic cell line as a model for GnRH secretion, because these cells release GnRH in a pulsatile pattern similar to that observed in vivo. To explore possible molecular mechanisms governing secretory timing, we investigated the role of the molecular circadian clock in regulation of GnRH secretion. GT1-7 cells express many known core circadian clock genes, and we demonstrate that oscillations of these components can be induced by stimuli such as serum and the adenylyl cyclase activator forskolin, similar to effects observed in fibroblasts. Strikingly, perturbation of circadian clock function in GT1-7 cells by transient expression of the dominant-negative Clock-Delta19 gene disrupts normal ultradian patterns of GnRH secretion, significantly decreasing mean pulse frequency. Additionally, overexpression of the negative limb clock gene mCry1 in GT1-7 cells substantially increases GnRH pulse amplitude without a commensurate change in pulse frequency, demonstrating that an endogenous biological clock is coupled to the mechanism of neurosecretion in these cells and can regulate multiple secretory parameters. Finally, mice harboring a somatic mutation in the Clock gene are subfertile and exhibit a substantial increase in estrous cycle duration as revealed by examination of vaginal cytology. This effect persists in normal light/dark (LD) cycles, suggesting that a suprachiasmatic nucleus-independent endogenous clock in GnRH neurons is required for eliciting normal pulsatile patterns of GnRH secretion.

Off-line monitoring of bacterial stress response during recombinant protein production using an optical biosensor.

PubMed

Vostiar, Igor; Tkac, Jan; Mandenius, Carl-Fredrik

2004-07-15

A surface plasmon resonance (SPR) biosensor was used to monitor the profiles of the heat-shock protein (DnaK) and the expression of a heterologous protein to map the dynamics of the cellular stress response in Escherichia coli. As expression system was used an E. coli strain overproducing human recombinant superoxide dismutase (rhSOD). Expression of DnaK showed complex patterns differing with strength of induction. The strong up-regulation of DnaK expression was observed in all cultivations which over-produced of rhSOD. Similar patterns were not observed in non-induced reference cultures. Differences in DnaK concentration profiles were correlated with induction strength. Presented data, carried out in shake flask and glucose limited fed-batch cultivation, show a good consistency with previously published transcriptional profiling results and provide complementary information to understand stress response related to overproduction of recombinant protein. The study also demonstrates the feasibility of using the SPR as a two channel protein array for monitoring of intracellular components.

Hox gene expression during postlarval development of the polychaete Alitta virens.

PubMed

Bakalenko, Nadezhda I; Novikova, Elena L; Nesterenko, Alexander Y; Kulakova, Milana A

2013-05-01

Hox genes are the family of transcription factors that play a key role in the patterning of the anterior-posterior axis of all bilaterian animals. These genes display clustered organization and colinear expression. Expression boundaries of individual Hox genes usually correspond with morphological boundaries of the body. Previously, we studied Hox gene expression during larval development of the polychaete Alitta virens (formerly Nereis virens) and discovered that Hox genes are expressed in nereid larva according to the spatial colinearity principle. Adult Alitta virens consist of multiple morphologically similar segments, which are formed sequentially in the growth zone. Since the worm grows for most of its life, postlarval segments constantly change their position along the anterior-posterior axis. We studied the expression dynamics of the Hox cluster during postlarval development of the nereid Alitta virens and found that 8 out of 11 Hox genes are transcribed as wide gene-specific gradients in the ventral nerve cord, ectoderm, and mesoderm. The expression domains constantly shift in accordance with the changing proportions of the growing worm, so expression domains of most Hox genes do not have stable anterior or/and posterior boundaries.In the course of our study, we revealed long antisense RNA (asRNA) for some Hox genes. Expression patterns of two of these genes were analyzed using whole-mount in-situ hybridization. This is the first discovery of antisense RNA for Hox genes in Lophotrochozoa. Hox gene expression in juvenile A. virens differs significantly from Hox gene expression patterns both in A. virens larva and in other Bilateria.We suppose that the postlarval function of the Hox genes in this polychaete is to establish and maintain positional coordinates in a constantly growing body, as opposed to creating morphological difference between segments.

Transgene Expression Patterns Indicate That Spaceflight Affects Stress Signal Perception and Transduction in Arabidopsis1

PubMed Central

Paul, Anna-Lisa; Daugherty, Christine J.; Bihn, Elizabeth A.; Chapman, David K.; Norwood, Kelly L.L.; Ferl, Robert J.

2001-01-01

The use of plants as integral components of life support systems remains a cornerstone of strategies for long-term human habitation of space and extraterrestrial colonization. Spaceflight experiments over the past few decades have refined the hardware required to grow plants in low-earth orbit and have illuminated fundamental issues regarding spaceflight effects on plant growth and development. Potential incipient hypoxia, resulting from the lack of convection-driven gas movement, has emerged as a possible major impact of microgravity. We developed transgenic Arabidopsis containing the alcohol dehydrogenase (Adh) gene promoter linked to the β-glucuronidase (GUS) reporter gene to address specifically the possibility that spaceflight induces the plant hypoxia response and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. The staining patterns resulting from a 5-d mission on the orbiter Columbia during mission STS-93 indicate that the Adh/GUS reporter gene was activated in roots during the flight. However, the patterns of expression were not identical to terrestrial control inductions. Moreover, although terrestrial hypoxia induces Adh/GUS expression in the shoot apex, no apex staining was observed in the spaceflight plants. This indicates that either the normal hypoxia response signaling is impaired in spaceflight or that spaceflight inappropriately induces Adh/GUS activity for reasons other than hypoxia. PMID:11402191

Protein expression of MMP-2 and MT1-MMP in actinic keratosis, squamous cell carcinoma of the skin, and basal cell carcinoma.

PubMed

de Oliveira Poswar, Fabiano; de Carvalho Fraga, Carlos Alberto; Gomes, Emisael Stênio Batista; Farias, Lucyana Conceição; Souza, Linton Wallis Figueiredo; Santos, Sérgio Henrique Souza; Gomez, Ricardo Santiago; de-Paula, Alfredo Maurício Batista; Guimarães, André Luiz Sena

2015-02-01

Squamous cell carcinoma (SCC) and basal cell carcinoma (BCC) are 2 skin neoplasms with distinct potentials to invasion and metastasis. Actinic keratosis (AK) is a precursor lesion of SCC. Immunohistochemistry was performed to evaluate the expression of MMP-2 and MT1-MMP in samples of BCC (n = 29), SCC (n = 12), and AK (n = 13). The ratio of positive cells to total cells was used to quantify the staining. Statistical significance was considered under the level P < .05. We found a higher expression of MMP-2 in tumor stroma and parenchyma of SCC as compared to BCC. The expression of this protein was also similar between SCC and its precursor actinic keratosis, and it was higher in the stroma of high-risk BCC when compared to low-risk BCC. MT1-MMP, which is an activator of MMP-2, was similarly expressed in all groups. Our results suggest that MMP-2 expression may contribute to the distinct invasive patterns seen in SCC and BCC. © The Author(s) 2014.

CREB expression in the brains of two closely related parasitic wasp species that differ in long-term memory formation.

PubMed

van den Berg, M; Verbaarschot, P; Hontelez, S; Vet, L E M; Dicke, M; Smid, H M

2010-06-01

The cAMP/PKA signalling pathway and transcription factor cAMP response element-binding protein (CREB) play key roles in long-term memory (LTM) formation. We used two closely related parasitic wasp species, Cotesia glomerata and Cotesia rubecula, which were previously shown to be different in LTM formation, and sequenced at least nine different CREB transcripts in both wasp species. The splicing patterns, functional domains and amino acid sequences were similar to those found in the CREB genes of other organisms. The predicted amino acid sequences of the CREB isoforms were identical in both wasp species. Using real-time quantitative PCR we found that two low abundant CREB transcripts are differentially expressed in the two wasps, whereas the expression levels of high abundant transcripts are similar.

Proteomic analysis of fibroblastema formation in regenerating hind limbs of Xenopus laevis froglets and comparison to axolotl

PubMed Central

2014-01-01

Background To gain insight into what differences might restrict the capacity for limb regeneration in Xenopus froglets, we used High Performance Liquid Chromatography (HPLC)/double mass spectrometry to characterize protein expression during fibroblastema formation in the amputated froglet hindlimb, and compared the results to those obtained previously for blastema formation in the axolotl limb. Results Comparison of the Xenopus fibroblastema and axolotl blastema revealed several similarities and significant differences in proteomic profiles. The most significant similarity was the strong parallel down regulation of muscle proteins and enzymes involved in carbohydrate metabolism. Regenerating Xenopus limbs differed significantly from axolotl regenerating limbs in several ways: deficiency in the inositol phosphate/diacylglycerol signaling pathway, down regulation of Wnt signaling, up regulation of extracellular matrix (ECM) proteins and proteins involved in chondrocyte differentiation, lack of expression of a key cell cycle protein, ecotropic viral integration site 5 (EVI5), that blocks mitosis in the axolotl, and the expression of several patterning proteins not seen in the axolotl that may dorsalize the fibroblastema. Conclusions We have characterized global protein expression during fibroblastema formation after amputation of the Xenopus froglet hindlimb and identified several differences that lead to signaling deficiency, failure to retard mitosis, premature chondrocyte differentiation, and failure of dorsoventral axial asymmetry. These differences point to possible interventions to improve blastema formation and pattern formation in the froglet limb. PMID:25063185

Human growth is associated with distinct patterns of gene expression in evolutionarily conserved networks

PubMed Central

2013-01-01

Background A co-ordinated tissue-independent gene expression profile associated with growth is present in rodent models and this is hypothesised to extend to all mammals. Growth in humans has similarities to other mammals but the return to active long bone growth in the pubertal growth spurt is a distinctly human growth event. The aim of this study was to describe gene expression and biological pathways associated with stages of growth in children and to assess tissue-independent expression patterns in relation to human growth. Results We conducted gene expression analysis on a library of datasets from normal children with age annotation, collated from the NCBI Gene Expression Omnibus (GEO) and EBI Arrayexpress databases. A primary data set was generated using cells of lymphoid origin from normal children; the expression of 688 genes (ANOVA false discovery rate modified p-value, q < 0.1) was associated with age, and subsets of these genes formed clusters that correlated with the phases of growth – infancy, childhood, puberty and final height. Network analysis on these clusters identified evolutionarily conserved growth pathways (NOTCH, VEGF, TGFB, WNT and glucocorticoid receptor – Hyper-geometric test, q < 0.05). The greatest degree of network ‘connectivity’ and hence functional significance was present in infancy (Wilcoxon test, p < 0.05), which then decreased through to adulthood. These observations were confirmed in a separate validation data set from lymphoid tissue. Similar biological pathways were observed to be associated with development-related gene expression in other tissues (conjunctival epithelia, temporal lobe brain tissue and bone marrow) suggesting the existence of a tissue-independent genetic program for human growth and maturation. Conclusions Similar evolutionarily conserved pathways have been associated with gene expression and child growth in multiple tissues. These expression profiles associate with the developmental phases of growth including the return to active long bone growth in puberty, a distinctly human event. These observations also have direct medical relevance to pathological changes that induce disease in children. Taking into account development-dependent gene expression profiles for normal children will be key to the appropriate selection of genes and pathways as potential biomarkers of disease or as drug targets. PMID:23941278

Development of the head and trunk mesoderm in the dogfish, Scyliorhinus torazame: II. Comparison of gene expression between the head mesoderm and somites with reference to the origin of the vertebrate head.

PubMed

Adachi, Noritaka; Takechi, Masaki; Hirai, Tamami; Kuratani, Shigeru

2012-01-01

The vertebrate mesoderm differs distinctly between the head and trunk, and the evolutionary origin of the head mesoderm remains enigmatic. Although the presence of somite-like segmentation in the head mesoderm of model animals is generally denied at molecular developmental levels, the appearance of head cavities in elasmobranch embryos has not been explained, and the possibility that they may represent vestigial head somites once present in an amphioxus-like ancestor has not been ruled out entirely. To examine whether the head cavities in the shark embryo exhibit any molecular signatures reminiscent of trunk somites, we isolated several developmentally key genes, including Pax1, Pax3, Pax7, Pax9, Myf5, Sonic hedgehog, and Patched2, which are involved in myogenic and chondrogenic differentiation in somites, and Pitx2, Tbx1, and Engrailed2, which are related to the patterning of the head mesoderm, from an elasmobranch species, Scyliorhinus torazame. Observation of the expression patterns of these genes revealed that most were expressed in patterns that resembled those found in amniote embryos. In addition, the head cavities did not exhibit an overt similarity to somites; that is, the similarity was no greater than that of the unsegmented head mesoderm in other vertebrates. Moreover, the shark head mesoderm showed an amniote-like somatic/visceral distinction according to the expression of Pitx2, Tbx1, and Engrailed2. We conclude that the head cavities do not represent a manifestation of ancestral head somites; rather, they are more likely to represent a derived trait obtained in the lineage of gnathostomes. © 2012 Wiley Periodicals, Inc.

Dietary fructooligosaccharides and wheat bran elicit specific and dose-dependent gene expression profiles in the proximal colon epithelia of healthy Fischer 344 rats.

PubMed

Chen, Qixuan; Swist, Eleonora; Beckstead, Jocelyn; Green, Judy; Matias, Fernando; Roberts, Jennifer; Qiao, Cunye; Raju, Jayadev; Brooks, Stephen P J; Scoggan, Kylie A

2011-05-01

Proximal colon epithelial gene responses to diets containing increasing levels of dietary fermentable material (FM) from 2 different sources were measured to determine whether gene expression patterns were independent of the source of FM. Male Fischer 344 rats (10/group) were fed for 6 wk a control diet containing 10% (g/g) cellulose (0% FM); or a 2, 5, or 10% wheat bran (WB) diet (1, 2, 5% FM); or a 2, 5, or 8% fructooligosaccharides (FOS) diet (2, 5, 8% FM). WB and FOS were substituted for cellulose to give a final 10% nondigestible material content including FM. Gene responses were relative to expression in rats fed the control diet. The gene response patterns associated with feeding ∼2% FM (5% WB and 2% FOS) were similar (∼10 gene changes ≥ 1.6-fold; P ≤ 0.01) and involved genes associated with transport (Scnn1g, Mt1a), transcription (Zbtb16, Egr1), immunity (Fkbp5), a gut hormone (Retn1β), and lipid metabolism (Scd2, Insig1). These changes were also similar to those associated with 5% FM but only in rats fed the 10% WB diet. In contrast, the 5% FOS diet (~5% FM) was associated with 68 gene expression changes ≥ 1.6-fold (P ≤ 0.01). The diet with the highest level of fermentation (8% FOS, ~8% FM) was associated with 132 changes ≥ 1.6-fold (P ≤ 0.01), including genes associated with transport, cellular proliferation, oncogene and tumor metastasis, the cell cycle, apoptosis, signal transduction, transcript regulation, immunity, gut hormones, and lipid metabolic processes. These results show that both the amount and source of FM determine proximal colon epithelial gene response patterns in rats.

Precipitation, temperature, and teleconnection signals across the combined North American, Monsoon Asia, and Old World Drought Atlases

NASA Astrophysics Data System (ADS)

Smerdon, J. E.; Baek, S. H.; Coats, S.; Williams, P.; Cook, B.; Cook, E. R.; Seager, R.

2017-12-01

The tree-ring-based North American Drought Atlas (NADA), Monsoon Asia Drought Atlas (MADA), and Old World Drought Atlas (OWDA) collectively yield a near-hemispheric gridded reconstruction of hydroclimate variability over the last millennium. To test the robustness of the large-scale representation of hydroclimate variability across the drought atlases, the joint expression of seasonal climate variability and teleconnections in the NADA, MADA, and OWDA are compared against two global, observation-based PDSI products. Predominantly positive (negative) correlations are determined between seasonal precipitation (surface air temperature) and collocated tree-ring-based PDSI, with average Pearson's correlation coefficients increasing in magnitude from boreal winter to summer. For precipitation, these correlations tend to be stronger in the boreal winter and summer when calculated for the observed PDSI record, while remaining similar for temperature. Notwithstanding these differences, the drought atlases robustly express teleconnection patterns associated with the El Niño-Southern Oscillation (ENSO), North Atlantic Oscillation (NAO), Pacific Decadal Oscillation (PDO), and Atlantic Multidecadal Oscillation (AMO). These expressions exist in the drought atlas estimates of boreal summer PDSI despite the fact that these modes of climate variability are dominant in boreal winter, with the exception of the Atlantic Multidecadal Oscillation. ENSO and NAO teleconnection patterns in the drought atlases are particularly consistent with their well-known dominant expressions in boreal winter and over the OWDA domain, respectively. Collectively, our findings confirm that the joint Northern Hemisphere drought atlases robustly reflect large-scale patterns of hydroclimate variability on seasonal to multidecadal timescales over the 20th century and are likely to provide similarly robust estimates of hydroclimate variability prior to the existence of widespread instrumental data.

Contrasting visual working memory for verbal and non-verbal material with multivariate analysis of fMRI

PubMed Central

Habeck, Christian; Rakitin, Brian; Steffener, Jason; Stern, Yaakov

2012-01-01

We performed a delayed-item-recognition task to investigate the neural substrates of non-verbal visual working memory with event-related fMRI (‘Shape task’). 25 young subjects (mean age: 24.0 years; STD=3.8 years) were instructed to study a list of either 1,2 or 3 unnamable nonsense line drawings for 3 seconds (‘stimulus phase’ or STIM). Subsequently, the screen went blank for 7 seconds (‘retention phase’ or RET), and then displayed a probe stimulus for 3 seconds in which subject indicated with a differential button press whether the probe was contained in the studied shape-array or not (‘probe phase’ or PROBE). Ordinal Trend Canonical Variates Analysis (Habeck et al., 2005a) was performed to identify spatial covariance patterns that showed a monotonic increase in expression with memory load during all task phases. Reliable load-related patterns were identified in the stimulus and retention phase (p<0.01), while no significant pattern could be discerned during the probe phase. Spatial covariance patterns that were obtained from an earlier version of this task (Habeck et al., 2005b) using 1, 3, or 6 letters (‘Letter task’) were also prospectively applied to their corresponding task phases in the current non-verbal task version. Interestingly, subject expression of covariance patterns from both verbal and non-verbal retention phases correlated positively in the non-verbal task for all memory loads (p<0.0001). Both patterns also involved similar frontoparietal brain regions that were increasing in activity with memory load, and mediofrontal and temporal regions that were decreasing. Mean subject expression of both patterns across memory load during retention also correlated positively with recognition accuracy (dL) in the Shape task (p<0.005). These findings point to similarities in the neural substrates of verbal and non-verbal rehearsal processes. Encoding processes, on the other hand, are critically dependent on the to-be-remembered material, and seem to necessitate material-specific neural substrates. PMID:22652306

Phytophthora megakarya and P. palmivora, Causal Agents of Black Pod Rot, Induce Similar Plant Defense Responses Late during Infection of Susceptible Cacao Pods

PubMed Central

Ali, Shahin S.; Shao, Jonathan; Lary, David J.; Strem, Mary D.; Meinhardt, Lyndel W.; Bailey, Bryan A.

2017-01-01

Phytophthora megakarya (Pmeg) and Phytophthora palmivora (Ppal) cause black pod rot of Theobroma cacao L. (cacao). Of these two clade 4 species, Pmeg is more virulent and is displacing Ppal in many cacao production areas in Africa. Symptoms and species specific sporangia production were compared when the two species were co-inoculated onto pod pieces in staggered 24 h time intervals. Pmeg sporangia were predominantly recovered from pod pieces with unwounded surfaces even when inoculated 24 h after Ppal. On wounded surfaces, sporangia of Ppal were predominantly recovered if the two species were simultaneously applied or Ppal was applied first but not if Pmeg was applied first. Pmeg demonstrated an advantage over Ppal when infecting un-wounded surfaces while Ppal had the advantage when infecting wounded surfaces. RNA-Seq was carried out on RNA isolated from control and Pmeg and Ppal infected pod pieces 3 days post inoculation to assess their abilities to alter/suppress cacao defense. Expression of 4,482 and 5,264 cacao genes was altered after Pmeg and Ppal infection, respectively, with most genes responding to both species. Neural network self-organizing map analyses separated the cacao RNA-Seq gene expression profiles into 24 classes, 6 of which were largely induced in response to infection. Using KEGG analysis, subsets of genes composing interrelated pathways leading to phenylpropanoid biosynthesis, ethylene and jasmonic acid biosynthesis and action, plant defense signal transduction, and endocytosis showed induction in response to infection. A large subset of genes encoding putative Pr-proteins also showed differential expression in response to infection. A subset of 36 cacao genes was used to validate the RNA-Seq expression data and compare infection induced gene expression patterns in leaves and wounded and unwounded pod husks. Expression patterns between RNA-Seq and RT-qPCR were generally reproducible. The level and timing of altered gene expression was influenced by the tissues studied and by wounding. Although, in these susceptible interactions gene expression patterns were similar, some genes did show differential expression in a Phytophthora species dependent manner. The biggest difference was the more intense changes in expression in Ppal inoculated wounded pod pieces further demonstrating its rapid progression when penetrating through wounds. PMID:28261234

Estimating mutual information using B-spline functions – an improved similarity measure for analysing gene expression data

PubMed Central

Daub, Carsten O; Steuer, Ralf; Selbig, Joachim; Kloska, Sebastian

2004-01-01

Background The information theoretic concept of mutual information provides a general framework to evaluate dependencies between variables. In the context of the clustering of genes with similar patterns of expression it has been suggested as a general quantity of similarity to extend commonly used linear measures. Since mutual information is defined in terms of discrete variables, its application to continuous data requires the use of binning procedures, which can lead to significant numerical errors for datasets of small or moderate size. Results In this work, we propose a method for the numerical estimation of mutual information from continuous data. We investigate the characteristic properties arising from the application of our algorithm and show that our approach outperforms commonly used algorithms: The significance, as a measure of the power of distinction from random correlation, is significantly increased. This concept is subsequently illustrated on two large-scale gene expression datasets and the results are compared to those obtained using other similarity measures. A C++ source code of our algorithm is available for non-commercial use from kloska@scienion.de upon request. Conclusion The utilisation of mutual information as similarity measure enables the detection of non-linear correlations in gene expression datasets. Frequently applied linear correlation measures, which are often used on an ad-hoc basis without further justification, are thereby extended. PMID:15339346

Nutritional channels in breast cancer.

PubMed

Godoy, Alejandro; Salazar, Katherine; Figueroa, Carlos; Smith, Gary J; de Los Angeles Garcia, Maria; Nualart, Francisco J

2009-09-01

Breast cancers increase glucose uptake by increasing expression of the facilitative glucose transporters (GLUTs), mainly GLUT1. However, little is known about the relationship between GLUT1 expression and malignant potential in breast cancer. In this study, expression and subcellular localization of GLUT1 was analysed in vivo in breast cancer tissue specimens with differing malignant potential, based on the Scarff-Bloom-Richardson (SBRI, II, III) histological grading system, and in vitro in the breast cancer cell lines, MDA-MB-468 and MCF-7, and in MDA-MB-468 cells grown as xenografts in nude athymic BALB/c male mice. In situ hybridization analyses demonstrated similar levels of GLUT1 mRNA expression in tissue sections from breast cancers of all histological grades. However, GLUT1 protein was expressed at higher levels in grade SBRII cancer, compared with SBRI and SBRIII, and associated with the expression of the proliferation marker PCNA. Immunolocalization analyses in SBRII cancers demonstrated a preferential localization of GLUT1 to the portions of the cellular membrane that faced neighbouring cells and formed 'canaliculi-like structures', that we hypothesize could have a potential role as 'nutritional channels'. A similar pattern of GLUT1 localization was observed in confluent cultures of MDA-MB-468 and MCF-7, and in MDA-MB-468 cells grown as xenografts, but not in the normal breast epithelial cell line HMEC. However, no relationship between GLUT1 expression and malignant potential of human breast cancer was observed. Preferential subcellular localization of GLUT1 could represent a physiological adaptation of a subset of breast cancer cells that form infiltrative tumours with a nodular growth pattern and that therefore need a major diffusion of glucose from blood vessels.

The DNA methylation status of MyoD and IGF-I genes are correlated with muscle growth during different developmental stages of Japanese flounder (Paralichthys olivaceus).

PubMed

Huang, Yajuan; Wen, Haishen; Zhang, Meizhao; Hu, Nan; Si, Yufeng; Li, Siping; He, Feng

2018-05-01

Many genes related to muscle growth modulate myoblast proliferation and differentiation and promote muscle hypertrophy. MyoD is a myogenic determinant that contributes to myoblast determination, and insulin-like growth factor 1 (IGF-I) interacts with MyoD to regulate muscle hypertrophy and muscle mass. In this study, we aimed to assess DNA methylation and mRNA expression patterns of MyoD and IGF-I during different developmental stages of Japanese flounder, and to examine the relationship between MyoD and IGF-I gene. DNA and RNA were extracted from muscles, and DNA methylation of MyoD and IGF-I promoter and exons was detected by bisulfite sequencing. The relative expression of MyoD and IGF-I was measured by quantitative polymerase chain reaction. IGF-I was measured by radioimmunoassay. Interestingly, the lowest expression of MyoD and IGF-I emerged at larva stage, and the mRNA expression was negatively associated with methylation. We hypothesized that many skeletal muscle were required to complete metamorphosis; thus, the expression levels of MyoD and IGF-I genes increased from larva stage and then decreased. The relative expression levels of MyoD and IGF-I exhibited similar patterns, suggesting that MyoD and IGF-I regulated muscle growth through combined effects. Changes in the concentrations of IGF-I hormone were similar to those of IGF-I gene expression. Our results the mechanism through which MyoD and IGF-I regulate muscle development and demonstrated that MyoD interacted with IGF-I to regulate muscle growth during different developmental stages. Copyright © 2018 Elsevier Inc. All rights reserved.

CD163-L1 is an endocytic macrophage protein strongly regulated by mediators in the inflammatory response.

PubMed

Moeller, Jesper B; Nielsen, Marianne J; Reichhardt, Martin P; Schlosser, Anders; Sorensen, Grith L; Nielsen, Ole; Tornøe, Ida; Grønlund, Jørn; Nielsen, Maria E; Jørgensen, Jan S; Jensen, Ole N; Mollenhauer, Jan; Moestrup, Søren K; Holmskov, Uffe

2012-03-01

CD163-L1 belongs to the group B scavenger receptor cysteine-rich family of proteins, where the CD163-L1 gene arose by duplication of the gene encoding the hemoglobin scavenger receptor CD163 in late evolution. The current data demonstrate that CD163-L1 is highly expressed and colocalizes with CD163 on large subsets of macrophages, but in contrast to CD163 the expression is low or absent in monocytes and in alveolar macrophages, glia, and Kupffer cells. The expression of CD163-L1 increases when cultured monocytes are M-CSF stimulated to macrophages, and the expression is further increased by the acute-phase mediator IL-6 and the anti-inflammatory mediator IL-10 but is suppressed by the proinflammatory mediators IL-4, IL-13, TNF-α, and LPS/IFN-γ. Furthermore, we show that CD163-L1 is an endocytic receptor, which internalizes independently of cross-linking through a clathrin-mediated pathway. Two cytoplasmic splice variants of CD163-L1 are differentially expressed and have different subcellular distribution patterns. Despite its many similarities to CD163, CD163-L1 does not possess measurable affinity for CD163 ligands such as the haptoglobin-hemoglobin complex or various bacteria. In conclusion, CD163-L1 exhibits similarity to CD163 in terms of structure and regulated expression in cultured monocytes but shows clear differences compared with the known CD163 ligand preferences and expression pattern in the pool of tissue macrophages. We postulate that CD163-L1 functions as a scavenger receptor for one or several ligands that might have a role in resolution of inflammation.

Topographical cone photopigment gene expression in deutan-type red-green color vision defects.

PubMed

Bollinger, Kathryn; Sjoberg, Stacy A; Neitz, Maureen; Neitz, Jay

2004-01-01

Eye donors were identified who had X-chromosome photopigment gene arrays like those of living deuteranomalous men; the arrays contained two genes encoding long-wavelength sensitive (L) pigments as well as genes to encode middle-wavelength sensitive (M) photopigment. Ultrasensitive methods failed to detect the presence of M photopigment mRNA in the retinas of these deutan donors. This provides direct evidence that deuteranomaly is caused by the complete absence of M pigment mRNA. Additionally, for those eyes with mRNA corresponding to two different L-type photopigments, the ratio of mRNA from the first vs. downstream L genes was analyzed across the retinal topography. Results show that the pattern of first relative to downstream L gene expression in the deuteranomalous retina is similar to the pattern of L vs. M gene expression found in normal retinas.

Effect of Acting Experience on Emotion Expression and Recognition in Voice: Non-Actors Provide Better Stimuli than Expected.

PubMed

Jürgens, Rebecca; Grass, Annika; Drolet, Matthis; Fischer, Julia

Both in the performative arts and in emotion research, professional actors are assumed to be capable of delivering emotions comparable to spontaneous emotional expressions. This study examines the effects of acting training on vocal emotion depiction and recognition. We predicted that professional actors express emotions in a more realistic fashion than non-professional actors. However, professional acting training may lead to a particular speech pattern; this might account for vocal expressions by actors that are less comparable to authentic samples than the ones by non-professional actors. We compared 80 emotional speech tokens from radio interviews with 80 re-enactments by professional and inexperienced actors, respectively. We analyzed recognition accuracies for emotion and authenticity ratings and compared the acoustic structure of the speech tokens. Both play-acted conditions yielded similar recognition accuracies and possessed more variable pitch contours than the spontaneous recordings. However, professional actors exhibited signs of different articulation patterns compared to non-trained speakers. Our results indicate that for emotion research, emotional expressions by professional actors are not better suited than those from non-actors.

AINTEGUMENTA homolog expression in Gnetum (gymnosperms) and implications for the evolution of ovulate axes in seed plants.

PubMed

Yamada, Toshihiro; Hirayama, Yumiko; Imaichi, Ryoko; Kato, Masahiro

2008-01-01

The expression of GpANTL1, a homolog of AINTEGUMENTA (ANT) found in the gymnosperm Gnetum parvifolium, was analyzed by RT-PCR and in situ hybridization. GpANTL1 was expressed in the leaf primordia, root tips, and young ovules. In the ovulate axis, expression was detected as four distinct rings around the outer, middle, and inner envelope primordia as well as around the nucellar tip. This pattern of expression is similar to that of ANT in Arabidopsis thaliana. A comparison of the expression of GpANTL1 with that of PtANTL1 in the conifer Pinus thunbergii suggests that the integrated expression of PtANTL1 may have been caused by congenital fusion of the integument, ovuliferous scale, and bract.

R-spondin1 and FOXL2 act into two distinct cellular types during goat ovarian differentiation.

PubMed

Kocer, Ayhan; Pinheiro, Iris; Pannetier, Maëlle; Renault, Lauriane; Parma, Pietro; Radi, Orietta; Kim, Kyung-Ah; Camerino, Giovanna; Pailhoux, Eric

2008-04-02

Up to now, two loci have been involved in XX sex-reversal in mammals following loss-of-function mutations, PIS (Polled Intersex Syndrome) in goats and R-spondin1 (RSPO1) in humans. Here, we analyze the possible interaction between these two factors during goat gonad development. Furthermore, since functional redundancy between different R-spondins may influence gonad development, we also studied the expression patterns of RSPO2, 3 and 4. Similarly to the mouse, RSPO1 shows a sex-dimorphic expression pattern during goat gonad development with higher levels in the ovaries. Interestingly, the PIS mutation does not seem to influence its level of expression. Moreover, using an RSPO1 specific antibody, the RSPO1 protein was localized in the cortical area of early differentiating ovaries (36 and 40 dpc). This cortical area contains the majority of germ cell that are surrounded by FOXL2 negative somatic cells. At latter stages (50 and 60 dpc) RSPO1 protein remains specifically localized on the germ cell membranes. Interestingly, a time-specific relocation of RSPO1 on the germ cell membrane was noticed, moving from a uniform distribution at 40 dpc to a punctuated staining before and during meiosis (50 and 60 dpc respectively). Interestingly, also RSPO2 and RSPO4 show a sex-dimorphic expression pattern with higher levels in the ovaries. Although RSPO4 was found to be faintly and belatedly expressed, the expression of RSPO2 increases at the crucial 36 dpc stage, as does that of FOXL2. Importantly, RSPO2 expression appears dramatically decreased in XX PIS-/- gonads at all three tested stages (36, 40 and 50 dpc). During goat ovarian development, the pattern of expression of RSPO1 is in agreement with its possible anti-testis function but is not influenced by the PIS mutation. Moreover, our data suggest that RSPO1 may be associated with germ cell development and meiosis. Interestingly, another RSPO gene, RSPO2 shows a sex-dimorphic pattern of expression that is dramatically influenced by the PIS mutation.

R-spondin1 and FOXL2 act into two distinct cellular types during goat ovarian differentiation

PubMed Central

Kocer, Ayhan; Pinheiro, Iris; Pannetier, Maëlle; Renault, Lauriane; Parma, Pietro; Radi, Orietta; Kim, Kyung-Ah; Camerino, Giovanna; Pailhoux, Eric

2008-01-01

Background Up to now, two loci have been involved in XX sex-reversal in mammals following loss-of-function mutations, PIS (Polled Intersex Syndrome) in goats and R-spondin1 (RSPO1) in humans. Here, we analyze the possible interaction between these two factors during goat gonad development. Furthermore, since functional redundancy between different R-spondins may influence gonad development, we also studied the expression patterns of RSPO2, 3 and 4. Results Similarly to the mouse, RSPO1 shows a sex-dimorphic expression pattern during goat gonad development with higher levels in the ovaries. Interestingly, the PIS mutation does not seem to influence its level of expression. Moreover, using an RSPO1 specific antibody, the RSPO1 protein was localized in the cortical area of early differentiating ovaries (36 and 40 dpc). This cortical area contains the majority of germ cell that are surrounded by FOXL2 negative somatic cells. At latter stages (50 and 60 dpc) RSPO1 protein remains specifically localized on the germ cell membranes. Interestingly, a time-specific relocation of RSPO1 on the germ cell membrane was noticed, moving from a uniform distribution at 40 dpc to a punctuated staining before and during meiosis (50 and 60 dpc respectively). Interestingly, also RSPO2 and RSPO4 show a sex-dimorphic expression pattern with higher levels in the ovaries. Although RSPO4 was found to be faintly and belatedly expressed, the expression of RSPO2 increases at the crucial 36 dpc stage, as does that of FOXL2. Importantly, RSPO2 expression appears dramatically decreased in XX PIS-/- gonads at all three tested stages (36, 40 and 50 dpc). Conclusion During goat ovarian development, the pattern of expression of RSPO1 is in agreement with its possible anti-testis function but is not influenced by the PIS mutation. Moreover, our data suggest that RSPO1 may be associated with germ cell development and meiosis. Interestingly, another RSPO gene, RSPO2 shows a sex-dimorphic pattern of expression that is dramatically influenced by the PIS mutation. PMID:18384673

LateBiclustering: Efficient Heuristic Algorithm for Time-Lagged Bicluster Identification.

PubMed

Gonçalves, Joana P; Madeira, Sara C

2014-01-01

Identifying patterns in temporal data is key to uncover meaningful relationships in diverse domains, from stock trading to social interactions. Also of great interest are clinical and biological applications, namely monitoring patient response to treatment or characterizing activity at the molecular level. In biology, researchers seek to gain insight into gene functions and dynamics of biological processes, as well as potential perturbations of these leading to disease, through the study of patterns emerging from gene expression time series. Clustering can group genes exhibiting similar expression profiles, but focuses on global patterns denoting rather broad, unspecific responses. Biclustering reveals local patterns, which more naturally capture the intricate collaboration between biological players, particularly under a temporal setting. Despite the general biclustering formulation being NP-hard, considering specific properties of time series has led to efficient solutions for the discovery of temporally aligned patterns. Notably, the identification of biclusters with time-lagged patterns, suggestive of transcriptional cascades, remains a challenge due to the combinatorial explosion of delayed occurrences. Herein, we propose LateBiclustering, a sensible heuristic algorithm enabling a polynomial rather than exponential time solution for the problem. We show that it identifies meaningful time-lagged biclusters relevant to the response of Saccharomyces cerevisiae to heat stress.

Transcriptomic insights into the genetic basis of mammalian limb diversity.

PubMed

Maier, Jennifer A; Rivas-Astroza, Marcelo; Deng, Jenny; Dowling, Anna; Oboikovitz, Paige; Cao, Xiaoyi; Behringer, Richard R; Cretekos, Chris J; Rasweiler, John J; Zhong, Sheng; Sears, Karen E

2017-03-23

From bat wings to whale flippers, limb diversification has been crucial to the evolutionary success of mammals. We performed the first transcriptome-wide study of limb development in multiple species to explore the hypothesis that mammalian limb diversification has proceeded through the differential expression of conserved shared genes, rather than by major changes to limb patterning. Specifically, we investigated the manner in which the expression of shared genes has evolved within and among mammalian species. We assembled and compared transcriptomes of bat, mouse, opossum, and pig fore- and hind limbs at the ridge, bud, and paddle stages of development. Results suggest that gene expression patterns exhibit larger variation among species during later than earlier stages of limb development, while within species results are more mixed. Consistent with the former, results also suggest that genes expressed at later developmental stages tend to have a younger evolutionary age than genes expressed at earlier stages. A suite of key limb-patterning genes was identified as being differentially expressed among the homologous limbs of all species. However, only a small subset of shared genes is differentially expressed in the fore- and hind limbs of all examined species. Similarly, a small subset of shared genes is differentially expressed within the fore- and hind limb of a single species and among the forelimbs of different species. Taken together, results of this study do not support the existence of a phylotypic period of limb development ending at chondrogenesis, but do support the hypothesis that the hierarchical nature of development translates into increasing variation among species as development progresses.

Implicit Race Bias Decreases the Similarity of Neural Representations of Black and White Faces

PubMed Central

Brosch, Tobias; Bar-David, Eyal; Phelps, Elizabeth A.

2013-01-01

Implicit race bias has been shown to affect decisions and behaviors. It may also change perceptual experience by increasing perceived differences between social groups. We investigated how this phenomenon may be expressed at the neural level by testing whether the distributed blood-oxygenation-level-dependent (BOLD) patterns representing Black and White faces are more dissimilar in participants with higher implicit race bias. We used multivoxel pattern analysis to predict the race of faces participants were viewing. We successfully predicted the race of the faces on the basis of BOLD activation patterns in early occipital visual cortex, occipital face area, and fusiform face area (FFA). Whereas BOLD activation patterns in early visual regions, likely reflecting different perceptual features, allowed successful prediction for all participants, successful prediction on the basis of BOLD activation patterns in FFA, a high-level face-processing region, was restricted to participants with high pro-White bias. These findings suggest that stronger implicit pro-White bias decreases the similarity of neural representations of Black and White faces. PMID:23300228

Microbial Gene Abundance and Expression Patterns across a River to Ocean Salinity Gradient

PubMed Central

Fortunato, Caroline S.; Crump, Byron C.

2015-01-01

Microbial communities mediate the biogeochemical cycles that drive ecosystems, and it is important to understand how these communities are affected by changing environmental conditions, especially in complex coastal zones. As fresh and marine waters mix in estuaries and river plumes, the salinity, temperature, and nutrient gradients that are generated strongly influence bacterioplankton community structure, yet, a parallel change in functional diversity has not been described. Metagenomic and metatranscriptomic analyses were conducted on five water samples spanning the salinity gradient of the Columbia River coastal margin, including river, estuary, plume, and ocean, in August 2010. Samples were pre-filtered through 3 μm filters and collected on 0.2 μm filters, thus results were focused on changes among free-living microbial communities. Results from metagenomic 16S rRNA sequences showed taxonomically distinct bacterial communities in river, estuary, and coastal ocean. Despite the strong salinity gradient observed over sampling locations (0 to 33), the functional gene profiles in the metagenomes were very similar from river to ocean with an average similarity of 82%. The metatranscriptomes, however, had an average similarity of 31%. Although differences were few among the metagenomes, we observed a change from river to ocean in the abundance of genes encoding for catabolic pathways, osmoregulators, and metal transporters. Additionally, genes specifying both bacterial oxygenic and anoxygenic photosynthesis were abundant and expressed in the estuary and plume. Denitrification genes were found throughout the Columbia River coastal margin, and most highly expressed in the estuary. Across a river to ocean gradient, the free-living microbial community followed three different patterns of diversity: 1) the taxonomy of the community changed strongly with salinity, 2) metabolic potential was highly similar across samples, with few differences in functional gene abundance from river to ocean, and 3) gene expression was highly variable and generally was independent of changes in salinity. PMID:26536246

Microbial Gene Abundance and Expression Patterns across a River to Ocean Salinity Gradient.

PubMed

Fortunato, Caroline S; Crump, Byron C

2015-01-01

Microbial communities mediate the biogeochemical cycles that drive ecosystems, and it is important to understand how these communities are affected by changing environmental conditions, especially in complex coastal zones. As fresh and marine waters mix in estuaries and river plumes, the salinity, temperature, and nutrient gradients that are generated strongly influence bacterioplankton community structure, yet, a parallel change in functional diversity has not been described. Metagenomic and metatranscriptomic analyses were conducted on five water samples spanning the salinity gradient of the Columbia River coastal margin, including river, estuary, plume, and ocean, in August 2010. Samples were pre-filtered through 3 μm filters and collected on 0.2 μm filters, thus results were focused on changes among free-living microbial communities. Results from metagenomic 16S rRNA sequences showed taxonomically distinct bacterial communities in river, estuary, and coastal ocean. Despite the strong salinity gradient observed over sampling locations (0 to 33), the functional gene profiles in the metagenomes were very similar from river to ocean with an average similarity of 82%. The metatranscriptomes, however, had an average similarity of 31%. Although differences were few among the metagenomes, we observed a change from river to ocean in the abundance of genes encoding for catabolic pathways, osmoregulators, and metal transporters. Additionally, genes specifying both bacterial oxygenic and anoxygenic photosynthesis were abundant and expressed in the estuary and plume. Denitrification genes were found throughout the Columbia River coastal margin, and most highly expressed in the estuary. Across a river to ocean gradient, the free-living microbial community followed three different patterns of diversity: 1) the taxonomy of the community changed strongly with salinity, 2) metabolic potential was highly similar across samples, with few differences in functional gene abundance from river to ocean, and 3) gene expression was highly variable and generally was independent of changes in salinity.

Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory.

PubMed

Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J; Honjo, Mie N; Fukuda, Hirokazu

2015-01-01

In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions.

Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory

PubMed Central

Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J.; Honjo, Mie N.; Fukuda, Hirokazu

2015-01-01

In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions. PMID:26624004

Circadian exosomal expression of renal thiazide-sensitive NaCl cotransporter (NCC) and prostasin in healthy individuals.

PubMed

Castagna, Annalisa; Pizzolo, Francesca; Chiecchi, Laura; Morandini, Francesca; Channavajjhala, Sarath Kiran; Guarini, Patrizia; Salvagno, Gianluca; Olivieri, Oliviero

2015-06-01

A circadian timing system is involved in the maintenance of fluid and electrolyte balance and blood pressure control. Aldosterone and vasopressin modulate ion transporters and channels crucial in sodium (Na) and water reabsorption such as the epithelium Na channel and the renal thiazide-sensitive NaCl cotransporter (NCC). We analyzed in urinary exosomes the intraday variations of NCC and prostasin expression and the association with electrolytes and water balance parameters. Blood and urine samples were collected at five time points during the day from five healthy subjects. Blood renin, aldosterone, cortisol, ACTH, and plasmatic and urinary Na, potassium, creatinine, adiuretin (ADH), NCC, and prostasin were evaluated. ACTH and cortisol showed a circadian pattern, similarly to aldosterone, while exosomal NCC and prostasin pattern were similar to urinary ADH, decreased in the morning and subsequently increased in the afternoon and evening. In urinary exosomes, NCC and prostasin had a diurnal pattern parallel to ADH and aquaporin 2, confirming that, in healthy subjects, both prostasin and NCC relate to water balance. These results provide suggestions for a possible chronotherapeutic approach in patients treated with thiazides, diuretic drugs acting as specific inhibitors of NCC-mediated Na reabsorption. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Rejuvenation of Gene Expression Pattern of Aged Human Skin by Broadband Light Treatment: A Pilot Study

PubMed Central

Chang, Anne Lynn S; Bitter, Patrick H; Qu, Kun; Lin, Meihong; Rapicavoli, Nicole A; Chang, Howard Y

2013-01-01

Studies in model organisms suggest that aged cells can be functionally rejuvenated, but whether this concept applies to human skin is unclear. Here we apply 3′-end sequencing for expression quantification (“3-seq”) to discover the gene expression program associated with human photoaging and intrinsic skin aging (collectively termed “skin aging”), and the impact of broadband light (BBL) treatment. We find that skin aging was associated with a significantly altered expression level of 2,265 coding and noncoding RNAs, of which 1,293 became “rejuvenated” after BBL treatment; i.e., they became more similar to their expression level in youthful skin. Rejuvenated genes (RGs) included several known key regulators of organismal longevity and their proximal long noncoding RNAs. Skin aging is not associated with systematic changes in 3′-end mRNA processing. Hence, BBL treatment can restore gene expression pattern of photoaged and intrinsically aged human skin to resemble young skin. In addition, our data reveal, to our knowledge, a previously unreported set of targets that may lead to new insights into the human skin aging process. PMID:22931923

Molecular identification of a pancreatic lipase-like gene involved in sex pheromone biosynthesis of Bombyx mori.

PubMed

Zhang, Song-Dou; Li, Xun; Bin, Zhu; Du, Meng-Fang; Yin, Xin-Ming; An, Shi-Heng

2014-08-01

Cytoplasmic lipid droplet (LD) lipolysis is regulated by pheromone biosynthesis activating neuropeptide (PBAN) in Bombyx mori. To elucidate the molecular mechanism of cytoplasm LD lipolysis, the pancreatic lipase-like gene in B. mori pheromone glands (PGs), designated as B. mori pancreatic lipase-like gene (BmPLLG), was identified in this study. Spatial expression analysis revealed that BmPLLG is a ubiquitous gene present in all studied tissues, such as PGs, brain, epidermis, egg, midgut, flight muscle and fat body. Temporal expression analysis showed that the BmPLLG transcript begins to express 96 h before eclosion (-96 h), continues to increase, peaks in newly emerged females and steadily decreases after eclosion. Translational expression analysis of BmPLLG using a prepared antiserum demonstrated that BmPLLG was expressed in an age-dependent pattern at different development stages in B. mori. This finding was similar to the transcript expression pattern. Further RNA interference-mediated knockdown of BmPLLG significantly inhibited bombykol production. Overall, these results demonstrated that BmPLLG is involved in PBAN-induced sex pheromone biosynthesis and release. © 2013 Institute of Zoology, Chinese Academy of Sciences.

Fundamental Patterns Underlying Neurotoxicity Revealed by DNA Microarray Expression Profiling

DTIC Science & Technology

2004-09-01

treated SH - SY5Y cells also resulted in an up-regulation of CHOP, albeit with a much later, more prolonged time course (Conn et al., 2002). Similarly... neuroblastoma and PC-12 cell lines , 6-OHDA has been shown to increase the levels of ubiquitin-conjugated proteins (Dawson and Mandir, 2002). Here, Sqstml...screened to determine changes in gene expression caused by MPP+, the active metabolite of MPTP, and 6-OHDA in a mouse CNS dopaminergic cell line

The expression of the clock gene cycle has rhythmic pattern and is affected by photoperiod in the moth Sesamia nonagrioides.

PubMed

Kontogiannatos, Dimitrios; Gkouvitsas, Theodoros; Kourti, Anna

2017-06-01

To obtain clues to the link between the molecular mechanism of circadian and photoperiod clocks, we have cloned the circadian clock gene cycle (Sncyc) in the corn stalk borer, Sesamia nonagrioides, which undergoes facultative diapause controlled by photoperiod. Sequence analysis revealed a high degree of conservation among insects for this gene. SnCYC consists of 667 amino acids and structural analysis showed that it contains a BCTR domain in its C-terminal in addition to the common domains found in Drosophila CYC, i.e. bHLH, PAS-A, PAS-B domains. The results revealed that the sequence of Sncyc showed a similarity to that of its mammalian orthologue, Bmal1. We also investigated the expression patterns of Sncyc in the brain of larvae growing under long-day 16L: 8D (LD), constant darkness (DD) and short-day 10L: 14D (SD) conditions using qRT-PCR assays. The mRNAs of Sncyc expression was rhythmic in LD, DD and SD cycles. Also, it is remarkable that the photoperiodic conditions affect the expression patterns and/or amplitudes of circadian clock gene Sncyc. This gene is associated with diapause in S. nonagrioides, because under SD (diapause conditions) the photoperiodic signal altered mRNA accumulation. Sequence and expression analysis of cyc in S. nonagrioides shows interesting differences compared to Drosophila where this gene does not oscillate or change in expression patterns in response to photoperiod, suggesting that this species is an interesting new model to study the molecular control of insect circadian and photoperiodic clocks. Copyright © 2017 Elsevier Inc. All rights reserved.

Full-length Transcriptome Sequencing and Modular Organization Analysis of Naringin/Neoeriocitrin Related Gene Expression Pattern in Drynaria roosii.

PubMed

Sun, Mei-Yu; Li, Jing-Yi; Li, Dong; Huang, Feng-Jie; Wang, Di; Li, Hui; Xing, Quan; Zhu, Hui-Bin; Shi, Lei

2018-04-12

Drynaria roosii (Nakaike) is a traditional Chinese medicinal fern, known as 'GuSuiBu'. The corresponding effective components of naringin/neoeriocitrin share highly similar chemical structure and medicinal function. Our HPLC-MS/MS results showed that the accumulation of naringin/neoeriocitrin depended on specific tissues or ages. However, little was known about the expression patterns of naringin/neoeriocitrin related genes involved in their regulatory pathways. For lack of the basic genetic information, we applied a combination of SMRT sequencing and SGS to generate the complete and full-length transcriptome of D. roosii. According to the SGS data, the DEG-based heat map analysis revealed the naringin/neoeriocitrin related gene expression exhibited obvious tissue- and time-specific transcriptomic differences. Using the systems biology method of modular organization analysis, we clustered 16,472 DEGs into 17 gene modules and studied the relationships between modules and tissue/time point samples, as well as modules and naringin/neoeriocitrin contents. Hereinto, naringin/neoeriocitrin related DEGs distributed in nine distinct modules, and DEGs in these modules showed significant different patterns of transcript abundance to be linked with specific tissues or ages. Moreover, WGCNA results further identified that PAL, 4CL, C4H and C3H, HCT acted as the major hub genes involved in naringin and neoeriocitrin synthesis respectively and exhibited high co-expression with MYB- and bHLH-regulated genes. In this work, modular organization and co-expression networks elucidated the tissue- and time-specificity of gene expression pattern, as well as hub genes associated with naringin/neoeriocitrin synthesis in D. roosii. Simultaneously, the comprehensive transcriptome dataset provided the important genetic information for further research on D. roosii.

Discovering cultural differences (and similarities) in facial expressions of emotion.

PubMed

Chen, Chaona; Jack, Rachael E

2017-10-01

Understanding the cultural commonalities and specificities of facial expressions of emotion remains a central goal of Psychology. However, recent progress has been stayed by dichotomous debates (e.g. nature versus nurture) that have created silos of empirical and theoretical knowledge. Now, an emerging interdisciplinary scientific culture is broadening the focus of research to provide a more unified and refined account of facial expressions within and across cultures. Specifically, data-driven approaches allow a wider, more objective exploration of face movement patterns that provide detailed information ontologies of their cultural commonalities and specificities. Similarly, a wider exploration of the social messages perceived from face movements diversifies knowledge of their functional roles (e.g. the 'fear' face used as a threat display). Together, these new approaches promise to diversify, deepen, and refine knowledge of facial expressions, and deliver the next major milestones for a functional theory of human social communication that is transferable to social robotics. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Comparison of the Structure and Expression of Odd-Skipped and Two Related Genes That Encode a New Family of Zinc Finger Proteins in Drosophila

PubMed Central

Hart, M. C.; Wang, L.; Coulter, D. E.

1996-01-01

The odd-skipped (odd) gene, which was identified on the basis of a pair-rule segmentation phenotype in mutant embryos, is initially expressed in the Drosophila embryo in seven pair-rule stripes, but later exhibits a segment polarity-like pattern for which no phenotypic correlate is apparent. We have molecularly characterized two embryonically expressed odd-cognate genes, sob and bowel (bowl), that encode proteins with highly conserved C(2)H(2) zinc fingers. While the Sob and Bowl proteins each contain five tandem fingers, the Odd protein lacks a fifth (C-terminal) finger and is also less conserved among the four common fingers. Reminiscent of many segmentation gene paralogues, the closely linked odd and sob genes are expressed during embryogenesis in similar striped patterns; in contrast, the less-tightly linked bowl gene is expressed in a distinctly different pattern at the termini of the early embryo. Although our results indicate that odd and sob are more likely than bowl to share overlapping developmental roles, some functional divergence between the Odd and Sob proteins is suggested by the absence of homology outside the zinc fingers, and also by amino acid substitutions in the Odd zinc fingers at positions that appear to be constrained in Sob and Bowl. PMID:8878683

Expression of genes involved in energy mobilization and osmoprotectant synthesis during thermal and dehydration stress in the Antarctic midge, Belgica antarctica.

PubMed

Teets, Nicholas M; Kawarasaki, Yuta; Lee, Richard E; Denlinger, David L

2013-02-01

The Antarctic midge, Belgica antarctica, experiences sub-zero temperatures and desiccating conditions for much of the year, and in response to these environmental insults, larvae undergo rapid shifts in metabolism, mobilizing carbohydrate energy reserves to promote synthesis of low-molecular-mass osmoprotectants. In this study, we measured the expression of 11 metabolic genes in response to thermal and dehydration stress. During both heat and cold stress, we observed upregulation of phosphoenolpyruvate carboxykinase (pepck) and glycogen phosphorylase (gp) to support rapid glucose mobilization. In contrast, there was a general downregulation of pathways related to polyol, trehalose, and proline synthesis during both high- and low-temperature stress. Pepck was likewise upregulated in response to different types of dehydration stress; however, for many of the other genes, expression patterns depended on the nature of dehydration stress. Following fast dehydration, expression patterns were similar to those observed during thermal stress, i.e., upregulation of gp accompanied by downregulation of trehalose and proline synthetic genes. In contrast, gradual, prolonged dehydration (both at a constant temperature and in conjunction with chilling) promoted marked upregulation of genes responsible for trehalose and proline synthesis. On the whole, our data agree with known metabolic adaptations to stress in B. antarctica, although a few discrepancies between gene expression patterns and downstream metabolite contents point to fluxes that are not controlled at the level of transcription.

Mutual regulatory interactions of the trunk gap genes during blastoderm patterning in the hemipteran Oncopeltus fasciatus.

PubMed

Ben-David, Jonathan; Chipman, Ariel D

2010-10-01

The early embryo of the milkweed bug, Oncopeltus fasciatus, appears as a single cell layer - the embryonic blastoderm - covering the entire egg. It is at this blastoderm stage that morphological domains are first determined, long before the appearance of overt segmentation. Central to the process of patterning the blastoderm into distinct domains are a group of transcription factors known as gap genes. In Drosophila melanogaster these genes form a network of interactions, and maintain sharp expression boundaries through strong mutual repression. Their restricted expression domains define specific areas along the entire body. We have studied the expression domains of the four trunk gap gene homologues in O. fasciatus and have determined their interactions through dsRNA gene knockdown experiments, followed by expression analyses. While the blastoderm in O. fasciatus includes only the first six segments of the embryo, the expression domains of the gap genes within these segments are broadly similar to those in Drosophila where the blastoderm includes all 15 segments. However, the interactions between the gap genes are surprisingly different from those in Drosophila, and mutual repression between the genes seems to play a much less significant role. This suggests that the well-studied interaction pattern in Drosophila is evolutionarily derived, and has evolved from a less strongly interacting network. Copyright © 2010 Elsevier Inc. All rights reserved.

Tetrapod-like axial regionalization in an early ray-finned fish

PubMed Central

Sallan, Lauren Cole

2012-01-01

Tetrapods possess up to five morphologically distinct vertebral series: cervical, thoracic, lumbar, sacral and caudal. The evolution of axial regionalization has been linked to derived Hox expression patterns during development and the demands of weight-bearing and walking on land. These evolutionary and functional explanations are supported by an absence of similar traits in fishes, living and extinct. Here, I show that, Tarrasius problematicus, a marine ray-finned fish from the Mississippian (Early Carboniferous; 359–318 Ma) of Scotland, is the first non-tetrapod known to possess tetrapod-like axial regionalization. Tarrasius exhibits five vertebral regions, including a seven-vertebrae ‘cervical’ series and a reinforced ‘sacrum’ over the pelvic area. Most vertebrae possess processes for intervertebral contact similar to tetrapod zygapophyses. The fully aquatic Tarrasius evolved these morphologies alongside other traits convergent with early tetrapods, including a naked trunk, and a single median continuous fin. Regional modifications in Tarrasius probably facilitated pelagic swimming, rather than a terrestrial lifestyle or walking gait, presenting an alternative scenario for the evolution of such traits in tetrapods. Axial regionalization in Tarrasius could indicate tetrapod-like Hox expression patterns, possibly representing the primitive state for jawed vertebrates. Alternately, it could signal a weaker relationship, or even a complete disconnect, between Hox expression domains and vertebrate axial plans. PMID:22628471

Keep your opponents close: social context affects EEG and fEMG linkage in a turn-based computer game.

PubMed

Spapé, Michiel M; Kivikangas, J Matias; Järvelä, Simo; Kosunen, Ilkka; Jacucci, Giulio; Ravaja, Niklas

2013-01-01

In daily life, we often copy the gestures and expressions of those we communicate with, but recent evidence shows that such mimicry has a physiological counterpart: interaction elicits linkage, which is a concordance between the biological signals of those involved. To find out how the type of social interaction affects linkage, pairs of participants played a turn-based computer game in which the level of competition was systematically varied between cooperation and competition. Linkage in the beta and gamma frequency bands was observed in the EEG, especially when the participants played directly against each other. Emotional expression, measured using facial EMG, reflected this pattern, with the most competitive condition showing enhanced linkage over the facial muscle-regions involved in smiling. These effects were found to be related to self-reported social presence: linkage in positive emotional expression was associated with self-reported shared negative feelings. The observed effects confirmed the hypothesis that the social context affected the degree to which participants had similar reactions to their environment and consequently showed similar patterns of brain activity. We discuss the functional resemblance between linkage, as an indicator of a shared physiology and affect, and the well-known mirror neuron system, and how they relate to social functions like empathy.

SCARLESS SKIN WOUND HEALING IN FOXN1 DEFICIENT (NUDE) MICE IS ASSOCIATED WITH DISTINCTIVE MATRIX METALLOPROTEINASE EXPRESSION

PubMed Central

Gawronska-Kozak, Barbara

2011-01-01

Similar to mammalian fetuses FOXN1 deficient (nude) mice are able to restore the structure and integrity of injured skin in a scarless healing process by mechanisms independent of the genetic background. Matrix metalloproteinases (MMPs) are required for regular skin wound healing and the distinctive pattern of their expression has been implicated to promote scarless healing. In this study, we analyzed the temporal and spatial expression patterns of these molecules during the incisional skin wounds in adult nude mice. Macroscopic and histological analyses of skin wounds revealed an accelerated wound healing process, minimal granulation tissue formation and markedly diminished scarring in nude mice. Quantitative RT-PCR (Mmp-2,-3,-8,-9,-10,-12,-13,-14 and Timp-1, -2, -3), Western blots (MMP-13) and gelatin zymography (MMP-9) revealed that MMP-9 and MMP-13 showed a unique, bimodal pattern of up-regulation during the early and late phases of wound healing in nude mice. Immunohistochemically MMP-9 and MMP-13 were generally detected in epidermis during the early phase and in dermis during the late (remodeling) phase. Consistent with these in vivo observations, dermal fibroblasts cultured from nude mice expressed higher levels of type I and III collagen, MMP-9 and MMP-13 mRNA levels and higher MMP enzyme activity than wild type controls. Collectively, these finding suggest that the bimodal pattern of MMP-9 and MMP-13 expression during skin repair process in nude mice could be a major component of their ability for scarless healing. PMID:21539913

Serum microRNA expression patterns that predict early treatment failure in prostate cancer patients.

PubMed

Singh, Prashant K; Preus, Leah; Hu, Qiang; Yan, Li; Long, Mark D; Morrison, Carl D; Nesline, Mary; Johnson, Candace S; Koochekpour, Shahriar; Kohli, Manish; Liu, Song; Trump, Donald L; Sucheston-Campbell, Lara E; Campbell, Moray J

2014-02-15

We aimed to identify microRNA (miRNA) expression patterns in the serum of prostate cancer (CaP) patients that predict the risk of early treatment failure following radical prostatectomy (RP). Microarray and Q-RT-PCR analyses identified 43 miRNAs as differentiating disease stages within 14 prostate cell lines and reflectedpublically available patient data. 34 of these miRNA were detectable in the serum of CaP patients. Association with time to biochemical progression was examined in a cohort of CaP patients following RP. A greater than two-fold increase in hazard of biochemical progression associated with altered expression of miR-103, miR-125b and miR-222 (p<.0008) in the serum of CaP patients. Prediction models based on penalized regression analyses showed that the levels of the miRNAs and PSA together were better at detecting false positives than models without miRNAs, for similar level of sensitivity. Analyses of publically available data revealed significant and reciprocal relationships between changes in CpG methylation and miRNA expression patterns suggesting a role for CpG methylation to regulate miRNA. Exploratory validation supported roles for miR-222 and miR-125b to predict progression risk in CaP. The current study established that expression patterns of serum-detectable miRNAs taken at the time of RP are prognostic for men who are at risk of experiencing subsequent early biochemical progression. These non-invasive approaches could be used to augment treatment decisions.

A comparison of brain gene expression levels in domesticated and wild animals.

PubMed

Albert, Frank W; Somel, Mehmet; Carneiro, Miguel; Aximu-Petri, Ayinuer; Halbwax, Michel; Thalmann, Olaf; Blanco-Aguiar, Jose A; Plyusnina, Irina Z; Trut, Lyudmila; Villafuerte, Rafael; Ferrand, Nuno; Kaiser, Sylvia; Jensen, Per; Pääbo, Svante

2012-09-01

Domestication has led to similar changes in morphology and behavior in several animal species, raising the question whether similarities between different domestication events also exist at the molecular level. We used mRNA sequencing to analyze genome-wide gene expression patterns in brain frontal cortex in three pairs of domesticated and wild species (dogs and wolves, pigs and wild boars, and domesticated and wild rabbits). We compared the expression differences with those between domesticated guinea pigs and a distant wild relative (Cavia aperea) as well as between two lines of rats selected for tameness or aggression towards humans. There were few gene expression differences between domesticated and wild dogs, pigs, and rabbits (30-75 genes (less than 1%) of expressed genes were differentially expressed), while guinea pigs and C. aperea differed more strongly. Almost no overlap was found between the genes with differential expression in the different domestication events. In addition, joint analyses of all domesticated and wild samples provided only suggestive evidence for the existence of a small group of genes that changed their expression in a similar fashion in different domesticated species. The most extreme of these shared expression changes include up-regulation in domesticates of SOX6 and PROM1, two modulators of brain development. There was almost no overlap between gene expression in domesticated animals and the tame and aggressive rats. However, two of the genes with the strongest expression differences between the rats (DLL3 and DHDH) were located in a genomic region associated with tameness and aggression, suggesting a role in influencing tameness. In summary, the majority of brain gene expression changes in domesticated animals are specific to the given domestication event, suggesting that the causative variants of behavioral domestication traits may likewise be different.

A Comparison of Brain Gene Expression Levels in Domesticated and Wild Animals

PubMed Central

Albert, Frank W.; Somel, Mehmet; Carneiro, Miguel; Aximu-Petri, Ayinuer; Halbwax, Michel; Thalmann, Olaf; Blanco-Aguiar, Jose A.; Trut, Lyudmila; Villafuerte, Rafael; Ferrand, Nuno; Kaiser, Sylvia; Jensen, Per; Pääbo, Svante

2012-01-01

Domestication has led to similar changes in morphology and behavior in several animal species, raising the question whether similarities between different domestication events also exist at the molecular level. We used mRNA sequencing to analyze genome-wide gene expression patterns in brain frontal cortex in three pairs of domesticated and wild species (dogs and wolves, pigs and wild boars, and domesticated and wild rabbits). We compared the expression differences with those between domesticated guinea pigs and a distant wild relative (Cavia aperea) as well as between two lines of rats selected for tameness or aggression towards humans. There were few gene expression differences between domesticated and wild dogs, pigs, and rabbits (30–75 genes (less than 1%) of expressed genes were differentially expressed), while guinea pigs and C. aperea differed more strongly. Almost no overlap was found between the genes with differential expression in the different domestication events. In addition, joint analyses of all domesticated and wild samples provided only suggestive evidence for the existence of a small group of genes that changed their expression in a similar fashion in different domesticated species. The most extreme of these shared expression changes include up-regulation in domesticates of SOX6 and PROM1, two modulators of brain development. There was almost no overlap between gene expression in domesticated animals and the tame and aggressive rats. However, two of the genes with the strongest expression differences between the rats (DLL3 and DHDH) were located in a genomic region associated with tameness and aggression, suggesting a role in influencing tameness. In summary, the majority of brain gene expression changes in domesticated animals are specific to the given domestication event, suggesting that the causative variants of behavioral domestication traits may likewise be different. PMID:23028369

Induction of P450 genes in Nilaparvata lugens and Sogatella furcifera by two neonicotinoid insecticides.

PubMed

Yang, Yuan-Xue; Yu, Na; Zhang, Jian-Hua; Zhang, Yi-Xi; Liu, Ze-Wen

2018-06-01

Nilaparvata lugens and Sogatella furcifera are two primary planthoppers on rice throughout Asian countries and areas. Neonicotinoid insecticides, such as imidacloprid (IMI), have been extensively used to control rice planthoppers and IMI resistance consequently occurred with an important mechanism from the over-expression of P450 genes. The induction of P450 genes by IMI may increase the ability to metabolize this insecticide in planthoppers and increase the resistance risk. In this study, the induction of P450 genes was compared in S. furcifera treated with IMI and nitromethyleneimidazole (NMI), in two planthopper species by IMI lethal dose that kills 85% of the population (LD 85 ), and in N. lugens among three IMI doses (LD 15 , LD 50 and LD 85 ). When IMI and NMI at the LD 85 dose were applied to S. furcifera, the expression changes in most P450 genes were similar, including the up-regulation of nine genes and down-regulation of three genes. In terms of the expression changes in 12 homologous P450 genes between N. lugens and S. furcifera treated with IMI at the LD 85 dose, 10 genes had very similar patterns, such as up-regulation in seven genes, down-regulation in one gene and no significant changes in two genes. When three different IMI doses were applied to N. lugens, the changes in P450 gene expression were much different, such as up-regulation in four genes at all doses and dose-dependent regulation of the other nine genes. For example, CYP6AY1 could be induced by all IMI doses, while CYP6ER1 was only up-regulated by the LD 50 dose, although both genes were reported important in IMI resistance. In conclusion, P450 genes in two planthopper species showed similar regulation patterns in responding to IMI, and the two neonicotinoid insecticides had similar effects on P450 gene expression, although the regulation was often dose-dependent. © 2017 Institute of Zoology, Chinese Academy of Sciences.

Sex differences in autism: a resting-state fMRI investigation of functional brain connectivity in males and females

PubMed Central

Swinnen, Stephan P.; Wenderoth, Nicole

2016-01-01

Autism spectrum disorders (ASD) are far more prevalent in males than in females. Little is known however about the differential neural expression of ASD in males and females. We used a resting-state fMRI-dataset comprising 42 males/42 females with ASD and 75 male/75 female typical-controls to examine whether autism-related alterations in intrinsic functional connectivity are similar or different in males and females, and particularly whether alterations reflect ‘neural masculinization’, as predicted by the Extreme Male Brain theory. Males and females showed a differential neural expression of ASD, characterized by highly consistent patterns of hypo-connectivity in males with ASD (compared to typical males), and hyper-connectivity in females with ASD (compared to typical females). Interestingly, patterns of hyper-connectivity in females with ASD reflected a shift towards the (high) connectivity levels seen in typical males (neural masculinization), whereas patterns of hypo-connectivity observed in males with ASD reflected a shift towards the (low) typical feminine connectivity patterns (neural feminization). Our data support the notion that ASD is a disorder of sexual differentiation rather than a disorder characterized by masculinization in both genders. Future work is needed to identify underlying factors such as sex hormonal alterations that drive these sex-specific neural expressions of ASD. PMID:26989195

R-spondin 3 regulates dorsoventral and anteroposterior patterning by antagonizing Wnt/β-catenin signaling in zebrafish embryos.

PubMed

Rong, Xiaozhi; Chen, Chen; Zhou, Pin; Zhou, Yumei; Li, Yun; Lu, Ling; Liu, Yunzhang; Zhou, Jianfeng; Duan, Cunming

2014-01-01

The Wnt/β-catenin or canonical Wnt signaling pathway plays fundamental roles in early development and in maintaining adult tissue homeostasis. R-spondin 3 (Rspo3) is a secreted protein that has been implicated in activating the Wnt/β-catenin signaling in amphibians and mammals. Here we report that zebrafish Rspo3 plays a negative role in regulating the zygotic Wnt/β-catenin signaling. Zebrafish Rspo3 has a unique domain structure. It contains a third furin-like (FU3) domain. This FU3 is present in other four ray-finned fish species studied but not in elephant shark. In zebrafish, rspo3 mRNA is maternally deposited and has a ubiquitous expression in early embryonic stages. After 12 hpf, its expression becomes tissue-specific. Forced expression of rspo3 promotes dorsoanterior patterning and increases the expression of dorsal and anterior marker genes. Knockdown of rspo3 increases ventral-posterior development and stimulates ventral and posterior marker genes expression. Forced expression of rspo3 abolishes exogenous Wnt3a action and reduces the endogenous Wnt signaling activity. Knockdown of rspo3 results in increased Wnt/β-catenin signaling activity. Further analyses indicate that Rspo3 does not promote maternal Wnt signaling. Human RSPO3 has similar action when tested in zebrafish embryos. These results suggest that Rspo3 regulates dorsoventral and anteroposterior patterning by negatively regulating the zygotic Wnt/β-catenin signaling in zebrafish embryos.

R-Spondin 3 Regulates Dorsoventral and Anteroposterior Patterning by Antagonizing Wnt/β-Catenin Signaling in Zebrafish Embryos

PubMed Central

Zhou, Pin; Zhou, Yumei; Li, Yun; Lu, Ling; Liu, Yunzhang; Zhou, Jianfeng; Duan, Cunming

2014-01-01

The Wnt/β-catenin or canonical Wnt signaling pathway plays fundamental roles in early development and in maintaining adult tissue homeostasis. R-spondin 3 (Rspo3) is a secreted protein that has been implicated in activating the Wnt/β-catenin signaling in amphibians and mammals. Here we report that zebrafish Rspo3 plays a negative role in regulating the zygotic Wnt/β-catenin signaling. Zebrafish Rspo3 has a unique domain structure. It contains a third furin-like (FU3) domain. This FU3 is present in other four ray-finned fish species studied but not in elephant shark. In zebrafish, rspo3 mRNA is maternally deposited and has a ubiquitous expression in early embryonic stages. After 12 hpf, its expression becomes tissue-specific. Forced expression of rspo3 promotes dorsoanterior patterning and increases the expression of dorsal and anterior marker genes. Knockdown of rspo3 increases ventral-posterior development and stimulates ventral and posterior marker genes expression. Forced expression of rspo3 abolishes exogenous Wnt3a action and reduces the endogenous Wnt signaling activity. Knockdown of rspo3 results in increased Wnt/β-catenin signaling activity. Further analyses indicate that Rspo3 does not promote maternal Wnt signaling. Human RSPO3 has similar action when tested in zebrafish embryos. These results suggest that Rspo3 regulates dorsoventral and anteroposterior patterning by negatively regulating the zygotic Wnt/β-catenin signaling in zebrafish embryos. PMID:24918770

DNA methylation patterns and gene expression associated with litter size in Berkshire pig placenta

PubMed Central

Kwon, Seulgi; Park, Da Hye; Kim, Tae Wan; Kang, Deok Gyeong; Yu, Go Eun; Kim, Il-Suk; Park, Hwa Chun; Ha, Jeongim; Kim, Chul Wook

2017-01-01

Increasing litter size is of great interest to the pig industry. DNA methylation is an important epigenetic modification that regulates gene expression, resulting in livestock phenotypes such as disease resistance, milk production, and reproduction. We classified Berkshire pigs into two groups according to litter size and estimated breeding value: smaller (SLG) and larger (LLG) litter size groups. Genome-wide DNA methylation and gene expression were analyzed using placenta genomic DNA and RNA to identify differentially methylated regions (DMRs) and differentially expressed genes (DEGs) associated with litter size. The methylation levels of CpG dinucleotides in different genomic regions were noticeably different between the groups, while global methylation pattern was similar, and excluding intergenic regions they were found the most frequently in gene body regions. Next, we analyzed RNA-Seq data to identify DEGs between the SLG and LLG groups. A total of 1591 DEGs were identified: 567 were downregulated and 1024 were upregulated in LLG compared to SLG. To identify genes that simultaneously exhibited changes in DNA methylation and mRNA expression, we integrated and analyzed the data from bisulfite-Seq and RNA-Seq. Nine DEGs positioned in DMRs were found. The expression of only three of these genes (PRKG2, CLCA4, and PCK1) was verified by RT-qPCR. Furthermore, we observed the same methylation patterns in blood samples as in the placental tissues by PCR-based methylation analysis. Together, these results provide useful data regarding potential epigenetic markers for selecting hyperprolific sows. PMID:28880934

Expression of a gymnosperm PIN homologous gene correlates with auxin immunolocalization pattern at cotyledon formation and in demarcation of the procambium during Picea abies somatic embryo development and in seedling tissues.

PubMed

Palovaara, Joakim; Hallberg, Henrik; Stasolla, Claudio; Luit, Bert; Hakman, Inger

2010-04-01

In seed plants, the body organization is established during embryogenesis and is uniform across gymnosperms and angiosperms, despite differences during early embryogeny. Evidence from angiosperms implicates the plant hormone auxin and its polar transport, mainly established by the PIN family of auxin efflux transporters, in the patterning of embryos. Here, PaPIN1 from Norway spruce (Picea abies [L.] Karst.), a gene widely expressed in conifer tissues and organs, was characterized and its expression and localization patterns were determined with reverse transcription polymerase chain reaction and in situ hybridization during somatic embryo development and in seedlings. PaPIN1 shares the predicted structure of other PIN proteins, but its central hydrophilic loop is longer than most PINs. In phylogenetic analyses, PaPIN1 clusters with Arabidopsis thaliana (L.) Heynh. PIN3, PIN4 and PIN7, but its expression pattern also suggests similarity to PIN1. The PaPIN1 expression signal was high in the protoderm of pre-cotyledonary embryos, but not if embryos were pre-treated with the auxin transport inhibitor N-1-naphthylphthalamic acid (NPA). This, together with a high auxin immunolocalization signal in this cell layer, suggests a role of PaPIN1 during cotyledon formation. At later stages, high PaPIN1 expression was observed in differentiating procambium, running from the tip of incipient cotyledons down through the embryo axis and to the root apical meristem (RAM), although the mode of RAM specification in conifer embryos differs from that of most angiosperms. Also, the PaPIN1 in situ signal was high in seedling root tips including root cap columella cells. The results thus suggest that PaPIN1 provides an ancient function associated with auxin transport and embryo pattern formation prior to the separation of angiosperms and gymnosperms, in spite of some morphological differences.

Cancer, Warts, or Asymptomatic Infections: Clinical Presentation Matches Codon Usage Preferences in Human Papillomaviruses

PubMed Central

Félez-Sánchez, Marta; Trösemeier, Jan-Hendrik; Bedhomme, Stéphanie; González-Bravo, Maria Isabel; Kamp, Christel; Bravo, Ignacio G.

2015-01-01

Viruses rely completely on the hosts’ machinery for translation of viral transcripts. However, for most viruses infecting humans, codon usage preferences (CUPrefs) do not match those of the host. Human papillomaviruses (HPVs) are a showcase to tackle this paradox: they present a large genotypic diversity and a broad range of phenotypic presentations, from asymptomatic infections to productive lesions and cancer. By applying phylogenetic inference and dimensionality reduction methods, we demonstrate first that genes in HPVs are poorly adapted to the average human CUPrefs, the only exception being capsid genes in viruses causing productive lesions. Phylogenetic relationships between HPVs explained only a small proportion of CUPrefs variation. Instead, the most important explanatory factor for viral CUPrefs was infection phenotype, as orthologous genes in viruses with similar clinical presentation displayed similar CUPrefs. Moreover, viral genes with similar spatiotemporal expression patterns also showed similar CUPrefs. Our results suggest that CUPrefs in HPVs reflect either variations in the mutation bias or differential selection pressures depending on the clinical presentation and expression timing. We propose that poor viral CUPrefs may be central to a trade-off between strong viral gene expression and the potential for eliciting protective immune response. PMID:26139833

Transcriptome analysis of a long-lived natural Drosophila variant: a prominent role of stress- and reproduction-genes in lifespan extension

PubMed Central

2012-01-01

Background While studying long-lived mutants has advanced our understanding of the processes involved in ageing, the mechanisms underlying natural variation in lifespan and ageing rate remain largely unknown. Here, we characterise genome-wide expression patterns of a long-lived, natural variant of Drosophila melanogaster resulting from selection for starvation resistance (SR) and compare it with normal-lived control flies (C). We do this at two time points representing middle age (90% survival) and old age (10% survival) respectively, in three adult diets (malnutrition, optimal food, and overfeeding). Results We found profound differences between Drosophila lines in their age-related expression. Most of the age-associated changes in normal-lived flies were abrogated in long-lived Drosophila. The stress-related genes, including those involved in proteolysis and cytochrome P450, were generally higher expressed in SR flies and showed a smaller increase in expression with age compared to C flies. The genes involved in reproduction showed a lower expression in middle-aged SR than in C flies and, unlike C flies, a lack of their downregulation with age. Further, we found that malnutrition strongly affected age-associated transcript patterns overriding the differences between the lines. However, under less stressful dietary conditions, line and diet affected age-dependent expression similarly. Finally, we present lists of candidate markers of ageing and lifespan extension. Conclusions Our study unveils transcriptional changes associated with lifespan extension in SR Drosophila. The results suggest that natural genetic variation for SR and lifespan can operate through similar transcriptional mechanisms as those of dietary restriction and life-extending mutations. PMID:22559237

Homoeolog-specific activation of genes for heat acclimation in the allopolyploid grass Brachypodium hybridum.

PubMed

Takahagi, Kotaro; Inoue, Komaki; Shimizu, Minami; Uehara-Yamaguchi, Yukiko; Onda, Yoshihiko; Mochida, Keiichi

2018-04-01

Allopolyploid plants often show wider environmental tolerances than their ancestors; this is expected to be due to the merger of multiple distinct genomes with a fixed heterozygosity. The complex homoeologous gene expression could have been evolutionarily advantageous for the adaptation of allopolyploid plants. Despite multiple previous studies reporting homoeolog-specific gene expression in allopolyploid species, there are no clear examples of homoeolog-specific function in acclimation to a long-term stress condition. We found that the allopolyploid grass Brachypodium hybridum and its ancestor Brachypodium stacei show long-term heat stress tolerance, unlike its other ancestor, Brachypodium distachyon. To understand the physiological traits of B. hybridum, we compared the transcriptome of the 3 Brachypodium species grown under normal and heat stress conditions. We found that the expression patterns of approximately 26% and approximately 38% of the homoeolog groups in B. hybridum changed toward nonadditive expression and nonancestral expression, respectively, under normal condition. Moreover, we found that B. distachyon showed similar expression patterns between normal and heat stress conditions, whereas B. hybridum and B. stacei significantly altered their transcriptome in response to heat after 3 days of stress exposure, and homoeologs that were inherited from B. stacei may have contributed to the transcriptional stress response to heat in B. hybridum. After 15 days of heat exposure, B. hybridum and B. stacei maintained transcriptional states similar to those under normal conditions. These results suggest that an earlier response to heat that was specific to homoeologs originating from B. stacei contributed to cellular homeostasis under long-term heat stress in B. hybridum. Our results provide insights into different regulatory events of the homoeo-transcriptome that are associated with stress acclimation in allopolyploid plants.

Archetypal analysis of diverse Pseudomonas aeruginosa transcriptomes reveals adaptation in cystic fibrosis airways

PubMed Central

2013-01-01

Background Analysis of global gene expression by DNA microarrays is widely used in experimental molecular biology. However, the complexity of such high-dimensional data sets makes it difficult to fully understand the underlying biological features present in the data. The aim of this study is to introduce a method for DNA microarray analysis that provides an intuitive interpretation of data through dimension reduction and pattern recognition. We present the first “Archetypal Analysis” of global gene expression. The analysis is based on microarray data from five integrated studies of Pseudomonas aeruginosa isolated from the airways of cystic fibrosis patients. Results Our analysis clustered samples into distinct groups with comprehensible characteristics since the archetypes representing the individual groups are closely related to samples present in the data set. Significant changes in gene expression between different groups identified adaptive changes of the bacteria residing in the cystic fibrosis lung. The analysis suggests a similar gene expression pattern between isolates with a high mutation rate (hypermutators) despite accumulation of different mutations for these isolates. This suggests positive selection in the cystic fibrosis lung environment, and changes in gene expression for these isolates are therefore most likely related to adaptation of the bacteria. Conclusions Archetypal analysis succeeded in identifying adaptive changes of P. aeruginosa. The combination of clustering and matrix factorization made it possible to reveal minor similarities among different groups of data, which other analytical methods failed to identify. We suggest that this analysis could be used to supplement current methods used to analyze DNA microarray data. PMID:24059747

Characterization and comparison of osteoblasts derived from mouse embryonic stem cells and induced pluripotent stem cells.

PubMed

Ma, Ming-San; Kannan, Vishnu; de Vries, Anneriek E; Czepiel, Marcin; Wesseling, Evelyn M; Balasubramaniyan, Veerakumar; Kuijer, Roel; Vissink, Arjan; Copray, Sjef C V M; Raghoebar, Gerry M

2017-01-01

New developments in stem cell biology offer alternatives for the reconstruction of critical-sized bone defects. One of these developments is the use of induced pluripotent stem (iPS) cells. These stem cells are similar to embryonic stem (ES) cells, but can be generated from adult somatic cells and therefore do not raise ethical concerns. Proper characterization of iPS-derived osteoblasts is important for future development of safe clinical applications of these cells. For this reason, we differentiated mouse ES and iPS cells toward osteoblasts using osteogenic medium and compared their functionality. Immunocytochemical analysis showed significant expression of bone markers (osteocalcin and collagen type I) in osteoblasts differentiated from ES and iPS cells on days 7 and 30. An in vitro mineralization assay confirmed the functionality of osteogenically differentiated ES and iPS cells. Gene expression arrays focusing on osteogenic differentiation were performed in order to compare the gene expression pattern in both differentiated and undifferentiated ES cells and iPS cells. We observed a significant upregulation of osteogenesis-related genes such as Runx2, osteopontin, collagen type I, Tnfsf11, Csf1, and alkaline phosphatase upon osteogenic differentiation of the ES and iPS cells. We further validated the expression of key osteogenic genes Runx2, osteopontin, osteocalcin, collagen type I, and osterix in both differentiated and undifferentiated ES and iPS cells by means of quantified real-time polymerase chain reaction. We conclude that ES and iPS cells are similar in their osteogenic differentiation capacities, as well as in their gene expression patterns.

Vitellogenin Underwent Subfunctionalization to Acquire Caste and Behavioral Specific Expression in The Harvester Ant Pogonomyrmex barbatus

USDA-ARS?s Scientific Manuscript database

Similarly to others advanced social insects, ants and bees have an age-associated division of labor, whereby young workers normally perform tasks inside the colony and old workers forage outside the nest, but this pattern is more variable in ants. It is unknown whether, notwithstanding their differe...

In vitro developmental model of the gastrointestinal tract from mouse embryonic stem cells.

PubMed

Torihashi, Shigeko; Kuwahara, Masaki; Kurahashi, Masaaki

2007-10-01

Mouse embryonic stem (ES) cells are pluripotent and retain their potential to form cells, tissues and organs originated from three embryonic germ layers. Recently, we developed in vitro organ--gut-like structures--from mouse ES cells. They had basically similar morphological features to a mouse gastrointestinal tract in vivo composed of three distinct layers (i.e., epithelium, connective tissue and musculature). Gut-like structures showed spontaneous contractions derived from pacemaker cells (interstitial cells of Cajal) in the musculature. We also examined their formation process and expression pattern of transcription factors crucial for gut organogenesis such as Id2, Sox17, HNF3beta/Foxa2 and GATA4. We found that they mimic the development of embryonic gut in vivo and showed a similar expression pattern of common transcription factors. They also maintain their developmental potential after transplantation to a renal capsule. Therefore, gut-like structures are suitable for in vitro models of gastrointestinal tracts and their development. In addition, we pointed out several unique features different from gut in vivo that provide useful and advantageous tools to investigate the developmental mechanism of the gastrointestinal tract.

Human Empathy, Personality and Experience Affect the Emotion Ratings of Dog and Human Facial Expressions.

PubMed

Kujala, Miiamaaria V; Somppi, Sanni; Jokela, Markus; Vainio, Outi; Parkkonen, Lauri

2017-01-01

Facial expressions are important for humans in communicating emotions to the conspecifics and enhancing interpersonal understanding. Many muscles producing facial expressions in humans are also found in domestic dogs, but little is known about how humans perceive dog facial expressions, and which psychological factors influence people's perceptions. Here, we asked 34 observers to rate the valence, arousal, and the six basic emotions (happiness, sadness, surprise, disgust, fear, and anger/aggressiveness) from images of human and dog faces with Pleasant, Neutral and Threatening expressions. We investigated how the subjects' personality (the Big Five Inventory), empathy (Interpersonal Reactivity Index) and experience of dog behavior affect the ratings of dog and human faces. Ratings of both species followed similar general patterns: human subjects classified dog facial expressions from pleasant to threatening very similarly to human facial expressions. Subjects with higher emotional empathy evaluated Threatening faces of both species as more negative in valence and higher in anger/aggressiveness. More empathetic subjects also rated the happiness of Pleasant humans but not dogs higher, and they were quicker in their valence judgments of Pleasant human, Threatening human and Threatening dog faces. Experience with dogs correlated positively with ratings of Pleasant and Neutral dog faces. Personality also had a minor effect on the ratings of Pleasant and Neutral faces in both species. The results imply that humans perceive human and dog facial expression in a similar manner, and the perception of both species is influenced by psychological factors of the evaluators. Especially empathy affects both the speed and intensity of rating dogs' emotional facial expressions.

Human Empathy, Personality and Experience Affect the Emotion Ratings of Dog and Human Facial Expressions

PubMed Central

Kujala, Miiamaaria V.; Somppi, Sanni; Jokela, Markus; Vainio, Outi; Parkkonen, Lauri

2017-01-01

Facial expressions are important for humans in communicating emotions to the conspecifics and enhancing interpersonal understanding. Many muscles producing facial expressions in humans are also found in domestic dogs, but little is known about how humans perceive dog facial expressions, and which psychological factors influence people’s perceptions. Here, we asked 34 observers to rate the valence, arousal, and the six basic emotions (happiness, sadness, surprise, disgust, fear, and anger/aggressiveness) from images of human and dog faces with Pleasant, Neutral and Threatening expressions. We investigated how the subjects’ personality (the Big Five Inventory), empathy (Interpersonal Reactivity Index) and experience of dog behavior affect the ratings of dog and human faces. Ratings of both species followed similar general patterns: human subjects classified dog facial expressions from pleasant to threatening very similarly to human facial expressions. Subjects with higher emotional empathy evaluated Threatening faces of both species as more negative in valence and higher in anger/aggressiveness. More empathetic subjects also rated the happiness of Pleasant humans but not dogs higher, and they were quicker in their valence judgments of Pleasant human, Threatening human and Threatening dog faces. Experience with dogs correlated positively with ratings of Pleasant and Neutral dog faces. Personality also had a minor effect on the ratings of Pleasant and Neutral faces in both species. The results imply that humans perceive human and dog facial expression in a similar manner, and the perception of both species is influenced by psychological factors of the evaluators. Especially empathy affects both the speed and intensity of rating dogs’ emotional facial expressions. PMID:28114335

The activation pattern of macrophages in giant cell (temporal) arteritis and primary angiitis of the central nervous system.

PubMed

Mihm, Bernhard; Bergmann, Markus; Brück, Wolfgang; Probst-Cousin, Stefan

2014-06-01

To determine if the pattern of macrophage activation reflects differences in the pathogenesis and clinical presentation of giant cell arteritis and primary angiitis of the central nervous system, specimens of 10 patients with giant cell arteritis and five with primary angiitis of the central nervous system were immunohistochemically studied and the expression of the macrophage activation markers 27E10, MRP14, MRP8 and 25F9 was determined in the vasculitic infiltrates. Thus, a partly different expression pattern of macrophage activation markers in giant cell arteritis and primary angiitis of the central nervous system was observed. The group comparison revealed that giant cell arteritis cases had significantly higher numbers of acute activated MRP14-positive macrophages, whereas primary angiitis of the central nervous system is characterized by a tendency toward more MRP8-positive intermediate/late activated macrophages. Furthermore, in giant cell arteritis comparably fewer CD8-positive lymphocytes were observed. These observations suggest, that despite their histopathological similarities, giant cell arteritis and primary angiitis of the central nervous system appear to represent either distinct entities within the spectrum of granulomatous vasculitides or different stages of similar disease processes. Their discrete clinical presentation is reflected by different activation patterns of macrophages, which may characterize giant cell arteritis as a more acute process and primary angiitis of the central nervous system as a more advanced inflammatory process. © 2013 Japanese Society of Neuropathology.

Ectopic expression of hoxb2 after retinoic acid treatment or mRNA injection: disruption of hindbrain and craniofacial morphogenesis in zebrafish embryos.

PubMed

Yan, Y L; Jowett, T; Postlethwait, J H

1998-12-01

To investigate pattern formation in the vertebrate hindbrain, we isolated a full length hoxb2 cDNA clone from zebrafish. In a gene phylogeny, zebrafish hoxb2 clusters with human HOXB2, and it maps on linkage group 3 along with several other loci whose orthologues are syntenic with human HOXB2. In the hindbrain, hoxb2 is expressed at high levels in rhombomere 3 (r3), lower levels in r4, still lower in r5, and at undetectable levels in r6. In r7, r8, and the rostral spinal cord, hoxb2 is expressed at a lower level than in r5. Lateral cells appearing to emanate from r4 express both hoxb2 and dlx2, suggesting that they are neural crest. Overexpression of hoxb2 by mRNA injections into early cleavage stage embryos resulted in abnormal morphogenesis of the midbrain and rostral hindbrain, abnormal patterning in r4, fusion of cartilage elements arising from pharyngeal arches 1 and 2, and ectopic expression of krx20 and valentino (but not pax2, rtk1, or hoxb1) in the rostral hindbrain, midbrain, and, surprisingly, the eye. Treatments with retinoic acid produced a phenotype similar to that of ectopic hoxb2 expression, including ectopic krx20 (but not valentino) expression in the eye, and fusion of cartilages from pharyngeal arches 1 and 2. The results suggest that hoxb2 plays an important role in the patterning of hindbrain and pharyngeal arches in the zebrafish.

Altered procollagen gene expression in mid-gestational mouse excisional wounds.

PubMed

Goldberg, Stephanie R; Quirk, Gerald L; Sykes, Virginia W; Kordula, Tomasz; Lanning, David A

2007-11-01

Many pathologic conditions are characterized by excessive tissue contraction and scar formation. Previously, we developed a murine model of excisional wound healing in which mid-gestational wounds heal scarlessly compared with late-gestational wounds. We theorized that variations in procollagen gene expression may contribute to the scarless and rapid closure. Time-dated pregnant FVB strain mice underwent laparotomy and hysterotomy on embryonic days 15 (E15) and 18 (E18). Full-thickness, excisional wounds (3 mm) were made on each of 4 fetuses per doe and then harvested at 32, 48, or 72 h. Control tissue consisted of age-matched normal fetal skin. Procollagen types 1alpha1, 1alpha2, and 3 gene expressions were measured by real-time polymerase chain reaction and normalized to glyceraldehyde-3-phosphate dehydrogenase. Trichrome staining was also performed. Procollagen 1alpha1 expression was decreased in E15 wounds at 32 h compared with their normal skin groups. Procollagen types 1alpha2 and 3 expressions were both increased in the E15 groups compared with the E18 groups at 48 h. At 72 h, the E15 wounds had a collagen density similar to the surrounding normal skin while E18 wounds exhibited increased collagen deposition in a disorganized pattern. This study demonstrates that the pattern of gene expression for types 1 and 3 collagen varies between mid- and late-gestational mouse excisional wounds. These alterations in procollagen expression may contribute to a pattern of collagen deposition in the mid-gestational fetuses that is more favorable for scarless healing with less type 1 and more type 3 collagen.

Transcriptional Modulation of Genes Encoding Structural Characteristics of Differentiating Enterocytes During Development of a Polarized Epithelium In Vitro

PubMed Central

Halbleib, Jennifer M.; Sääf, Annika M.

2007-01-01

Although there is considerable evidence implicating posttranslational mechanisms in the development of epithelial cell polarity, little is known about the patterns of gene expression and transcriptional regulation during this process. We characterized the temporal program of gene expression during cell–cell adhesion–initiated polarization of human Caco-2 cells in tissue culture, which develop structural and functional polarity similar to that of enterocytes in vivo. A distinctive switch in gene expression patterns occurred upon formation of cell–cell contacts between neighboring cells. Expression of genes involved in cell proliferation was down-regulated concomitant with induction of genes necessary for functional specialization of polarized epithelial cells. Transcriptional up-regulation of these latter genes correlated with formation of important structural and functional features in enterocyte differentiation and establishment of structural and functional cell polarity; components of the apical microvilli were induced as the brush border formed during polarization; as barrier function was established, expression of tight junction transmembrane proteins peaked; transcripts encoding components of the apical, but not the basal-lateral trafficking machinery were increased during polarization. Coordinated expression of genes encoding components of functional cell structures were often observed indicating temporal control of expression and assembly of multiprotein complexes. PMID:17699590

Videos of conspecifics elicit interactive looking patterns and facial expressions in monkeys

PubMed Central

Mosher, Clayton P.; Zimmerman, Prisca E.; Gothard, Katalin M.

2014-01-01

A broader understanding of the neural basis of social behavior in primates requires the use of species-specific stimuli that elicit spontaneous, but reproducible and tractable behaviors. In this context of natural behaviors, individual variation can further inform about the factors that influence social interactions. To approximate natural social interactions similar to those documented by field studies, we used unedited video footage to induce in viewer monkeys spontaneous facial expressions and looking patterns in the laboratory setting. Three adult male monkeys, previously behaviorally and genetically (5-HTTLPR) characterized (Gibboni et al., 2009), were monitored while they watched 10 s video segments depicting unfamiliar monkeys (movie monkeys) displaying affiliative, neutral, and aggressive behaviors. The gaze and head orientation of the movie monkeys alternated between ‘averted’ and ‘directed’ at the viewer. The viewers were not reinforced for watching the movies, thus their looking patterns indicated their interest and social engagement with the stimuli. The behavior of the movie monkey accounted for differences in the looking patterns and facial expressions displayed by the viewers. We also found multiple significant differences in the behavior of the viewers that correlated with their interest in these stimuli. These socially relevant dynamic stimuli elicited spontaneous social behaviors, such as eye-contact induced reciprocation of facial expression, gaze aversion, and gaze following, that were previously not observed in response to static images. This approach opens a unique opportunity to understanding the mechanisms that trigger spontaneous social behaviors in humans and non-human primates. PMID:21688888

Gene expression changes governing extreme dehydration tolerance in an Antarctic insect

PubMed Central

Teets, Nicholas M.; Peyton, Justin T.; Colinet, Herve; Renault, David; Kelley, Joanna L.; Kawarasaki, Yuta; Lee, Richard E.; Denlinger, David L.

2012-01-01

Among terrestrial organisms, arthropods are especially susceptible to dehydration, given their small body size and high surface area to volume ratio. This challenge is particularly acute for polar arthropods that face near-constant desiccating conditions, as water is frozen and thus unavailable for much of the year. The molecular mechanisms that govern extreme dehydration tolerance in insects remain largely undefined. In this study, we used RNA sequencing to quantify transcriptional mechanisms of extreme dehydration tolerance in the Antarctic midge, Belgica antarctica, the world’s southernmost insect and only insect endemic to Antarctica. Larvae of B. antarctica are remarkably tolerant of dehydration, surviving losses up to 70% of their body water. Gene expression changes in response to dehydration indicated up-regulation of cellular recycling pathways including the ubiquitin-mediated proteasome and autophagy, with concurrent down-regulation of genes involved in general metabolism and ATP production. Metabolomics results revealed shifts in metabolite pools that correlated closely with changes in gene expression, indicating that coordinated changes in gene expression and metabolism are a critical component of the dehydration response. Finally, using comparative genomics, we compared our gene expression results with a transcriptomic dataset for the Arctic collembolan, Megaphorura arctica. Although B. antarctica and M. arctica are adapted to similar environments, our analysis indicated very little overlap in expression profiles between these two arthropods. Whereas several orthologous genes showed similar expression patterns, transcriptional changes were largely species specific, indicating these polar arthropods have developed distinct transcriptional mechanisms to cope with similar desiccating conditions. PMID:23197828

Gene expression changes governing extreme dehydration tolerance in an Antarctic insect.

PubMed

Teets, Nicholas M; Peyton, Justin T; Colinet, Herve; Renault, David; Kelley, Joanna L; Kawarasaki, Yuta; Lee, Richard E; Denlinger, David L

2012-12-11

Among terrestrial organisms, arthropods are especially susceptible to dehydration, given their small body size and high surface area to volume ratio. This challenge is particularly acute for polar arthropods that face near-constant desiccating conditions, as water is frozen and thus unavailable for much of the year. The molecular mechanisms that govern extreme dehydration tolerance in insects remain largely undefined. In this study, we used RNA sequencing to quantify transcriptional mechanisms of extreme dehydration tolerance in the Antarctic midge, Belgica antarctica, the world's southernmost insect and only insect endemic to Antarctica. Larvae of B. antarctica are remarkably tolerant of dehydration, surviving losses up to 70% of their body water. Gene expression changes in response to dehydration indicated up-regulation of cellular recycling pathways including the ubiquitin-mediated proteasome and autophagy, with concurrent down-regulation of genes involved in general metabolism and ATP production. Metabolomics results revealed shifts in metabolite pools that correlated closely with changes in gene expression, indicating that coordinated changes in gene expression and metabolism are a critical component of the dehydration response. Finally, using comparative genomics, we compared our gene expression results with a transcriptomic dataset for the Arctic collembolan, Megaphorura arctica. Although B. antarctica and M. arctica are adapted to similar environments, our analysis indicated very little overlap in expression profiles between these two arthropods. Whereas several orthologous genes showed similar expression patterns, transcriptional changes were largely species specific, indicating these polar arthropods have developed distinct transcriptional mechanisms to cope with similar desiccating conditions.

Octreotide and pasireotide (dis)similarly inhibit pituitary tumor cells in vitro.

PubMed

Ibáñez-Costa, Alejandro; Rivero-Cortés, Esther; Vázquez-Borrego, Mari C; Gahete, Manuel D; Jiménez-Reina, Luis; Venegas-Moreno, Eva; de la Riva, Andrés; Arráez, Miguel Ángel; González-Molero, Inmaculada; Schmid, Herbert A; Maraver-Selfa, Silvia; Gavilán-Villarejo, Inmaculada; García-Arnés, Juan Antonio; Japón, Miguel A; Soto-Moreno, Alfonso; Gálvez, María A; Luque, Raúl M; Castaño, Justo P

2016-11-01

Somatostatin analogs (SSA) are the mainstay of pharmacological treatment for pituitary adenomas. However, some patients escape from therapy with octreotide, a somatostatin receptor 2 (sst2)-preferring SSA, and pasireotide, a novel multi-sst-preferring SSA, may help to overcome this problem. It has been proposed that correspondence between sst1-sst5 expression pattern and SSA-binding profile could predict patient's response. To explore the cellular/molecular features associated with octreotide/pasireotide response, we performed a parallel comparison of their in vitro effects, evaluating sst1-sst5 expression, intracellular Ca 2+ signaling ([Ca 2+ ] i ), hormone secretion and cell viability, in a series of 85 pituitary samples. Somatotropinomas expressed sst5>sst2, yet octreotide reduced [Ca 2+ ] i more efficiently than pasireotide, while both SSA similarly decreased growth hormone release/expression and viability. Corticotropinomas predominantly expressed sst5, but displayed limited response to pasireotide, while octreotide reduced functional endpoints. Non-functioning adenomas preferentially expressed sst3 but, surprisingly, both SSA increased cell viability. Prolactinomas mainly expressed sst1 but were virtually unresponsive to SSA. Finally, both SSA decreased [Ca 2+ ] i in normal pituitaries. In conclusion, both SSA act in vitro on pituitary adenomas exerting both similar and distinct effects; however, no evident correspondence was found with the sst1-sst5 profile. Thus, it seems plausible that additional factors, besides the simple abundance of a given sst, critically influence the SSA response. © 2016 Society for Endocrinology.

Hilar cholangiocarcinoma is pathologically similar to pancreatic duct adenocarcinoma: suggestions of similar background and development.

PubMed

Nakanuma, Yasuni; Sato, Yasunori

2014-07-01

Routine experiences suggest that cholangiocarcinomas (CCAs) show different clinicopathological behaviors along the biliary tree, and hilar CCA apparently resembles pancreatic duct adenocarcinoma (PDAC). Herein, the backgrounds for these similarities were reviewed. While all cases of PDAC, hilar CCA, intrahepatic CCA (ICCA) and CCA components of combined hepatocellular-cholangiocarcinoma (cHC-CCA) were adenocarcinomas, micropapillary patterns and columnar carcinoma cells were common in PDAC and hilar CCA, and trabecular components and cuboidal carcinoma cells were common in ICCA and CCA components of cHC-CCA. Anterior gradient protein-2 and S100P were frequently expressed in perihilar CCA and PDAC, while neural cell adhesion molecule and luminal epithelial membrane antigen were common in CCA components of c-HC-CCA. Pdx1 and Hes1 were frequently and markedly expressed aberrantly in PDAC and perihilar CCA, although their expression was rare and mild in CCA components in cHC-CCA and ICCA. Hilar CCA showed a similar postoperative prognosis to PDAC but differed from ICCA and cHC-CCA. Taken together, hilar CCA may differ from ICCA and CCA components of cHC-CCA but have a similar development to PDAC. These similarities may be explained by the unique anatomical, embryological and reactive nature of the pancreatobiliary tract. Further studies of these intractable malignancies are warranted. © 2014 Japanese Society of Hepato-Biliary-Pancreatic Surgery.

Identification of General Patterns of Sex-Biased Expression in Daphnia, a Genus with Environmental Sex Determination

PubMed Central

Molinier, Cécile; Reisser, Céline M.O.; Fields, Peter; Ségard, Adeline; Galimov, Yan; Haag, Christoph R.

2018-01-01

Daphnia reproduce by cyclic-parthenogenesis, where phases of asexual reproduction are intermitted by sexual production of diapause stages. This life cycle, together with environmental sex determination, allow the comparison of gene expression between genetically identical males and females. We investigated gene expression differences between males and females in four genotypes of Daphnia magna and compared the results with published data on sex-biased gene expression in two other Daphnia species, each representing one of the major phylogenetic clades within the genus. We found that 42% of all annotated genes showed sex-biased expression in D. magna. This proportion is similar both to estimates from other Daphnia species as well as from species with genetic sex determination, suggesting that sex-biased expression is not reduced under environmental sex determination. Among 7453 single copy, one-to-one orthologs in the three Daphnia species, 707 consistently showed sex-biased expression and 675 were biased in the same direction in all three species. Hence these genes represent a core-set of genes with consistent sex-differential expression in the genus. A functional analysis identified that several of them are involved in known sex determination pathways. Moreover, 75% were overexpressed in females rather than males, a pattern that appears to be a general feature of sex-biased gene expression in Daphnia. PMID:29535148

Identification of General Patterns of Sex-Biased Expression in Daphnia, a Genus with Environmental Sex Determination.

PubMed

Molinier, Cécile; Reisser, Céline M O; Fields, Peter; Ségard, Adeline; Galimov, Yan; Haag, Christoph R

2018-05-04

Daphnia reproduce by cyclic-parthenogenesis, where phases of asexual reproduction are intermitted by sexual production of diapause stages. This life cycle, together with environmental sex determination, allow the comparison of gene expression between genetically identical males and females. We investigated gene expression differences between males and females in four genotypes of Daphnia magna and compared the results with published data on sex-biased gene expression in two other Daphnia species, each representing one of the major phylogenetic clades within the genus. We found that 42% of all annotated genes showed sex-biased expression in D. magna This proportion is similar both to estimates from other Daphnia species as well as from species with genetic sex determination, suggesting that sex-biased expression is not reduced under environmental sex determination. Among 7453 single copy, one-to-one orthologs in the three Daphnia species, 707 consistently showed sex-biased expression and 675 were biased in the same direction in all three species. Hence these genes represent a core-set of genes with consistent sex-differential expression in the genus. A functional analysis identified that several of them are involved in known sex determination pathways. Moreover, 75% were overexpressed in females rather than males, a pattern that appears to be a general feature of sex-biased gene expression in Daphnia . Copyright © 2018 Molinier et al.

Genomic Porosity between Invasive Chondrostoma nasus and Endangered Endemic Parachondrostoma toxostoma (Cyprinidae): The Evolution of MHC IIB Genes

PubMed Central

Šimková, Andrea; Civáňová, Kristína; Gettová, Lenka; Gilles, André

2013-01-01

Two cyprinid species, Parachondrostoma toxostoma, an endemic threatened species, and Chondrostoma nasus, an invasive species, live in sympatry in southern France and form two sympatric zones where the presence of intergeneric hybrids is reported. To estimate the potential threat to endemic species linked to the introduction of invasive species, we focused on the DAB genes (functional MHC IIB genes) because of their adaptive significance and role in parasite resistance. More specifically, we investigated (1) the variability of MHC IIB genes, (2) the selection pattern shaping MHC polymorphism, and (3) the extent to which trans-species evolution and intergeneric hybridization affect MHC polymorphism. In sympatric areas, the native species has more diversified MHC IIB genes when compared to the invasive species, probably resulting from the different origins and dispersal of both species. A similar level of MHC polymorphism was found at population level in both species, suggesting similar mechanisms generating MHC diversity. In contrast, a higher number of DAB-like alleles per specimen were found in invasive species. Invasive species tended to express the alleles of two DAB lineages, whilst native species tended to express the alleles of only the DAB3 lineage. Hybrids have a pattern of MHC expression intermediate between both species. Whilst positive selection acting on peptide binding sites (PBS) was demonstrated in both species, a slightly higher number of positively selected sites were identified in C. nasus, which could result from parasite-mediated selection. Bayesian clustering analysis revealed a similar pattern of structuring for the genetic variation when using microsatellites or the MHC approach. We confirmed the importance of trans-species evolution for MHC polymorphism. In addition, we demonstrated bidirectional gene flow for MHC IIB genes in sympatric areas. The positive significant correlation between MHC and microsatellites suggests that demographic factors may contribute to MHC variation on a short time scale. PMID:23824831

Identification of a distant cis-regulatory element controlling pharyngeal arch-specific expression of zebrafish gdf6a/radar

PubMed Central

Reed, Nykolaus P.; Mortlock, Douglas P.

2011-01-01

Skeletal formation is an essential and intricately regulated part of vertebrate development. Humans and mice deficient in Growth and Differentiation Factor 6 (Gdf6) have numerous skeletal abnormalities including joint fusions and cartilage reductions. The expression of Gdf6 is dynamic and in part regulated by distant evolutionarily conserved cis-regulatory elements. radar/gdf6a is a zebrafish ortholog of Gdf6 and has an essential role in embryonic patterning. Here we show that radar is transcribed in the cells surrounding and between the developing cartilages of the ventral pharyngeal arches, similar to mouse Gdf6. A 312 bp evolutionarily conserved region (ECR5), 122 kilobases downstream, drives expression in a pharyngeal arch-specific manner similar to endogenous radar/gdf6a. Deletion analysis identified a 78 bp region within ECR5 that is essential for transgene activity. This work illustrates that radar is regulated in the pharyngeal arches by a distant conserved element and suggests radar has similar functions in skeletal development in fish and mammals. PMID:20201106

Ontogeny changes and weaning effects in gene expression patterns of digestive enzymes and regulatory digestive factors in spotted rose snapper (Lutjanus guttatus) larvae.

PubMed

Moguel-Hernández, I; Peña, R; Andree, K B; Tovar-Ramirez, D; Bonacic, K; Dumas, S; Gisbert, E

2016-10-01

The study of digestive physiology is an important issue in species that have been introduced in aquaculture like the spotted rose snapper (Lutjanus guttatus). The aims of this study were to describe the expression of digestive enzymes (trypsinogen, chymotrypsinogen, α-amylase, lipoprotein lipase, phospholipase A and pepsinogen) and their relation with orexigenic (neuropeptide Y, NPY) and anorexigenic (cholecystokinin, CCK) factors during the larval development and to evaluate the effect of weaning in their expression. The results showed that the transcripts of all the assayed digestive enzymes, with the exception of pepsinogen, and NPY and CCK were already present in L. guttatus from the hatching stage. The expression of all the enzymes was low during the yolk-sac stage (0-2 days after hatching, DAH), whereas after the onset of exogenous feeding at 2 DAH, their expression increased and fluctuated throughout larval development, which followed a similar pattern as in other marine fish species and reflected changes in different types of food items and the progressive maturation of the digestive system. On the other hand, weaning of L. guttatus larvae from live prey onto a microdiet between 25 and 35 DAH significantly affected the relative expression of most pancreatic digestive enzymes during the first weaning days, whereas chymotrypsinogen 2 and lipoprotein lipase remained stable during this period. At the end of co-feeding, larvae showed similar levels of gene expression regardless of the diet (live prey vs. microdiet), which indicated that larvae of L. guttatus were able to adapt their digestive capacities to the microdiet. In contrast, feeding L. guttatus larvae with live feed or microdiet did not affect the expression of CCK and NPY. The relevance of these findings with regard to current larval rearing procedures of L. guttatus is discussed.

Comparative Analysis of Two Flavonol Synthases from Different-Colored Onions Provides Insight into Flavonoid Biosynthesis.

PubMed

Park, Sangkyu; Kim, Da-Hye; Lee, Jong-Yeol; Ha, Sun-Hwa; Lim, Sun-Hyung

2017-07-05

We isolated cDNAs encoding flavonol synthase (FLS) from the red onion "H6" (AcFLS-H6) and the yellow onion "Hwangryongball" (AcFLS-HRB). We found three amino acid variations between the two sequences. Kinetic analysis with recombinant proteins revealed that AcFLS-HRB exhibited approximately 2-fold higher catalytic efficiencies than AcFLS-H6 for dihydroflavonol substrates and that both proteins preferred dihydroquercetin to dihydrokaempferol. The expression patterns of flavonoid biosynthesis genes corresponded to the accumulation patterns of flavonoid aglycones in both onions. Whereas the other flavonoid biosynthesis genes were weakly expressed in the HRB sheath compared to that of H6, the expression of FLS was similar in both onions. This relatively enhanced FLS expression, along with the higher activity of AcFLS-HRB, could increase the quercetin production in the HRB sheath. The quercetin content was approximately 12-fold higher than the cyanidin content in the H6 sheath, suggesting that FLS has priority in the competition between FLS and dihydroflavonol 4-reductase (DFR) for their substrate dihydroquercetin.

Sodium fluoride affects zebrafish behaviour and alters mRNA expressions of biomarker genes in the brain: Role of Nrf2/Keap1.

PubMed

Mukhopadhyay, Debdip; Priya, Pooja; Chattopadhyay, Ansuman

2015-09-01

Sodium fluoride (NaF), used as pesticides and for industrial purposes are deposited in the water bodies and therefore affects its biota. Zebrafish exposed to NaF in laboratory condition showed hyperactivity and frequent surfacing activity, somersaulting and vertical swimming pattern as compared to the control group. Reactive oxygen species level was elevated and glutathione level was depleted along with increased malondialdehyde content in the brain. Levels of glutathione-s-transferase (GST), catalase (CAT) and superoxide dismutase were also elevated in the treatment groups. Expression of mRNA of nuclear factor erythroid 2 related factor 2 (Nrf2) and its inhibitor Kelch-like ECH-associated protein 1 (Keap1) during stress condition were observed along with Gst, Cat, NADPH: quinone oxidoreductase 1(Nqo1) and p38. Except Keap1, all other genes exhibited elevated expression. Nrf2/Keap1 proteins had similar expression pattern as their corresponding mRNA. The findings in this study might help to understand the molecular mechanism of fluoride induced neurotoxicity in fish. Copyright © 2015 Elsevier B.V. All rights reserved.

Phylogenetic turnover along local environmental gradients in tropical forest communities.

PubMed

Baldeck, C A; Kembel, S W; Harms, K E; Yavitt, J B; John, R; Turner, B L; Madawala, S; Gunatilleke, N; Gunatilleke, S; Bunyavejchewin, S; Kiratiprayoon, S; Yaacob, A; Supardi, M N N; Valencia, R; Navarrete, H; Davies, S J; Chuyong, G B; Kenfack, D; Thomas, D W; Dalling, J W

2016-10-01

While the importance of local-scale habitat niches in shaping tree species turnover along environmental gradients in tropical forests is well appreciated, relatively little is known about the influence of phylogenetic signal in species' habitat niches in shaping local community structure. We used detailed maps of the soil resource and topographic variation within eight 24-50 ha tropical forest plots combined with species phylogenies created from the APG III phylogeny to examine how phylogenetic beta diversity (indicating the degree of phylogenetic similarity of two communities) was related to environmental gradients within tropical tree communities. Using distance-based redundancy analysis we found that phylogenetic beta diversity, expressed as either nearest neighbor distance or mean pairwise distance, was significantly related to both soil and topographic variation in all study sites. In general, more phylogenetic beta diversity within a forest plot was explained by environmental variables this was expressed as nearest neighbor distance versus mean pairwise distance (3.0-10.3 % and 0.4-8.8 % of variation explained among plots, respectively), and more variation was explained by soil resource variables than topographic variables using either phylogenetic beta diversity metric. We also found that patterns of phylogenetic beta diversity expressed as nearest neighbor distance were consistent with previously observed patterns of niche similarity among congeneric species pairs in these plots. These results indicate the importance of phylogenetic signal in local habitat niches in shaping the phylogenetic structure of tropical tree communities, especially at the level of close phylogenetic neighbors, where similarity in habitat niches is most strongly preserved.

Importance of correlation between gene expression levels: application to the type I interferon signature in rheumatoid arthritis.

PubMed

Reynier, Frédéric; Petit, Fabien; Paye, Malick; Turrel-Davin, Fanny; Imbert, Pierre-Emmanuel; Hot, Arnaud; Mougin, Bruno; Miossec, Pierre

2011-01-01

The analysis of gene expression data shows that many genes display similarity in their expression profiles suggesting some co-regulation. Here, we investigated the co-expression patterns in gene expression data and proposed a correlation-based research method to stratify individuals. Using blood from rheumatoid arthritis (RA) patients, we investigated the gene expression profiles from whole blood using Affymetrix microarray technology. Co-expressed genes were analyzed by a biclustering method, followed by gene ontology analysis of the relevant biclusters. Taking the type I interferon (IFN) pathway as an example, a classification algorithm was developed from the 102 RA patients and extended to 10 systemic lupus erythematosus (SLE) patients and 100 healthy volunteers to further characterize individuals. We developed a correlation-based algorithm referred to as Classification Algorithm Based on a Biological Signature (CABS), an alternative to other approaches focused specifically on the expression levels. This algorithm applied to the expression of 35 IFN-related genes showed that the IFN signature presented a heterogeneous expression between RA, SLE and healthy controls which could reflect the level of global IFN signature activation. Moreover, the monitoring of the IFN-related genes during the anti-TNF treatment identified changes in type I IFN gene activity induced in RA patients. In conclusion, we have proposed an original method to analyze genes sharing an expression pattern and a biological function showing that the activation levels of a biological signature could be characterized by its overall state of correlation.

Developmental pattern of ANF gene expression reveals a strict localization of cardiac chamber formation in chicken.

PubMed

Houweling, Arjan C; Somi, Semir; Van Den Hoff, Maurice J B; Moorman, Antoon F M; Christoffels, Vincent M

2002-02-01

In mouse, atrial natriuretic factor (ANF) gene expression was shown to be a marker for chamber formation within the embryonic heart. To gain insight into the process of chamber formation in the chicken embryonic heart, we analyzed the expression pattern of cANF during development. We found cANF to be specifically expressed in the myocardium of the morphologically distinguishable atrial and ventricular chambers, similar to ANF in mouse. cANF expression was never detected in the myocardium of the atrioventricular canal (AVC), inner curvature, and outflow tract (OFT), which is lined by endocardial cushions. Expression was strictly excluded from the interventricular myocardium and most proximal part of the bundle branches, as identified by the expression of Msx-2, whereas the rest of the bundle branches, trabeculae, and surrounding working myocardium did express cANF. The myocardium that forms de novo within the cushions after looping did not express cANF. At HH9 cANF expression was first observed in a subset of cardiomyocytes, which was localized ventrally in the fused heart tube and laterally in the unfused cardiac sheets. Together, these results show that cANF expression can be used to distinguish differentiated chamber (working) myocardium, including the peripheral ventricular conduction system, from embryonic myocardium. We conclude that differentiation of chamber myocardium takes place already at HH9 at the ventral side of the linear heart tube, possibly preceded by latero-medial signals in the unfused cardiac sheets. Copyright 2002 Wiley-Liss, Inc.

Msx genes are expressed in the carapacial ridge of turtle shell: a study of the European pond turtle, Emys orbicularis.

PubMed

Vincent, Christine; Bontoux, Martine; Le Douarin, Nicole M; Pieau, Claude; Monsoro-Burq, Anne-Hélène

2003-09-01

The turtle shell forms by extensive ossification of dermis ventrally and dorsally. The carapacial ridge (CR) controls early dorsal shell formation and is thought to play a similar role in shell growth as the apical ectodermal ridge during limb development. However, the molecular mechanisms underlying carapace development are still unknown. Msx genes are involved in the development of limb mesenchyme and of various skeletal structures. In particular, precocious Msx expression is recorded in skeletal precursors that develop close to the ectoderm, such as vertebral spinous processes or skull. Here, we have studied the embryonic expression of Msx genes in the European pond turtle, Emys orbicularis. The overall Msx expression in head, limb, and trunk is similar to what is observed in other vertebrates. We have focused on the CR area and pre-skeletal shell condensations. The CR expresses Msx genes transiently, in a pattern similar to that of fgf10. In the future carapace domain, the dermis located dorsal to the spinal cord expresses Msx genes, as in other vertebrates, but we did not see expansion of this expression in the dermis located more laterally, on top of the dermomyotomes. In the ventral plastron, although the dermal osseous condensations form in the embryonic Msx-positive somatopleura, we did not observe enhanced Msx expression around these elements. These observations may indicate that common mechanisms participate in limb bud and CR early development, but that pre-differentiation steps differ between shell and other skeletal structures and involve other gene activities than that of Msx genes.

Similarities in temperature-dependent gene expression plasticity across timescales in threespine stickleback (Gasterosteus aculeatus).

PubMed

Metzger, David C H; Schulte, Patricia M

2018-04-14

Phenotypic plasticity occurs at a variety of timescales, but little is known about the degree to which plastic responses at different timescales are associated with similar underlying molecular processes, which is critical for assessing the effects of plasticity on evolutionary trajectories. To address this issue, we identified differential gene expression in response to developmental temperature in the muscle transcriptome of adult threespine stickleback (Gasterosteus aculeatus) exposed to 12, 18 and 24°C until hatch and then held at 18°C for 9 months and compared these results to differential gene expression in response to adult thermal acclimation in stickleback developed at 18°C and then acclimated to 5 and 25°C as adults. Adult thermal acclimation affected the expression of 7,940 and 7,015 genes in response to cold and warm acclimation, respectively, and 4,851 of these genes responded in both treatments. In contrast, the expression of only 33 and 29 genes was affected by cold and warm development, respectively. The majority of the genes affected by developmental temperature were also affected by adult acclimation temperature. Many genes that were differentially expressed as a result of adult acclimation were associated with previously identified temperature-dependent effects on DNA methylation patterns, suggesting a role of epigenetic mechanisms in regulating gene expression plasticity during acclimation. Taken together, these results demonstrate similarities between the persistent effects of developmental plasticity on gene expression and the effects of adult thermal acclimation, emphasizing the potential for mechanistic links between plasticity acting at these different life stages. © 2018 John Wiley & Sons Ltd.

BnEPFL6, an EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) secreted peptide gene, is required for filament elongation in Brassica napus.

PubMed

Huang, Yi; Tao, Zhangsheng; Liu, Qiong; Wang, Xinfa; Yu, Jingyin; Liu, Guihua; Wang, Hanzhong

2014-07-01

Inflorescence architecture, pedicel length and stomata patterning in Arabidopsis thaliana are specified by inter-tissue communication mediated by ERECTA and its signaling ligands in the EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) family of secreted cysteine-rich peptides. Here, we identified and characterized BnEPFL6 from Brassica napus. Heterologous expression of this gene under the double enhanced CaMV promoter (D35S) in Arabidopsis resulted in shortened stamen filaments, filaments degradation, and reduced filament cell size that displayed down-regulated expression of AHK2, in which phenotypic variation of ahk2-1 mutant presented highly consistent with that of BnEPFL6 transgenic lines. Especially, the expression level of BnEPFL6 in the shortened filaments of four B. napus male sterile lines (98A, 86A, SA, and Z11A) was similar to that of BnEPFL6 in the transgenic Arabidopsis lines. The activity of pBnEPFL6.2::GUS was intensive in the filaments of transgenic lines. These observations reveal that BnEPFL6 plays an important role in filament elongation and may also affect organ morphology and floral organ specification via a BnEPFL6-mediated cascade.

Comprehensive analysis of the flowering genes in Chinese cabbage and examination of evolutionary pattern of CO-like genes in plant kingdom

NASA Astrophysics Data System (ADS)

Song, Xiaoming; Duan, Weike; Huang, Zhinan; Liu, Gaofeng; Wu, Peng; Liu, Tongkun; Li, Ying; Hou, Xilin

2015-09-01

In plants, flowering is the most important transition from vegetative to reproductive growth. The flowering patterns of monocots and eudicots are distinctly different, but few studies have described the evolutionary patterns of the flowering genes in them. In this study, we analysed the evolutionary pattern, duplication and expression level of these genes. The main results were as follows: (i) characterization of flowering genes in monocots and eudicots, including the identification of family-specific, orthologous and collinear genes; (ii) full characterization of CONSTANS-like genes in Brassica rapa (BraCOL genes), the key flowering genes; (iii) exploration of the evolution of COL genes in plant kingdom and construction of the evolutionary pattern of COL genes; (iv) comparative analysis of CO and FT genes between Brassicaceae and Grass, which identified several family-specific amino acids, and revealed that CO and FT protein structures were similar in B. rapa and Arabidopsis but different in rice; and (v) expression analysis of photoperiod pathway-related genes in B. rapa under different photoperiod treatments by RT-qPCR. This analysis will provide resources for understanding the flowering mechanisms and evolutionary pattern of COL genes. In addition, this genome-wide comparative study of COL genes may also provide clues for evolution of other flowering genes.

EMAGE mouse embryo spatial gene expression database: 2010 update

PubMed Central

Richardson, Lorna; Venkataraman, Shanmugasundaram; Stevenson, Peter; Yang, Yiya; Burton, Nicholas; Rao, Jianguo; Fisher, Malcolm; Baldock, Richard A.; Davidson, Duncan R.; Christiansen, Jeffrey H.

2010-01-01

EMAGE (http://www.emouseatlas.org/emage) is a freely available online database of in situ gene expression patterns in the developing mouse embryo. Gene expression domains from raw images are extracted and integrated spatially into a set of standard 3D virtual mouse embryos at different stages of development, which allows data interrogation by spatial methods. An anatomy ontology is also used to describe sites of expression, which allows data to be queried using text-based methods. Here, we describe recent enhancements to EMAGE including: the release of a completely re-designed website, which offers integration of many different search functions in HTML web pages, improved user feedback and the ability to find similar expression patterns at the click of a button; back-end refactoring from an object oriented to relational architecture, allowing associated SQL access; and the provision of further access by standard formatted URLs and a Java API. We have also increased data coverage by sourcing from a greater selection of journals and developed automated methods for spatial data annotation that are being applied to spatially incorporate the genome-wide (∼19 000 gene) ‘EURExpress’ dataset into EMAGE. PMID:19767607

CD22 expression on blastic plasmacytoid dendritic cell neoplasms and reactivity of anti-CD22 antibodies to peripheral blood dendritic cells.

PubMed

Reineks, Edmunds Z; Osei, Ebenezer S; Rosenberg, Arlene; Auletta, Jeffrey; Meyerson, Howard J

2009-07-01

We identified CD22 expression on a blastic plasmacytoid dendritic cell (pDC) neoplasm presenting as a leukemia in a child. CD22 expression, as determined by the antibody s-HCL-1, was also noted on the neoplastic cells from three additional patients with blastic pDC tumors identified at our institution. Subsequently we determined that peripheral blood pDCs react with the s-HCL-1 antibody demonstrating that normal pDCs express CD22. Evaluation of five additional anti-CD22 antibodies indicated that staining of pDCs with these reagents was poor except for s-HCL-1. Therefore, the detection of CD22 on pDCs is best demonstrated with the use of this specific antibody clone. All anti-CD22 antibodies stained conventional DCs. We also evaluated the reactivity of the anti-CD22 antibodies with basophils and noted that the pattern of staining was similar to that seen with pDCs. The studies demonstrate that normal DCs and pDC neoplasms express CD22, and highlight clone specific differences in anti-CD22 antibody reactivity patterns on pDCs and basophils. (c) 2009 Clinical Cytometry Society.

Heterochrony in the regulation of the developing marsupial limb.

PubMed

Chew, Keng Yih; Shaw, Geoffrey; Yu, Hongshi; Pask, Andrew J; Renfree, Marilyn B

2014-02-01

At birth, marsupial neonates have precociously developed forelimbs. The development of the tammar wallaby (Macropus eugenii) hindlimbs lags significantly behind that of the forelimbs. This differs from the grey short-tailed opossum, Monodelphis domestica, which has relatively similar fore- and hindlimbs at birth. This study examines the expression of the key patterning genes TBX4, TBX5, PITX1, FGF8, and SHH in developing limb buds in the tammar wallaby. All genes examined were highly conserved with orthologues from opossum and mouse. TBX4 expression appeared earlier in development than in the mouse, but later than in the opossum. SHH expression is restricted to the zone of polarising activity, while TBX5 (forelimb) and PITX1 (hindlimb) showed diffuse mRNA expression. FGF8 is specifically localised to the apical ectodermal ridge, which is more prominent than in the opossum. The most marked divergence in limb size in marsupials occurs in the kangaroos and wallabies. The faster development of the fore limb compared to that of the hind limb correlates with the early timing of the expression of the key patterning genes in these limbs. Copyright © 2013 Wiley Periodicals, Inc.

Annotation of gene function in citrus using gene expression information and co-expression networks

PubMed Central

2014-01-01

Background The genus Citrus encompasses major cultivated plants such as sweet orange, mandarin, lemon and grapefruit, among the world’s most economically important fruit crops. With increasing volumes of transcriptomics data available for these species, Gene Co-expression Network (GCN) analysis is a viable option for predicting gene function at a genome-wide scale. GCN analysis is based on a “guilt-by-association” principle whereby genes encoding proteins involved in similar and/or related biological processes may exhibit similar expression patterns across diverse sets of experimental conditions. While bioinformatics resources such as GCN analysis are widely available for efficient gene function prediction in model plant species including Arabidopsis, soybean and rice, in citrus these tools are not yet developed. Results We have constructed a comprehensive GCN for citrus inferred from 297 publicly available Affymetrix Genechip Citrus Genome microarray datasets, providing gene co-expression relationships at a genome-wide scale (33,000 transcripts). The comprehensive citrus GCN consists of a global GCN (condition-independent) and four condition-dependent GCNs that survey the sweet orange species only, all citrus fruit tissues, all citrus leaf tissues, or stress-exposed plants. All of these GCNs are clustered using genome-wide, gene-centric (guide) and graph clustering algorithms for flexibility of gene function prediction. For each putative cluster, gene ontology (GO) enrichment and gene expression specificity analyses were performed to enhance gene function, expression and regulation pattern prediction. The guide-gene approach was used to infer novel roles of genes involved in disease susceptibility and vitamin C metabolism, and graph-clustering approaches were used to investigate isoprenoid/phenylpropanoid metabolism in citrus peel, and citric acid catabolism via the GABA shunt in citrus fruit. Conclusions Integration of citrus gene co-expression networks, functional enrichment analysis and gene expression information provide opportunities to infer gene function in citrus. We present a publicly accessible tool, Network Inference for Citrus Co-Expression (NICCE, http://citrus.adelaide.edu.au/nicce/home.aspx), for the gene co-expression analysis in citrus. PMID:25023870

Zic3 is required in the migrating primitive streak for node morphogenesis and left–right patterning

PubMed Central

Sutherland, Mardi J.; Wang, Shuyun; Quinn, Malgorzata E.; Haaning, Allison; Ware, Stephanie M.

2013-01-01

In humans, loss-of-function mutations in ZIC3 cause isolated cardiovascular malformations and X-linked heterotaxy, a disorder with abnormal left–right asymmetry of organs. Zic3 null mice recapitulate the human heterotaxy phenotype but also have early gastrulation defects, axial patterning defects and neural tube defects complicating an assessment of the role of Zic3 in cardiac development. Zic3 is expressed ubiquitously during critical stages of left–right patterning but its later expression in the developing heart remains controversial and the molecular mechanism(s) by which it causes heterotaxy are unknown. To define the temporal and spatial requirements, for Zic3 in left–right patterning, we generated conditional Zic3 mice and Zic3-LacZ-BAC reporter mice. The latter provide compelling evidence that Zic3 is expressed in the mouse node and absent in the heart. Conditional deletion using T-Cre identifies a requirement for Zic3 in the primitive streak and migrating mesoderm for proper left–right patterning and cardiac development. In contrast, Zic3 is not required in heart progenitors or the cardiac compartment. In addition, the data demonstrate abnormal node morphogenesis in Zic3 null mice and identify similar node dysplasia when Zic3 was specifically deleted from the migrating mesoderm and primitive streak. These results define the temporal and spatial requirements for Zic3 in node morphogenesis, left–right patterning and cardiac development and suggest the possibility that a requirement for Zic3 in node ultrastructure underlies its role in heterotaxy and laterality disorders. PMID:23303524

Comparative expression of the four enamel matrix protein genes, amelogenin, ameloblastin, enamelin and amelotin during amelogenesis in the lizard Anolis carolinensis.

PubMed

Gasse, Barbara; Sire, Jean-Yves

2015-01-01

In a recent study, we have demonstrated that amelotin (AMTN) gene structure and its expression during amelogenesis have changed during tetrapod evolution. Indeed, this gene is expressed throughout enamel matrix deposition and maturation in non-mammalian tetrapods, while in mammals its expression is restricted to the transition and maturation stages of amelogenesis. Previous studies of amelogenin (AMEL) gene expression in a lizard and a salamander have shown similar expression pattern to that in mammals, but to our knowledge there are no data regarding ameloblastin (AMBN) and enamelin (ENAM) expression in non-mammalian tetrapods. The present study aims to look at, and compare, the structure and expression of four enamel matrix protein genes, AMEL, AMBN, ENAM and AMTN during amelogenesis in the lizard Anolis carolinensis. We provide the full-length cDNA sequence of A. carolinensis AMEL and AMBN, and show for the first time the expression of ENAM and AMBN in a non-mammalian species. During amelogenesis in A. carolinensis, AMEL, AMBN and ENAM expression in ameloblasts is similar to that described in mammals. It is noteworthy that AMEL and AMBN expression is also found in odontoblasts. Our findings indicate that AMTN is the only enamel matrix protein gene that is differentially expressed in ameloblasts between mammals and sauropsids. Changes in AMTN structure and expression could be the key to explain the structural differences between mammalian and reptilian enamel, i.e. prismatic versus non-prismatic.

Molecular profiling of tumor progression in head and neck cancer.

PubMed

Belbin, Thomas J; Singh, Bhuvanesh; Smith, Richard V; Socci, Nicholas D; Wreesmann, Volkert B; Sanchez-Carbayo, Marta; Masterson, Jessica; Patel, Snehal; Cordon-Cardo, Carlos; Prystowsky, Michael B; Childs, Geoffrey

2005-01-01

To assess gene expression changes associated with tumor progression in patients with squamous cell carcinoma of the oral cavity. A microarray containing 17 840 complementary DNA clones was used to measure gene expression changes associated with tumor progression in 9 patients with squamous cell carcinoma of the oral cavity. Samples were taken for analysis from the primary tumor, nodal metastasis, and "normal" mucosa from the patients' oral cavity. Tertiary care facility. Patients Nine patients with stage III or stage IV untreated oral cavity squamous cell carcinoma. Our analysis to categorize genes based on their expression patterns has identified 140 genes that consistently increased in expression during progression from normal tissue to invasive tumor and subsequently to metastatic node (in at least 4 of the 9 cases studied). A similar list of 94 genes has been identified that decreased in expression during tumor progression and metastasis. We validated this gene discovery approach by selecting moesin (a member of the ezrin/radixin/moesin [ERM] family of cytoskeletal proteins) and one of the genes that consistently increased in expression during tumor progression for subsequent immunohistochemical analysis using a head and neck squamous cell carcinoma tissue array. A distinct pattern of gene expression, with progressive up- or down-regulation of expression, is found during the progression from histologically normal tissue to primary carcinoma and to nodal metastasis.

Differential expression patterns of metastasis suppressor proteins in basal cell carcinoma.

PubMed

Bozdogan, Onder; Yulug, Isik G; Vargel, Ibrahim; Cavusoglu, Tarik; Karabulut, Ayse A; Karahan, Gurbet; Sayar, Nilufer

2015-08-01

Basal cell carcinomas (BCCs) are common malignant skin tumors. Despite having a significant invasion capacity, they metastasize only rarely. Our aim in this study was to detect the expression patterns of the NM23-H1, NDRG1, E-cadherin, RHOGDI2, CD82/KAI1, MKK4, and AKAP12 metastasis suppressor proteins in BCCs. A total of 96 BCC and 10 normal skin samples were included for the immunohistochemical study. Eleven frozen BCC samples were also studied by quantitative real time polymerase chain reaction (qRT-PCR) to detect the gene expression profile. NM23-H1 was strongly and diffusely expressed in all types of BCC. Significant cytoplasmic expression of NDRG1 and E-cadherin was also detected. However, AKAP12 and CD82/KAI1 expression was significantly decreased. The expressions of the other proteins were somewhere between the two extremes. Similarly, qRT-PCR analysis showed down-regulation of AKAP12 and up-regulation of NM23-H1 and NDRG1 in BCC. Morphologically aggressive BCCs showed significantly higher cytoplasmic NDRG1 expression scores and lower CD82/KAI1 scores than non-aggressive BCCs. The relatively preserved levels of NM23-H1, NDRG1, and E-cadherin proteins may have a positive effect on the non-metastasizing features of these tumors. © 2014 The International Society of Dermatology.

Expression profiles of genes for mitochondrial respiratory energy-dissipating systems and antioxidant enzymes in wheat leaves during de-etiolation.

PubMed

Garmash, Elena V; Velegzhaninov, Ilya O; Grabelnych, Olga I; Borovik, Olga A; Silina, Ekaterina V; Voinikov, Victor K; Golovko, Tamara K

2017-08-01

Mitochondrial respiratory components participate in the maintenance of chloroplast functional activity. This study investigates the effects 48h de-etiolation of spring wheat seedlings (Triticum aestivum L., var. Irgina) on the expression of genes that encode energy-dissipating respiratory components and antioxidant enzymes under continuous light conditions. The expression of AOX1a following the prolonged darkness exhibited a pattern indicating a prominent dependence on light. The expression of other respiratory genes, including NDA2, NDB2, and UCP1b, increased during de-etiolation and dark-to-light transition; however, changes in the expression of these genes occurred later than those in AOX1a expression. A high expression of NDA1 was detected after 12h of de-etiolation. The suppression of AOX1a, NDA2, NDB2, and UCP1b was observed 24h after de-etiolation when the photosynthetic apparatus and its defence systems against excess light were completely developed. The expression patterns of the respiratory genes and several genes encoding antioxidant enzymes (MnSOD, Cu-ZnSOD, t-APX, GR, and GRX) were quite similar. Our data indicate that the induction of nuclear genes encoding respiratory and antioxidant enzymes allow the plants to control reactive oxygen species (ROS) production and avoid oxidative stress during de-etiolation. Copyright © 2017 Elsevier GmbH. All rights reserved.

Characterization of the canine mda-7 gene, transcripts and expression patterns

PubMed Central

Sandey, Maninder; Bird, R. Curtis; Das, Swadesh K.; Sarkar, Devanand; Curiel, David T.; Fisher, Paul B.; Smith, Bruce F.

2014-01-01

Human melanoma differentiation associated gene-7/interleukin-24 (mda-7/IL-24) displays potent growth suppressing and cell killing activity against a wide variety of human and rodent cancer cells. In this study, we identified a canine ortholog of the human mda-7/IL-24 gene located within a cluster of IL-10 family members on chromosome 7. The full-length mRNA sequence of canine mda-7 was determined, which encodes a 186-amino acid protein that has 66% similarity to human MDA-7/IL-24. Canine MDA-7 is constitutively expressed in cultured normal canine epidermal keratinocytes (NCEKs), and its expression levels are increased after lipopolysaccharide stimulation. In cultured NCEKs, the canine mda-7 pre-mRNA is differentially spliced, via exon skipping and alternate 5′-splice donor sites, to yield five splice variants (canine mda-7sv1, canine mda-7sv2, canine mda-7sv3, canine mda-7sv4 and canine mda-7sv5) that encode four protein isoforms of the canine MDA-7 protein. These protein isoforms have a conserved N-terminus (signal peptide sequence) and are dissimilar in amino acid sequences at their C-terminus. Canine MDA-7 is not expressed in primary canine tumor samples, and most tumor derived cancer cell lines tested, like its human counterpart. Unlike human MDA-7/IL-24, canine mda-7 mRNA is not expressed in unstimulated or lipopolysaccharide (LPS), concanavalin A (ConA) or phytohemagglutinin (PHA) stimulated canine peripheral blood mononuclear cells (PBMCs). Furthermore, in-silico analysis revealed that canonical canine MDA-7 has a potential 28 amino acid signal peptide sequence that can target it for active secretion. This data suggests that canine mda-7 is indeed an ortholog of human mda-7/IL-24, its protein product has high amino acid similarity to human MDA-7/IL-24 protein and it may possess similar biological properties to human MDA-7/IL-24, but its expression pattern is more restricted than its human ortholog. PMID:24865935

Expression pattern and function of tyrosine receptor kinase B isoforms in rat mesenteric arterial smooth muscle cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Otani, Kosuke; Okada, Muneyoshi; Yamawaki, Hideyuki, E-mail: yamawaki@vmas.kitasato-u.ac.jp

Tyrosine receptor kinaseB (TrkB) is a high affinity receptor for brain-derived neurotrophic factor (BDNF). TrkB isoforms involve full length TrkB (TrkB FL) and truncated TrkB type1 (TrkB T1) and type 2 (TrkB T2) in rats. The aim of present study was to explore their expression pattern and function in mesenteric arterial smooth muscle cells (MASMCs). The expression of TrkB isoform protein and mRNA was examined by Western blotting, immunofluorescence and quantitative RT-PCR analyses. Cell proliferation was measured by a bromodeoxyuridine (BrdU) incorporation assay. Cell migration was measured by a Boyden chamber assay. Cell morphology was observed with a phase-contrast microscope.more » Protein and mRNA expression of BDNF and TrkB isoforms was confirmed in MASMCs. Expression level of TrkB FL was less, while that of TrkB T1 was the highest in MASMCs. Although BDNF increased phosphorylation of ERK, it had no influence on migration and proliferation of MASMCs. TrkB T1 gene knockdown by a RNA interference induced morphological changes and reduced expression level of α-smooth muscle actin (α-SMA) in MASMCs. Similar morphological changes and reduced α-SMA expression were induced in MASMCs by a Rho kinase inhibitor, Y-27632. In conclusion, we for the first time demonstrate that TrkB T1 expressed highly in MASMCs contributes to maintain normal cell morphology possibly via regulation of Rho activity. This study firstly defined expression level of TrkB isoforms and partly revealed their functions in peripheral vascular cells. - Highlights: • BDNF-TrkB axis mediates neurogenesis, growth, differentiation and survival. • Expression pattern and function of TrkB in vascular smooth muscle remain unclear. • Expression of TrkB FL is low, while that of TrkB T1 is the highest. • TrkB T1 contributes to maintain normal morphology possibly via activating Rho.« less

BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

DOE PAGES

Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana; ...

2016-02-04

Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana

Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

Early Developmental and Evolutionary Origins of Gene Body DNA Methylation Patterns in Mammalian Placentas

PubMed Central

Schroeder, Diane I.; Jayashankar, Kartika; Douglas, Kory C.; Thirkill, Twanda L.; York, Daniel; Dickinson, Pete J.; Williams, Lawrence E.; Samollow, Paul B.; Ross, Pablo J.; Bannasch, Danika L.; Douglas, Gordon C.; LaSalle, Janine M.

2015-01-01

Over the last 20-80 million years the mammalian placenta has taken on a variety of morphologies through both divergent and convergent evolution. Recently we have shown that the human placenta genome has a unique epigenetic pattern of large partially methylated domains (PMDs) and highly methylated domains (HMDs) with gene body DNA methylation positively correlating with level of gene expression. In order to determine the evolutionary conservation of DNA methylation patterns and transcriptional regulatory programs in the placenta, we performed a genome-wide methylome (MethylC-seq) analysis of human, rhesus macaque, squirrel monkey, mouse, dog, horse, and cow placentas as well as opossum extraembryonic membrane. We found that, similar to human placenta, mammalian placentas and opossum extraembryonic membrane have globally lower levels of methylation compared to somatic tissues. Higher relative gene body methylation was the conserved feature across all mammalian placentas, despite differences in PMD/HMDs and absolute methylation levels. Specifically, higher methylation over the bodies of genes involved in mitosis, vesicle-mediated transport, protein phosphorylation, and chromatin modification was observed compared with the rest of the genome. As in human placenta, higher methylation is associated with higher gene expression and is predictive of genic location across species. Analysis of DNA methylation in oocytes and preimplantation embryos shows a conserved pattern of gene body methylation similar to the placenta. Intriguingly, mouse and cow oocytes and mouse early embryos have PMD/HMDs but their placentas do not, suggesting that PMD/HMDs are a feature of early preimplantation methylation patterns that become lost during placental development in some species and following implantation of the embryo. PMID:26241857

Tooth Morphogenesis and FGF4 Expression During Development of Molar Tooth in Three Muroid Rodents: Calomyscus elburzensis (Calomyscidae), Mesocricetus auratus (Cricetidae) and Mus musculus (Muridae).

PubMed

Hamidi, Kordiyeh; Darvish, Jamshid; Matin, Maryam M; Javanmard, Athar Sadat; Kilpatrick, C William

2017-12-01

To date, no studies have examined the tooth formation during developmental stages of brush-tailed mice (Calomyscidae) and true hamsters (Cricetidae). Herein, we compared the timing of tooth morphogenesis and FGF4 expression pattern during development of the first lower molar in Goodwin's brush-tailed mouse, Calomyscus elburzensis with two other muroid rodents; the house mouse, Mus musculus (Muridae), model organism for tooth morphogenesis, and the golden hamster, Mesocricetus auratus which shares great similarities in cusp pattern with brush-tailed mice. All three species were bred in captivity and developing embryos were isolated at different embryonic days (E). Histological evaluation of lower molars was performed and spatiotemporal pattern of FGF4 expression was determined by immunohistochemistry. Results indicated that morphogenesis of the tooth cusps starts at the beginning of the cap stage of the first lower molar (E14 in house mouse, about E11.5 in golden hamster and E22 in Goodwin's brush-tailed mouse). During the cap to bell stage (E15 in house mouse, E12 in golden hamster and at about E24 in Goodwin's brush-tailed mouse), a decrease in the expression of FGF4 was observed in the mesenchyme, except for the cusp tips. According to our observations, the developmental process of the first lower molar formation in Goodwin's brush-tailed mouse began much later as compared with the other two species. Despite the differences in the temporal pattern of molar development between these three members of the same superfamily (Muroidea), the correlation in the expression of FGF4 with specific stages of tooth morphogenesis supported its regulatory function. Anat Rec, 300:2138-2149, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Three Human Cell Types Respond to Multi-Walled Carbon Nanotubes and Titanium Dioxide Nanobelts with Cell-Specific Transcriptomic and Proteomic Expression Patterns.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tilton, Susan C.; Karin, Norman J.; Tolic, Ana

2014-08-01

The growing use of engineered nanoparticles (NPs) in commercial and medical applications raises the urgent need for tools that can predict NP toxicity. Global transcriptome and proteome analyses were conducted on three human cell types, exposed to two high aspect ratio NP types, to identify patterns of expression that might indicate high versus low NP toxicity. Three cell types representing the most common routes of human exposure to NPs, including macrophage-like (THP-1), small airway epithelial and intestinal (Caco-2/HT29-MTX) cells, were exposed to TiO2 nanobelts (TiO2-NB; high toxicity) and multi-walled carbon nanotubes (MWCNT; low toxicity) at low (10 µg/mL) and highmore » (100 µg/mL) concentrations for 1 and 24 h. Unique patterns of gene and protein expressions were identified for each cell type, with no differentially expressed (p < 0.05, 1.5-fold change) genes or proteins overlapping across all three cell types. While unique to each cell type, the early response was primarily independent of NP type, showing similar expression patterns in response to both TiO2-NB and MWCNT. The early response might, therefore, indicate a general response to insult. In contrast, the 24 h response was unique to each NP type. The most significantly (p < 0.05) enriched biological processes in THP-1 cells indicated TiO2-NB regulation of pathways associated with inflammation, apoptosis, cell cycle arrest, DNA replication stress and genomic instability, while MWCNT-regulated pathways indicated increased cell proliferation, DNA repair and anti-apoptosis. These two distinct sets of biological pathways might, therefore, underlie cellular responses to high and low NP toxicity, respectively.« less

Morphological "primary homology" and expression of AG-subfamily MADS-box genes in pines, podocarps, and yews.

PubMed

Englund, Marie; Carlsbecker, Annelie; Engström, Peter; Vergara-Silva, Francisco

2011-01-01

The morphological variation among reproductive organs of extant gymnosperms is remarkable, especially among conifers. Several hypotheses concerning morphological homology between various conifer reproductive organs have been put forward, in particular in relation to the pine ovuliferous scale. Here, we use the expression patterns of orthologs of the ABC-model MADS-box gene AGAMOUS (AG) for testing morphological homology hypotheses related to organs of the conifer female cone. To this end, we first developed a tailored 3'RACE procedure that allows reliable amplification of partial sequences highly similar to gymnosperm-derived members of the AG-subfamily of MADS-box genes. Expression patterns of two novel conifer AG orthologs cloned with this procedure-namely PodAG and TgAG, obtained from the podocarp Podocarpus reichei and the yew Taxus globosa, respectively-are then further characterized in the morphologically divergent female cones of these species. The expression patterns of PodAG and TgAG are compared with those of DAL2, a previously discovered Picea abies (Pinaceae) AG ortholog. By treating the expression patterns of DAL2, PodAG, and TgAG as character states mapped onto currently accepted cladogram topologies, we suggest that the epimatium-that is, the podocarp female cone organ previously postulated as a "modified" ovuliferous scale-and the canonical Pinaceae ovuliferous scale can be legitimally conceptualized as "primary homologs." Character state mapping for TgAG suggests in turn that the aril of Taxaceae should be considered as a different type of organ. This work demonstrates how the interaction between developmental-genetic data and formal cladistic theory could fruitfully contribute to gymnosperm systematics. © 2011 Wiley Periodicals, Inc.

Parallels between UNUSUAL FLORAL ORGANS and FIMBRIATA, genes controlling flower development in Arabidopsis and Antirrhinum.

PubMed

Ingram, G C; Goodrich, J; Wilkinson, M D; Simon, R; Haughn, G W; Coen, E S

1995-09-01

The unusual floral organs (ufo) mutant of Arabidopsis has flowers with variable homeotic organ transformations and inflorescence-like characteristics. To determine the relationship between UFO and previously characterized meristem and organ identity genes, we cloned UFO and determined its expression pattern. The UFO gene shows extensive homology with FIMBRIATA (FIM), a gene mediating between meristem and organ identity genes in Antirrhinum. All three UFO mutant alleles that we sequenced are predicted to produce truncated proteins. UFO transcripts were first detected in early floral meristems, before organ identity genes had been activated. At later developmental stages, UFO expression is restricted to the junction between sepal and petal primordia. Phenotypic, genetic, and expression pattern comparisons between UFO and FIM suggest that they are cognate homologs and play a similar role in mediating between meristem and organ identity genes. However, some differences in the functions and genetic interactions of UFO and FIM were apparent, indicating that changes in partially redundant pathways have occurred during the evolutionary divergence of Arabidopsis and Antirrhinum.

Emergence of the self-similar property in gene expression dynamics

NASA Astrophysics Data System (ADS)

Ochiai, T.; Nacher, J. C.; Akutsu, T.

2007-08-01

Many theoretical models have recently been proposed to understand the structure of cellular systems composed of various types of elements (e.g., proteins, metabolites and genes) and their interactions. However, the cell is a highly dynamic system with thousands of functional elements fluctuating across temporal states. Therefore, structural analysis alone is not sufficient to reproduce the cell's observed behavior. In this article, we analyze the gene expression dynamics (i.e., how the amount of mRNA molecules in cell fluctuate in time) by using a new constructive approach, which reveals a symmetry embedded in gene expression fluctuations and characterizes the dynamical equation of gene expression (i.e., a specific stochastic differential equation). First, by using experimental data of human and yeast gene expression time series, we found a symmetry in short-time transition probability from time t to time t+1. We call it self-similarity symmetry (i.e., the gene expression short-time fluctuations contain a repeating pattern of smaller and smaller parts that are like the whole, but different in size). Secondly, we reconstruct the global behavior of the observed distribution of gene expression (i.e., scaling-law) and the local behavior of the power-law tail of this distribution. This approach may represent a step forward toward an integrated image of the basic elements of the whole cell.

Transcriptomic variation of eyestalk reveals the genes and biological processes associated with molting in Portunus trituberculatus

PubMed Central

Zhang, Longtao; Liu, Ping; Li, Jian

2017-01-01

Background Molting is an essential biological process throughout the life history of crustaceans, which is regulated by many neuropeptide hormones expressed in the eyestalk. To better understand the molting mechanism in Portunus trituberculatus, we used digital gene expression (DGE) to analyze single eyestalk samples during the molting cycle by high-throughput sequencing. Results We obtained 14,387,942, 12,631,508 and 13,060,062 clean sequence reads from inter-molt (InM), pre-molt (PrM) and post-molt (PoM) cDNA libraries, respectively. A total of 1,394 molt-related differentially expressed genes (DEGs) were identified. GO and KEGG enrichment analysis identified some important processes and pathways with key roles in molting regulation, such as chitin metabolism, peptidase inhibitor activity, and the ribosome. We first observed a pattern associated with the neuromodulator-related pathways during the molting cycle, which were up-regulated in PrM and down-regulated in PoM. Four categories of important molting-related transcripts were clustered and most of them had similar expression patterns, which suggests that there is a connection between these genes throughout the molt cycle. Conclusion Our work is the first molt-related investigation of P. trituberculatus focusing on the eyestalk at the whole transcriptome level. Together, our results, including DEGs, identification of molting-related biological processes and pathways, and observed expression patterns of important genes, provide a novel insight into the function of the eyestalk in molting regulation. PMID:28394948

Conservation of Endo16 expression in sea urchins despite evolutionary divergence in both cis and trans-acting components of transcriptional regulation

NASA Technical Reports Server (NTRS)

Romano, Laura A.; Wray, Gregory A.

2003-01-01

Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.

Expression of the Maize Dof1 Transcription Factor in Wheat and Sorghum

PubMed Central

Peña, Pamela A.; Quach, Truyen; Sato, Shirley; Ge, Zhengxiang; Nersesian, Natalya; Changa, Taity; Dweikat, Ismail; Soundararajan, Madhavan; Clemente, Tom E.

2017-01-01

Nitrogen is essential for plant growth and development. Improving the ability of plants to acquire and assimilate nitrogen more efficiently is a key agronomic parameter that will augment sustainability in agriculture. A transcription factor approach was pursued to address improvement of nitrogen use efficiency in two major commodity crops. To this end, the Zea mays Dof1 (ZmDof1) transcription factor was expressed in both wheat (Triticum aestivum) and sorghum (Sorghum bicolor) either constitutively, UBI4 promoter from sugarcane, or in a tissue specific fashion via the maize rbcS1 promoter. The primary transcription activation target of ZmDof1, phosphoenolpyruvate carboxylase (PEPC), is observed in transgenic wheat events. Expression ZmDof1 under control of the rbcs1 promoter translates to increase in biomass and yield components in wheat. However, constitutive expression of ZmDof1 led to the down-regulation of genes involved in photosynthesis and the functional apparatus of chloroplasts, and an outcome that negatively impacts photosynthesis, height, and biomass in wheat. Similar patterns were also observed in sorghum transgenic events harboring the constitutive expression cassette of ZmDof1. These results indicate that transcription factor strategies to boost agronomic phenotypic outcomes in crops need to consider expression patterns of the genetic elements to be introduced. PMID:28424717

Gene expression characterizes different nutritional strategies among three mixotrophic protists.

PubMed

Liu, Zhenfeng; Campbell, Victoria; Heidelberg, Karla B; Caron, David A

2016-07-01

Mixotrophic protists, i.e. protists that can carry out both phototrophy and heterotrophy, are a group of organisms with a wide range of nutritional strategies. The ecological and biogeochemical importance of these species has recently been recognized. In this study, we investigated and compared the gene expression of three mixotrophic protists, Prymnesium parvum, Dinobyron sp. and Ochromonas sp. under light and dark conditions in the presence of prey using RNA-Seq. Gene expression of the obligately phototrophic P. parvum and Dinobryon sp. changed significantly between light and dark treatments, while that of primarily heterotrophic Ochromonas sp. was largely unchanged. Gene expression of P. parvum and Dinobryon sp. shared many similarities, especially in the expression patterns of genes related to reproduction. However, key genes involved in central carbon metabolism and phagotrophy had different expression patterns between these two species, suggesting differences in prey consumption and heterotrophic nutrition in the dark. Transcriptomic data also offered clues to other physiological traits of these organisms such as preference of nitrogen sources and photo-oxidative stress. These results provide potential target genes for further exploration of the mechanisms of mixotrophic physiology and demonstrate the potential usefulness of molecular approaches in characterizing the nutritional modes of mixotrophic protists. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

De novo analysis of the Nilaparvata lugens (Stål) antenna transcriptome and expression patterns of olfactory genes.

PubMed

Zhou, Shuang-Shuang; Sun, Ze; Ma, Weihua; Chen, Wei; Wang, Man-Qun

2014-03-01

We sequenced the antenna transcriptome of the brown planthopper (BPH), Nilaparvata lugens (Stål), a global rice pest, and performed transcriptome analysis on BPH antenna. We obtained about 40million 90bp reads that were assembled into 75,874 unigenes with a mean size of 456bp. Among the antenna transcripts, 32,856 (43%) showed significant similarity (E-value <1e(-5)) to known proteins in the NCBI database. Gene ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) analyses were used to classify functions of BPH antenna genes. We identified 10 odorant-binding proteins (OBPs), including 7 previously unidentified, and 11 chemosensory proteins (CSPs), including two new members. The expression profiles of 4 OBPs and 2 CSPs were determined by q-PCR for antenna, abdomen, leg and wing of insects of different age, gender, and mating status including two BPH adult wing-morphology types. NlugCSP10 and 4 OBPs appeared to be antenna-specific because they were highly and differentially expressed in male and female antennae. NlugCSP11 was expressed ubiquitously, with particularly high expression in wings. The transcript levels of several olfactory genes depended on adult wing form, age, gender, and mating status, although no clear expression patterns were determined. Copyright © 2013 Elsevier Inc. All rights reserved.

Characterization of Cer-1 cis-regulatory region during early Xenopus development.

PubMed

Silva, Ana Cristina; Filipe, Mário; Steinbeisser, Herbert; Belo, José António

2011-05-01

Cerberus-related molecules are well-known Wnt, Nodal, and BMP inhibitors that have been implicated in different processes including anterior–posterior patterning and left–right asymmetry. In both mouse and frog, two Cerberus-related genes have been isolated, mCer-1 and mCer-2, and Xcer and Xcoco, respectively. Until now, little is known about the mechanisms involved in their transcriptional regulation. Here, we report a heterologous analysis of the mouse Cerberus-1 gene upstream regulatory regions, responsible for its expression in the visceral endodermal cells. Our analysis showed that the consensus sequences for a TATA, CAAT, or GC boxes were absent but a TGTGG sequence was present at position -172 to -168 bp, relative to the ATG. Using a series of deletion constructs and transient expression in Xenopus embryos, we found that a fragment of 1.4 kb of Cer-1 promoter sequence could reproduce the endogenous expression pattern of Xenopus cerberus. A 0.7-kb mcer-1 upstream region was able to drive reporter expression to the involuting mesendodermal cells, while further deletions abolished reporter gene expression. Our results suggest that although no sequence similarity was found between mouse and Xenopus cerberus cis-regulatory regions, the signaling cascades regulating cerberus expression, during gastrulation, is conserved.

Cytokine mRNA expression in normal skin of various age populations before and after engraftment onto nude mice.

PubMed

Gilhar, A; Ullmann, Y; Shalagino, R; Weisinger, G

1998-01-01

Whether the impact of skin biological age on cytokine expression is a result of this tissue's proliferation potential or not is an important issue in dermatology. We investigated these questions by monitoring cytokine marker mRNA expression from human skin samples from healthy groups of individuals. The skin samples studied represented three age groups: fetal (17-21 weeks), young (18-35 years) and aged (76-88 years). Furthermore, upon skin transplantation of tissue from different age groups onto nude mice, we investigated whether cytokine marker RNA levels would change or normalize. Interestingly, both TNF-alpha and P53 mRNA showed a similar pattern of expression. Both were significantly higher in fetal skin (p < 0.0001 and p < 0.05, respectively), and no difference was noted between aged versus young skin. In contrast to this, IL1-alpha mRNA was expressed at its lowest and highest levels in fetal and young skin, respectively. Following skin transplantation, cytokines and P53 mRNA expression were normalized to similar levels in all age groups. This study implies that when cytokine expression was determined directly at the mRNA level, post-natal expression was not significantly different at either age group. Furthermore, it seems that the environmental conditions surrounding the grafted human skin found on nude mice encouraged normalization of donor cytokine expression.

AAV vector-mediated secretion of chondroitinase provides a sensitive tracer for axonal arborisations.

PubMed

Alves, João Nuno; Muir, Elizabeth M; Andrews, Melissa R; Ward, Anneliese; Michelmore, Nicholas; Dasgupta, Debayan; Verhaagen, Joost; Moloney, Elizabeth B; Keynes, Roger J; Fawcett, James W; Rogers, John H

2014-04-30

As part of a project to express chondroitinase ABC (ChABC) in neurons of the central nervous system, we have inserted a modified ChABC gene into an adeno-associated viral (AAV) vector and injected it into the vibrissal motor cortex in adult rats to determine the extent and distribution of expression of the enzyme. A similar vector for expression of green fluorescent protein (GFP) was injected into the same location. For each vector, two versions with minor differences were used, giving similar results. After 4 weeks, the brains were stained to show GFP and products of chondroitinase digestion. Chondroitinase was widely expressed, and the AAV-ChABC and AAV-GFP vectors gave similar expression patterns in many respects, consistent with the known projections from the directly transduced neurons in vibrissal motor cortex and adjacent cingulate cortex. In addition, diffusion of vector to deeper neuronal populations led to labelling of remote projection fields which was much more extensive with AAV-ChABC than with AAV-GFP. The most notable of these populations are inferred to be neurons of cortical layer 6, projecting widely in the thalamus, and neurons of the anterior pole of the hippocampus, projecting through most of the hippocampus. We conclude that, whereas GFP does not label the thinnest axonal branches of some neuronal types, chondroitinase is efficiently secreted from these arborisations and enables their extent to be sensitively visualised. After 12 weeks, chondroitinase expression was undiminished. Copyright © 2014 Elsevier B.V. All rights reserved.

TRANSCRIPTIONAL PROFILES FOR GLUTAMATE TRANSPORTERS REVEAL DIFFERENCES BETWEEN ORGANOPHOSPHATES BUT SIMILARITIES WITH UNRELATED NEUROTOXICANTS

PubMed Central

Slotkin, Theodore A.; Lobner, Doug; Seidler, Frederic J.

2010-01-01

The developmental neurotoxicity of organophosphates involves mechanisms other than their shared property as cholinesterase inhibitors, among which are excitotoxicity and oxidative stress. We used PC12 cells as a neurodevelopmental model to compare the effects of chlorpyrifos and diazinon on the expression of genes encoding glutamate transporters. Chlorpyrifos had a greater effect in cells undergoing nerve growth factor-induced neurodifferentiation as compared to undifferentiated PC12 cells, with peak sensitivity at the initiation of differentiation, reflecting a global upregulation of all the glutamate transporter genes expressed in this cell line. In differentiating cells, chlorpyrifos had a significantly greater effect than did diazinon and concordance analysis indicated no resemblance in their expression patterns. At the same time, the smaller effects of diazinon were highly concordant with those of an organochlorine pesticide (dieldrin) and a metal (divalent nickel). We also performed similar evaluations for the cystine/glutamate exchanger, which provides protection against oxidative stress by moving cystine into the cell; again, chlorpyrifos had the greatest effect, in this case reducing expression in undifferentiated and differentiating cells. Our results point to excitotoxicity and oxidative stress as major contributors to the noncholinesterase mechanisms that distinguish the neurodevelopmental outcomes betweem different organophosphates while providing a means whereby apparently unrelated neurotoxicants may produce similar outcomes. PMID:20600679

Sex differences in autism: a resting-state fMRI investigation of functional brain connectivity in males and females.

PubMed

Alaerts, Kaat; Swinnen, Stephan P; Wenderoth, Nicole

2016-06-01

Autism spectrum disorders (ASD) are far more prevalent in males than in females. Little is known however about the differential neural expression of ASD in males and females. We used a resting-state fMRI-dataset comprising 42 males/42 females with ASD and 75 male/75 female typical-controls to examine whether autism-related alterations in intrinsic functional connectivity are similar or different in males and females, and particularly whether alterations reflect 'neural masculinization', as predicted by the Extreme Male Brain theory. Males and females showed a differential neural expression of ASD, characterized by highly consistent patterns of hypo-connectivity in males with ASD (compared to typical males), and hyper-connectivity in females with ASD (compared to typical females). Interestingly, patterns of hyper-connectivity in females with ASD reflected a shift towards the (high) connectivity levels seen in typical males (neural masculinization), whereas patterns of hypo-connectivity observed in males with ASD reflected a shift towards the (low) typical feminine connectivity patterns (neural feminization). Our data support the notion that ASD is a disorder of sexual differentiation rather than a disorder characterized by masculinization in both genders. Future work is needed to identify underlying factors such as sex hormonal alterations that drive these sex-specific neural expressions of ASD. © The Author (2016). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

T cell source of type 1 cytokines determines illness patterns in respiratory syncytial virus-infected mice.

PubMed Central

Tang, Y. W.; Graham, B. S.

1997-01-01

Manipulation of the cytokine microenvironment at the time of vaccination can influence immune responses to remote challenge, providing a strategy to study the molecular pathogenesis of respiratory syncytial virus (RSV) vaccine-enhanced disease in the mouse model. Although treatment with antibody against IL-4 or recombinant IL-12 (rIL-12) at the time of formalin-inactivated RSV vaccination induced a similar shift in the pattern of cytokine mRNA expression upon live virus challenge, anti-IL-4 treated mice had increased CD8+ cytotoxic T lymphocyte activity and reduced illness compared with rIL-12-treated mice. To define effector mechanisms responsible for these patterns, CD4+ and/or CD8+ T lymphocytes were selectively depleted in vivo at the time of RSV challenge. In rIL-12-treated mice, CD4+ lymphocytes made the largest contribution to IFN-gamma mRNA, RSV clearance, and illness, while in anti-IL-4 treated mice, CD8+ lymphocytes were the major effector. The effector responsible for virus clearance also mediated illness, suggesting that efficiency of virus clearance determined disease expression. These results demonstrate that the phenotype of effector cells involved in the immune response to virus challenge may be a more important determinant of disease than patterns of cytokine expression classically assigned to Th1 and Th2 lymphocytes. PMID:9151790

Investigating the Role of Surface Materials and Three Dimensional Architecture on In Vitro Differentiation of Porcine Monocyte-Derived Dendritic Cells

PubMed Central

Hartmann, Sofie Bruun; Mohanty, Soumyaranjan; Skovgaard, Kerstin; Brogaard, Louise; Flagstad, Frederikke Bjergvang; Emnéus, Jenny; Wolff, Anders; Summerfield, Artur; Jungersen, Gregers

2016-01-01

In vitro generation of dendritic-like cells through differentiation of peripheral blood monocytes is typically done using two-dimensional polystyrene culture plates. In the process of optimising cell culture techniques, engineers have developed fluidic micro-devises usually manufactured in materials other than polystyrene and applying three-dimensional structures more similar to the in vivo environment. Polydimethylsiloxane (PDMS) is an often used polymer for lab-on-a-chip devices but not much is known about the effect of changing the culture surface material from polystyrene to PDMS. In the present study the differentiation of porcine monocytes to monocyte-derived dendritic cells (moDCs) was investigated using CD172apos pig blood monocytes stimulated with GM-CSF and IL-4. Monocytes were cultured on surfaces made of two- and three-dimensional polystyrene as well as two- and three-dimensional PDMS and carbonised three-dimensional PDMS. Cells cultured conventionally (on two-dimensional polystyrene) differentiated into moDCs as expected. Interestingly, gene expression of a wide range of cytokines, chemokines, and pattern recognition receptors was influenced by culture surface material and architecture. Distinct clustering of cells, based on similar expression patterns of 46 genes of interest, was seen for cells isolated from two- and three-dimensional polystyrene as well as two- and three-dimensional PDMS. Changing the material from polystyrene to PDMS resulted in cells with expression patterns usually associated with macrophage expression (upregulation of CD163 and downregulation of CD1a, FLT3, LAMP3 and BATF3). However, this was purely based on gene expression level, and no functional assays were included in this study which would be necessary in order to classify the cells as being macrophages. When changing to three-dimensional culture the cells became increasingly activated in terms of IL6, IL8, IL10 and CCR5 gene expression. Further stimulation with LPS resulted in a slight increase in the expression of maturation markers (SLA-DRB1, CD86 and CD40) as well as cytokines (IL6, IL8, IL10 and IL23A) but the influence of the surfaces was unchanged. These findings highlights future challenges of combining and comparing data generated from microfluidic cell culture-devices made using alternative materials to data generated using conventional polystyrene plates used by most laboratories today. PMID:27362493

Investigating the Role of Surface Materials and Three Dimensional Architecture on In Vitro Differentiation of Porcine Monocyte-Derived Dendritic Cells.

PubMed

Hartmann, Sofie Bruun; Mohanty, Soumyaranjan; Skovgaard, Kerstin; Brogaard, Louise; Flagstad, Frederikke Bjergvang; Emnéus, Jenny; Wolff, Anders; Summerfield, Artur; Jungersen, Gregers

2016-01-01

In vitro generation of dendritic-like cells through differentiation of peripheral blood monocytes is typically done using two-dimensional polystyrene culture plates. In the process of optimising cell culture techniques, engineers have developed fluidic micro-devises usually manufactured in materials other than polystyrene and applying three-dimensional structures more similar to the in vivo environment. Polydimethylsiloxane (PDMS) is an often used polymer for lab-on-a-chip devices but not much is known about the effect of changing the culture surface material from polystyrene to PDMS. In the present study the differentiation of porcine monocytes to monocyte-derived dendritic cells (moDCs) was investigated using CD172apos pig blood monocytes stimulated with GM-CSF and IL-4. Monocytes were cultured on surfaces made of two- and three-dimensional polystyrene as well as two- and three-dimensional PDMS and carbonised three-dimensional PDMS. Cells cultured conventionally (on two-dimensional polystyrene) differentiated into moDCs as expected. Interestingly, gene expression of a wide range of cytokines, chemokines, and pattern recognition receptors was influenced by culture surface material and architecture. Distinct clustering of cells, based on similar expression patterns of 46 genes of interest, was seen for cells isolated from two- and three-dimensional polystyrene as well as two- and three-dimensional PDMS. Changing the material from polystyrene to PDMS resulted in cells with expression patterns usually associated with macrophage expression (upregulation of CD163 and downregulation of CD1a, FLT3, LAMP3 and BATF3). However, this was purely based on gene expression level, and no functional assays were included in this study which would be necessary in order to classify the cells as being macrophages. When changing to three-dimensional culture the cells became increasingly activated in terms of IL6, IL8, IL10 and CCR5 gene expression. Further stimulation with LPS resulted in a slight increase in the expression of maturation markers (SLA-DRB1, CD86 and CD40) as well as cytokines (IL6, IL8, IL10 and IL23A) but the influence of the surfaces was unchanged. These findings highlights future challenges of combining and comparing data generated from microfluidic cell culture-devices made using alternative materials to data generated using conventional polystyrene plates used by most laboratories today.

T-lymphocyte cytokine mRNA expression in cystic echinococcosis.

PubMed

Fauser, S; Kern, P

1997-04-01

In the present study we investigated cytokine mRNA expression by peripheral blood mononuclear cells (PBMC) from patients with cystic echinococcosis (CE) after stimulation with different antigens. By using reverse transcriptase polymerase chain reaction (RT-PCR) we could demonstrate that restimulation with crude Echinococcus granulosus antigen (Eg-Ag) induced or enhanced Th2 cytokine mRNA expression, especially IL-5 (by using antigen from sheep cyst fluid) in 23 out of 26 investigated CE patients and IL-10 (by using antigen from camel cyst fluid) in 10 out of 10 investigated CE patients. In contrast, IL-5 mRNA expression was absent in PBMC of healthy controls after Eg-Ag stimulation. To determine the specificity of this reaction we stimulated PBMC from 11 CE patients with crude Echinococcus multilocularis antigen (Em-Ag) and PBMC from 8 CE patients with Toxocara canis antigen (Tc-Ag). We found that the PBMC of patients showed a similar mRNA cytokine pattern on stimulation with Em-Ag when compared with Eg-Ag stimulation. The cytokine mRNA pattern on stimulation with Tc-Ag, however, resembled the cytokine mRNA pattern of unstimulated PBMC. Furthermore, the stimulation of PBMC with crude Mycobacterium tuberculosis antigen (H37Ra) and purified protein derivative (PPD) of M. tuberculosis revealed distinct IL-5 mRNA expression in all investigated CE patients, whereas in healthy controls IL-5 mRNA expression was very weak or totally absent. Thus, our results indicate an induction of Th2 cytokine mRNA expression in CE patients, which is frequently observed in parasite infections. Interestingly, this response persists after stimulation with tuberculosis antigens, which normally induce Th1 response.

Hypoxia regulates microRNA expression in the human carotid body

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mkrtchian, Souren, E-mail: souren.mkrtchian@ki.se; Lee, Kian Leong, E-mail: csilkl@nus.edu.sg; Kåhlin, Jessica

The carotid body (CB) is the key sensing organ for physiological oxygen levels in the body. Under conditions of low oxygen (hypoxia), the CB plays crucial roles in signaling to the cardiorespiratory center in the medulla oblongata for the restoration of oxygen homeostasis. How hypoxia regulates gene expression in the human CB remains poorly understood. While limited information on transcriptional regulation in animal CBs is available, the identity and impact of important post-transcriptional regulators such as non-coding RNAs, and in particular miRNAs are not known. Here we show using ex vivo experiments that indeed a number of miRNAs are differentiallymore » regulated in surgically removed human CB slices when acute hypoxic conditions were applied. Analysis of the hypoxia-regulated miRNAs shows that they target biological pathways with upregulation of functions related to cell proliferation and immune response and downregulation of cell differentiation and cell death functions. Comparative analysis of the human CB miRNAome with the global miRNA expression patterns of a large number of different human tissues showed that the CB miRNAome had a unique profile which reflects its highly specialized functional status. Nevertheless, the human CB miRNAome is most closely related to the miRNA expression pattern of brain tissues indicating that they may have the most similar developmental origins. - Highlights: • Hypoxia triggers differential expression of many miRNAs in the human carotid body. • This can lead to the upregulation of proliferation and immune response functions. • CB expression profile in the carotid body resembles the miRNA expression pattern in the brain. • miRNAs are involved in the regulation of carotid body functions including oxygen sensing.« less

The relative expression levels of insulin-like growth factor 1 and myostatin mRNA in the asynchronous development of skeletal muscle in ducks during early development.

PubMed

Hu, Yan; Liu, Hongxiang; Shan, Yanju; Ji, Gaige; Xu, Wenjuan; Shu, Jingting; Li, Huifang

2015-08-10

Genetic selection is a powerful tool for modifying poultry muscle yield. Insulin-like growth factor I (IGF-I) and myostatin (MSTN) are important regulators of muscle growth, especially in the myogenesis stage. This study compared the developmental pattern of the pectoralis major (PM) and lateral gastrocnemius (LM) muscles, mRNA expression characterization of IGF-I and MSTN-A and their correlation between 14 days in ovo and 1 week post-hatch in two Chinese local duck breeds. During early development, the growth of duck PM and LM followed an asynchronous pattern. Variations in PM growth rate observed with development followed the relative variations of MSTN and IGF-I expression; however, the same behavior was not observed in LM. Moreover, the profile of IGF-I expression in duck skeletal muscles indicated that genetic selection for high meat-yield poultry has altered the temporal expression of IGF-I and affected cellular characteristics and mass by hatch in a PM-specific manner. The MSTN-A expression profile showed synchronization with the growth of skeletal muscle and peaks of myofiber proliferation. The expression patterns of IGF-I and MSTN suggest that duck pectoralis fibers are prioritized for proliferation in embryogenesis. The IGF-1/MSTN-A mRNA ratios in PM and LM presented very similar trends in the changes of myofiber characteristics, and differences in the IGF-1/MSTN-A mRNA ratio in PM between the two breeds corresponded to the timing of differences in PM mass between the varieties. Our results support the hypothesis that relative levels of IGF-I and MSTN mRNA may participate in ordering muscle growth rates with selected development. Copyright © 2015 Elsevier B.V. All rights reserved.

Identification of Temporal and Region-Specific Myocardial Gene Expression Patterns in Response to Infarction in Swine

PubMed Central

Nonell, Lara; Puigdecanet, Eulàlia; Astier, Laura; Solé, Francesc; Bayes-Genis, Antoni

2013-01-01

Molecular mechanisms associated with pathophysiological changes in ventricular remodelling due to myocardial infarction (MI) remain poorly understood. We analyzed changes in gene expression by microarray technology in porcine myocardial tissue at 1, 4, and 6 weeks post-MI. MI was induced by coronary artery ligation in 9 female pigs (30–40 kg). Animals were randomly sacrificed at 1, 4, or 6 weeks post-MI (n = 3 per group) and 3 healthy animals were also included as control group. Total RNA from myocardial samples was hybridized to GeneChip® Porcine Genome Arrays. Functional analysis was obtained with the Ingenuity Pathway Analysis (IPA) online tool. Validation of microarray data was performed by quantitative real-time PCR (qRT-PCR). More than 8,000 different probe sets showed altered expression in the remodelling myocardium at 1, 4, or 6 weeks post-MI. Ninety-seven percent of altered transcripts were detected in the infarct core and 255 probe sets were differentially expressed in the remote myocardium. Functional analysis revealed 28 genes de-regulated in the remote myocardial region in at least one of the three temporal analyzed stages, including genes associated with heart failure (HF), systemic sclerosis and coronary artery disease. In the infarct core tissue, eight major time-dependent gene expression patterns were recognized among 4,221 probe sets commonly altered over time. Altered gene expression of ACVR2B, BID, BMP2, BMPR1A, LMNA, NFKBIA, SMAD1, TGFB3, TNFRSF1A, and TP53 were further validated. The clustering of similar expression patterns for gene products with related function revealed molecular footprints, some of them described for the first time, which elucidate changes in biological processes at different stages after MI. PMID:23372767

Clinicopathological significance and prognostic value of myoinvasive patterns in endometrial endometrioid carcinoma.

PubMed

Amălinei, Cornelia; Aignătoaei, Anda Maria; Balan, Raluca Anca; Giuşcă, Simona Eliza; Lozneanu, Ludmila; Avădănei, Elena Roxana; Căruntu, Irina Draga

2018-01-01

Endometrioid endometrial carcinoma has an overall good prognosis. However, variable five-year survival rates (92%-42%) have been reported in FIGO stage I, suggesting the involvement of other factors related to tumor biological behavior. These may be related to the role played by epithelial-mesenchymal transition (EMT) and cancer stem cells in endometrial carcinogenesis. In this context, our review highlights the prognostic significance of several types of myoinvasion in low grade, low stage endometrioid endometrial carcinoma, as a reflection of these molecular changes at the invasive front. According to recently introduced myoinvasive patterns, the diffusely infiltrating and microcystic, elongated, and fragmented (MELF) patterns show loss of hormone receptors, along with EMT and high expression of cancer stem cell markers, being associated with a poor prognosis. Additionally, MELF pattern exhibits a high incidence of lymphovascular invasion and lymph node metastases. Conversely, the broad front pattern has a good prognosis and a low expression of EMT and stem cells markers. Similarly, the adenomyosis (AM)-like and adenoma malignum patterns of invasion are associated to a favorable prognosis, but nevertheless, they raise diagnostic challenges. AM-like pattern must be differentiated from carcinoma invasion of AM foci, while adenoma malignum pattern creates difficulties in appreciating the depth of myoinvasion and requires differential diagnosis with other conditions. Another pattern expecting its validation and prognostic significance value is the nodular fasciitis-like stroma and large cystic growth pattern. In practice, the knowledge of these patterns of myoinvasion may be valuable for the correct assessment of stage, may improve prognosis evaluation and may help identify molecules for future targeted therapies.

Expression pattern of NMDA receptors reveals antiepileptic potential of apigenin 8-C-glucoside and chlorogenic acid in pilocarpine induced epileptic mice.

PubMed

Aseervatham, G Smilin Bell; Suryakala, U; Doulethunisha; Sundaram, S; Bose, P Chandra; Sivasudha, T

2016-08-01

The present study was aimed to evaluate the effect of apigenin 8-C-glucoside (Vitexin) and chlorogenic acid on epileptic mice induced by pilocarpine and explored its possible mechanisms. Intraperitonial administration of pilocarpine (85mg/kg) induced seizure in mice was assessed by behavior observations, which is significantly (p>0.05) reduced by apigenin 8-C-glucoside (AP8CG) (10mg/kg) and chlorogenic acid (CA) (5mg/kg), similar to diazepam. Seizure was accompanied by an imbalance in the levels of Gamma-aminobutyric acid (GABA) and glutamate in the pilocarpine administered group. Moreover, convulsion along with reduced acetylcholinesterase, increased monoamine oxidase and oxidative stress was observed in epileptic mice brain. AP8CG and CA significantly restored back to normal levels even at lower doses. Further, increased lipid peroxidation and nitrite content was also significantly attenuated by AP8CG and CA. However, CA was found to be more effective when compared to AP8CG. In addition, the mRNA expression of N-methyl-d-aspartate receptor (NMDAR), mGluR1 and mGlu5 was significantly (P≤0.05) inhibited by AP8CG and CA in a lower dose. The mRNA expression of GRIK1 did not differ significantly in any of the group and showed a similar pattern of expression. Our result shows that AP8CG and CA selectively inhibit NMDAR, mGluR1 and mGlu5 expression. Modification in the provoked NMDAR calcium response coupled with neuronal death. Hence, these findings underline that the polyphenolics, AP8CG and CA have exerted antiepileptic and neuroprotective activity by suppressing glutamate receptors. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Characterization and Comparative Profiling of MiRNA Transcriptomes in Bighead Carp and Silver Carp

PubMed Central

Chi, Wei; Tong, Chaobo; Gan, Xiaoni; He, Shunping

2011-01-01

MicroRNAs (miRNAs) are small non-coding RNA molecules that are processed from large ‘hairpin’ precursors and function as post-transcriptional regulators of target genes. Although many individual miRNAs have recently been extensively studied, there has been very little research on miRNA transcriptomes in teleost fishes. By using high throughput sequencing technology, we have identified 167 and 166 conserved miRNAs (belonging to 108 families) in bighead carp (Hypophthalmichthys nobilis) and silver carp (Hypophthalmichthys molitrix), respectively. We compared the expression patterns of conserved miRNAs by means of hierarchical clustering analysis and log2 ratio. Results indicated that there is not a strong correlation between sequence conservation and expression conservation, most of these miRNAs have similar expression patterns. However, high expression differences were also identified for several individual miRNAs. Several miRNA* sequences were also found in our dataset and some of them may have regulatory functions. Two computational strategies were used to identify novel miRNAs from un-annotated data in the two carps. A first strategy based on zebrafish genome, identified 8 and 22 novel miRNAs in bighead carp and silver carp, respectively. We postulate that these miRNAs should also exist in the zebrafish, but the methodologies used have not allowed for their detection. In the second strategy we obtained several carp-specific miRNAs, 31 in bighead carp and 32 in silver carp, which showed low expression. Gain and loss of family members were observed in several miRNA families, which suggests that duplication of animal miRNA genes may occur through evolutionary processes which are similar to the protein-coding genes. PMID:21858165

APETALA2 like genes from Picea abies show functional similarities to their Arabidopsis homologues.

PubMed

Nilsson, Lars; Carlsbecker, Annelie; Sundås-Larsson, Annika; Vahala, Tiina

2007-02-01

In angiosperm flower development the identity of the floral organs is determined by the A, B and C factors. Here we present the characterisation of three homologues of the A class gene APETALA2 (AP2) from the conifer Picea abies (Norway spruce), Picea abies APETALA2 LIKE1 (PaAP2L1), PaAP2L2 and PaAP2L3. Similar to AP2 these genes contain sequence motifs complementary to miRNA172 that has been shown to regulate AP2 in Arabidopsis. The genes display distinct expression patterns during plant development; in the female-cone bud PaAP2L1 and PaAP2L3 are expressed in the seed-bearing ovuliferous scale in a pattern complementary to each other, and overlapping with the expression of the C class-related gene DAL2. To study the function of PaAP2L1 and PaAP2L2 the genes were expressed in Arabidopsis. The transgenic PaAP2L2 plants were stunted and flowered later than control plants. Flowers were indeterminate and produced an excess of floral organs most severely in the two inner whorls, associated with an ectopic expression of the meristem-regulating gene WUSCHEL. No homeotic changes in floral-organ identities occurred, but in the ap2-1 mutant background PaAP2L2 was able to promote petal identity, indicating that the spruce AP2 gene has the capacity to substitute for an A class gene in Arabidopsis. In spite of the long evolutionary distance between angiosperms and gymnosperms and the fact that gymnosperms lack structures homologous to sepals and petals our data supports a functional conservation of AP2 genes among the seed plants.

Effects of natural mineral-rich water consumption on the expression of sirtuin 1 and angiogenic factors in the erectile tissue of rats with fructose-induced metabolic syndrome

PubMed Central

Pereira, Cidália D; Severo, Milton; Rafael, Luísa; Martins, Maria João; Neves, Delminda

2014-01-01

Consuming a high-fructose diet induces metabolic syndrome (MS)-like features, including endothelial dysfunction. Erectile dysfunction is an early manifestation of endothelial dysfunction and systemic vascular disease. Because mineral deficiency intensifies the deleterious effects of fructose consumption and mineral ingestion is protective against MS, we aimed to characterize the effects of 8 weeks of natural mineral-rich water consumption on the structural organization and expression of vascular growth factors and receptors on the corpus cavernosum (CC) in 10% fructose-fed Sprague-Dawley rats (FRUCT). Differences were not observed in the organization of the CC either on the expression of vascular endothelial growth factor (VEGF) or the components of the angiopoietins/Tie2 system. However, opposing expression patterns were observed for VEGF receptors (an increase and a decrease for VEGFR1 and VEGFR2, respectively) in FRUCT animals, with these patterns being strengthened by mineral-rich water ingestion. Mineral-rich water ingestion (FRUCTMIN) increased the proportion of smooth muscle cells compared with FRUCT rats and induced an upregulatory tendency of sirtuin 1 expression compared with the control and FRUCT groups. Western blot results were consistent with the dual immunofluorescence evaluation. Plasma oxidized low-density lipoprotein and plasma testosterone levels were similar among the experimental groups, although a tendency for an increase in the former was observed in the FRUCTMIN group. The mineral-rich water-treated rats presented changes similar to those observed in rats treated with MS-protective polyphenol-rich beverages or subjected to energy restriction, which led us to hypothesize that the effects of mineral-rich water consumption may be more vast than those directly observed in this study. PMID:24625878

Effect of Ppd-1 on the expression of flowering-time genes in vegetative and reproductive growth stages of wheat.

PubMed

Kitagawa, Satoshi; Shimada, Sanae; Murai, Koji

2012-01-01

The photoperiod sensitivity gene Ppd-1 influences the timing of flowering in temperate cereals such as wheat and barley. The effect of Ppd-1 on the expression of flowering-time genes was assessed by examining the expression levels of the vernalization genes VRN1 and VRN3/WFT and of two CONSTANS-like genes, WCO1 and TaHd1, during vegetative and reproductive growth stages. Two near-isogenic lines (NILs) were used: the first carried a photoperiod-insensitive allele of Ppd-1 (Ppd-1a-NIL), the other, a photoperiod-sensitive allele (Ppd-1b-NIL). We found that the expression pattern of VRN1 was similar in Ppd-1a-NIL and Ppd-1b-NIL plants, suggesting that VRN1 is not regulated by Ppd-1. Under long day conditions, VRN3/WFT showed similar expression patterns in Ppd-1a-NIL and Ppd-1b-NIL plants. However, expression differed greatly under short day conditions: VRN3/WFT expression was detected in Ppd-1a-NIL plants at the 5-leaf stage when they transited from vegetative to reproductive growth; very low expression was present in Ppd-1b-NIL throughout all growth stages. Thus, the Ppd-1b allele acts to down-regulate VRN3/WFT under short day conditions. WCO1 showed high levels of expression at the vegetative stage, which decreased during the phase transition and reproductive growth stages in both Ppd-1a-NIL and Ppd-1b-NIL plants under short day conditions. By contrast to WCO1, TaHd1 was up-regulated during the reproductive stage. The level of TaHd1 expression was much higher in Ppd-1a-NIL than the Ppd-1b-NIL plants, suggesting that the Ppd-1b allele down-regulates TaHd1 under short day conditions. The present study indicates that down-regulation of VRN3/WFT together with TaHd1 is the cause of late flowering in the Ppd-1b-NIL plants under short day conditions.

Enc1 expression in the chick telencephalon at intermediate and late stages of development.

PubMed

García-Calero, Elena; Puelles, Luis

2009-12-10

In this work we studied the regional expression pattern of the Enc1 gene in the chick embryo telencephalon at intermediate and late stages of development, bearing on architectonic groupings and boundaries of current interest. In general, the Enc1 signal shows a markedly heterogeneous areal pattern of expression throughout the telencephalon; this corroborates data on new pallial and subpallial structures defined recently in the stereotaxic chick brain atlas of Puelles et al. (2007. The chick brain in stereotaxic coodinates. San Diego, CA: Academic Press). For example: a periventricular/central domain is Enc1-negative in the ventral pallium or nidopallium; core and shell nuclei appear in the mesopallium; the redefined caudodorsolateral area shows a characteristic pattern; the limits of the densocellular hyperpallium in the dorsal pallium are illuminated; and the postulated entorhinal cortex area is distinct at the posterior telencephalic pole. Interestingly, Enc1 transcripts are distinctly present in the piriform cortex at the surface of the ventral pallium throughout its longitudinal extent, as well as in the most rostral part of the lateral pallium, implying a layout of this cortex more similar to the situation in mammals than was assumed previously. Separate corticoid superficial strata are labeled by the Enc1 probe in the lateral and dorsal pallial regions. In the subpallium, the expression of Enc1 agrees with the new radial subdivisions defined by Puelles et al. (2007).

Decreased capacity of recombinant 45/47-kDa molecules (Apa) of Mycobacterium tuberculosis to stimulate T lymphocyte responses related to changes in their mannosylation pattern.

PubMed

Horn, C; Namane, A; Pescher, P; Rivière, M; Romain, F; Puzo, G; Bârzu, O; Marchal, G

1999-11-05

The Apa molecules secreted by Mycobacterium tuberculosis, Mycobacterium bovis, or BCG have been identified as major immunodominant antigens. Mass spectrometry analysis indicated similar mannosylation, a complete pattern from 1 up to 9 hexose residues/mole of protein, of the native species from the 3 reference strains. The recombinant antigen expressed in M. smegmatis revealed a different mannosylation pattern: species containing 7 to 9 sugar residues/mole of protein were in the highest proportion, whereas species bearing a low number of sugar residues were almost absent. The 45/47-kDa recombinant antigen expressed in E. coli was devoid of sugar residues. The proteins purified from M. tuberculosis, M. bovis, or BCG have a high capacity to elicit in vivo potent delayed-type hypersensitivity (DTH) reactions and to stimulate in vitro sensitized T lymphocytes of guinea pigs immunized with living BCG. The recombinant Apa expressed in Mycobacterium smegmatis was 4-fold less potent in vivo in the DTH assay and 10-fold less active in vitro to stimulate sensitized T lymphocytes than the native proteins. The recombinant protein expressed in Escherichia coli was nearly unable to elicit DTH reactions in vivo or to stimulate T lymphocytes in vitro. Thus the observed biological effects were related to the extent of glycosylation of the antigen.

Influence of culture medium composition on relative mRNA abundances in domestic cat embryos.

PubMed

Hribal, R; Jewgenow, K; Braun, B C; Comizzoli, P

2013-04-01

Different culture conditions have been used to produce domestic cat embryos. As part of the in vitro procedures, the medium composition significantly affects the quality of the embryo development also. Quality assessments based on cleavage kinetics and blastomere symmetry are useful, but embryos also can differ in their relative gene expression patterns despite similar morphological characteristics. The aim of this study was to compare cat embryos produced with two different in vitro culture systems routinely used in two different laboratories [Smithsonian Conservation Biology Institute, Washington D.C., USA (SCBI) and Leibniz Institute for Zoo and Wildlife Research, Berlin, Germany (IZW)]. Specifically, relative mRNA expression patterns of critical genes for pre-implantation embryo development were assessed in both conditions. Embryos were produced in parallel in both culture systems by IVF using frozen-thawed ejaculated semen in the United States and fresh epididymal sperm in Germany. Success of embryo development in vitro was recorded as well as relative mRNA abundances [DNA methyltransferases 1 and 3A (DNMT1, DNMT3A), gap junction protein alpha 1 (GJA1), octamer-binding transcription factor 4 [OCT4], insulin-like growth factors 1 and 2 receptors (IGF1R, IGF2R), beta-actin (ACTB)] in pools of days 4-5 morulae by semi-quantitative RT-PCR assay. Percentages of cleaved embryos were similar (p > 0.05) between both culture systems, regardless of the location. OCT4 mRNA abundance was higher (p < 0.05) in embryos derived in the SCBI culture system compared with those from the IZW system when epididymal sperm was used for IVF. No clear correlation between the expression pattern and the culture system could be found for all other genes. It is suggested that OCT4 expression might be affected by the media composition in some conditions and can be the indicator of a better embryo quality. © 2012 Blackwell Verlag GmbH.

Differential regulation of transcription through distinct Suppressor of Hairless DNA binding site architectures during Notch signaling in proneural clusters.

PubMed

Cave, John W; Xia, Li; Caudy, Michael

2011-01-01

In Drosophila melanogaster, achaete (ac) and m8 are model basic helix-loop-helix activator (bHLH A) and repressor genes, respectively, that have the opposite cell expression pattern in proneural clusters during Notch signaling. Previous studies have shown that activation of m8 transcription in specific cells within proneural clusters by Notch signaling is programmed by a "combinatorial" and "architectural" DNA transcription code containing binding sites for the Su(H) and proneural bHLH A proteins. Here we show the novel result that the ac promoter contains a similar combinatorial code of Su(H) and bHLH A binding sites but contains a different Su(H) site architectural code that does not mediate activation during Notch signaling, thus programming a cell expression pattern opposite that of m8 in proneural clusters.

Varroa destructor parasitism reduces hemocyte concentrations and prophenol oxidase gene expression in bees from two populations.

PubMed

Koleoglu, Gun; Goodwin, Paul H; Reyes-Quintana, Mariana; Hamiduzzaman, Mollah Md; Guzman-Novoa, Ernesto

2018-04-01

Circulating hemocytes are responsible for defensive and healing mechanisms in the honey bee, Apis mellifera. Parasitism by the mite Varroa destructor and injection of V. destructor homogenate in buffer, but not buffer injection, showed similar reductions in total hemocyte concentrations in both Africanized and European adult honey bees. This indicated that compounds in V. destructor homogenate can have similar effects as V. destructor parasitism and that the response is not solely due to wounding. Samples from honey bees with different hemocyte concentrations were compared for the expression patterns of hemolectin (AmHml), prophenol oxidase (AmPpo), and class C scavenger receptor (AmSRC-C). Of the genes tested, only the expression of AmPpo correlated well with hemocyte counts for all the treatments, indicating that melanization is associated with those responses. Thus, the expression of AmPpo might be a suitable biomarker for hemocyte counts as part of cellular defenses against injection of buffer or mite compounds and V. destructor parasitism and perhaps other conditions involving healing and immunity.

THE EFFECT OF PROPRANOLOL ON GENE EXPRESSION DURING THE BLOOD ALCOHOL CYCLE OF RATS FED ETHANOL INTRAGASTRICALLY

PubMed Central

Li, Jun; Bardag-Gorce, F; Joan, Oliva; French, BA; Dedes, J; French, SW

2010-01-01

Propranolol, a beta adrenergic blocker prevents the blood alcohol (BAL) cycle in rats fed ethanol intragastrically at a constant rate by preventing the cyclic changes in the metabolic rate caused by fluctuating levels of norepinephrine released into the blood. The change in the rate of metabolism changes the rate of alcohol elimination in the blood which causes the BAL to cycle. Microarray analysis of the livers from the rats fed ethanol and propranolol showed similar changes in clusters of functionally related gene expressions. The controls and the trough of the cycle differed dramatically from the cluster pattern seen in the rats at the peaks of the blood alcohol cycle. The changes in gene expression induced by ethanol were similar when propranolol was fed without ethanol especially with the changes in the kinases and phosphatases, Toll-like receptor signaling and cytokine-cytokine receptor interaction were also changed. The changes in gene expression caused by ethanol and propranolol feeding are alike probably because both drugs induce β adrenergic receptor desensitization. PMID:19925788

Comprehensive microarray-based analysis for stage-specific larval camouflage pattern-associated genes in the swallowtail butterfly, Papilio xuthus

PubMed Central

2012-01-01

Background Body coloration is an ecologically important trait that is often involved in prey-predator interactions through mimicry and crypsis. Although this subject has attracted the interest of biologists and the general public, our scientific knowledge on the subject remains fragmentary. In the caterpillar of the swallowtail butterfly Papilio xuthus, spectacular changes in the color pattern are observed; the insect mimics bird droppings (mimetic pattern) as a young larva, and switches to a green camouflage coloration (cryptic pattern) in the final instar. Despite the wide variety and significance of larval color patterns, few studies have been conducted at a molecular level compared with the number of studies on adult butterfly wing patterns. Results To obtain a catalog of genes involved in larval mimetic and cryptic pattern formation, we constructed expressed sequence tag (EST) libraries of larval epidermis for P. xuthus, and P. polytes that contained 20,736 and 5,376 clones, respectively, representing one of the largest collections available in butterflies. A comparison with silkworm epidermal EST information revealed the high expression of putative blue and yellow pigment-binding proteins in Papilio species. We also designed a microarray from the EST dataset information, analyzed more than five stages each for six markings, and confirmed spatial expression patterns by whole-mount in situ hybridization. Hence, we succeeded in elucidating many novel marking-specific genes for mimetic and cryptic pattern formation, including pigment-binding protein genes, the melanin-associated gene yellow-h3, the ecdysteroid synthesis enzyme gene 3-dehydroecdysone 3b-reductase, and Papilio-specific genes. We also found many cuticular protein genes with marking specificity that may be associated with the unique surface nanostructure of the markings. Furthermore, we identified two transcription factors, spalt and ecdysteroid signal-related E75, as genes expressed in larval eyespot markings. This finding suggests that E75 is a strong candidate mediator of the hormone-dependent coordination of larval pattern formation. Conclusions This study is one of the most comprehensive molecular analyses of complicated morphological features, and it will serve as a new resource for studying insect mimetic and cryptic pattern formation in general. The wide variety of marking-associated genes (both regulatory and structural genes) identified by our screening indicates that a similar strategy will be effective for understanding other complex traits. PMID:22651552

Videos of conspecifics elicit interactive looking patterns and facial expressions in monkeys.

PubMed

Mosher, Clayton P; Zimmerman, Prisca E; Gothard, Katalin M

2011-08-01

A broader understanding of the neural basis of social behavior in primates requires the use of species-specific stimuli that elicit spontaneous, but reproducible and tractable behaviors. In this context of natural behaviors, individual variation can further inform about the factors that influence social interactions. To approximate natural social interactions similar to those documented by field studies, we used unedited video footage to induce in viewer monkeys spontaneous facial expressions and looking patterns in the laboratory setting. Three adult male monkeys (Macaca mulatta), previously behaviorally and genetically (5-HTTLPR) characterized, were monitored while they watched 10 s video segments depicting unfamiliar monkeys (movie monkeys) displaying affiliative, neutral, and aggressive behaviors. The gaze and head orientation of the movie monkeys alternated between "averted" and "directed" at the viewer. The viewers were not reinforced for watching the movies, thus their looking patterns indicated their interest and social engagement with the stimuli. The behavior of the movie monkey accounted for differences in the looking patterns and facial expressions displayed by the viewers. We also found multiple significant differences in the behavior of the viewers that correlated with their interest in these stimuli. These socially relevant dynamic stimuli elicited spontaneous social behaviors, such as eye-contact induced reciprocation of facial expression, gaze aversion, and gaze following, that were previously not observed in response to static images. This approach opens a unique opportunity to understanding the mechanisms that trigger spontaneous social behaviors in humans and nonhuman primates. (PsycINFO Database Record (c) 2011 APA, all rights reserved).

Reorientation Timescales and Pattern Dynamics for Titan's Dunes: Does the Tail Wag the Dog or the Dragon?

NASA Astrophysics Data System (ADS)

Hayes, A. G.; Ewing, R. C.; Cassini Radar Science Team, T.

2011-12-01

Fields of bedform patterns persist across many orders of magnitude, from cm-scale sub-aqueous current ripples to km-scale aeolian dunes, and form with surprisingly little difference in expression despite a range of formative environments. Because of the remarkable similarity between and among patterns, extracting information about climate and environment from these patterns is a challenge. For example, crest orientation is not diagnostic of a particular flow regime; similar patterns form under many different flow configurations. On Titan, these challenges have played out with many attempts to reconcile dune-field patterns with modeled and expected wind regimes. We propose that thinking about the change in dune orientation, rather than the orientation itself, can provide new insights on the long-term stability of the dune-field patterns and the formative wind regime. In this work, we apply the re-orientation model presented by Werner and Kocurek [Geology, 1997] to the equatorial dune fields of Titan. We measure variations in pattern parameters (crest spacing, crest length and defect density, which is the number of defect pairs per total crest length) both within and between Titan's dune fields to describe pattern maturity and identify areas where changes in dune orientation are likely to occur (or may already be occurring). Measured defect densities are similar to Earth's largest linear dune fields, such as the Namib Sand Sea and the Simpson Desert. We use measured defect densities in the Werner and Kocurek model to estimate crestline reorientation rates. We find reorientation timescales varying from ten to a hundred thousand times the average migration timescale (time to migrate a bedform one meter, ~1 Titan year according to Tokano (Aeolian Research, 2010)). Well organized patterns have the longest reorientation time scales (~10^5 migration timescales), while the topographically or spatially isolated patches of dunes show the shortest reorientation times (~10^3 migration timescales). In addition, comparisons between spacing and defect density of Titan's dunes and some of the largest fields observed on Earth and Mars reveal that dune patterns on all three planets are geometrically similar, suggesting that growth and organization share common pattern dynamics. Our results suggest that Titan's dunes may react to gross bedform transport averaged over orbital timescales, relaxing the requirement that a single modern wind regime is required to produce the observed pattern.

Altered gene expression in human placenta after suspected preterm labour.

PubMed

Oros, D; Strunk, M; Breton, P; Paules, C; Benito, R; Moreno, E; Garcés, M; Godino, J; Schoorlemmer, J

2017-07-01

Suspected preterm labour occurs in around 9% of pregnancies. However, almost two-thirds of women admitted for threatened preterm labour ultimately deliver at term and are considered risk-free for fetal development. We examined placental and umbilical cord blood samples from preterm or term deliveries after threatened preterm labour as well as term deliveries without threatened preterm labour. We quantitatively analysed the mRNA expression of inflammatory markers (IL6, IFNγ, and TNFα) and modulators of angiogenesis (FGF2, PGF, VEGFA, VEGFB, and VEGFR1). A total of 132 deliveries were analysed. Preterm delivery and term delivery after suspected preterm labour groups showed similar increases in TNFα expression compared with the term delivery control group in umbilical cord blood samples. Placental samples from preterm and term deliveries after suspected preterm labour exhibited significantly increased expression of TNFα and IL6 and decreased expression of IFNγ. Suspected preterm labour was also associated with altered expression of angiogenic factors, although not all differences reached statistical significance. We found gene expression patterns indicative of inflammation in human placentas after suspected preterm labour regardless of whether the deliveries occurred preterm or at term. Similarly, a trend towards altered expression of angiogeneic factors was not limited to preterm birth. These findings suggest that the biological mechanisms underlying threatened preterm labour affect pregnancies independently of gestational age at birth. Copyright © 2017 Elsevier Ltd. All rights reserved.

Differential expression of steroidogenic factors 1 and 2, cytochrome p450scc, and steroidogenic acute regulatory protein in human pancreas.

PubMed

Morales, Angélica; Vilchis, Felipe; Chávez, Bertha; Morimoto, Sumiko; Chan, Carlos; Robles-Díaz, Guillermo; Díaz-Sánchez, Vicente

2008-08-01

The aim of this study was to investigate the expression of the 4 gene transcripts, steroidogenic factors 1 (SF-1) and 2 (SF-2), steroidogenic acute regulatory (StAR), and cytochrome P450 11A1, involved in the synthesis of steroid hormones in normal human pancreas. Total RNA was extracted from normal male (n = 5) and female (n = 5) samples, obtained from the organ donor program. The expression levels of SF-1, SF-2, StAR protein, and P450scc were assessed by reverse transcription-polymerase chain reaction and complemented with immunohistochemistry analysis. Polymerase chain reaction products amplification for all genes was present in both male and female samples, although differential expression was observed. The signals detected were much more evident in male than in female messenger RNA isolates for SF-1, SF-2, and StAR protein. The expression for P450scc was more intense in female samples. A similar pattern was observed in the immunohistochemical studies. Normal human pancreas expresses 4 gene transcripts involved in steroid synthesis similarly to steroidogenic organs. A distinctive characteristic is the sexually dimorphic expression of these factors. These data provide further evidence to support that the pancreas is a truly steroidogenic tissue, highlighting the presence of sex- and location-related differences in the expression of steroidogenic factors.

Diurnal oscillation of SBE expression in sorghum endosperm

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sun, Chuanxin; Mutisya, J.; Rosenquist, S.

2009-01-15

Spatial and temporal expression patterns of the sorghum SBEI, SBEIIA and SBEIIB genes, encoding, respectively, starch branching enzyme (SBE) I, IIA and IIB, in the developing endosperm of sorghum (Sorghum bicolor) were studied. Full-length genomic and cDNA clones for sorghum was cloned and the SBEIIA cDNA was used together with gene-specific probes for sorghum SBEIIB and SBEI. In contrast to sorghum SBEIIB, which was expressed primarily in endosperm and embryo, SBEIIA was expressed also in vegetative tissues. All three genes shared a similar temporal expression profile during endosperm development, with a maximum activity at 15-24 days after pollination. This ismore » different from barley and maize where SBEI gene activity showed a significantly later onset compared to that of SBEIIA and SBEIIB. Expression of the three SBE genes in the sorghum endosperm exhibited a diurnal rhythm during a 24-h cycle.« less

What Does Children's Spatial Language Reveal about Spatial Concepts? Evidence from the Use of Containment Expressions

ERIC Educational Resources Information Center

Johanson, Megan; Papafragou, Anna

2014-01-01

Children's overextensions of spatial language are often taken to reveal spatial biases. However, it is unclear whether extension patterns should be attributed to children's overly general spatial concepts or to a narrower notion of conceptual similarity allowing metaphor-like extensions. We describe a previously unnoticed extension of…

GST ( phi) gene from Macrophyte Lemna minor is involved in cadmium exposure responses

NASA Astrophysics Data System (ADS)

Chen, Shihua; Chen, Xin; Dou, Weihong; Wang, Liang; Yin, Haibo; Guo, Shanli

2016-03-01

Reactive oxygen species (ROS) scavengers, including ascorbate peroxidase, superoxide dismutase, catalase and peroxidase, are the most commonly used biomarkers in assessing an organisms' response to many biotic and abiotic stresses. In this study, we cloned an 866 bp GST ( phi) gene in Lemna minor and investigated its characteristics, expression and enzymatic activities under 75 μmol/L cadmium concentrations in comparison with other ROS scavengers. GST ( phi) gene expression patterns were similar to those of other scavengers of ROS. This suggests that GST ( phi) might be involved in responding to heavy metal (cadmium) stress and that its expression level could be used as a bio-indicator in monitoring cadmium pollution.

Genealogical correspondence of a forebrain centre implies an executive brain in the protostome–deuterostome bilaterian ancestor

PubMed Central

2016-01-01

Orthologous genes involved in the formation of proteins associated with memory acquisition are similarly expressed in forebrain centres that exhibit similar cognitive properties. These proteins include cAMP-dependent protein kinase A catalytic subunit (PKA-Cα) and phosphorylated Ca2+/calmodulin-dependent protein kinase II (pCaMKII), both required for long-term memory formation which is enriched in rodent hippocampus and insect mushroom bodies, both implicated in allocentric memory and both possessing corresponding neuronal architectures. Antibodies against these proteins resolve forebrain centres, or their equivalents, having the same ground pattern of neuronal organization in species across five phyla. The ground pattern is defined by olfactory or chemosensory afferents supplying systems of parallel fibres of intrinsic neurons intersected by orthogonal domains of afferent and efferent arborizations with local interneurons providing feedback loops. The totality of shared characters implies a deep origin in the protostome–deuterostome bilaterian ancestor of elements of a learning and memory circuit. Proxies for such an ancestral taxon are simple extant bilaterians, particularly acoels that express PKA-Cα and pCaMKII in discrete anterior domains that can be properly referred to as brains. PMID:26598732

Pulmonary tuberculosis in Asian elephants (Elephas maximus): histologic lesions with correlation to local immune responses.

PubMed

Landolfi, J A; Terio, K A; Miller, M; Junecko, B F; Reinhart, T

2015-05-01

Although Mycobacterium tuberculosis infection is an important health concern for Asian elephants (Elephas maximus), no studies have evaluated the associated local immune responses or histologic lesions. In primates including humans, latent tuberculosis is distinguished by well-organized granulomas with TH1 cytokine expression, whereas active disease is characterized by poorly organized inflammation and local imbalance in TH1/TH2 cytokines. This study examined archival, formalin-fixed, paraffin-embedded lung samples from 5 tuberculosis-negative and 9 tuberculosis-positive Asian elephants. Lesions were assessed by light microscopy, and lymphoid infiltrates were characterized by CD3 and CD20 immunolabeling. Expression of TH1 (interferon [IFN]-γ, tumor necrosis factor [TNF]-α) and TH2 (interleukin [IL]-4, IL-10, transforming growth factor [TGF]-β) cytokines was determined using in situ hybridization. In 6 of 9 samples, inflammation was similar to the pattern of primate active disease with low to moderate numbers of lymphocytes, most of which were CD20 positive. In 1 sample, inflammation was most similar to latent tuberculosis in primates with numerous CD3-positive lymphocytes. Expression of IFN-γ was detected in 3 of 8 tuberculosis-positive samples. Expression of TNF-α was detected in 3 of 8 positive samples, including the one with latent morphology. Low-level expression of IL-4 was present in 4 of 8 positive samples. Only single positive samples displayed expression of IL-10 and TGF-β. Tuberculosis-negative samples generally lacked cytokine expression. Results showed heterogeneity in lesions of elephant tuberculosis similar to those of latent and active disease in primates, with variable expression of both TH1 and TH2 cytokines. © The Author(s) 2014.

Analysis of myofibrillar proteins and transcripts in adult skeletal muscles of the American lobster Homarus americanus: variable expression of myosins, actin and troponins in fast, slow-twitch and slow-tonic fibres.

PubMed

Medler, Scott; Mykles, Donald L

2003-10-01

Skeletal muscles are diverse in their contractile properties, with many of these differences being directly related to the assemblages of myofibrillar isoforms characteristic of different fibers. Crustacean muscles are similar to other muscles in this respect, although the majority of information about differences in muscle organization comes from vertebrate species. In the present study, we examined the correlation between myofibrillar protein isoforms and the patterns of myofibrillar gene expression in fast, slow-phasic (S(1)) and slow-tonic (S(2)) fibers of the American lobster Homarus americanus. SDS-PAGE and western blotting were used to identify isoform assemblages of myosin heavy chain (MHC), P75, troponin T (TnT) and troponin I (TnI). RT-PCR was used to monitor expression of fast and slow (S(1)) MHC, P75 and actin in different fiber types, and the MHC and actin levels were quantified by real-time PCR. Fast and slow fibers from the claw closers predominantly expressed fast and S(1) MHC, respectively, but also lower levels of the alternate MHC. By contrast, fast fibers from the deep abdominal muscle expressed fast MHC exclusively. In addition, slow muscles expressed significantly higher levels of actin than fast fibers. A distal bundle of fibers in the cutter claw closer muscle was found to be composed of a mixture of S(1) and S(2) fibers, many of which possessed a mixture of S(1) and S(2) MHC isoforms. This pattern supports the idea that S(1) and S(2) fibers represent extremes in a continuum of slow muscle phenotype. Overall, these patterns demonstrate that crustacean skeletal muscles cannot be strictly categorized into discrete fiber types, but a muscle's properties probably represent a point on a continuum of fiber types. This trend may result from differences in innervation pattern, as each muscle is controlled by a unique combination of phasic, tonic or both phasic and tonic motor nerves. In this respect, future studies examining how muscle phenotype correlates with innervation pattern may help account for variation in crustacean fiber types.

Two C-type lectins from shrimp Litopenaeus vannamei that might be involved in immune response against bacteria and virus.

PubMed

Wei, Xiumei; Liu, Xiangquan; Yang, Jianmin; Fang, Jinghui; Qiao, Hongjin; Zhang, Ying; Yang, Jialong

2012-01-01

C-type lectins play crucial roles in innate immunity to recognize and eliminate pathogens efficiently. In the present study, two C-type lectins from shrimp Litopenaeus vannamei (designated as LvLectin-1 and LvLectin-2) were identified, and their expression patterns, both in tissues and toward pathogen stimulation, were then characterized. The full-length cDNA of LvLectin-1 and LvLectin-2 was 567 and 625 bp, containing an open reading frame (ORF) of 471 and 489 bp, respectively, and deduced amino acid sequences showed high similarity to other members of C-type lectin superfamily. Both two C-type lectins encoded a single carbohydrate-recognition domain (CRD). The motif of Ca(2+) binding site 2 in CRD, which determined carbohydrate-binding specificity, was QPN (Gln(122)-Pro(123)-Asn(124)) in LvLectin-1, but QPD (Gln(128)-Pro(129)-Asp(130)) in LvLectin-2. Two C-type lectins exhibited similar tissue expression pattern, for their mRNA were both constitutively expressed in all tested tissues, including hepatopancreas, muscle, gill, hemocytes, gonad and heart, furthermore they were both mostly expressed in hepatopancreas, though the expression level of LvLectin-2 was much higher than LvLectin-1. The expression level of two C-type lectins mRNA in hemocytes varied greatly after the challenge of Listonella anguillarum or WSSV. After L. anguillarum challenge, the expression of both C-type lectins were significantly (P<0.01) up-regulated compared with blank group, and LvLectin-1 exhibited higher level than LvLectin-2; while after the stimulation of WSSV, the expression of LvLectin-2 was significantly up-regulated at 6 h (P<0.01) and 12 h (P<0.05), but the expression level of LvLectin-1 down-regulated significantly (P<0.01) to 0.4-fold at 6 and 12 h post-stimulation. The results indicated that the two C-type lectins might be involved in immune response toward pathogen infection, and they might perform different recognition specificity toward bacteria or virus. Copyright © 2011 Elsevier Ltd. All rights reserved.

Prion Strain Differences in Accumulation of PrPSc on Neurons and Glia Are Associated with Similar Expression Profiles of Neuroinflammatory Genes: Comparison of Three Prion Strains

PubMed Central

Carroll, James A.; Striebel, James F.; Rangel, Alejandra; Woods, Tyson; Phillips, Katie; Peterson, Karin E.; Race, Brent; Chesebro, Bruce

2016-01-01

Misfolding and aggregation of host proteins are important features of the pathogenesis of neurodegenerative diseases including Alzheimer’s disease, Parkinson’s disease, frontotemporal dementia and prion diseases. In all these diseases, the misfolded protein increases in amount by a mechanism involving seeded polymerization. In prion diseases, host prion protein is misfolded to form a pathogenic protease-resistant form, PrPSc, which accumulates in neurons, astroglia and microglia in the CNS. Here using dual-staining immunohistochemistry, we compared the cell specificity of PrPSc accumulation at early preclinical times post-infection using three mouse scrapie strains that differ in brain regional pathology. PrPSc from each strain had a different pattern of cell specificity. Strain 22L was mainly associated with astroglia, whereas strain ME7 was mainly associated with neurons and neuropil. In thalamus and cortex, strain RML was similar to 22L, but in substantia nigra, RML was similar to ME7. Expression of 90 genes involved in neuroinflammation was studied quantitatively using mRNA from thalamus at preclinical times. Surprisingly, despite the cellular differences in PrPSc accumulation, the pattern of upregulated genes was similar for all three strains, and the small differences observed correlated with variations in the early disease tempo. Gene upregulation correlated with activation of both astroglia and microglia detected in early disease prior to vacuolar pathology or clinical signs. Interestingly, the profile of upregulated genes in scrapie differed markedly from that seen in two acute viral CNS diseases (LaCrosse virus and BE polytropic Friend retrovirus) that had reactive gliosis at levels similar to our prion-infected mice. PMID:27046083

Human and feline adipose-derived mesenchymal stem cells have comparable phenotype, immunomodulatory functions, and transcriptome.

PubMed

Clark, Kaitlin C; Fierro, Fernando A; Ko, Emily Mills; Walker, Naomi J; Arzi, Boaz; Tepper, Clifford G; Dahlenburg, Heather; Cicchetto, Andrew; Kol, Amir; Marsh, Lyndsey; Murphy, William J; Fazel, Nasim; Borjesson, Dori L

2017-03-20

Adipose-derived mesenchymal stem cells (ASCs) are a promising cell therapy to treat inflammatory and immune-mediated diseases. Development of appropriate pre-clinical animal models is critical to determine safety and attain early efficacy data for the most promising therapeutic candidates. Naturally occurring diseases in cats already serve as valuable models to inform human clinical trials in oncologic, cardiovascular, and genetic diseases. The objective of this study was to complete a comprehensive side-by-side comparison of human and feline ASCs, with an emphasis on their immunomodulatory capacity and transcriptome. Human and feline ASCs were evaluated for phenotype, immunomodulatory profile, and transcriptome. Additionally, transwells were used to determine the role of cell-cell contact in ASC-mediated inhibition of lymphocyte proliferation in both humans and cats. Similar to human ASCs, feline ASCs were highly proliferative at low passages and fit the minimal criteria of multipotent stem cells including a compatible surface protein phenotype, osteogenic capacity, and normal karyotype. Like ASCs from all species, feline ASCs inhibited mitogen-activated lymphocyte proliferation in vitro, with or without direct ASC-lymphocyte contact. Feline ASCs mimic human ASCs in their mediator secretion pattern, including prostaglandin E2, indoleamine 2,3 dioxygenase, transforming growth factor beta, and interleukin-6, all augmented by interferon gamma secretion by lymphocytes. The transcriptome of three unactivated feline ASC lines were highly similar. Functional analysis of the most highly expressed genes highlighted processes including: 1) the regulation of apoptosis; 2) cell adhesion; 3) response to oxidative stress; and 4) regulation of cell differentiation. Finally, feline ASCs had a similar gene expression profile to noninduced human ASCs. Findings suggest that feline ASCs modulate lymphocyte proliferation using soluble mediators that mirror the human ASC secretion pattern. Uninduced feline ASCs have similar gene expression profiles to uninduced human ASCs, as revealed by transcriptome analysis. These data will help inform clinical trials using cats with naturally occurring diseases as surrogate models for human clinical trials in the regenerative medicine arena.

Turbomachinery noise studies of the AiResearch QCGAT engine with inflow control

NASA Technical Reports Server (NTRS)

Mcardle, J. G.; Homyak, L.; Chrulski, D. D.

1981-01-01

The AiResearch Quiet Clean General Aviation Turbofan engine was tested on an outdoor test stand to compare the acoustic performance of two inflow control devices (ICD's) of similar design, and three inlet lips of different external shape. Only small performance differences were found. Far-field directivity patterns calculated by applicable existing analyses were compared with the measured tone and broadband patterns. For some of these comparisons, tests were made with an ICD to reduce rotor/inflow disturbance interaction noise, or with the acoustic suppression panels in the inlet or bypass duct covered with aluminum tape to determine hard wall acoustic performance. The comparisons showed that the analytical expressions used predict many directivity pattern features and trends, but can deviate in shape from the measured patterns under certain engine operating conditions. Some patterns showed lobes from modes attributable to rotor/engine strut interaction sources.

Epigenetic control of vasopressin expression is maintained by steroid hormones in the adult male rat brain

PubMed Central

Auger, Catherine J.; Coss, Dylan; Auger, Anthony P.; Forbes-Lorman, Robin M.

2011-01-01

Although some DNA methylation patterns are altered by steroid hormone exposure in the developing brain, less is known about how changes in steroid hormone levels influence DNA methylation patterns in the adult brain. Steroid hormones act in the adult brain to regulate gene expression. Specifically, the expression of the socially relevant peptide vasopressin (AVP) within the bed nucleus of the stria terminalis (BST) of adult brain is dependent upon testosterone exposure. Castration dramatically reduces and testosterone replacement restores AVP expression within the BST. As decreases in mRNA expression are associated with increases in DNA promoter methylation, we explored the hypothesis that AVP expression in the adult brain is maintained through sustained epigenetic modifications of the AVP gene promoter. We find that castration of adult male rats resulted in decreased AVP mRNA expression and increased methylation of specific CpG sites within the AVP promoter in the BST. Similarly, castration significantly increased estrogen receptor α (ERα) mRNA expression and decreased ERα promoter methylation within the BST. These changes were prevented by testosterone replacement. This suggests that the DNA promoter methylation status of some steroid responsive genes in the adult brain is actively maintained by the presence of circulating steroid hormones. The maintenance of methylated or demethylated states of some genes in the adult brain by the presence of steroid hormones may play a role in the homeostatic regulation of behaviorally relevant systems. PMID:21368111

Cloning of an ADP-ribosylation factor gene from banana (Musa acuminata) and its expression patterns in postharvest ripening fruit.

PubMed

Wang, Yuan; Wu, Jing; Xu, Bi-Yu; Liu, Ju-Hua; Zhang, Jian-Bin; Jia, Cai-Hong; Jin, Zhi-Qiang

2010-08-15

A full-length cDNA encoding an ADP-ribosylation factor (ARF) from banana (Musa acuminata) fruit was cloned and named MaArf. It contains an open reading frame encoding a 181-amino-acid polypeptide. Sequence analysis showed that MaArf shared high similarity with ARF of other plant species. The genomic sequence of MaArf was also obtained using polymerase chain reaction (PCR). Sequence analysis showed that MaArf was a split gene containing five exons and four introns in genomic DNA. Reverse-transcriptase PCR was used to analyze the spatial expression of MaArf. The results showed that MaArf was expressed in all the organs examined: root, rhizome, leaf, flower and fruit. Real-time quantitative PCR was used to explore expression patterns of MaArf in postharvest banana. There was differential expression of MaArf associated with ethylene biosynthesis. In naturally ripened banana, expression of MaArf was in accordance with ethylene biosynthesis. However, in 1-methylcyclopropene-treated banana, the expression of MaArf was inhibited and changed little. When treated with ethylene, MaArf expression in banana fruit significantly increased in accordance with ethylene biosynthesis; the peak of MaArf was 3 d after harvest, 11 d earlier than for naturally ripened banana fruits. These results suggest that MaArf is induced by ethylene in regulating postharvest banana ripening. Finally, subcellular localization assays showed the MaArf protein in the cytoplasm. Copyright 2010 Elsevier GmbH. All rights reserved.

Sonic hedgehog: restricted expression and limb dysmorphologies

PubMed Central

Hill, Robert E; Heaney, Simon JH; Lettice, Laura A

2003-01-01

Sonic hedgehog, SHH, is required for patterning the limb. The array of skeletal elements that compose the hands and feet, and the ordered arrangement of these bones to form the pattern of fingers and toes are dependent on SHH. The mechanism of action of SHH in the limb is not fully understood; however, an aspect that appears to be important is the localized, asymmetric expression of Shh. Shh is expressed in the posterior margin of the limb bud in a region defined as the zone of polarizing activity (ZPA). Analysis of mouse mutants which have polydactyly (extra toes) shows that asymmetric expression of Shh is lost due to the appearance of an ectopic domain of expression in the anterior limb margin. One such polydactylous mouse mutant, sasquatch (Ssq), maps to the corresponding chromosomal region of the human condition pre-axial polydactyly (PPD) and thus represents a model for this condition. The mutation responsible for Ssq is located 1 Mb away from the Shh gene; however, the mutation disrupts a long-range cis-acting regulator of Shh expression. By inference, human pre-axial polydactyly results from a similar disruption of Shh expression. Other human congenital abnormalities also map near the pre-axial polydactyly locus, suggesting a major chromosomal region for limb dysmorphologies. The distinct phenotypes range from loss of all bones of the hands and feet to syndactyly of the soft tissue and fusion of the digits. We discuss the role played by Shh expression in mouse mutant phenotypes and the human limb dysmorphologies. PMID:12587915

Unsupervised Clustering of Subcellular Protein Expression Patterns in High-Throughput Microscopy Images Reveals Protein Complexes and Functional Relationships between Proteins

PubMed Central

Handfield, Louis-François; Chong, Yolanda T.; Simmons, Jibril; Andrews, Brenda J.; Moses, Alan M.

2013-01-01

Protein subcellular localization has been systematically characterized in budding yeast using fluorescently tagged proteins. Based on the fluorescence microscopy images, subcellular localization of many proteins can be classified automatically using supervised machine learning approaches that have been trained to recognize predefined image classes based on statistical features. Here, we present an unsupervised analysis of protein expression patterns in a set of high-resolution, high-throughput microscope images. Our analysis is based on 7 biologically interpretable features which are evaluated on automatically identified cells, and whose cell-stage dependency is captured by a continuous model for cell growth. We show that it is possible to identify most previously identified localization patterns in a cluster analysis based on these features and that similarities between the inferred expression patterns contain more information about protein function than can be explained by a previous manual categorization of subcellular localization. Furthermore, the inferred cell-stage associated to each fluorescence measurement allows us to visualize large groups of proteins entering the bud at specific stages of bud growth. These correspond to proteins localized to organelles, revealing that the organelles must be entering the bud in a stereotypical order. We also identify and organize a smaller group of proteins that show subtle differences in the way they move around the bud during growth. Our results suggest that biologically interpretable features based on explicit models of cell morphology will yield unprecedented power for pattern discovery in high-resolution, high-throughput microscopy images. PMID:23785265

Altered temporal patterns of anxiety in aged and amyloid precursor protein (APP) transgenic mice.

PubMed

Bedrosian, Tracy A; Herring, Kamillya L; Weil, Zachary M; Nelson, Randy J

2011-07-12

Both normal aging and dementia are associated with dysregulation of the biological clock, which contributes to disrupted circadian organization of physiology and behavior. Diminished circadian organization in conjunction with the loss of cholinergic input to the cortex likely contributes to impaired cognition and behavior. One especially notable and relatively common circadian disturbance among the aged is "sundowning syndrome," which is characterized by exacerbated anxiety, agitation, locomotor activity, and delirium during the hours before bedtime. Sundowning has been reported in both dementia patients and cognitively intact elderly individuals living in institutions; however, little is known about temporal patterns in anxiety and agitation, and the neurobiological basis of these rhythms remains unspecified. In the present study, we explored the diurnal pattern of anxiety-like behavior in aged and amyloid precursor protein (APP) transgenic mice. We then attempted to treat the observed behavioral disturbances in the aged mice using chronic nightly melatonin treatment. Finally, we tested the hypothesis that time-of-day differences in acetylcholinesterase and choline acetyltransferase expression and general neuronal activation (i.e., c-Fos expression) coincide with the behavioral symptoms. Our results show a temporal pattern of anxiety-like behavior that emerges in elderly mice. This behavioral pattern coincides with elevated locomotor activity relative to adult mice near the end of the dark phase, and with time-dependent changes in basal forebrain acetylcholinesterase expression. Transgenic APP mice show a similar behavioral phenomenon that is not observed among age-matched wild-type mice. These results may have useful applications to the study and treatment of age- and dementia-related circadian behavioral disturbances, namely, sundowning syndrome.

Extensive Analysis of GmFTL and GmCOL Expression in Northern Soybean Cultivars in Field Conditions.

PubMed

Guo, Guangyu; Xu, Kun; Zhang, Xiaomei; Zhu, Jinlong; Lu, Mingyang; Chen, Fulu; Liu, Linpo; Xi, Zhang-Ying; Bachmair, Andreas; Chen, Qingshan; Fu, Yong-Fu

2015-01-01

The FLOWERING LOCUS T (FT) gene is a highly conserved florigen gene among flowering plants. Soybean genome encodes six homologs of FT, which display flowering activity in Arabidopsis thaliana. However, their contributions to flowering time in different soybean cultivars, especially in field conditions, are unclear. We employed six soybean cultivars with different maturities to extensively investigate expression patterns of GmFTLs (Glycine max FT-like) and GmCOLs (Glycine max CO-like) in the field conditions. The results show that GmFTL3 is an FT homolog with the highest transcript abundance in soybean, but other GmFTLs may also contribute to flower induction with different extents, because they have more or less similar expression patterns in developmental-, leaf-, and circadian-specific modes. And four GmCOL genes (GmCOL1/2/5/13) may confer to the expression of GmFTL genes. Artificial manipulation of GmFTL expression by transgenic strategy (overexpression and RNAi) results in a distinct change in soybean flowering time, indicating that GmFTLs not only impact on the control of flowering time, but have potential applications in the manipulation of photoperiodic adaptation in soybean. Additionally, transgenic plants show that GmFTLs play a role in formation of the first flowers and in vegetative growth.

Sequence and expression pattern of the germ line marker vasa in honey bees and stingless bees

PubMed Central

2009-01-01

Queens and workers of social insects differ in the rates of egg laying. Using genomic information we determined the sequence of vasa, a highly conserved gene specific to the germ line of metazoans, for the honey bee and four stingless bees. The vasa sequence of social bees differed from that of other insects in two motifs. By RT-PCR we confirmed the germ line specificity of Amvasa expression in honey bees. In situ hybridization on ovarioles showed that Amvasa is expressed throughout the germarium, except for the transition zone beneath the terminal filament. A diffuse vasa signal was also seen in terminal filaments suggesting the presence of germ line cells. Oocytes showed elevated levels of Amvasa transcripts in the lower germarium and after follicles became segregated. In previtellogenic follicles, Amvasa transcription was detected in the trophocytes, which appear to supply its mRNA to the growing oocyte. A similar picture was obtained for ovarioles of the stingless bee Melipona quadrifasciata, except that Amvasa expression was higher in the oocytes of previtellogenic follicles. The social bees differ in this respect from Drosophila, the model system for insect oogenesis, suggesting that changes in the sequence and expression pattern of vasa may have occurred during social evolution. PMID:21637523

Extensive Analysis of GmFTL and GmCOL Expression in Northern Soybean Cultivars in Field Conditions

PubMed Central

Zhu, Jinlong; Lu, Mingyang; Chen, Fulu; Liu, Linpo; Xi, Zhang-Ying; Bachmair, Andreas; Chen, Qingshan; Fu, Yong-Fu

2015-01-01

The FLOWERING LOCUS T (FT) gene is a highly conserved florigen gene among flowering plants. Soybean genome encodes six homologs of FT, which display flowering activity in Arabidopsis thaliana. However, their contributions to flowering time in different soybean cultivars, especially in field conditions, are unclear. We employed six soybean cultivars with different maturities to extensively investigate expression patterns of GmFTLs (Glycine max FT-like) and GmCOLs (Glycine max CO-like) in the field conditions. The results show that GmFTL3 is an FT homolog with the highest transcript abundance in soybean, but other GmFTLs may also contribute to flower induction with different extents, because they have more or less similar expression patterns in developmental-, leaf-, and circadian-specific modes. And four GmCOL genes (GmCOL1/2/5/13) may confer to the expression of GmFTL genes. Artificial manipulation of GmFTL expression by transgenic strategy (overexpression and RNAi) results in a distinct change in soybean flowering time, indicating that GmFTLs not only impact on the control of flowering time, but have potential applications in the manipulation of photoperiodic adaptation in soybean. Additionally, transgenic plants show that GmFTLs play a role in formation of the first flowers and in vegetative growth. PMID:26371882

CYP450s analysis across spiny lobster metamorphosis identifies a long sought missing link in crustacean development.

PubMed

Ventura, Tomer; Bose, Utpal; Fitzgibbon, Quinn P; Smith, Gregory G; Shaw, P Nicholas; Cummins, Scott F; Elizur, Abigail

2017-07-01

Cytochrome P450s (CYP450s) are a rapidly evolving family of enzymes, making it difficult to identify bona fide orthologs with notable lineage-specific exceptions. In ecdysozoans, a small number of the most conserved orthologs include enzymes which metabolize ecdysteroids. Ecdysone pathway components were recently shown in a decapod crustacean but with a notable absence of shade, which is important for converting ecdysone to its active form, 20-hydroxyecdysone (20HE), suggesting that another CYP450 performs a similar function in crustaceans. A CYPome temporal expression analysis throughout metamorphosis performed in this research highlights several un-annotated CYP450s displaying differential expression and provides information into expression patterns of annotated CYP450s. Using the expression patterns in the Eastern spiny lobster Sagmariasus verreauxi, followed by 3D modelling and finally activity assays in vitro, we were able to conclude that a group of CYP450s, conserved across decapod crustaceans, function as the insect shade. To emphasize the fact that these genes share the function with shade but are phylogenetically distinct, we name this enzyme system Shed. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Collapsed Reticular Network and its Possible Mechanism during the Initiation and/or Progression of Hepatic Fibrosis

PubMed Central

Wen, Shi-Lei; Feng, Shi; Tang, Shi-Hang; Gao, Jin-Hang; Zhang, Lin-hao; Tong, Huan; Yan, Zhao-Ping; Fang, Ding Zhi

2016-01-01

Among the researches on hepatic fibrosis, great attention was paid to both hepatocytes and extracellular matrix (ECM). However, little focus was drawn on reticular fibrous network, which is important for demarcation and support of hepatocytes. The aim of this study was to investigate the change pattern of reticular fibers in hepatic fibrosis/cirrhosis and its underlying mechanism. In this study, thioacetamide (TAA) and bile duct ligation (BDL) were utilized to induce rat hepatic fibrosis respectively, and Human liver cirrhotic microassay was analyzed with IHC to confirm the results in animal experiment and to detect the metalloproteinases (MMPs) expressions. As a result, the reticular fibers decreased markedly after 1 week in TAA and 1 day in BDL treated rats. Multiple representative regulators of MMPs and MMPs increased significantly in their expressions and activities. Further more, in human liver cirrhotic microassay, MMPs expressions also showed similar patterns as that of animal experiment. In Conclusions: Degradation or collapse of reticular fibers in hepatic sinusoid can be considered as a pathological feature during the initiation and/or progression of hepatic fibrosis. Moreover, such degradation is associated with and probably caused by the over/dysregulated expression of MMPs. PMID:27739503

Uneven Expressive Language Development in Mandarin-Exposed Preschool Children with ASD: Comparing Vocabulary, Grammar, and the Decontextualized Use of Language via the PCDI-Toddler Form.

PubMed

Su, Yi Esther; Naigles, Letitia R; Su, Lin-Yan

2018-05-21

Data from children with ASD who are learning Indo-European languages indicate that (a) they vary hugely in their expressive language skills and (b) their pragmatic/socially-based language is more impaired than their structural language. We investigate whether similar patterns of language development exist for Mandarin-exposed children with ASD. Parent report data of the Putonghua Communicative Development Inventory-Toddler Form were collected from 160 17-83-month-old children with ASD. These children with ASD demonstrated similar levels of variability as Western children with ASD. In particular, they could be divided into three distinct subgroups (high verbal, middle verbal, low verbal), all of which manifested relative strengths in lexical and grammatical language compared to pragmatic usage of decontextualized language.

Use of keyword hierarchies to interpret gene expression patterns.

PubMed

Masys, D R; Welsh, J B; Lynn Fink, J; Gribskov, M; Klacansky, I; Corbeil, J

2001-04-01

High-density microarray technology permits the quantitative and simultaneous monitoring of thousands of genes. The interpretation challenge is to extract relevant information from this large amount of data. A growing variety of statistical analysis approaches are available to identify clusters of genes that share common expression characteristics, but provide no information regarding the biological similarities of genes within clusters. The published literature provides a potential source of information to assist in interpretation of clustering results. We describe a data mining method that uses indexing terms ('keywords') from the published literature linked to specific genes to present a view of the conceptual similarity of genes within a cluster or group of interest. The method takes advantage of the hierarchical nature of Medical Subject Headings used to index citations in the MEDLINE database, and the registry numbers applied to enzymes.

Cloning, phylogeny, and regional expression of a Y5 receptor mRNA in the brain of the sea lamprey (Petromyzon marinus).

PubMed

Pérez-Fernández, Juan; Megías, Manuel; Pombal, Manuel A

2014-04-01

The NPY receptors known as Y receptors are classified into three subfamilies, Y1, Y2, and Y5, and are involved in different physiological functions. The Y5 receptor is the only member of the Y5 subfamily, and it is present in all vertebrate groups, except for teleosts. Both molecular and pharmacological studies show that Y5 receptor is highly conserved during vertebrate evolution. Furthermore, this receptor is widely expressed in the mammalian brain, including the hypothalamus, where it is thought to take part in feeding and homeostasis regulation. Lampreys belong to the agnathan lineage, and they are thought to have branched out between the two whole-genome duplications that occurred in vertebrates. Therefore, they are in a key position for studies on the evolution of gene families in vertebrates. Here we report the cloning, phylogeny, and brain expression pattern of the sea lamprey Y5 receptor. In phylogenetic studies, the lamprey Y5 receptor clusters in a basal position, together with Y5 receptors of other vertebrates. The mRNA of this receptor is broadly expressed in the lamprey brain, being especially abundant in hypothalamic areas. Its expression pattern is roughly similar to that reported for other vertebrates and parallels the expression pattern of the Y1 receptor subtype previously described by our group, as it occurs in mammals. Altogether, these results confirm that a Y5 receptor is present in lampreys, thus being highly conserved during the evolution of vertebrates, and suggest that it is involved in many brain functions, the only known exception being teleosts. Copyright © 2013 Wiley Periodicals, Inc.

Evolution of Daily Gene Co-expression Patterns from Algae to Plants

PubMed Central

de los Reyes, Pedro; Romero-Campero, Francisco J.; Ruiz, M. Teresa; Romero, José M.; Valverde, Federico

2017-01-01

Daily rhythms play a key role in transcriptome regulation in plants and microalgae orchestrating responses that, among other processes, anticipate light transitions that are essential for their metabolism and development. The recent accumulation of genome-wide transcriptomic data generated under alternating light:dark periods from plants and microalgae has made possible integrative and comparative analysis that could contribute to shed light on the evolution of daily rhythms in the green lineage. In this work, RNA-seq and microarray data generated over 24 h periods in different light regimes from the eudicot Arabidopsis thaliana and the microalgae Chlamydomonas reinhardtii and Ostreococcus tauri have been integrated and analyzed using gene co-expression networks. This analysis revealed a reduction in the size of the daily rhythmic transcriptome from around 90% in Ostreococcus, being heavily influenced by light transitions, to around 40% in Arabidopsis, where a certain independence from light transitions can be observed. A novel Multiple Bidirectional Best Hit (MBBH) algorithm was applied to associate single genes with a family of potential orthologues from evolutionary distant species. Gene duplication, amplification and divergence of rhythmic expression profiles seems to have played a central role in the evolution of gene families in the green lineage such as Pseudo Response Regulators (PRRs), CONSTANS-Likes (COLs), and DNA-binding with One Finger (DOFs). Gene clustering and functional enrichment have been used to identify groups of genes with similar rhythmic gene expression patterns. The comparison of gene clusters between species based on potential orthologous relationships has unveiled a low to moderate level of conservation of daily rhythmic expression patterns. However, a strikingly high conservation was found for the gene clusters exhibiting their highest and/or lowest expression value during the light transitions. PMID:28751903

Lactation stage-dependent expression of transporters in rat whole mammary gland and primary mammary epithelial organoids.

PubMed

Gilchrist, Samuel E; Alcorn, Jane

2010-04-01

Since solute carrier (SLC) and ATP-binding cassette (ABC) transporters play pivotal roles in the transport of both nutrients and drugs into breast milk, drug-nutrient transport interactions at the lactating mammary gland are possible. Our purpose was to characterize lactation stage-dependent changes in transporter expression in rat mammary gland and isolated mammary epithelial organoids (MEO) to provide additional insight for the safe use of maternal medications during breastfeeding. We used quantitative reverse transcription-polymerase chain reaction to assess the temporal expression patterns of SLC and ABC transporters in rat mammary gland and isolated MEO at different stages of lactation. In whole mammary gland five distinct patterns of expression emerged relative to late gestation: (i) decreasing throughout lactation (Mdr1a, Mdr1b, Mrp1, Octn2, Ent2, Ent3, Ncbt2, Mtx1); (ii) prominent increase in early lactation, which may remain elevated or decline with advancing lactation (Octn1, Cnt2, Cnt3, Ent1, Pept1, Pept2); (iii) constant but decreasing later in lactation (Octn3, Dmt1); (iv) increasing until mid-to-late lactation (Oct1, Cnt1); and (v) prominent increase late in lactation (Ncbt1). In isolated MEO (an enriched source of mammary epithelial cells) major differences in expression patterns were noted for Octn3, Ncbt1, and Mtx1, but otherwise were reasonably similar with the whole mammary gland. In conclusion our study augments existing data on transporter expression in the lactating mammary gland. These data should facilitate investigations into lactation-stage dependent changes in drug or nutrient milk-to-serum concentration ratios, the potential for drug- or disease-transporter interactions, and mechanistic studies of transporter function in the lactating mammary gland.

Molecular cloning, mRNA expression and tissue distribution analysis of Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors.

PubMed

Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng

2015-01-25

Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

Cloning and pattern of expression of the shiro-uo vasa gene during embryogenesis and its roles in PGC development.

PubMed

Miyake, Akimitsu; Saito, Taiju; Kashiwagi, Noboru; Ando, Daisuke; Yamamoto, Akitsugu; Suzuki, Tohru; Nakatsuji, Norio; Nakatsuji, Takako

2006-01-01

The vasa genes are expressed in the germ cell lineage in many organisms, but their expression patterns show large variations. Recent studies suggest that vasa transcripts are involved in germ cell lineage development. In this paper, we isolated the vasa cDNA clone from a teleost, shiro-uo, Leucopsarion petersii and examined its expression pattern during embryogenesis. Then, we examined the functional significance of vasa mRNA during the formation of primordial germ cells (PGCs). The amino acid sequence of shiro-uo VASA is 61.1% identical to that of zebrafish. In whole-mount in situ hybridization, vasa transcripts appeared at the 4- and 8-cell stages as four spots at both ends of two cleavage planes between the lower tier of blastomeres and the yolk cell mass. At the 16-cell stage, eight spots were observed. After the blastula stage, shiro-uo vasa transcripts showed similar localization as in the zebrafish. Ultrastructural analysis of 4-cell stage embryos revealed the presence of a subcellular organelle that resembled 'nuage' in the germ cell lineage observed in the embryos of various organisms. We carried out micromanipulation of 4- or 8-cell stage embryos to remove the vasa mRNA-containing spots and then measured the number of the vasa-expressing PGCs in the genital ridge of the manipulated embryos. The numbers decreased when all of the four spots were removed, indicating that the vasa-containing spots at early cleavage stages have important functions in the development of PGCs.

Profiles of Global Gene Expression in Ionizing-Radiation–Damaged Human Diploid Fibroblasts Reveal Synchronization behind the G1 Checkpoint in a G0-like State of Quiescence

PubMed Central

Zhou, Tong; Chou, Jeff W.; Simpson, Dennis A.; Zhou, Yingchun; Mullen, Thomas E.; Medeiros, Margarida; Bushel, Pierre R.; Paules, Richard S.; Yang, Xuebin; Hurban, Patrick; Lobenhofer, Edward K.; Kaufmann, William K.

2006-01-01

Cell cycle arrest and stereotypic transcriptional responses to DNA damage induced by ionizing radiation (IR) were quantified in telomerase-expressing human diploid fibroblasts. Analysis of cytotoxicity demonstrated that 1.5 Gy IR inactivated colony formation by 40–45% in three fibroblast lines; this dose was used in all subsequent analyses. Fibroblasts exhibited > 90% arrest of progression from G2 to M at 2 hr post-IR and a similarly severe arrest of progression from G1 to S at 6 and 12 hr post-IR. Normal rates of DNA synthesis and mitosis 6 and 12 hr post-IR caused the S and M compartments to empty by > 70% at 24 hr. Global gene expression was analyzed in IR-treated cells. A microarray analysis algorithm, EPIG, identified nine IR-responsive patterns of gene expression that were common to the three fibroblast lines, including a dominant p53-dependent G1 checkpoint response. Many p53 target genes, such as CDKN1A, GADD45, BTG2, and PLK3, were significantly up-regulated at 2 hr post-IR. Many genes whose expression is regulated by E2F family transcription factors, including CDK2, CCNE1, CDC6, CDC2, MCM2, were significantly down-regulated at 24 hr post-IR. Numerous genes that participate in DNA metabolism were also markedly repressed in arrested fibroblasts apparently as a result of cell synchronization behind the G1 checkpoint. However, cluster and principal component analyses of gene expression revealed a profile 24 hr post-IR with similarity to that of G0 growth quiescence. The results reveal a highly stereotypic pattern of response to IR in human diploid fibroblasts that reflects primarily synchronization behind the G1 checkpoint but with prominent induction of additional markers of G0 quiescence such as GAS1. PMID:16581545

Sphingomonas wittichii Strain RW1 Genome-Wide Gene Expression Shifts in Response to Dioxins and Clay

PubMed Central

Tsoi, Tamara V.; Iwai, Shoko; Liu, Cun; Fish, Jordan A.; Gu, Cheng; Johnson, Timothy A.; Zylstra, Gerben; Teppen, Brian J.; Li, Hui; Hashsham, Syed A.; Boyd, Stephen A.; Cole, James R.; Tiedje, James M.

2016-01-01

Sphingomonas wittichii strain RW1 (RW1) is one of the few strains that can grow on dibenzo-p-dioxin (DD). We conducted a transcriptomic study of RW1 using RNA-Seq to outline transcriptional responses to DD, dibenzofuran (DF), and the smectite clay mineral saponite with succinate as carbon source. The ability to grow on DD is rare compared to growth on the chemically similar DF even though the same initial dioxygenase may be involved in oxidation of both substrates. Therefore, we hypothesized the reason for this lies beyond catabolic pathways and may concern genes involved in processes for cell-substrate interactions such as substrate recognition, transport, and detoxification. Compared to succinate (SUC) as control carbon source, DF caused over 240 protein-coding genes to be differentially expressed, whereas more than 300 were differentially expressed with DD. Stress response genes were up-regulated in response to both DD and DF. This effect was stronger with DD than DF, suggesting a higher toxicity of DD compared to DF. Both DD and DF caused changes in expression of genes involved in active cross-membrane transport such as TonB-dependent receptor proteins, but the patterns of change differed between the two substrates. Multiple transcription factor genes also displayed expression patterns distinct to DD and DF growth. DD and DF induced the catechol ortho- and the salicylate/gentisate pathways, respectively. Both DD and DF induced the shared down-stream aliphatic intermediate compound pathway. Clay caused category-wide down-regulation of genes for cell motility and chemotaxis, particularly those involved in the synthesis, assembly and functioning of flagella. This is an environmentally important finding because clay is a major component of soil microbes’ microenvironment influencing local chemistry and may serve as a geosorbent for toxic pollutants. Similar to clay, DD and DF also affected expression of genes involved in motility and chemotaxis. PMID:27309357

Functionally Convergent B Cell Receptor Sequences in Transgenic Rats Expressing a Human B Cell Repertoire in Response to Tetanus Toxoid and Measles Antigens.

PubMed

Bürckert, Jean-Philippe; Dubois, Axel R S X; Faison, William J; Farinelle, Sophie; Charpentier, Emilie; Sinner, Regina; Wienecke-Baldacchino, Anke; Muller, Claude P

2017-01-01

The identification and tracking of antigen-specific immunoglobulin (Ig) sequences within total Ig repertoires is central to high-throughput sequencing (HTS) studies of infections or vaccinations. In this context, public Ig sequences shared by different individuals exposed to the same antigen could be valuable markers for tracing back infections, measuring vaccine immunogenicity, and perhaps ultimately allow the reconstruction of the immunological history of an individual. Here, we immunized groups of transgenic rats expressing human Ig against tetanus toxoid (TT), Modified Vaccinia virus Ankara (MVA), measles virus hemagglutinin and fusion proteins expressed on MVA, and the environmental carcinogen benzo[a]pyrene, coupled to TT. We showed that these antigens impose a selective pressure causing the Ig heavy chain (IgH) repertoires of the rats to converge toward the expression of antibodies with highly similar IgH CDR3 amino acid sequences. We present a computational approach, similar to differential gene expression analysis, that selects for clusters of CDR3s with 80% similarity, significantly overrepresented within the different groups of immunized rats. These IgH clusters represent antigen-induced IgH signatures exhibiting stereotypic amino acid patterns including previously described TT- and measles-specific IgH sequences. Our data suggest that with the presented methodology, transgenic Ig rats can be utilized as a model to identify antigen-induced, human IgH signatures to a variety of different antigens.

Genome-wide expression profiling of five mouse models identifies similarities and differences with human psoriasis.

PubMed

Swindell, William R; Johnston, Andrew; Carbajal, Steve; Han, Gangwen; Wohn, Christian; Lu, Jun; Xing, Xianying; Nair, Rajan P; Voorhees, John J; Elder, James T; Wang, Xiao-Jing; Sano, Shigetoshi; Prens, Errol P; DiGiovanni, John; Pittelkow, Mark R; Ward, Nicole L; Gudjonsson, Johann E

2011-04-04

Development of a suitable mouse model would facilitate the investigation of pathomechanisms underlying human psoriasis and would also assist in development of therapeutic treatments. However, while many psoriasis mouse models have been proposed, no single model recapitulates all features of the human disease, and standardized validation criteria for psoriasis mouse models have not been widely applied. In this study, whole-genome transcriptional profiling is used to compare gene expression patterns manifested by human psoriatic skin lesions with those that occur in five psoriasis mouse models (K5-Tie2, imiquimod, K14-AREG, K5-Stat3C and K5-TGFbeta1). While the cutaneous gene expression profiles associated with each mouse phenotype exhibited statistically significant similarity to the expression profile of psoriasis in humans, each model displayed distinctive sets of similarities and differences in comparison to human psoriasis. For all five models, correspondence to the human disease was strong with respect to genes involved in epidermal development and keratinization. Immune and inflammation-associated gene expression, in contrast, was more variable between models as compared to the human disease. These findings support the value of all five models as research tools, each with identifiable areas of convergence to and divergence from the human disease. Additionally, the approach used in this paper provides an objective and quantitative method for evaluation of proposed mouse models of psoriasis, which can be strategically applied in future studies to score strengths of mouse phenotypes relative to specific aspects of human psoriasis.

Novel molecular subtypes of serous and endometrioid ovarian cancer linked to clinical outcome.

PubMed

Tothill, Richard W; Tinker, Anna V; George, Joshy; Brown, Robert; Fox, Stephen B; Lade, Stephen; Johnson, Daryl S; Trivett, Melanie K; Etemadmoghadam, Dariush; Locandro, Bianca; Traficante, Nadia; Fereday, Sian; Hung, Jillian A; Chiew, Yoke-Eng; Haviv, Izhak; Gertig, Dorota; DeFazio, Anna; Bowtell, David D L

2008-08-15

The study aim to identify novel molecular subtypes of ovarian cancer by gene expression profiling with linkage to clinical and pathologic features. Microarray gene expression profiling was done on 285 serous and endometrioid tumors of the ovary, peritoneum, and fallopian tube. K-means clustering was applied to identify robust molecular subtypes. Statistical analysis identified differentially expressed genes, pathways, and gene ontologies. Laser capture microdissection, pathology review, and immunohistochemistry validated the array-based findings. Patient survival within k-means groups was evaluated using Cox proportional hazards models. Class prediction validated k-means groups in an independent dataset. A semisupervised survival analysis of the array data was used to compare against unsupervised clustering results. Optimal clustering of array data identified six molecular subtypes. Two subtypes represented predominantly serous low malignant potential and low-grade endometrioid subtypes, respectively. The remaining four subtypes represented higher grade and advanced stage cancers of serous and endometrioid morphology. A novel subtype of high-grade serous cancers reflected a mesenchymal cell type, characterized by overexpression of N-cadherin and P-cadherin and low expression of differentiation markers, including CA125 and MUC1. A poor prognosis subtype was defined by a reactive stroma gene expression signature, correlating with extensive desmoplasia in such samples. A similar poor prognosis signature could be found using a semisupervised analysis. Each subtype displayed distinct levels and patterns of immune cell infiltration. Class prediction identified similar subtypes in an independent ovarian dataset with similar prognostic trends. Gene expression profiling identified molecular subtypes of ovarian cancer of biological and clinical importance.

Pisrt1, a gene implicated in XX sex reversal, is expressed in gonads of both sexes during mouse development.

PubMed

Loffler, Kelly A; Combes, Alexander N; Wilhelm, Dagmar; Beverdam, Annemiek; Bowles, Jo; Koopman, Peter

2005-01-01

XX sex reversal syndromes not involving Sry provide an opportunity to identify and study genes important for sexual development. The polled intersex syndrome (PIS) in goats, which shares some features with blepharophimosis, ptosis, epicanthus inversus syndrome (BPES) in humans, exemplifies such syndromes. BPES is caused by defects in the forkhead transcription factor gene FOXL2, while PIS is caused by a large deletion of goat chromosome 1q43 that affects transcription of the genes Pisrt1 and Foxl2. Pisrt1 is a non-translated gene that has a sexually dimorphic expression pattern in goats. Here, we describe the structure and expression of the mouse Pisrt1 locus, to investigate its likely role in ovarian development more broadly in mammals. This gene showed some sequence similarity, and was found in a similar genomic context, to its goat and human orthologues. Expression analyses indicated that Pisrt1 is transcribed, and its mRNA polyadenylated and exported to the cytoplasm, but no significant open reading frames were found in a 1.5kb mouse genomic region corresponding to goat Pisrt1. Pisrt1 transcripts were expressed very broadly among tissues of the developing mouse embryo, and at similar levels in male and female gonads at each stage examined, as determined by in situ hybridisation and RT-PCR. This profile of expression suggests that Pisrt1 is unlikely to contribute to sex-specific events during gonadal development in mice and that divergent pathways of ovarian development operate among different mammalian species.

Expression of the pair-rule gene homologs runt, Pax3/7, even-skipped-1 and even-skipped-2 during larval and juvenile development of the polychaete annelid Capitella teleta does not support a role in segmentation

PubMed Central

2012-01-01

Background Annelids and arthropods each possess a segmented body. Whether this similarity represents an evolutionary convergence or inheritance from a common segmented ancestor is the subject of ongoing investigation. Methods To investigate whether annelids and arthropods share molecular components that control segmentation, we isolated orthologs of the Drosophila melanogaster pair-rule genes, runt, paired (Pax3/7) and eve, from the polychaete annelid Capitella teleta and used whole mount in situ hybridization to characterize their expression patterns. Results When segments first appear, expression of the single C. teleta runt ortholog is only detected in the brain. Later, Ct-runt is expressed in the ventral nerve cord, foregut and hindgut. Analysis of Pax genes in the C. teleta genome reveals the presence of a single Pax3/7 ortholog. Ct-Pax3/7 is initially detected in the mid-body prior to segmentation, but is restricted to two longitudinal bands in the ventral ectoderm. Each of the two C. teleta eve orthologs has a unique and complex expression pattern, although there is partial overlap in several tissues. Prior to and during segment formation, Ct-eve1 and Ct-eve2 are both expressed in the bilaterial pair of mesoteloblasts, while Ct-eve1 is expressed in the descendant mesodermal band cells. At later stages, Ct-eve2 is expressed in the central and peripheral nervous system, and in mesoderm along the dorsal midline. In late stage larvae and adults, Ct-eve1 and Ct-eve2 are expressed in the posterior growth zone. Conclusions C. teleta eve, Pax3/7 and runt homologs all have distinct expression patterns and share expression domains with homologs from other bilaterians. None of the pair-rule orthologs examined in C. teleta exhibit segmental or pair-rule stripes of expression in the ectoderm or mesoderm, consistent with an independent origin of segmentation between annelids and arthropods. PMID:22510249

Comparison of human bone marrow stromal cells cultured in human platelet growth factors and fetal bovine serum.

PubMed

Ren, Jiaqiang; Ward, Dawn; Chen, Steven; Tran, Katherine; Jin, Ping; Sabatino, Marianna; Robey, Pamela G; Stroncek, David F

2018-03-14

Bone marrow stromal cells (BMSCs) have classically been cultured in media supplemented with fetal bovine serum (FBS). As an alternative to FBS, pooled solvent detergent apheresis platelets, HPGF-C18, was evaluated for BMSC culture. A comparison of passage 2 BMSC growth revealed that 10% HPGF-C18 produced similar cell numbers as 20% FBS. Marrow aspirates from 5 healthy subjects were cultured for 4 passages in 10% HPGF-C18 or 20% FBS and were analyzed for proliferation, colony formation efficiency (CFE), surface marker expression, suppression of mixed lymphocyte reactions (MLRs), global gene and microRNA expression analysis. BMSC supernatant cytokine and growth factor concentrations were also compared. Primary cultures of marrow aspirates in 10% HPGF-C18 and 20% FBS yielded similar numbers and CFE. After 4 passages, 10% HPGF-C18 and 20% FBS yielded similar numbers of BMSCs, surface marker expression patterns and immunosuppression effects. Gene and microRNA expression analysis revealed that BMSCs cultured under the two conditions had distinct expression profiles. Gene Set Enrichment Analysis (GSEA) revealed HPGF-C18-cultured BMSCs were enriched in metabolic processing and biosynthetic pathways, cell proliferation and cell cycle pathways, and immune response pathways. FBS-cultured BMSCs were enriched in MAPK signaling, TGF-beta signaling, cell adhesion and extracellular matrix pathways. Differently expressed microRNAs were related to the osteogenesis of BMSCs. The supernatant of HPGF-C18 BMSCs had higher levels of PEDF and TGFB1 and lower levels of IL6, VEGF, SDF1 and PLGF. Traditional measures, expansion, surface marker expression and inhibition of MLRs suggest that BMSC cultured in HPGF-C18 and FBS were similar, but analysis at the molecular level revealed many differences. BMSCs cultured in HPGF-C18 should be assessed in specific functional assays that reflect application-specific potency before substituting FBS with HPGF-C18.

Accumulation of cholesterol and increased demand for zinc in serum-deprived RPE cells

PubMed Central

Mishra, Sanghamitra; Peterson, Katherine; Yin, Lili; Berger, Alan; Fan, Jianguo

2016-01-01

Purpose Having observed that confluent ARPE-19 cells (derived from human RPE) survive well in high-glucose serum-free medium (SFM) without further feeding for several days, we investigated the expression profile of RPE cells under the same conditions. Methods Expression profiles were examined with microarray and quantitative PCR (qPCR) analyses, followed by western blot analysis of key regulated proteins. The effects of low-density lipoprotein (LDL) and zinc supplementation were examined with qPCR. Immunofluorescence was used to localize the LDL receptor and to examine LDL uptake. Cellular cholesterol levels were measured with filipin binding. Expression patterns in primary fetal RPE cells were compared using qPCR. Results Microarray analyses of gene expression in ARPE-19, confirmed with qPCR, showed upregulation of lipid and cholesterol biosynthesis pathways in SFM. At the protein level, the cholesterol synthesis control factor SRBEF2 was activated, and other key lipid synthesis proteins increased. Supplementation of SFM with LDL reversed the upregulation of lipid and cholesterol synthesis genes, but not of cholesterol transport genes. The LDL receptor relocated to the plasma membrane, and LDL uptake was activated by day 5–7 in SFM, suggesting increased demand for cholesterol. Confluent ARPE-19 cells in SFM accumulated intracellular cholesterol, compared with cells supplemented with serum, over 7 days. Over the same time course in SFM, the expression of metallothioneins decreased while the major zinc transporter was upregulated, consistent with a parallel increase in demand for zinc. Supplementation with zinc reversed expression changes for metallothionein genes, but not for other zinc-related genes. Similar patterns of regulation were also seen in primary fetal human RPE cells in SFM. Conclusions ARPE-19 cells respond to serum deprivation and starvation with upregulation of the lipid and cholesterol pathways, accumulation of intracellular cholesterol, and increased demand for zinc. Similar trends are seen in primary fetal RPE cells. Cholesterol accumulation basal to RPE is a prominent feature of age-related macular degeneration (AMD), while dietary zinc is protective. It is conceivable that accumulating defects in Bruch’s membrane and dysfunction of the choriocapillaris could impede transport between RPE and vasculature in AMD. Thus, this pattern of response to serum deprivation in RPE-derived cells may have relevance for some aspects of the progression of AMD. PMID:28003730

Tissue-specific expression of the gene coding for human Clara cell 10-kD protein, a phospholipase A2-inhibitory protein.

PubMed Central

Peri, A; Cordella-Miele, E; Miele, L; Mukherjee, A B

1993-01-01

Clara cell 10-kD protein (cc10kD), a secretory phospholipase A2 inhibitor, is suggested to be the human counterpart of rabbit uteroglobin (UG). Because cc10kD is expressed constitutively at a very high level in the human respiratory epithelium, the 5' region of its gene may be useful in achieving organ-specific expression of recombinant DNA in gene therapy of diseases such as cystic fibrosis. However, it is important to establish the tissue-specific expression of this gene before designing gene transfer experiments. Since the UG gene in the rabbit is expressed in many other organs besides the lung and the endometrium, we investigated the organ and tissue specificity of human cc10kD gene expression using polymerase chain reaction, nucleotide sequence analysis, immunofluorescence, and Northern blotting. Our results indicate that, in addition to the lung, cc10kD is expressed in several nonrespiratory organs, with a distribution pattern very similar, if not identical, to that of UG in the rabbit. These results underscore the necessity for more detailed analyses of the 5' region of the human cc10kD gene before its usefulness in gene therapy could be fully assessed. These data also suggest that cc10kD and UG may have similar physiological function(s). Images PMID:8227325

An integrated genomics analysis of epigenetic subtypes in human breast tumors links DNA methylation patterns to chromatin states in normal mammary cells.

PubMed

Holm, Karolina; Staaf, Johan; Lauss, Martin; Aine, Mattias; Lindgren, David; Bendahl, Pär-Ola; Vallon-Christersson, Johan; Barkardottir, Rosa Bjork; Höglund, Mattias; Borg, Åke; Jönsson, Göran; Ringnér, Markus

2016-02-29

Aberrant DNA methylation is frequently observed in breast cancer. However, the relationship between methylation patterns and the heterogeneity of breast cancer has not been comprehensively characterized. Whole-genome DNA methylation analysis using Illumina Infinium HumanMethylation450 BeadChip arrays was performed on 188 human breast tumors. Unsupervised bootstrap consensus clustering was performed to identify DNA methylation epigenetic subgroups (epitypes). The Cancer Genome Atlas data, including methylation profiles of 669 human breast tumors, was used for validation. The identified epitypes were characterized by integration with publicly available genome-wide data, including gene expression levels, DNA copy numbers, whole-exome sequencing data, and chromatin states. We identified seven breast cancer epitypes. One epitype was distinctly associated with basal-like tumors and with BRCA1 mutations, one epitype contained a subset of ERBB2-amplified tumors characterized by multiple additional amplifications and the most complex genomes, and one epitype displayed a methylation profile similar to normal epithelial cells. Luminal tumors were stratified into the remaining four epitypes, with differences in promoter hypermethylation, global hypomethylation, proliferative rates, and genomic instability. Specific hyper- and hypomethylation across the basal-like epitype was rare. However, we observed that the candidate genomic instability drivers BRCA1 and HORMAD1 displayed aberrant methylation linked to gene expression levels in some basal-like tumors. Hypomethylation in luminal tumors was associated with DNA repeats and subtelomeric regions. We observed two dominant patterns of aberrant methylation in breast cancer. One pattern, constitutively methylated in both basal-like and luminal breast cancer, was linked to genes with promoters in a Polycomb-repressed state in normal epithelial cells and displayed no correlation with gene expression levels. The second pattern correlated with gene expression levels and was associated with methylation in luminal tumors and genes with active promoters in normal epithelial cells. Our results suggest that hypermethylation patterns across basal-like breast cancer may have limited influence on tumor progression and instead reflect the repressed chromatin state of the tissue of origin. On the contrary, hypermethylation patterns specific to luminal breast cancer influence gene expression, may contribute to tumor progression, and may present an actionable epigenetic alteration in a subset of luminal breast cancers.

Estradiol increases urethral tone through the local inhibition of neuronal nitric oxide synthase expression.

PubMed

Gamé, Xavier; Allard, Julien; Escourrou, Ghislaine; Gourdy, Pierre; Tack, Ivan; Rischmann, Pascal; Arnal, Jean-François; Malavaud, Bernard

2008-03-01

Estrogens are known to modulate lower urinary tract (LUT) trophicity and neuronal nitric oxide synthase (nNOS) expression in several organs. The aim of this study was to explore the effects of endogenous and supraestrus levels of 17beta-estradiol (E2) on LUT and urethral nNOS expression and function. LUT function and histology and urethral nNOS expression were studied in adult female mice subjected either to sham surgery, surgical castration, or castration plus chronic E2 supplementation (80 microg.kg(-1).day(-1), i.e., pregnancy level). The micturition pattern was profoundly altered by long-term supraestrus levels of E2 with decreased frequency paralleled by increased residual volumes higher than those of ovariectomized mice. Urethral resistance was increased twofold in E2-treated mice, with no structural changes in urethra, supporting a pure tonic mechanism. Acute nNOS inhibition by 7-nitroindazole decreased frequency and increased residual volumes in ovariectomized mice but had no additive effect on the micturition pattern of long-term supraestrus mice, showing that long-term supraestrus E2 levels and acute inhibition of nNOS activity had similar functional effects. Finally, E2 decreased urethral nNOS expression in ovariectomized mice. Long-term supraestrus levels of E2 increased urethral tone through inhibition of nNOS expression, whereas physiological levels of E2 had no effect.

Architectural patterns of p16 immunohistochemical expression associated with cancer immunity and prognosis of head and neck squamous cell carcinoma.

PubMed

Ryu, Hyang Joo; Kim, Eun Kyung; Heo, Su Jin; Cho, Byoung Chul; Kim, Hye Ryun; Yoon, Sun Och

2017-11-01

We evaluated the expression patterns of p16, which is used as a surrogate marker of HPV infection in head and neck squamous cell carcinoma (HNSCC), in regard to their biological and prognostic implications. p16 expression patterns and infiltrated immune cells were analyzed through immunohistochemistry of p16, CD3, CD8, PD-1, FOXP3, and CD163 on surgically resected HNSCCs (n = 393). Patterns of p16 immunoexpression were defined as STRONG (strong, diffuse expression in cytoplasm, and nucleus in >70% of tumor cells), MARGINAL (expression restricted to tumor margins), MOSAIC (ragged, discontinued expression), NUCLEAR (expression in nuclei only), and ABSENT (no expression). The STRONG pattern was more frequent in the oropharynx, and the MARGINAL pattern was noted only in the oral cavity. MOSAIC and NUCLEAR patterns were noted at variable sites. No two patterns of p16 expression showed the same immune cell composition of CD3+ T cells, CD8+ cytotoxic T cells, PD-1+ T cells, FOXP3+ regulatory T cells, and CD163+ macrophages. In overall and disease-free survival analyses, the STRONG pattern showed the most favorable prognosis, while the NUCLEAR pattern had the worst prognosis. HNSCC anatomical sites, tumor-related immune cell components, and patient outcomes were associated with p16 expression patterns. Each architectural pattern of p16 expression may be related to different biological and prognostic phenotypes. © 2017 APMIS. Published by John Wiley & Sons Ltd.

Comparative genotypic and phenotypic analysis of human peripheral blood monocytes and surrogate monocyte-like cell lines commonly used in metabolic disease research.

PubMed

Riddy, Darren M; Goy, Emily; Delerive, Philippe; Summers, Roger J; Sexton, Patrick M; Langmead, Christopher J

2018-01-01

Monocyte-like cell lines (MCLCs), including THP-1, HL-60 and U-937 cells, are used routinely as surrogates for isolated human peripheral blood mononuclear cells (PBMCs). To systematically evaluate these immortalised cells and PBMCs as model systems to study inflammation relevant to the pathogenesis of type II diabetes and immuno-metabolism, we compared mRNA expression of inflammation-relevant genes, cell surface expression of cluster of differentiation (CD) markers, and chemotactic responses to inflammatory stimuli. Messenger RNA expression analysis suggested most genes were present at similar levels across all undifferentiated cells, though notably, IDO1, which encodes for indoleamine 2,3-dioxygenase and catabolises tryptophan to kynureninase (shown to be elevated in serum from diabetic patients), was not expressed in any PMA-treated MCLC, but present in GM-CSF-treated PBMCs. There was little overall difference in the pattern of expression of CD markers across all cells, though absolute expression levels varied considerably and the correlation between MCLCs and PBMCs was improved upon MCLC differentiation. Functionally, THP-1 and PBMCs migrated in response to chemoattractants in a transwell assay, with varying sensitivity to MCP-1, MIP-1α and LTB-4. However, despite similar gene and CD expression profiles, U-937 cells were functionally impaired as no migration was observed to any chemoattractant. Our analysis reveals that the MCLCs examined only partly replicate the genotypic and phenotypic properties of human PBMCs. To overcome such issues a universal differentiation protocol should be implemented for these cell lines, similar to those already used with isolated monocytes. Although not perfect, in our hands the THP-1 cells represent the closest, simplified surrogate model of PBMCs for study of inflammatory cell migration.

The evolution of Msx gene function: expression and regulation of a sea urchin Msx class homeobox gene.

PubMed

Dobias, S L; Ma, L; Wu, H; Bell, J R; Maxson, R

1997-01-01

Msx- class homeobox genes, characterized by a distinct and highly conserved homeodomain, have been identified in a wide variety of metazoans from vertebrates to coelenterates. Although there is evidence that they participate in inductive tissue interactions that underlie vertebrate organogenesis, including those that pattern the neural crest, there is little information about their function in simple deuterostomes. Both to learn more about the ancient function of Msx genes, and to shed light on the evolution of developmental mechanisms within the lineage that gave rise to vertebrates, we have isolated and characterized Msx genes from ascidians and echinoderms. Here we describe the sequence and expression of a sea urchin (Strongylocentrotus purpouratus) Msx gene whose homeodomain is very similar to that of vertebrate Msx2. This gene, designated SpMsx, is first expressed in blastula stage embryos, apparently in a non-localized manner. Subsequently, during the early phases of gastrulation, SpMsx transcripts are expressed intensely in the invaginating archenteron and secondary mesenchyme, and at reduced levels in the ectoderm. In the latter part of gastrulation, SpMsx transcripts are concentrated in the oral ectoderm and gut, and continue to be expressed at those sites through the remainder of embryonic development. That vertebrate Msx genes are regulated by inductive tissue interactions and growth factors suggested to us that the restriction of SpMsx gene expression to the oral ectoderm and derivatives of the vegetal plate might similarly be regulated by the series of signaling events that pattern these embryonic territories. As a first test of this hypothesis, we examined the influence of exogastrulation and cell-dissociation on SpMsx gene expression. In experimentally-induced exogastrulae, SpMsx transcripts were distributed normally in the oral ectoderm, evaginated gut, and secondary mesenchyme. However, when embryos were dissociated into their component cells, SpMsx transcripts failed to accumulate. These data show that the localization of SpMsx transcripts in gastrulae does not depend on interactions between germ layers, yet the activation and maintenance of SpMsx expression does require cell-cell or cell-matrix interactions.

Expression of the beta-catenin gene in the skin of embryonic geese during feather bud development.

PubMed

Wu, W; Xu, R F; Xiao, L; Xu, H; Gao, G

2008-01-01

beta-Catenin signaling has been reported to initiate feather bud development. In the present study, beta-catenin gene was isolated and identified from a cDNA library constructed using embryonic goose skin. Expression patterns of beta-catenin gene in the dorsal skin of goose embryos were investigated using the methods of semi-quantitative reverse transcription PCR, Northern blot analysis, and in situ hybridization. The sequence of beta-catenin was found highly conserved at the amino acid level, sharing 100, 99, and 99% identity with chicken, Chinese soft-shell turtle, and human sequences, respectively. Relatively high levels (62.51 +/- 7.11% to 101.74 +/- 7.29%) of beta-catenin mRNA were detected in the dorsal skin samples. The levels of beta-catenin expression were most prominent at the early stage from embryo day (E)10 to E20 and then significantly declined with the embryonic development. In situ hybridization demonstrated that at E10, beta-catenin expression was mainly observed at the surface periderm cells and the localized region of the epidermal layer. Because feather bud forms with an anterior-posterior orientation, strong staining was observed in the periderm layer and in the ectoderm and epidermis with a diffuse distribution within the internal area of the buds. The stronger staining was seen in the barb ridges than in the center pulp of the feather follicles at E18 and E20. In this study, expression of Shh as a marker gene for the bud development was examined paralleling with expression patterns of beta-catenin. It was found that the expression pattern of beta-catenin was almost similar spatially and temporally to that of Shh mRNA at the later stages of bud development. The differential beta-catenin mRNA expression in the goose dorsal skin may be essential for promoting the normal development of embryonic feather bud.

Unaltered myocilin expression in the blood of primary open angle glaucoma patients

PubMed Central

Azad, Taif Anwar; Spaeth, George L.; Myers, Jonathan; Katz, L. Jay; Moster, Marlene; Bosley, Thomas M.

2012-01-01

Purpose To investigate the expression of the myocilin gene (MYOC) in the blood of primary open angle glaucoma (POAG) patients to determine if altered systemic expression is playing a role. Methods Patients (n=47) were eligible for inclusion if they met standard clinical criteria for POAG. Control subjects (n=27) were recruited who were free from glaucoma by examination. RNA was extracted from leukocytes of patients and controls and converted to cDNA by reverse transcriptase enzyme, and quantitative PCR was used to assess expression levels of MYOC and the house keeping gene β-globulin (HBB). The ratio of MYOC expression to HBB expression for POAG patients was compared to that of controls and to clinical characteristics of POAG patients. Results Mean gene expression values were statistically similar in POAG patients and controls for both MYOC (p≤0.55) and HBB (p≤0.48). MYOC/HBB ratios were also statistically indistinguishable between POAG patients and controls (p≤0.90). MYOC/HBB ratios were not significantly associated with age, sex, or ethnicity of patients within the POAG group. Similarly, MYOC/HBB ratios were not significantly associated with clinical parameters related to POAG severity, including maximum intraocular pressure, vertical cup-to-disk ratio, static perimetry mean deviation, or static perimetry pattern standard deviation. Conclusions MYOC expression is not altered in the blood of POAG patients, unlike MYOC expression in trabecular meshwork (TM) cultures. These results suggests that MYOC expression is not altered systemically but rather that MYOC expression may contribute to POAG pathogenesis in specific tissues such as TM. PMID:22550394

Expression and functional analyses of a Kinesin gene GhKIS13A1 from cotton (Gossypium hirsutum) fiber.

PubMed

Li, Yan-Jun; Zhu, Shou-Hong; Zhang, Xin-Yu; Liu, Yong-Chang; Xue, Fei; Zhao, Lan-Jie; Sun, Jie

2017-06-12

Cotton fiber, a natural fiber widely used in the textile industry, is differentiated from single cell of ovule epidermis. A large number of genes are believed to be involved in fiber formation, but so far only a few fiber genes have been isolated and functionally characterized in this developmental process. The Kinesin13 subfamily was found to play key roles during cell division and cell elongation, and was considered to be involved in the regulation of cotton fiber development. The full length of coding sequence of GhKIS13A1 was cloned using cDNA from cotton fiber for functional characterization. Expression pattern analysis showed that GhKIS13A1 maintained a lower expression level during cotton fiber development. Biochemical assay showed that GhKIS13A1 has microtubule binding activity and basal ATPase activity that can be activated significantly by the presence of microtubules. Overexpression of GhKIS13A1 in Arabidopsis reduced leaf trichomes and the percentage of three-branch trichomes, and increased two-branch and shriveled trichomes compared to wild-type. Additionally, the expression of GhKIS13A1 in the Arabidopsis Kinesin-13a-1 mutant rescued the defective trichome branching pattern of the mutant, making its overall trichome branching pattern back to normal. Our results suggested that GhKIS13A1 is functionally compatible with AtKinesin-13A regarding their role in regulating the number and branching pattern of leaf trichomes. Given the developmental similarities between cotton fibers and Arabidopsis trichomes, it is speculated that GhKIS13A1 may also be involved in the regulation of cotton fiber development.

Functional conservation of atonal and Math1 in the CNS and PNS

NASA Technical Reports Server (NTRS)

Ben-Arie, N.; Hassan, B. A.; Bermingham, N. A.; Malicki, D. M.; Armstrong, D.; Matzuk, M.; Bellen, H. J.; Zoghbi, H. Y.

2000-01-01

To determine the extent to which atonal and its mouse homolog Math1 exhibit functional conservation, we inserted (beta)-galactosidase (lacZ) into the Math1 locus and analyzed its expression, evaluated consequences of loss of Math1 function, and expressed Math1 in atonal mutant flies. lacZ under the control of Math1 regulatory elements duplicated the previously known expression pattern of Math1 in the CNS (i.e., the neural tube, dorsal spinal cord, brainstem, and cerebellar external granule neurons) but also revealed new sites of expression: PNS mechanoreceptors (inner ear hair cells and Merkel cells) and articular chondrocytes. Expressing Math1 induced ectopic chordotonal organs (CHOs) in wild-type flies and partially rescued CHO loss in atonal mutant embryos. These data demonstrate that both the mouse and fly homologs encode lineage identity information and, more interestingly, that some of the cells dependent on this information serve similar mechanoreceptor functions.

Expression of pathogenicity-related genes of Xylella fastidiosa in vitro and in planta.

PubMed

de Souza, Alessandra A; Takita, Marco A; Pereira, Eridan O; Coletta-Filho, Helvécio D; Machado, Marcos A

2005-04-01

Xylella fastidiosa is responsible for several economically important plant diseases. It is currently assumed that the symptoms are caused by vascular occlusion due to biofilm formation. Microarray technology was previously used to examine the global gene expression profile of X. fastidiosa freshly isolated from symptomatic plants or after several passages by axenic culture medium, and different pathogenicity profiles have been obtained. In the present study the expression of some pathogenicity-related genes was evaluated in vitro and in planta by RT-PCR. The results suggest that adhesion is important at the beginning of biofilm formation, while the genes related to adaptation are essential for the organism's maintenance in planta. Similar results were observed in vitro mainly for the adhesion genes. The pattern of expression observed suggests that adhesion modulates biofilm formation whereas the expression of some adaptation genes may be related to the environment in which the organism is living.

Changes in expression and secretion patterns of fibroblast growth factor 8 and Sonic Hedgehog signaling pathway molecules during murine neural stem/progenitor cell differentiation in vitro☆

PubMed Central

Lu, Jiang; Lu, Kehuan; Li, Dongsheng

2012-01-01

In the present study, we investigated the dynamic expression of fibroblast growth factor 8 and Sonic Hedgehog signaling pathway related factors in the process of in vitro hippocampal neural stem/progenitor cell differentiation from embryonic Sprague-Dawley rats or embryonic Kunming species mice, using fluorescent quantitative reverse transcription-PCR and western blot analyses. Results demonstrated that the dynamic expression of fibroblast growth factor 8 was similar to fibroblast growth factor receptor 1 expression but not to other fibroblast growth factor receptors. Enzyme-linked immunosorbent assay demonstrated that fibroblast growth factor 8 and Sonic Hedgehog signaling pathway protein factors were secreted by neural cells into the intercellular niche. Our experimental findings indicate that fibroblast growth factor 8 and Sonic Hedgehog expression may be related to the differentiation of neural stem/progenitor cells. PMID:25624789

Comprehensive analysis and discovery of drought-related NAC transcription factors in common bean.

PubMed

Wu, Jing; Wang, Lanfen; Wang, Shumin

2016-09-07

Common bean (Phaseolus vulgaris L.) is an important warm-season food legume. Drought is the most important environmental stress factor affecting large areas of common bean via plant death or reduced global production. The NAM, ATAF1/2 and CUC2 (NAC) domain protein family are classic transcription factors (TFs) involved in a variety of abiotic stresses, particularly drought stress. However, the NAC TFs in common bean have not been characterized. In the present study, 86 putative NAC TF proteins were identified from the common bean genome database and located on 11 common bean chromosomes. The proteins were phylogenetically clustered into 8 distinct subfamilies. The gene structure and motif composition of common bean NACs were similar in each subfamily. These results suggest that NACs in the same subfamily may possess conserved functions. The expression patterns of common bean NAC genes were also characterized. The majority of NACs exhibited specific temporal and spatial expression patterns. We identified 22 drought-related NAC TFs based on transcriptome data for drought-tolerant and drought-sensitive genotypes. Quantitative real-time PCR (qRT-PCR) was performed to confirm the expression patterns of the 20 drought-related NAC genes. Based on the common bean genome sequence, we analyzed the structural characteristics, genome distribution, and expression profiles of NAC gene family members and analyzed drought-responsive NAC genes. Our results provide useful information for the functional characterization of common bean NAC genes and rich resources and opportunities for understanding common bean drought stress tolerance mechanisms.

Muscle-specific gene expression is underscored by differential stressor responses and coexpression changes.

PubMed

Moreno-Sánchez, Natalia; Rueda, Julia; Reverter, Antonio; Carabaño, María Jesús; Díaz, Clara

2012-03-01

Variations on the transcriptome from one skeletal muscle type to another still remain unknown. The reliable identification of stable gene coexpression networks is essential to unravel gene functions and define biological processes. The differential expression of two distinct muscles, M. flexor digitorum (FD) and M. psoas major (PM), was studied using microarrays in cattle to illustrate muscle-specific transcription patterns and to quantify changes in connectivity regarding the expected gene coexpression pattern. A total of 206 genes were differentially expressed (DE), 94 upregulated in PM and 112 in FD. The distribution of DE genes in pathways and biological functions was explored in the context of system biology. Global interactomes for genes of interest were predicted. Fast/slow twitch genes, genes coding for extracellular matrix, ribosomal and heat shock proteins, and fatty acid uptake centred the specific gene expression patterns per muscle. Genes involved in repairing mechanisms, such as ribosomal and heat shock proteins, suggested a differential ability of muscles to react to similar stressing factors, acting preferentially in slow twitch muscles. Muscle attributes do not seem to be completely explained by the muscle fibre composition. Changes in connectivity accounted for 24% of significant correlations between DE genes. Genes changing their connectivity mostly seem to contribute to the main differential attributes that characterize each specific muscle type. These results underscore the unique flexibility of skeletal muscle where a substantial set of genes are able to change their behavior depending on the circumstances.

Skeletal muscle repair in a mouse model of nemaline myopathy

PubMed Central

Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

2012-01-01

Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles. PMID:16877500

Skeletal muscle repair in a mouse model of nemaline myopathy.

PubMed

Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

2006-09-01

Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

Accelerated recruitment of new brain development genes into the human genome.

PubMed

Zhang, Yong E; Landback, Patrick; Vibranovski, Maria D; Long, Manyuan

2011-10-01

How the human brain evolved has attracted tremendous interests for decades. Motivated by case studies of primate-specific genes implicated in brain function, we examined whether or not the young genes, those emerging genome-wide in the lineages specific to the primates or rodents, showed distinct spatial and temporal patterns of transcription compared to old genes, which had existed before primate and rodent split. We found consistent patterns across different sources of expression data: there is a significantly larger proportion of young genes expressed in the fetal or infant brain of humans than in mouse, and more young genes in humans have expression biased toward early developing brains than old genes. Most of these young genes are expressed in the evolutionarily newest part of human brain, the neocortex. Remarkably, we also identified a number of human-specific genes which are expressed in the prefrontal cortex, which is implicated in complex cognitive behaviors. The young genes upregulated in the early developing human brain play diverse functional roles, with a significant enrichment of transcription factors. Genes originating from different mechanisms show a similar expression bias in the developing brain. Moreover, we found that the young genes upregulated in early brain development showed rapid protein evolution compared to old genes also expressed in the fetal brain. Strikingly, genes expressed in the neocortex arose soon after its morphological origin. These four lines of evidence suggest that positive selection for brain function may have contributed to the origination of young genes expressed in the developing brain. These data demonstrate a striking recruitment of new genes into the early development of the human brain.

Genome-scale gene expression characteristics define the follicular initiation and developmental rules during folliculogenesis.

PubMed

Shi, Kerong; He, Feng; Yuan, Xuefeng; Zhao, Yaofeng; Deng, Xuemei; Hu, Xiaoxiang; Li, Ning

2013-08-01

The ovarian follicle supplies a unique dynamic system for gametes that ensures the propagation of the species. During folliculogenesis, the vast majority of the germ cells are lost or inactivated because of ovarian follicle atresia, resulting in diminished reproductive potency and potential infertility. Understanding the underlying molecular mechanism of folliculogenesis rules is essential. Primordial (P), preantral (M), and large antral (L) porcine follicles were used to reveal their genome-wide gene expression profiles. Results indicate that primordial follicles (P) process a diverse gene expression pattern compared to growing follicles (M and L). The 5,548 differentially expressed genes display a similar expression mode in M and L, with a correlation coefficient of 0.892. The number of regulated (both up and down) genes in M is more than that in L. Also, their regulation folds in M (2-364-fold) are much more acute than in L (2-75-fold). Differentially expressed gene groups with different regulation patterns in certain follicular stages are identified and presumed to be closely related following follicular developmental rules. Interestingly, functional annotation analysis revealed that these gene groups feature distinct biological processes or molecular functions. Moreover, representative candidate genes from these gene groups have had their RNA or protein expressions within follicles confirmed. Our study emphasized genome-scale gene expression characteristics, which provide novel entry points for understanding the folliculogenesis rules on the molecular level, such as follicular initiation, atresia, and dominance. Transcriptional regulatory circuitries in certain follicular stages are expected to be found among the identified differentially expressed gene groups.

Identification of a phorbol ester-repressible v-src-inducible gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Simmons, D.L.; Levy, D.B.; Yannoni, Y.

1989-02-01

Chicken embryo fibroblasts (CEF) infected with a temperature-sensitive Rous sarcoma virus (RSV) mutant, tsNY72-4, express a set of pp60{sup v-src}-induced RNAs soon after shift to the permissive temperature. By subtractive and differential screening, the authors have cloned 12 of these sequences, 2 of which were c-fos and krox-24. Serum induced all the v-src-inducible genes tested, suggesting that these genes serve roles in normal cell division and are not specific to transformation per se. Significantly, however, v-src produced prolonged, and in some cases kinetically complex, patterns of induction compared to serum. For most of the clones, phorbol 12-tetradecanoate 13-acetate (TPA) inducedmore » mRNAs with kinetics similar to that of serum. However, one clone (CEF-4) was expressed in a biphasic manner. Another (CEF-10) was repressed by TPA at 1 hr, after which this mRNA was permanently induced. The pattern of repression-induction of CEF-10 mRNA is the inverse of protein kinase C (PKC) activity in the cell, suggesting that PKC actively represses this gene. In vivo expression of CEF-10 mRNA is restricted predominantly to the lung. A full-length CEF-10 cDNA encodes a 41-kDa protein that has an amino-terminal signal peptide for secretion, contains a markedly high number of cysteine residues, and shows no sequence similarity to known proteins.« less

Cortical orofacial motor representation in Old World monkeys, great apes, and humans. I. Quantitative analysis of cytoarchitecture.

PubMed

Sherwood, Chet C; Holloway, Ralph L; Erwin, Joseph M; Schleicher, Axel; Zilles, Karl; Hof, Patrick R

2004-01-01

Social life in anthropoid primates is mediated by interindividual communication, involving movements of the orofacial muscles for the production of vocalization and gestural expression. Although phylogenetic diversity has been reported in the auditory and visual communication systems of primates, little is known about the comparative neuroanatomy that subserves orofacial movement. The current study reports results from quantitative image analysis of the region corresponding to orofacial representation of primary motor cortex (Brodmann's area 4) in several catarrhine primate species (Macaca fascicularis, Papio anubis, Pongo pygmaeus, Gorilla gorilla, Pan troglodytes, and Homo sapiens) using the Grey Level Index method. This cortical region has been implicated in the execution of skilled motor activities such as voluntary facial expression and human speech. Density profiles of the laminar distribution of Nissl-stained neuronal somata were acquired from high-resolution images to quantify cytoarchitectural patterns. Despite general similarity in these profiles across catarrhines, multivariate analysis showed that cytoarchitectural patterns of individuals were more similar within-species versus between-species. Compared to Old World monkeys, the orofacial representation of area 4 in great apes and humans was characterized by an increased relative thickness of layer III and overall lower cell volume densities, providing more neuropil space for interconnections. These phylogenetic differences in microstructure might provide an anatomical substrate for the evolution of greater volitional fine motor control of facial expressions in great apes and humans. Copyright 2004 S. Karger AG, Basel

bullwinkle and shark regulate dorsal-appendage morphogenesis in Drosophila oogenesis.

PubMed

Tran, David H; Berg, Celeste A

2003-12-01

bullwinkle (bwk) regulates embryonic anteroposterior patterning and, through a novel germline-to-soma signal, morphogenesis of the eggshell dorsal appendages. We screened for dominant modifiers of the bullwinkle mooseantler eggshell phenotype and identified shark, which encodes an SH2-domain, ankyrin-repeat tyrosine kinase. At the onset of dorsal-appendage formation, shark is expressed in a punctate pattern in the squamous stretch cells overlying the nurse cells. Confocal microscopy with cell-type-specific markers demonstrates that the stretch cells act as a substrate for the migrating dorsal-appendage-forming cells and extend cellular projections towards them. Mosaic analyses reveal that shark is required in follicle cells for cell migration and chorion deposition. Proper shark RNA expression in the stretch cells requires bwk activity, while restoration of shark expression in the stretch cells suppresses the bwk dorsal-appendage phenotype. These results suggest that shark plays an important downstream role in the bwk-signaling pathway. Candidate testing implicates Src42A in a similar role, suggesting conservation with a vertebrate signaling pathway involving non-receptor tyrosine kinases.

Physiological role of ghrelin as revealed by the ghrelin and GOAT knockout mice.

PubMed

Kang, Kihwa; Zmuda, Erik; Sleeman, Mark W

2011-11-01

Ghrelin is a gastric hormone that has been shown to regulate food intake and energy metabolism. One unique feature of ghrelin is that its activity is regulated post transcriptionally by ghrelin O-acyltransferase (GOAT) through the addition of fatty acid to the serine residue in the N terminal region. Despite much biochemical characterization, to date no other proteins have been shown to be specifically octonylated by GOAT, suggesting a unique matching of the acyl transferase for a single ligand, ghrelin. If this is indeed correct, then genetic deletion of ghrelin or GOAT should produce near identical phenotypes and there should be extensive overlap in expression patterns. This review summarizes the similarities and differences in the phenotypes with the genetic deletion of ghrelin and GOAT in the various knockout mouse lines reported to date. While there is considerable overlap in expression pattern between ghrelin and GOAT, the latter does exhibit some unique tissue expression that could suggest that additional peptides may be acylated and await discovery and characterization. Copyright © 2011 Elsevier Inc. All rights reserved.

Expression and enzymatic activity of phenylalanine ammonia-lyase and p-coumarate 3-hydroxylase in mango (Mangifera indica 'Ataulfo') during ripening.

PubMed

Palafox-Carlos, H; Contreras-Vergara, C A; Muhlia-Almazán, A; Islas-Osuna, M A; González-Aguilar, G A

2014-05-16

Phenylalanine ammonia lyase (PAL) and p-coumarate 3-hydroxylase (C3H) are key enzymes in the phenylpropanoid pathway. The relative expression of PAL and C3H was evaluated in mango fruit cultivar 'Ataulfo' in four ripening stages (RS1, RS2, RS3, and RS4) by quantitative polymerase chain reaction. In addition, enzyme activity of PAL and C3H was determined in mango fruits during ripening. The PAL levels were downregulated at the RS2 and RS3 stages, while C3H levels were upregulated in fruits only at RS3. The enzyme activity of PAL followed a pattern that was different from that of the PAL expression, thus suggesting regulation at several levels. For C3H, a regulation at the transcriptional level is suggested because a similar pattern was revealed by its activity and transcript level. In this study, the complexity of secondary metabolite biosynthesis regulation is emphasized because PAL and C3H enzymes are involved in the biosynthesis of several secondary metabolites that are active during all mango ripening stages.

Developmental patterns of emission of scent compounds and related gene expression in roses of the cultivar Rosa x hybrida cv. 'Yves Piaget'.

PubMed

Chen, Xiaomin; Baldermann, Susanne; Cao, Shuyan; Lu, Yao; Liu, Caixia; Hirata, Hiroshi; Watanabe, Naoharu

2015-02-01

2-Phenylethanol (2PE) and 3,5-dimethoxytoluene (DMT) are characteristic scent compounds in specific roses such as Rosa x hybrida cv. 'Yves Piaget'. We analyzed the endogenous concentrations and emission of 2PE and DMT during the unfurling process in different floral organs, as well as changes in transcript levels of the two key genes, PAR and OOMT2. The emission of both 2PE and DMT increased during floral development to reach peaks at the fully unfurled stage. The relative transcripts of PAR and OOMT2 also increased during floral development. Whereas the maximum for OOMT2 was found at the fully unfurled stage (stage 4), similar expression levels of PAR were detected at stage 4 and the senescence stage (stage 6). The results demonstrate a positive correlation between the expression levels of PAR and OOMT2 and the emission of 2PE and DMT. In addition, endogenous volatiles and relative transcripts showed tissue- and development-specific patterns. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Methylation and expression patterns of tropomyosin-related kinase genes in different grades of glioma.

PubMed

Palani, Mahalakshmi; Arunkumar, R; Vanisree, Arrambakam Janardhanam

2014-09-01

Tropomyosin-related kinase family (NTRK1, NTRK2 and NTRK3) is well known to play an important role in the pathogenesis of brain tumour, which exhibit heterogeneity in its biological and clinical behaviour. However, the mechanism that regulates NTRKs in glioma is not well understood. The present study investigates the epigenetic status (methylation) of NTRKs and their expression in different grades of glioma. Promoter methylation and structural relationship of NTRKs was assessed using methylation-specific PCR followed by chromatin immunoprecipitation in brain tissue samples from 220 subjects with different grades of glioma. Control brain samples were also assessed similarly. Reverse transcriptase PCR was performed to analyse the expressions of NTRK mRNAs in the grades of glioma. In addition, the expression level of p75(NTR) protein was analysed using immunofluorescent technique in all of the samples. The overall percentage of NTRK3 gene methylation frequency with subsequent loss of mRNA expression was significantly higher in glioma compared with control samples (p < 0.05). No such significance was observed in other NTRK1 and NTRK2 genes. Further, mRNA expression pattern of NTRK1 and NTRK2 genes was found to be significantly higher in low grades as compared with high grades (HG) and control samples (p < 0.05). Survival rate of HG patients with negative expressions of NTRK1 and NTRK2 was poor than those with the positive expressions of both NTRK1 and NTRK2. Further, a significant correlation was observed with reduced expression of p75(NTR) and the expression pattern of NTRK family in glioma as compared with the control samples (p < 0.05). There exists a correlation between the expression of NTRK family and different grades of glioma with a significant suggestion that the promoter methylation does not play role in the regulation of these genes in glioma. Further, poor survival could be associated with NTRK mRNAs 1 and 2. Hence, NTRKs are potential probes for assessing the behaviour of different grades of glioma, which could also function as significant prognostic factors and thus deserve wider attention for an effective management of the grades.

Quantitative expression patterns of GDF9 and BMP15 genes in sheep ovarian follicles grown in vivo or cultured in vitro.

PubMed

Kona, S S R; Praveen Chakravarthi, V; Siva Kumar, A V N; Srividya, D; Padmaja, K; Rao, V H

2016-01-15

Quantitative patterns of expression of the growth differentiation factor 9 (GDF9) and bone morphogenic protein 15 (BMP15) genes in different development stages of in vivo and in vitro grown ovarian follicles in sheep were studied for the first time. Both GDF9 and BMP15 were expressed in the cumulus cells and oocytes at all the development stages of in vivo and in vitro grown ovarian follicles. Growth differentiation factor 9 and bone morphogenic protein 15 exhibited stage-specific undulations in the expression in the cumulus cells and oocytes isolated from in vivo grown ovarian follicles. These undulations could be related to discrete development events during the ovarian follicle development. The expression of GDF9 and BMP15 was highest (3.38 ± 0.02 and 2.69 ± 0.06, respectively; P ≤ 0.05) in the primordial follicles compared with preantral, early antral, antral, and large antral stages. Similarly, GDF9 and BMP15 expression in the cumulus cells (0 ± 0.16 and 0 ± 0.07) and oocytes (1.47 ± 0.07 and 1.32 ± 0.03) was lowest (P ≤ 0.05) in the in vivo grown antral follicles. In the cultured follicles, the stage-specific undulations observed in the expression of GDF9 and BMP15 in the in vivo grown follicles were either different or abolished. For example, in the oocytes from in vitro grown follicles, the expression of BMP15 did not change as the development progressed all the way from preantral to large antral follicle stage although in the oocytes from in vivo grown follicles BMP15 expression exhibited stage-specific variations. It is concluded that GDF9 and BMP15 follow a stage-specific pattern of expression during the in vivo development of ovarian follicles in sheep, and in vitro culture altered the stage-specific changes in the expression of these two genes. Copyright © 2016 Elsevier Inc. All rights reserved.

GABAA receptor subunit gene expression in human prefrontal cortex: comparison of schizophrenics and controls

NASA Technical Reports Server (NTRS)

Akbarian, S.; Huntsman, M. M.; Kim, J. J.; Tafazzoli, A.; Potkin, S. G.; Bunney, W. E. Jr; Jones, E. G.; Bloom, F. E. (Principal Investigator)

1995-01-01

The prefrontal cortex of schizophrenics is hypoactive and displays changes related to inhibitory, GABAergic neurons, and GABAergic synapses. These changes include decreased levels of glutamic acid decarboxylase (GAD), the enzyme for GABA synthesis, upregulation of muscimol binding, and downregulation of benzodiazepine binding to GABAA receptors. Studies in the visual cortex of nonhuman primates have demonstrated that gene expression for GAD and for several GABAA receptor subunit polypeptides is under control of neuronal activity, raising the possibility that similar mechanisms in the hypoactive prefrontal cortex of schizophrenics may explain the abnormalities in GAD and in GABAA receptor regulation. In the present study, which is the first of its type on human cerebral cortex, levels of mRNAs for six GABAA receptor subunits (alpha 1, alpha 2, alpha 5, beta 1, beta 2, gamma 2) and their laminar expression patterns were analyzed in the prefrontal cortex of schizophrenics and matched controls, using in situ hybridization histochemistry and densitometry. Three types of laminar expression pattern were observed: mRNAs for the alpha 1, beta 2, and gamma 2 subunits, which are the predominant receptor subunits expressed in the mature cortex, were expressed at comparatively high levels by cells of all six cortical layers, but most intensely by cells in lower layer III and layer IV. mRNAs for the alpha 2, alpha 5, and beta 1 subunits were expressed at lower levels; alpha 2 and beta 1 were expressed predominantly by cells in layers II, III, and IV; alpha 5 was expressed predominantly in layers IV, V, and VI. There were no significant changes in overall mRNA levels for any of the receptor subunits in the prefrontal cortex of schizophrenics, and the laminar expression pattern of all six receptor subunit mRNAs did not differ between schizophrenics and controls. Because gene expression for GABAA receptor subunits is not consistently altered in the prefrontal cortex of schizophrenics, the previously reported upregulation of muscimol binding sites and downregulation of benzodiazepine binding sites in the prefrontal and adjacent cingulate cortex of schizophrenics are possibly due to posttranscriptional modifications of mRNAs and their translated polypeptides.

A Novel Persistence Associated EBV miRNA Expression Profile Is Disrupted in Neoplasia

PubMed Central

Qiu, Jin; Cosmopoulos, Katherine; Pegtel, Michiel; Hopmans, Erik; Murray, Paul; Middeldorp, Jaap; Shapiro, Michael; Thorley-Lawson, David A.

2011-01-01

We have performed the first extensive profiling of Epstein-Barr virus (EBV) miRNAs on in vivo derived normal and neoplastic infected tissues. We describe a unique pattern of viral miRNA expression by normal infected cells in vivo expressing restricted viral latency programs (germinal center: Latency II and memory B: Latency I/0). This includes the complete absence of 15 of the 34 miRNAs profiled. These consist of 12 BART miRNAs (including approximately half of Cluster 2) and 3 of the 4 BHRF1 miRNAs. All but 2 of these absent miRNAs become expressed during EBV driven growth (Latency III). Furthermore, EBV driven growth is accompanied by a 5–10 fold down regulation in the level of the BART miRNAs expressed in germinal center and memory B cells. Therefore, Latency III also expresses a unique pattern of viral miRNAs. We refer to the miRNAs that are specifically expressed in EBV driven growth as the Latency III associated miRNAs. In EBV associated tumors that employ Latency I or II (Burkitt's lymphoma, Hodgkin's disease, nasopharyngeal carcinoma and gastric carcinoma), the Latency III associated BART but not BHRF1 miRNAs are up regulated. Thus BART miRNA expression is deregulated in the EBV associated tumors. This is the first demonstration that Latency III specific genes (the Latency III associated BARTs) can be expressed in these tumors. The EBV associated tumors demonstrate very similar patterns of miRNA expression yet were readily distinguished when the expression data were analyzed either by heat-map/clustering or principal component analysis. Systematic analysis revealed that the information distinguishing the tumor types was redundant and distributed across all the miRNAs. This resembles “secret sharing” algorithms where information can be distributed among a large number of recipients in such a way that any combination of a small number of recipients is able to understand the message. Biologically, this may be a consequence of functional redundancy between the miRNAs. PMID:21901094

Construction and comparison of gene co-expression networks shows complex plant immune responses

PubMed Central

López, Camilo; López-Kleine, Liliana

2014-01-01

Gene co-expression networks (GCNs) are graphic representations that depict the coordinated transcription of genes in response to certain stimuli. GCNs provide functional annotations of genes whose function is unknown and are further used in studies of translational functional genomics among species. In this work, a methodology for the reconstruction and comparison of GCNs is presented. This approach was applied using gene expression data that were obtained from immunity experiments in Arabidopsis thaliana, rice, soybean, tomato and cassava. After the evaluation of diverse similarity metrics for the GCN reconstruction, we recommended the mutual information coefficient measurement and a clustering coefficient-based method for similarity threshold selection. To compare GCNs, we proposed a multivariate approach based on the Principal Component Analysis (PCA). Branches of plant immunity that were exemplified by each experiment were analyzed in conjunction with the PCA results, suggesting both the robustness and the dynamic nature of the cellular responses. The dynamic of molecular plant responses produced networks with different characteristics that are differentiable using our methodology. The comparison of GCNs from plant pathosystems, showed that in response to similar pathogens plants could activate conserved signaling pathways. The results confirmed that the closeness of GCNs projected on the principal component space is an indicative of similarity among GCNs. This also can be used to understand global patterns of events triggered during plant immune responses. PMID:25320678

Transcriptional profiling of Epstein–Barr virus (EBV) genes and host cellular genes in nasal NK/T-cell lymphoma and chronic active EBV infection

PubMed Central

Zhang, Y; Ohyashiki, J H; Takaku, T; Shimizu, N; Ohyashiki, K

2006-01-01

Nasal NK/T-cell lymphoma is an aggressive subtype of non-Hodgkin lymphoma (NHL) that is closely associated with Epstein–Barr virus (EBV). The clonal expansion of EBV-infected NK or T cells is also seen in patients with chronic active EBV (CAEBV) infection, suggesting that two diseases might share a partially similar mechanism by which EBV affects host cellular gene expression. To understand the pathogenesis of EBV-associated NK/T-cell lymphoproliferative disorders (LPD) and design new therapies, we employed a novel EBV DNA microarray to compare patterns of EBV expression in six cell lines established from EBV-associated NK/T-cell LPD. We found that expression of BZLF1, which encodes the immediate-early gene product Zta, was expressed in SNK/T cells and the expression levels were preferentially high in cell lines from CAEBV infection. We also analyzsd the gene expression patterns of host cellular genes using a human oligonucleotide DNA microarray. We identified a subset of pathogenically and clinically relevant host cellular genes, including TNFRSF10D, CDK2, HSPCA, IL12A as a common molecular biological properties of EBV-associated NK/T-cell LPD and a subset of genes, such as PDCD4 as a putative contributor for disease progression. This study describes a novel approach from the aspects of viral and host gene expression, which could identify novel therapeutic targets in EBV-associated NK/T-cell LPD. PMID:16449999

Analysis of C. elegans VIG-1 expression.

PubMed

Shin, Kyoung-Hwa; Choi, Boram; Park, Yang-Seo; Cho, Nam Jeong

2008-12-31

Double-stranded RNA (dsRNA) induces gene silencing in a sequence-specific manner by a process known as RNA interference (RNAi). The RNA-induced silencing complex (RISC) is a multi-subunit ribonucleoprotein complex that plays a key role in RNAi. VIG (Vasa intronic gene) has been identified as a component of Drosophila RISC; however, the role VIG plays in regulating RNAi is poorly understood. Here, we examined the spatial and temporal expression patterns of VIG-1, the C. elegans ortholog of Drosophila VIG, using a vig-1::gfp fusion construct. This construct contains the 908-bp region immediately upstream of vig-1 gene translation initiation site. Analysis by confocal microscopy demonstrated GFP-VIG-1 expression in a number of tissues including the pharynx, body wall muscle, hypodermis, intestine, reproductive system, and nervous system at the larval and adult stages. Furthermore, western blot analysis showed that VIG-1 is present in each developmental stage examined. To investigate regulatory sequences for vig-1 gene expression, we generated constructs containing deletions in the upstream region. It was determined that the GFP expression pattern of a deletion construct (delta-908 to -597) was generally similar to that of the non-deletion construct. In contrast, removal of a larger segment (delta-908 to -191) resulted in the loss of GFP expression in most cell types. Collectively, these results indicate that the 406-bp upstream region (-596 to -191) contains essential regulatory sequences required for VIG-1 expression.

Characterization of a new, inducible transgenic mouse model with GFP expression in melanocytes and their precursors.

PubMed

Joshi, Sandeep S; Tandukar, Bishal; Castaneda, Maira; Jiang, Shunlin; Diwakar, Ganesh; Hertzano, Ronna P; Hornyak, Thomas J

2018-01-01

Melanocytes are neural crest-derived cells that are responsible for mammalian hair follicle (HF) pigmentation. The Dct-LacZ transgenic mouse is extensively used to study melanocyte biology but lacks conditionally-inducible labelling and fluorescent labelling, enabling specific, viable isolation of melanocytes using fluorescence-activated cell sorting (FACS). Here, we have generated a Tet-off bitransgenic mouse model, Dct-H2BGFP, containing Dct-tTA and TRE-H2BGFP transgenes. Characterization of Dct-H2BGFP mice confirmed a pattern of Dct-H2BGFP expression in melanoblasts, melanocyte stem cells (McSCs), and terminally differentiated melanocytes similar to the expression pattern of previously published mouse models Dct-LacZ and iDct-GFP. GFP expression is regulated by doxycycline. GFP is shown to co-localize with melanocyte label-retaining cells (LRCs) identified through BrdU retention. The GFP-expressing cells identified in vivo in the bulge and the secondary hair germ of telogen HFs of Dct-H2BGFP mice express the melanocyte and melanocyte stem cell markers Dct and Kit. Using Dct-H2BGFP mice, we separated GFP-expressing cells from the telogen HF based on FACS and showed that GFP-expressing cells express high levels of Kit and Dct, and lower levels of HF epithelial keratin genes. We also show that GFP-expressing cells express high levels of the melanocyte differentiation genes Tyr, Tyrp1, and Pmel17, further substantiating their identity within the melanocyte lineage. Thus, Dct-H2BGFP mice are not only useful for the in vivo identification of melanocytic cells, but also for isolating them viably and studying their molecular and biological properties. Published by Elsevier B.V.

Color pattern analysis of nymphalid butterfly wings: revision of the nymphalid groundplan.

PubMed

Otaki, Joji M

2012-09-01

To better understand the developmental mechanisms of color pattern variation in butterfly wings, it is important to construct an accurate representation of pattern elements, known as the "nymphalid groundplan". However, some aspects of the current groundplan remain elusive. Here, I examined wing-wide elemental patterns of various nymphalid butterflies and confirmed that wing-wide color patterns are composed of the border, central, and basal symmetry systems. The central and basal symmetry systems can express circular patterns resembling eyespots, indicating that these systems have developmental mechanisms similar to those of the border symmetry system. The wing root band commonly occurs as a distinct symmetry system independent from the basal symmetry system. In addition, the marginal and submarginal bands are likely generated as a single system, referred to as the "marginal band system". Background spaces between two symmetry systems are sometimes light in coloration and can produce white bands, contributing significantly to color pattern diversity. When an element is enlarged with a pale central area, a visually similar (yet developmentally distinct) white band is produced. Based on the symmetric relationships of elements, I propose that both the central and border symmetry systems are comprised of "core elements" (the discal spot and the border ocelli, respectively) and a pair of "paracore elements" (the distal and proximal bands and the parafocal elements, respectively). Both core and paracore elements can be doubled, or outlined. Developmentally, this system configuration is consistent with the induction model, but not with the concentration gradient model for positional information.

MSL: A Measure to Evaluate Three-dimensional Patterns in Gene Expression Data

PubMed Central

Gutiérrez-Avilés, David; Rubio-Escudero, Cristina

2015-01-01

Microarray technology is highly used in biological research environments due to its ability to monitor the RNA concentration levels. The analysis of the data generated represents a computational challenge due to the characteristics of these data. Clustering techniques are widely applied to create groups of genes that exhibit a similar behavior. Biclustering relaxes the constraints for grouping, allowing genes to be evaluated only under a subset of the conditions. Triclustering appears for the analysis of longitudinal experiments in which the genes are evaluated under certain conditions at several time points. These triclusters provide hidden information in the form of behavior patterns from temporal experiments with microarrays relating subsets of genes, experimental conditions, and time points. We present an evaluation measure for triclusters called Multi Slope Measure, based on the similarity among the angles of the slopes formed by each profile formed by the genes, conditions, and times of the tricluster. PMID:26124630

Influence of the interaction between nodal fibroblast and breast cancer cells on gene expression

PubMed Central

Santos, Rosângela Portilho Costa; Benvenuti, Ticiana Thomazine; Honda, Suzana Terumi; Del Valle, Paulo Roberto; Katayama, Maria Lucia Hirata; Brentani, Helena Paula; Carraro, Dirce Maria; Rozenchan, Patrícia Bortman; Brentani, Maria Mitzi; de Lyra, Eduardo Carneiro; Torres, César Henrique; Salzgeber, Marcia Batista; Kaiano, Jane Haruko Lima; Góes, João Carlos Sampaio

2010-01-01

Our aim was to evaluate the interaction between breast cancer cells and nodal fibroblasts, by means of their gene expression profile. Fibroblast primary cultures were established from negative and positive lymph nodes from breast cancer patients and a similar gene expression pattern was identified, following cell culture. Fibroblasts and breast cancer cells (MDA-MB231, MDA-MB435, and MCF7) were cultured alone or co-cultured separated by a porous membrane (which allows passage of soluble factors) for comparison. Each breast cancer lineage exerted a particular effect on fibroblasts viability and transcriptional profile. However, fibroblasts from positive and negative nodes had a parallel transcriptional behavior when co-cultured with a specific breast cancer cell line. The effects of nodal fibroblasts on breast cancer cells were also investigated. MDA MB-231 cells viability and migration were enhanced by the presence of fibroblasts and accordingly, MDA-MB435 and MCF7 cells viability followed a similar pattern. MDA-MB231 gene expression profile, as evaluated by cDNA microarray, was influenced by the fibroblasts presence, and HNMT, COMT, FN3K, and SOD2 were confirmed downregulated in MDA-MB231 co-cultured cells with fibroblasts from both negative and positive nodes, in a new series of RT-PCR assays. In summary, transcriptional changes induced in breast cancer cells by fibroblasts from positive as well as negative nodes are very much alike in a specific lineage. However, fibroblasts effects are distinct in each one of the breast cancer lineages, suggesting that the inter-relationships between stromal and malignant cells are dependent on the intrinsic subtype of the tumor. Electronic supplementary material The online version of this article (doi:10.1007/s13277-010-0108-7) contains supplementary material, which is available to authorized users. PMID:20820980

Influence of the interaction between nodal fibroblast and breast cancer cells on gene expression.

PubMed

Santos, Rosângela Portilho Costa; Benvenuti, Ticiana Thomazine; Honda, Suzana Terumi; Del Valle, Paulo Roberto; Katayama, Maria Lucia Hirata; Brentani, Helena Paula; Carraro, Dirce Maria; Rozenchan, Patrícia Bortman; Brentani, Maria Mitzi; de Lyra, Eduardo Carneiro; Torres, César Henrique; Salzgeber, Marcia Batista; Kaiano, Jane Haruko Lima; Góes, João Carlos Sampaio; Folgueira, Maria Aparecida Azevedo Koike

2011-02-01

Our aim was to evaluate the interaction between breast cancer cells and nodal fibroblasts, by means of their gene expression profile. Fibroblast primary cultures were established from negative and positive lymph nodes from breast cancer patients and a similar gene expression pattern was identified, following cell culture. Fibroblasts and breast cancer cells (MDA-MB231, MDA-MB435, and MCF7) were cultured alone or co-cultured separated by a porous membrane (which allows passage of soluble factors) for comparison. Each breast cancer lineage exerted a particular effect on fibroblasts viability and transcriptional profile. However, fibroblasts from positive and negative nodes had a parallel transcriptional behavior when co-cultured with a specific breast cancer cell line. The effects of nodal fibroblasts on breast cancer cells were also investigated. MDA MB-231 cells viability and migration were enhanced by the presence of fibroblasts and accordingly, MDA-MB435 and MCF7 cells viability followed a similar pattern. MDA-MB231 gene expression profile, as evaluated by cDNA microarray, was influenced by the fibroblasts presence, and HNMT, COMT, FN3K, and SOD2 were confirmed downregulated in MDA-MB231 co-cultured cells with fibroblasts from both negative and positive nodes, in a new series of RT-PCR assays. In summary, transcriptional changes induced in breast cancer cells by fibroblasts from positive as well as negative nodes are very much alike in a specific lineage. However, fibroblasts effects are distinct in each one of the breast cancer lineages, suggesting that the inter-relationships between stromal and malignant cells are dependent on the intrinsic subtype of the tumor.

Temporal components of the motor patterns expressed by the human spinal cord reflect foot kinematics.

PubMed

Ivanenko, Yuri P; Grasso, Renato; Zago, Myrka; Molinari, Marco; Scivoletto, Giorgio; Castellano, Vincenzo; Macellari, Velio; Lacquaniti, Francesco

2003-11-01

What are the building blocks with which the human spinal cord constructs the motor patterns of locomotion? In principle, they could correspond to each individual activity pattern in dozens of different muscles. Alternatively, there could exist a small set of constituent temporal components that are common to all activation patterns and reflect global kinematic goals. To address this issue, we studied patients with spinal injury trained to step on a treadmill with body weight support. Patients learned to produce foot kinematics similar to that of healthy subjects but with activity patterns of individual muscles generally different from the control group. Hidden in the muscle patterns, we found a basic set of five temporal components, whose flexible combination accounted for the wide range of muscle patterns recorded in both controls and patients. Furthermore, two of the components were systematically related to foot kinematics across different stepping speeds and loading conditions. We suggest that the components are related to control signals output by spinal pattern generators, normally under the influence of descending and afferent inputs.

A transcriptomics investigation into pine reproductive organ development.

PubMed

Niu, Shihui; Yuan, Huwei; Sun, Xinrui; Porth, Ilga; Li, Yue; El-Kassaby, Yousry A; Li, Wei

2016-02-01

The development of reproductive structures in gymnosperms is still poorly studied because of a lack of genomic information and useful genetic tools. The hermaphroditic reproductive structure derived from unisexual gymnosperms is an even less studied aspect of seed plant evolution. To extend our understanding of the molecular mechanism of hermaphroditism and the determination of sexual identity of conifer reproductive structures in general, unisexual and bisexual cones from Pinus tabuliformis were profiled for gene expression using 60K microarrays. Expression patterns of genes during progression of sexual cone development were analysed using RNA-seq. The results showed that, overall, the transcriptomes of male structures in bisexual cones were more similar to those of female cones. However, the expression of several MADS-box genes in the bisexual cones was similar to that of male cones at the more juvenile developmental stage, while despite these expression shifts, male structures of bisexual cones and normal male cones were histologically indistinguishable and cone development was continuous. This study represents a starting point for in-depth analysis of the molecular regulation of cone development and also the origin of hermaphroditism in pine. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

Genome-wide profiling of 24 hr diel rhythmicity in the water flea, Daphnia pulex: network analysis reveals rhythmic gene expression and enhances functional gene annotation.

PubMed

Rund, Samuel S C; Yoo, Boyoung; Alam, Camille; Green, Taryn; Stephens, Melissa T; Zeng, Erliang; George, Gary F; Sheppard, Aaron D; Duffield, Giles E; Milenković, Tijana; Pfrender, Michael E

2016-08-18

Marine and freshwater zooplankton exhibit daily rhythmic patterns of behavior and physiology which may be regulated directly by the light:dark (LD) cycle and/or a molecular circadian clock. One of the best-studied zooplankton taxa, the freshwater crustacean Daphnia, has a 24 h diel vertical migration (DVM) behavior whereby the organism travels up and down through the water column daily. DVM plays a critical role in resource tracking and the behavioral avoidance of predators and damaging ultraviolet radiation. However, there is little information at the transcriptional level linking the expression patterns of genes to the rhythmic physiology/behavior of Daphnia. Here we analyzed genome-wide temporal transcriptional patterns from Daphnia pulex collected over a 44 h time period under a 12:12 LD cycle (diel) conditions using a cosine-fitting algorithm. We used a comprehensive network modeling and analysis approach to identify novel co-regulated rhythmic genes that have similar network topological properties and functional annotations as rhythmic genes identified by the cosine-fitting analyses. Furthermore, we used the network approach to predict with high accuracy novel gene-function associations, thus enhancing current functional annotations available for genes in this ecologically relevant model species. Our results reveal that genes in many functional groupings exhibit 24 h rhythms in their expression patterns under diel conditions. We highlight the rhythmic expression of immunity, oxidative detoxification, and sensory process genes. We discuss differences in the chronobiology of D. pulex from other well-characterized terrestrial arthropods. This research adds to a growing body of literature suggesting the genetic mechanisms governing rhythmicity in crustaceans may be divergent from other arthropod lineages including insects. Lastly, these results highlight the power of using a network analysis approach to identify differential gene expression and provide novel functional annotation.

Identification and transcriptional analysis of two types of lectins (SgCTL-1 and SgGal-1) from mollusk Solen grandis.

PubMed

Wei, Xiumei; Yang, Jianmin; Liu, Xiangquan; Yang, Dinglong; Xu, Jie; Fang, Jinghui; Wang, Weijun; Yang, Jialong

2012-08-01

C-type lectin and galectin are two types of animal carbohydrate-binding proteins which serve as pathogen recognition molecules and play crucial roles in the innate immunity of invertebrates. In the present study, a C-type lectin (designated as SgCTL-1) and galectin (designated as SgGal-1) were identified from mollusk Solen grandis, and their expression patterns, both in tissues and toward three pathogen-associated molecular patterns (PAMPs) stimulation were characterized. The full-length cDNA of SgCTL-1 and SgGal-1 was 1280 and 1466 bp, containing an open reading frame (ORF) of 519 and 1218 bp, respectively. Their deduced amino acid sequences showed high similarity to other members of C-type lectin and galectin superfamily, respectively. SgCTL-1 encoded a single carbohydrate-recognition domain (CRD), and the motif of Ca(2+)-binding site 2 was EPN (Glu(135)-Pro(136)-Asn(137)). While SgGal-1 encoded two CRDs, and the amino acid residues constituted the carbohydrate-binding motifs were well conserved in CRD1 but partially conserved in CRD2. Although SgCTL-1 and SgGal-1 exhibited different tissue expression pattern, they were both constitutively expressed in all tested tissues, including hemocytes, gonad, mantle, muscle, gill and hepatopancreas, and they were both highly expressed in hepatopancreas and gill. Furthermore, the mRNA expression of two lectins in hemocytes was significantly (P < 0.01) up-regulated with different levels after S. grandis were stimulated by lipopolysaccharide (LPS), peptidoglycan (PGN) or β-1,3-glucan. Our results suggested that SgCTL-1 and SgGal-1 from razor clam were two novel members of animal lectins, and they might function as pattern recognition receptors (PRRs) taking part in the process of pathogen recognition. Copyright © 2012 Elsevier Ltd. All rights reserved.

Trigeminal activation using chemical, electrical, and mechanical stimuli.

PubMed

Iannilli, E; Del Gratta, C; Gerber, J C; Romani, G L; Hummel, T

2008-10-15

Tactile, proprioceptive, and nociceptive information, including also chemosensory functions are expressed in the trigeminal nerve sensory response. To study differences in the processing of different stimulus qualities, we performed a study based on functional magnetic resonance imaging. The first trigeminal branch (ophthalmic nerve) was activated by (a) intranasal chemical stimulation with gaseous CO2 which produces stinging and burning sensations, but is virtually odorless, (b) painful, but not nociceptive specific cutaneous electrical stimulation, and (c) cutaneous mechanical stimulation using air puffs. Eighteen healthy subjects participated (eight men, 10 women, mean age 31 years). Painful stimuli produced patterns of activation similar to what has been reported for other noxious stimuli, namely activation in the primary and secondary somatosensory cortices, anterior cingulate cortex, insular cortex, and thalamus. In addition, analyses indicated intensity-related activation in the prefrontal cortex which was specifically involved in the evaluation of stimulus intensity. Importantly, the results also indicated similarities between activation patterns after intranasal chemosensory trigeminal stimulation and patterns usually found following intranasal odorous stimulation, indicating the intimate connection between these two systems in the processing of sensory information.

Discovering biclusters in gene expression data based on high-dimensional linear geometries

PubMed Central

Gan, Xiangchao; Liew, Alan Wee-Chung; Yan, Hong

2008-01-01

Background In DNA microarray experiments, discovering groups of genes that share similar transcriptional characteristics is instrumental in functional annotation, tissue classification and motif identification. However, in many situations a subset of genes only exhibits consistent pattern over a subset of conditions. Conventional clustering algorithms that deal with the entire row or column in an expression matrix would therefore fail to detect these useful patterns in the data. Recently, biclustering has been proposed to detect a subset of genes exhibiting consistent pattern over a subset of conditions. However, most existing biclustering algorithms are based on searching for sub-matrices within a data matrix by optimizing certain heuristically defined merit functions. Moreover, most of these algorithms can only detect a restricted set of bicluster patterns. Results In this paper, we present a novel geometric perspective for the biclustering problem. The biclustering process is interpreted as the detection of linear geometries in a high dimensional data space. Such a new perspective views biclusters with different patterns as hyperplanes in a high dimensional space, and allows us to handle different types of linear patterns simultaneously by matching a specific set of linear geometries. This geometric viewpoint also inspires us to propose a generic bicluster pattern, i.e. the linear coherent model that unifies the seemingly incompatible additive and multiplicative bicluster models. As a particular realization of our framework, we have implemented a Hough transform-based hyperplane detection algorithm. The experimental results on human lymphoma gene expression dataset show that our algorithm can find biologically significant subsets of genes. Conclusion We have proposed a novel geometric interpretation of the biclustering problem. We have shown that many common types of bicluster are just different spatial arrangements of hyperplanes in a high dimensional data space. An implementation of the geometric framework using the Fast Hough transform for hyperplane detection can be used to discover biologically significant subsets of genes under subsets of conditions for microarray data analysis. PMID:18433477

Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain

PubMed Central

Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

2013-01-01

An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain. PMID:23440889

Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain.

PubMed

Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

2013-01-01

An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain.

Expression of interleukin-1β and interleukin-6 in leprosy reactions in patients with human immunodeficiency virus coinfection.

PubMed

Pires, Carla Andréa Avelar; Quaresma, Juarez Antônio Simões; de Souza Aarão, Tinara Leila; de Souza, Jorge Rodrigues; Macedo, Geraldo Mariano Moraes; Neto, Fernando Octávio Machado Jucá; Xavier, Marília Brasil

2017-08-01

Previous studies suggest that coinfection of leprosy and human immunodeficiency virus (HIV) does not decrease the frequency and intensity of leprosy reactions. However, the immunological aspects of leprosy reactions in coinfected patients remain obscure, with a limited number of studies showing contradictory results. Observational study using tissue samples collected during leprosy reactions from 15 patients coinfected with leprosy and HIV and from 15 patients with leprosy alone. Patients were part of a prior larger cohort study of leprosy patients with and without HIV coinfection. Specific antibodies were used to detect IL-1β and IL-6 expression in skin biopsy tissue cells. IL-1β and IL-6 expression was similar between leprosy patients with and without HIV coinfection (p>0.05). Coinfected and non-coinfected tissues showed similar levels of IL-1β and IL-6 expression for type 1 reactions. A trend towards increased levels of IL-1β and IL-6 expression was observed in tissue from coinfected patients (p=0.0024). The expression of IL-1β and IL-6 during leprosy reactions did not differ significantly between tissues obtained from leprosy patients with and without HIV coinfection. Therefore, we conclude that HIV coinfection does not affect the immunological pattern of leprosy reactions. Copyright © 2017. Published by Elsevier B.V.

Social Plasticity Relies on Different Neuroplasticity Mechanisms across the Brain Social Decision-Making Network in Zebrafish.

PubMed

Teles, Magda C; Cardoso, Sara D; Oliveira, Rui F

2016-01-01

Social living animals need to adjust the expression of their behavior to their status within the group and to changes in social context and this ability (social plasticity) has an impact on their Darwinian fitness. At the proximate level social plasticity must rely on neuroplasticity in the brain social decision-making network (SDMN) that underlies the expression of social behavior, such that the same neural circuit may underlie the expression of different behaviors depending on social context. Here we tested this hypothesis in zebrafish by characterizing the gene expression response in the SDMN to changes in social status of a set of genes involved in different types of neural plasticity: bdnf, involved in changes in synaptic strength; npas4, involved in contextual learning and dependent establishment of GABAergic synapses; neuroligins (nlgn1 and nlgn2) as synaptogenesis markers; and genes involved in adult neurogenesis (wnt3 and neurod). Four social phenotypes were experimentally induced: Winners and Losers of a real-opponent interaction; Mirror-fighters, that fight their own image in a mirror and thus do not experience a change in social status despite the expression of aggressive behavior; and non-interacting fish, which were used as a reference group. Our results show that each social phenotype (i.e., Winners, Losers, and Mirror-fighters) present specific patterns of gene expression across the SDMN, and that different neuroplasticity genes are differentially expressed in different nodes of the network (e.g., BDNF in the dorsolateral telencephalon, which is a putative teleost homolog of the mammalian hippocampus). Winners expressed unique patterns of gene co-expression across the SDMN, whereas in Losers and Mirror-fighters the co-expression patterns were similar in the dorsal regions of the telencephalon and in the supracommissural nucleus of the ventral telencephalic area, but differents in the remaining regions of the ventral telencephalon. These results indicate that social plasticity relies on multiple neuroplasticity mechanisms across the SDMN, and that there is not a single neuromolecular module underlying this type of behavioral flexibility.

Social Plasticity Relies on Different Neuroplasticity Mechanisms across the Brain Social Decision-Making Network in Zebrafish

PubMed Central

Teles, Magda C.; Cardoso, Sara D.; Oliveira, Rui F.

2016-01-01

Social living animals need to adjust the expression of their behavior to their status within the group and to changes in social context and this ability (social plasticity) has an impact on their Darwinian fitness. At the proximate level social plasticity must rely on neuroplasticity in the brain social decision-making network (SDMN) that underlies the expression of social behavior, such that the same neural circuit may underlie the expression of different behaviors depending on social context. Here we tested this hypothesis in zebrafish by characterizing the gene expression response in the SDMN to changes in social status of a set of genes involved in different types of neural plasticity: bdnf, involved in changes in synaptic strength; npas4, involved in contextual learning and dependent establishment of GABAergic synapses; neuroligins (nlgn1 and nlgn2) as synaptogenesis markers; and genes involved in adult neurogenesis (wnt3 and neurod). Four social phenotypes were experimentally induced: Winners and Losers of a real-opponent interaction; Mirror-fighters, that fight their own image in a mirror and thus do not experience a change in social status despite the expression of aggressive behavior; and non-interacting fish, which were used as a reference group. Our results show that each social phenotype (i.e., Winners, Losers, and Mirror-fighters) present specific patterns of gene expression across the SDMN, and that different neuroplasticity genes are differentially expressed in different nodes of the network (e.g., BDNF in the dorsolateral telencephalon, which is a putative teleost homolog of the mammalian hippocampus). Winners expressed unique patterns of gene co-expression across the SDMN, whereas in Losers and Mirror-fighters the co-expression patterns were similar in the dorsal regions of the telencephalon and in the supracommissural nucleus of the ventral telencephalic area, but differents in the remaining regions of the ventral telencephalon. These results indicate that social plasticity relies on multiple neuroplasticity mechanisms across the SDMN, and that there is not a single neuromolecular module underlying this type of behavioral flexibility. PMID:26909029

Single trial classification for the categories of perceived emotional facial expressions: an event-related fMRI study

NASA Astrophysics Data System (ADS)

Song, Sutao; Huang, Yuxia; Long, Zhiying; Zhang, Jiacai; Chen, Gongxiang; Wang, Shuqing

2016-03-01

Recently, several studies have successfully applied multivariate pattern analysis methods to predict the categories of emotions. These studies are mainly focused on self-experienced emotions, such as the emotional states elicited by music or movie. In fact, most of our social interactions involve perception of emotional information from the expressions of other people, and it is an important basic skill for humans to recognize the emotional facial expressions of other people in a short time. In this study, we aimed to determine the discriminability of perceived emotional facial expressions. In a rapid event-related fMRI design, subjects were instructed to classify four categories of facial expressions (happy, disgust, angry and neutral) by pressing different buttons, and each facial expression stimulus lasted for 2s. All participants performed 5 fMRI runs. One multivariate pattern analysis method, support vector machine was trained to predict the categories of facial expressions. For feature selection, ninety masks defined from anatomical automatic labeling (AAL) atlas were firstly generated and each were treated as the input of the classifier; then, the most stable AAL areas were selected according to prediction accuracies, and comprised the final feature sets. Results showed that: for the 6 pair-wise classification conditions, the accuracy, sensitivity and specificity were all above chance prediction, among which, happy vs. neutral , angry vs. disgust achieved the lowest results. These results suggested that specific neural signatures of perceived emotional facial expressions may exist, and happy vs. neutral, angry vs. disgust might be more similar in information representation in the brain.

Gene expression of antioxidant enzymes and coffee seed quality during pre- and post-physiological maturity.

PubMed

Santos, F C; Caixeta, F; Clemente, A C S; Pinho, E V; Rosa, S D V F

2014-12-19

Seeds collected at different maturation stages vary in physiological quality and patterns of protective antioxidant systems against deterioration. In this study we investigated the expression of genes that codify catalase (CAT), dismutase superoxide (SOD), and polyphenol oxidase (PPO) during the pre- and post-physiological maturation phases in whole seeds and in endosperms and embryos extracted from the seeds. Coffea arabica L. berries were collected at the green, yellowish-green, cherry, over-ripe, and dry stages, and the seeds were examined physiologically. The transcription levels of the genes were quantified by quantitative real-time polymerase chain reaction using coffee-specific primers. The highest level of SOD expression was observed in the endosperm at the cherry and over-ripe stages; in addition, these seeds presented the greatest physiological quality (assessed via germination test). The highest CAT3 transcript expression was observed at the green stage in whole seeds, and at the green and over-ripe stages in the embryos and endosperms. High expression of the PPO transcript was observed at the green and yellowish-green stages in whole seeds. In embryos and endosperms, peak expression of the PPO transcript was observed at the green stage; subsequently, peaks at the cherry and over-ripe stages were observed. We concluded that the expression patterns of the SOD and CAT3 transcripts were similar at the more advanced maturation stages, which corresponded to enhanced physiological seed quality. High expression of the PPO transcript at the over-ripe stage, also observed in the embryos and endosperms at the cherry stage, coincided with the highest physiological seed quality.

Expression Divergence Is Correlated with Sequence Evolution but Not Positive Selection in Conifers.

PubMed

Hodgins, Kathryn A; Yeaman, Sam; Nurkowski, Kristin A; Rieseberg, Loren H; Aitken, Sally N

2016-06-01

The evolutionary and genomic determinants of sequence evolution in conifers are poorly understood, and previous studies have found only limited evidence for positive selection. Using RNAseq data, we compared gene expression profiles to patterns of divergence and polymorphism in 44 seedlings of lodgepole pine (Pinus contorta) and 39 seedlings of interior spruce (Picea glauca × engelmannii) to elucidate the evolutionary forces that shape their genomes and their plastic responses to abiotic stress. We found that rapidly diverging genes tend to have greater expression divergence, lower expression levels, reduced levels of synonymous site diversity, and longer proteins than slowly diverging genes. Similar patterns were identified for the untranslated regions, but with some exceptions. We found evidence that genes with low expression levels had a larger fraction of nearly neutral sites, suggesting a primary role for negative selection in determining the association between evolutionary rate and expression level. There was limited evidence for differences in the rate of positive selection among genes with divergent versus conserved expression profiles and some evidence supporting relaxed selection in genes diverging in expression between the species. Finally, we identified a small number of genes that showed evidence of site-specific positive selection using divergence data alone. However, estimates of the proportion of sites fixed by positive selection (α) were in the range of other plant species with large effective population sizes suggesting relatively high rates of adaptive divergence among conifers. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Raman intensity and vibrational modes of armchair CNTs

NASA Astrophysics Data System (ADS)

Hur, Jaewoong; Stuart, Steven J.

2017-07-01

Raman intensity changes and frequency patterns have been studied using the various armchair (n, n) to understand the variations of bond polarizability, in regard to changing diameters, lengths, and the number of atoms in the (n, n). The Raman intensity trends of the (n, n) are validated by those of Cn isomers. For frequency trends, similar frequency patterns and frequency inward shifts for the (n, n) are characterized. Also, VDOS trends of the (n, n) expressing Raman modes are interpreted. The decomposition of vibrational modes in the (n, n) into radial, longitudinal, and tangential mode is beneficially used to recognize the distinct characteristics of vibrational modes.

Proteolysis of microtubule associated protein 2 and sensitivity of pancreatic tumours to docetaxel

PubMed Central

Veitia, R; David, S; Barbier, P; Vantard, M; Gounon, P; Bissery, M C; Fellous, A

2000-01-01

We have studied the state of microtubule associated protein 2 (MAP2) in the pancreatic ductal adenocarcinomas P03 and P02 (sensitive and refractory to docetaxel respectively) since they express the corresponding mRNA and MAP2-related peptides. Immunohistochemical localization showed that in tumour P03 the MAP2-related peptides are highly expressed and confined to the epithelial malignant cells while in P02 the intensity of the immunostaining is lower. However, anti α-tubulin staining followed a similar pattern suggesting that the net amount of macromolecular structures in the sensitive tumour is higher than in the refractory one. This may explain its higher sensitivity to docetaxel, because tubulin assembled into microtubules is the target of the drug. We found that protein extracts from both tumours differed in their proteolytic activity on rat brain MAP2. Since the proteolysis pattern obtained was similar to the one produced by Cathepsin D, we studied the effect of MAP2 proteolysed by this enzyme on microtubule formation in vitro. Proteolysis was found to increase the tendency of tubulin to assemble into macromolecular structures (microtubules and aggregates) in the presence of docetaxel. This suggests that in vivo proteolysis of MAP2 might increase microtubule alterations and potentiate the antitumour effect of docetaxel. © 2000 Cancer Research Campaign PMID:10945505

Purkinje Cell Compartmentation in the Cerebellum of the Lysosomal Acid Phosphatase 2 Mutant Mouse (Nax - Naked-Ataxia Mutant Mouse)

PubMed Central

Bailey, Karen; Rahimi Balaei, Maryam; Mannan, Ashraf; Del Bigio, Marc R.; Marzban, Hassan

2014-01-01

The Acp2 gene encodes the beta subunit of lysosomal acid phosphatase, which is an isoenzyme that hydrolyzes orthophosphoric monoesters. In mice, a spontaneous mutation in Acp2 results in severe cerebellar defects. These include a reduced size, abnormal lobulation, and an apparent anterior cerebellar disorder with an absent or hypoplastic vermis. Based on differential gene expression in the cerebellum, the mouse cerebellar cortex can normally be compartmentalized anteroposteriorly into four transverse zones and mediolaterally into parasagittal stripes. In this study, immunohistochemistry was performed using various Purkinje cell compartmentation markers to examine their expression patterns in the Acp2 mutant. Despite the abnormal lobulation and anterior cerebellar defects, zebrin II and PLCβ4 showed similar expression patterns in the nax mutant and wild type cerebellum. However, fewer stripes were found in the anterior zone of the nax mutant, which could be due to a lack of Purkinje cells or altered expression of the stripe markers. HSP25 expression was uniform in the central zone of the nax mutant cerebellum at around postnatal day (P) 18–19, suggesting that HSP25 immunonegative Purkinje cells are absent or delayed in stripe pattern expression compared to the wild type. HSP25 expression became heterogeneous around P22–23, with twice the number of parasagittal stripes in the nax mutant compared to the wild type. Aside from reduced size and cortical disorganization, both the posterior zone and nodular zone in the nax mutant appeared less abnormal than the rest of the cerebellum. From these results, it is evident that the anterior zone of the nax mutant cerebellum is the most severely affected, and this extends beyond the primary fissure into the rostral central zone/vermis. This suggests that ACP2 has critical roles in the development of the anterior cerebellum and it may regulate anterior and central zone compartmentation. PMID:24722417

A Conserved Developmental Patterning Network Produces Quantitatively Different Output in Multiple Species of Drosophila

PubMed Central

Meyer, Miriah; Wunderlich, Zeba; Simirenko, Lisa; Luengo Hendriks, Cris L.; Keränen, Soile V. E.; Henriquez, Clara; Knowles, David W.; Biggin, Mark D.; Eisen, Michael B.; DePace, Angela H.

2011-01-01

Differences in the level, timing, or location of gene expression can contribute to alternative phenotypes at the molecular and organismal level. Understanding the origins of expression differences is complicated by the fact that organismal morphology and gene regulatory networks could potentially vary even between closely related species. To assess the scope of such changes, we used high-resolution imaging methods to measure mRNA expression in blastoderm embryos of Drosophila yakuba and Drosophila pseudoobscura and assembled these data into cellular resolution atlases, where expression levels for 13 genes in the segmentation network are averaged into species-specific, cellular resolution morphological frameworks. We demonstrate that the blastoderm embryos of these species differ in their morphology in terms of size, shape, and number of nuclei. We present an approach to compare cellular gene expression patterns between species, while accounting for varying embryo morphology, and apply it to our data and an equivalent dataset for Drosophila melanogaster. Our analysis reveals that all individual genes differ quantitatively in their spatio-temporal expression patterns between these species, primarily in terms of their relative position and dynamics. Despite many small quantitative differences, cellular gene expression profiles for the whole set of genes examined are largely similar. This suggests that cell types at this stage of development are conserved, though they can differ in their relative position by up to 3–4 cell widths and in their relative proportion between species by as much as 5-fold. Quantitative differences in the dynamics and relative level of a subset of genes between corresponding cell types may reflect altered regulatory functions between species. Our results emphasize that transcriptional networks can diverge over short evolutionary timescales and that even small changes can lead to distinct output in terms of the placement and number of equivalent cells. PMID:22046143

Interhemispheric gene expression differences in the cerebral cortex of humans and macaque monkeys.

PubMed

Muntané, Gerard; Santpere, Gabriel; Verendeev, Andrey; Seeley, William W; Jacobs, Bob; Hopkins, William D; Navarro, Arcadi; Sherwood, Chet C

2017-09-01

Handedness and language are two well-studied examples of asymmetrical brain function in humans. Approximately 90% of humans exhibit a right-hand preference, and the vast majority shows left-hemisphere dominance for language function. Although genetic models of human handedness and language have been proposed, the actual gene expression differences between cerebral hemispheres in humans remain to be fully defined. In the present study, gene expression profiles were examined in both hemispheres of three cortical regions involved in handedness and language in humans and their homologues in rhesus macaques: ventrolateral prefrontal cortex, posterior superior temporal cortex (STC), and primary motor cortex. Although the overall pattern of gene expression was very similar between hemispheres in both humans and macaques, weighted gene correlation network analysis revealed gene co-expression modules associated with hemisphere, which are different among the three cortical regions examined. Notably, a receptor-enriched gene module in STC was particularly associated with hemisphere and showed different expression levels between hemispheres only in humans.

Expression of EGFP and NPTII protein is not associated with organ abnormalities in deceased transgenic cloned cattle.

PubMed

Liu, Yan; Wu, Qian; Cui, Huiting; Li, Qinghe; Zhao, Yiqiang; Luo, Juan; Liu, Qiuyue; Sun, Xiuzhu; Tang, Bo; Zhang, Lei; Dai, Yunping; Li, Ning

2008-12-01

Both enhanced green fluorescence protein (EGFP) and neomycin phosphotransferase type II enzyme (NPTII) are widely used in transgenic studies, but their side effects have not been extensively investigated. In this study, we evaluated the expression profiles of the two marker genes and the relationship between their expression and organ abnormalities. Eight transgenic cloned cattle were studied, four harboring both EGFP and NPTII, and four harboring only the NPTII gene. Four age-matched cloned cattle were used as controls. EGFP and NPTII expression were measured and detected by Q-PCR, Western blot, ELISA, and RIA in heart, liver, and lungs, and the values ranged from 0.3 to 5 microg/g. The expression profiles exhibited differential or mosaic pattern between the organs, the pathologic symptoms of which were identified, but were similar to those of age-matched cloned cattle. All data indicated that the expression of EGFP and NPTII is not associated with organ abnormalities in transgenic cloned cattle.

Analysis of xylem formation in pine by cDNA sequencing

NASA Technical Reports Server (NTRS)

Allona, I.; Quinn, M.; Shoop, E.; Swope, K.; St Cyr, S.; Carlis, J.; Riedl, J.; Retzel, E.; Campbell, M. M.; Sederoff, R.;

Two genes with similarity to bacterial response regulators are rapidly and specifically induced by cytokinin in Arabidopsis

NASA Technical Reports Server (NTRS)

Brandstatter, I.; Kieber, J. J.; Evans, M. L. (Principal Investigator)

1998-01-01

Cytokinins are central regulators of plant growth and development, but little is known about their mode of action. By using differential display, we identified a gene, IBC6 (for induced by cytokinin), from etiolated Arabidopsis seedlings, that is induced rapidly by cytokinin. The steady state level of IBC6 mRNA was elevated within 10 min by the exogenous application of cytokinin, and this induction did not require de novo protein synthesis. IBC6 was not induced by other plant hormones or by light. A second Arabidopsis gene with a sequence highly similar to IBC6 was identified. This IBC7 gene also was induced by cytokinin, although with somewhat slower kinetics and to a lesser extent. The pattern of expression of the two genes was similar, with higher expression in leaves, rachises, and flowers and lower transcript levels in roots and siliques. Sequence analysis revealed that IBC6 and IBC7 are similar to the receiver domain of bacterial two-component response regulators. This homology, coupled with previously published work on the CKI1 histidine kinase homolog, suggests that these proteins may play a role in early cytokinin signaling.

Discover mouse gene coexpression landscapes using dictionary learning and sparse coding.

PubMed

Li, Yujie; Chen, Hanbo; Jiang, Xi; Li, Xiang; Lv, Jinglei; Peng, Hanchuan; Tsien, Joe Z; Liu, Tianming

2017-12-01

Gene coexpression patterns carry rich information regarding enormously complex brain structures and functions. Characterization of these patterns in an unbiased, integrated, and anatomically comprehensive manner will illuminate the higher-order transcriptome organization and offer genetic foundations of functional circuitry. Here using dictionary learning and sparse coding, we derived coexpression networks from the space-resolved anatomical comprehensive in situ hybridization data from Allen Mouse Brain Atlas dataset. The key idea is that if two genes use the same dictionary to represent their original signals, then their gene expressions must share similar patterns, thereby considering them as "coexpressed." For each network, we have simultaneous knowledge of spatial distributions, the genes in the network and the extent a particular gene conforms to the coexpression pattern. Gene ontologies and the comparisons with published gene lists reveal biologically identified coexpression networks, some of which correspond to major cell types, biological pathways, and/or anatomical regions.

Genome-wide Hi-C analysis reveals extensive hierarchical chromatin interactions in rice.

PubMed

Dong, Qianli; Li, Ning; Li, Xiaochong; Yuan, Zan; Xie, Dejian; Wang, Xiaofei; Li, Jianing; Yu, Yanan; Wang, Jinbin; Ding, Baoxu; Zhang, Zhibin; Li, Changping; Bian, Yao; Zhang, Ai; Wu, Ying; Liu, Bao; Gong, Lei

2018-06-01

The non-random spatial packing of chromosomes in the nucleus plays a critical role in orchestrating gene expression and genome function. Here, we present a Hi-C analysis of the chromatin interaction patterns in rice (Oryza sativa L.) at hierarchical architectural levels. We confirm that rice chromosomes occupy their own territories with certain preferential inter-chromosomal associations. Moderate compartment delimitation and extensive TADs (Topologically Associated Domains) were determined to be associated with heterogeneous genomic compositions and epigenetic marks in the rice genome. We found subtle features including chromatin loops, gene loops, and off-/near-diagonal intensive interaction regions. Gene chromatin loops associated with H3K27me3 could be positively involved in gene expression. In addition to insulated enhancing effects for neighbor gene expression, the identified rice gene loops could bi-directionally (+/-) affect the expression of looped genes themselves. Finally, web-interleaved off-diagonal IHIs/KEEs (Interactive Heterochromatic Islands or KNOT ENGAGED ELEMENTs) could trap transposable elements (TEs) via the enrichment of silencing epigenetic marks. In parallel, the near-diagonal FIREs (Frequently Interacting Regions) could positively affect the expression of involved genes. Our results suggest that the chromatin packing pattern in rice is generally similar to that in Arabidopsis thaliana but with clear differences at specific structural levels. We conclude that genomic composition, epigenetic modification, and transcriptional activity could act in combination to shape global and local chromatin packing in rice. Our results confirm recent observations in rice and A. thaliana but also provide additional insights into the patterns and features of chromatin organization in higher plants. © 2018 The Authors. The Plant Journal published by John Wiley & Sons Ltd and Society for Experimental Biology.

The post-menopausal ovary displays a unique pattern of steroidogenic enzyme expression.

PubMed

Havelock, Jon C; Rainey, William E; Bradshaw, Karen D; Carr, Bruce R

2006-01-01

While menopause results in the loss of cyclic steroid production, evidence exists for persistent, albeit reduced, ovarian androgen production. In order to continue to synthesize ovarian androgens, the steroidogenic enzymes necessary for androgen biosynthesis must be present. Few studies have selectively analysed some of the steroidogenic enzymes present in the post-menopausal ovary (PMO), and a comprehensive study of this matter has never been undertaken. RNA and protein were obtained from PMO, pre-menopausal ovarian stroma, corpora lutea (CL), ovarian follicles, placenta, and myometrium. Oligonucleotide microarray analysis was performed to compare the gene expression profiles of PMO with pre-menopausal ovarian stroma. Real-time RT-PCR was performed for LH/HCG receptor (LHCGR), steroidogenic acute regulatory (StAR), cholesterol side-chain cleavage (CYP11A), 3beta-hydroxysteroid dehydrogenase type I (HSD3B1) and type II (HSD3B2, 3betaHSD), 17a-hydroxylase (CYP17), cytochrome b5 (CytB5), and aromatase (CYP19). Western blot analysis was performed for StAR, CYP11A, CYP17,and 3betaHSD. The PMO and pre-menopausal ovarian stroma had a similar pattern of steroidogenic enzyme expression. The PMO had persistent, but reduced, levels of LHCGR and most steroidogenic enzymes. CYP19 and HSD3B2 mRNA were greatly reduced in PMO in comparison with CL (50-fold and 2000-fold less respectively). HSD3B2 was not detectable in PMO by western analysis. This study supports the idea that the PMO retains some steroidogenic capacity. However, based on steroidogenic enzyme expression, the PMO has a unique pattern of steroidogenic enzyme expression that favors Delta5 steroid formation over Delta4 steroid formation.

Histone methylation at gene promoters is associated with developmental regulation and region-specific expression of ionotropic and metabotropic glutamate receptors in human brain.

PubMed

Stadler, Florian; Kolb, Gabriele; Rubusch, Lothar; Baker, Stephen P; Jones, Edward G; Akbarian, Schahram

2005-07-01

Glutamatergic signaling is regulated, in part, through differential expression of NMDA and AMPA/KA channel subunits and G protein-coupled metabotropic receptors. In human brain, region-specific expression patterns of glutamate receptor genes are maintained over the course of decades, suggesting a role for molecular mechanisms involved in long-term regulation of transcription, including methylation of lysine residues at histone N-terminal tails. Using a native chromatin immunoprecipitation assay, we studied histone methylation marks at proximal promoters of 16 ionotropic and metabotropic glutamate receptor genes (GRIN1,2A-D; GRIA1,3,4; GRIK2,4,5; GRM1,3,4,6,7 ) in cerebellar cortex collected across a wide age range from midgestation to 90 years old. Levels of di- and trimethylated histone H3-lysine 4, which are associated with open chromatin and transcription, showed significant differences between promoters and a robust correlation with corresponding mRNA levels in immature and mature cerebellar cortex. In contrast, levels of trimethylated H3-lysine 27 and H4-lysine 20, two histone modifications defining silenced or condensed chromatin, did not correlate with transcription but were up-regulated overall in adult cerebellum. Furthermore, differential gene expression patterns in prefrontal and cerebellar cortex were reflected by similar differences in H3-lysine 4 methylation at promoters. Together, these findings suggest that histone lysine methylation at gene promoters is involved in developmental regulation and maintenance of region-specific expression patterns of ionotropic and metabotropic glutamate receptors. The association of a specific epigenetic mark, H3-(methyl)-lysine 4, with the molecular architecture of glutamatergic signaling in human brain has potential implications for schizophrenia and other disorders with altered glutamate receptor function.

RNA-Seq of Arabidopsis Pollen Uncovers Novel Transcription and Alternative Splicing1[C][W][OA

PubMed Central

Loraine, Ann E.; McCormick, Sheila; Estrada, April; Patel, Ketan; Qin, Peng

2013-01-01

Pollen grains of Arabidopsis (Arabidopsis thaliana) contain two haploid sperm cells enclosed in a haploid vegetative cell. Upon germination, the vegetative cell extrudes a pollen tube that carries the sperm to an ovule for fertilization. Knowing the identity, relative abundance, and splicing patterns of pollen transcripts will improve our understanding of pollen and allow investigation of tissue-specific splicing in plants. Most Arabidopsis pollen transcriptome studies have used the ATH1 microarray, which does not assay splice variants and lacks specific probe sets for many genes. To investigate the pollen transcriptome, we performed high-throughput sequencing (RNA-Seq) of Arabidopsis pollen and seedlings for comparison. Gene expression was more diverse in seedling, and genes involved in cell wall biogenesis were highly expressed in pollen. RNA-Seq detected at least 4,172 protein-coding genes expressed in pollen, including 289 assayed only by nonspecific probe sets. Additional exons and previously unannotated 5′ and 3′ untranslated regions for pollen-expressed genes were revealed. We detected regions in the genome not previously annotated as expressed; 14 were tested and 12 were confirmed by polymerase chain reaction. Gapped read alignments revealed 1,908 high-confidence new splicing events supported by 10 or more spliced read alignments. Alternative splicing patterns in pollen and seedling were highly correlated. For most alternatively spliced genes, the ratio of variants in pollen and seedling was similar, except for some encoding proteins involved in RNA splicing. This study highlights the robustness of splicing patterns in plants and the importance of ongoing annotation and visualization of RNA-Seq data using interactive tools such as Integrated Genome Browser. PMID:23590974

New insights into roles of cell wall invertase in early seed development revealed by comprehensive spatial and temporal expression patterns of GhCWIN1 in cotton.

PubMed

Wang, Lu; Ruan, Yong-Ling

2012-10-01

Despite substantial evidence on the essential roles of cell wall invertase (CWIN) in seed filling, it remains largely unknown how CWIN exerts its regulation early in seed development, a critical stage that sets yield potential. To fill this knowledge gap, we systematically examined the spatial and temporal expression patterns of a major CWIN gene, GhCWIN1, in cotton (Gossypium hirsutum) seeds from prefertilization to prestorage phase. GhCWIN1 messenger RNA was abundant at the innermost seed coat cell layer at 5 d after anthesis but became undetectable at 10 d after anthesis, at the onset of its differentiation into transfer cells characterized by wall ingrowths, suggesting that CWIN may negatively regulate transfer cell differentiation. Within the filial tissues, GhCWIN1 transcript was detected in endosperm cells undergoing nuclear division but not in those cells at the cellularization stage, with similar results observed in Arabidopsis (Arabidopsis thaliana) endosperm for CWIN, AtCWIN4. These findings indicate a function of CWIN in nuclear division but not cell wall biosynthesis in endosperm, contrasting to the role proposed for sucrose synthase (Sus). Further analyses revealed a preferential expression pattern of GhCWIN1 and AtCWIN4 in the provascular region of the torpedo embryos in cotton and Arabidopsis seed, respectively, indicating a role of CWIN in vascular initiation. Together, these novel findings provide insights into the roles of CWIN in regulating early seed development spatially and temporally. By comparing with previous studies on Sus expression and in conjunction with the expression of other related genes, we propose models of CWIN- and Sus-mediated regulation of early seed development.

The CRC orthologue from Pisum sativum shows conserved functions in carpel morphogenesis and vascular development

PubMed Central

Fourquin, Chloé; Primo, Amparo; Martínez-Fernández, Irene; Huet-Trujillo, Estefanía; Ferrándiz, Cristina

2014-01-01

Background and Aims CRABS CLAW (CRC) is a member of the YABBY family of transcription factors involved in carpel morphogenesis, floral determinacy and nectary specification in arabidopsis. CRC orthologues have been functionally characterized across angiosperms, revealing additional roles in leaf vascular development and carpel identity specification in Poaceae. These studies support an ancestral role of CRC orthologues in carpel development, while roles in vascular development and nectary specification appear to be derived. This study aimed to expand research on CRC functional conservation to the legume family in order to better understand the evolutionary history of CRC orthologues in angiosperms. Methods CRC orthologues from Pisum sativum and Medicago truncatula were identified. RNA in situ hybridization experiments determined the corresponding expression patterns throughout flower development. The phenotypic effects of reduced CRC activity were investigated in P. sativum using virus-induced gene silencing. Key Results CRC orthologues from P. sativum and M. truncatula showed similar expression patterns, mainly restricted to carpels and nectaries. However, these expression patterns differed from those of other core eudicots, most importantly in a lack of abaxial expression in the carpel and in atypical expression associated with the medial vein of the ovary. CRC downregulation in pea caused defects in carpel fusion and style/stigma development, both typically associated with CRC function in eudicots, but also affected vascular development in the carpel. Conclusions The data support the conserved roles of CRC orthologues in carpel fusion, style/stigma development and nectary development. In addition, an intriguing new aspect of CRC function in legumes was the unexpected role in vascular development, which could be shared by other species from widely diverged clades within the angiosperms, suggesting that this role could be ancestral rather than derived, as so far generally accepted. PMID:24989787

Immunohistochemical assessment of NY-ESO-1 expression in esophageal adenocarcinoma resection specimens.

PubMed

Hayes, Stephen J; Hng, Keng Ngee; Clark, Peter; Thistlethwaite, Fiona; Hawkins, Robert E; Ang, Yeng

2014-04-14

To assess NY-ESO-1 expression in a cohort of esophageal adenocarcinomas. A retrospective search of our tissue archive for esophageal resection specimens containing esophageal adenocarcinoma was performed, for cases which had previously been reported for diagnostic purposes, using the systematised nomenclature of human and veterinary medicine coding system. Original haematoxylin and eosin stained sections were reviewed, using light microscopy, to confirm classification and tumour differentiation. A total of 27 adenocarcinoma resection specimens were then assessed using immunohistochemistry for NY-ESO-1 expression: 4 well differentiated, 14 moderately differentiated, 4 moderate-poorly differentiated, and 5 poorly differentiated. Four out of a total of 27 cases of esophageal adenocarcinoma examined (15%) displayed diffuse cytoplasmic and nuclear expression for NY-ESO-1. They displayed a heterogeneous and mosaic-type pattern of diffuse staining. Diffuse cytoplasmic staining was not identified in any of these structures: stroma, normal squamous epithelium, normal submucosal gland and duct, Barrett's esophagus (goblet cell), Barrett's esophagus (non-goblet cell) and high grade glandular dysplasia. All adenocarcinomas showed an unexpected dot-type pattern of staining at nuclear, paranuclear and cytoplasmic locations. Similar dot-type staining, with varying frequency and size of dots, was observed on examination of Barrett's metaplasia, esophageal submucosal gland acini and the large bowel negative control, predominantly at the crypt base. Furthermore, a prominent pattern of apical (luminal) cytoplasmic dot-type staining was observed in some cases of Barrett's metaplasia and also adenocarcinoma. A further morphological finding of interest was noted on examination of haematoxylin and eosin stained sections, as aggregates of lymphocytes were consistently noted to surround submucosal glands. We have demonstrated for the first time NY-ESO-1 expression by esophageal adenocarcinomas, Barrett's metaplasia and normal tissues other than germ cells.

Immunohistochemical assessment of NY-ESO-1 expression in esophageal adenocarcinoma resection specimens

PubMed Central

Hayes, Stephen J; Hng, Keng Ngee; Clark, Peter; Thistlethwaite, Fiona; Hawkins, Robert E; Ang, Yeng

2014-01-01

AIM: To assess NY-ESO-1 expression in a cohort of esophageal adenocarcinomas. METHODS: A retrospective search of our tissue archive for esophageal resection specimens containing esophageal adenocarcinoma was performed, for cases which had previously been reported for diagnostic purposes, using the systematised nomenclature of human and veterinary medicine coding system. Original haematoxylin and eosin stained sections were reviewed, using light microscopy, to confirm classification and tumour differentiation. A total of 27 adenocarcinoma resection specimens were then assessed using immunohistochemistry for NY-ESO-1 expression: 4 well differentiated, 14 moderately differentiated, 4 moderate-poorly differentiated, and 5 poorly differentiated. RESULTS: Four out of a total of 27 cases of esophageal adenocarcinoma examined (15%) displayed diffuse cytoplasmic and nuclear expression for NY-ESO-1. They displayed a heterogeneous and mosaic-type pattern of diffuse staining. Diffuse cytoplasmic staining was not identified in any of these structures: stroma, normal squamous epithelium, normal submucosal gland and duct, Barrett’s esophagus (goblet cell), Barrett’s esophagus (non-goblet cell) and high grade glandular dysplasia. All adenocarcinomas showed an unexpected dot-type pattern of staining at nuclear, paranuclear and cytoplasmic locations. Similar dot-type staining, with varying frequency and size of dots, was observed on examination of Barrett’s metaplasia, esophageal submucosal gland acini and the large bowel negative control, predominantly at the crypt base. Furthermore, a prominent pattern of apical (luminal) cytoplasmic dot-type staining was observed in some cases of Barrett’s metaplasia and also adenocarcinoma. A further morphological finding of interest was noted on examination of haematoxylin and eosin stained sections, as aggregates of lymphocytes were consistently noted to surround submucosal glands. CONCLUSION: We have demonstrated for the first time NY-ESO-1 expression by esophageal adenocarcinomas, Barrett’s metaplasia and normal tissues other than germ cells. PMID:24744590

Breast cancer prognosis by combinatorial analysis of gene expression data.

PubMed

Alexe, Gabriela; Alexe, Sorin; Axelrod, David E; Bonates, Tibérius O; Lozina, Irina I; Reiss, Michael; Hammer, Peter L

2006-01-01

The potential of applying data analysis tools to microarray data for diagnosis and prognosis is illustrated on the recent breast cancer dataset of van 't Veer and coworkers. We re-examine that dataset using the novel technique of logical analysis of data (LAD), with the double objective of discovering patterns characteristic for cases with good or poor outcome, using them for accurate and justifiable predictions; and deriving novel information about the role of genes, the existence of special classes of cases, and other factors. Data were analyzed using the combinatorics and optimization-based method of LAD, recently shown to provide highly accurate diagnostic and prognostic systems in cardiology, cancer proteomics, hematology, pulmonology, and other disciplines. LAD identified a subset of 17 of the 25,000 genes, capable of fully distinguishing between patients with poor, respectively good prognoses. An extensive list of 'patterns' or 'combinatorial biomarkers' (that is, combinations of genes and limitations on their expression levels) was generated, and 40 patterns were used to create a prognostic system, shown to have 100% and 92.9% weighted accuracy on the training and test sets, respectively. The prognostic system uses fewer genes than other methods, and has similar or better accuracy than those reported in other studies. Out of the 17 genes identified by LAD, three (respectively, five) were shown to play a significant role in determining poor (respectively, good) prognosis. Two new classes of patients (described by similar sets of covering patterns, gene expression ranges, and clinical features) were discovered. As a by-product of the study, it is shown that the training and the test sets of van 't Veer have differing characteristics. The study shows that LAD provides an accurate and fully explanatory prognostic system for breast cancer using genomic data (that is, a system that, in addition to predicting good or poor prognosis, provides an individualized explanation of the reasons for that prognosis for each patient). Moreover, the LAD model provides valuable insights into the roles of individual and combinatorial biomarkers, allows the discovery of new classes of patients, and generates a vast library of biomedical research hypotheses.

Paraoxonase 2 (PON2) in the mouse central nervous system: A neuroprotective role?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Giordano, Gennaro; Cole, Toby B.; Dept. of Medicine

2011-11-15

The aims of this study were to characterize the expression of paraoxonase 2 (PON2) in mouse brain and to assess its antioxidant properties. PON2 levels were highest in the lung, intestine, heart and liver, and lower in the brain; in all tissues, PON2 expression was higher in female than in male mice. PON2 knockout [PON2{sup -/-}] mice did not express any PON2, as expected. In the brain, the highest levels of PON2 were found in the substantia nigra, the nucleus accumbens and the striatum, with lower levels in the cerebral cortex, hippocampus, cerebellum and brainstem. A similar regional distribution ofmore » PON2 activity (measured by dihydrocoumarin hydrolysis) was also found. PON3 was not detected in any brain area, while PON1 was expressed at very low levels, and did not show any regional difference. PON2 levels were higher in astrocytes than in neurons isolated from all brain regions, and were highest in cells from the striatum. PON2 activity and mRNA levels followed a similar pattern. Brain PON2 levels were highest around birth, and gradually declined. Subcellular distribution experiments indicated that PON2 is primarily expressed in microsomes and in mitochondria. The toxicity in neurons and astrocytes of agents known to cause oxidative stress (DMNQ and H{sub 2}O{sub 2}) was higher in cells from PON2{sup -/-} mice than in the same cells from wild-type mice, despite similar glutathione levels. These results indicate that PON2 is expressed in the brain, and that higher levels are found in dopaminergic regions such as the striatum, suggesting that this enzyme may provide protection against oxidative stress-mediated neurotoxicity.« less

Differentiation of human embryonic stem cells to HOXA+ hemogenic vasculature that resembles the aorta-gonad-mesonephros.

PubMed

Ng, Elizabeth S; Azzola, Lisa; Bruveris, Freya F; Calvanese, Vincenzo; Phipson, Belinda; Vlahos, Katerina; Hirst, Claire; Jokubaitis, Vanta J; Yu, Qing C; Maksimovic, Jovana; Liebscher, Simone; Januar, Vania; Zhang, Zhen; Williams, Brenda; Conscience, Aude; Durnall, Jennifer; Jackson, Steven; Costa, Magdaline; Elliott, David; Haylock, David N; Nilsson, Susan K; Saffery, Richard; Schenke-Layland, Katja; Oshlack, Alicia; Mikkola, Hanna K A; Stanley, Edouard G; Elefanty, Andrew G

2016-11-01

The ability to generate hematopoietic stem cells from human pluripotent cells would enable many biomedical applications. We find that hematopoietic CD34 + cells in spin embryoid bodies derived from human embryonic stem cells (hESCs) lack HOXA expression compared with repopulation-competent human cord blood CD34 + cells, indicating incorrect mesoderm patterning. Using reporter hESC lines to track the endothelial (SOX17) to hematopoietic (RUNX1C) transition that occurs in development, we show that simultaneous modulation of WNT and ACTIVIN signaling yields CD34 + hematopoietic cells with HOXA expression that more closely resembles that of cord blood. The cultures generate a network of aorta-like SOX17 + vessels from which RUNX1C + blood cells emerge, similar to hematopoiesis in the aorta-gonad-mesonephros (AGM). Nascent CD34 + hematopoietic cells and corresponding cells sorted from human AGM show similar expression of cell surface receptors, signaling molecules and transcription factors. Our findings provide an approach to mimic in vitro a key early stage in human hematopoiesis for the generation of AGM-derived hematopoietic lineages from hESCs.

Small RNA fragments in complex culture media cause alterations in protein profiles of three species of bacteria.

PubMed

Pavankumar, Asalapuram R; Ayyappasamy, Sudalaiyadum Perumal; Sankaran, Krishnan

2012-03-01

Efforts to delineate the basis for variations in protein profiles of different membrane fractions from various bacterial pathogens led to the finding that even the same medium [e.g., Luria Bertani (LB) broth] purchased from different commercial sources generates remarkably dissimilar protein profiles despite similar growth characteristics. Given the pervasive roles small RNAs play in regulating gene expression, we inquired if these source-specific differences due to media arise from disparities in the presence of small RNAs. Indeed, LB media components from two different commercial suppliers contained varying, yet significant, amounts of 10-80 bp small RNAs. Removal of small RNA from LB using RNaseA during media preparation resulted in significant changes in bacterial protein expression profiles. Our studies underscore the fact that seemingly identical growth media can lead to dramatic alterations in protein expression patterns, highlighting the importance of utilizing media free of small RNA during bacteriological studies. Finally, these results raise the intriguing possibility that similar pools of small RNAs in the environment can influence bacterial adaptation.

Genome-Wide Expression Profiling of Five Mouse Models Identifies Similarities and Differences with Human Psoriasis

PubMed Central

Swindell, William R.; Johnston, Andrew; Carbajal, Steve; Han, Gangwen; Wohn, Christian; Lu, Jun; Xing, Xianying; Nair, Rajan P.; Voorhees, John J.; Elder, James T.; Wang, Xiao-Jing; Sano, Shigetoshi; Prens, Errol P.; DiGiovanni, John; Pittelkow, Mark R.; Ward, Nicole L.; Gudjonsson, Johann E.

2011-01-01

Development of a suitable mouse model would facilitate the investigation of pathomechanisms underlying human psoriasis and would also assist in development of therapeutic treatments. However, while many psoriasis mouse models have been proposed, no single model recapitulates all features of the human disease, and standardized validation criteria for psoriasis mouse models have not been widely applied. In this study, whole-genome transcriptional profiling is used to compare gene expression patterns manifested by human psoriatic skin lesions with those that occur in five psoriasis mouse models (K5-Tie2, imiquimod, K14-AREG, K5-Stat3C and K5-TGFbeta1). While the cutaneous gene expression profiles associated with each mouse phenotype exhibited statistically significant similarity to the expression profile of psoriasis in humans, each model displayed distinctive sets of similarities and differences in comparison to human psoriasis. For all five models, correspondence to the human disease was strong with respect to genes involved in epidermal development and keratinization. Immune and inflammation-associated gene expression, in contrast, was more variable between models as compared to the human disease. These findings support the value of all five models as research tools, each with identifiable areas of convergence to and divergence from the human disease. Additionally, the approach used in this paper provides an objective and quantitative method for evaluation of proposed mouse models of psoriasis, which can be strategically applied in future studies to score strengths of mouse phenotypes relative to specific aspects of human psoriasis. PMID:21483750

Quantitative Analysis of the KSHV Transcriptome Following Primary Infection of Blood and Lymphatic Endothelial Cells

PubMed Central

Bruce, A. Gregory; Barcy, Serge; DiMaio, Terri; Gan, Emilia; Garrigues, H. Jacques; Lagunoff, Michael; Rose, Timothy M.

2017-01-01

The transcriptome of the Kaposi’s sarcoma-associated herpesvirus (KSHV/HHV8) after primary latent infection of human blood (BEC), lymphatic (LEC) and immortalized (TIME) endothelial cells was analyzed using RNAseq, and compared to long-term latency in BCBL-1 lymphoma cells. Naturally expressed transcripts were obtained without artificial induction, and a comprehensive annotation of the KSHV genome was determined. A set of unique coding sequence (UCDS) features and a process to resolve overlapping transcripts were developed to accurately quantitate transcript levels from specific promoters. Similar patterns of KSHV expression were detected in BCBL-1 cells undergoing long-term latent infections and in primary latent infections of both BEC and LEC cultures. High expression levels of poly-adenylated nuclear (PAN) RNA and spliced and unspliced transcripts encoding the K12 Kaposin B/C complex and associated microRNA region were detected, with an elevated expression of a large set of lytic genes in all latently infected cultures. Quantitation of non-overlapping regions of transcripts across the complete KSHV genome enabled for the first time accurate evaluation of the KSHV transcriptome associated with viral latency in different cell types. Hierarchical clustering applied to a gene correlation matrix identified modules of co-regulated genes with similar correlation profiles, which corresponded with biological and functional similarities of the encoded gene products. Gene modules were differentially upregulated during latency in specific cell types indicating a role for cellular factors associated with differentiated and/or proliferative states of the host cell to influence viral gene expression. PMID:28335496

Tlx and Pax6 co-operate genetically to establish the pallio-subpallial boundary in the embryonic mouse telencephalon.

PubMed

Stenman, Jan; Yu, Ruth T; Evans, Ronald M; Campbell, Kenneth

2003-03-01

We have examined the role of Tlx, an orphan nuclear receptor, in dorsal-ventral patterning of the mouse telencephalon. Tlx is expressed broadly in the ventricular zone, with the exception of the dorsomedial and ventromedial regions. The expression spans the pallio-subpallial boundary, which separates the dorsal (i.e. pallium) and ventral (i.e. subpallium) telencephalon. Despite being expressed on both sides of the pallio-subpallial boundary, Tlx homozygous mutants display alterations in the development of this boundary. These alterations include a dorsal shift in the expression limits of certain genes that abut at the pallio-subpallial boundary as well as the abnormal formation of the radial glial palisade that normally marks this boundary. The Tlx mutant phenotype is similar to, but less severe than, that seen in Small eye (i.e. Pax6) mutants. Interestingly, removal of one allele of Pax6 on the homozygous Tlx mutant background significantly worsens the phenotype. Thus Tlx and Pax6 cooperate genetically to regulate the establishment of the pallio-subpallial boundary. The patterning defects in the Tlx mutant telencephalon result in a loss of region-specific gene expression in the ventral-most pallial region. This correlates well with the malformation of the lateral and basolateral amygdala in Tlx mutants, both of which have been suggested to derive from ventral portions of the pallium.

Gene expression analysis of parthenogenetic embryonic development of the pea aphid, Acyrthosiphon pisum, suggests that aphid parthenogenesis evolved from meiotic oogenesis.

PubMed

Srinivasan, Dayalan G; Abdelhady, Ahmed; Stern, David L

2014-01-01

Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity.

Gene Expression Analysis of Parthenogenetic Embryonic Development of the Pea Aphid, Acyrthosiphon pisum, Suggests That Aphid Parthenogenesis Evolved from Meiotic Oogenesis

PubMed Central

Srinivasan, Dayalan G.; Abdelhady, Ahmed; Stern, David L.

2014-01-01

Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity. PMID:25501006

Expression pattern of Chlamys farreri sox2 in eggs, embryos and larvae of various stages

NASA Astrophysics Data System (ADS)

Liang, Shaoshuai; Ma, Xiaoshi; Han, Tiantian; Yang, Dandan; Zhang, Zhifeng

2015-08-01

The SOX2 protein is an important transcription factor functioning during the early development of animals. In this study, we isolated a full-length cDNA sequence of scallop Chlamys farreri sox2, Cf-sox2 which was 2194 bp in length with a 981 bp open reading frame encoding 327 amino acids. With real-time PCR analysis, it was detected that Cf-sox2 was expressed in unfertilized oocytes, fertilized eggs and all the tested embryos and larvae. The expression level increased significantly ( P < 0.01) in embryos from 2-cell to blastula, and then decreased significantly ( P < 0.01) and reached the minimum in umbo larva. Moreover, location of the Cf-sox2 expression was revealed using whole mount in situ hybridization technique. Positive hybridization signal could be detected in the central region of unfertilized oocytes and fertilized eggs, and then strong signals dispersed throughout the embryos from 2-cell to gastrula. During larval development, the signals were concentrated and strong signals were restricted to 4 regions of viscera mass in veliger larva. In umbo larva, weak signals could be detected in regions where presumptive visceral and pedal ganglia may be formed. The expression pattern of Cf-sox2 during embryogenesis was similar to that of mammal sox2, which implied that Cf-SOX2 may participate in the regulation of early development of C. farreri.

Optomotor-blind negatively regulates Drosophila eye development by blocking Jak/STAT signaling.

PubMed

Tsai, Yu-Chen; Grimm, Stefan; Chao, Ju-Lan; Wang, Shih-Chin; Hofmeyer, Kerstin; Shen, Jie; Eichinger, Fred; Michalopoulou, Theoni; Yao, Chi-Kuang; Chang, Chih-Hsuan; Lin, Shih-Han; Sun, Y Henry; Pflugfelder, Gert O

2015-01-01

Organ formation requires a delicate balance of positive and negative regulators. In Drosophila eye development, wingless (wg) is expressed at the lateral margins of the eye disc and serves to block retinal development. The T-box gene optomotor-blind (omb) is expressed in a similar pattern and is regulated by Wg. Omb mediates part of Wg activity in blocking eye development. Omb exerts its function primarily by blocking cell proliferation. These effects occur predominantly in the ventral margin. Our results suggest that the primary effect of Omb is the blocking of Jak/STAT signaling by repressing transcription of upd which encodes the Jak receptor ligand Unpaired.

Primate Short-Wavelength Cones Share Molecular Markers with Rods

PubMed Central

Craft, Cheryl M.; Huang, Jing; Possin, Daniel E.; Hendrickson, Anita

2015-01-01

Macaca, Callithrix jacchus marmoset monkey, Pan troglodytes chim- panzee and human retinas were examined to define if short wavelength (S) cones share molecular markers with L&M cone or rod photoreceptors. S cones showed consistent differences in their immunohistochemical staining and expression levels compared to L&M cones for “rod” Arrestin1 (S-Antigen), “cone” Arrestin4, cone alpha transducin, and Calbindin. Our data verify a similar pattern of expression in these primate retinas and provide clues to the structural divergence of rods and S cones versus L&M cones, suggesting S cone retinal function is “intermediate” between them. PMID:24664680

Cell Alignment Required in Differentiation of Myxococcus xanthus

NASA Astrophysics Data System (ADS)

Kim, Seung K.; Kaiser, Dale

1990-08-01

During fruiting body morphogenesis of Myxococcus xanthus, cell movement is required for transmission of C-factor, a short range intercellular signaling protein necessary for sporulation and developmental gene expression. Nonmotile cells fail to sporulate and to express C-factor-dependent genes, but both defects were rescued by a simple manipulation of cell position that oriented the cells in aligned, parallel groups. A similar pattern of aligned cells normally results from coordinated recruitment of wild-type cells into multicellular aggregates, which later form mature fruiting bodies. It is proposed that directed cell movement establishes critical contacts between adjacent cells, which are required for efficient intercellular C-factor transmission.

Genome-wide identification, classification and expression analysis in fungal-plant interactions of cutinase gene family and functional analysis of a putative ClCUT7 in Curvularia lunata.

PubMed

Liu, Tong; Hou, Jumei; Wang, Yuying; Jin, Yazhong; Borth, Wayne; Zhao, Fengzhou; Liu, Zheng; Hu, John; Zuo, Yuhu

2016-06-01

Cutinase is described as playing various roles in fungal-plant pathogen interactions, such as eliciting host-derived signals, fungal spore attachment and carbon acquisition during saprophytic growth. However, the characteristics of the cutinase genes, their expression in compatible interactions and their roles in pathogenesis have not been reported in Curvularia lunata, an important leaf spot pathogen of maize in China. Therefore, a cutinase gene family analysis could have profound significance. In this study, we identified 13 cutinase genes (ClCUT1 to ClCUT13) in the C. lunata genome. Multiple sequence alignment showed that most fungal cutinase proteins had one highly conserved GYSQG motif and a similar DxVCxG[ST]-[LIVMF](3)-x(3)H motif. Gene structure analyses of the cutinases revealed a complex intron-exon pattern with differences in the position and number of introns and exons. Based on phylogenetic relationship analysis, C. lunata cutinases and 78 known cutinase proteins from other fungi were classified into four groups with subgroups, but the C. lunata cutinases clustered in only three of the four groups. Motif analyses showed that each group of cutinases from C. lunata had a common motif. Real-time PCR indicated that transcript levels of the cutinase genes in a compatible interaction between pathogen and host had varied expression patterns. Interestingly, the transcript levels of ClCUT7 gradually increased during early pathogenesis with the most significant up-regulation at 3 h post-inoculation. When ClCUT7 was deleted, pathogenicity of the mutant decreased on unwounded maize (Zea mays) leaves. On wounded maize leaves, however, the mutant caused symptoms similar to the wild-type strain. Moreover, the ClCUT7 mutant had an approximately 10 % reduction in growth rate when cutin was the sole carbon source. In conclusion, we identified and characterized the cutinase family genes of C. lunata, analyzed their expression patterns in a compatible host-pathogen interaction, and explored the role of ClCUT7 in pathogenicity. This work will increase our understanding of cutinase genes in other fungal-plant pathogens.

Cultural Similarities and Differences in Perceived Affordances of Situations for Big Five Behaviors

PubMed Central

Church, A. Timothy; Katigbak, Marcia S.; del Prado, Alicia M.

2009-01-01

The perceived affordance or conduciveness of various situations for Big Five behaviors was investigated in the United States (N = 188) and the Philippines (N = 215). The basic proposition that different situations afford different trait-relevant behaviors was supported, at least in the perceptions of cultural informants. Cultural similarities exceeded differences, and in both cultures individuals perceived Big Five behaviors as expressed in if-then patterns of variation across situations. Americans and Filipinos showed some similarity in the general dimensions along which situations are construed, but meaningful differences in the construal of certain interpersonal situations were also observed. The findings contribute to efforts to integrate person and situation approaches in personality and social psychology. PMID:20401176

A novel hsp110-related gene, apg-1, that is abundantly expressed in the testis responds to a low temperature heat shock rather than the traditional elevated temperatures.

PubMed

Kaneko, Y; Nishiyama, H; Nonoguchi, K; Higashitsuji, H; Kishishita, M; Fujita, J

1997-01-31

We isolated a novel hsp110-related gene, apg-1, from a testis cDNA library. The apg-1 transcripts were constitutively expressed in the testicular germ cells and, in some degree, most tissues examined. In a mouse TAMA26 Sertoli cell line, apg-1 transcripts were induced in 2 h by a temperature shift from 32 to 39 degrees C, but not by a shift from 37 to 42 degrees C, the traditional heat stress, or a shift from 32 to 42 degrees C. The heat response pattern of hsp110 expression was similar to that of apg-1. Although induction of a hsp70 transcript was observed in 2 h by a shift from 32 to 39 degrees C, the induction was more apparent by a shift from 37 to 42 degrees C or from 32 to 42 degrees C. Essentially similar differential response patterns were observed among these genes in NIH/3T3 fibroblasts as well. The nuclear run-on assay and the native gel mobility shift assay demonstrated that, by the 32 to 39 degrees C temperature shift, the apg-1 gene was transcriptionally activated, and heat shock factor 1 bound to the heat shock elements in the 5'-flanking region of the apg-1 gene. These results demonstrated that expressions of apg-1, hsp110, and hsp70 could be heat-induced at a temperature lower than the traditional elevated temperatures in somatic cells of both testis and nontestis origin and suggest that the mechanisms regulating the transcript levels of apg-1 and hsp110 are different from those of hsp70. Furthermore, the constitutive expression in germ cells suggests that APG-1 plays a specific role in spermatogenesis as well as in stress response.

Control of lysosomal biogenesis and Notch-dependent tissue patterning by components of the TFEB-V-ATPase axis in Drosophila melanogaster.

PubMed

Tognon, Emiliana; Kobia, Francis; Busi, Ilaria; Fumagalli, Arianna; De Masi, Federico; Vaccari, Thomas

2016-01-01

In vertebrates, TFEB (transcription factor EB) and MITF (microphthalmia-associated transcription factor) family of basic Helix-Loop-Helix (bHLH) transcription factors regulates both lysosomal function and organ development. However, it is not clear whether these 2 processes are interconnected. Here, we show that Mitf, the single TFEB and MITF ortholog in Drosophila, controls expression of vacuolar-type H(+)-ATPase pump (V-ATPase) subunits. Remarkably, we also find that expression of Vha16-1 and Vha13, encoding 2 key components of V-ATPase, is patterned in the wing imaginal disc. In particular, Vha16-1 expression follows differentiation of proneural regions of the disc. These regions, which will form sensory organs in the adult, appear to possess a distinctive endolysosomal compartment and Notch (N) localization. Modulation of Mitf activity in the disc in vivo alters endolysosomal function and disrupts proneural patterning. Similar to our findings in Drosophila, in human breast epithelial cells we observe that impairment of the Vha16-1 human ortholog ATP6V0C changes the size and function of the endolysosomal compartment and that depletion of TFEB reduces ligand-independent N signaling activity. Our data suggest that lysosomal-associated functions regulated by the TFEB-V-ATPase axis might play a conserved role in shaping cell fate.

The Interplay of Temperature and Genotype on Patterns of Alternative Splicing in Drosophila melanogaster.

PubMed

Jakšić, Ana Marija; Schlötterer, Christian

2016-09-01

Alternative splicing is the highly regulated process of variation in the removal of introns from premessenger-RNA transcripts. The consequences of alternative splicing on the phenotype are well documented, but the impact of the environment on alternative splicing is not yet clear. We studied variation in alternative splicing among four different temperatures, 13, 18, 23, and 29°, in two Drosophila melanogaster genotypes. We show plasticity of alternative splicing with up to 10% of the expressed genes being differentially spliced between the most extreme temperatures for a given genotype. Comparing the two genotypes at different temperatures, we found <1% of the genes being differentially spliced at 18°. At extreme temperatures, however, we detected substantial differences in alternative splicing-with almost 10% of the genes having differential splicing between the genotypes: a magnitude similar to between species differences. Genes with differential alternative splicing between genotypes frequently exhibit dominant inheritance. Remarkably, the pattern of surplus of differences in alternative splicing at extreme temperatures resembled the pattern seen for gene expression intensity. Since different sets of genes were involved for the two phenotypes, we propose that purifying selection results in the reduction of differences at benign temperatures. Relaxed purifying selection at temperature extremes, on the other hand, may cause the divergence in gene expression and alternative splicing between the two strains in rarely encountered environments. Copyright © 2016 by the Genetics Society of America.

VGLUT1 and VGLUT2 mRNA expression in the primate auditory pathway

PubMed Central

Hackett, Troy A.; Takahata, Toru; Balaram, Pooja

2011-01-01

The vesicular glutamate transporters (VGLUTs) regulate storage and release of glutamate in the brain. In adult animals, the VGLUT1 and VGLUT2 isoforms are widely expressed and differentially distributed, suggesting that neural circuits exhibit distinct modes of glutamate regulation. Studies in rodents suggest that VGLUT1 and VGLUT2 mRNA expression patterns are partly complementary, with VGLUT1 expressed at higher levels in cortex and VGLUT2 prominent subcortically, but with overlapping distributions in some nuclei. In primates, VGLUT gene expression has not been previously studied in any part of the brain. The purposes of the present study were to document the regional expression of VGLUT1 and VGLUT2 mRNA in the auditory pathway through A1 in cortex, and to determine whether their distributions are comparable to rodents. In situ hybridization with antisense riboprobes revealed that VGLUT2 was strongly expressed by neurons in the cerebellum and most major auditory nuclei, including the dorsal and ventral cochlear nuclei, medial and lateral superior olivary nuclei, central nucleus of the inferior colliculus, sagulum, and all divisions of the medial geniculate. VGLUT1 was densely expressed in the hippocampus and ventral cochlear nuclei, and at reduced levels in other auditory nuclei. In auditory cortex, neurons expressing VGLUT1 were widely distributed in layers II – VI of the core, belt and parabelt regions. VGLUT2 was most strongly expressed by neurons in layers IIIb and IV, weakly by neurons in layers II – IIIa, and at very low levels in layers V – VI. The findings indicate that VGLUT2 is strongly expressed by neurons at all levels of the subcortical auditory pathway, and by neurons in the middle layers of cortex, whereas VGLUT1 is strongly expressed by most if not all glutamatergic neurons in auditory cortex and at variable levels among auditory subcortical nuclei. These patterns imply that VGLUT2 is the main vesicular glutamate transporter in subcortical and thalamocortical (TC) circuits, whereas VGLUT1 is dominant in cortico-cortical (CC) and cortico-thalamic (CT) systems of projections. The results also suggest that VGLUT mRNA expression patterns in primates are similar to rodents, and establishes a baseline for detailed studies of these transporters in selected circuits of the auditory system. PMID:21111036

VGLUT1 and VGLUT2 mRNA expression in the primate auditory pathway.

PubMed

Hackett, Troy A; Takahata, Toru; Balaram, Pooja

2011-04-01

The vesicular glutamate transporters (VGLUTs) regulate the storage and release of glutamate in the brain. In adult animals, the VGLUT1 and VGLUT2 isoforms are widely expressed and differentially distributed, suggesting that neural circuits exhibit distinct modes of glutamate regulation. Studies in rodents suggest that VGLUT1 and VGLUT2 mRNA expression patterns are partly complementary, with VGLUT1 expressed at higher levels in the cortex and VGLUT2 prominent subcortically, but with overlapping distributions in some nuclei. In primates, VGLUT gene expression has not been previously studied in any part of the brain. The purposes of the present study were to document the regional expression of VGLUT1 and VGLUT2 mRNA in the auditory pathway through A1 in the cortex, and to determine whether their distributions are comparable to rodents. In situ hybridization with antisense riboprobes revealed that VGLUT2 was strongly expressed by neurons in the cerebellum and most major auditory nuclei, including the dorsal and ventral cochlear nuclei, medial and lateral superior olivary nuclei, central nucleus of the inferior colliculus, sagulum, and all divisions of the medial geniculate. VGLUT1 was densely expressed in the hippocampus and ventral cochlear nuclei, and at reduced levels in other auditory nuclei. In the auditory cortex, neurons expressing VGLUT1 were widely distributed in layers II-VI of the core, belt and parabelt regions. VGLUT2 was expressed most strongly by neurons in layers IIIb and IV, weakly by neurons in layers II-IIIa, and at very low levels in layers V-VI. The findings indicate that VGLUT2 is strongly expressed by neurons at all levels of the subcortical auditory pathway, and by neurons in the middle layers of the cortex, whereas VGLUT1 is strongly expressed by most if not all glutamatergic neurons in the auditory cortex and at variable levels among auditory subcortical nuclei. These patterns imply that VGLUT2 is the main vesicular glutamate transporter in subcortical and thalamocortical (TC) circuits, whereas VGLUT1 is dominant in corticocortical (CC) and corticothalamic (CT) systems of projections. The results also suggest that VGLUT mRNA expression patterns in primates are similar to rodents, and establish a baseline for detailed studies of these transporters in selected circuits of the auditory system. Copyright © 2010 Elsevier B.V. All rights reserved.

Simple Shared Motifs (SSM) in conserved region of promoters: a new approach to identify co-regulation patterns.

PubMed

Gruel, Jérémy; LeBorgne, Michel; LeMeur, Nolwenn; Théret, Nathalie

2011-09-12

Regulation of gene expression plays a pivotal role in cellular functions. However, understanding the dynamics of transcription remains a challenging task. A host of computational approaches have been developed to identify regulatory motifs, mainly based on the recognition of DNA sequences for transcription factor binding sites. Recent integration of additional data from genomic analyses or phylogenetic footprinting has significantly improved these methods. Here, we propose a different approach based on the compilation of Simple Shared Motifs (SSM), groups of sequences defined by their length and similarity and present in conserved sequences of gene promoters. We developed an original algorithm to search and count SSM in pairs of genes. An exceptional number of SSM is considered as a common regulatory pattern. The SSM approach is applied to a sample set of genes and validated using functional gene-set enrichment analyses. We demonstrate that the SSM approach selects genes that are over-represented in specific biological categories (Ontology and Pathways) and are enriched in co-expressed genes. Finally we show that genes co-expressed in the same tissue or involved in the same biological pathway have increased SSM values. Using unbiased clustering of genes, Simple Shared Motifs analysis constitutes an original contribution to provide a clearer definition of expression networks.

Simple Shared Motifs (SSM) in conserved region of promoters: a new approach to identify co-regulation patterns

PubMed Central

2011-01-01

Background Regulation of gene expression plays a pivotal role in cellular functions. However, understanding the dynamics of transcription remains a challenging task. A host of computational approaches have been developed to identify regulatory motifs, mainly based on the recognition of DNA sequences for transcription factor binding sites. Recent integration of additional data from genomic analyses or phylogenetic footprinting has significantly improved these methods. Results Here, we propose a different approach based on the compilation of Simple Shared Motifs (SSM), groups of sequences defined by their length and similarity and present in conserved sequences of gene promoters. We developed an original algorithm to search and count SSM in pairs of genes. An exceptional number of SSM is considered as a common regulatory pattern. The SSM approach is applied to a sample set of genes and validated using functional gene-set enrichment analyses. We demonstrate that the SSM approach selects genes that are over-represented in specific biological categories (Ontology and Pathways) and are enriched in co-expressed genes. Finally we show that genes co-expressed in the same tissue or involved in the same biological pathway have increased SSM values. Conclusions Using unbiased clustering of genes, Simple Shared Motifs analysis constitutes an original contribution to provide a clearer definition of expression networks. PMID:21910886

Changes in cis-regulatory elements of a key floral regulator are associated with divergence of inflorescence architectures.

PubMed

Kusters, Elske; Della Pina, Serena; Castel, Rob; Souer, Erik; Koes, Ronald

2015-08-15

Higher plant species diverged extensively with regard to the moment (flowering time) and position (inflorescence architecture) at which flowers are formed. This seems largely caused by variation in the expression patterns of conserved genes that specify floral meristem identity (FMI), rather than changes in the encoded proteins. Here, we report a functional comparison of the promoters of homologous FMI genes from Arabidopsis, petunia, tomato and Antirrhinum. Analysis of promoter-reporter constructs in petunia and Arabidopsis, as well as complementation experiments, showed that the divergent expression of leafy (LFY) and the petunia homolog aberrant leaf and flower (ALF) results from alterations in the upstream regulatory network rather than cis-regulatory changes. The divergent expression of unusual floral organs (UFO) from Arabidopsis, and the petunia homolog double top (DOT), however, is caused by the loss or gain of cis-regulatory promoter elements, which respond to trans-acting factors that are expressed in similar patterns in both species. Introduction of pUFO:UFO causes no obvious defects in Arabidopsis, but in petunia it causes the precocious and ectopic formation of flowers. This provides an example of how a change in a cis-regulatory region can account for a change in the plant body plan. © 2015. Published by The Company of Biologists Ltd.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fournier, Marcia V.; Martin, Katherine J.; Kenny, Paraic A.

To understand how non-malignant human mammary epithelial cells (HMEC) transit from a disorganized proliferating to an organized growth arrested state, and to relate this process to the changes that occur in breast cancer, we studied gene expression changes in non-malignant HMEC grown in three-dimensional cultures, and in a previously published panel of microarray data for 295 breast cancer samples. We hypothesized that the gene expression pattern of organized and growth arrested mammary acini would share similarities with breast tumors with good prognoses. Using Affymetrix HG-U133A microarrays, we analyzed the expression of 22,283 gene transcripts in two HMEC cell lines, 184more » (finite life span) and HMT3522 S1 (immortal non-malignant), on successive days post-seeding in a laminin-rich extracellular matrix assay. Both HMECs underwent growth arrest in G0/G1 and differentiated into polarized acini between days 5 and 7. We identified gene expression changes with the same temporal pattern in both lines. We show that genes that are significantly lower in the organized, growth arrested HMEC than in their proliferating counterparts can be used to classify breast cancer patients into poor and good prognosis groups with high accuracy. This study represents a novel unsupervised approach to identifying breast cancer markers that may be of use clinically.« less

Concurrent hypothalamic gene expression under acute and chronic long days: Implications for initiation and maintenance of photoperiodic response in migratory songbirds.

PubMed

Mishra, Ila; Bhardwaj, Sanjay K; Malik, Shalie; Kumar, Vinod

2017-01-05

Hypothalamic expression of the thyroid hormone (TH) responsive gonadostimulatory (eya3, cga, tshβ, dio2, dio3, gnrh, gnih) and neurosteroid pathway genes (androgen receptor [ar], aromatase [cyp19], estrogen receptor [er] α and β) was examined in photosensitive redheaded buntings exposed to 2 (acute, experiment 1) or 12 (chronic, experiment 2) long days (16L:8D). Experiment 2 also included a photorefractory group. Acute long days caused a significant increase in eya3, cga, tshβ, dio2 and gnrh and decrease in dio3 mRNA levels. eya3, cga and tshβ expressions were unchanged after the chronic long days. We also found increased cyp19, erα and erβ mRNA levels after acute, and increased cyp19 and decreased erβ levels after the chronic long-day exposure. Photorefractory buntings showed expression patterns similar to that in the photosensitive state, except for high gnrh and gnih and low dio3 mRNA levels. Consistent with gene expression patterns, there were changes in fat deposition, body mass, testis size, and plasma levels of testosterone, tri-iodothyronine and thyroxine. These results show concurrent photostimulation of the TH-signalling and neurosteroid pathways, and extend the idea, based on differences in gene expression, that transitions in seasonal photoperiodic states are accomplished at the transcriptional levels in absolute photorefractory species. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Expression of Pannexin 1 and Pannexin 3 during skeletal muscle development, regeneration, and Duchenne muscular dystrophy.

PubMed

Pham, Tammy L; St-Pierre, Marie-Eve; Ravel-Chapuis, Aymeric; Parks, Tara E C; Langlois, Stéphanie; Penuela, Silvia; Jasmin, Bernard J; Cowan, Kyle N

2018-05-10

Pannexin 1 (Panx1) and Pannexin 3 (Panx3) are single membrane channels recently implicated in myogenic commitment, as well as myoblast proliferation and differentiation in vitro. However, their expression patterns during skeletal muscle development and regeneration had yet to be investigated. Here, we show that Panx1 levels increase during skeletal muscle development becoming highly expressed together with Panx3 in adult skeletal muscle. In adult mice, Panx1 and Panx3 were differentially expressed in fast- and slow-twitch muscles. We also report that Panx1/PANX1 and Panx3/PANX3 are co-expressed in mouse and human satellite cells, which play crucial roles in skeletal muscle regeneration. Interestingly, Panx1 and Panx3 levels were modulated in muscle degeneration/regeneration, similar to the pattern seen during skeletal muscle development. As Duchenne muscular dystrophy is characterized by skeletal muscle degeneration and impaired regeneration, we next used mild and severe mouse models of this disease and found a significant dysregulation of Panx1 and Panx3 levels in dystrophic skeletal muscles. Together, our results are the first demonstration that Panx1 and Panx3 are differentially expressed amongst skeletal muscle types with their levels being highly modulated during skeletal muscle development, regeneration, and dystrophy. These findings suggest that Panx1 and Panx3 channels may play important and distinct roles in healthy and diseased skeletal muscles. © 2018 Wiley Periodicals, Inc.

MicroRNA profiling of the murine hematopoietic system

PubMed Central

Monticelli, Silvia; Ansel, K Mark; Xiao, Changchun; Socci, Nicholas D; Krichevsky, Anna M; Thai, To-Ha; Rajewsky, Nikolaus; Marks, Debora S; Sander, Chris; Rajewsky, Klaus; Rao, Anjana; Kosik, Kenneth S

2005-01-01

Background MicroRNAs (miRNAs) are a class of recently discovered noncoding RNA genes that post-transcriptionally regulate gene expression. It is becoming clear that miRNAs play an important role in the regulation of gene expression during development. However, in mammals, expression data are principally based on whole tissue analysis and are still very incomplete. Results We used oligonucleotide arrays to analyze miRNA expression in the murine hematopoietic system. Complementary oligonucleotides capable of hybridizing to 181 miRNAs were immobilized on a membrane and probed with radiolabeled RNA derived from low molecular weight fractions of total RNA from several different hematopoietic and neuronal cells. This method allowed us to analyze cell type-specific patterns of miRNA expression and to identify miRNAs that might be important for cell lineage specification and/or cell effector functions. Conclusion This is the first report of systematic miRNA gene profiling in cells of the hematopoietic system. As expected, miRNA expression patterns were very different between hematopoietic and non-hematopoietic cells, with further subtle differences observed within the hematopoietic group. Interestingly, the most pronounced similarities were observed among fully differentiated effector cells (Th1 and Th2 lymphocytes and mast cells) and precursors at comparable stages of differentiation (double negative thymocytes and pro-B cells), suggesting that in addition to regulating the process of commitment to particular cellular lineages, miRNAs might have an important general role in the mechanism of cell differentiation and maintenance of cell identity. PMID:16086853

Identification, characterization and expression analysis of pigeonpea miRNAs in response to Fusarium wilt.

PubMed

Hussain, Khalid; Mungikar, Kanak; Kulkarni, Abhijeet; Kamble, Avinash

2018-05-05

Upon confrontation with unfavourable conditions, plants invoke a very complex set of biochemical and physiological reactions and alter gene expression patterns to combat the situations. MicroRNAs (miRNAs), a class of small non-coding RNA, contribute extensively in regulation of gene expression through translation inhibition or degradation of their target mRNAs during such conditions. Therefore, identification of miRNAs and their targets holds importance in understanding the regulatory networks triggered during stress. Structure and sequence similarity based in silico prediction of miRNAs in Cajanus cajan L. (Pigeonpea) draft genome sequence has been carried out earlier. These annotations also appear in related GenBank genome sequence entries. However, there are no reports available on context dependent miRNA expression and their targets in pigeonpea. Therefore, in the present study we addressed these questions computationally, using pigeonpea EST sequence information. We identified five novel pigeonpea miRNA precursors, their mature forms and targets. Interestingly, only one of these miRNAs (miR169i-3p) was identified earlier in draft genome sequence. We then validated expression of these miRNAs, experimentally. It was also observed that these miRNAs show differential expression patterns in response to Fusarium inoculation indicating their biotic stress responsive nature. Overall these results will help towards better understanding the regulatory network of defense during pigeonpea -pathogen interactions and role of miRNAs in the process. Copyright © 2018 Elsevier B.V. All rights reserved.

Genome-wide identification and expression analysis of SBP-like transcription factor genes in Moso Bamboo (Phyllostachys edulis).

PubMed

Pan, Feng; Wang, Yue; Liu, Huanglong; Wu, Min; Chu, Wenyuan; Chen, Danmei; Xiang, Yan

2017-06-27

The SQUAMOSA promoter binding protein-like (SPL) proteins are plant-specific transcription factors (TFs) that function in a variety of developmental processes including growth, flower development, and signal transduction. SPL proteins are encoded by a gene family, and these genes have been characterized in two model grass species, Zea mays and Oryza sativa. The SPL gene family has not been well studied in moso bamboo (Phyllostachys edulis), a woody grass species. We identified 32 putative PeSPL genes in the P. edulis genome. Phylogenetic analysis arranged the PeSPL protein sequences in eight groups. Similarly, phylogenetic analysis of the SBP-like and SBP proteins from rice and maize clustered them into eight groups analogous to those from P. edulis. Furthermore, the deduced PeSPL proteins in each group contained very similar conserved sequence motifs. Our analyses indicate that the PeSPL genes experienced a large-scale duplication event ~15 million years ago (MYA), and that divergence between the PeSPL and OsSPL genes occurred 34 MYA. The stress-response expression profiles and tissue-specificity of the putative PeSPL gene promoter regions showed that SPL genes in moso bamboo have potential biological functions in stress resistance as well as in growth and development. We therefore examined PeSPL gene expression in response to different plant hormone and drought (polyethylene glycol-6000; PEG) treatments to mimic biotic and abiotic stresses. Expression of three (PeSPL10, -12, -17), six (PeSPL1, -10, -12, -17, -20, -31), and nine (PeSPL5, -8, -9, -14, -15, -19, -20, -31, -32) genes remained relatively stable after treating with salicylic acid (SA), gibberellic acid (GA), and PEG, respectively, while the expression patterns of other genes changed. In addition, analysis of tissue-specific expression of the moso bamboo SPL genes during development showed differences in their spatiotemporal expression patterns, and many were expressed at high levels in flowers and leaves. The PeSPL genes play important roles in plant growth and development, including responses to stresses, and most of the genes are expressed in different tissues. Our study provides a comprehensive understanding of the PeSPL gene family and may enable future studies on the function and evolution of SPL genes in moso bamboo.

De novo Transcriptome Assembly of Chinese Kale and Global Expression Analysis of Genes Involved in Glucosinolate Metabolism in Multiple Tissues

PubMed Central

Wu, Shuanghua; Lei, Jianjun; Chen, Guoju; Chen, Hancai; Cao, Bihao; Chen, Changming

2017-01-01

Chinese kale, a vegetable of the cruciferous family, is a popular crop in southern China and Southeast Asia due to its high glucosinolate content and nutritional qualities. However, there is little research on the molecular genetics and genes involved in glucosinolate metabolism and its regulation in Chinese kale. In this study, we sequenced and characterized the transcriptomes and expression profiles of genes expressed in 11 tissues of Chinese kale. A total of 216 million 150-bp clean reads were generated using RNA-sequencing technology. From the sequences, 98,180 unigenes were assembled for the whole plant, and 49,582~98,423 unigenes were assembled for each tissue. Blast analysis indicated that a total of 80,688 (82.18%) unigenes exhibited similarity to known proteins. The functional annotation and classification tools used in this study suggested that genes principally expressed in Chinese kale, were mostly involved in fundamental processes, such as cellular and molecular functions, the signal transduction, and biosynthesis of secondary metabolites. The expression levels of all unigenes were analyzed in various tissues of Chinese kale. A large number of candidate genes involved in glucosinolate metabolism and its regulation were identified, and the expression patterns of these genes were analyzed. We found that most of the genes involved in glucosinolate biosynthesis were highly expressed in the root, petiole, and in senescent leaves. The expression patterns of ten glucosinolate biosynthetic genes from RNA-seq were validated by quantitative RT-PCR in different tissues. These results provided an initial and global overview of Chinese kale gene functions and expression activities in different tissues. PMID:28228764

A Machine Learning Approach to Discover Rules for Expressive Performance Actions in Jazz Guitar Music.

PubMed

Giraldo, Sergio I; Ramirez, Rafael

2016-01-01

Expert musicians introduce expression in their performances by manipulating sound properties such as timing, energy, pitch, and timbre. Here, we present a data driven computational approach to induce expressive performance rule models for note duration, onset, energy, and ornamentation transformations in jazz guitar music. We extract high-level features from a set of 16 commercial audio recordings (and corresponding music scores) of jazz guitarist Grant Green in order to characterize the expression in the pieces. We apply machine learning techniques to the resulting features to learn expressive performance rule models. We (1) quantitatively evaluate the accuracy of the induced models, (2) analyse the relative importance of the considered musical features, (3) discuss some of the learnt expressive performance rules in the context of previous work, and (4) assess their generailty. The accuracies of the induced predictive models is significantly above base-line levels indicating that the audio performances and the musical features extracted contain sufficient information to automatically learn informative expressive performance patterns. Feature analysis shows that the most important musical features for predicting expressive transformations are note duration, pitch, metrical strength, phrase position, Narmour structure, and tempo and key of the piece. Similarities and differences between the induced expressive rules and the rules reported in the literature were found. Differences may be due to the fact that most previously studied performance data has consisted of classical music recordings. Finally, the rules' performer specificity/generality is assessed by applying the induced rules to performances of the same pieces performed by two other professional jazz guitar players. Results show a consistency in the ornamentation patterns between Grant Green and the other two musicians, which may be interpreted as a good indicator for generality of the ornamentation rules.

Dynamic pattern of endothelial cell adhesion molecule expression in muscle and perineural vessels from patients with classic polyarteritis nodosa.

PubMed

Coll-Vinent, B; Cebrián, M; Cid, M C; Font, C; Esparza, J; Juan, M; Yagüe, J; Urbano-Márquez, A; Grau, J M

1998-03-01

To investigate endothelial cell adhesion molecule expression in vessels from patients with classic polyarteritis nodosa (PAN). Frozen sections of 21 muscle and 16 nerve samples from 30 patients with biopsy-proven PAN and 12 histologically normal muscle and 2 histologically normal nerve samples from 12 controls were studied immunohistochemically, using specific monoclonal antibodies (MAb) that recognize adhesion molecules. Adhesion molecules identified were intercellular adhesion molecule 1 (ICAM-1), ICAM-2, ICAM-3, vascular cell adhesion molecule 1 (VCAM-1), platelet endothelial cell adhesion molecule 1 (PECAM-1), E-selectin, P-selectin, L-selectin, lymphocyte function-associated antigen 1 (LFA-1), and very late activation antigen 4 (VLA-4). Neutrophils were identified with a MAb recognizing neutrophil elastase. Endothelial cells were identified with the lectin ulex europaeus. In early lesions, expression of PECAM-1, ICAM-1, ICAM-2, and P-selectin was similar to that in control samples, and VCAM-1 and E-selectin were induced in vascular endothelium. In advanced lesions, immunostaining for adhesion molecules diminished or disappeared in luminal endothelium, whereas these molecules were clearly expressed in microvessels within and surrounding inflamed vessels. Staining in endothelia from vessels in a healing stage tended to be negative. A high proportion of infiltrating leukocytes expressed LFA-1 and VLA-4, and only a minority expressed L-selectin. No relationship between the expression pattern of adhesion molecules and clinical features, disease duration, or previous corticosteroid treatment was observed. Endothelial adhesion molecule expression in PAN is a dynamic process that varies according to the histopathologic stage of the vascular lesions. The preferential expression of constitutive and inducible adhesion molecules in microvessels suggests that angiogenesis contributes to the persistence of inflammatory infiltration in PAN.

Global Expression Profiling in Atopic Eczema Reveals Reciprocal Expression of Inflammatory and Lipid Genes

PubMed Central

Sääf, Annika M.; Tengvall-Linder, Maria; Chang, Howard Y.; Adler, Adam S.; Wahlgren, Carl-Fredrik; Scheynius, Annika; Nordenskjöld, Magnus; Bradley, Maria

2008-01-01

Background Atopic eczema (AE) is a common chronic inflammatory skin disorder. In order to dissect the genetic background several linkage and genetic association studies have been performed. Yet very little is known about specific genes involved in this complex skin disease, and the underlying molecular mechanisms are not fully understood. Methodology/Findings We used human DNA microarrays to identify a molecular picture of the programmed responses of the human genome to AE. The transcriptional program was analyzed in skin biopsy samples from lesional and patch-tested skin from AE patients sensitized to Malassezia sympodialis (M. sympodialis), and corresponding biopsies from healthy individuals. The most notable feature of the global gene-expression pattern observed in AE skin was a reciprocal expression of induced inflammatory genes and repressed lipid metabolism genes. The overall transcriptional response in M. sympodialis patch-tested AE skin was similar to the gene-expression signature identified in lesional AE skin. In the constellation of genes differentially expressed in AE skin compared to healthy control skin, we have identified several potential susceptibility genes that may play a critical role in the pathological condition of AE. Many of these genes, including genes with a role in immune responses, lipid homeostasis, and epidermal differentiation, are localized on chromosomal regions previously linked to AE. Conclusions/Significance Through genome-wide expression profiling, we were able to discover a distinct reciprocal expression pattern of induced inflammatory genes and repressed lipid metabolism genes in skin from AE patients. We found a significant enrichment of differentially expressed genes in AE with cytobands associated to the disease, and furthermore new chromosomal regions were found that could potentially guide future region-specific linkage mapping in AE. The full data set is available at http://microarray-pubs.stanford.edu/eczema. PMID:19107207

Specialized Motor-Driven dusp1 Expression in the Song Systems of Multiple Lineages of Vocal Learning Birds

PubMed Central

Horita, Haruhito; Kobayashi, Masahiko; Liu, Wan-chun; Oka, Kotaro; Jarvis, Erich D.; Wada, Kazuhiro

2012-01-01

Mechanisms for the evolution of convergent behavioral traits are largely unknown. Vocal learning is one such trait that evolved multiple times and is necessary in humans for the acquisition of spoken language. Among birds, vocal learning is evolved in songbirds, parrots, and hummingbirds. Each time similar forebrain song nuclei specialized for vocal learning and production have evolved. This finding led to the hypothesis that the behavioral and neuroanatomical convergences for vocal learning could be associated with molecular convergence. We previously found that the neural activity-induced gene dual specificity phosphatase 1 (dusp1) was up-regulated in non-vocal circuits, specifically in sensory-input neurons of the thalamus and telencephalon; however, dusp1 was not up-regulated in higher order sensory neurons or motor circuits. Here we show that song motor nuclei are an exception to this pattern. The song nuclei of species from all known vocal learning avian lineages showed motor-driven up-regulation of dusp1 expression induced by singing. There was no detectable motor-driven dusp1 expression throughout the rest of the forebrain after non-vocal motor performance. This pattern contrasts with expression of the commonly studied activity-induced gene egr1, which shows motor-driven expression in song nuclei induced by singing, but also motor-driven expression in adjacent brain regions after non-vocal motor behaviors. In the vocal non-learning avian species, we found no detectable vocalizing-driven dusp1 expression in the forebrain. These findings suggest that independent evolutions of neural systems for vocal learning were accompanied by selection for specialized motor-driven expression of the dusp1 gene in those circuits. This specialized expression of dusp1 could potentially lead to differential regulation of dusp1-modulated molecular cascades in vocal learning circuits. PMID:22876306

Anatomical and histological profiling of orphan G-protein-coupled receptor expression in gastrointestinal tract of C57BL/6J mice.

PubMed

Ito, Junko; Ito, Masahiko; Nambu, Hirohide; Fujikawa, Toru; Tanaka, Kenichi; Iwaasa, Hisashi; Tokita, Shigeru

2009-11-01

G-protein-coupled receptors (GPCRs) constitute the largest family of transmembrane receptors and regulate a variety of physiological and disease processes. Although the roles of many non-odorant GPCRs have been identified in vivo, several GPCRs remain orphans (oGPCRs). The gastrointestinal (GI) tract is the largest endocrine organ and is a promising target for drug discovery. Given their close link to physiological function, the anatomical and histological expression profiles of benchmark GI-related GPCRs, such as the cholecystokinin-1 receptor and GPR120, and 106 oGPCRs were investigated in the mucosal and muscle-myenteric nerve layers in the GI tract of C57BL/6J mice by quantitative real-time polymerase chain reaction. The mRNA expression patterns of these benchmark molecules were consistent with previous in situ hybridization and immunohistochemical studies, validating the experimental protocols in this study. Of 96 oGPCRs with significant mRNA expression in the GI tract, several oGPCRs showed unique expression patterns. GPR85, GPR37, GPR37L1, brain-specific angiogenesis inhibitor (BAI) 1, BAI2, BAI3, and GPRC5B mRNAs were preferentially expressed in the muscle-myenteric nerve layer, similar to GPCRs that are expressed in both the central and enteric nerve systems and that play multiple regulatory roles throughout the gut-brain axis. In contrast, GPR112, trace amine-associated receptor (TAAR) 1, TAAR2, and GPRC5A mRNAs were preferentially expressed in the mucosal layer, suggesting their potential roles in the regulation of secretion, immunity, and epithelial homeostasis. These anatomical and histological mRNA expression profiles of oGPCRs provide useful clues about the physiological roles of oGPCRs in the GI tract.

A Machine Learning Approach to Discover Rules for Expressive Performance Actions in Jazz Guitar Music

PubMed Central

Giraldo, Sergio I.; Ramirez, Rafael

2016-01-01

Expert musicians introduce expression in their performances by manipulating sound properties such as timing, energy, pitch, and timbre. Here, we present a data driven computational approach to induce expressive performance rule models for note duration, onset, energy, and ornamentation transformations in jazz guitar music. We extract high-level features from a set of 16 commercial audio recordings (and corresponding music scores) of jazz guitarist Grant Green in order to characterize the expression in the pieces. We apply machine learning techniques to the resulting features to learn expressive performance rule models. We (1) quantitatively evaluate the accuracy of the induced models, (2) analyse the relative importance of the considered musical features, (3) discuss some of the learnt expressive performance rules in the context of previous work, and (4) assess their generailty. The accuracies of the induced predictive models is significantly above base-line levels indicating that the audio performances and the musical features extracted contain sufficient information to automatically learn informative expressive performance patterns. Feature analysis shows that the most important musical features for predicting expressive transformations are note duration, pitch, metrical strength, phrase position, Narmour structure, and tempo and key of the piece. Similarities and differences between the induced expressive rules and the rules reported in the literature were found. Differences may be due to the fact that most previously studied performance data has consisted of classical music recordings. Finally, the rules' performer specificity/generality is assessed by applying the induced rules to performances of the same pieces performed by two other professional jazz guitar players. Results show a consistency in the ornamentation patterns between Grant Green and the other two musicians, which may be interpreted as a good indicator for generality of the ornamentation rules. PMID:28066290

Generation of shape complexity through tissue conflict resolution

PubMed Central

Rebocho, Alexandra B; Southam, Paul; Kennaway, J Richard; Coen, Enrico

2017-01-01

Out-of-plane tissue deformations are key morphogenetic events during plant and animal development that generate 3D shapes, such as flowers or limbs. However, the mechanisms by which spatiotemporal patterns of gene expression modify cellular behaviours to generate such deformations remain to be established. We use the Snapdragon flower as a model system to address this problem. Combining cellular analysis with tissue-level modelling, we show that an orthogonal pattern of growth orientations plays a key role in generating out-of-plane deformations. This growth pattern is most likely oriented by a polarity field, highlighted by PIN1 protein localisation, and is modulated by dorsoventral gene activity. The orthogonal growth pattern interacts with other patterns of differential growth to create tissue conflicts that shape the flower. Similar shape changes can be generated by contraction as well as growth, suggesting tissue conflict resolution provides a flexible morphogenetic mechanism for generating shape diversity in plants and animals. DOI: http://dx.doi.org/10.7554/eLife.20156.001 PMID:28166865

Non-targeted profiling of circulating microRNAs in women with polycystic ovary syndrome (PCOS): effects of obesity and sex hormones.

PubMed

Murri, Mora; Insenser, María; Fernández-Durán, Elena; San-Millán, José L; Luque-Ramírez, Manuel; Escobar-Morreale, Héctor F

2018-02-02

Circulating micro-ribonucleic acids (miRNAs) are small noncoding RNA molecules that influence gene transcription. We conducted the present profiling study to characterize the expression of circulating miRNAs in lean and obese patients with polycystic ovary syndrome (PCOS), the most common endocrine and metabolic disorder in premenopausal women. We selected 11 control women, 12 patients with PCOS and 12 men so that they were similar in terms of body mass index. Five control women, 6 men and 6 patients with PCOS had normal weight whereas 6 subjects per group were obese. We used miRCURY LNA™ Universal RT microRNA PCR for miRNA profiling. The expression of 38 miRNAs and was different between subjects with PCOS and male and female controls. The differences in 15 miRNAs followed a pattern suggestive of androgenization characterized by expression levels that were similar in patients with PCOS and men but were different compared with those of control women. The expression of 13 miRNAs in women with PCOS was similar to that of control women and different compared with the expression observed in men, suggesting sexual dimorphism and, lastly, we observed 5 miRNAs that were expressed differently in women with PCOS compared with both men and control women, suggesting a specific abnormality in expression associated with the syndrome. Obesity interacted with the differences in several of these miRNAs, and the expression levels of many of them correlated with the hirsutism score, sex hormones and/or indexes of obesity, adiposity and metabolic dysfunction. The present results suggest that several serum miRNAs are influenced by PCOS, sex hormones and obesity. Our findings may guide the targeted search of miRNAs as clinically relevant markers for PCOS and its association with obesity and metabolic dysfunction in future studies. Copyright © 2018. Published by Elsevier Inc.

A transcriptional approach to unravel the connection between phospholipases A₂ and D and ABA signal in citrus under water stress.

PubMed

Romero, Paco; Lafuente, M Teresa; Alférez, Fernando

2014-07-01

The effect of water stress on the interplay between phospholipases (PL) A2 and D and ABA signalling was investigated in fruit and leaves from the sweet orange Navelate and its fruit-specific ABA-deficient mutant Pinalate by studying simultaneously expression of 5 PLD and 3 PLA2-encoding genes. In general, expression levels of PLD-encoding genes were higher at harvest in the flavedo (coloured outer part of the peel) from Pinalate. Moreover, a higher and transient increase in expression of CsPLDα, CsPLDβ, CsPLDδ and CsPLDζ was observed in the mutant as compared to Navelate fruit under water stress, which may reflect a mechanism of acclimation to water stress influenced by ABA deficiency. An early induction in CsPLDγ gene expression, when increase in peel damage during fruit storage was most evident, suggested a role for this gene in membrane degradation processes during water stress. Exogenous ABA on mutant fruit modified the expression of all PLD genes and reduced the expression of CsPLDα and CsPLDβ by 1 week to levels similar to those of Navelate, suggesting a repressor role of ABA on these genes. In general, CssPLA2α and β transcript levels were lower in flavedo from Pinalate than from Navelate fruit during the first 3 weeks of storage, suggesting that expression of these genes also depends at least partially on ABA levels. Patterns of expression of PLD and PLA2-encoding genes were very similar in Navelate and Pinalate leaves, which have similar ABA levels, when comparing both RH conditions. Results comparison with other from previous works in the same experimental systems helped to decipher the effect of the stress severity on the differential response of some of these genes under dehydration conditions and pointed out the interplay between PLA2 and PLD families and their connection with ABA signalling in citrus. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

AtSIG6 and other members of the sigma gene family jointly but differentially determine plastid target gene expression in Arabidopsis thaliana

PubMed Central

Bock, Sylvia; Ortelt, Jennifer; Link, Gerhard

2014-01-01

Plants contain a nuclear gene family for plastid sigma factors, i.e., proteins that associate with the “bacterial-type” organellar RNA polymerase and confer the ability for correct promoter binding and transcription initiation. Questions that are still unresolved relate to the “division of labor” among members of the sigma family, both in terms of their range of target genes and their temporal and spatial activity during development. Clues to the in vivo role of individual sigma genes have mainly come from studies of sigma knockout lines. Despite its obvious strengths, however, this strategy does not necessarily trace-down causal relationships between mutant phenotype and a single sigma gene, if other family members act in a redundant and/or compensatory manner. We made efforts to reduce the complexity by genetic crosses of Arabidopsis single mutants (with focus on a chlorophyll-deficient sig6 line) to generate double knockout lines. The latter typically had a similar visible phenotype as the parental lines, but tended to be more strongly affected in the transcript patterns of both plastid and sigma genes. Because triple mutants were lethal under our growth conditions, we exploited a strategy of transformation of single and double mutants with RNAi constructs that contained sequences from the unconserved sigma region (UCR). These RNAi/knockout lines phenotypically resembled their parental lines, but were even more strongly affected in their plastid transcript patterns. Expression patterns of sigma genes revealed both similarities and differences compared to the parental lines, with transcripts at reduced or unchanged amounts and others that were found to be present in higher (perhaps compensatory) amounts. Together, our results reveal considerable flexibility of gene activity at the levels of both sigma and plastid gene expression. A (still viable) “basal state” seems to be reached, if 2–3 of the 6 Arabidopsis sigma genes are functionally compromised. PMID:25505479

Dexamethasone transcriptionally increases the expression of the pregnane X receptor and synergistically enhances pyrethroid esfenvalerate in the induction of cytochrome P450 3A23.

PubMed

Shi, Deshi; Yang, Dongfang; Yan, Bingfang

2010-10-15

The pregnane X receptor (PXR) is recognized as a key regulator for the induction of a large number of genes in drug metabolism and transport. The transactivation of PXR is enhanced by the glucocorticoid dexamethasone and the enhancement is linked to the induction of PXR in humans and rats. The present study was undertaken to determine the mechanism for the induction and ascertain the synergistic effect on the expression of CYP3A23, a rat PXR target. In primary hepatocytes, significant induction of PXR was detected as early as 2h after the treatment and the maximal induction occurred at 1 microM dexamethasone. Similar induction kinetics was observed in the hepatoma line H4-II-E-C3. The induction was abolished by actinomycin D and dexamethasone efficaciously stimulated the rat PXR promoter. In addition, dexamethasone synergized esfenvalerate (an insecticide and a PXR activator) in inducing CYP3A23 and stimulating the CYP3A23 promoter. The full promoter of CYP3A23 (-1445/+74) was activated in a similar pattern as the changes in PXR mRNA in response to dexamethasone, esfenvalerate and co-treatment. In contrast, different responding patterns were detected on the stimulation of the CYP3A23 proximal promoter. Synergistic stimulation was also observed on the CYP3A4-DP-Luc reporter, the human counterpart of CYP3A23. These findings establish that transactivation is responsible for the induction of rat PXR and the induction presents potential interactions with insecticides in a species-conserved manner. The different responding patterns among CYP3A23 reporters point to an involvement of multiple transcriptional events in the regulation of CYP3A23 expression by dexamethasone, esfenvalerate and both. Copyright 2010 Elsevier Inc. All rights reserved.

DEXAMETHASONE TRANSCRIPTIONALLY INCREASES THE EXPRESSION OF THE PREGNANE X RECEPTOR AND SYNERGISTICALLY ENHANCES PYRETHROID ESFENVALERATE IN THE INDUCTION OF CYTOCHROME P450 3A23

PubMed Central

Shi, Deshi; Yang, Dongfang; Yan, Bingfang

2010-01-01

The pregnane X receptor (PXR) is recognized as a key regulator for the induction of a large number of genes in drug metabolism and transport. The transactivation of PXR is enhanced by the glucocorticoid dexamethasone and the enhancement is linked to the induction of PXR in humans and rats. The present study was undertaken to determine the mechanism for the induction and ascertain the synergistic effect on the expression of CYP3A23, a rat PXR target. In primary hepatocytes, significant induction of PXR was detected as early as 2 h after the treatment and the maximal induction occurred at 1 μM dexamethasone. Similar induction kinetics was observed in the hepatoma line H4-II-E-C3. The induction was abolished by actinomycin D and dexamethasone efficaciously stimulated the rat PXR promoter. In addition, dexamethasone synergized esfenvalerate (an insecticide and a PXR activator) in inducing CYP3A23 and stimulating the CYP3A23 promoter. The full promoter of CYP3A23 (−1445/+74) was activated in a similar pattern as the changes in PXR mRNA in response to dexamethasone, esfenvalerate and co-treatment. In contrast, different responding patterns were detected on the stimulation of the CYP3A23 proximal promoter. Synergistic stimulation was also observed on the CYP3A4-DP-Luc reporter, the human counterpart of CYP3A23. These findings establish that transactivation is responsible for the induction of rat PXR and the induction presents potential interactions with insecticides in a species-conserved manner. The different responding patterns among CYP3A23 reporters point to an involvement of multiple transcriptional events in the regulation of CYP3A23 expression by dexamethasone, esfenvalerate and both. PMID:20599767

Angiofibroma-like perineurioma. Report of a case.

PubMed

Zámečník, Michal; Mukenšnabl, Petr; Chlumská, Alena

2013-04-01

We report an unusual perineurioma with numerous vessels, showing a strong similarity with angiofibroma. A 2,5 x 2 x 2 cm subcutaneous/dermal tumor occurred in 58-ys-old male in the left brachial region. Histologically, it was composed of haphazardly arranged bland spindle cells and it contained prominent vasculature. In rare foci, the tumor cells showed thin bipolar processes and an onion-like perivascular whorling pattern. Immunohistochemically, expression of perineural cell markers EMA, claudin-1 and CD34 was limited to perivascular foci and to rare cells among the vessels. In addition, the tumor expressed CD10 diffusely. Our finding indicates that diagnosis of perineurioma should be considered also by tumors with an "angiofibromatous" morphology. Especially soft tissue angiofibroma, which often express EMA (perineural cell marker), shows a strong resemblance to angiofibroma-like perineurioma.

Portraying the Expression Landscapes of B-Cell Lymphoma-Intuitive Detection of Outlier Samples and of Molecular Subtypes

PubMed Central

Hopp, Lydia; Lembcke, Kathrin; Binder, Hans; Wirth, Henry

2013-01-01

We present an analytic framework based on Self-Organizing Map (SOM) machine learning to study large scale patient data sets. The potency of the approach is demonstrated in a case study using gene expression data of more than 200 mature aggressive B-cell lymphoma patients. The method portrays each sample with individual resolution, characterizes the subtypes, disentangles the expression patterns into distinct modules, extracts their functional context using enrichment techniques and enables investigation of the similarity relations between the samples. The method also allows to detect and to correct outliers caused by contaminations. Based on our analysis, we propose a refined classification of B-cell Lymphoma into four molecular subtypes which are characterized by differential functional and clinical characteristics. PMID:24833231

Degeneration of oxidative muscle fibers in HTLV-1 tax transgenic mice.

PubMed

Nerenberg, M I; Wiley, C A

1989-12-01

The HTLV-1 tax gene under control of the HTLV-1 long terminal repeat (LTR) was introduced into transgenic mice. Previously tax protein expression in the muscle and peripheral nerves of three independent mouse lines was reported. Here the localization of this transgenic protein at a cellular and subcellular level is described. Tax protein was expressed in oxidative muscle fibers that developed severe progressive atrophy. It localized to the cytoplasma where it was associated with structures resembling degenerating Z bands. This pattern of muscle fiber involvement is similar to that observed in human retroviral associated myopathy. This transgenic mouse model suggests that preferential expression of the HTLV-1 viral promoter in oxidative muscle fibers may explain the productive infection of these fibers in HTLV-1 myopathy.

Segmental expression of Pax3/7 and engrailed homologs in tardigrade development.

PubMed

Gabriel, Willow N; Goldstein, Bob

2007-06-01

How morphological diversity arises through evolution of gene sequence is a major question in biology. In Drosophila, the genetic basis for body patterning and morphological segmentation has been studied intensively. It is clear that some of the genes in the Drosophila segmentation program are functioning similarly in certain other taxa, although many questions remain about when these gene functions arose and which taxa use these genes similarly to establish diverse body plans. Tardigrades are an outgroup to arthropods in the Ecdysozoa and, as such, can provide insight into how gene functions have evolved among the arthropods and their close relatives. We developed immunostaining methods for tardigrade embryos, and we used cross-reactive antibodies to investigate the expression of homologs of the pair-rule gene paired (Pax3/7) and the segment polarity gene engrailed in the tardigrade Hypsibius dujardini. We find that in H. dujardini embryos, Pax3/7 protein localizes not in a pair-rule pattern but in a segmentally iterated pattern, after the segments are established, in regions of the embryo where neurons later arise. Engrailed protein localizes in the posterior ectoderm of each segment before ectodermal segmentation is apparent. Together with previous results from others, our data support the conclusions that the pair-rule function of Pax3/7 is specific to the arthropods, that some of the ancient functions of Pax3/7 and Engrailed in ancestral bilaterians may have been in neurogenesis, and that Engrailed may have a function in establishing morphological boundaries between segments that is conserved at least among the Panarthropoda.

The retinoic acid signaling pathway regulates anterior/posterior patterning in the nerve cord and pharynx of amphioxus, a chordate lacking neural crest.

PubMed

Escriva, Hector; Holland, Nicholas D; Gronemeyer, Hinrich; Laudet, Vincent; Holland, Linda Z

2002-06-01

Amphioxus, the closest living invertebrate relative of the vertebrates, has a notochord, segmental axial musculature, pharyngeal gill slits and dorsal hollow nerve cord, but lacks neural crest. In amphioxus, as in vertebrates, exogenous retinoic acid (RA) posteriorizes the embryo. The mouth and gill slits never form, AmphiPax1, which is normally downregulated where gill slits form, remains upregulated and AmphiHox1 expression shifts anteriorly in the nerve cord. To dissect the role of RA signaling in patterning chordate embryos, we have cloned the single retinoic acid receptor (AmphiRAR), retinoid X receptor (AmphiRXR) and an orphan receptor (AmphiTR2/4) from amphioxus. AmphiTR2/4 inhibits AmphiRAR-AmphiRXR-mediated transactivation in the presence of RA by competing for DR5 or IR7 retinoic acid response elements (RAREs). The 5' untranslated region of AmphiTR2/4 contains an IR7 element, suggesting possible auto- and RA-regulation. The patterns of AmphiTR2/4 and AmphiRAR expression during embryogenesis are largely complementary: AmphiTR2/4 is strongly expressed in the cerebral vesicle (homologous to the diencephalon plus anterior midbrain), while AmphiRAR expression is high in the equivalent of the hindbrain and spinal cord. Similarly, while AmphiTR2/4 is expressed most strongly in the anterior and posterior thirds of the endoderm, the highest AmphiRAR expression is in the middle third. Expression of AmphiRAR is upregulated by exogenous RA and completely downregulated by the RA antagonist BMS009. Moreover, BMS009 expands the pharynx posteriorly; the first three gill slit primordia are elongated and shifted posteriorly, but do not penetrate, and additional, non-penetrating gill slit primordia are induced. Thus, in an organism without neural crest, initiation and penetration of gill slits appear to be separate events mediated by distinct levels of RA signaling in the pharyngeal endoderm. Although these compounds have little effect on levels of AmphiTR2/4 expression, RA shifts pharyngeal expression of AmphiTR2/4 anteriorly, while BMS009 extends it posteriorly. Collectively, our results suggest a model for anteroposterior patterning of the amphioxus nerve cord and pharynx, which is probably applicable to vertebrates as well, in which a low anterior level of AmphiRAR (caused, at least in part, by competitive inhibition by AmphiTR2/4) is necessary for patterning the forebrain and formation of gill slits, the posterior extent of both being set by a sharp increase in the level of AmphiRAR. Supplemental data available on-line

The retinoic acid signaling pathway regulates anterior/posterior patterning in the nerve cord and pharynx of amphioxus, a chordate lacking neural crest

NASA Technical Reports Server (NTRS)

Escriva, Hector; Holland, Nicholas D.; Gronemeyer, Hinrich; Laudet, Vincent; Holland, Linda Z.

2002-01-01

Amphioxus, the closest living invertebrate relative of the vertebrates, has a notochord, segmental axial musculature, pharyngeal gill slits and dorsal hollow nerve cord, but lacks neural crest. In amphioxus, as in vertebrates, exogenous retinoic acid (RA) posteriorizes the embryo. The mouth and gill slits never form, AmphiPax1, which is normally downregulated where gill slits form, remains upregulated and AmphiHox1 expression shifts anteriorly in the nerve cord. To dissect the role of RA signaling in patterning chordate embryos, we have cloned the single retinoic acid receptor (AmphiRAR), retinoid X receptor (AmphiRXR) and an orphan receptor (AmphiTR2/4) from amphioxus. AmphiTR2/4 inhibits AmphiRAR-AmphiRXR-mediated transactivation in the presence of RA by competing for DR5 or IR7 retinoic acid response elements (RAREs). The 5' untranslated region of AmphiTR2/4 contains an IR7 element, suggesting possible auto- and RA-regulation. The patterns of AmphiTR2/4 and AmphiRAR expression during embryogenesis are largely complementary: AmphiTR2/4 is strongly expressed in the cerebral vesicle (homologous to the diencephalon plus anterior midbrain), while AmphiRAR expression is high in the equivalent of the hindbrain and spinal cord. Similarly, while AmphiTR2/4 is expressed most strongly in the anterior and posterior thirds of the endoderm, the highest AmphiRAR expression is in the middle third. Expression of AmphiRAR is upregulated by exogenous RA and completely downregulated by the RA antagonist BMS009. Moreover, BMS009 expands the pharynx posteriorly; the first three gill slit primordia are elongated and shifted posteriorly, but do not penetrate, and additional, non-penetrating gill slit primordia are induced. Thus, in an organism without neural crest, initiation and penetration of gill slits appear to be separate events mediated by distinct levels of RA signaling in the pharyngeal endoderm. Although these compounds have little effect on levels of AmphiTR2/4 expression, RA shifts pharyngeal expression of AmphiTR2/4 anteriorly, while BMS009 extends it posteriorly. Collectively, our results suggest a model for anteroposterior patterning of the amphioxus nerve cord and pharynx, which is probably applicable to vertebrates as well, in which a low anterior level of AmphiRAR (caused, at least in part, by competitive inhibition by AmphiTR2/4) is necessary for patterning the forebrain and formation of gill slits, the posterior extent of both being set by a sharp increase in the level of AmphiRAR. Supplemental data available on-line.

Main Strategies of Plant Expression System Glycoengineering for Producing Humanized Recombinant Pharmaceutical Proteins.

PubMed

Rozov, S M; Permyakova, N V; Deineko, E V

2018-03-01

Most the pharmaceutical proteins are derived not from their natural sources, rather their recombinant analogs are synthesized in various expression systems. Plant expression systems, unlike mammalian cell cultures, combine simplicity and low cost of procaryotic systems and the ability for posttranslational modifications inherent in eucaryotes. More than 50% of all human proteins and more than 40% of the currently used pharmaceutical proteins are glycosylated, that is, they are glycoproteins, and their biological activity, pharmacodynamics, and immunogenicity depend on the correct glycosylation pattern. This review examines in detail the similarities and differences between N- and O-glycosylation in plant and mammalian cells, as well as the effect of plant glycans on the activity, pharmacokinetics, immunity, and intensity of biosynthesis of pharmaceutical proteins. The main current strategies of glycoengineering of plant expression systems aimed at obtaining fully humanized proteins for pharmaceutical application are summarized.

G-cimp status prediction of glioblastoma samples using mRNA expression data.

PubMed

Baysan, Mehmet; Bozdag, Serdar; Cam, Margaret C; Kotliarova, Svetlana; Ahn, Susie; Walling, Jennifer; Killian, Jonathan K; Stevenson, Holly; Meltzer, Paul; Fine, Howard A

2012-01-01

Glioblastoma Multiforme (GBM) is a tumor with high mortality and no known cure. The dramatic molecular and clinical heterogeneity seen in this tumor has led to attempts to define genetically similar subgroups of GBM with the hope of developing tumor specific therapies targeted to the unique biology within each of these subgroups. Recently, a subset of relatively favorable prognosis GBMs has been identified. These glioma CpG island methylator phenotype, or G-CIMP tumors, have distinct genomic copy number aberrations, DNA methylation patterns, and (mRNA) expression profiles compared to other GBMs. While the standard method for identifying G-CIMP tumors is based on genome-wide DNA methylation data, such data is often not available compared to the more widely available gene expression data. In this study, we have developed and evaluated a method to predict the G-CIMP status of GBM samples based solely on gene expression data.

G-Cimp Status Prediction Of Glioblastoma Samples Using mRNA Expression Data

PubMed Central

Baysan, Mehmet; Bozdag, Serdar; Cam, Margaret C.; Kotliarova, Svetlana; Ahn, Susie; Walling, Jennifer; Killian, Jonathan K.; Stevenson, Holly; Meltzer, Paul; Fine, Howard A.

2012-01-01

Glioblastoma Multiforme (GBM) is a tumor with high mortality and no known cure. The dramatic molecular and clinical heterogeneity seen in this tumor has led to attempts to define genetically similar subgroups of GBM with the hope of developing tumor specific therapies targeted to the unique biology within each of these subgroups. Recently, a subset of relatively favorable prognosis GBMs has been identified. These glioma CpG island methylator phenotype, or G-CIMP tumors, have distinct genomic copy number aberrations, DNA methylation patterns, and (mRNA) expression profiles compared to other GBMs. While the standard method for identifying G-CIMP tumors is based on genome-wide DNA methylation data, such data is often not available compared to the more widely available gene expression data. In this study, we have developed and evaluated a method to predict the G-CIMP status of GBM samples based solely on gene expression data. PMID:23139755

EGR-1 Expression in Catecholamine-synthesizing Neurons Reflects Auditory Learning and Correlates with Responses in Auditory Processing Areas.

PubMed

Dai, Jennifer B; Chen, Yining; Sakata, Jon T

2018-05-21

Distinguishing between familiar and unfamiliar individuals is an important task that shapes the expression of social behavior. As such, identifying the neural populations involved in processing and learning the sensory attributes of individuals is important for understanding mechanisms of behavior. Catecholamine-synthesizing neurons have been implicated in sensory processing, but relatively little is known about their contribution to auditory learning and processing across various vertebrate taxa. Here we investigated the extent to which immediate early gene expression in catecholaminergic circuitry reflects information about the familiarity of social signals and predicts immediate early gene expression in sensory processing areas in songbirds. We found that male zebra finches readily learned to differentiate between familiar and unfamiliar acoustic signals ('songs') and that playback of familiar songs led to fewer catecholaminergic neurons in the locus coeruleus (but not in the ventral tegmental area, substantia nigra, or periaqueductal gray) expressing the immediate early gene, EGR-1, than playback of unfamiliar songs. The pattern of EGR-1 expression in the locus coeruleus was similar to that observed in two auditory processing areas implicated in auditory learning and memory, namely the caudomedial nidopallium (NCM) and the caudal medial mesopallium (CMM), suggesting a contribution of catecholamines to sensory processing. Consistent with this, the pattern of catecholaminergic innervation onto auditory neurons co-varied with the degree to which song playback affected the relative intensity of EGR-1 expression. Together, our data support the contention that catecholamines like norepinephrine contribute to social recognition and the processing of social information. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

Differential expression of cytokeratin mRNA and protein in normal prostate, prostatic intraepithelial neoplasia, and invasive carcinoma.

PubMed Central

Yang, Y.; Hao, J.; Liu, X.; Dalkin, B.; Nagle, R. B.

1997-01-01

The expression of cytokeratin (CK) mRNA for CK5, -8, -14, -16, and -19 was investigated in normal prostate, prostatic intraepithelial neoplasia (PIN) lesions, and invasive carcinoma using in situ hybridization. Protein localization was carried out in adjacent sections using immunohistochemistry and correlated with mRNA expression. Snap-frozen human prostate samples including 22 examples of normal glands, 20 cases of PIN lesions, and 12 cases of invasive carcinoma were examined. CK5 and -14 mRNA and protein were prominently expressed only in the basal cells of normal glands and PIN lesions. CK14 mRNA was absent in the luminal cells of the most of the PIN lesions but was seen at a low level in some PIN lesions. CK14 protein was not detected in any PIN lesion, suggesting that, if the cell that makes up the PIN lesions is derived from a basal cell, CK14 translation is depressed although a low level of CK14 mRNA may persist. CK8 mRNA and protein were constitutively expressed in all epithelia of normal and abnormal prostate tissues. CK19 mRNA and protein were persistently expressed in both basal and luminal cells of the tubular portion of normal glands as well as PIN lesions, but were expressed heterogeneously in both basal and luminal cells of normal alveoli. CK16 mRNA was expressed in a similar pattern as CK19, but CK16 protein was not detected either in normal or in abnormal prostate tissues. In conclusion, the expression of CK19 in PIN lesions is similar to its tubular expression and would support an origin of PIN lesions from this structure rather than the alveolar portion of the glands. The similar cytokeratin expression between PIN lesions and invasive carcinoma further supports the concept that PIN is a precursor lesion of invasive carcinoma. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 PMID:9033282

Finding functional features in Saccharomyces genomes by phylogenetic footprinting.

PubMed

Cliften, Paul; Sudarsanam, Priya; Desikan, Ashwin; Fulton, Lucinda; Fulton, Bob; Majors, John; Waterston, Robert; Cohen, Barak A; Johnston, Mark

2003-07-04

The sifting and winnowing of DNA sequence that occur during evolution cause nonfunctional sequences to diverge, leaving phylogenetic footprints of functional sequence elements in comparisons of genome sequences. We searched for such footprints among the genome sequences of six Saccharomyces species and identified potentially functional sequences. Comparison of these sequences allowed us to revise the catalog of yeast genes and identify sequence motifs that may be targets of transcriptional regulatory proteins. Some of these conserved sequence motifs reside upstream of genes with similar functional annotations or similar expression patterns or those bound by the same transcription factor and are thus good candidates for functional regulatory sequences.