Sample records for expression pattern suggests

  1. BMPs regulate msx gene expression in the dorsal neuroectoderm of Drosophila and vertebrates by distinct mechanisms.

    PubMed

    Esteves, Francisco F; Springhorn, Alexander; Kague, Erika; Taylor, Erika; Pyrowolakis, George; Fisher, Shannon; Bier, Ethan

    2014-09-01

    In a broad variety of bilaterian species the trunk central nervous system (CNS) derives from three primary rows of neuroblasts. The fates of these neural progenitor cells are determined in part by three conserved transcription factors: vnd/nkx2.2, ind/gsh and msh/msx in Drosophila melanogaster/vertebrates, which are expressed in corresponding non-overlapping patterns along the dorsal-ventral axis. While this conserved suite of "neural identity" gene expression strongly suggests a common ancestral origin for the patterning systems, it is unclear whether the original regulatory mechanisms establishing these patterns have been similarly conserved during evolution. In Drosophila, genetic evidence suggests that Bone Morphogenetic Proteins (BMPs) act in a dosage-dependent fashion to repress expression of neural identity genes. BMPs also play a dose-dependent role in patterning the dorsal and lateral regions of the vertebrate CNS, however, the mechanism by which they achieve such patterning has not yet been clearly established. In this report, we examine the mechanisms by which BMPs act on cis-regulatory modules (CRMs) that control localized expression of the Drosophila msh and zebrafish (Danio rerio) msxB in the dorsal central nervous system (CNS). Our analysis suggests that BMPs act differently in these organisms to regulate similar patterns of gene expression in the neuroectoderm: repressing msh expression in Drosophila, while activating msxB expression in the zebrafish. These findings suggest that the mechanisms by which the BMP gradient patterns the dorsal neuroectoderm have reversed since the divergence of these two ancient lineages.

  2. BMPs Regulate msx Gene Expression in the Dorsal Neuroectoderm of Drosophila and Vertebrates by Distinct Mechanisms

    PubMed Central

    Esteves, Francisco F.; Taylor, Erika; Pyrowolakis, George; Fisher, Shannon; Bier, Ethan

    2014-01-01

    In a broad variety of bilaterian species the trunk central nervous system (CNS) derives from three primary rows of neuroblasts. The fates of these neural progenitor cells are determined in part by three conserved transcription factors: vnd/nkx2.2, ind/gsh and msh/msx in Drosophila melanogaster/vertebrates, which are expressed in corresponding non-overlapping patterns along the dorsal-ventral axis. While this conserved suite of “neural identity” gene expression strongly suggests a common ancestral origin for the patterning systems, it is unclear whether the original regulatory mechanisms establishing these patterns have been similarly conserved during evolution. In Drosophila, genetic evidence suggests that Bone Morphogenetic Proteins (BMPs) act in a dosage-dependent fashion to repress expression of neural identity genes. BMPs also play a dose-dependent role in patterning the dorsal and lateral regions of the vertebrate CNS, however, the mechanism by which they achieve such patterning has not yet been clearly established. In this report, we examine the mechanisms by which BMPs act on cis-regulatory modules (CRMs) that control localized expression of the Drosophila msh and zebrafish (Danio rerio) msxB in the dorsal central nervous system (CNS). Our analysis suggests that BMPs act differently in these organisms to regulate similar patterns of gene expression in the neuroectoderm: repressing msh expression in Drosophila, while activating msxB expression in the zebrafish. These findings suggest that the mechanisms by which the BMP gradient patterns the dorsal neuroectoderm have reversed since the divergence of these two ancient lineages. PMID:25210771

  3. Expression of Eag1 K+ channel and ErbBs in human pituitary adenomas: cytoskeleton arrangement patterns in cultured cells.

    PubMed

    del Pliego, Margarita González; Aguirre-Benítez, Elsa; Paisano-Cerón, Karina; Valdovinos-Ramírez, Irene; Rangel-Morales, Carlos; Rodríguez-Mata, Verónica; Solano-Agama, Carmen; Martín-Tapia, Dolores; de la Vega, María Teresa; Saldoval-Balanzario, Miguel; Camacho, Javier; Mendoza-Garrido, María Eugenia

    2013-01-01

    Pituitary adenomas can invade surrounded tissue, but the mechanism remains elusive. Ether à go-go-1 (Eag1) potassium channel and epidermal growth factor receptors (ErbB1 and ErbB2) have been associated to invasive phenotypes or poor prognosis in cancer patients. However, cells arrange their cytoskeleton in order to acquire a successful migration pattern. We have studied ErbBs and Eag1 expression, and cytoskeleton arrangements in 11 human pituitary adenomas. Eag1, ErbB1 and ErbB2 expression were studied by immunochemistry in tissue and cultured cells. The cytoskeleton arrangement was analyzed in cultured cells by immunofluorescence. Normal pituitary tissue showed ErbB2 expression and Eag1 only in few cells. However, Eag1 and ErbB2 were expressed in all the tumors analyzed. ErbB1 expression was observed variable and did not show specificity for a tumor characteristic. Cultured cells from micro- and macro-adenomas clinically functional organize their cytoskeleton suggesting a mesenchymal pattern, and a round leucocyte/amoeboid pattern from invasive clinically silent adenoma. Pituitary tumors over-express EGF receptors and the ErbB2 repeated expression suggests is a characteristic of adenomas. Eag 1 was express, in different extent, and could be a therapeutic target. The cytoskeleton arrangements observed suggest that pituitary tumor cells acquire different patterns: mesenchymal, and leucocyte/amoeboid, the last observed in the invasive adenomas. Amoeboid migration pattern has been associated with high invasion capacity.

  4. Modeling of gene expression pattern alteration by p,p′-DDE and dieldrin in largemouth bass

    PubMed Central

    Garcia-Reyero, Natàlia; Barber, David; Gross, Timothy; Denslow, Nancy

    2007-01-01

    In this study, largemouth bass (LMB) were subchronically exposed to p,p′-DDE or dieldrin in their diet to evaluate the effect of exposure on expression of genes involved in reproduction and steroid homeostasis. Using real-time PCR, we detected a different gene expression pattern for each OCP, suggesting that they each affect LMB in a different way. We also detected a different expression pattern among sexes, suggesting that sexes are affected differently by OCPs perhaps reflecting the different adaptive responses of each sex to dysregulation caused by OCP exposure. PMID:16707152

  5. Modeling of gene expression pattern alteration by p,p′-DDE and dieldrin in largemouth bass

    USGS Publications Warehouse

    Garcia-Reyero, Natalia; Barber, David; Gross, Timothy; Denslow, Nancy

    2006-01-01

    In this study, largemouth bass (LMB) were subchronically exposed to p,p′-DDE or dieldrin in their diet to evaluate the effect of exposure on expression of genes involved in reproduction and steroid homeostasis. Using real-time PCR, we detected a different gene expression pattern for each OCP, suggesting that they each affect LMB in a different way. We also detected a different expression pattern among sexes, suggesting that sexes are affected differently by OCPs perhaps reflecting the different adaptive responses of each sex to dysregulation caused by OCP exposure.

  6. Four not six: Revealing culturally common facial expressions of emotion.

    PubMed

    Jack, Rachael E; Sun, Wei; Delis, Ioannis; Garrod, Oliver G B; Schyns, Philippe G

    2016-06-01

    As a highly social species, humans generate complex facial expressions to communicate a diverse range of emotions. Since Darwin's work, identifying among these complex patterns which are common across cultures and which are culture-specific has remained a central question in psychology, anthropology, philosophy, and more recently machine vision and social robotics. Classic approaches to addressing this question typically tested the cross-cultural recognition of theoretically motivated facial expressions representing 6 emotions, and reported universality. Yet, variable recognition accuracy across cultures suggests a narrower cross-cultural communication supported by sets of simpler expressive patterns embedded in more complex facial expressions. We explore this hypothesis by modeling the facial expressions of over 60 emotions across 2 cultures, and segregating out the latent expressive patterns. Using a multidisciplinary approach, we first map the conceptual organization of a broad spectrum of emotion words by building semantic networks in 2 cultures. For each emotion word in each culture, we then model and validate its corresponding dynamic facial expression, producing over 60 culturally valid facial expression models. We then apply to the pooled models a multivariate data reduction technique, revealing 4 latent and culturally common facial expression patterns that each communicates specific combinations of valence, arousal, and dominance. We then reveal the face movements that accentuate each latent expressive pattern to create complex facial expressions. Our data questions the widely held view that 6 facial expression patterns are universal, instead suggesting 4 latent expressive patterns with direct implications for emotion communication, social psychology, cognitive neuroscience, and social robotics. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  7. Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia

    PubMed Central

    Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J. V.; Schulz, Marcel H.; Simon, Martin

    2015-01-01

    Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. PMID:26231545

  8. BnDGAT1s Function Similarly in Oil Deposition and Are Expressed with Uniform Patterns in Tissues of Brassica napus.

    PubMed

    Zhao, Cuizhu; Li, Huan; Zhang, Wenxue; Wang, Hailan; Xu, Aixia; Tian, Jianhua; Zou, Jitao; Taylor, David C; Zhang, Meng

    2017-01-01

    As an allotetraploid oilcrop, Brassica napus contains four duplicated Acyl-CoA:diacylglycerol acyltransferase 1 ( DGAT1 ) genes, which catalyze one of the rate-limiting steps in triacylglycerol (TAG) biosynthesis in plants. While all four BnDGAT1 s have been expressed functionally in yeast, their expression patterns in different germplasms and tissues and also consequent contribution to seed oil accumulation in planta remain to be elucidated. In this study, the coding regions of the four BnDGAT1s were expressed in an Arabidopsis dgat1 mutant. All four BnDGAT1s showed similar effects on oil content and fatty acid composition, a result which is different from that observed in previous studies of their expression in yeast. Expression patterns of BnDGAT1s were analyzed in developing seeds of 34 B. napus inbred lines and in different tissues of 14 lines. Different expression patterns were observed for the four BnDGAT1 s, which suggests that they express independently or randomly in different germplasm sources. Higher expression of BnDGAT1s was correlated with higher seed oil content lines. Tissue-specific analyses showed that the BnDGAT1 s were expressed in a uniform pattern in different tissues. Our results suggest that it is important to maintain expression of the four BnDGAT1s for maximum return on oil content.

  9. Expression patterns of protein C inhibitor in mouse development.

    PubMed

    Wagenaar, Gerry T M; Uhrin, Pavel; Weipoltshammer, Klara; Almeder, Marlene; Hiemstra, Pieter S; Geiger, Margarethe; Meijers, Joost C M; Schöfer, Christian

    2010-02-01

    Proteolysis of extracellular matrix is an important requirement for embryonic development and is instrumental in processes such as morphogenesis, angiogenesis, and cell migration. Efficient remodeling requires controlled spatio-temporal expression of both the proteases and their inhibitors. Protein C inhibitor (PCI) effectively blocks a range of serine proteases, and recently has been suggested to play a role in cell differentiation and angiogenesis. In this study, we mapped the expression pattern of PCI throughout mouse development using in situ hybridization and immunohistochemistry. We detected a wide-spread, yet distinct expression pattern with prominent PCI levels in skin including vibrissae, and in fore- and hindgut. Further sites of PCI expression were choroid plexus of brain ventricles, heart, skeletal muscles, urogenital tract, and cartilages. A strong and stage-dependent PCI expression was observed in the developing lung. In the pseudoglandular stage, PCI expression was present in distal branching tubules whereas proximal tubules did not express PCI. Later in development, in the saccular stage, PCI expression was restricted to distal bronchioli whereas sacculi did not express PCI. PCI expression declined in postnatal stages and was not detected in adult lungs. In general, embryonic PCI expression indicates multifunctional roles of PCI during mouse development. The expression pattern of PCI during lung development suggests its possible involvement in lung morphogenesis and angiogenesis.

  10. Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia.

    PubMed

    Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J V; Schulz, Marcel H; Simon, Martin

    2015-08-01

    Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  11. BnDGAT1s Function Similarly in Oil Deposition and Are Expressed with Uniform Patterns in Tissues of Brassica napus

    PubMed Central

    Zhao, Cuizhu; Li, Huan; Zhang, Wenxue; Wang, Hailan; Xu, Aixia; Tian, Jianhua; Zou, Jitao; Taylor, David C.; Zhang, Meng

    2017-01-01

    As an allotetraploid oilcrop, Brassica napus contains four duplicated Acyl-CoA:diacylglycerol acyltransferase 1 (DGAT1) genes, which catalyze one of the rate-limiting steps in triacylglycerol (TAG) biosynthesis in plants. While all four BnDGAT1s have been expressed functionally in yeast, their expression patterns in different germplasms and tissues and also consequent contribution to seed oil accumulation in planta remain to be elucidated. In this study, the coding regions of the four BnDGAT1s were expressed in an Arabidopsis dgat1 mutant. All four BnDGAT1s showed similar effects on oil content and fatty acid composition, a result which is different from that observed in previous studies of their expression in yeast. Expression patterns of BnDGAT1s were analyzed in developing seeds of 34 B. napus inbred lines and in different tissues of 14 lines. Different expression patterns were observed for the four BnDGAT1s, which suggests that they express independently or randomly in different germplasm sources. Higher expression of BnDGAT1s was correlated with higher seed oil content lines. Tissue-specific analyses showed that the BnDGAT1s were expressed in a uniform pattern in different tissues. Our results suggest that it is important to maintain expression of the four BnDGAT1s for maximum return on oil content. PMID:29312429

  12. Divergent and nonuniform gene expression patterns in mouse brain

    PubMed Central

    Morris, John A.; Royall, Joshua J.; Bertagnolli, Darren; Boe, Andrew F.; Burnell, Josh J.; Byrnes, Emi J.; Copeland, Cathy; Desta, Tsega; Fischer, Shanna R.; Goldy, Jeff; Glattfelder, Katie J.; Kidney, Jolene M.; Lemon, Tracy; Orta, Geralyn J.; Parry, Sheana E.; Pathak, Sayan D.; Pearson, Owen C.; Reding, Melissa; Shapouri, Sheila; Smith, Kimberly A.; Soden, Chad; Solan, Beth M.; Weller, John; Takahashi, Joseph S.; Overly, Caroline C.; Lein, Ed S.; Hawrylycz, Michael J.; Hohmann, John G.; Jones, Allan R.

    2010-01-01

    Considerable progress has been made in understanding variations in gene sequence and expression level associated with phenotype, yet how genetic diversity translates into complex phenotypic differences remains poorly understood. Here, we examine the relationship between genetic background and spatial patterns of gene expression across seven strains of mice, providing the most extensive cellular-resolution comparative analysis of gene expression in the mammalian brain to date. Using comprehensive brainwide anatomic coverage (more than 200 brain regions), we applied in situ hybridization to analyze the spatial expression patterns of 49 genes encoding well-known pharmaceutical drug targets. Remarkably, over 50% of the genes examined showed interstrain expression variation. In addition, the variability was nonuniformly distributed across strain and neuroanatomic region, suggesting certain organizing principles. First, the degree of expression variance among strains mirrors genealogic relationships. Second, expression pattern differences were concentrated in higher-order brain regions such as the cortex and hippocampus. Divergence in gene expression patterns across the brain could contribute significantly to variations in behavior and responses to neuroactive drugs in laboratory mouse strains and may help to explain individual differences in human responsiveness to neuroactive drugs. PMID:20956311

  13. Regulation of mouse hepatic CYP2D9 mRNA expression by growth and adrenal hormones.

    PubMed

    Jarukamjorn, Kanokwan; Sakuma, Tsutomu; Jaruchotikamol, Atika; Oguro, Miki; Nemoto, Nobuo

    2006-02-01

    The constitutive expression of CYP2D9 is sexually dimorphic, namely, strong in males, but diminutive in females. Repetition of mimic growth hormone (GH) secretion pattern impressively returned the mRNA expression level to that in intact mice: the GH secretion pattern's regulation of CYP2D9 mRNA expression has been predominantly disrupted by exogenous GH-administration. The extensive decline of CYP2D9 mRNA expression becoming a sexually non-specific P450 in 9-week-old male mice exposed as neonates to monosodium L-glutamate (MSG) suggested that the male GH secretion pattern is a key to the regulation of male-specific CYP2D9 mRNA expression in adult mice. Dexamethasone (Dex) showed possibility to induce CYP2D9 mRNA expression in adult MSG-neonatally treated mice of either sex. However, the antagonism was observed by co-administration of Dex and GH in the males. Dex-administration in adrenalectomized mice significantly elevated CYP2D9 mRNA expression levels. These findings suggest that an adrenal hormone participates in the regulatory mechanism of CYP2D9 mRNA expression in association with GH.

  14. Circadian Clock Gene Expression in the Coral Favia fragum over Diel and Lunar Reproductive Cycles

    PubMed Central

    Hoadley, Kenneth D.; Szmant, Alina M.; Pyott, Sonja J.

    2011-01-01

    Natural light cycles synchronize behavioral and physiological cycles over varying time periods in both plants and animals. Many scleractinian corals exhibit diel cycles of polyp expansion and contraction entrained by diel sunlight patterns, and monthly cycles of spawning or planulation that correspond to lunar moonlight cycles. The molecular mechanisms for regulating such cycles are poorly understood. In this study, we identified four molecular clock genes (cry1, cry2, clock and cycle) in the scleractinian coral, Favia fragum, and investigated patterns of gene expression hypothesized to be involved in the corals' diel polyp behavior and lunar reproductive cycles. Using quantitative PCR, we measured fluctuations in expression of these clock genes over both diel and monthly spawning timeframes. Additionally, we assayed gene expression and polyp expansion-contraction behavior in experimental corals in normal light:dark (control) or constant dark treatments. Well-defined and reproducible diel patterns in cry1, cry2, and clock expression were observed in both field-collected and the experimental colonies maintained under control light:dark conditions, but no pattern was observed for cycle. Colonies in the control light:dark treatment also displayed diel rhythms of tentacle expansion and contraction. Experimental colonies in the constant dark treatment lost diel patterns in cry1, cry2, and clock expression and displayed a diminished and less synchronous pattern of tentacle expansion and contraction. We observed no pattern in cry1, cry2, clock, or cycle expression correlated with monthly spawning events suggesting these genes are not involved in the entrainment of reproductive cycles to lunar light cycles in F. fragum. Our results suggest a molecular clock mechanism, potentially similar to that in described in fruit flies, exists within F. fragum. PMID:21573070

  15. Multivariate Pattern Classification of Facial Expressions Based on Large-Scale Functional Connectivity.

    PubMed

    Liang, Yin; Liu, Baolin; Li, Xianglin; Wang, Peiyuan

    2018-01-01

    It is an important question how human beings achieve efficient recognition of others' facial expressions in cognitive neuroscience, and it has been identified that specific cortical regions show preferential activation to facial expressions in previous studies. However, the potential contributions of the connectivity patterns in the processing of facial expressions remained unclear. The present functional magnetic resonance imaging (fMRI) study explored whether facial expressions could be decoded from the functional connectivity (FC) patterns using multivariate pattern analysis combined with machine learning algorithms (fcMVPA). We employed a block design experiment and collected neural activities while participants viewed facial expressions of six basic emotions (anger, disgust, fear, joy, sadness, and surprise). Both static and dynamic expression stimuli were included in our study. A behavioral experiment after scanning confirmed the validity of the facial stimuli presented during the fMRI experiment with classification accuracies and emotional intensities. We obtained whole-brain FC patterns for each facial expression and found that both static and dynamic facial expressions could be successfully decoded from the FC patterns. Moreover, we identified the expression-discriminative networks for the static and dynamic facial expressions, which span beyond the conventional face-selective areas. Overall, these results reveal that large-scale FC patterns may also contain rich expression information to accurately decode facial expressions, suggesting a novel mechanism, which includes general interactions between distributed brain regions, and that contributes to the human facial expression recognition.

  16. Multivariate Pattern Classification of Facial Expressions Based on Large-Scale Functional Connectivity

    PubMed Central

    Liang, Yin; Liu, Baolin; Li, Xianglin; Wang, Peiyuan

    2018-01-01

    It is an important question how human beings achieve efficient recognition of others’ facial expressions in cognitive neuroscience, and it has been identified that specific cortical regions show preferential activation to facial expressions in previous studies. However, the potential contributions of the connectivity patterns in the processing of facial expressions remained unclear. The present functional magnetic resonance imaging (fMRI) study explored whether facial expressions could be decoded from the functional connectivity (FC) patterns using multivariate pattern analysis combined with machine learning algorithms (fcMVPA). We employed a block design experiment and collected neural activities while participants viewed facial expressions of six basic emotions (anger, disgust, fear, joy, sadness, and surprise). Both static and dynamic expression stimuli were included in our study. A behavioral experiment after scanning confirmed the validity of the facial stimuli presented during the fMRI experiment with classification accuracies and emotional intensities. We obtained whole-brain FC patterns for each facial expression and found that both static and dynamic facial expressions could be successfully decoded from the FC patterns. Moreover, we identified the expression-discriminative networks for the static and dynamic facial expressions, which span beyond the conventional face-selective areas. Overall, these results reveal that large-scale FC patterns may also contain rich expression information to accurately decode facial expressions, suggesting a novel mechanism, which includes general interactions between distributed brain regions, and that contributes to the human facial expression recognition. PMID:29615882

  17. Gene expression underlying adaptive variation in Heliconius wing patterns: non-modular regulation of overlapping cinnabar and vermilion prepatterns.

    PubMed

    Reed, Robert D; McMillan, W Owen; Nagy, Lisa M

    2008-01-07

    Geographical variation in the mimetic wing patterns of the butterfly Heliconius erato is a textbook example of adaptive polymorphism; however, little is known about how this variation is controlled developmentally. Using microarrays and qPCR, we identified and compared expression of candidate genes potentially involved with a red/yellow forewing band polymorphism in H. erato. We found that transcripts encoding the pigment synthesis enzymes cinnabar and vermilion showed pattern- and polymorphism-related expression patterns, respectively. cinnabar expression was associated with the forewing band regardless of pigment colour, providing the first gene expression pattern known to be correlated with a major Heliconius colour pattern. In contrast, vermilion expression changed spatially over time in red-banded butterflies, but was not expressed at detectable levels in yellow-banded butterflies, suggesting that regulation of this gene may be involved with the red/yellow polymorphism. Furthermore, we found that the yellow pigment, 3-hydroxykynurenine, is incorporated into wing scales from the haemolymph rather than being synthesized in situ. We propose that some aspects of Heliconius colour patterns are determined by spatio-temporal overlap of pigment gene transcription prepatterns and speculate that evolutionary changes in vermilion regulation may in part underlie an adaptive colour pattern polymorphism.

  18. Comprehensive Expression Map of Transcription Regulators in the Adult Zebrafish Telencephalon Reveals Distinct Neurogenic Niches

    PubMed Central

    Diotel, Nicolas; Rodriguez Viales, Rebecca; Armant, Olivier; März, Martin; Ferg, Marco; Rastegar, Sepand; Strähle, Uwe

    2015-01-01

    The zebrafish has become a model to study adult vertebrate neurogenesis. In particular, the adult telencephalon has been an intensely studied structure in the zebrafish brain. Differential expression of transcriptional regulators (TRs) is a key feature of development and tissue homeostasis. Here we report an expression map of 1,202 TR genes in the telencephalon of adult zebrafish. Our results are summarized in a database with search and clustering functions to identify genes expressed in particular regions of the telencephalon. We classified 562 genes into 13 distinct patterns, including genes expressed in the proliferative zone. The remaining 640 genes displayed unique and complex patterns of expression and could thus not be grouped into distinct classes. The neurogenic ventricular regions express overlapping but distinct sets of TR genes, suggesting regional differences in the neurogenic niches in the telencephalon. In summary, the small telencephalon of the zebrafish shows a remarkable complexity in TR gene expression. The adult zebrafish telencephalon has become a model to study neurogenesis. We established the expression pattern of more than 1200 transcription regulators (TR) in the adult telencephalon. The neurogenic regions express overlapping but distinct sets of TR genes suggesting regional differences in the neurogenic potential. J. Comp. Neurol. 523:1202–1221, 2015. © 2015 Wiley Periodicals, Inc. PMID:25556858

  19. Comprehensive expression map of transcription regulators in the adult zebrafish telencephalon reveals distinct neurogenic niches.

    PubMed

    Diotel, Nicolas; Rodriguez Viales, Rebecca; Armant, Olivier; März, Martin; Ferg, Marco; Rastegar, Sepand; Strähle, Uwe

    2015-06-01

    The zebrafish has become a model to study adult vertebrate neurogenesis. In particular, the adult telencephalon has been an intensely studied structure in the zebrafish brain. Differential expression of transcriptional regulators (TRs) is a key feature of development and tissue homeostasis. Here we report an expression map of 1,202 TR genes in the telencephalon of adult zebrafish. Our results are summarized in a database with search and clustering functions to identify genes expressed in particular regions of the telencephalon. We classified 562 genes into 13 distinct patterns, including genes expressed in the proliferative zone. The remaining 640 genes displayed unique and complex patterns of expression and could thus not be grouped into distinct classes. The neurogenic ventricular regions express overlapping but distinct sets of TR genes, suggesting regional differences in the neurogenic niches in the telencephalon. In summary, the small telencephalon of the zebrafish shows a remarkable complexity in TR gene expression. The adult zebrafish telencephalon has become a model to study neurogenesis. We established the expression pattern of more than 1200 transcription regulators (TR) in the adult telencephalon. The neurogenic regions express overlapping but distinct sets of TR genes suggesting regional differences in the neurogenic potential. © 2015 Wiley Periodicals, Inc.

  20. EXPRESSION PATTERNS OF ESTROGEN RECEPTORS IN THE CENTRAL AUDITORY SYSTEM CHANGE IN PREPUBERTAL AND AGED MICE

    PubMed Central

    Charitidi, K.; Frisina, R. D.; Vasilyeva, O. N.; Zhu, X.; Canlon, B.

    2011-01-01

    Estrogens are important in the development, maintenance and physiology of the CNS. Several studies have shown their effects on the processing of hearing in both males and females, and these effects, in part, are thought to result from regulation of the transcription of genes via their classical estrogen receptor (ER) pathway. In order to understand the spatiotemporal changes that occur with age, we have studied the expression of ERs in the central auditory pathway in prepubertal and aged CBA mice with immunohistochemistry. In prepubertal mice a clear dichotomy was noted between the expression of ERα and ERβ. ERβ-positive neurons were found in the metencephalon whereas the majority of ERα was found in mesencephalon, diencephalon or the telencephalon. In the aged animals a different pattern of ER expression was found in terms of location and overall intensity. These age-induced changes in the expression pattern were generally not uniform, suggesting that region-specific mechanisms regulate the ERs’ age-related expression. Neither the prepubertal nor the aged animals showed sex differences in any auditory structure. Our results demonstrate different age-dependent spatial and temporal changes in the pattern of expression of ERα and ERβ, suggesting that each ER type may be involved in distinct roles across the central auditory pathway in different periods of maturation. PMID:20736049

  1. Gene expression in spider appendages reveals reversal of exd/hth spatial specificity, altered leg gap gene dynamics, and suggests divergent distal morphogen signaling.

    PubMed

    Prpic, Nikola-Michael; Janssen, Ralf; Wigand, Barbara; Klingler, Martin; Damen, Wim G M

    2003-12-01

    Leg development in Drosophila has been studied in much detail. However, Drosophila limbs form in the larva as imaginal discs and not during embryogenesis as in most other arthropods. Here, we analyze appendage genes in the spider Cupiennius salei and the beetle Tribolium castaneum. Differences in decapentaplegic (dpp) expression suggest a different mode of distal morphogen signaling suitable for the specific geometry of growing limb buds. Also, expression of the proximal genes homothorax (hth) and extradenticle (exd) is significantly altered: in the spider, exd is restricted to the proximal leg and hth expression extends distally, while in insects, exd is expressed in the entire leg and hth is restricted to proximal parts. This reversal of spatial specificity demonstrates an evolutionary shift, which is nevertheless compatible with a conserved role of this gene pair as instructor of proximal fate. Different expression dynamics of dachshund and Distal-less point to modifications in the regulation of the leg gap gene system. We comment on the significance of this finding for attempts to homologize leg segments in different arthropod classes. Comparison of the expression profiles of H15 and optomotor-blind to the Drosophila patterns suggests modifications also in the dorsal-ventral patterning system of the legs. Together, our results suggest alterations in many components of the leg developmental system, namely proximal-distal and dorsal-ventral patterning, and leg segmentation. Thus, the leg developmental system exhibits a propensity to evolutionary change, which probably forms the basis for the impressive diversity of arthropod leg morphologies.

  2. Humans and Mice Display Opposing Patterns of "Browning" Gene Expression in Visceral and Subcutaneous White Adipose Tissue Depots.

    PubMed

    Zuriaga, Maria A; Fuster, Jose J; Gokce, Noyan; Walsh, Kenneth

    2017-01-01

    Visceral adiposity is much more strongly associated with cardiometabolic disease in humans than subcutaneous adiposity. Browning, the appearance of brown-like adipocytes in the white adipose tissue (WAT), has been shown to protect mice against metabolic dysfunction, suggesting the possibility of new therapeutic approaches to treat obesity and type 2 diabetes. In mice, subcutaneous WAT depots express higher levels of browning genes when compared with visceral WAT, further suggesting that differences in WAT browning could contribute to the differences in the pathogenicity of the two depots. However, the expression of browning genes in different WAT depots of human has not been characterized. Here, it is shown that the expression of browning genes is higher in visceral than in subcutaneous WAT in humans, a pattern that is opposite to what is observed in mice. These results suggest that caution should be applied in extrapolating the results of murine browning gene expression studies to human pathophysiology.

  3. Distal-less induces elemental color patterns in Junonia butterfly wings.

    PubMed

    Dhungel, Bidur; Ohno, Yoshikazu; Matayoshi, Rie; Iwasaki, Mayo; Taira, Wataru; Adhikari, Kiran; Gurung, Raj; Otaki, Joji M

    2016-01-01

    The border ocellus, or eyespot, is a conspicuous color pattern element in butterfly wings. For two decades, it has been hypothesized that transcription factors such as Distal-less (Dll) are responsible for eyespot pattern development in butterfly wings, based on their expression in the prospective eyespots. In particular, it has been suggested that Dll is a determinant for eyespot size. However, functional evidence for this hypothesis has remained incomplete, due to technical difficulties. Here, we show that ectopically expressed Dll induces ectopic elemental color patterns in the adult wings of the blue pansy butterfly, Junonia orithya (Lepidoptera, Nymphalidae). Using baculovirus-mediated gene transfer, we misexpressed Dll protein fused with green fluorescent protein (GFP) in pupal wings, resulting in ectopic color patterns, but not the formation of intact eyespots. Induced changes included clusters of black and orange scales (a basic feature of eyespot patterns), black and gray scales, and inhibition of cover scale development. In contrast, ectopic expression of GFP alone did not induce any color pattern changes using the same baculovirus-mediated gene transfer system. These results suggest that Dll plays an instructive role in the development of color pattern elements in butterfly wings, although Dll alone may not be sufficient to induce a complete eyespot. This study thus experimentally supports the hypothesis of Dll function in eyespot development.

  4. FoxP2 expression in the cerebellum and inferior olive: development of the transverse stripe-shaped expression pattern in the mouse cerebellar cortex.

    PubMed

    Fujita, Hirofumi; Sugihara, Izumi

    2012-02-15

    Many molecules are expressed heterogeneously in subpopulations of cerebellar Purkinje cells (PCs) and inferior olive (IO) neurons during development or in adulthood. These expression patterns are often organized in longitudinal stripes in the cerebellar cortex, which may be related to functional compartmentalization. FoxP2, a transcription factor, is expressed in PCs and IO neurons, but the details of its expression pattern remain unclear. Here we examined FoxP2 expression patterns systematically by immunostaining serial sections of the hindbrain from embryonic day 14.5 to adulthood in mice. FoxP2 was highly expressed in virtually all PCs at and before postnatal day 6 (P6), except for those in the flocculus and small parts of the nodulus (vermal lobule X), where FoxP2 expression was moderate or absent. After P6, FoxP2 expression gradually diminished in PCs in some areas. In adults, FoxP2 was expressed, less intensely than in earlier stages, in subsets of PCs that were mostly arranged transversely along the folial apices. In contrast, FoxP2 was expressed intensely in most IO neurons during development and in adulthood. FoxP2 was also expressed in a small population of neurons in the cerebellar nuclei. FoxP2 expression in adult rats and chicks was generally comparable to that in adult mice, suggesting evolutionary conservation of the expression pattern. Thus, the FoxP2 expression pattern reflects new transverse compartmentalization in the adult cerebellar cortex, although its functional significance remains unclear. Copyright © 2011 Wiley-Liss, Inc.

  5. Patterns of activity expressed by juvenile horseshoe crabs.

    PubMed

    Dubofsky, E A; Simpson, S D; Chabot, Christopher C; Watson, Winsor H

    2013-09-01

    Adult American horseshoe crabs, Limulus polyphemus, possess endogenous circadian and circatidal clocks controlling visual sensitivity and locomotion, respectively. The goal of this study was to determine the types of activity rhythms expressed by juvenile horseshoe crabs (n = 24) when exposed to a 14:10 light/dark cycle (LD) for 10 days, followed by 10 days of constant darkness (DD). Horseshoe crab activity was recorded with a digital time-lapse video system that used an infrared-sensitive camera so animals could be monitored at night. In LD, 15 animals expressed daily patterns of activity, 6 displayed a circatidal pattern, and the remaining 3 were arrhythmic. Of the 15 animals with daily patterns of locomotion, 7 had a significant preference (P < 0.05) for diurnal activity and 3 for nocturnal activity; the remainder did not express a significant preference for day or night activity. In DD, 13 horseshoe crabs expressed circatidal rhythms and 8 maintained a pattern of about 24 h. Although these results suggest the presence of a circadian clock influencing circatidal patterns of locomotion, these apparent circadian rhythms may actually represent the expression of just one of the two bouts of activity driven by the putative circalunidian clocks that control their tidal rhythms. Overall, these results indicate that, like adults, juvenile horseshoe crabs express both daily and tidal patterns of activity and that at least one, and maybe both, of these patterns is driven by endogenous clocks.

  6. No turning, a mouse mutation causing left-right and axial patterning defects.

    PubMed

    Melloy, P G; Ewart, J L; Cohen, M F; Desmond, M E; Kuehn, M R; Lo, C W

    1998-01-01

    Patterning along the left/right axes helps establish the orientation of visceral organ asymmetries, a process which is of fundamental importance to the viability of an organism. A linkage between left/right and axial patterning is indicated by the finding that a number of genes involved in left/right patterning also play a role in anteroposterior and dorsoventral patterning. We have recovered a spontaneous mouse mutation causing left/right patterning defects together with defects in anteroposterior and dorsoventral patterning. This mutation is recessive lethal and was named no turning (nt) because the mutant embryos fail to undergo embryonic turning. nt embryos exhibit cranial neural tube closure defects and malformed somites and are caudally truncated. Development of the heart arrests at the looped heart tube stage, with cardiovascular defects indicated by ballooning of the pericardial sac and the pooling of blood in various regions of the embryo. Interestingly, in nt embryos, the direction of heart looping was randomized. Nodal and lefty, two genes that are normally expressed only in the left lateral plate mesoderm, show expression in the right and left lateral plate mesoderm. Lefty, which is normally also expressed in the floorplate, is not found in the prospective floor plate of nt embryos. This suggests the possibility of notochordal defects. This was confirmed by histological analysis and the examination of sonic hedgehog, Brachyury, and HNF-3 beta gene expression. These studies showed that the notochord is present in the early nt embryo, but degenerates as development progresses. Overall, these findings support the hypothesis that the notochord plays an active role in left/right patterning. Our results suggest that nt may participate in this process by modulating the notochordal expression of HNF-3 beta.

  7. Regional expression patterns of taste receptors and gustducin in the mouse tongue.

    PubMed

    Kim, Mi-Ryung; Kusakabe, Yuko; Miura, Hirohito; Shindo, Yoichiro; Ninomiya, Yuzo; Hino, Akihiro

    2003-12-12

    In order to understand differences in taste sensitivities of taste bud cells between the anterior and posterior part of tongue, it is important to analyze the regional expression patterns of genes related to taste signal transduction on the tongue. Here we examined the expression pattern of a taste receptor family, the T1r family, and gustducin in circumvallate and fungiform papillae of the mouse tongue using double-labeled in situ hybridization. Each member of the T1r family was expressed in both circumvallate and fungiform papillae with some differences in their expression patterns. The most striking difference between fungiform and circumvallate papillae was observed in their co-expression patterns of T1r2, T1r3, and gustducin. T1r2-positive cells in fungiform papillae co-expressed T1r3 and gustducin, whereas T1r2 and T1r3 double-positive cells in circumvallate papillae merely expressed gustducin. These results suggested that in fungiform papillae, gustducin might play a role in the sweet taste signal transduction cascade mediated by a sweet receptor based on the T1r2 and T1r3 combination, in fungiform papillae.

  8. Origin of heterogeneous spiking patterns from continuously distributed ion channel densities: a computational study in spinal dorsal horn neurons.

    PubMed

    Balachandar, Arjun; Prescott, Steven A

    2018-05-01

    Distinct spiking patterns may arise from qualitative differences in ion channel expression (i.e. when different neurons express distinct ion channels) and/or when quantitative differences in expression levels qualitatively alter the spike generation process. We hypothesized that spiking patterns in neurons of the superficial dorsal horn (SDH) of spinal cord reflect both mechanisms. We reproduced SDH neuron spiking patterns by varying densities of K V 1- and A-type potassium conductances. Plotting the spiking patterns that emerge from different density combinations revealed spiking-pattern regions separated by boundaries (bifurcations). This map suggests that certain spiking pattern combinations occur when the distribution of potassium channel densities straddle boundaries, whereas other spiking patterns reflect distinct patterns of ion channel expression. The former mechanism may explain why certain spiking patterns co-occur in genetically identified neuron types. We also present algorithms to predict spiking pattern proportions from ion channel density distributions, and vice versa. Neurons are often classified by spiking pattern. Yet, some neurons exhibit distinct patterns under subtly different test conditions, which suggests that they operate near an abrupt transition, or bifurcation. A set of such neurons may exhibit heterogeneous spiking patterns not because of qualitative differences in which ion channels they express, but rather because quantitative differences in expression levels cause neurons to operate on opposite sides of a bifurcation. Neurons in the spinal dorsal horn, for example, respond to somatic current injection with patterns that include tonic, single, gap, delayed and reluctant spiking. It is unclear whether these patterns reflect five cell populations (defined by distinct ion channel expression patterns), heterogeneity within a single population, or some combination thereof. We reproduced all five spiking patterns in a computational model by varying the densities of a low-threshold (K V 1-type) potassium conductance and an inactivating (A-type) potassium conductance and found that single, gap, delayed and reluctant spiking arise when the joint probability distribution of those channel densities spans two intersecting bifurcations that divide the parameter space into quadrants, each associated with a different spiking pattern. Tonic spiking likely arises from a separate distribution of potassium channel densities. These results argue in favour of two cell populations, one characterized by tonic spiking and the other by heterogeneous spiking patterns. We present algorithms to predict spiking pattern proportions based on ion channel density distributions and, conversely, to estimate ion channel density distributions based on spiking pattern proportions. The implications for classifying cells based on spiking pattern are discussed. © 2018 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

  9. The Brassicaceae Family Displays Divergent, Shoot-Skewed NLR Resistance Gene Expression.

    PubMed

    Munch, David; Gupta, Vikas; Bachmann, Asger; Busch, Wolfgang; Kelly, Simon; Mun, Terry; Andersen, Stig Uggerhøj

    2018-02-01

    Nucleotide-binding site leucine-rich repeat resistance genes (NLRs) allow plants to detect microbial effectors. We hypothesized that NLR expression patterns could reflect organ-specific differences in effector challenge and tested this by carrying out a meta-analysis of expression data for 1,235 NLRs from nine plant species. We found stable NLR root/shoot expression ratios within species, suggesting organ-specific hardwiring of NLR expression patterns in anticipation of distinct challenges. Most monocot and dicot plant species preferentially expressed NLRs in roots. In contrast, Brassicaceae species, including oilseed rape ( Brassica napus ) and the model plant Arabidopsis ( Arabidopsis thaliana ), were unique in showing NLR expression skewed toward the shoot across multiple phylogenetically distinct groups of NLRs. The Brassicaceae are also outliers in the sense that they have lost the common symbiosis signaling pathway, which enables intracellular infection by root symbionts. While it is unclear if these two events are related, the NLR expression shift identified here suggests that the Brassicaceae may have evolved unique pattern-recognition receptors and antimicrobial root metabolites to substitute for NLR protection. Such innovations in root protection could potentially be exploited in crop rotation schemes or for enhancing root defense systems of non-Brassicaceae crops. © 2018 American Society of Plant Biologists. All Rights Reserved.

  10. Development-related expression patterns of protein-coding and miRNA genes involved in porcine muscle growth.

    PubMed

    Wang, F J; Jin, L; Guo, Y Q; Liu, R; He, M N; Li, M Z; Li, X W

    2014-11-27

    Muscle growth and development is associated with remarkable changes in protein-coding and microRNA (miRNA) gene expression. To determine the expression patterns of genes and miRNAs related to muscle growth and development, we measured the expression levels of 25 protein-coding and 16 miRNA genes in skeletal and cardiac muscles throughout 5 developmental stages by quantitative reverse transcription-polymerase chain reaction. The Short Time-Series Expression Miner (STEM) software clustering results showed that growth-related genes were downregulated at all developmental stages in both the psoas major and longissimus dorsi muscles, indicating their involvement in early developmental stages. Furthermore, genes related to muscle atrophy, such as forkhead box 1 and muscle ring finger, showed unregulated expression with increasing age, suggesting a decrease in protein synthesis during the later stages of skeletal muscle development. We found that development of the cardiac muscle was a complex process in which growth-related genes were highly expressed during embryonic development, but they did not show uniform postnatal expression patterns. Moreover, the expression level of miR-499, which enhances the expression of the β-myosin heavy chain, was significantly different in the psoas major and longissimus dorsi muscles, suggesting the involvement of miR-499 in the determination of skeletal muscle fiber types. We also performed correlation analyses of messenger RNA and miRNA expression. We found negative relationships between miR-486 and forkhead box 1, and miR-133a and serum response factor at all developmental stages, suggesting that forkhead box 1 and serum response factor are potential targets of miR-486 and miR-133a, respectively.

  11. Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone's level of tolerance.

    PubMed

    Ali, Shahin S; Melnick, Rachel L; Crozier, Jayne; Phillips-Mora, Wilberth; Strem, Mary D; Shao, Jonathan; Zhang, Dapeng; Sicher, Richard; Meinhardt, Lyndel; Bailey, Bryan A

    2014-09-01

    An understanding of the tolerance mechanisms of Theobroma cacao used against Moniliophthora roreri, the causal agent of frosty pod rot, is important for the generation of stable disease-tolerant clones. A comparative view was obtained of transcript populations of infected pods from two susceptible and two tolerant clones using RNA sequence (RNA-Seq) analysis. A total of 3009 transcripts showed differential expression among clones. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of differentially expressed genes indicated shifts in 152 different metabolic pathways between the tolerant and susceptible clones. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) analyses of 36 genes verified the differential expression. Regression analysis validated a uniform progression in gene expression in association with infection levels and fungal loads in the susceptible clones. Expression patterns observed in the susceptible clones diverged in tolerant clones, with many genes showing higher expression at a low level of infection and fungal load. Principal coordinate analyses of real-time qRT-PCR data separated the gene expression patterns between susceptible and tolerant clones for pods showing malformation. Although some genes were constitutively differentially expressed between clones, most results suggested that defence responses were induced at low fungal load in the tolerant clones. Several elicitor-responsive genes were highly expressed in tolerant clones, suggesting rapid recognition of the pathogen and induction of defence genes. Expression patterns suggested that the jasmonic acid-ethylene- and/or salicylic acid-mediated defence pathways were activated in the tolerant clones, being enhanced by reduced brassinosteroid (BR) biosynthesis and catabolic inactivation of both BR and abscisic acids. Finally, several genes associated with hypersensitive response-like cell death were also induced in tolerant clones. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  12. Complex genomic rearrangement in CCS-LacZ transgenic mice.

    PubMed

    Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

    2007-02-01

    The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

  13. Subdivision of arthropod cap-n-collar expression domains is restricted to Mandibulata

    PubMed Central

    2014-01-01

    Background The monophyly of Mandibulata - the division of arthropods uniting pancrustaceans and myriapods - is consistent with several morphological characters, such as the presence of sensory appendages called antennae and the eponymous biting appendage, the mandible. Functional studies have demonstrated that the patterning of the mandible requires the activity of the Hox gene Deformed and the transcription factor cap-n-collar (cnc) in at least two holometabolous insects: the fruit fly Drosophila melanogaster and the beetle Tribolium castaneum. Expression patterns of cnc from two non-holometabolous insects and a millipede have suggested conservation of the labral and mandibular domains within Mandibulata. However, the activity of cnc is unknown in crustaceans and chelicerates, precluding understanding of a complete scenario for the evolution of patterning of this appendage within arthropods. To redress these lacunae, here we investigate the gene expression of the ortholog of cnc in Parhyale hawaiensis, a malacostracan crustacean, and two chelicerates: the harvestman Phalangium opilio, and the scorpion Centruroides sculpturatus. Results In the crustacean P. hawaiensis, the segmental expression of Ph-cnc is the same as that reported previously in hexapods and myriapods, with two distinct head domains in the labrum and the mandibular segment. In contrast, Po-cnc and Cs-cnc expression is not enriched in the labrum of either chelicerate, but instead is expressed at comparable levels in all appendages. In further contrast to mandibulate orthologs, the expression domain of Po-cnc posterior to the labrum is not confined within the expression domain of Po-Dfd. Conclusions Expression data from two chelicerate outgroup taxa suggest that the signature two-domain head expression pattern of cnc evolved at the base of Mandibulata. The observation of the archetypal labral and mandibular segment domains in a crustacean exemplar supports the synapomorphic nature of mandibulate cnc expression. The broader expression of Po-cnc with respect to Po-Dfd in chelicerates further suggests that the regulation of cnc by Dfd was also acquired at the base of Mandibulata. To test this hypothesis, future studies examining panarthropod cnc evolution should investigate expression of the cnc ortholog in arthropod outgroups, such as Onychophora and Tardigrada. PMID:24405788

  14. A case of mild phenotype Alport syndrome caused by COL4A3 mutations.

    PubMed

    Kamijo, Masafumi; Kitamura, Mineaki; Muta, Kumiko; Uramatsu, Tadashi; Obata, Yoko; Nozu, Kandai; Kaito, Hiroshi; Iijima, Kazumoto; Mukae, Hiroshi; Nishino, Tomoya

    2017-11-01

    In a case of 41-year-old man with mild nephropathy, Alport syndrome (AS) was diagnosed from the renal biopsy. However, the α5 chain of type IV collagen expressed in the glomerular basement membrane, which was the atypical staining pattern of AS. Genetic testing suggested autosomal recessive AS from heterozygous mutations at two positions in the type IV collagen α3 chain. These two gene mutations represented a new pattern of mutation and was suggested the association with an atypical α5 chain expression and mild phenotype.

  15. Evolutionary modification of T-brain (tbr) expression patterns in sand dollar.

    PubMed

    Minemura, Keiko; Yamaguchi, Masaaki; Minokawa, Takuya

    2009-10-01

    The sand dollars are a group of irregular echinoids that diverged from other regular sea urchins approximately 200 million years ago. We isolated two orthologs of T-brain (tbr), Smtbr and Pjtbr, from the indirect developing sand dollar Scaphechinus mirabilis and the direct developing sand dollar Peronella japonica, respectively. The expression patterns of Smtbr and Pjtbr during early development were examined by whole mount in situ hybridization. The expression of Smtbr was first detected in micromere descendants in early blastula stage, similar to tbr expression in regular sea urchins. However, unlike in regular sea urchin, Smtbr expression in middle blastula stage was detected in micromere-descendent cells and a subset of macromere-descendant cells. At gastrula stage, expression of Smtbr was detected in part of the archenteron as well as primary mesenchyme cells. A similar pattern of tbr expression was observed in early Peronella embryos. A comparison of tbr expression patterns between sand dollars and other echinoderm species suggested that broader expression in the endomesoderm is an ancestral character of echinoderms. In addition to the endomesoderm, Pjtbr expression was detected in the apical organ, the animal-most part of the ectoderm.

  16. Regulatory gene expression patterns reveal transverse and longitudinal subdivisions of the embryonic zebrafish forebrain.

    PubMed

    Hauptmann, G; Gerster, T

    2000-03-01

    To shed light on the organization of the rostral embryonic brain of a lower vertebrate, we have directly compared the expression patterns of dlx, fgf, hh, hlx, otx, pax, POU, winged helix and wnt gene family members in the fore- and midbrain of the zebrafish. We show that the analyzed genes are expressed in distinct transverse and longitudinal domains and share expression boundaries at stereotypic positions within the fore- and midbrain. Some of these shared expression boundaries coincide with morphological landmarks like the pathways of primary axon tracts. We identified a series of eight transverse diencephalic domains suggestive of neuromeric subdivisions within the rostral brain. In addition, we identified four molecularly distinct longitudinal subdivisions and provide evidence for a strong bending of the longitudinal rostral brain axis at the cephalic flexure. Our data suggest a strong conservation of early forebrain organization between lower and higher vertebrates.

  17. Patterning of leaf vein networks by convergent auxin transport pathways.

    PubMed

    Sawchuk, Megan G; Edgar, Alexander; Scarpella, Enrico

    2013-01-01

    The formation of leaf vein patterns has fascinated biologists for centuries. Transport of the plant signal auxin has long been implicated in vein patterning, but molecular details have remained unclear. Varied evidence suggests a central role for the plasma-membrane (PM)-localized PIN-FORMED1 (PIN1) intercellular auxin transporter of Arabidopsis thaliana in auxin-transport-dependent vein patterning. However, in contrast to the severe vein-pattern defects induced by auxin transport inhibitors, pin1 mutant leaves have only mild vein-pattern defects. These defects have been interpreted as evidence of redundancy between PIN1 and the other four PM-localized PIN proteins in vein patterning, redundancy that underlies many developmental processes. By contrast, we show here that vein patterning in the Arabidopsis leaf is controlled by two distinct and convergent auxin-transport pathways: intercellular auxin transport mediated by PM-localized PIN1 and intracellular auxin transport mediated by the evolutionarily older, endoplasmic-reticulum-localized PIN6, PIN8, and PIN5. PIN6 and PIN8 are expressed, as PIN1 and PIN5, at sites of vein formation. pin6 synthetically enhances pin1 vein-pattern defects, and pin8 quantitatively enhances pin1pin6 vein-pattern defects. Function of PIN6 is necessary, redundantly with that of PIN8, and sufficient to control auxin response levels, PIN1 expression, and vein network formation; and the vein pattern defects induced by ectopic PIN6 expression are mimicked by ectopic PIN8 expression. Finally, vein patterning functions of PIN6 and PIN8 are antagonized by PIN5 function. Our data define a new level of control of vein patterning, one with repercussions on other patterning processes in the plant, and suggest a mechanism to select cell files specialized for vascular function that predates evolution of PM-localized PIN proteins.

  18. Developmental stage related patterns of codon usage and genomic GC content: searching for evolutionary fingerprints with models of stem cell differentiation

    PubMed Central

    2007-01-01

    Background The usage of synonymous codons shows considerable variation among mammalian genes. How and why this usage is non-random are fundamental biological questions and remain controversial. It is also important to explore whether mammalian genes that are selectively expressed at different developmental stages bear different molecular features. Results In two models of mouse stem cell differentiation, we established correlations between codon usage and the patterns of gene expression. We found that the optimal codons exhibited variation (AT- or GC-ending codons) in different cell types within the developmental hierarchy. We also found that genes that were enriched (developmental-pivotal genes) or specifically expressed (developmental-specific genes) at different developmental stages had different patterns of codon usage and local genomic GC (GCg) content. Moreover, at the same developmental stage, developmental-specific genes generally used more GC-ending codons and had higher GCg content compared with developmental-pivotal genes. Further analyses suggest that the model of translational selection might be consistent with the developmental stage-related patterns of codon usage, especially for the AT-ending optimal codons. In addition, our data show that after human-mouse divergence, the influence of selective constraints is still detectable. Conclusion Our findings suggest that developmental stage-related patterns of gene expression are correlated with codon usage (GC3) and GCg content in stem cell hierarchies. Moreover, this paper provides evidence for the influence of natural selection at synonymous sites in the mouse genome and novel clues for linking the molecular features of genes to their patterns of expression during mammalian ontogenesis. PMID:17349061

  19. The Written Expression Abilities of Adolescents with Attention-Deficit/Hyperactivity Disorder

    PubMed Central

    Molitor, Stephen J.; Langberg, Joshua M.; Evans, Steve W.

    2016-01-01

    Students with Attention-Deficit/Hyperactivity Disorder (ADHD) often experience deficits in academic achievement. Written expression abilities in this population have not been extensively studied but existing prevalence estimates suggest that rates of comorbid writing underachievement may be substantially higher than rates of comorbid reading and mathematics underachievement. The current study examined written expression abilities in a school-based sample of 326 middle school age students with ADHD. The prevalence of written expression impairment, the associations between written expression and academic outcomes, and specific patterns of written expression were investigated. Students with ADHD in this sample experienced written expression impairment (17.2% – 22.4%) at a similar rate to reading impairment (17.0% – 24.3%) and at a slightly lower rate than mathematics impairment (24.7% – 36.3%). Students’ written expression abilities were significantly associated with school grades and parent ratings of academic functioning, above and beyond the influence of intelligence. Analyses of patterns suggest that students with ADHD exhibit greater deficits in written expression tasks requiring organization and attention to detail, especially in the context of a complex task. PMID:26802631

  20. Quantitative deviating effects of maple syrup extract supplementation on the hepatic gene expression of mice fed a high-fat diet.

    PubMed

    Kamei, Asuka; Watanabe, Yuki; Shinozaki, Fumika; Yasuoka, Akihito; Shimada, Kousuke; Kondo, Kaori; Ishijima, Tomoko; Toyoda, Tsudoi; Arai, Soichi; Kondo, Takashi; Abe, Keiko

    2017-02-01

    Maple syrup contains various polyphenols and we investigated the effects of a polyphenol-rich maple syrup extract (MSXH) on the physiology of mice fed a high-fat diet (HFD). The mice fed a low-fat diet (LFD), an HFD, or an HFD supplemented with 0.02% (002MSXH) or 0.05% MSXH (005MSXH) for 4 weeks. Global gene expression analysis of the liver was performed, and the differentially expressed genes were classified into three expression patterns; pattern A (LFD < HFD > 002MSXH = 005MSXH, LFD > HFD < 002MSXH = 005MSXH), pattern B (LFD < HFD = 002MSXH > 005MSXH, LFD > HFD = 002MSXH < 005MSXH), and pattern C (LFD < HFD > 002MSXH < 005MSXH, LFD > HFD < 002MSXH > 005MSXH). Pattern A was enriched in glycolysis, fatty acid metabolism, and folate metabolism. Pattern B was enriched in tricarboxylic acid cycle while pattern C was enriched in gluconeogenesis, cholesterol metabolism, amino acid metabolism, and endoplasmic reticulum stress-related event. Our study suggested that the effects of MSXH ingestion showed (i) dose-dependent pattern involved in energy metabolisms and (ii) reversely pattern involved in stress responses. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Transcriptomic Analysis of Lung Tissue from Cigarette Smoke-Induced Emphysema Murine Models and Human Chronic Obstructive Pulmonary Disease Show Shared and Distinct Pathways.

    PubMed

    Yun, Jeong H; Morrow, Jarrett; Owen, Caroline A; Qiu, Weiliang; Glass, Kimberly; Lao, Taotao; Jiang, Zhiqiang; Perrella, Mark A; Silverman, Edwin K; Zhou, Xiaobo; Hersh, Craig P

    2017-07-01

    Although cigarette smoke (CS) is the primary risk factor for chronic obstructive pulmonary disease (COPD), the underlying molecular mechanisms for the significant variability in developing COPD in response to CS are incompletely understood. We performed lung gene expression profiling of two different wild-type murine strains (C57BL/6 and NZW/LacJ) and two genetic models with mutations in COPD genome-wide association study genes (HHIP and FAM13A) after 6 months of chronic CS exposure and compared the results to human COPD lung tissues. We identified gene expression patterns that correlate with severity of emphysema in murine and human lungs. Xenobiotic metabolism and nuclear erythroid 2-related factor 2-mediated oxidative stress response were commonly regulated molecular response patterns in C57BL/6, Hhip +/- , and Fam13a -/- murine strains exposed chronically to CS. The CS-resistant Fam13a -/- mouse and NZW/LacJ strain revealed gene expression response pattern differences. The Fam13a -/- strain diverged in gene expression compared with C57BL/6 control only after CS exposure. However, the NZW/LacJ strain had a unique baseline expression pattern, enriched for nuclear erythroid 2-related factor 2-mediated oxidative stress response and xenobiotic metabolism, and converged to a gene expression pattern similar to the more susceptible wild-type C57BL/6 after CS exposure. These results suggest that distinct molecular pathways may account for resistance to emphysema. Surprisingly, there were few genes commonly modulated in mice and humans. Our study suggests that gene expression responses to CS may be largely species and model dependent, yet shared pathways could provide biologically significant insights underlying individual susceptibility to CS.

  2. Expression of a gymnosperm PIN homologous gene correlates with auxin immunolocalization pattern at cotyledon formation and in demarcation of the procambium during Picea abies somatic embryo development and in seedling tissues.

    PubMed

    Palovaara, Joakim; Hallberg, Henrik; Stasolla, Claudio; Luit, Bert; Hakman, Inger

    2010-04-01

    In seed plants, the body organization is established during embryogenesis and is uniform across gymnosperms and angiosperms, despite differences during early embryogeny. Evidence from angiosperms implicates the plant hormone auxin and its polar transport, mainly established by the PIN family of auxin efflux transporters, in the patterning of embryos. Here, PaPIN1 from Norway spruce (Picea abies [L.] Karst.), a gene widely expressed in conifer tissues and organs, was characterized and its expression and localization patterns were determined with reverse transcription polymerase chain reaction and in situ hybridization during somatic embryo development and in seedlings. PaPIN1 shares the predicted structure of other PIN proteins, but its central hydrophilic loop is longer than most PINs. In phylogenetic analyses, PaPIN1 clusters with Arabidopsis thaliana (L.) Heynh. PIN3, PIN4 and PIN7, but its expression pattern also suggests similarity to PIN1. The PaPIN1 expression signal was high in the protoderm of pre-cotyledonary embryos, but not if embryos were pre-treated with the auxin transport inhibitor N-1-naphthylphthalamic acid (NPA). This, together with a high auxin immunolocalization signal in this cell layer, suggests a role of PaPIN1 during cotyledon formation. At later stages, high PaPIN1 expression was observed in differentiating procambium, running from the tip of incipient cotyledons down through the embryo axis and to the root apical meristem (RAM), although the mode of RAM specification in conifer embryos differs from that of most angiosperms. Also, the PaPIN1 in situ signal was high in seedling root tips including root cap columella cells. The results thus suggest that PaPIN1 provides an ancient function associated with auxin transport and embryo pattern formation prior to the separation of angiosperms and gymnosperms, in spite of some morphological differences.

  3. Adult mouse brain gene expression patterns bear an embryologic imprint

    PubMed Central

    Zapala, Matthew A.; Hovatta, Iiris; Ellison, Julie A.; Wodicka, Lisa; Del Rio, Jo A.; Tennant, Richard; Tynan, Wendy; Broide, Ron S.; Helton, Rob; Stoveken, Barbara S.; Winrow, Christopher; Lockhart, Daniel J.; Reilly, John F.; Young, Warren G.; Bloom, Floyd E.; Lockhart, David J.; Barlow, Carrolee

    2005-01-01

    The current model to explain the organization of the mammalian nervous system is based on studies of anatomy, embryology, and evolution. To further investigate the molecular organization of the adult mammalian brain, we have built a gene expression-based brain map. We measured gene expression patterns for 24 neural tissues covering the mouse central nervous system and found, surprisingly, that the adult brain bears a transcriptional “imprint” consistent with both embryological origins and classic evolutionary relationships. Embryonic cellular position along the anterior–posterior axis of the neural tube was shown to be closely associated with, and possibly a determinant of, the gene expression patterns in adult structures. We also observed a significant number of embryonic patterning and homeobox genes with region-specific expression in the adult nervous system. The relationships between global expression patterns for different anatomical regions and the nature of the observed region-specific genes suggest that the adult brain retains a degree of overall gene expression established during embryogenesis that is important for regional specificity and the functional relationships between regions in the adult. The complete collection of extensively annotated gene expression data along with data mining and visualization tools have been made available on a publicly accessible web site (www.barlow-lockhart-brainmapnimhgrant.org). PMID:16002470

  4. Transcript and protein environmental biomarkers in fish--a review.

    PubMed

    Tom, Moshe; Auslander, Meirav

    2005-04-01

    The levels of contaminant-affected gene products (transcripts and proteins) are increasingly utilized as environmental biomarkers, and their appropriate implementation as diagnostic tools is discussed. The required characteristics of a gene product biomarker are accurate evaluation using properly normalized absolute units, aiming at long-term comparability of biomarker levels over a wide geographical range and among many laboratories. Quantitative RT-PCR and competitive ELISA are suggested as preferred evaluation methods for transcript and protein, respectively. Constitutively expressed RNAs or proteins which are part of the examined homogenate are suggested as normalizing agents, compensating for variable processing efficiency. Essential characterization of expression patterns is suggested, providing reference values to be compared to the monitored levels. This comparison would enable estimation of the intensity of biological effects of contaminants. Contaminant-independent reference expression patterns should include natural fluctuations of the biomarker level. Contaminant-dependent patterns should include dose response to model contaminants chronically administered in two environmentally-realistic routes, reaching extreme sub-lethal affected levels. Recent studies using fish as environmental sentinel species, applying gene products as environmental biomarkers, and implementing at least part of the depicted methodologies are reviewed.

  5. Vertebrate homologues of Frodo are dynamically expressed during embryonic development in tissues undergoing extensive morphogenetic movements.

    PubMed

    Hunter, Nina L; Hikasa, Hiroki; Dymecki, Susan M; Sokol, Sergei Y

    2006-01-01

    Frodo has been identified as a protein interacting with Dishevelled, an essential mediator of the Wnt signaling pathway, critical for the determination of cell fate and polarity in embryonic development. In this study, we use specific gene probes to characterize stage- and tissue-specific expression patterns of the mouse Frodo homologue and compare them with Frodo expression patterns in Xenopus embryos. In situ hybridization analysis of mouse Frodo transcripts demonstrates that, similar to Xenopus Frodo, mouse Frodo is expressed in primitive streak mesoderm, neuroectoderm, neural crest, presomitic mesoderm, and somites. In many cases, Frodo expression is confined to tissues undergoing extensive morphogenesis, suggesting that Frodo may be involved in the regulation of cell shape and motility. Highly conserved dynamic expression patterns of Frodo homologues indicate a similar function for these proteins in different vertebrates. 2005 Wiley-Liss, Inc.

  6. Dynamic patterns of expression for genes regulating cytokinin metabolism and signaling during rice inflorescence development.

    PubMed

    Yamburenko, Maria V; Kieber, Joseph J; Schaller, G Eric

    2017-01-01

    Inflorescence development in cereals, including such important crops as rice, maize, and wheat, directly affects grain number and size and is a key determinant of yield. Cytokinin regulates meristem size and activity and, as a result, has profound effects on inflorescence development and architecture. To clarify the role of cytokinin action in inflorescence development, we used the NanoString nCounter system to analyze gene expression in the early stages of rice panicle development, focusing on 67 genes involved in cytokinin biosynthesis, degradation, and signaling. Results point toward key members of these gene families involved in panicle development and indicate that the expression of many genes involved in cytokinin action differs between the panicle and vegetative tissues. Dynamic patterns of gene expression suggest that subnetworks mediate cytokinin action during different stages of panicle development. The variation of expression during panicle development is greater among genes encoding proteins involved in cytokinin metabolism and negative regulators of the pathway than for the genes in the primary response pathway. These results provide insight into the expression patterns of genes involved in cytokinin action during inflorescence development in a crop of agricultural importance, with relevance to similar processes in other monocots. The identification of subnetworks of genes expressed at different stages of early panicle development suggests that manipulation of their expression could have substantial effects on inflorescence architecture.

  7. The homeobox gene mirror links EGF signalling to embryonic dorso-ventral axis formation through notch activation.

    PubMed

    Jordan, K C; Clegg, N J; Blasi, J A; Morimoto, A M; Sen, J; Stein, D; McNeill, H; Deng, W M; Tworoger, M; Ruohola-Baker, H

    2000-04-01

    Recent studies in vertebrates and Drosophila melanogaster have revealed that Fringe-mediated activation of the Notch pathway has a role in patterning cell layers during organogenesis. In these processes, a homeobox-containing transcription factor is responsible for spatially regulating fringe (fng) expression and thus directing activation of the Notch pathway along the fng expression border. Here we show that this may be a general mechanism for patterning epithelial cell layers. At three stages in Drosophila oogenesis, mirror (mirr) and fng have complementary expression patterns in the follicle-cell epithelial layer, and at all three stages loss of mirr enlarges, and ectopic expression of mirr restricts, fng expression, with consequences for follicle-cell patterning. These morphological changes are similar to those caused by Notch mutations. Ectopic expression of mirr in the posterior follicle cells induces a stripe of rhomboid (rho) expression and represses pipe (pip), a gene with a role in the establishment of the dorsal-ventral axis, at a distance. Ectopic Notch activation has a similar long-range effect on pip. Our results suggest that Mirror and Notch induce secretion of diffusible morphogens and we have identified TGF-beta (encoded by dpp) as such a molecule in germarium. We also found that mirr expression in dorsal follicle cells is induced by the EGF-receptor (EGFR) pathway and that mirr then represses pip expression in all but the ventral follicle cells, connecting EGFR activation in the dorsal follicle cells to repression of pip in the dorsal and lateral follicle cells. Our results suggest that the differentiation of ventral follicle cells is not a direct consequence of germline signalling, but depends on long-range signals from dorsal follicle cells, and provide a link between early and late events in Drosophila embryonic dorsal-ventral axis formation.

  8. DNA-Demethylase Regulated Genes Show Methylation-Independent Spatiotemporal Expression Patterns

    PubMed Central

    Schumann, Ulrike; Lee, Joanne; Kazan, Kemal; Ayliffe, Michael; Wang, Ming-Bo

    2017-01-01

    Recent research has indicated that a subset of defense-related genes is downregulated in the Arabidopsis DNA demethylase triple mutant rdd (ros1 dml2 dml3) resulting in increased susceptibility to the fungal pathogen Fusarium oxysporum. In rdd plants these downregulated genes contain hypermethylated transposable element sequences (TE) in their promoters, suggesting that this methylation represses gene expression in the mutant and that these sequences are actively demethylated in wild-type plants to maintain gene expression. In this study, the tissue-specific and pathogen-inducible expression patterns of rdd-downregulated genes were investigated and the individual role of ROS1, DML2, and DML3 demethylases in these spatiotemporal regulation patterns was determined. Large differences in defense gene expression were observed between pathogen-infected and uninfected tissues and between root and shoot tissues in both WT and rdd plants, however, only subtle changes in promoter TE methylation patterns occurred. Therefore, while TE hypermethylation caused decreased gene expression in rdd plants it did not dramatically effect spatiotemporal gene regulation, suggesting that this latter regulation is largely methylation independent. Analysis of ros1-3, dml2-1, and dml3-1 single gene mutant lines showed that promoter TE hypermethylation and defense-related gene repression was predominantly, but not exclusively, due to loss of ROS1 activity. These data demonstrate that DNA demethylation of TE sequences, largely by ROS1, promotes defense-related gene expression but does not control spatiotemporal expression in Arabidopsis. Summary: Ros1-mediated DNA demethylation of promoter transposable elements is essential for activation of defense-related gene expression in response to fungal infection in Arabidopsis thaliana. PMID:28894455

  9. Ectopic KNOX Expression Affects Plant Development by Altering Tissue Cell Polarity and Identity[OPEN

    PubMed Central

    Rebocho, Alexandra B.

    2016-01-01

    Plant development involves two polarity types: tissue cell (asymmetries within cells are coordinated across tissues) and regional (identities vary spatially across tissues) polarity. Both appear altered in the barley (Hordeum vulgare) Hooded mutant, in which ectopic expression of the KNOTTED1-like Homeobox (KNOX) gene, BKn3, causes inverted polarity of differentiated hairs and ectopic flowers, in addition to wing-shaped outgrowths. These lemma-specific effects allow the spatiotemporal analysis of events following ectopic BKn3 expression, determining the relationship between KNOXs, polarity, and shape. We show that tissue cell polarity, based on localization of the auxin transporter SISTER OF PINFORMED1 (SoPIN1), dynamically reorients as ectopic BKn3 expression increases. Concurrently, ectopic expression of the auxin importer LIKE AUX1 and boundary gene NO APICAL MERISTEM is activated. The polarity of hairs reflects SoPIN1 patterns, suggesting that tissue cell polarity underpins oriented cell differentiation. Wing cell files reveal an anisotropic growth pattern, and computational modeling shows how polarity guiding growth can account for this pattern and wing emergence. The inverted ectopic flower orientation does not correlate with SoPIN1, suggesting that this form of regional polarity is not controlled by tissue cell polarity. Overall, the results suggest that KNOXs trigger different morphogenetic effects through interplay between tissue cell polarity, identity, and growth. PMID:27553356

  10. Multiple Pesticides Detoxification Function of Maize (Zea mays) GST34.

    PubMed

    Li, Dongzhi; Xu, Li; Pang, Sen; Liu, Zhiqian; Zhao, Weisong; Wang, Chengju

    2017-03-08

    ZmGST34 is a maize Tau class GST gene and was found to be differently expressed between two maize cultivars differing in tolerance to herbicide metolachlor. To explore the possible role of ZmGST34 in maize development, the expression pattern and substrate specificity of ZmGST34 were characterized by quantitative RT-PCR and heterologous expression system, respectively. The results indicated that the expression level of ZmGST34 was increased ∼2-5-fold per day during the second-leaf stage of maize seedling. Chloroacetanilide herbicides or phytohormone treatments had no influence on the expression level of ZmGST34, suggesting that ZmGST34 is a constitutively expressed gene in maize seedling. Heterologous expression in Escherichia coli and in Arabidopsis thaliana proved that ZmGST34 can metabolize most chloroacetanilide herbicides and increase tolerance to these herbicides in transgenic Arabidopsis thaliana. The constitutive expression pattern and broad substrate activity of ZmGST34 suggested that this gene may play an important role in maize development in addition to the detoxification of pesticides.

  11. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru

    2007-06-29

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics inmore » their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated.« less

  12. From wild wolf to domestic dog: gene expression changes in the brain.

    PubMed

    Saetre, Peter; Lindberg, Julia; Leonard, Jennifer A; Olsson, Kerstin; Pettersson, Ulf; Ellegren, Hans; Bergström, Tomas F; Vilà, Carles; Jazin, Elena

    2004-07-26

    Despite the relatively recent divergence time between domestic dogs (Canis familiaris) and gray wolves (Canis lupus), the two species show remarkable behavioral differences. Since dogs and wolves are nearly identical at the level of DNA sequence, we hypothesize that the two species may differ in patterns of gene expression. We compare gene expression patterns in dogs, wolves and a close relative, the coyote (Canis latrans), in three parts of the brain: hypothalamus, amygdala and frontal cortex, with microarray technology. Additionally, we identify genes with region-specific expression patterns in all three species. Among the wild canids, the hypothalamus has a highly conserved expression profile. This contrasts with a marked divergence in domestic dogs. Real-time PCR experiments confirm the altered expression of two neuropeptides, CALCB and NPY. Our results suggest that strong selection on dogs for behavior during domestication may have resulted in modifications of mRNA expression patterns in a few hypothalamic genes with multiple functions. This study indicates that rapid changes in brain gene expression may not be exclusive to the development of human brains. Instead, they may provide a common mechanism for rapid adaptive changes during speciation, particularly in cases that present strong selective pressures on behavioral characters.

  13. Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization[OPEN

    PubMed Central

    Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Peng, Huiru; Sun, Qixin; Ni, Zhongfu

    2018-01-01

    Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid (Aegilops spp), tetraploid, and hexaploid wheat (Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. PMID:29298834

  14. Of mice and genes: evolution of vertebrate brain development

    NASA Technical Reports Server (NTRS)

    Fritzsch, B.

    1998-01-01

    In this review the current understanding of genetic and molecular evolution of development, in particular the formation of the major axis of bilateral animals, is critically evaluated, and the early pattern formation in the hindbrain is related as much as possible to these processes. On the genetic level it is proposed that the exuberant multiplication of regulatory genes compared to that of structural genes relates to the increased flexibility of early vertebrate development. In comparisons to fruit flies, many conserved genes are found to be expressed very differently, while many others seem to reflect a comparable pattern and thus suggest a conservation of function. Even genes with a largely conserved pattern of expression may change the level at which they are expressed and the mechanisms by which they are regulated in their expression. Evolution and development of hindbrain motoneurons is reviewed, and it is concluded that both comparative data as well as more recent experimental data suggest a limited importance for the rhombomeres. Clearly, many cell fate-specifying processes work below the level of rhombomeres or in the absence of rhombomeres. It is suggested that more comparative developmental data are needed to establish firmly the relationship between homeobox genes and rhombomere specification in vertebrates other than a few model species.

  15. Specifying and Sustaining Pigmentation Patterns in Domestic and Wild Cats

    PubMed Central

    Kaelin, Christopher B.; Xu, Xiao; Hong, Lewis Z.; David, Victor A.; McGowan, Kelly A.; Schmidt-Küntzel, Anne; Roelke, Melody E.; Pino, Javier; Pontius, Joan; Cooper, Gregory M.; Manuel, Hermogenes; Swanson, William F.; Marker, Laurie; Harper, Cindy K.; van Dyk, Ann; Yue, Bisong; Mullikin, James C.; Warren, Wesley C.; Eizirik, Eduardo; Kos, Lidia; O’Brien, Stephen J.; Barsh, Gregory S.; Menotti-Raymond, Marilyn

    2013-01-01

    Color markings among felid species display both a remarkable diversity and a common underlying periodicity. A similar range of patterns in domestic cats suggests a conserved mechanism whose appearance can be altered by selection. We identified the gene responsible for tabby pattern variation in domestic cats as Transmembrane aminopeptidase Q (Taqpep), which encodes a membrane-bound metalloprotease. Analyzing 31 other felid species, we identified Taqpep as the cause of the rare king cheetah phenotype, in which spots coalesce into blotches and stripes. Histologic, genomic expression, and transgenic mouse studies indicate that paracrine expression of Endothelin3 (Edn3) coordinates localized color differences. We propose a two-stage model in which Taqpep helps to establish a periodic pre-pattern during skin development that is later implemented by differential expression of Edn3. PMID:22997338

  16. Ectopic application of recombinant BMP-2 and BMP-4 can change patterning of developing chick facial primordia.

    PubMed

    Barlow, A J; Francis-West, P H

    1997-01-01

    The facial primordia initially consist of buds of undifferentiated mesenchyme, which give rise to a variety of tissues including cartilage, muscle and nerve. These must be arranged in a precise spatial order for correct function. The signals that control facial outgrowth and patterning are largely unknown. The bone morphogenetic proteins Bmp-2 and Bmp-4 are expressed in discrete regions at the distal tips of the early facial primordia suggesting possible roles for BMP-2 and BMP-4 during chick facial development. We show that expression of Bmp-4 and Bmp-2 is correlated with the expression of Msx-1 and Msx-2 and that ectopic application of BMP-2 and BMP-4 can activate Msx-1 and Msx-2 gene expression in the developing facial primordia. We correlate this activation of gene expression with changes in skeletal development. For example, activation of Msx-1 gene expression across the distal tip of the mandibular primordium is associated with an extension of Fgf-4 expression in the epithelium and bifurcation of Meckel's cartilage. In the maxillary primordium, extension of the normal domain of Msx-1 gene expression is correlated with extended epithelial expression of shh and bifurcation of the palatine bone. We also show that application of BMP-2 can increase cell proliferation of the mandibular primordia. Our data suggest that BMP-2 and BMP-4 are part of a signalling cascade that controls outgrowth and patterning of the facial primordia.

  17. Characterization of basal gene expression trends over a diurnal cycle in Xiphophorus maculatus skin, brain and liver.

    PubMed

    Lu, Yuan; Reyes, Jose; Walter, Sean; Gonzalez, Trevor; Medrano, Geraldo; Boswell, Mikki; Boswell, William; Savage, Markita; Walter, Ronald

    2018-06-01

    Evolutionarily conserved diurnal circadian mechanisms maintain oscillating patterns of gene expression based on the day-night cycle. Xiphophorus fish have been used to evaluate transcriptional responses after exposure to various light sources and it was determined that each source incites distinct genetic responses in skin tissue. However, basal expression levels of genes that show oscillating expression patterns in day-night cycle, may affect the outcomes of such experiments, since basal gene expression levels at each point in the circadian path may influence the profile of identified light responsive genes. Lack of knowledge regarding diurnal fluctuations in basal gene expression patterns may confound the understanding of genetic responses to external stimuli (e.g., light) since the dynamic nature of gene expression implies animals subjected to stimuli at different times may be at very different stages within the continuum of genetic homeostasis. We assessed basal gene expression changes over a 24-hour period in 200 select Xiphophorus gene targets known to transcriptionally respond to various types of light exposure. We identified 22 genes in skin, 36 genes in brain and 28 genes in liver that exhibit basal oscillation of expression patterns. These genes, including known circadian regulators, produced the expected expression patterns over a 24-hour cycle when compared to circadian regulatory genes identified in other species, especially human and other vertebrate animal models. Our results suggest the regulatory network governing diurnal oscillating gene expression is similar between Xiphophorus and other vertebrates for the three Xiphophorus organs tested. In addition, we were able to categorize light responsive gene sets in Xiphophorus that do, and do not, exhibit circadian based oscillating expression patterns. Copyright © 2017 Elsevier Inc. All rights reserved.

  18. Capturing Physiology of Emotion along Facial Muscles: A Method of Distinguishing Feigned from Involuntary Expressions

    NASA Astrophysics Data System (ADS)

    Khan, Masood Mehmood; Ward, Robert D.; Ingleby, Michael

    The ability to distinguish feigned from involuntary expressions of emotions could help in the investigation and treatment of neuropsychiatric and affective disorders and in the detection of malingering. This work investigates differences in emotion-specific patterns of thermal variations along the major facial muscles. Using experimental data extracted from 156 images, we attempted to classify patterns of emotion-specific thermal variations into neutral, and voluntary and involuntary expressions of positive and negative emotive states. Initial results suggest (i) each facial muscle exhibits a unique thermal response to various emotive states; (ii) the pattern of thermal variances along the facial muscles may assist in classifying voluntary and involuntary facial expressions; and (iii) facial skin temperature measurements along the major facial muscles may be used in automated emotion assessment.

  19. Arabidopsis thaliana gonidialess A/Zuotin related factors (GlsA/ZRF) are essential for maintenance of meristem integrity.

    PubMed

    Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June

    2016-05-01

    Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.

  20. Genomic Expression Patterns in Menstrually-Related Migraine in Adolescents

    PubMed Central

    Hershey, Andrew; Horn, Paul; Kabbouche, Marielle; O'Brien, Hope; Powers, Scott

    2011-01-01

    Background Exacerbation of migraine with menses is common in adolescent girls and women with migraine, occurring in up to 60% of females with migraine. These migraines are oftentimes longer and more disabling and may be related to estrogen levels and hormonal fluctuations. Objective This study identifies the unique genomic expression pattern of menstrually-related migraine (MRM) in comparison to migraine occurring outside the menstrual period and headache free controls. Methods Whole blood samples were obtained from female subjects having an acute migraine during their menstrual period (MRM) or outside of their menstrual period (nonMRM) and controls (C) – females having a menstrual period without any history of headache. The mRNA was isolated from these samples and genomic profile was assessed. Affymetrix Human Exon ST 1.0 arrays were used to examine the genomic expression pattern differences between these three groups. Results Blood genomic expression patterns were obtained on 56 subjects (MRM = 18, nonMRM = 18 and C = 20). Unique genomic expression patterns were observed for both MRM and nonMRM. For MRM, 77 genes were identified that were unique to MRM, while 61 genes were commonly expressed for MRM and nonMRM and 127 genes appeared to have a unique expression pattern for nonMRM. In addition, there were 279 genes that differentially expressed for MRM compared to nonMRM that were not differentially expressed for nonMRM. Gene ontology of these samples indicated many of these groups of genes were functionally related and included categories of immunomodulation/inflammation, mitochondrial function and DNA homeostasis. Conclusions Blood genomic patterns can accurately differentiate MRM from nonMRM. These results indicate that MRM involves a unique molecular biology pathway that can be identified with a specific biomarker and suggest that individuals with MRM have a different underlying genetic etiology. PMID:22220971

  1. Dynamic gene expression of Lin-28 during embryonic development in mouse and chicken.

    PubMed

    Yokoyama, Shigetoshi; Hashimoto, Megumi; Shimizu, Hirohito; Ueno-Kudoh, Hiroe; Uchibe, Kenta; Kimura, Ichiro; Asahara, Hiroshi

    2008-02-01

    The Caenorhabditis elegans heterochronic gene lin-28 regulates developmental timing in the nematode trunk. We report the dynamic expression patterns of Lin-28 homologues in mouse and chick embryos. Whole mount in situ hybridization revealed specific and intriguing expression patterns of Lin-28 in the developing mouse and chick limb bud. Mouse Lin-28 expression was detected in both the forelimb and hindlimb at E9.5, but disappeared from the forelimb at E10.5, and finally from the forelimb and hindlimb at E11.5. Chicken Lin-28, which was first detected in the limb primordium at stage 15/16, was also downregulated as the stage proceeded. The amino acid sequences of mouse and chicken Lin-28 genes are highly conserved and the similar expression patterns of Lin-28 during limb development in mouse and chicken suggest that this heterochronic gene is also conserved during vertebrate limb development.

  2. Differential expression of homeobox-containing genes Msx-1 and Msx-2 and homeoprotein Msx-2 expression during chick craniofacial development.

    PubMed

    Nishikawa, K; Nakanishi, T; Aoki, C; Hattori, T; Takahashi, K; Taniguchi, S

    1994-03-01

    The expression pattern of chick Msx-1 and Msx-2 homeobox genes in craniofacial primordia was examined by in situ hybridization using cRNA probes. Both genes were expressed in the distal region of the facial primordia, where the distribution of Msx-2 expression was restricted distally within the Msx-1 expression domain. On the contrary, Msx-2 expression in the lateral choroid plexus and cranial skull was broader and more intensive than Msx-1 expression. Our findings suggest that these two genes cooperate to play differential roles in craniofacial development. Msx-2 protein was detected immunohistochemically, and its localization essentially corresponded to the mRNA expression pattern, substantiating the involvement of Msx-2 protein as a transcriptional regulator in developing limb and face.

  3. Partial co-option of the appendage patterning pathway in the development of abdominal appendages in the sepsid fly Themira biloba

    PubMed Central

    Nijhout, H. Frederik

    2014-01-01

    The abdominal appendages on male Themira biloba (Diptera: Sepsidae) are complex novel structures used during mating. These abdominal appendages superficially resemble the serially homologous insect appendages in that they have a joint and a short segment that can be rotated. Non-genital appendages do not occur in adult pterygote insects, so these abdominal appendages are novel structures with no obvious ancestry. We investigated whether the genes that pattern the serially homologous insect appendages have been co-opted to pattern these novel abdominal appendages. Immunohistochemistry was used to determine the expression patterns of the genes extradenticle (exd), Distal-less (Dll), engrailed (en), Notch, and the Bithorax Complex in the appendages of T. biloba during pupation. The expression patterns of Exd, En, and Notch were consistent with the hypothesis that a portion of the patterning pathway that establishes the coxopodite has been co-opted to pattern the developing abdominal appendages. However, Dll was only expressed in the bristles of the developing appendages and not the proximal–distal axis of the appendage itself. The lack of Dll expression indicates the absence of a distal domain of the appendage suggesting that sepsid abdominal appendages only use genes that normally pattern the base of segmental appendages. PMID:20182886

  4. Embryonic expression of endothelins and their receptors in lamprey and frog reveals stem vertebrate origins of complex Endothelin signaling

    PubMed Central

    Square, Tyler; Jandzik, David; Cattell, Maria; Hansen, Andrew; Medeiros, Daniel Meulemans

    2016-01-01

    Neural crest cells (NCCs) are highly patterned embryonic cells that migrate along stereotyped routes to give rise to a diverse array of adult tissues and cell types. Modern NCCs are thought to have evolved from migratory neural precursors with limited developmental potential and patterning. How this occurred is poorly understood. Endothelin signaling regulates several aspects of NCC development, including their migration, differentiation, and patterning. In jawed vertebrates, Endothelin signaling involves multiple functionally distinct ligands (Edns) and receptors (Ednrs) expressed in various NCC subpopulations. To test the potential role of endothelin signaling diversification in the evolution of modern, highly patterned NCC, we analyzed the expression of the complete set of endothelin ligands and receptors in the jawless vertebrate, the sea lamprey (Petromyzon marinus). To better understand ancestral features of gnathostome edn and ednr expression, we also analyzed all known Endothelin signaling components in the African clawed frog (Xenopus laevis). We found that the sea lamprey has a gnathsotome-like complement of edn and ednr duplicates, and these genes are expressed in patterns highly reminiscent of their gnathostome counterparts. Our results suggest that the duplication and specialization of vertebrate Endothelin signaling coincided with the appearance of highly patterned and multipotent NCCs in stem vertebrates. PMID:27677704

  5. Plant twitter: ligands under 140 amino acids enforcing stomatal patterning.

    PubMed

    Rychel, Amanda L; Peterson, Kylee M; Torii, Keiko U

    2010-05-01

    Stomata are an essential land plant innovation whose patterning and density are under genetic and environmental control. Recently, several putative ligands have been discovered that influence stomatal density, and they all belong to the epidermal patterning factor-like family of secreted cysteine-rich peptides. Two of these putative ligands, EPF1 and EPF2, are expressed exclusively in the stomatal lineage cells and negatively regulate stomatal density. A third, EPFL6 or CHALLAH, is also a negative regulator of density, but is expressed subepidermally in the hypocotyl. A fourth, EPFL9 or STOMAGEN, is expressed in the mesophyll tissues and is a positive regulator of density. Genetic evidence suggests that these ligands may compete for the same receptor complex. Proper stomatal patterning is likely to be an intricate process involving ligand competition, regional specificity, and communication between tissue layers. EPFL-family genes exist in the moss Physcomitrella patens, the lycophyte Selaginella moellendorffii, and rice, Oryza sativa, and their sequence analysis yields several genes some of which are related to EPF1, EPF2, EPFL6, and EPFL9. Presence of these EPFL family members in the basal land plants suggests an exciting hypothesis that the genetic components for stomatal patterning originated early in land plant evolution.

  6. Retinoic acid influences anteroposterior positioning of epidermal sensory neurons and their gene expression in a developing chordate (amphioxus)

    PubMed Central

    Schubert, Michael; Holland, Nicholas D.; Escriva, Hector; Holland, Linda Z.; Laudet, Vincent

    2004-01-01

    In developing chordates, retinoic acid (RA) signaling patterns the rostrocaudal body axis globally and affects gene expression locally in some differentiating cell populations. Here we focus on development of epidermal sensory neurons in an invertebrate chordate (amphioxus) to determine how RA signaling influences their rostrocaudal distribution and gene expression (for AmphiCoe, a neural precursor gene; for amphioxus islet and AmphiERR, two neural differentiation genes; and for AmphiHox1, -3, -4, and -6). Treatments with RA or an RA antagonist (BMS009) shift the distribution of developing epidermal neurons anteriorly or posteriorly, respectively. These treatments also affect gene expression patterns in the epidermal neurons, suggesting that RA levels may influence specification of neuronal subtypes. Although colinear expression of Hox genes is well known for the amphioxus central nervous system, we find an unexpected comparable colinearity for AmphiHox1, -3, -4, and -6 in the developing epidermis; moreover, RA levels affect the anteroposterior extent of these Hox expression domains, suggesting that RA signaling controls a colinear Hox code for anteroposterior patterning of the amphioxus epidermis. Thus, in amphioxus, the developing peripheral nervous system appears to be structured by mechanisms parallel to those that structure the central nervous system. One can speculate that, during evolution, an ancestral deuterostome that structured its panepidermal nervous system with an RA-influenced Hox code gave rise to chordates in which this patterning mechanism persisted within the epidermal elements of the peripheral nervous system and was transferred to the neuroectoderm as the central nervous system condensed dorsally. PMID:15226493

  7. Evidence of sex-bias in gene expression in the brain transcriptome of two populations of rainbow trout (Oncorhynchus mykiss) with divergent life histories.

    PubMed

    Hale, Matthew C; McKinney, Garrett J; Thrower, Frank P; Nichols, Krista M

    2018-01-01

    Sex-bias in gene expression is a mechanism that can generate phenotypic variance between the sexes, however, relatively little is known about how patterns of sex-bias vary during development, and how variable sex-bias is between different populations. To that end, we measured sex-bias in gene expression in the brain transcriptome of rainbow trout (Oncorhynchus mykiss) during the first two years of development. Our sampling included from the fry stage through to when O. mykiss either migrate to the ocean or remain resident and undergo sexual maturation. Samples came from two F1 lines: One from migratory steelhead trout and one from resident rainbow trout. All samples were reared in a common garden environment and RNA sequencing (RNA-seq) was used to estimate patterns of gene expression. A total of 1,716 (4.6% of total) genes showed evidence of sex-bias in gene expression in at least one time point. The majority (96.7%) of sex-biased genes were differentially expressed during the second year of development, indicating that patterns of sex-bias in expression are tied to key developmental events, such as migration and sexual maturation. Mapping of differentially expressed genes to the O. mykiss genome revealed that the X chromosome is enriched for female upregulated genes, and this may indicate a lack of dosage compensation in rainbow trout. There were many more sex-biased genes in the migratory line than the resident line suggesting differences in patterns of gene expression in the brain between populations subjected to different forces of selection. Overall, our results suggest that there is considerable variation in the extent and identity of genes exhibiting sex-bias during the first two years of life. These differentially expressed genes may be connected to developmental differences between the sexes, and/or between adopting a resident or migratory life history.

  8. In the eye of the beholder? Universality and cultural specificity in the expression and perception of emotion.

    PubMed

    Scherer, Klaus R; Clark-Polner, Elizabeth; Mortillaro, Marcello

    2011-12-01

    Do members of different cultures express (or "encode") emotions in the same fashion? How well can members of distinct cultures recognize (or "decode") each other's emotion expressions? The question of cultural universality versus specificity in emotional expression has been a hot topic of debate for more than half a century, but, despite a sizeable amount of empirical research produced to date, no convincing answers have emerged. We suggest that this unsatisfactory state of affairs is due largely to a lack of concern with the precise mechanisms involved in emotion expression and perception, and propose to use a modified Brunswikian lens model as an appropriate framework for research in this area. On this basis we provide a comprehensive review of the existing literature and point to research paradigms that are likely to provide the evidence required to resolve the debate on universality vs. cultural specificity of emotional expression. Applying this fresh perspective, our analysis reveals that, given the paucity of pertinent data, no firm conclusions can be drawn on actual expression (encoding) patterns across cultures (although there appear to be more similarities than differences), but that there is compelling evidence for intercultural continuity in decoding, or recognition, ability. We also note a growing body of research on the notion of ingroup advantage due to expression "dialects," above and beyond the general encoding or decoding patterns. We furthermore suggest that these empirical patterns could be explained by both universality in the underlying mechanisms and cultural specificity in the input to, and the regulation of, these expression and perception mechanisms. Overall, more evidence is needed, both to further elucidate these mechanisms and to inventory the patterns of cultural effects. We strongly recommend using more solid conceptual and theoretical perspectives, as well as more ecologically valid approaches, in designing future studies in emotion expression and perception research.

  9. Fungal and host transcriptome analysis of pH-regulated genes during colonization of apple fruits by Penicillium expansum.

    PubMed

    Barad, Shiri; Sela, Noa; Kumar, Dilip; Kumar-Dubey, Amit; Glam-Matana, Nofar; Sherman, Amir; Prusky, Dov

    2016-05-04

    Penicillium expansum is a destructive phytopathogen that causes decay in deciduous fruits during postharvest handling and storage. During colonization the fungus secretes D-gluconic acid (GLA), which modulates environmental pH and regulates mycotoxin accumulation in colonized tissue. Till now no transcriptomic analysis has addressed the specific contribution of the pathogen's pH regulation to the P. expansum colonization process. For this purpose total RNA from the leading edge of P. expansum-colonized apple tissue of cv. 'Golden Delicious' and from fungal cultures grown under pH 4 or 7 were sequenced and their gene expression patterns were compared. We present a large-scale analysis of the transcriptome data of P. expansum and apple response to fungal colonization. The fungal analysis revealed nine different clusters of gene expression patterns that were divided among three major groups in which the colonized tissue showed, respectively: (i) differing transcript expression patterns between mycelial growth at pH 4 and pH 7; (ii) similar transcript expression patterns of mycelial growth at pH 4; and (iii) similar transcript expression patterns of mycelial growth at pH 7. Each group was functionally characterized in order to decipher genes that are important for pH regulation and also for colonization of apple fruits by Penicillium. Furthermore, comparison of gene expression of healthy apple tissue with that of colonized tissue showed that differentially expressed genes revealed up-regulation of the jasmonic acid and mevalonate pathways, and also down-regulation of the glycogen and starch biosynthesis pathways. Overall, we identified important genes and functionalities of P. expansum that were controlled by the environmental pH. Differential expression patterns of genes belonging to the same gene family suggest that genes were selectively activated according to their optimal environmental conditions (pH, in vitro or in vivo) to enable the fungus to cope with varying conditions and to make optimal use of available enzymes. Comparison between the activation of the colonized host's gene responses by alkalizing Colletotrichum gloeosporioides and acidifying P. expansum pathogens indicated similar gene response patterns, but stronger responses to P. expansum, suggesting the importance of acidification by P. expansum as a factor in its increased aggressiveness.

  10. Osteosarcoma tissues and cell lines from patients with differing serum alkaline phosphatase concentrations display minimal differences in gene expression patterns

    PubMed Central

    de Sá Rodrigues, L. C.; Holmes, K. E.; Thompson, V.; Piskun, C. M.; Lana, S. E.; Newton, M. A.; Stein, T. J.

    2016-01-01

    Serum alkaline phosphatase (ALP) concentration is a prognostic factor for osteosarcoma in multiple studies, although its biological significance remains incompletely understood. To determine whether gene expression patterns differed in osteosarcoma from patients with differing serum ALP concentrations, microarray analysis was performed on 18 primary osteosarcoma samples and six osteosarcoma cell lines from dogs with normal and increased serum ALP concentration. No differences in gene expression patterns were noted between tumours or cell lines with differing serum ALP concentration using a gene-specific two-sample t-test. Using a more sensitive empirical Bayes procedure, defective in cullin neddylation 1 domain containing 1 (DCUN1D1) was increased in both the tissue and cell lines of the normal ALP group. Using quantitative PCR (qPCR), differences in DCUN1D1 expression between the two groups failed to reach significance. The homogeneity of gene expression patterns of osteosarcoma associated differing serum ALP concentrations are consistent with previous studies suggesting serum ALP concentration is not associated with intrinsic differences of osteosarcoma cells. PMID:25643733

  11. Differential expression of Meis2, Mab21l2 and Tbx3 during limb development associated with diversification of limb morphology in mammals.

    PubMed

    Dai, Mengyao; Wang, Yao; Fang, Lu; Irwin, David M; Zhu, Tengteng; Zhang, Junpeng; Zhang, Shuyi; Wang, Zhe

    2014-01-01

    Bats are the only mammals capable of self-powered flight using wings. Differing from mouse or human limbs, four elongated digits within a broad wing membrane support the bat wing, and the foot of the bat has evolved a long calcar that spread the interfemoral membrane. Our recent mRNA sequencing (mRNA-Seq) study found unique expression patterns for genes at the 5' end of the Hoxd gene cluster and for Tbx3 that are associated with digit elongation and wing membrane growth in bats. In this study, we focused on two additional genes, Meis2 and Mab21l2, identified from the mRNA-Seq data. Using whole-mount in situ hybridization (WISH) we validated the mRNA-Seq results for differences in the expression patterns of Meis2 and Mab21l2 between bat and mouse limbs, and further characterize the timing and location of the expression of these two genes. These analyses suggest that Meis2 may function in wing membrane growth and Mab21l2 may have a role in AP and DV axial patterning. In addition, we found that Tbx3 is uniquely expressed in the unique calcar structure found in the bat hindlimb, suggesting a role for this gene in calcar growth and elongation. Moreover, analysis of the coding sequences for Meis2, Mab21l2 and Tbx3 showed that Meis2 and Mab21l2 have high sequence identity, consistent with the functions of genes being conserved, but that Tbx3 showed accelerated evolution in bats. However, evidence for positive selection in Tbx3 was not found, which would suggest that the function of this gene has not been changed. Together, our findings support the hypothesis that the modulation of the spatiotemporal expression patterns of multiple functional conserved genes control limb morphology and drive morphological change in the diversification of mammalian limbs.

  12. Differential Expression of Meis2, Mab21l2 and Tbx3 during Limb Development Associated with Diversification of Limb Morphology in Mammals

    PubMed Central

    Fang, Lu; Irwin, David M.; Zhu, Tengteng; Zhang, Junpeng; Zhang, Shuyi; Wang, Zhe

    2014-01-01

    Bats are the only mammals capable of self-powered flight using wings. Differing from mouse or human limbs, four elongated digits within a broad wing membrane support the bat wing, and the foot of the bat has evolved a long calcar that spread the interfemoral membrane. Our recent mRNA sequencing (mRNA-Seq) study found unique expression patterns for genes at the 5′ end of the Hoxd gene cluster and for Tbx3 that are associated with digit elongation and wing membrane growth in bats. In this study, we focused on two additional genes, Meis2 and Mab21l2, identified from the mRNA-Seq data. Using whole-mount in situ hybridization (WISH) we validated the mRNA-Seq results for differences in the expression patterns of Meis2 and Mab21l2 between bat and mouse limbs, and further characterize the timing and location of the expression of these two genes. These analyses suggest that Meis2 may function in wing membrane growth and Mab21l2 may have a role in AP and DV axial patterning. In addition, we found that Tbx3 is uniquely expressed in the unique calcar structure found in the bat hindlimb, suggesting a role for this gene in calcar growth and elongation. Moreover, analysis of the coding sequences for Meis2, Mab21l2 and Tbx3 showed that Meis2 and Mab21l2 have high sequence identity, consistent with the functions of genes being conserved, but that Tbx3 showed accelerated evolution in bats. However, evidence for positive selection in Tbx3 was not found, which would suggest that the function of this gene has not been changed. Together, our findings support the hypothesis that the modulation of the spatiotemporal expression patterns of multiple functional conserved genes control limb morphology and drive morphological change in the diversification of mammalian limbs. PMID:25166052

  13. Gene expression analysis of the ovary of hybrid females of Xenopus laevis and X. muelleri

    PubMed Central

    2008-01-01

    Background Interspecific hybrids of frogs of the genus Xenopus result in sterile hybrid males and fertile hybrid females. Previous work has demonstrated a dramatic asymmetrical pattern of misexpression in hybrid males compared to the two parental species with relatively few genes misexpressed in comparisons of hybrids and the maternal species (X. laevis) and dramatically more genes misexpressed in hybrids compared to the paternal species (X. muelleri). In this work, we examine the gene expression pattern in hybrid females of X. laevis × X. muelleri to determine if this asymmetrical pattern of expression also occurs in hybrid females. Results We find a similar pattern of asymmetry in expression compared to males in that there were more genes differentially expressed between hybrids and X. muelleri compared to hybrids and X. laevis. We also found a dramatic increase in the number of misexpressed genes with hybrid females having about 20 times more genes misexpressed in ovaries compared to testes of hybrid males and therefore the match between phenotype and expression pattern is not supported. Conclusion We discuss these intriguing findings in the context of reproductive isolation and suggest that divergence in female expression may be involved in sterility of hybrid males due to the inherent sensitivity of spermatogenesis as defined by the faster male evolution hypothesis for Haldane's rule. PMID:18331635

  14. Homeotic genes and the arthropod head: Expression patterns of the labial, proboscipedia, and Deformed genes in crustaceans and insects

    PubMed Central

    Abzhanov, Arhat; Kaufman, Thomas C.

    1999-01-01

    cDNA fragments of the homologues of the Drosophila head homeotic genes labial (lab), proboscipedia (pb), and Deformed (Dfd) have been isolated from the crustacean Porcellio scaber. Because the accumulation domains of the head homeotic complex (Hox) genes had not been previously reported for crustaceans, we studied the expression patterns of these genes in P. scaber embryos by using in situ hybridization. The P. scaber lab homologue is expressed in the developing second antennal segment and its appendages. This expression domain in crustaceans and in the homologous intercalary segment of insects suggests that the lab gene specified this metamere in the last common ancestor of these two groups. The expression domain of the P. scaber pb gene is in the posterior part of the second antennal segment. This domain, in contrast to that in insects, is colinear with the domains of other head genes in P. scaber, and it differs from the insect pb gene expression domain in the posterior mouthparts, suggesting that the insect and crustacean patterns evolved independently from a broader ancestral domain similar to that found in modern chelicerates. P. scaber Dfd is expressed in the mandibular segment and paragnaths (a pair of ventral mouthpart structures associated with the stomodeum) and differs from insects, where expression is in the mandibular and maxillary segments. Thus, like pb, Dfd shows a divergent Hox gene deployment. We conclude that homologous structures of the mandibulate head display striking differences in their underlying developmental programs related to Hox gene expression. PMID:10468590

  15. Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization.

    PubMed

    Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Yao, Yingyin; Peng, Huiru; Hu, Zhaorong; Sun, Qixin; Ni, Zhongfu; Xin, Mingming

    2018-01-01

    Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid ( Aegilops spp), tetraploid, and hexaploid wheat ( Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. © 2018 American Society of Plant Biologists. All rights reserved.

  16. Pattern Genes Suggest Functional Connectivity of Organs

    NASA Astrophysics Data System (ADS)

    Qin, Yangmei; Pan, Jianbo; Cai, Meichun; Yao, Lixia; Ji, Zhiliang

    2016-05-01

    Human organ, as the basic structural and functional unit in human body, is made of a large community of different cell types that organically bound together. Each organ usually exerts highly specified physiological function; while several related organs work smartly together to perform complicated body functions. In this study, we present a computational effort to understand the roles of genes in building functional connection between organs. More specifically, we mined multiple transcriptome datasets sampled from 36 human organs and tissues, and quantitatively identified 3,149 genes whose expressions showed consensus modularly patterns: specific to one organ/tissue, selectively expressed in several functionally related tissues and ubiquitously expressed. These pattern genes imply intrinsic connections between organs. According to the expression abundance of the 766 selective genes, we consistently cluster the 36 human organs/tissues into seven functional groups: adipose & gland, brain, muscle, immune, metabolism, mucoid and nerve conduction. The organs and tissues in each group either work together to form organ systems or coordinate to perform particular body functions. The particular roles of specific genes and selective genes suggest that they could not only be used to mechanistically explore organ functions, but also be designed for selective biomarkers and therapeutic targets.

  17. Functional autonomy of distant-acting human enhancers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Visel, Axel; Akiyama, Jennifer A.; Shoukry, Malak

    2009-02-19

    Many human genes are associated with dispersed arrays of transcriptional enhancers that regulate their expression in time and space. Studies in invertebrate model systems have suggested that these elements function as discrete and independent regulatory units, but the in vivo combinatorial properties of vertebrate enhancers remain poorly understood. To explore the modularity and regulatory autonomy of human developmental enhancers, we experimentally concatenated up to four enhancers from different genes and used a transgenic mouse assay to compare the in vivo activity of these compound elements with that of the single modules. In all of the six different combinations of elementsmore » tested, the reporter gene activity patterns were additive without signs of interference between the individual modules, indicating that regulatory specificity was maintained despite the presence of closely-positioned heterologous enhancers. Even in cases where two elements drove expression in close anatomical proximity, such as within neighboring subregions of the developing limb bud, the compound patterns did not show signs of cross-inhibition between individual elements or novel expression sites. These data indicate that human developmental enhancers are highly modular and functionally autonomous and suggest that genomic enhancer shuffling may have contributed to the evolution of complex gene expression patterns in vertebrates« less

  18. Evolutionary conservation of the presumptive neural plate markers AmphiSox1/2/3 and AmphiNeurogenin in the invertebrate chordate amphioxus

    NASA Technical Reports Server (NTRS)

    Holland, L. Z.; Schubert, M.; Holland, N. D.; Neuman, T.

    2000-01-01

    Amphioxus, as the closest living invertebrate relative of the vertebrates, can give insights into the evolutionary origin of the vertebrate body plan. Therefore, to investigate the evolution of genetic mechanisms for establishing and patterning the neuroectoderm, we cloned and determined the embryonic expression of two amphioxus transcription factors, AmphiSox1/2/3 and AmphiNeurogenin. These genes are the earliest known markers for presumptive neuroectoderm in amphioxus. By the early neurula stage, AmphiNeurogenin expression becomes restricted to two bilateral columns of segmentally arranged neural plate cells, which probably include precursors of motor neurons. This is the earliest indication of segmentation in the amphioxus nerve cord. Later, expression extends to dorsal cells in the nerve cord, which may include precursors of sensory neurons. By the midneurula, AmphiSox1/2/3 expression becomes limited to the dorsal part of the forming neural tube. These patterns resemble those of their vertebrate and Drosophila homologs. Taken together with the evolutionarily conserved expression of the dorsoventral patterning genes, BMP2/4 and chordin, in nonneural and neural ectoderm, respectively, of chordates and Drosophila, our results are consistent with the evolution of the chordate dorsal nerve cord and the insect ventral nerve cord from a longitudinal nerve cord in a common bilaterian ancestor. However, AmphiSox1/2/3 differs from its vertebrate homologs in not being expressed outside the CNS, suggesting that additional roles for this gene have evolved in connection with gene duplication in the vertebrate lineage. In contrast, expression in the midgut of AmphiNeurogenin together with the gene encoding the insulin-like peptide suggests that amphioxus may have homologs of vertebrate pancreatic islet cells, which express neurogenin3. In addition, AmphiNeurogenin, like its vertebrate and Drosophila homologs, is expressed in apparent precursors of epidermal chemosensory and possibly mechanosensory cells, suggesting a common origin for protostome and deuterostome epidermal sensory cells in the ancestral bilaterian. Copyright 2000 Academic Press.

  19. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures

    PubMed Central

    Liu, Juan; Franks, Robert G.; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin;  (Jenny) Xiang, Qiu-Yun

    2013-01-01

    Background and Aims LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Methods Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT–PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. Key Results cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. Conclusions The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories. PMID:24052556

  20. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures.

    PubMed

    Liu, Juan; Franks, Robert G; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun

    2013-11-01

    LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT-PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories.

  1. Patterning of anteroposterior body axis displayed in the expression of Hox genes in sea cucumber Apostichopus japonicus.

    PubMed

    Kikuchi, Mani; Omori, Akihito; Kurokawa, Daisuke; Akasaka, Koji

    2015-09-01

    The presence of an anteroposterior body axis is a fundamental feature of bilateria. Within this group, echinoderms have secondarily evolved pentameral symmetric body plans. Although all echinoderms present bilaterally symmetric larval stages, they dramatically rearrange their body axis and develop a pentaradial body plan during metamorphosis. Therefore, the location of their anteroposterior body axis in adult forms remains a contentious issue. Unlike other echinoderms, sea cucumbers present an obvious anteroposterior axis not rearranged during metamorphosis, thus representing an interesting group to study their anteroposterior axis patterning. Hox genes are known to play a broadly conserved role in anteroposterior axis patterning in deuterostomes. Here, we report the expression patterns of Hox genes from early development to pentactula stage in sea cucumber. In early larval stages, five Hox genes (AjHox1, AjHox7, AjHox8, AjHox11/13a, and AjHox11/13b) were expressed sequentially along the archenteron, suggesting that the role of anteroposterior patterning of the Hox genes is conserved in bilateral larvae of echinoderms. In doliolaria and pentactula stages, eight Hox genes (AjHox1, AjHox5, AjHox7, AjHox8, AjHox9/10, AjHox11/13a, AjHox11/13b, and AjHox11/13c) were expressed sequentially along the digestive tract, following a similar expression pattern to that found in the visceral mesoderm of other bilateria. Unlike other echinoderms, pentameral expression patterns of AjHox genes were not observed in sea cucumber. Altogether, we concluded that AjHox genes are involved in the patterning of the digestive tract in both larvae and metamorphosis of sea cucumbers. In addition, the anteroposterior axis in sea cucumbers might be patterned like that of other bilateria.

  2. Sex-Specific Selection and Sex-Biased Gene Expression in Humans and Flies.

    PubMed

    Cheng, Changde; Kirkpatrick, Mark

    2016-09-01

    Sexual dimorphism results from sex-biased gene expression, which evolves when selection acts differently on males and females. While there is an intimate connection between sex-biased gene expression and sex-specific selection, few empirical studies have studied this relationship directly. Here we compare the two on a genome-wide scale in humans and flies. We find a distinctive "Twin Peaks" pattern in humans that relates the strength of sex-specific selection, quantified by genetic divergence between male and female adults at autosomal loci, to the degree of sex-biased expression. Genes with intermediate degrees of sex-biased expression show evidence of ongoing sex-specific selection, while genes with either little or completely sex-biased expression do not. This pattern apparently results from differential viability selection in males and females acting in the current generation. The Twin Peaks pattern is also found in Drosophila using a different measure of sex-specific selection acting on fertility. We develop a simple model that successfully recapitulates the Twin Peaks. Our results suggest that many genes with intermediate sex-biased expression experience ongoing sex-specific selection in humans and flies.

  3. Spatial and temporal expression patterns of auxin response transcription factors in the syncytium induced by the beet cyst nematode Heterodera schachtii in Arabidopsis.

    PubMed

    Hewezi, Tarek; Piya, Sarbottam; Richard, Geoffrey; Rice, J Hollis

    2014-09-01

    Plant-parasitic cyst nematodes induce the formation of a multinucleated feeding site in the infected root, termed the syncytium. Recent studies point to key roles of the phytohormone auxin in the regulation of gene expression and establishment of the syncytium. Nevertheless, information about the spatiotemporal expression patterns of the transcription factors that mediate auxin transcriptional responses during syncytium formation is limited. Here, we provide a gene expression map of 22 auxin response factors (ARFs) during the initiation, formation and maintenance stages of the syncytium induced by the cyst nematode Heterodera schachtii in Arabidopsis. We observed distinct and overlapping expression patterns of ARFs throughout syncytium development phases. We identified a set of ARFs whose expression is predominantly located inside the developing syncytium, whereas others are expressed in the neighbouring cells, presumably to initiate specific transcriptional programmes required for their incorporation within the developing syncytium. Our analyses also point to a role of certain ARFs in determining the maximum size of the syncytium. In addition, several ARFs were found to be highly expressed in fully developed syncytia, suggesting a role in maintaining the functional phenotype of mature syncytia. The dynamic distribution and overlapping expression patterns of various ARFs seem to be essential characteristics of ARF activity during syncytium development. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  4. Sex determination in plants.

    PubMed

    Monéger, Françoise

    2007-05-01

    Most dioecious plant species are believed to derive from hermaphrodite ancestors. The regulatory pathways that have been modified during evolution of the hermaphrodite ancestors and led to the emergence of dioecious species (with separate sexes) still remain unknown. Silene latifolia is a dioecious plant species harbouring XY sex chromosomes. To identify the molecular mechanisms involved in female organ suppression in male flowers of S. latifolia, we looked for genes potentially involved in the establishment of floral organ and whorl boundaries. We identified Arabidopsis thaliana homologs of SHOOTMERISTEMLESS (STM) and CUP SHAPED COTYLEDON 1 (CUC1) and CUC2 genes in S. latifolia. Our phylogenetic analyses suggest that we identified true orthologs for both types of genes. Detailed expression analyses showed a conserved expression pattern for these genes between S. latifolia and A. thaliana, suggesting a conserved function of the corresponding proteins. Both orthologs showed clear differences in their expression pattern between males and females or hermaphrodites suggesting their possible involvement in the sex determination pathway in S. latifolia.

  5. Correct Hox gene expression established independently of position in Caenorhabditis elegans.

    PubMed

    Cowing, D; Kenyon, C

    1996-07-25

    The Hox genes are expressed in a conserved sequence of spatial domains along the anteroposterior (A/P) body axes of many organisms. In Drosophila, position-specific signals located along the A/P axis establish the pattern of Hox gene expression. In the nematode Caenorhabditis elegans, it is not known how the pattern of Hox gene expression is established. C. elegans uses lineal control mechanisms and local cell interactions to specify early blastomere identities. However, many cells expressing the same Hox gene are unrelated by lineage, suggesting that, as in Drosophila, domains of Hox gene expression may be defined by cell-extrinsic A/P positional signals. To test this, we have investigated whether posterior mesodermal and ectodermal cells will express their normal posterior Hox gene when they are mispositioned in the anterior. Surprisingly, we find that correct Hox gene expression does not depend on cell position, but is highly correlated with cell lineage. Thus, although the most striking feature of Hox gene expression is its positional specificity, in C. elegans the pattern is achieved, at least in part, by a lineage-specific control system that operates without regard to A/P position.

  6. Expression pattern of G protein-coupled receptor 30 in human seminiferous tubular cells.

    PubMed

    Oliveira, Pedro F; Alves, Marco G; Martins, Ana D; Correia, Sara; Bernardino, Raquel L; Silva, Joaquina; Barros, Alberto; Sousa, Mário; Cavaco, José E; Socorro, Sílvia

    2014-05-15

    The role of estrogens in male reproductive physiology has been intensively studied over the last few years. Yet, the involvement of their specific receptors has long been a matter of debate. The selective testicular expression of the classic nuclear estrogen receptors (ERα and ERβ) argues in favor of ER-specific functions in the spermatogenic event. Recently, the existence of a G protein-coupled estrogen receptor (GPR30) mediating non-genomic effects of estrogens has also been described. However, little is known about the specific testicular expression pattern of GPR30, as well as on its participation in the control of male reproductive function. Herein, by means of immunohistochemical and molecular biology techniques (RT-PCR and Western blot), we aimed to present the first exhaustive evaluation of GPR30 expression in non-neoplastic human testicular cells. Indeed, we were able to demonstrate that GPR30 was expressed in human testicular tissue and that the staining pattern was consistent with its cytoplasmic localization. Additionally, by using cultured human Sertoli cells (SCs) and isolated haploid and diploid germ cells fractions, we confirmed that GPR30 is expressed in SCs and diploid germ cells but not in haploid germ cells. This specific expression pattern suggests a role for GPR30 in spermatogenesis. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Microarray Analysis Gene Expression Profiles in Laryngeal Muscle After Recurrent Laryngeal Nerve Injury.

    PubMed

    Bijangi-Vishehsaraei, Khadijeh; Blum, Kevin; Zhang, Hongji; Safa, Ahmad R; Halum, Stacey L

    2016-03-01

    The pathophysiology of recurrent laryngeal nerve (RLN) transection injury is rare in that it is characteristically followed by a high degree of spontaneous reinnervation, with reinnervation of the laryngeal adductor complex (AC) preceding that of the abducting posterior cricoarytenoid (PCA) muscle. Here, we aim to elucidate the differentially expressed myogenic factors following RLN injury that may be at least partially responsible for the spontaneous reinnervation. F344 male rats underwent RLN injury (n = 12) or sham surgery (n = 12). One week after RLN injury, larynges were harvested following euthanasia. The mRNA was extracted from PCA and AC muscles bilaterally, and microarray analysis was performed using a full rat genome array. Microarray analysis of denervated AC and PCA muscles demonstrated dramatic differences in gene expression profiles, with 205 individual probes that were differentially expressed between the denervated AC and PCA muscles and only 14 genes with similar expression patterns. The differential expression patterns of the AC and PCA suggest different mechanisms of reinnervation. The PCA showed the gene patterns of Wallerian degeneration, while the AC expressed the gene patterns of reinnervation by adjacent axonal sprouting. This finding may reveal important therapeutic targets applicable to RLN and other peripheral nerve injuries. © The Author(s) 2015.

  8. Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

    2015-04-15

    DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

  9. Transcriptomic insights into the genetic basis of mammalian limb diversity.

    PubMed

    Maier, Jennifer A; Rivas-Astroza, Marcelo; Deng, Jenny; Dowling, Anna; Oboikovitz, Paige; Cao, Xiaoyi; Behringer, Richard R; Cretekos, Chris J; Rasweiler, John J; Zhong, Sheng; Sears, Karen E

    2017-03-23

    From bat wings to whale flippers, limb diversification has been crucial to the evolutionary success of mammals. We performed the first transcriptome-wide study of limb development in multiple species to explore the hypothesis that mammalian limb diversification has proceeded through the differential expression of conserved shared genes, rather than by major changes to limb patterning. Specifically, we investigated the manner in which the expression of shared genes has evolved within and among mammalian species. We assembled and compared transcriptomes of bat, mouse, opossum, and pig fore- and hind limbs at the ridge, bud, and paddle stages of development. Results suggest that gene expression patterns exhibit larger variation among species during later than earlier stages of limb development, while within species results are more mixed. Consistent with the former, results also suggest that genes expressed at later developmental stages tend to have a younger evolutionary age than genes expressed at earlier stages. A suite of key limb-patterning genes was identified as being differentially expressed among the homologous limbs of all species. However, only a small subset of shared genes is differentially expressed in the fore- and hind limbs of all examined species. Similarly, a small subset of shared genes is differentially expressed within the fore- and hind limb of a single species and among the forelimbs of different species. Taken together, results of this study do not support the existence of a phylotypic period of limb development ending at chondrogenesis, but do support the hypothesis that the hierarchical nature of development translates into increasing variation among species as development progresses.

  10. A Model-Based Analysis of Chemical and Temporal Patterns of Cuticular Hydrocarbons in Male Drosophila melanogaster

    PubMed Central

    Kent, Clement; Azanchi, Reza; Smith, Ben; Chu, Adrienne; Levine, Joel

    2007-01-01

    Drosophila Cuticular Hydrocarbons (CH) influence courtship behaviour, mating, aggregation, oviposition, and resistance to desiccation. We measured levels of 24 different CH compounds of individual male D. melanogaster hourly under a variety of environmental (LD/DD) conditions. Using a model-based analysis of CH variation, we developed an improved normalization method for CH data, and show that CH compounds have reproducible cyclic within-day temporal patterns of expression which differ between LD and DD conditions. Multivariate clustering of expression patterns identified 5 clusters of co-expressed compounds with common chemical characteristics. Turnover rate estimates suggest CH production may be a significant metabolic cost. Male cuticular hydrocarbon expression is a dynamic trait influenced by light and time of day; since abundant hydrocarbons affect male sexual behavior, males may present different pheromonal profiles at different times and under different conditions. PMID:17896002

  11. Mapping gene expression patterns during myeloid differentiation using the EML hematopoietic progenitor cell line.

    PubMed

    Du, Yang; Campbell, Janee L; Nalbant, Demet; Youn, Hyewon; Bass, Ann C Hughes; Cobos, Everardo; Tsai, Schickwann; Keller, Jonathan R; Williams, Simon C

    2002-07-01

    The detailed examination of the molecular events that control the early stages of myeloid differentiation has been hampered by the relative scarcity of hematopoietic stem cells and the lack of suitable cell line models. In this study, we examined the expression of several myeloid and nonmyeloid genes in the murine EML hematopoietic stem cell line. Expression patterns for 19 different genes were examined by Northern blotting and RT-PCR in RNA samples from EML, a variety of other immortalized cell lines, and purified murine hematopoietic stem cells. Representational difference analysis (RDA) was performed to identify differentially expressed genes in EML. Expression patterns of genes encoding transcription factors (four members of the C/EBP family, GATA-1, GATA-2, PU.1, CBFbeta, SCL, and c-myb) in EML were examined and were consistent with the proposed functions of these proteins in hematopoietic differentiation. Expression levels of three markers of terminal myeloid differentiation (neutrophil elastase, proteinase 3, and Mac-1) were highest in EML cells at the later stages of differentiation. In a search for genes that were differentially expressed in EML cells during myeloid differentiation, six cDNAs were isolated. These included three known genes (lysozyme, histidine decarboxylase, and tryptophan hydroxylase) and three novel genes. Expression patterns of known genes in differentiating EML cells accurately reflected their expected expression patterns based on previous studies. The identification of three novel genes, two of which encode proteins that may act as regulators of hematopoietic differentiation, suggests that EML is a useful model system for the molecular analysis of hematopoietic differentiation.

  12. Temporal and spatial expression patterns of Hedgehog receptors in the developing inner and middle ear.

    PubMed

    Shin, Jeong-Oh; Ankamreddy, Harinarayana; Jakka, Naga Mahesh; Lee, Seokwon; Kim, Un-Kyung; Bok, Jinwoong

    2017-01-01

    The mammalian inner ear is a complex organ responsible for balance and hearing. Sonic hedgehog (Shh), a member of the Hedgehog (Hh) family of secreted proteins, has been shown to play important roles in several aspects of inner ear development, including dorsoventral axial specification, cochlear elongation, tonotopic patterning, and hair cell differentiation. Hh proteins initiate a downstream signaling cascade by binding to the Patched 1 (Ptch1) receptor. Recent studies have revealed that other types of co-receptors can also mediate Hh signaling, including growth arrest-specific 1 (Gas1), cell-adhesion molecules-related/down-regulated by oncogenes (Cdon), and biregional Cdon binding protein (Boc). However, little is known about the role of these Hh co-receptors in inner ear development. In this study, we examined the expression patterns of Gas1, Cdon, and Boc, as well as that of Ptch1, in the developing mouse inner ear from otocyst (embryonic day (E) 9.5) until birth and in the developing middle ear at E15.5. Ptch1, a readout of Hh signaling, was expressed in a graded pattern in response to Shh signaling throughout development. Expression patterns of Gas1, Cdon, and Boc differed from that of Ptch1, and each Hh co-receptor was expressed in specific cells and domains in the developing inner and middle ear. These unique and differential expression patterns of Hh co-receptors suggest their roles in mediating various time- and space-specific functions of Shh during ear development.

  13. Gene expression plasticity in response to salinity acclimation in threespine stickleback ecotypes from different salinity habitats.

    PubMed

    Gibbons, Taylor C; Metzger, David C H; Healy, Timothy M; Schulte, Patricia M

    2017-05-01

    Phenotypic plasticity is thought to facilitate the colonization of novel environments and shape the direction of evolution in colonizing populations. However, the relative prevalence of various predicted patterns of changes in phenotypic plasticity following colonization remains unclear. Here, we use a whole-transcriptome approach to characterize patterns of gene expression plasticity in the gills of a freshwater-adapted and a saltwater-adapted ecotype of threespine stickleback (Gasterosteus aculeatus) exposed to a range of salinities. The response of the gill transcriptome to environmental salinity had a large shared component common to both ecotypes (2159 genes) with significant enrichment of genes involved in transmembrane ion transport and the restructuring of the gill epithelium. This transcriptional response to freshwater acclimation is induced at salinities below two parts per thousand. There was also differentiation in gene expression patterns between ecotypes (2515 genes), particularly in processes important for changes in the gill structure and permeability. Only 508 genes that differed between ecotypes also responded to salinity and no specific processes were enriched among this gene set, and an even smaller number (87 genes) showed evidence of changes in the extent of the response to salinity acclimation between ecotypes. No pattern of relative expression dominated among these genes, suggesting that neither gains nor losses of plasticity dominated the changes in expression patterns between the ecotypes. These data demonstrate that multiple patterns of changes in gene expression plasticity can occur following colonization of novel habitats. © 2017 John Wiley & Sons Ltd.

  14. Whole blood gene expression in adolescent chronic fatigue syndrome: an exploratory cross-sectional study suggesting altered B cell differentiation and survival.

    PubMed

    Nguyen, Chinh Bkrong; Alsøe, Lene; Lindvall, Jessica M; Sulheim, Dag; Fagermoen, Even; Winger, Anette; Kaarbø, Mari; Nilsen, Hilde; Wyller, Vegard Bruun

    2017-05-11

    Chronic fatigue syndrome (CFS) is a prevalent and disabling condition affecting adolescents. The pathophysiology is poorly understood, but immune alterations might be an important component. This study compared whole blood gene expression in adolescent CFS patients and healthy controls, and explored associations between gene expression and neuroendocrine markers, immune markers and clinical markers within the CFS group. CFS patients (12-18 years old) were recruited nation-wide to a single referral center as part of the NorCAPITAL project. A broad case definition of CFS was applied, requiring 3 months of unexplained, disabling chronic/relapsing fatigue of new onset, whereas no accompanying symptoms were necessary. Healthy controls having comparable distribution of gender and age were recruited from local schools. Whole blood samples were subjected to RNA sequencing. Immune markers were blood leukocyte counts, plasma cytokines, serum C-reactive protein and immunoglobulins. Neuroendocrine markers encompassed plasma and urine levels of catecholamines and cortisol, as well as heart rate variability indices. Clinical markers consisted of questionnaire scores for symptoms of post-exertional malaise, inflammation, fatigue, depression and trait anxiety, as well as activity recordings. A total of 29 CFS patients and 18 healthy controls were included. We identified 176 genes as differentially expressed in patients compared to controls, adjusting for age and gender factors. Gene set enrichment analyses suggested impairment of B cell differentiation and survival, as well as enhancement of innate antiviral responses and inflammation in the CFS group. A pattern of co-expression could be identified, and this pattern, as well as single gene transcripts, was significantly associated with indices of autonomic nervous activity, plasma cortisol, and blood monocyte and eosinophil counts. Also, an association with symptoms of post-exertional malaise was demonstrated. Adolescent CFS is characterized by differential gene expression pattern in whole blood suggestive of impaired B cell differentiation and survival, and enhanced innate antiviral responses and inflammation. This expression pattern is associated with neuroendocrine markers of altered HPA axis and autonomic nervous activity, and with symptoms of post-exertional malaise. Trial registration Clinical Trials NCT01040429.

  15. Differential expression and activation of Rab27A in human eosinophils: relationship to blood eosinophilia.

    PubMed

    Coughlin, Jason J; Odemuyiwa, Solomon O; Davidson, Courtney E; Moqbel, Redwan

    2008-08-29

    Eosinophil degranulation is thought to play a pathophysiological role in asthma. Rab27A is a GTP-binding protein that is known to be essential for the degranulation of several leukocyte subsets and thus may be essential for eosinophil granule exocytosis. Here, we show that Rab27A mRNA and protein are expressed in human eosinophils. We have developed a novel assay to assess Rab27A activation and have found a similar activation pattern of this protein upon stimulation of eosinophils, neutrophils and NK cells suggesting a similar function in these cell types. Interestingly, Rab27A expression was elevated in eosinophils from asthmatic donors. Furthermore, eosinophils from eosinophilic donors displayed more rapid Rab27A activation kinetics than those from donors with lower eosinophil counts. Given that elevated blood eosinophil numbers correlate with increased priming of eosinophils, this pattern of Rab27A activation suggests differential protein expression in activated cells may allow eosinophils to degranulate more rapidly upon stimulation.

  16. Tools for neuroanatomy and neurogenetics in Drosophila

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pfeiffer, Barret D.; Jenett, Arnim; Hammonds, Ann S.

    2008-08-11

    We demonstrate the feasibility of generating thousands of transgenic Drosophila melanogaster lines in which the expression of an exogenous gene is reproducibly directed to distinct small subsets of cells in the adult brain. We expect the expression patterns produced by the collection of 5,000 lines that we are currently generating to encompass all neurons in the brain in a variety of intersecting patterns. Overlapping 3-kb DNA fragments from the flanking noncoding and intronic regions of genes thought to have patterned expression in the adult brain were inserted into a defined genomic location by site-specific recombination. These fragments were then assayedmore » for their ability to function as transcriptional enhancers in conjunction with a synthetic core promoter designed to work with a wide variety of enhancer types. An analysis of 44 fragments from four genes found that >80% drive expression patterns in the brain; the observed patterns were, on average, comprised of <100 cells. Our results suggest that the D. melanogaster genome contains >50,000 enhancers and that multiple enhancers drive distinct subsets of expression of a gene in each tissue and developmental stage. We expect that these lines will be valuable tools for neuroanatomy as well as for the elucidation of neuronal circuits and information flow in the fly brain.« less

  17. Characterization of the molecular features and expression patterns of two serine proteases in Hermetia illucens (Diptera: Stratiomyidae) larvae.

    PubMed

    Kim, Wontae; Bae, Sungwoo; Kim, Ayoung; Park, Kwanho; Lee, Sangbeom; Choi, Youngcheol; Han, Sangmi; Park, Younghan; Koh, Youngho

    2011-06-01

    To investigate the molecular scavenging capabilities of the larvae of Hermetia illucens, two serine proteases (SPs) were cloned and characterized. Multiple sequence alignments and phylogenetic tree analysis of the deduced amino acid sequences of Hi-SP1 and Hi-SP2 were suggested that Hi-SP1 may be a chymotrypsin- and Hi-SP2 may be a trypsin-like protease. Hi-SP1 and Hi-SP2 3-D homology models revealed that a catalytic triad, three disulfide bonds, and a substrate-binding pocket were highly conserved, as would be expected of a SP. E. coli expressed Hi-SP1 and Hi-SP2 showed chymotrypsin or trypsin activities, respectively. Hi-SP2 mRNAs were consistently expressed during larval development. In contrast, the expression of Hi-SP1 mRNA fluctuated between feeding and molting stages and disappeared at the pupal stages. These expression pattern differences suggest that Hi-SP1 may be a larval specific chymotrypsin-like protease involved with food digestion, while Hi-SP2 may be a trypsin-like protease with diverse functions at different stages.

  18. Too much data, but little inter-changeability: a lesson learned from mining public data on tissue specificity of gene expression.

    PubMed

    Li, Shuyu; Li, Yiqun Helen; Wei, Tao; Su, Eric Wen; Duffin, Kevin; Liao, Birong

    2006-10-25

    The tissue expression pattern of a gene often provides an important clue to its potential role in a biological process. A vast amount of gene expression data have been and are being accumulated in public repository through different technology platforms. However, exploitations of these rich data sources remain limited in part due to issues of technology standardization. Our objective is to test the data comparability between SAGE and microarray technologies, through examining the expression pattern of genes under normal physiological states across variety of tissues. There are 42-54% of genes showing significant correlations in tissue expression patterns between SAGE and GeneChip, with 30-40% of genes whose expression patterns are positively correlated and 10-15% of genes whose expression patterns are negatively correlated at a statistically significant level (p = 0.05). Our analysis suggests that the discrepancy on the expression patterns derived from technology platforms is not likely from the heterogeneity of tissues used in these technologies, or other spurious correlations resulting from microarray probe design, abundance of genes, or gene function. The discrepancy can be partially explained by errors in the original assignment of SAGE tags to genes due to the evolution of sequence databases. In addition, sequence analysis has indicated that many SAGE tags and Affymetrix array probe sets are mapped to different splice variants or different sequence regions although they represent the same gene, which also contributes to the observed discrepancies between SAGE and array expression data. To our knowledge, this is the first report attempting to mine gene expression patterns across tissues using public data from different technology platforms. Unlike previous similar studies that only demonstrated the discrepancies between the two gene expression platforms, we carried out in-depth analysis to further investigate the cause for such discrepancies. Our study shows that the exploitation of rich public expression resource requires extensive knowledge about the technologies, and experiment. Informatic methodologies for better interoperability among platforms still remain a gap. One of the areas that can be improved practically is the accurate sequence mapping of SAGE tags and array probes to full-length genes.

  19. The segment polarity network is a robust developmental module

    NASA Astrophysics Data System (ADS)

    von Dassow, George; Meir, Eli; Munro, Edwin M.; Odell, Garrett M.

    2000-07-01

    All insects possess homologous segments, but segment specification differs radically among insect orders. In Drosophila, maternal morphogens control the patterned activation of gap genes, which encode transcriptional regulators that shape the patterned expression of pair-rule genes. This patterning cascade takes place before cellularization. Pair-rule gene products subsequently `imprint' segment polarity genes with reiterated patterns, thus defining the primordial segments. This mechanism must be greatly modified in insect groups in which many segments emerge only after cellularization. In beetles and parasitic wasps, for instance, pair-rule homologues are expressed in patterns consistent with roles during segmentation, but these patterns emerge within cellular fields. In contrast, although in locusts pair-rule homologues may not control segmentation, some segment polarity genes and their interactions are conserved. Perhaps segmentation is modular, with each module autonomously expressing a characteristic intrinsic behaviour in response to transient stimuli. If so, evolution could rearrange inputs to modules without changing their intrinsic behaviours. Here we suggest, using computer simulations, that the Drosophila segment polarity genes constitute such a module, and that this module is resistant to variations in the kinetic constants that govern its behaviour.

  20. Digital gene expression analysis of the zebra finch genome

    PubMed Central

    2010-01-01

    Background In order to understand patterns of adaptation and molecular evolution it is important to quantify both variation in gene expression and nucleotide sequence divergence. Gene expression profiling in non-model organisms has recently been facilitated by the advent of massively parallel sequencing technology. Here we investigate tissue specific gene expression patterns in the zebra finch (Taeniopygia guttata) with special emphasis on the genes of the major histocompatibility complex (MHC). Results Almost 2 million 454-sequencing reads from cDNA of six different tissues were assembled and analysed. A total of 11,793 zebra finch transcripts were represented in this EST data, indicating a transcriptome coverage of about 65%. There was a positive correlation between the tissue specificity of gene expression and non-synonymous to synonymous nucleotide substitution ratio of genes, suggesting that genes with a specialised function are evolving at a higher rate (or with less constraint) than genes with a more general function. In line with this, there was also a negative correlation between overall expression levels and expression specificity of contigs. We found evidence for expression of 10 different genes related to the MHC. MHC genes showed relatively tissue specific expression levels and were in general primarily expressed in spleen. Several MHC genes, including MHC class I also showed expression in brain. Furthermore, for all genes with highest levels of expression in spleen there was an overrepresentation of several gene ontology terms related to immune function. Conclusions Our study highlights the usefulness of next-generation sequence data for quantifying gene expression in the genome as a whole as well as in specific candidate genes. Overall, the data show predicted patterns of gene expression profiles and molecular evolution in the zebra finch genome. Expression of MHC genes in particular, corresponds well with expression patterns in other vertebrates. PMID:20359325

  1. Major recent and independent changes in levels and patterns of expression have occurred at the b gene, a regulatory locus in maize.

    PubMed

    Selinger, D A; Chandler, V L

    1999-12-21

    The b locus encodes a transcription factor that regulates the expression of genes that produce purple anthocyanin pigment. Different b alleles are expressed in distinct tissues, causing tissue-specific anthocyanin production. Understanding how phenotypic diversity is produced and maintained at the b locus should provide models for how other regulatory genes, including those that influence morphological traits and development, evolve. We have investigated how different levels and patterns of pigmentation have evolved by determining the phenotypic and evolutionary relationships between 18 alleles that represent the diversity of b alleles in Zea mays. Although most of these alleles have few phenotypic differences, five alleles have very distinct tissue-specific patterns of pigmentation. Superimposing the phenotypes on the molecular phylogeny reveals that the alleles with strong and distinctive patterns of expression are closely related to alleles with weak expression, implying that the distinctive patterns have arisen recently. We have identified apparent insertions in three of the five phenotypically distinct alleles, and the fourth has unique upstream restriction fragment length polymorphisms relative to closely related alleles. The insertion in B-Peru has been shown to be responsible for its unique expression and, in the other two alleles, the presence of the insertion correlates with the phenotype. These results suggest that major changes in gene expression are probably the result of large-scale changes in DNA sequence and/or structure most likely mediated by transposable elements.

  2. Transcriptomic information from Pacific white shrimp (Litopenaeus vannamei) ovary and eyestalk, and expression patterns for genes putatively involved in the reproductive process.

    PubMed

    Ventura-López, Claudia; Galindo-Torres, Pavel E; Arcos, Fabiola G; Galindo-Sánchez, Clara; Racotta, Ilie S; Escobedo-Fregoso, Cristina; Llera-Herrera, Raúl; Ibarra, Ana M

    2017-05-15

    The increased use of massive sequencing technologies has enabled the identification of several genes known to be involved in different mechanisms associated with reproduction that so far have only been studied in vertebrates and other model invertebrate species. In order to further investigate the genes involved in Litopenaeus vannamei reproduction, cDNA and SSH libraries derived from female eyestalk and gonad were produced, allowing the identification of expressed sequences tags (ESTs) that potentially have a role in the regulation of gonadal maturation. In the present study, different transcripts involved in reproduction were identified and a number of them were characterized as full-length. These transcripts were evaluated in males and females in order to establish their tissue expression profiles during developmental stages (juvenile, subadult and adult), and in the case of females, their possible association with gonad maturation was assessed through expression analysis of vitellogenin. The results indicated that the expression of vitellogenin receptor (vtgr) and minichromosome maintenance (mcm) family members in the female gonad suggest an important role during previtellogenesis. Additionally, the expression profiles of genes such as famet, igfbp and gpcr in brain tissues suggest an interaction between the insulin/insulin-like growth factor signaling pathway (IIS) and methyl farnesoate (MF) biosynthesis for control of reproduction. Furthermore, the specific expression pattern of farnesoic acid O-methyltransferase suggests that final synthesis of MF is carried out in different target tissues, where it is regulated by esterase enzymes under a tissue-specific hormonal control. Finally, the presence of a vertebrate type steroid receptor in hepatopancreas and intestine besides being highly expressed in female gonads, suggest a role of that receptor during sexual maturation. Copyright © 2016 Elsevier Inc. All rights reserved.

  3. Differential expression of chemosensory-protein genes in midguts in response to diet of Spodoptera litura.

    PubMed

    Yi, Xin; Qi, Jiangwei; Zhou, Xiaofan; Hu, Mei Ying; Zhong, Guo Hua

    2017-03-22

    While it has been well characterized that chemosensory receptors in guts of mammals have great influence on food preference, much remains elusive in insects. Insect chemosensory proteins (CSPs) are soluble proteins that could deliver chemicals to olfactory and gustatory receptors. Recent studies have identified a number of CSPs expressed in midgut in Lepidoptera insects, which started to reveal their roles in chemical recognition and stimulating appetite in midgut. In this study, we examined expression patterns in midgut of 21 Spodoptera litura CSPs (SlitCSPs) characterized from a previously reported transcriptome, and three CSPs were identified to be expressed highly in midgut. The orthologous relationships between midgut expressed CSPs in S. litura and those in Bombyx mori and Plutella xylostella also suggest a conserved pattern of CSP expression in midgut. We further demonstrated that the expression of midgut-CSPs may change in response to different host plants, and SlitCSPs could bind typical chemicals from host plant in vitro. Overall, our results suggested midgut expressed SlitCSPs may have functional roles, likely contributing to specialization and adaption to different ecosystems. Better knowledge of this critical component of the chemsensation signaling pathways in midguts may improve our understanding of food preference processes in a new perspective.

  4. Increased complexity of circRNA expression during species evolution.

    PubMed

    Dong, Rui; Ma, Xu-Kai; Chen, Ling-Ling; Yang, Li

    2017-08-03

    Circular RNAs (circRNAs) are broadly identified from precursor mRNA (pre-mRNA) back-splicing across various species. Recent studies have suggested a cell-/tissue- specific manner of circRNA expression. However, the distinct expression pattern of circRNAs among species and its underlying mechanism still remain to be explored. Here, we systematically compared circRNA expression from human and mouse, and found that only a small portion of human circRNAs could be determined in parallel mouse samples. The conserved circRNA expression between human and mouse is correlated with the existence of orientation-opposite complementary sequences in introns that flank back-spliced exons in both species, but not the circRNA sequences themselves. Quantification of RNA pairing capacity of orientation-opposite complementary sequences across circRNA-flanking introns by Complementary Sequence Index (CSI) identifies that among all types of complementary sequences, SINEs, especially Alu elements in human, contribute the most for circRNA formation and that their diverse distribution across species leads to the increased complexity of circRNA expression during species evolution. Together, our integrated and comparative reference catalog of circRNAs in different species reveals a species-specific pattern of circRNA expression and suggests a previously under-appreciated impact of fast-evolved SINEs on the regulation of (circRNA) gene expression.

  5. Effect of various classes of pesticides on expression of stress genes in transgenic C. elegans model of Parkinson's disease.

    PubMed

    Jadiya, Pooja; Mir, Snober S; Nazir, Aamir

    2012-12-01

    Neurodegenerative diseases are known to be associated with genetic and environmental factors. The multifactorial Parkinson's disease (PD) is triggered and/or further worsened by exposure to certain pesticides. Existing literature suggests a link between pesticide exposure and increased incidence of PD. We carried out the present study to look into the stress gene expression pattern of transgenic Caenorhabditis elegans (C. elegans) model of PD after exposure to pesticides from different classes. Expression level of sod-1, sod-2, sod-3, hsp-70, hsp-60, and hsp-16.2 stress responsive genes was determined using qPCR. Our findings demonstrate that the expression of stress related genes does not follow a generalized pattern to different toxicants; rather each pesticide class has a specific expression signature.

  6. G-protein coupled receptor expression patterns delineate medulloblastoma subgroups

    PubMed Central

    2013-01-01

    Background Medulloblastoma is the most common malignant brain tumor in children. Genetic profiling has identified four principle tumor subgroups; each subgroup is characterized by different initiating mutations, genetic and clinical profiles, and prognoses. The two most well-defined subgroups are caused by overactive signaling in the WNT and SHH mitogenic pathways; less is understood about Groups 3 and 4 medulloblastoma. Identification of tumor subgroup using molecular classification is set to become an important component of medulloblastoma diagnosis and staging, and will likely guide therapeutic options. However, thus far, few druggable targets have emerged. G-protein coupled receptors (GPCRs) possess characteristics that make them ideal targets for molecular imaging and therapeutics; drugs targeting GPCRs account for 30-40% of all current pharmaceuticals. While expression patterns of many proteins in human medulloblastoma subgroups have been discerned, the expression pattern of GPCRs in medulloblastoma has not been investigated. We hypothesized that analysis of GPCR expression would identify clear subsets of medulloblastoma and suggest distinct GPCRs that might serve as molecular targets for both imaging and therapy. Results Our study found that medulloblastoma tumors fall into distinct clusters based solely on GPCR expression patterns. Normal cerebellum clustered separately from the tumor samples. Further, two of the tumor clusters correspond with high fidelity to the WNT and SHH subgroups of medulloblastoma. Distinct over-expressed GPCRs emerge; for example, LGR5 and GPR64 are significantly and uniquely over-expressed in the WNT subgroup of tumors, while PTGER4 is over-expressed in the SHH subgroup. Uniquely under-expressed GPCRs were also observed. Our key findings were independently validated using a large international dataset. Conclusions Our results identify GPCRs with potential to act as imaging and therapeutic targets. Elucidating tumorigenic pathways is a secondary benefit to identifying differential GPCR expression patterns in medulloblastoma tumors. PMID:24252460

  7. The spatial expression and regulation of transcription factors IDEF1 and IDEF2

    PubMed Central

    Kobayashi, Takanori; Ogo, Yuko; Aung, May Sann; Nozoye, Tomoko; Itai, Reiko Nakanishi; Nakanishi, Hiromi; Yamakawa, Takashi; Nishizawa, Naoko K.

    2010-01-01

    Background and Aims Under conditions of low iron availability, rice plants induce genes involved in iron uptake and utilization. The iron deficiency-responsive cis-acting element binding factors 1 and 2 (IDEF1 and IDEF2) regulate transcriptional response to iron deficiency in rice roots. Clarification of the functions of IDEF1 and IDEF2 could uncover the gene regulation mechanism. Methods Spatial patterns of IDEF1 and IDEF2 expression were analysed by histochemical staining of IDEF1 and IDEF2 promoter-GUS transgenic rice lines. Expression patterns of the target genes of IDEF1 and IDEF2 were analysed using transformants with induced or repressed expression of IDEF1 or IDEF2 grown in iron-rich or in iron-deficient solutions for 1 d. Key Results IDEF1 and IDEF2 were highly expressed in the basal parts of the lateral roots and vascular bundles. IDEF1 and IDEF2 expression was dominant in leaf mesophyll and vascular cells, respectively. These expression patterns were similar under both iron-deficient and iron-sufficient conditions. IDEF1 was strongly expressed in pollen, ovaries, the aleurone layer and embryo. IDEF2 was expressed in pollen, ovaries and the dorsal vascular region of the endosperm. During seed germination, IDEF1 and IDEF2 were expressed in the endosperm and embryo. Expression of IDEF1 target genes was regulated in iron-rich roots similar to early iron-deficiency stages. In addition, the expression patterns of IDEF2 target genes were similar between iron-rich conditions and early or subsequent iron deficiency. Conclusions IDEF1 and IDEF2 are constitutively expressed during both vegetative and reproductive stages. The spatial expression patterns of IDEF1 and IDEF2 overlap with their target genes in restricted cell types, but not in all cells. The spatial expression patterns and gene regulation of IDEF1 and IDEF2 in roots are generally conserved under conditions of iron sufficiency and deficiency, suggesting complicated interactions with unknown factors for sensing and transmitting iron-deficiency signals. PMID:20197292

  8. Activation patterns in superficial layers of neocortex change between experiences independent of behavior, environment, or the hippocampus.

    PubMed

    Takehara-Nishiuchi, Kaori; Insel, Nathan; Hoang, Lan T; Wagner, Zachary; Olson, Kathy; Chawla, Monica K; Burke, Sara N; Barnes, Carol A

    2013-09-01

    Previous work suggests that activation patterns of neurons in superficial layers of the neocortex are more sensitive to spatial context than activation patterns in deep cortical layers. A possible source of this laminar difference is the distribution of contextual information to the superficial cortical layers carried by hippocampal efferents that travel through the entorhinal cortex and subiculum. To evaluate the role that the hippocampus plays in determining context sensitivity in superficial cortical layers, behavior-induced expression of the immediate early gene Arc was examined in hippocampus-lesioned and control rats after exposing them to 2 distinct contexts. Contrary to expectations, hippocampal lesions had no observable effect on Arc expression in any neocortical layer relative to controls. Furthermore, another group of intact animals was exposed to the same environment twice, to determine the reliability of Arc-expression patterns across identical contextual and behavioral episodes. Although this condition included no difference in external input between 2 epochs, the significant layer differences in Arc expression still remained. Thus, laminar differences in activation or plasticity patterns are not likely to arise from hippocampal sources or differences in external inputs, but are more likely to be an intrinsic property of the neocortex.

  9. Characterization of TALE genes expression during the first lineage segregation in mammalian embryos.

    PubMed

    Sonnet, Wendy; Rezsöhazy, Rene; Donnay, Isabelle

    2012-11-01

    Three amino acid loop extension (TALE) homeodomain-containing transcription factors are generally recognized for their role in organogenesis and differentiation during embryogenesis. However, very little is known about the expression and function of Meis, Pbx, and Prep genes during early development. In order to determine whether TALE proteins could contribute to the early cell fate decisions in mammalian development, this study aimed to characterize in a systematic manner the pattern of expression of all Meis, Pbx, and Prep genes from the precompaction to blastocyst stage corresponding to the first step of cell differentiation in mammals. To reveal to what extent TALE genes expression at these early stages is a conserved feature among mammals, this study was performed in parallel in the bovine and mouse models. We demonstrated the transcription and translation of TALE genes, before gastrulation in the two species. At least one member of Meis, Pbx, and Prep subfamilies was found expressed at the RNA and protein levels but different patterns of expression were observed between genes and between species, suggesting specific gene regulations. Taken together, these results suggest a previously unexpected involvement of these factors during the early development in mammals. Copyright © 2012 Wiley Periodicals, Inc.

  10. Establishment of embryonic neuroepithelial cell lines exhibiting an epiplastic expression pattern of region specific markers.

    PubMed

    Nardelli, Jeannette; Catala, Martin; Charnay, Patrick

    2003-09-15

    Neuroepithelial b2T cells were derived from the hindbrain and the spinal cord of mouse transgenic embryos, which expressed SV40 T antigen under the control of a Hoxb2 enhancer. Strikingly, b2T cell lines of either origin exhibit a very similar gene expression pattern, including markers of the hindbrain and the spinal cord, such as Hox genes, but not of more anterior cephalic regions. In addition, the broad expression pattern of b2T cells, probably linked to culture conditions, appeared to be appropriately modulated when the cells were reimplanted at different longitudinal levels into chick host embryos, suggesting that these cells are responsive to exogenous signalling mechanisms. Further support for these allegations was obtained by culturing b2T cells in defined medium and by assessing the expression of Krox20, an odd-numbered rhombomere marker, which appeared to be modulated by a complex interplay between FGF, retinoic acid (RA), and noggin. With respect to these as yet unique properties, b2T cells constitute an original alternative tool to in vivo models for the analysis of molecular pathways involved in the patterning of the neural tube. Copyright 2003 Wiley-Liss, Inc.

  11. ramosa2 encodes a LATERAL ORGAN BOUNDARY domain protein that determines the fate of stem cells in branch meristems of maize.

    PubMed

    Bortiri, Esteban; Chuck, George; Vollbrecht, Erik; Rocheford, Torbert; Martienssen, Rob; Hake, Sarah

    2006-03-01

    Genetic control of grass inflorescence architecture is critical given that cereal seeds provide most of the world's food. Seeds are borne on axillary branches, which arise from groups of stem cells in axils of leaves and whose branching patterns dictate most of the variation in plant form. Normal maize (Zea mays) ears are unbranched, and tassels have long branches only at their base. The ramosa2 (ra2) mutant of maize has increased branching with short branches replaced by long, indeterminate ones. ra2 was cloned by chromosome walking and shown to encode a LATERAL ORGAN BOUNDARY domain transcription factor. ra2 is transiently expressed in a group of cells that predicts the position of axillary meristem formation in inflorescences. Expression in different mutant backgrounds places ra2 upstream of other genes that regulate branch formation. The early expression of ra2 suggests that it functions in the patterning of stem cells in axillary meristems. Alignment of ra2-like sequences reveals a grass-specific domain in the C terminus that is not found in Arabidopsis thaliana. The ra2-dm allele suggests this domain is required for transcriptional activation of ra1. The ra2 expression pattern is conserved in rice (Oryza sativa), barley (Hordeum vulgare), sorghum (Sorghum bicolor), and maize, suggesting that ra2 is critical for shaping the initial steps of grass inflorescence architecture.

  12. Molecular mechanisms of foliar water uptake in a desert tree

    PubMed Central

    Yan, Xia; Zhou, Maoxian; Dong, Xicun; Zou, Songbing; Xiao, Honglang; Ma, Xiao-Fei

    2015-01-01

    Water deficits severely affect growth, particularly for the plants in arid and semiarid regions of the world. In addition to precipitation, other subsidiary water, such as dew, fog, clouds and small rain showers, may also be absorbed by leaves in a process known as foliar water uptake. With the severe scarcity of water in desert regions, this process is increasingly becoming a necessity. Studies have reported on physical and physiological processes of foliar water uptake. However, the molecular mechanisms remain less understood. As major channels for water regulation and transport, aquaporins (AQPs) are involved in this process. However, due to the regulatory complexity and functional diversity of AQPs, their molecular mechanism for foliar water uptake remains unclear. In this study, Tamarix ramosissima, a tree species widely distributed in desert regions, was investigated for gene expression patterns of AQPs and for sap flow velocity. Our results suggest that the foliar water uptake of T. ramosissima occurs in natural fields at night when the humidity is over a threshold of 85 %. The diurnal gene expression pattern of AQPs suggests that most AQP gene expressions display a circadian rhythm, and this could affect both photosynthesis and transpiration. At night, the PIP2-1 gene is also upregulated with increased relative air humidity. This gene expression pattern may allow desert plants to regulate foliar water uptake to adapt to extreme drought. This study suggests a molecular basis of foliar water uptake in desert plants. PMID:26567212

  13. Molecular mechanisms of foliar water uptake in a desert tree.

    PubMed

    Yan, Xia; Zhou, Maoxian; Dong, Xicun; Zou, Songbing; Xiao, Honglang; Ma, Xiao-Fei

    2015-11-12

    Water deficits severely affect growth, particularly for the plants in arid and semiarid regions of the world. In addition to precipitation, other subsidiary water, such as dew, fog, clouds and small rain showers, may also be absorbed by leaves in a process known as foliar water uptake. With the severe scarcity of water in desert regions, this process is increasingly becoming a necessity. Studies have reported on physical and physiological processes of foliar water uptake. However, the molecular mechanisms remain less understood. As major channels for water regulation and transport, aquaporins (AQPs) are involved in this process. However, due to the regulatory complexity and functional diversity of AQPs, their molecular mechanism for foliar water uptake remains unclear. In this study, Tamarix ramosissima, a tree species widely distributed in desert regions, was investigated for gene expression patterns of AQPs and for sap flow velocity. Our results suggest that the foliar water uptake of T. ramosissima occurs in natural fields at night when the humidity is over a threshold of 85 %. The diurnal gene expression pattern of AQPs suggests that most AQP gene expressions display a circadian rhythm, and this could affect both photosynthesis and transpiration. At night, the PIP2-1 gene is also upregulated with increased relative air humidity. This gene expression pattern may allow desert plants to regulate foliar water uptake to adapt to extreme drought. This study suggests a molecular basis of foliar water uptake in desert plants. Published by Oxford University Press on behalf of the Annals of Botany Company.

  14. Expression patterns of WRKY genes in di-haploid Populus simonii × P. nigra in response to salinity stress revealed by quantitative real-time PCR and RNA sequencing.

    PubMed

    Wang, Shengji; Wang, Jiying; Yao, Wenjing; Zhou, Boru; Li, Renhua; Jiang, Tingbo

    2014-10-01

    Spatio-temporal expression patterns of 13 out of 119 poplar WRKY genes indicated dynamic and tissue-specific roles of WRKY family proteins in salinity stress tolerance. To understand the expression patterns of poplar WRKY genes under salinity stress, 51 of the 119 WRKY genes were selected from di-haploid Populus simonii × P. nigra by quantitative real-time PCR (qRT-PCR). We used qRT-PCR to profile the expression of the top 13 genes under salinity stress across seven time points, and employed RNA-Seq platforms to cross-validate it. Results demonstrated that all the 13 WRKY genes were expressed in root, stem, and leaf tissues, but their expression levels and overall patterns varied notably in these tissues. Regarding overall gene expression in roots, the 13 genes were significantly highly expressed at all six time points after the treatment, reaching the plateau of expression at hour 9. In leaves, the 13 genes were similarly up-regulated from 3 to 12 h in response to NaCl treatment. In stems, however, expression levels of the 13 genes did not show significant changes after the NaCl treatment. Regarding individual gene expression across the time points and the three tissues, the 13 genes can be classified into three clusters: the lowly expressed Cluster 1 containing PthWRKY28, 45 and 105; intermediately expressed Clusters 2 including PthWRKY56, 88 and 116; and highly expressed Cluster 3 consisting of PthWRKY41, 44, 51, 61, 62, 75 and 106. In general, genes in Cluster 2 and 3 displayed a dynamic pattern of "induced amplification-recovering", suggesting that these WRKY genes and corresponding pathways may play a critical role in mediating salt response and tolerance in a dynamic and tissue-specific manner.

  15. Molecular characterization and expression analysis of Triticum aestivum squamosa-promoter binding protein-box genes involved in ear development.

    PubMed

    Zhang, Bin; Liu, Xia; Zhao, Guangyao; Mao, Xinguo; Li, Ang; Jing, Ruilian

    2014-06-01

    Wheat (Triticum aestivum L.) is one of the most important crops in the world. Squamosa-promoter binding protein (SBP)-box genes play a critical role in regulating flower and fruit development. In this study, 10 novel SBP-box genes (TaSPL genes) were isolated from wheat ((Triticum aestivum L.) cultivar Yanzhan 4110). Phylogenetic analysis classified the TaSPL genes into five groups (G1-G5). The motif combinations and expression patterns of the TaSPL genes varied among the five groups with each having own distinctive characteristics: TaSPL20/21 in G1 and TaSPL17 in G2 mainly expressed in the shoot apical meristem and the young ear, and their expression levels responded to development of the ear; TaSPL6/15 belonging to G3 were upregulated and TaSPL1/23 in G4 were downregulated during grain development; the gene in G5 (TaSPL3) expressed constitutively. Thus, the consistency of the phylogenetic analysis, motif compositions, and expression patterns of the TaSPL genes revealed specific gene structures and functions. On the other hand, the diverse gene structures and different expression patterns suggested that wheat SBP-box genes have a wide range of functions. The results also suggest a potential role for wheat SBP-box genes in ear development. This study provides a significant beginning of functional analysis of SBP-box genes in wheat. © 2014 The Authors. Journal of Integrative Plant Biology Published by Wiley Publishing Asia Pty Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.

  16. Ectopic expression of hoxb2 after retinoic acid treatment or mRNA injection: disruption of hindbrain and craniofacial morphogenesis in zebrafish embryos.

    PubMed

    Yan, Y L; Jowett, T; Postlethwait, J H

    1998-12-01

    To investigate pattern formation in the vertebrate hindbrain, we isolated a full length hoxb2 cDNA clone from zebrafish. In a gene phylogeny, zebrafish hoxb2 clusters with human HOXB2, and it maps on linkage group 3 along with several other loci whose orthologues are syntenic with human HOXB2. In the hindbrain, hoxb2 is expressed at high levels in rhombomere 3 (r3), lower levels in r4, still lower in r5, and at undetectable levels in r6. In r7, r8, and the rostral spinal cord, hoxb2 is expressed at a lower level than in r5. Lateral cells appearing to emanate from r4 express both hoxb2 and dlx2, suggesting that they are neural crest. Overexpression of hoxb2 by mRNA injections into early cleavage stage embryos resulted in abnormal morphogenesis of the midbrain and rostral hindbrain, abnormal patterning in r4, fusion of cartilage elements arising from pharyngeal arches 1 and 2, and ectopic expression of krx20 and valentino (but not pax2, rtk1, or hoxb1) in the rostral hindbrain, midbrain, and, surprisingly, the eye. Treatments with retinoic acid produced a phenotype similar to that of ectopic hoxb2 expression, including ectopic krx20 (but not valentino) expression in the eye, and fusion of cartilages from pharyngeal arches 1 and 2. The results suggest that hoxb2 plays an important role in the patterning of hindbrain and pharyngeal arches in the zebrafish.

  17. Conserved developmental expression of Fezf in chordates and Drosophila and the origin of the Zona Limitans Intrathalamica (ZLI) brain organizer

    PubMed Central

    2010-01-01

    Background The zona limitans intrathalamica (ZLI) and the isthmus organizer (IsO) are two major secondary organizers of vertebrate brain development. These organizers are located at the interface of the expression domains of key patterning genes (Fezf-Irx and Otx-Gbx, respectively). To gain insights into the evolutionary origin of the ZLI, we studied Fezf in bilaterians. Results In this paper, we identified a conserved sequence motif (Fezf box) in all bilaterians. We report the expression pattern of Fezf in amphioxus and Drosophila and compare it with those of Gbx, Otx and Irx. We found that the relative expression patterns of these genes in vertebrates are fully conserved in amphioxus and flies, indicating that the genetic subdivisions defining the location of both secondary organizers in early vertebrate brain development were probably present in the last common ancestor of extant bilaterians. However, in contrast to vertebrates, we found that Irx-defective flies do not show an affected Fezf expression pattern. Conclusions The absence of expression of the corresponding morphogens from cells at these conserved genetic boundaries in invertebrates suggests that the organizing properties might have evolved specifically in the vertebrate lineage by the recruitment of key morphogens to these conserved genetic locations. PMID:20849572

  18. Comparative analysis of cadherin expression and connectivity patterns in the cerebellar system of ferret and mouse.

    PubMed

    Neudert, Franziska; Nuernberger, Krishna-K Monique; Redies, Christoph

    2008-12-20

    The cerebellum shows remarkable variations in the relative size of its divisions among vertebrate species. In the present study, we compare the cerebella of two mammals (ferret and mouse) by mapping the expression of three cadherins (cadherin-8, protocadherin-7, and protocadherin-10) at similar postnatal stages. The three cadherins are expressed differentially in parasagittal stripes in the cerebellar cortex, in the portions of the deep cerebellar nuclei, in the divisions of the inferior olivary nucleus, and in the lateral vestibular nucleus. The expression profiles suggest that the cadherin-positive structures are interconnected. The expression patterns resemble each other in ferret and mouse, although some differences can be observed. The general resemblance indicates that cerebellar organization is based on a common set of embryonic divisions in the two species. Consequently, the large differences in cerebellar morphology between the two species are more likely caused by differential growth of these embryonic divisions than by differences in early embryonic patterning. Based on the cadherin expression patterns, a model of corticonuclear projection territories in ferret and mouse is proposed. In summary, our results indicate that the cerebellar systems of rodents and carnivores display a relatively large degree of similarity in their molecular and functional organization.

  19. Cell type-specific expression of FoxP2 in the ferret and mouse retina.

    PubMed

    Sato, Chihiro; Iwai-Takekoshi, Lena; Ichikawa, Yoshie; Kawasaki, Hiroshi

    2017-04-01

    Although the anatomical and physiological properties of subtypes of retinal ganglion cells (RGCs) have been extensively investigated, their molecular properties are still unclear. Here, we examined the expression patterns of FoxP2 in the retina of ferrets and mice. We found that FoxP2 was expressed in small subsets of neurons in the adult ferret retina. FoxP2-positive neurons in the ganglion cell layer were divided into two groups. Large FoxP2-positive neurons expressed Brn3a and were retrogradely labeled with cholera toxin subunit B injected into the optic nerve, indicating that they are RGCs. The soma size and the projection pattern of FoxP2-positive RGCs were consistent with those of X cells. Because we previously reported that FoxP2 was selectively expressed in X cells in the ferret lateral geniculate nucleus (LGN), our findings indicate that FoxP2 is specifically expressed in the parvocellular pathway from the retina to the LGN. Small FoxP2-positive neurons were positive for GAD65/67, suggesting that they are GABAergic amacrine cells. Most Foxp2-positive cells were RGCs in the adult mouse retina. Dendritic morphological analyses suggested that Foxp2-positive RGCs included direction-selective RGCs in mice. Thus, our findings suggest that FoxP2 is expressed in specific subtypes of RGCs in the retina of ferrets and mice. Copyright © 2016 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.

  20. EMODIN EFFICACY ON THE AKT, MAPK, ERK AND DNMT EXPRESSION PATTERN DURING DMBA-INDUCED ORAL CARCINOMA IN GOLDEN SYRIAN HAMSTERS.

    PubMed

    Manimaran, Asokan; Manoharan, Shanmugam; Neelakandan, Mani

    2016-01-01

    The present study has evaluated the Emodin efficacy on the Akt, MAPK, ERK and DNMT expression pattern during 7,12-dimethylbenz[a]anthracene (DMBA)-induced oral carcinoma in golden Syrian hamsters, in order to explore its antitumor potential. Oral tumors were developed in the buccal pouches of golden Syrian hamsters using the carcinogen, DMBA. While the incidence of tumor formation was 100% in hamsters treated with DMBA alone, the tumor formation was not noticed in DMBA+ Emodin treated hamsters. Also, Emodin reduced the severity of precancerous pathological lesions such as dysplasia, in the hamsters treated with DMBA. Emodin administration corrected the abnormalities in the expression pattern of Akt, MAPK, ERK and DNMT in the buccal mucosa of hamsters treated with DMBA. The present study thus suggests that the tumor preventive potential of Emodin is partly related to its modulating effect on the Akt, MAPK, ERK and DNMT expression pattern, as these molecular markers have a pivotal role in the process of cell proliferation, inflammation, invasion, and apoptosis.

  1. Pervasive Effects of Aging on Gene Expression in Wild Wolves

    PubMed Central

    Charruau, Pauline; Johnston, Rachel A.; Stahler, Daniel R.; Lea, Amanda; Snyder-Mackler, Noah; Smith, Douglas W.; vonHoldt, Bridgett M.; Cole, Steven W.; Tung, Jenny; Wayne, Robert K.

    2016-01-01

    Abstract Gene expression levels change as an individual ages and responds to environmental conditions. With the exception of humans, such patterns have principally been studied under controlled conditions, overlooking the array of developmental and environmental influences that organisms encounter under conditions in which natural selection operates. We used high-throughput RNA sequencing (RNA-Seq) of whole blood to assess the relative impacts of social status, age, disease, and sex on gene expression levels in a natural population of gray wolves (Canis lupus). Our findings suggest that age is broadly associated with gene expression levels, whereas other examined factors have minimal effects on gene expression patterns. Further, our results reveal evolutionarily conserved signatures of senescence, such as immunosenescence and metabolic aging, between wolves and humans despite major differences in life history and environment. The effects of aging on gene expression levels in wolves exhibit conservation with humans, but the more rapid expression differences observed in aging wolves is evolutionarily appropriate given the species’ high level of extrinsic mortality due to intraspecific aggression. Some expression changes that occur with age can facilitate physical age-related changes that may enhance fitness in older wolves. However, the expression of these ancestral patterns of aging in descendant modern dogs living in highly modified domestic environments may be maladaptive and cause disease. This work provides evolutionary insight into aging patterns observed in domestic dogs and demonstrates the applicability of studying natural populations to investigate the mechanisms of aging. PMID:27189566

  2. Patterning of inflorescences and flowers by the F-Box protein DOUBLE TOP and the LEAFY homolog ABERRANT LEAF AND FLOWER of petunia.

    PubMed

    Souer, Erik; Rebocho, Alexandra B; Bliek, Mattijs; Kusters, Elske; de Bruin, Robert A M; Koes, Ronald

    2008-08-01

    Angiosperms display a wide variety of inflorescence architectures differing in the positions where flowers or branches arise. The expression of floral meristem identity (FMI) genes determines when and where flowers are formed. In Arabidopsis thaliana, this is regulated via transcription of LEAFY (LFY), which encodes a transcription factor that promotes FMI. We found that this is regulated in petunia (Petunia hybrida) via transcription of a distinct gene, DOUBLE TOP (DOT), a homolog of UNUSUAL FLORAL ORGANS (UFO) from Arabidopsis. Mutation of DOT or its tomato (Solanum lycopersicum) homolog ANANTHA abolishes FMI. Ubiquitous expression of DOT or UFO in petunia causes very early flowering and transforms the inflorescence into a solitary flower and leaves into petals. Ectopic expression of DOT or UFO together with LFY or its homolog ABERRANT LEAF AND FLOWER (ALF) in petunia seedlings activates genes required for identity or outgrowth of organ primordia. DOT interacts physically with ALF, suggesting that it activates ALF by a posttranslational mechanism. Our findings suggest a wider role than previously thought for DOT and UFO in the patterning of flowers and indicate that the different roles of LFY and UFO homologs in the spatiotemporal control of floral identity in distinct species result from their divergent expression patterns.

  3. A combinatorial code for pattern formation in Drosophila oogenesis.

    PubMed

    Yakoby, Nir; Bristow, Christopher A; Gong, Danielle; Schafer, Xenia; Lembong, Jessica; Zartman, Jeremiah J; Halfon, Marc S; Schüpbach, Trudi; Shvartsman, Stanislav Y

    2008-11-01

    Two-dimensional patterning of the follicular epithelium in Drosophila oogenesis is required for the formation of three-dimensional eggshell structures. Our analysis of a large number of published gene expression patterns in the follicle cells suggests that they follow a simple combinatorial code based on six spatial building blocks and the operations of union, difference, intersection, and addition. The building blocks are related to the distribution of inductive signals, provided by the highly conserved epidermal growth factor receptor and bone morphogenetic protein signaling pathways. We demonstrate the validity of the code by testing it against a set of patterns obtained in a large-scale transcriptional profiling experiment. Using the proposed code, we distinguish 36 distinct patterns for 81 genes expressed in the follicular epithelium and characterize their joint dynamics over four stages of oogenesis. The proposed combinatorial framework allows systematic analysis of the diversity and dynamics of two-dimensional transcriptional patterns and guides future studies of gene regulation.

  4. Modulation of haloperidol-induced patterns of the transcription factor Nur77 and Nor-1 expression by serotonergic and adrenergic drugs in the mouse brain

    PubMed Central

    Maheux, Jérôme; Vuillier, Laura; Mahfouz, Mylène; Rouillard, Claude; Lévesque, Daniel

    2015-01-01

    Different patterns of expression of the transcription factors of Nur77 and Nor-1 are induced following acute administration of typical and atypical antipsychotic drugs. The pharmacological profile of atypical antipsychotics suggests that serotonergic and/or adrenergic receptors might contribute to these reported differences. In order to test this possibility, we examined the abilities of serotonin 5-HT1A and 5-HT2A/2C, and α1- and α2-adrenergic receptor drugs to modify the pattern of Nur77 (NR4A1) and Nor-1 (NR4A3) mRNA expression induced by haloperidol. Various groups of mice were treated with either saline, DOI, a 5-HT2A/2C agonist, MDL11939, a 5-HT2A antagonist, 8-OH-DPAT, a 5-HT1A agonist, prazosin, an α1-adrenergic antagonist and idazoxan, an α2-adrenergic antagonist, alone or in combination with haloperidol. The 5-HT2A/2C agonist DOI alone significantly increased Nur77 expression in the medial striatum and nucleus accumbens. DOI reduced Nor-1 expression, while MDL11939 increased the expression of this transcript in the cortex. Prazosin reduced Nur77 expression in the dorsal striatum and nucleus accumbens. Interestingly, 8-OH-DPAT and MDL11939 partially prevented haloperidol-induced Nur77 up-regulation, while MDL11939 completely abolished Nor-1 expression in the striatum. In addition, MDL11939 decreased haloperidol-induced Nur77 and Nor-1 mRNA levels in the ventral tegmental area. On the contrary, idazoxan (α2 antagonist) consistently potentiated haloperidol-induced Nur77, but not Nor-1 mRNA levels in the striatum, whereas prazosin (α1 antagonist) remained without effect. Taken together, these results show the ability of a 5-HT1A agonist or a 5-HT2A antagonist to reduce haloperidol-induced Nur77 and Nor-1 striatal expression, suggesting that these serotonin receptor subtypes participate in the differential pattern of gene expression induced by typical and atypical antipsychotic drugs. PMID:21524335

  5. The Toll pathway is required in the epidermis for muscle development in the Drosophila embryo

    NASA Technical Reports Server (NTRS)

    Halfon, M. S.; Keshishian, H.

    1998-01-01

    The Toll signaling pathway functions in several Drosophila processes, including dorsal-ventral pattern formation and the immune response. Here, we demonstrate that this pathway is required in the epidermis for proper muscle development. Previously, we showed that the zygotic Toll protein is necessary for normal muscle development; in the absence of zygotic Toll, close to 50% of hemisegments have muscle patterning defects consisting of missing, duplicated and misinserted muscle fibers (Halfon, M.S., Hashimoto, C., and Keshishian, H., Dev. Biol. 169, 151-167, 1995). We have now also analyzed the requirements for easter, spatzle, tube, and pelle, all of which function in the Toll-mediated dorsal-ventral patterning pathway. We find that spatzle, tube, and pelle, but not easter, are necessary for muscle development. Mutations in these genes give a phenotype identical to that seen in Toll mutants, suggesting that elements of the same pathway used for Toll signaling in dorsal-ventral development are used during muscle development. By expressing the Toll cDNA under the control of distinct Toll enhancer elements in Toll mutant flies, we have examined the spatial requirements for Toll expression during muscle development. Expression of Toll in a subset of epidermal cells that includes the epidermal muscle attachment cells, but not Toll expression in the musculature, is necessary for proper muscle development. Our results suggest that signals received by the epidermis early during muscle development are an important part of the muscle patterning process.

  6. Intra- and interregional coregulation of opioid genes: broken symmetry in spinal circuits

    PubMed Central

    Kononenko, Olga; Galatenko, Vladimir; Andersson, Malin; Bazov, Igor; Watanabe, Hiroyuki; Zhou, Xing Wu; Iatsyshyna, Anna; Mityakina, Irina; Yakovleva, Tatiana; Sarkisyan, Daniil; Ponomarev, Igor; Krishtal, Oleg; Marklund, Niklas; Tonevitsky, Alex; Adkins, DeAnna L.; Bakalkin, Georgy

    2017-01-01

    Regulation of the formation and rewiring of neural circuits by neuropeptides may require coordinated production of these signaling molecules and their receptors that may be established at the transcriptional level. Here, we address this hypothesis by comparing absolute expression levels of opioid peptides with their receptors, the largest neuropeptide family, and by characterizing coexpression (transcriptionally coordinated) patterns of these genes. We demonstrated that expression patterns of opioid genes highly correlate within and across functionally and anatomically different areas. Opioid peptide genes, compared with their receptor genes, are transcribed at much greater absolute levels, which suggests formation of a neuropeptide cloud that covers the receptor-expressed circuits. Surprisingly, we found that both expression levels and the proportion of opioid receptors are strongly lateralized in the spinal cord, interregional coexpression patterns are side specific, and intraregional coexpression profiles are affected differently by left- and right-side unilateral body injury. We propose that opioid genes are regulated as interconnected components of the same molecular system distributed between distinct anatomic regions. The striking feature of this system is its asymmetric coexpression patterns, which suggest side-specific regulation of selective neural circuits by opioid neurohormones.—Kononenko, O., Galatenko, V., Andersson, M., Bazov, I., Watanabe, H., Zhou, X. W., Iatsyshyna, A., Mityakina, I., Yakovleva, T., Sarkisyan, D., Ponomarev, I., Krishtal, O., Marklund, N., Tonevitsky, A., Adkins, D. L., Bakalkin, G. Intra- and interregional coregulation of opioid genes: broken symmetry in spinal circuits. PMID:28122917

  7. Complementary striped expression patterns of NK homeobox genes during segment formation in the annelid Platynereis.

    PubMed

    Saudemont, Alexandra; Dray, Nicolas; Hudry, Bruno; Le Gouar, Martine; Vervoort, Michel; Balavoine, Guillaume

    2008-05-15

    NK genes are related pan-metazoan homeobox genes. In the fruitfly, NK genes are clustered and involved in patterning various mesodermal derivatives during embryogenesis. It was therefore suggested that the NK cluster emerged in evolution as an ancestral mesodermal patterning cluster. To test this hypothesis, we cloned and analysed the expression patterns of the homologues of NK cluster genes Msx, NK4, NK3, Lbx, Tlx, NK1 and NK5 in the marine annelid Platynereis dumerilii, a representative of trochozoans, the third great branch of bilaterian animals alongside deuterostomes and ecdysozoans. We found that most of these genes are involved, as they are in the fly, in the specification of distinct mesodermal derivatives, notably subsets of muscle precursors. The expression of the homologue of NK4/tinman in the pulsatile dorsal vessel of Platynereis strongly supports the hypothesis that the vertebrate heart derived from a dorsal vessel relocated to a ventral position by D/V axis inversion in a chordate ancestor. Additionally and more surprisingly, NK4, Lbx, Msx, Tlx and NK1 orthologues are expressed in complementary sets of stripes in the ectoderm and/or mesoderm of forming segments, suggesting an involvement in the segment formation process. A potentially ancient role of the NK cluster genes in segment formation, unsuspected from vertebrate and fruitfly studies so far, now deserves to be investigated in other bilaterian species, especially non-insect arthropods and onychophorans.

  8. Alcoholism and alternative splicing of candidate genes.

    PubMed

    Sasabe, Toshikazu; Ishiura, Shoichi

    2010-04-01

    Gene expression studies have shown that expression patterns of several genes have changed during the development of alcoholism. Gene expression is regulated not only at the level of transcription but also through alternative splicing of pre-mRNA. In this review, we discuss some of the evidence suggesting that alternative splicing of candidate genes such as DRD2 (encoding dopamine D2 receptor) may form the basis of the mechanisms underlying the pathophysiology of alcoholism. These reports suggest that aberrant expression of splice variants affects alcohol sensitivities, and alcohol consumption also regulates alternative splicing. Thus, investigations of alternative splicing are essential for understanding the molecular events underlying the development of alcoholism.

  9. Metameric pattern of intervertebral disc/vertebral body is generated independently of Mesp2/Ripply-mediated rostro-caudal patterning of somites in the mouse embryo.

    PubMed

    Takahashi, Yu; Yasuhiko, Yukuto; Takahashi, Jun; Takada, Shinji; Johnson, Randy L; Saga, Yumiko; Kanno, Jun

    2013-08-15

    The vertebrae are derived from the sclerotome of somites. Formation of the vertebral body involves a process called resegmentation, by which the caudal half of a sclerotome is combined with the rostral half of the next sclerotome. To elucidate the relationship between resegmentation and rostro-caudal patterning of somite, we used the Uncx4.1-LacZ transgene to characterize the resegmentation process. Our observations suggested that in the thoracic and lumbar vertebrae, the Uncx4.1-expressing caudal sclerotome gave rise to the intervertebral disc (IVD) and rostral portion of the vertebral body (VB). In the cervical vertebrae, the Uncx4.1-expressing caudal sclerotome appeared to contribute to the IVD and both caudal and rostral ends of the VB. This finding suggests that the rostro-caudal gene expression boundary does not necessarily coincide with the resegmentation boundary. This conclusion was supported by analyses of Mesp2 KO and Ripply1/2 double KO embryos lacking rostral and caudal properties, respectively. Resegmentation was not observed in Mesp2 KO embryos, but both the IVD and whole VB were formed from the caudalized sclerotome. Expression analysis of IVD marker genes including Pax1 in the wild-type, Mesp2 KO, and Ripply1/2 DKO embryos also supported the idea that a metameric pattern of IVD/VB is generated independently of Mesp2/Ripply-mediated rostro-caudal patterning of somite. However, in the lumbar region, IVD differentiation appeared to be stimulated by the caudal property and suppressed by the rostral property. Therefore, we propose that rostro-caudal patterning of somites is not a prerequisite for metameric patterning of the IVD and VB, but instead required to stimulate IVD differentiation in the caudal half of the sclerotome. Copyright © 2013 Elsevier Inc. All rights reserved.

  10. Expression of the Fanconi anemia group A gene (Fanca) during mouse embryogenesis.

    PubMed

    Abu-Issa, R; Eichele, G; Youssoufian, H

    1999-07-15

    About 80% of all cases of Fanconi anemia (FA) can be accounted for by complementation groups A and C. To understand the relationship between these groups, we analyzed the expression pattern of the mouse FA group-A gene (Fanca) during embryogenesis and compared it with the known pattern of the group-C gene (Fancc). Northern analysis of RNA from mouse embryos at embryonic days 7, 11, 15, and 17 showed a predominant 4.5 kb band in all stages. By in situ hybridization, Fanca transcripts were found in the whisker follicles, teeth, brain, retina, kidney, liver, and limbs. There was also stage-specific variation in Fanca expression, particularly within the developing whiskers and the brain. Some tissues known to express Fancc (eg, gut) failed to show Fanca expression. These observations show that (1) Fanca is under both tissue- and stage-specific regulation in several tissues; (2) the expression pattern of Fanca is consistent with the phenotype of the human disease; and (3) Fanca expression is not necessarily coupled to that of Fancc. The presence of distinct tissue targets for FA genes suggests that some of the variability in the clinical phenotype can be attributed to the complementation group assignment.

  11. Sex-Specific Selection and Sex-Biased Gene Expression in Humans and Flies

    PubMed Central

    Kirkpatrick, Mark

    2016-01-01

    Sexual dimorphism results from sex-biased gene expression, which evolves when selection acts differently on males and females. While there is an intimate connection between sex-biased gene expression and sex-specific selection, few empirical studies have studied this relationship directly. Here we compare the two on a genome-wide scale in humans and flies. We find a distinctive “Twin Peaks” pattern in humans that relates the strength of sex-specific selection, quantified by genetic divergence between male and female adults at autosomal loci, to the degree of sex-biased expression. Genes with intermediate degrees of sex-biased expression show evidence of ongoing sex-specific selection, while genes with either little or completely sex-biased expression do not. This pattern apparently results from differential viability selection in males and females acting in the current generation. The Twin Peaks pattern is also found in Drosophila using a different measure of sex-specific selection acting on fertility. We develop a simple model that successfully recapitulates the Twin Peaks. Our results suggest that many genes with intermediate sex-biased expression experience ongoing sex-specific selection in humans and flies. PMID:27658217

  12. HLA-C expression pattern is spatially different between psoriasis and eczema skin lesions.

    PubMed

    Carlén, Lina; Sakuraba, Kazuko; Ståhle, Mona; Sánchez, Fabio

    2007-02-01

    Interactions between genetic and environmental factors underlie the immune dysregulation and keratinocyte abnormalities that characterize psoriasis. Among known psoriasis susceptibility loci (PSORS), PSORS1 on chromosome 6 has the strongest association to disease. Altered expression of some PSORS1 candidate genes has been reported but little is known about HLA-C expression in psoriasis. This study compared expression of major histocompatibility complex class Ia and HLA-C in psoriasis, allergic contact eczema, and normal skin. Although HLA-C was abundant in protein extracts from both eczema and psoriasis, a consistent and intriguing difference in the expression pattern was observed; strong immunoreactivity in the basal cell layer, polarized towards the basement membrane in psoriasis, whereas in eczema lesions HLA-C immunostaining was present mostly in suprabasal cells. Inflammatory cells in the dermis were strongly stained in both diseases. Normal skin epithelium showed less intense but similar HLA-C staining as eczema lesions. HLA class Ia expression overall resembled that of HLA-C in all samples. The distinct HLA-C expression patterns in psoriasis and eczema suggest a functional role in the specific psoriasis immune response and not only a general feature of inflammation.

  13. Tissue-Specific, Development-Dependent Phenolic Compounds Accumulation Profile and Gene Expression Pattern in Tea Plant [Camellia sinensis

    PubMed Central

    Li, Weiwei; Zhao, Lei; Meng, Fei; Wang, Yunsheng; Tan, Huarong; Yang, Hua; Wei, Chaoling; Wan, Xiaochun; Gao, Liping; Xia, Tao

    2013-01-01

    Phenolic compounds in tea plant [Camellia sinensis (L.)] play a crucial role in dominating tea flavor and possess a number of key pharmacological benefits on human health. The present research aimed to study the profile of tissue-specific, development-dependent accumulation pattern of phenolic compounds in tea plant. A total of 50 phenolic compounds were identified qualitatively using liquid chromatography in tandem mass spectrometry technology. Of which 29 phenolic compounds were quantified based on their fragmentation behaviors. Most of the phenolic compounds were higher in the younger leaves than that in the stem and root, whereas the total amount of proanthocyanidins were unexpectedly higher in the root. The expression patterns of 63 structural and regulator genes involved in the shikimic acid, phenylpropanoid, and flavonoid pathways were analyzed by quantitative real-time polymerase chain reaction and cluster analysis. Based on the similarity of their expression patterns, the genes were classified into two main groups: C1 and C2; and the genes in group C1 had high relative expression level in the root or low in the bud and leaves. The expression patterns of genes in C2-2-1 and C2-2-2-1 groups were probably responsible for the development-dependent accumulation of phenolic compounds in the leaves. Enzymatic analysis suggested that the accumulation of catechins was influenced simultaneously by catabolism and anabolism. Further research is recommended to know the expression patterns of various genes and the reason for the variation in contents of different compounds in different growth stages and also in different organs. PMID:23646127

  14. VGLUT1 and VGLUT2 mRNA expression in the primate auditory pathway

    PubMed Central

    Hackett, Troy A.; Takahata, Toru; Balaram, Pooja

    2011-01-01

    The vesicular glutamate transporters (VGLUTs) regulate storage and release of glutamate in the brain. In adult animals, the VGLUT1 and VGLUT2 isoforms are widely expressed and differentially distributed, suggesting that neural circuits exhibit distinct modes of glutamate regulation. Studies in rodents suggest that VGLUT1 and VGLUT2 mRNA expression patterns are partly complementary, with VGLUT1 expressed at higher levels in cortex and VGLUT2 prominent subcortically, but with overlapping distributions in some nuclei. In primates, VGLUT gene expression has not been previously studied in any part of the brain. The purposes of the present study were to document the regional expression of VGLUT1 and VGLUT2 mRNA in the auditory pathway through A1 in cortex, and to determine whether their distributions are comparable to rodents. In situ hybridization with antisense riboprobes revealed that VGLUT2 was strongly expressed by neurons in the cerebellum and most major auditory nuclei, including the dorsal and ventral cochlear nuclei, medial and lateral superior olivary nuclei, central nucleus of the inferior colliculus, sagulum, and all divisions of the medial geniculate. VGLUT1 was densely expressed in the hippocampus and ventral cochlear nuclei, and at reduced levels in other auditory nuclei. In auditory cortex, neurons expressing VGLUT1 were widely distributed in layers II – VI of the core, belt and parabelt regions. VGLUT2 was most strongly expressed by neurons in layers IIIb and IV, weakly by neurons in layers II – IIIa, and at very low levels in layers V – VI. The findings indicate that VGLUT2 is strongly expressed by neurons at all levels of the subcortical auditory pathway, and by neurons in the middle layers of cortex, whereas VGLUT1 is strongly expressed by most if not all glutamatergic neurons in auditory cortex and at variable levels among auditory subcortical nuclei. These patterns imply that VGLUT2 is the main vesicular glutamate transporter in subcortical and thalamocortical (TC) circuits, whereas VGLUT1 is dominant in cortico-cortical (CC) and cortico-thalamic (CT) systems of projections. The results also suggest that VGLUT mRNA expression patterns in primates are similar to rodents, and establishes a baseline for detailed studies of these transporters in selected circuits of the auditory system. PMID:21111036

  15. VGLUT1 and VGLUT2 mRNA expression in the primate auditory pathway.

    PubMed

    Hackett, Troy A; Takahata, Toru; Balaram, Pooja

    2011-04-01

    The vesicular glutamate transporters (VGLUTs) regulate the storage and release of glutamate in the brain. In adult animals, the VGLUT1 and VGLUT2 isoforms are widely expressed and differentially distributed, suggesting that neural circuits exhibit distinct modes of glutamate regulation. Studies in rodents suggest that VGLUT1 and VGLUT2 mRNA expression patterns are partly complementary, with VGLUT1 expressed at higher levels in the cortex and VGLUT2 prominent subcortically, but with overlapping distributions in some nuclei. In primates, VGLUT gene expression has not been previously studied in any part of the brain. The purposes of the present study were to document the regional expression of VGLUT1 and VGLUT2 mRNA in the auditory pathway through A1 in the cortex, and to determine whether their distributions are comparable to rodents. In situ hybridization with antisense riboprobes revealed that VGLUT2 was strongly expressed by neurons in the cerebellum and most major auditory nuclei, including the dorsal and ventral cochlear nuclei, medial and lateral superior olivary nuclei, central nucleus of the inferior colliculus, sagulum, and all divisions of the medial geniculate. VGLUT1 was densely expressed in the hippocampus and ventral cochlear nuclei, and at reduced levels in other auditory nuclei. In the auditory cortex, neurons expressing VGLUT1 were widely distributed in layers II-VI of the core, belt and parabelt regions. VGLUT2 was expressed most strongly by neurons in layers IIIb and IV, weakly by neurons in layers II-IIIa, and at very low levels in layers V-VI. The findings indicate that VGLUT2 is strongly expressed by neurons at all levels of the subcortical auditory pathway, and by neurons in the middle layers of the cortex, whereas VGLUT1 is strongly expressed by most if not all glutamatergic neurons in the auditory cortex and at variable levels among auditory subcortical nuclei. These patterns imply that VGLUT2 is the main vesicular glutamate transporter in subcortical and thalamocortical (TC) circuits, whereas VGLUT1 is dominant in corticocortical (CC) and corticothalamic (CT) systems of projections. The results also suggest that VGLUT mRNA expression patterns in primates are similar to rodents, and establish a baseline for detailed studies of these transporters in selected circuits of the auditory system. Copyright © 2010 Elsevier B.V. All rights reserved.

  16. Increased methylation and decreased expression of homeobox genes TLX1, HOXA10 and DLX5 in human placenta are associated with trophoblast differentiation.

    PubMed

    Novakovic, Boris; Fournier, Thierry; Harris, Lynda K; James, Joanna; Roberts, Claire T; Yong, Hannah E J; Kalionis, Bill; Evain-Brion, Danièle; Ebeling, Peter R; Wallace, Euan M; Saffery, Richard; Murthi, Padma

    2017-07-03

    Homeobox genes regulate embryonic and placental development, and are widely expressed in the human placenta, but their regulatory control by DNA methylation is unclear. DNA methylation analysis was performed on human placentae from first, second and third trimesters to determine methylation patterns of homeobox gene promoters across gestation. Most homeobox genes were hypo-methylated throughout gestation, suggesting that DNA methylation is not the primary mechanism involved in regulating HOX genes expression in the placenta. Nevertheless, several genes showed variable methylation patterns across gestation, with a general trend towards an increase in methylation over gestation. Three genes (TLX1, HOXA10 and DLX5) showed inverse gains of methylation with decreasing mRNA expression throughout pregnancy, supporting a role for DNA methylation in their regulation. Proteins encoded by these genes were primarily localised to the syncytiotrophoblast layer, and showed decreased expression later in gestation. siRNA mediated downregulation of DLX5, TLX1 and HOXA10 in primary term villous cytotrophoblast resulted in decreased proliferation and increased expression of differentiation markers, including ERVW-1. Our data suggest that loss of DLX5, TLX1 and HOXA10 expression in late gestation is required for proper placental differentiation and function.

  17. Hidden among the crowd: differential DNA methylation-expression correlations in cancer occur at important oncogenic pathways.

    PubMed

    Mosquera Orgueira, Adrián

    2015-01-01

    DNA methylation is a frequent epigenetic mechanism that participates in transcriptional repression. Variations in DNA methylation with respect to gene expression are constant, and, for unknown reasons, some genes with highly methylated promoters are sometimes overexpressed. In this study we have analyzed the expression and methylation patterns of thousands of genes in five groups of cancer and normal tissue samples in order to determine local and genome-wide differences. We observed significant changes in global methylation-expression correlation in all the neoplasms, which suggests that differential correlation events are frequent in cancer. A focused analysis in the breast cancer cohort identified 1662 genes whose correlation varies significantly between normal and cancerous breast, but whose DNA methylation and gene expression patterns do not change substantially. These genes were enriched in cancer-related pathways and repressive chromatin features across various model cell lines, such as PRC2 binding and H3K27me3 marks. Substantial changes in methylation-expression correlation indicate that these genes are subject to epigenetic remodeling, where the differential activity of other factors break the expected relationship between both variables. Our findings suggest a complex regulatory landscape where a redistribution of local and large-scale chromatin repressive domains at differentially correlated genes (DCGs) creates epigenetic hotspots that modulate cancer-specific gene expression.

  18. Genomic expression patterns in medication overuse headaches

    PubMed Central

    Hershey, Andrew D; Burdine, Danny; Kabbouche, Marielle A; Powers, Scott W

    2016-01-01

    Background Chronic daily headache (CDH) and chronic migraine (CM) are one of the most frequent problems encountered in neurology, are often difficult to treat, and frequently complicated by medication-overuse headache (MOH). Proper recognition of MOH may alter treatment outcome and prevent long term disability. Objective This study identifies the unique genomic expression pattern MOH that respond to cessation of the overused medication. Methods Baseline occurrence of MOH and typical pattern of response to medication cessation were measured from a large database. Whole blood samples from patients with CM with or without MOH were obtained and their genomic profile was assessed. Affymetrix human U133 plus2 arrays were used to examine the genomic expression patterns prior to treatment and 6–12 weeks later. Headache characterisation and response to treatment based on headache frequency and disability were compared. Results Of 1311 patients reporting daily or continuous headaches, 513 (39.1%) reported overusing analgesic medication. At follow-up, 44.5% had a 50% or greater reduction in headache frequency, while 41.6% had no change. Blood genomic expression patterns were obtained on 33 patients with 19 (57.6%) overusing analgesic medication with a unique genomic expression pattern in MOH that responded to cessation of analgesics. Gene ontology of these samples indicated a significant number were involved with brain and immunological tissues, including multiple signalling pathways and apoptosis. Conclusions Blood genomic patterns can accurately identify MOH patients that respond to medication cessation. These results suggest that MOH involves a unique molecular biology pathway that can be identified with a specific biomarker. PMID:20974594

  19. Expression of adhesion molecules and cytokeratin 20 in merkel cell carcinomas.

    PubMed

    Tanaka, Yasushi; Sano, Toshiaki; Qian, Zhi Rong; Hirokawa, Mitsuyoshi

    2004-01-01

    Merkel cell carcinoma (MCC) is an aggressive neuroendocrine carcinoma of the skin. MCCs often show characteristic paranuclear dot-like immunopositivity for cytokeratin 20 (CK20), a globular aggregation of CK20 intermediate filaments. These aggregates typically form rhabdoid features and fibrous bodies and may be associated with a down-regulation in adhesion molecules (AMs). To date, the relationship between the expression of AMs and CK20 and clinicopathological findings in MCC has not been well examined. In this immunohistochemical study, we assessed the expression of AMs, CK20, and chromogranin A (CgA) on MCCs in 8 men and 23 women with this disease, and also characterized their clinicopathological features. This study is the largest of its kind that has been undertaken to date in Japanese patients. Compared to normal tissue, E-cadherin and alpha- and beta-catenins showed reduced membranous expression in 95.7%, 46.7%, and 45.2% of MCCs, respectively. Nuclear E-cadherin localization was seen in four tumors, all of which predominantly showed a CK20 dot pattern. However, there was no significant relationship between the membranous expression of AMs and a CK20 dot pattern. E-cadherin expression was significantly lower in tumors of > or =2 cm, and tumors negative for E-cadherin more frequently developed outside of the head and neck than within those regions. CgA was more intensely expressed in tumors with uniform nuclei and a dense lymphocytic infiltrate than in those that showed pleomorphisms and that had few, if any, infiltrating lymphocytes. These findings suggest that MCCs have a reduced expression of AMs and that down-regulation of E-cadherin expression may correlate with increased tumor aggressiveness. The fact that no significant relationship was demonstrable between the membranous expression of AMs and the CK20 expression pattern suggests that the mechanism of aggregation of intermediate filaments may be different in different types of tumors.

  20. Identification of a spatially specific enhancer element in the chicken Msx-2 gene that regulates its expression in the apical ectodermal ridge of the developing limb buds of transgenic mice.

    PubMed

    Sumoy, L; Wang, C K; Lichtler, A C; Pierro, L J; Kosher, R A; Upholt, W B

    1995-07-01

    Msx-2 is a member of the Msx family of homeobox-containing genes expressed in a variety of embryonic tissues involved in epithelial-mesenchymal interactions and pattern formation. In the developing chick limb bud, Msx-2 is expressed in the apical ectodermal ridge, which plays a crucial role in directing the growth and patterning of limb mesoderm. In addition, Msx-2 is expressed in the anterior nonskeletal-forming mesoderm of the limb bud, in the posterior necrotic zone, and in the interdigital mesenchyme. Studies of the altered expression patterns of Msx-2 in amelic and polydactylous mutant chick limbs have suggested that the apical ectodermal ridge and mesodermal domains of Msx-2 expression are independently regulated and that there might be separate cis-regulatory elements in the Msx-2 gene controlling its spatially distinct domains of expression. To test this hypothesis, we have isolated the chicken Msx-2 gene and have tested the ability of various regions of the gene to target expression of LacZ reporter gene to specific regions of the limbs of transgenic mice. A variety of these constructs are consistently expressed only in the apical ectodermal ridge and the ectoderm of the genital tubercle and are not expressed in the mesoderm of the limb bud or in other regions of the embryo where the endogenous Msx-2 gene is expressed. These results suggest the presence of spatially specific cis-regulatory elements in the Msx-2 gene. We identified a 348-bp region in the 5' flanking region of the Msx-2 gene which can act as an apical ectodermal ridge enhancer element when placed in reverse orientation in front of the reporter gene with transcription initiation directed by the minimal hsp68 promoter.

  1. On Expression Patterns and Developmental Origin of Human Brain Regions.

    PubMed

    Kirsch, Lior; Chechik, Gal

    2016-08-01

    Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions.

  2. On Expression Patterns and Developmental Origin of Human Brain Regions

    PubMed Central

    Kirsch, Lior; Chechik, Gal

    2016-01-01

    Anatomical substructures of the human brain have characteristic cell-types, connectivity and local circuitry, which are reflected in area-specific transcriptome signatures, but the principles governing area-specific transcription and their relation to brain development are still being studied. In adult rodents, areal transcriptome patterns agree with the embryonic origin of brain regions, but the processes and genes that preserve an embryonic signature in regional expression profiles were not quantified. Furthermore, it is not clear how embryonic-origin signatures of adult-brain expression interplay with changes in expression patterns during development. Here we first quantify which genes have regional expression-patterns related to the developmental origin of brain regions, using genome-wide mRNA expression from post-mortem adult human brains. We find that almost all human genes (92%) exhibit an expression pattern that agrees with developmental brain-region ontology, but that this agreement changes at multiple phases during development. Agreement is particularly strong in neuron-specific genes, but also in genes that are not spatially correlated with neuron-specific or glia-specific markers. Surprisingly, agreement is also stronger in early-evolved genes. We further find that pairs of similar genes having high agreement to developmental region ontology tend to be more strongly correlated or anti-correlated, and that the strength of spatial correlation changes more strongly in gene pairs with stronger embryonic signatures. These results suggest that transcription regulation of most genes in the adult human brain is spatially tuned in a way that changes through life, but in agreement with development-determined brain regions. PMID:27564987

  3. Sox genes in the coral Acropora millepora: divergent expression patterns reflect differences in developmental mechanisms within the Anthozoa

    PubMed Central

    2008-01-01

    Background Sox genes encode transcription factors that function in a wide range of developmental processes across the animal kingdom. To better understand both the evolution of the Sox family and the roles of these genes in cnidarians, we are studying the Sox gene complement of the coral, Acropora millepora (Class Anthozoa). Results Based on overall domain structures and HMG box sequences, the Acropora Sox genes considered here clearly fall into four of the five major Sox classes. AmSoxC is expressed in the ectoderm during development, in cells whose morphology is consistent with their assignment as sensory neurons. The expression pattern of the Nematostella ortholog of this gene is broadly similar to that of AmSoxC, but there are subtle differences – for example, expression begins significantly earlier in Acropora than in Nematostella. During gastrulation, AmSoxBb and AmSoxB1 transcripts are detected only in the presumptive ectoderm while AmSoxE1 transcription is restricted to the presumptive endoderm, suggesting that these Sox genes might play roles in germ layer specification. A third type B Sox gene, AmSoxBa, and a Sox F gene AmSoxF also have complex and specific expression patterns during early development. Each of these genes has a clear Nematostella ortholog, but in several cases the expression pattern observed in Acropora differs significantly from that reported in Nematostella. Conclusion These differences in expression patterns between Acropora and Nematostella largely reflect fundamental differences in developmental processes, underscoring the diversity of mechanisms within the anthozoan Sub-Class Hexacorallia (Zoantharia). PMID:19014479

  4. Development of the central nervous system in the larvacean Oikopleura dioica and the evolution of the chordate brain.

    PubMed

    Cañestro, Cristian; Bassham, Susan; Postlethwait, John

    2005-09-15

    In non-vertebrate chordates, central nervous system (CNS) development has been studied in only two taxa, the Cephalochordata and a single Class (Ascidiacea) of the morphologically diverse Urochordata. To understand development and molecular regionalization of the brain in a different deeply diverging chordate clade, we isolated and determined the expression patterns of orthologs of vertebrate CNS markers (otxa, otxb, otxc, pax6, pax2/5/8a, pax2/5/8b, engrailed, and hox1) in Oikopleura dioica (Subphylum Urochordata, Class Larvacea). The three Oikopleura otx genes are expressed similarly to vertebrate Otx paralogs, demonstrating that trans-homologs converged on similar evolutionary outcomes by independent neo- or subfunctionalization processes during the evolution of the two taxa. This work revealed that the Oikopleura CNS possesses homologs of the vertebrate forebrain, hindbrain, and spinal cord, but not the midbrain. Comparing larvacean gene expression patterns to published results in ascidians disclosed important developmental differences and similarities that suggest mechanisms of development likely present in their last common ancestor. In contrast to ascidians, the lack of a radical reorganization of the CNS as larvaceans become adults allows us to relate embryonic gene expression patterns to three subdivisions of the adult anterior brain. Our study of the Oikopleura brain provides new insights into chordate CNS evolution: first, the absence of midbrain is a urochordate synapomorphy and not a peculiarity of ascidians, perhaps resulting from their drastic CNS metamorphosis; second, there is no convincing evidence for a homolog of a midbrain-hindbrain boundary (MHB) organizer in urochordates; and third, the expression pattern of "MHB-genes" in the urochordate hindbrain suggests that they function in the development of specific neurons rather than in an MHB organizer.

  5. Morphological "primary homology" and expression of AG-subfamily MADS-box genes in pines, podocarps, and yews.

    PubMed

    Englund, Marie; Carlsbecker, Annelie; Engström, Peter; Vergara-Silva, Francisco

    2011-01-01

    The morphological variation among reproductive organs of extant gymnosperms is remarkable, especially among conifers. Several hypotheses concerning morphological homology between various conifer reproductive organs have been put forward, in particular in relation to the pine ovuliferous scale. Here, we use the expression patterns of orthologs of the ABC-model MADS-box gene AGAMOUS (AG) for testing morphological homology hypotheses related to organs of the conifer female cone. To this end, we first developed a tailored 3'RACE procedure that allows reliable amplification of partial sequences highly similar to gymnosperm-derived members of the AG-subfamily of MADS-box genes. Expression patterns of two novel conifer AG orthologs cloned with this procedure-namely PodAG and TgAG, obtained from the podocarp Podocarpus reichei and the yew Taxus globosa, respectively-are then further characterized in the morphologically divergent female cones of these species. The expression patterns of PodAG and TgAG are compared with those of DAL2, a previously discovered Picea abies (Pinaceae) AG ortholog. By treating the expression patterns of DAL2, PodAG, and TgAG as character states mapped onto currently accepted cladogram topologies, we suggest that the epimatium-that is, the podocarp female cone organ previously postulated as a "modified" ovuliferous scale-and the canonical Pinaceae ovuliferous scale can be legitimally conceptualized as "primary homologs." Character state mapping for TgAG suggests in turn that the aril of Taxaceae should be considered as a different type of organ. This work demonstrates how the interaction between developmental-genetic data and formal cladistic theory could fruitfully contribute to gymnosperm systematics. © 2011 Wiley Periodicals, Inc.

  6. Posterior Hox gene reduction in an arthropod: Ultrabithorax and Abdominal-B are expressed in a single segment in the mite Archegozetes longisetosus

    PubMed Central

    2013-01-01

    Background Hox genes encode transcription factors that have an ancestral role in all bilaterian animals in specifying regions along the antero-posterior axis. In arthropods (insects, crustaceans, myriapods and chelicerates), Hox genes function to specify segmental identity, and changes in Hox gene expression domains in different segments have been causal to the evolution of novel arthropod morphologies. Despite this, the roles of Hox genes in arthropods that have secondarily lost or reduced their segmental composition have been relatively unexplored. Recent data suggest that acariform mites have a reduced segmental component of their posterior body tagma, the opisthosoma, in that only two segments are patterned during embryogenesis. This is in contrast to the observation that in many extinct and extant chelicerates (that is, horseshoe crabs, scorpions, spiders and harvestmen) the opisthosoma is comprised of ten or more segments. To explore the role of Hox genes in this reduced body region, we followed the expression of the posterior-patterning Hox genes Ultrabithorax (Ubx) and Abdominal-B (Abd-B), as well as the segment polarity genes patched (ptc) and engrailed (en), in the oribatid mite Archegozetes longisetosus. Results We find that the expression patterns of ptc are in agreement with previous reports of a reduced mite opisthosoma. In comparison to the ptc and en expression patterns, we find that Ubx and Abd-B are expressed in a single segment in A. longisetosus, the second opisthosomal segment. Abd-B is initially expressed more posteriorly than Ubx, that is, into the unsegmented telson; however, this domain clears in subsequent stages where it remains in the second opisthosomal segment. Conclusions Our findings suggest that Ubx and Abd-B are expressed in a single segment in the opisthosoma. This is a novel observation, in that these genes are expressed in several segments in all studied arthropods. These data imply that a reduction in opisthosomal segmentation may be tied to a dramatically reduced Hox gene input in the opisthosoma. PMID:23991696

  7. Exposure to Nickel, Chromium, or Cadmium Causes Distinct Changes in the Gene Expression Patterns of a Rat Liver Derived Cell Line

    DTIC Science & Technology

    2011-11-16

    protein A (Rpa2), the minichromosome maintenance complex component genes which encode helicases, DNA ligase (Lig1), DNA polymerase e ( Pole and Pole2...and DNA polymerase d ( Pold1 and Pold2 ) are all up-regulated as a result of exposure to chromium (Figure 6), suggesting that there is an increase in...Exposure to Nickel, Chromium, or Cadmium Causes Distinct Changes in the Gene Expression Patterns of a Rat Liver Derived Cell Line Matthew G

  8. Butterfly eyespot serial homology: enter the Hox genes

    PubMed Central

    2011-01-01

    Hox genes modify serial homology patterns in many organisms, exemplified in vertebrates by modification of the axial skeleton and in arthropods by diversification of the body segments. Butterfly wing eyespots also appear in a serial homologous pattern that, in certain species, is subject to local modification. A paper in EvoDevo reports the Hox gene Antp is the earliest known gene to have eyespot-specific expression; however, not all Lepidoptera express Antp in eyespots, suggesting some developmental flexibility. See research article: http://www.evodevojournal.com/content/2/1/9 PMID:21527048

  9. WEREWOLF, a MYB-related protein in Arabidopsis, is a position-dependent regulator of epidermal cell patterning.

    PubMed

    Lee, M M; Schiefelbein, J

    1999-11-24

    The formation of the root epidermis of Arabidopsis provides a simple and elegant model for the analysis of cell patterning. A novel gene, WEREWOLF (WER), is described here that is required for position-dependent patterning of the epidermal cell types. The WER gene encodes a MYB-type protein and is preferentially expressed within cells destined to adopt the non-hair fate. Furthermore, WER is shown to regulate the position-dependent expression of the GLABRA2 homeobox gene, to interact with a bHLH protein, and to act in opposition to the CAPRICE MYB. These results suggest a simple model to explain the specification of the two root epidermal cell types, and they provide insight into the molecular mechanisms used to control cell patterning.

  10. Transcriptomic and macroevolutionary evidence for phenotypic uncoupling between frog life history phases

    PubMed Central

    Wollenberg Valero, Katharina C.; Garcia-Porta, Joan; Rodríguez, Ariel; Arias, Mónica; Shah, Abhijeet; Randrianiaina, Roger Daniel; Brown, Jason L.; Glaw, Frank; Amat, Felix; Künzel, Sven; Metzler, Dirk; Isokpehi, Raphael D.; Vences, Miguel

    2017-01-01

    Anuran amphibians undergo major morphological transitions during development, but the contribution of their markedly different life-history phases to macroevolution has rarely been analysed. Here we generate testable predictions for coupling versus uncoupling of phenotypic evolution of tadpole and adult life-history phases, and for the underlying expression of genes related to morphological feature formation. We test these predictions by combining evidence from gene expression in two distantly related frogs, Xenopus laevis and Mantidactylus betsileanus, with patterns of morphological evolution in the entire radiation of Madagascan mantellid frogs. Genes linked to morphological structure formation are expressed in a highly phase-specific pattern, suggesting uncoupling of phenotypic evolution across life-history phases. This gene expression pattern agrees with uncoupled rates of trait evolution among life-history phases in the mantellids, which we show to have undergone an adaptive radiation. Our results validate a prevalence of uncoupling in the evolution of tadpole and adult phenotypes of frogs. PMID:28504275

  11. The generation and diversification of butterfly eyespot color patterns.

    PubMed

    Brunetti, C R; Selegue, J E; Monteiro, A; French, V; Brakefield, P M; Carroll, S B

    2001-10-16

    A fundamental challenge of evolutionary and developmental biology is understanding how new characters arise and change. The recently derived eyespots on butterfly wings vary extensively in number and pattern between species and play important roles in predator avoidance. Eyespots form through the activity of inductive organizers (foci) at the center of developing eyespot fields. Foci are the proposed source of a morphogen, the levels of which determine the color of surrounding wing scale cells. However, it is unknown how reception of the focal signal translates into rings of different-colored scales, nor how different color schemes arise in different species. We have identified several transcription factors, including butterfly homologs of the Drosophila Engrailed/Invected and Spalt proteins, that are deployed in concentric territories corresponding to the future rings of pigmented scales that compose the adult eyespot. We have isolated a new Bicyclus anynana wing pattern mutant, Goldeneye, in which the scales of one inner color ring become the color of a different ring. These changes correlate with shifts in transcription factor expression, suggesting that Goldeneye affects an early regulatory step in eyespot color patterning. In different butterfly species, the same transcription factors are expressed in eyespot fields, but in different relative spatial domains that correlate with divergent eyespot color schemes. Our results suggest that signaling from the focus induces nested rings of regulatory gene expression that subsequently control the final color pattern. Furthermore, the remarkably plastic regulatory interactions downstream of focal signaling have facilitated the evolution of eyespot diversity.

  12. The marginal band system in nymphalid butterfly wings.

    PubMed

    Taira, Wataru; Kinjo, Seira; Otaki, Joji M

    2015-01-01

    Butterfly wing color patterns are highly complex and diverse, but they are believed to be derived from the nymphalid groundplan, which is composed of several color pattern systems. Among these pattern systems, the marginal band system, including marginal and submarginal bands, has rarely been studied. Here, we examined the color pattern diversity of the marginal band system among nymphalid butterflies. Marginal and submarginal bands are usually expressed as a pair of linear bands aligned with the wing margin. However, a submarginal band can be expressed as a broken band, an elongated oval, or a single dot. The marginal focus, usually a white dot at the middle of a wing compartment along the wing edge, corresponds to the pupal edge spot, one of the pupal cuticle spots that signify the locations of color pattern organizing centers. A marginal band can be expressed as a semicircle, an elongated oval, or a pair of eyespot-like structures, which suggest the organizing activity of the marginal focus. Physical damage at the pupal edge spot leads to distal dislocation of the submarginal band in Junonia almana and in Vanessa indica, suggesting that the marginal focus functions as an organizing center for the marginal band system. Taken together, we conclude that the marginal band system is developmentally equivalent to other symmetry systems. Additionally, the marginal band is likely a core element and the submarginal band a paracore element of the marginal band system, and both bands are primarily specified by the marginal focus organizing center.

  13. System Biology Approach: Gene Network Analysis for Muscular Dystrophy.

    PubMed

    Censi, Federica; Calcagnini, Giovanni; Mattei, Eugenio; Giuliani, Alessandro

    2018-01-01

    Phenotypic changes at different organization levels from cell to entire organism are associated to changes in the pattern of gene expression. These changes involve the entire genome expression pattern and heavily rely upon correlation patterns among genes. The classical approach used to analyze gene expression data builds upon the application of supervised statistical techniques to detect genes differentially expressed among two or more phenotypes (e.g., normal vs. disease). The use of an a posteriori, unsupervised approach based on principal component analysis (PCA) and the subsequent construction of gene correlation networks can shed a light on unexpected behaviour of gene regulation system while maintaining a more naturalistic view on the studied system.In this chapter we applied an unsupervised method to discriminate DMD patient and controls. The genes having the highest absolute scores in the discrimination between the groups were then analyzed in terms of gene expression networks, on the basis of their mutual correlation in the two groups. The correlation network structures suggest two different modes of gene regulation in the two groups, reminiscent of important aspects of DMD pathogenesis.

  14. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori)

    PubMed Central

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-01-01

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family. PMID:27706106

  15. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    PubMed

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  16. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  17. Gene expression analysis of parthenogenetic embryonic development of the pea aphid, Acyrthosiphon pisum, suggests that aphid parthenogenesis evolved from meiotic oogenesis.

    PubMed

    Srinivasan, Dayalan G; Abdelhady, Ahmed; Stern, David L

    2014-01-01

    Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity.

  18. Gene Expression Analysis of Parthenogenetic Embryonic Development of the Pea Aphid, Acyrthosiphon pisum, Suggests That Aphid Parthenogenesis Evolved from Meiotic Oogenesis

    PubMed Central

    Srinivasan, Dayalan G.; Abdelhady, Ahmed; Stern, David L.

    2014-01-01

    Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity. PMID:25501006

  19. Cloning, Characterization, and Expression Analysis of the Novel Acetyltransferase Retrogene Ard1b in the Mouse1

    PubMed Central

    Pang, Alan Lap-Yin; Peacock, Stephanie; Johnson, Warren; Bear, Deborah H.; Rennert, Owen M.; Chan, Wai-Yee

    2009-01-01

    N-alpha-terminal acetylation is a modification process that occurs cotranslationally on most eukaryotic proteins. The major enzyme responsible for this process, N-alpha-terminal acetyltransferase, is composed of the catalytic subunit ARD1A and the auxiliary subunit NAT1. We cloned, characterized, and studied the expression pattern of Ard1b (also known as Ard2), a novel homolog of the mouse Ard1a. Comparison of the genomic structures suggests that the autosomal Ard1b is a retroposed copy of the X-linked Ard1a. Expression analyses demonstrated a testis predominance of Ard1b. A reciprocal expression pattern between Ard1a and Ard1b is also observed during spermatogenesis, suggesting that Ard1b is expressed to compensate for the loss of Ard1a starting from meiosis. Both ARD1A and ARD1B can interact with NAT1 to constitute a functional N-alpha-terminal acetyltransferase in vitro. The expression of ARD1B protein can be detected in mouse testes but is delayed until the first appearance of round spermatids. In a cell culture model, the inclusion of the long 3′ untranslated region of Ard1b leads to reduction of luciferase reporter activity, which implicates its role in translational repression of Ard1b during spermatogenesis. Our results suggest that ARD1B may have an important role in the later course of the spermatogenic process. PMID:19246321

  20. Cloning, characterization, and expression analysis of the novel acetyltransferase retrogene Ard1b in the mouse.

    PubMed

    Pang, Alan Lap-Yin; Peacock, Stephanie; Johnson, Warren; Bear, Deborah H; Rennert, Owen M; Chan, Wai-Yee

    2009-08-01

    N-alpha-terminal acetylation is a modification process that occurs cotranslationally on most eukaryotic proteins. The major enzyme responsible for this process, N-alpha-terminal acetyltransferase, is composed of the catalytic subunit ARD1A and the auxiliary subunit NAT1. We cloned, characterized, and studied the expression pattern of Ard1b (also known as Ard2), a novel homolog of the mouse Ard1a. Comparison of the genomic structures suggests that the autosomal Ard1b is a retroposed copy of the X-linked Ard1a. Expression analyses demonstrated a testis predominance of Ard1b. A reciprocal expression pattern between Ard1a and Ard1b is also observed during spermatogenesis, suggesting that Ard1b is expressed to compensate for the loss of Ard1a starting from meiosis. Both ARD1A and ARD1B can interact with NAT1 to constitute a functional N-alpha-terminal acetyltransferase in vitro. The expression of ARD1B protein can be detected in mouse testes but is delayed until the first appearance of round spermatids. In a cell culture model, the inclusion of the long 3' untranslated region of Ard1b leads to reduction of luciferase reporter activity, which implicates its role in translational repression of Ard1b during spermatogenesis. Our results suggest that ARD1B may have an important role in the later course of the spermatogenic process.

  1. Revisiting the phosphatidylethanolamine-binding protein (PEBP) gene family reveals cryptic FLOWERING LOCUS T gene homologs in gymnosperms and sheds new light on functional evolution.

    PubMed

    Liu, Yan-Yan; Yang, Ke-Zhen; Wei, Xiao-Xin; Wang, Xiao-Quan

    2016-11-01

    Angiosperms and gymnosperms are two major groups of extant seed plants. It has been suggested that gymnosperms lack FLOWERING LOCUS T (FT), a key integrator at the core of flowering pathways in angiosperms. Taking advantage of newly released gymnosperm genomes, we revisited the evolutionary history of the plant phosphatidylethanolamine-binding protein (PEBP) gene family through phylogenetic reconstruction. Expression patterns in three gymnosperm taxa and heterologous expression in Arabidopsis were studied to investigate the functions of gymnosperm FT-like and TERMINAL FLOWER 1 (TFL1)-like genes. Phylogenetic reconstruction suggests that an ancient gene duplication predating the divergence of seed plants gave rise to the FT and TFL1 genes. Expression patterns indicate that gymnosperm TFL1-like genes play a role in the reproductive development process, while GymFT1 and GymFT2, the FT-like genes resulting from a duplication event in the common ancestor of gymnosperms, function in both growth rhythm and sexual development pathways. When expressed in Arabidopsis, both spruce FT-like and TFL1-like genes repressed flowering. Our study demonstrates that gymnosperms do have FT-like and TFL1-like genes. Frequent gene and genome duplications contributed significantly to the expansion of the plant PEBP gene family. The expression patterns of gymnosperm PEBP genes provide novel insight into the functional evolution of this gene family. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  2. Hox genes and chordate evolution.

    PubMed

    Holland, P W; Garcia-Fernàndez, J

    1996-02-01

    Hox genes are implicated in the control of axial patterning during embryonic development of many, perhaps all, animals. Here we review recent data on Hox gene diversity, genomic organization, and embryonic expression in chordates (including tunicates, amphioxus, hagfish, lampreys, teleosts) plus their putative sister group, the hemichordates. We consider the potential of comparative Hox gene data to resolve some outstanding controversies in chordate phylogeny. The use of Hox gene expression patterns to identify homologies between body plans both within the vertebrates and between the chordate subphyla is also discussed. Homology between the vertebrate hindbrain and an extensive region of amphioxus neural tube is suggested by comparison of Hox-3 homologues and strengthened by new data on amphioxus Hox-1 gene expression reported here. Finally, we give two examples of how Hox genes are giving glimpses into chordate developmental evolution. The first relates changes in Hox gene expression to transposition of vertebral of vertebral identities; the second describes a correlation between vertebrate origins and Hox gene cluster duplication. We suggest that the simultaneous duplication of many classes of genes, often interacting in gene networks, allowed the elaboration of new developmental control mechanisms at vertebrate origins.

  3. TORNADO1 regulates root epidermal patterning through the WEREWOLF pathway in Arabidopsis thaliana.

    PubMed

    Kwak, Su-Hwan; Song, Sang-Kee; Lee, Myeong Min; Schiefelbein, John

    2015-01-01

    Cell fate in the root epidermis of Arabidopsis thaliana is determined in a position-dependent manner. SCRAMBLED (SCM), an atypical leucine-rich repeat receptor-like kinase, mediates this positional regulation via its effect on WEREWOLF (WER) expression, and subsequently, its downstream transcription factor, GLABRA2 (GL2), which are required for nonhair cell development. Previously, TORNADO1 (TRN1), a plant-specific protein with a leucine-rich repeat ribonuclease inhibitor-like domain, was shown to be required for proper epidermal patterning in Arabidopsis roots. In this work, we analyzed the possible involvement of TRN1 in the known root epidermal gene network. We discovered that the trn1 mutant caused the ectopic expression of WER and the randomized expression of GL2 and EGL3. This suggests that TRN1 regulates the position-dependent cell fate determination by affecting WER expression in Arabidopsis root epidermis. Additionally, the distinct phenotypes of the aerial parts of the trn1-t and scm-2 mutant suggest that TRN1 and SCM might have different functions in the development of aerial parts.

  4. TORNADO1 regulates root epidermal patterning through the WEREWOLF pathway in Arabidopsis thaliana

    PubMed Central

    Kwak, Su-Hwan; Song, Sang-Kee; Lee, Myeong Min; Schiefelbein, John

    2015-01-01

    Cell fate in the root epidermis of Arabidopsis thaliana is determined in a position-dependent manner. SCRAMBLED (SCM), an atypical leucine-rich repeat receptor-like kinase, mediates this positional regulation via its effect on WEREWOLF (WER) expression, and subsequently, its downstream transcription factor, GLABRA2 (GL2), which are required for nonhair cell development. Previously, TORNADO1 (TRN1), a plant-specific protein with a leucine-rich repeat ribonuclease inhibitor-like domain, was shown to be required for proper epidermal patterning in Arabidopsis roots. In this work, we analyzed the possible involvement of TRN1 in the known root epidermal gene network. We discovered that the trn1 mutant caused the ectopic expression of WER and the randomized expression of GL2 and EGL3. This suggests that TRN1 regulates the position-dependent cell fate determination by affecting WER expression in Arabidopsis root epidermis. Additionally, the distinct phenotypes of the aerial parts of the trn1-t and scm-2 mutant suggest that TRN1 and SCM might have different functions in the development of aerial parts. PMID:26451798

  5. Dynamic expression of the LAP family of genes during early development of Xenopus tropicalis.

    PubMed

    Yang, Qiutan; Lv, Xiaoyan; Kong, Qinghua; Li, Chaocui; Zhou, Qin; Mao, Bingyu

    2011-10-01

    The leucine-rich repeats and PDZ (LAP) family of genes are crucial for the maintenance of cell polarity as well as for epithelial homeostasis and tumor suppression in both vertebrates and invertebrates. Four members of this gene family are known: densin, erbin, scribble and lano. Here, we identified the four members of the LAP gene family in Xenopus tropicalis and studied their expression patterns during embryonic development. The Xenopus LAP proteins show a conserved domain structure that is similar to their homologs in other vertebrates. In Xenopus embryos, these genes were detected in animal cap cells at the early gastrula stage. At later stages of development, they were widely expressed in epithelial tissues that are highly polar in nature, including the neural epithelia, optic and otic vesicles, and in the pronephros. These data suggest that the roles of the Xenopus LAP genes in the control of cell polarity and morphogenesis are conserved during early development. Erbin and lano show similar expression patterns in the developing head, suggesting potential functional interactions between the two molecules in vivo.

  6. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    PubMed Central

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  7. Bacterial competition reveals differential regulation of the pks genes by Bacillus subtilis.

    PubMed

    Vargas-Bautista, Carol; Rahlwes, Kathryn; Straight, Paul

    2014-02-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305-310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis.

  8. Expression of Glutamate and Inhibitory Amino Acid Vesicular Transporters in the Rodent Auditory Brainstem

    PubMed Central

    Ito, Tetsufumi; Bishop, Deborah C.; Oliver, Douglas L.

    2011-01-01

    Glutamate is the main excitatory neurotransmitter in the auditory system, but associations between glutamatergic neuronal populations and the distribution of their synaptic terminations have been difficult. Different subsets of glutamatergic terminals employ one of three vesicular glutamate transporters (VGLUT) to load synaptic vesicles. Recently, VGLUT1 and VGLUT2 terminals were found to have different patterns of organization in the inferior colliculus suggesting that there are different types of glutamatergic neurons in the brainstem auditory system with projections to the colliculus. To positively identify VGLUT-expressing neurons as well as inhibitory neurons in the auditory brainstem, we used in situ hybridization to identify the mRNA for VGLUT1, VGLUT2, and VIAAT (the vesicular inhibitory amino acid transporter used by GABAergic and glycinergic terminals). Similar expression patterns were found in subsets of glutamatergic and inhibitory neurons in the auditory brainstem and thalamus of adult rats and mice. Four patterns of gene expression were seen in individual neurons. 1) VGLUT2 expressed alone was the prevalent pattern. 2) VGLUT1 co-expressed with VGLUT2 was seen in scattered neurons in most nuclei but was common in the medial geniculate body and ventral cochlear nucleus. 3) VGLUT1 expressed alone was found only in granule cells. 4) VIAAT expression was common in most nuclei but dominated in some. These data show that the expression of the VGLUT1/2 and VIAAT genes can identify different subsets of auditory neurons. This may facilitate the identification of different components in auditory circuits. PMID:21165977

  9. Characterization of GPR101 transcript structure and expression patterns

    PubMed Central

    Trivellin, Giampaolo; Bjelobaba, Ivana; Daly, Adrian F.; Larco, Darwin O.; Palmeira, Leonor; Faucz, Fabio R.; Thiry, Albert; Leal, Letícia F.; Rostomyan, Liliya; Quezado, Martha; Schernthaner-Reiter, Marie Helene; Janjic, Marija M.; Villa, Chiara; Wu, T. John; Stojilkovic, Stanko S.; Beckers, Albert; Feldman, Benjamin; Stratakis, Constantine A.

    2016-01-01

    We recently showed that Xq26.3 microduplications cause X-linked acrogigantism (X-LAG). X-LAG patients mainly present with growth hormone and prolactin-secreting adenomas and share a minimal duplicated region containing at least four genes. GPR101 was the only gene highly expressed in their pituitary lesions, but little is known about its expression patterns. GPR101 transcripts were characterized in human tissues by 5’-RACE and RNAseq, while the putative promoter was bioinformatically predicted. We investigated GPR101 mRNA and protein expression by RT-qPCR, whole-mount in situ hybridization, and immunostaining, in human, rhesus monkey, rat, and zebrafish. We identified four GPR101 isoforms characterized by different 5’ untranslated regions (UTRs) and a common 6.1 kb-long 3’UTR. GPR101 expression was very low or absent in almost all adult human tissues examined, except for specific brain regions. Strong GPR101 staining was observed in human fetal pituitary and during adolescence, whereas very weak/absent expression was detected during childhood and adult life. In contrast to humans, adult pituitaries of monkey and rat expressed GPR101, but in different cell types. Gpr101 is expressed in the brain and pituitary during rat and zebrafish development; in rat pituitary Gpr101 is expressed only after birth and showed sexual dimorphism. This study shows that different GPR101 transcripts exist and that the brain is the major site of GPR101 expression across different species, although divergent species- and temporal-specific expression patterns are evident. These findings suggest an important role for GPR101 in brain and pituitary development and likely reflect the very different growth, development and maturation patterns among species. PMID:27282544

  10. Transcription factors define the neuroanatomical organization of the medullary reticular formation

    PubMed Central

    Gray, Paul A.

    2013-01-01

    The medullary reticular formation contains large populations of inadequately described, excitatory interneurons that have been implicated in multiple homeostatic behaviors including breathing, viserosensory processing, vascular tone, and pain. Many hindbrain nuclei show a highly stereotyped pattern of localization across vertebrates suggesting a strong underlying genetic organization. Whether this is true for neurons within the reticular regions of hindbrain is unknown. Hindbrain neurons are derived from distinct developmental progenitor domains each of which expresses distinct patterns of transcription factors (TFs). These neuronal populations have distinct characteristics such as transmitter identity, migration, and connectivity suggesting developmentally expressed TFs might identify unique subpopulations of neurons within the reticular formation. A fate-mapping strategy using perinatal expression of reporter genes within Atoh1, Dbx1, Lmx1b, and Ptf1a transgenic mice coupled with immunohistochemistry (IHC) and in situ hybridization (ISH) were used to address the developmental organization of a large subset of reticular formation glutamatergic neurons. All hindbrain lineages have relatively large populations that extend the entire length of the hindbrain. Importantly, the location of neurons within each lineage was highly constrained. Lmx1b- and Dbx1- derived populations were both present in partially overlapping stripes within the reticular formation extending from dorsal to ventral brain. Within each lineage, distinct patterns of gene expression and organization were localized to specific hindbrain regions. Rostro-caudally sub-populations differ sequentially corresponding to proposed pseudo-rhombomereic boundaries. Dorsal-ventrally, sub-populations correspond to specific migratory positions. Together these data suggests the reticular formation is organized by a highly stereotyped developmental logic. PMID:23717265

  11. Transcription factors define the neuroanatomical organization of the medullary reticular formation.

    PubMed

    Gray, Paul A

    2013-01-01

    The medullary reticular formation contains large populations of inadequately described, excitatory interneurons that have been implicated in multiple homeostatic behaviors including breathing, viserosensory processing, vascular tone, and pain. Many hindbrain nuclei show a highly stereotyped pattern of localization across vertebrates suggesting a strong underlying genetic organization. Whether this is true for neurons within the reticular regions of hindbrain is unknown. Hindbrain neurons are derived from distinct developmental progenitor domains each of which expresses distinct patterns of transcription factors (TFs). These neuronal populations have distinct characteristics such as transmitter identity, migration, and connectivity suggesting developmentally expressed TFs might identify unique subpopulations of neurons within the reticular formation. A fate-mapping strategy using perinatal expression of reporter genes within Atoh1, Dbx1, Lmx1b, and Ptf1a transgenic mice coupled with immunohistochemistry (IHC) and in situ hybridization (ISH) were used to address the developmental organization of a large subset of reticular formation glutamatergic neurons. All hindbrain lineages have relatively large populations that extend the entire length of the hindbrain. Importantly, the location of neurons within each lineage was highly constrained. Lmx1b- and Dbx1- derived populations were both present in partially overlapping stripes within the reticular formation extending from dorsal to ventral brain. Within each lineage, distinct patterns of gene expression and organization were localized to specific hindbrain regions. Rostro-caudally sub-populations differ sequentially corresponding to proposed pseudo-rhombomereic boundaries. Dorsal-ventrally, sub-populations correspond to specific migratory positions. Together these data suggests the reticular formation is organized by a highly stereotyped developmental logic.

  12. Transcriptomic correlates of neuron electrophysiological diversity

    PubMed Central

    Li, Brenna; Crichlow, Cindy-Lee; Mancarci, B. Ogan; Pavlidis, Paul

    2017-01-01

    How neuronal diversity emerges from complex patterns of gene expression remains poorly understood. Here we present an approach to understand electrophysiological diversity through gene expression by integrating pooled- and single-cell transcriptomics with intracellular electrophysiology. Using neuroinformatics methods, we compiled a brain-wide dataset of 34 neuron types with paired gene expression and intrinsic electrophysiological features from publically accessible sources, the largest such collection to date. We identified 420 genes whose expression levels significantly correlated with variability in one or more of 11 physiological parameters. We next trained statistical models to infer cellular features from multivariate gene expression patterns. Such models were predictive of gene-electrophysiological relationships in an independent collection of 12 visual cortex cell types from the Allen Institute, suggesting that these correlations might reflect general principles relating expression patterns to phenotypic diversity across very different cell types. Many associations reported here have the potential to provide new insights into how neurons generate functional diversity, and correlations of ion channel genes like Gabrd and Scn1a (Nav1.1) with resting potential and spiking frequency are consistent with known causal mechanisms. Our work highlights the promise and inherent challenges in using cell type-specific transcriptomics to understand the mechanistic origins of neuronal diversity. PMID:29069078

  13. A microcosm of musical expression: II. Quantitative analysis of pianists' dynamics in the initial measures of Chopin's Etude in E major.

    PubMed

    Repp, B H

    1999-03-01

    Patterns of expressive dynamics were measured in bars 1-5 of 115 commercially recorded performances of Chopin's Etude in E major, op. 10, No. 3. The grand average pattern (or dynamic profile) was representative of many performances and highly similar to the average dynamic profile of a group of advanced student performances, which suggests a widely shared central norm of expressive dynamics. The individual dynamic profiles were subjected to principal components analysis, which yielded Varimax-rotated components, each representing a different, nonstandard dynamic profile associated with a small subset of performances. Most performances had dynamic patterns resembling a mixture of several components, and no clustering of of performances into distinct groups was apparent. Some weak relationships of dynamic profiles with sociocultural variables were found, most notably a tendency of female pianists to exhibit a greater dynamic range in the melody. Within the melody, there were no significant relationships between expressive timing [Repp, J. Acoust. Soc. Am. 104, 1085-1100 (1998)] and expressive dynamics. These two important dimensions seemed to be controlled independently at this local level and thus offer the artist many degrees of freedom in giving a melody expressive shape.

  14. Categorization of biologically relevant chemical signals in the medial amygdala

    PubMed Central

    Samuelsen, Chad L.; Meredith, Michael

    2009-01-01

    Many species employ chemical signals to convey messages between members of the same species (conspecific), but chemosignals may also provide information to another species (heterospecific). Here, we found that conspecific chemosignals (male, female mouse urine) increased immediate early gene-protein (IEG) expression in both anterior and posterior medial amygdala of male mice, whereas most heterospecific chemosignals (e.g.: hamster vaginal fluid, steer urine) increased expression only in anterior medial amygdala. This categorization of responses in medial amygdala conforms to our previously reported findings in male hamsters. The same characteristic pattern of IEG expression appears in the medial amygdala of each species in response to conspecific stimuli for that species. These results suggest that the amygdala categorizes stimuli according to the biological relevance for the tested species. Thus, a heterospecific predator (cat collar) stimulus, which elicited behavioral avoidance in mice, increased IEG expression in mouse posterior medial amygdala (like conspecific stimuli). Further analysis suggests reproduction related and potentially threatening stimuli produce increased IEG expression in different sub-regions of posterior medial amygdala (dorsal and ventral, respectively). These patterns of IEG expression in medial amygdala may provide glimpses of a tertiary sorting of chemosensory signals beyond the primary-level selectivity of chemosensory neurons and the secondary sorting in main and accessory olfactory bulbs. PMID:19368822

  15. The carnegie protein trap library: a versatile tool for Drosophila developmental studies.

    PubMed

    Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D; Nystul, Todd G; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E; Murphy, Terence D; Levis, Robert W; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A; Spradling, Allan C

    2007-03-01

    Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600-900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions.

  16. Over-expression of thymosin β4 in granulomatous lung tissue with active pulmonary tuberculosis.

    PubMed

    Kang, Yun-Jeong; Jo, Jin-Ok; Ock, Mee Sun; Yoo, Young-Bin; Chun, Bong-Kwon; Oak, Chul-Ho; Cha, Hee-Jae

    2014-05-01

    Recent studies have shown that thymosin β4 (Tβ4) stimulates angiogenesis by inducing vascular endothelial growth factor (VEGF) expression and stabilizing hypoxia inducible factor-1α (HIF-1α) protein. Pulmonary tuberculosis (TB), a type of granulomatous disease, is accompanied by intense angiogenesis and VEGF levels have been reported to be elevated in serum or tissue inflamed by pulmonary tuberculosis. We investigated the expression of Tβ4 in granulomatous lung tissues at various stages of active pulmonary tuberculosis, and we also examined the expression patterns of VEGF and HIF-1α to compare their Tβ4 expression patterns in patients' tissues and in the tissue microarray of TB patients. Tβ4 was highly expressed in both granulomas and surrounding lymphocytes in nascent granulomatous lung tissue, but was expressed only surrounding tissues of necrotic or caseous necrotic regions. The expression pattern of HIF-1α was similar to that of Tβ4. VEGF was expressed in both granulomas and blood vessels surrounding granulomas. The expression pattern of VEGF co-localized with CD31 (platelet endothelial cell adhesion molecule, PECAM-1), a blood endothelial cell marker, and partially co-localized with Tβ4. However, the expression of Tβ4 did not co-localize with alveolar macrophages. Stained alveolar macrophages were present surrounding regions of granuloma highly expressing Tβ4. We also analyzed mRNA expression in the sputum of 10 normal and 19 pulmonary TB patients. Expression of Tβ4 was significantly higher in patients with pulmonary tuberculosis than in normal controls. These data suggest that Tβ4 is highly expressed in granulomatous lung tissue with active pulmonary TB and is associated with HIF-1α- and VEGF-mediated inflammation and angiogenesis. Furthermore, the expression of Tβ4 in the sputum of pulmonary tuberculosis patients can be used as a potential marker for diagnosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  17. Dynamic expression of a Hydra FGF at boundaries and termini.

    PubMed

    Lange, Ellen; Bertrand, Stephanie; Holz, Oliver; Rebscher, Nicole; Hassel, Monika

    2014-12-01

    Guidance of cells and tissue sheets is an essential function in developing and differentiating animal tissues. In Hydra, where cells and tissue move dynamically due to constant cell proliferation towards the termini or into lateral, vegetative buds, factors essential for guidance are still unknown. Good candidates to take over this function are fibroblast growth factors (FGFs). We present the phylogeny of several Hydra FGFs and analysis of their expression patterns. One of the FGFs is expressed in all terminal regions targeted by tissue movement and at boundaries crossed by moving tissue and cells with an expression pattern slightly differing in two Hydra strains. A model addressing an involvement of this FGF in cell movement and morphogenesis is proposed: Hydra FGFf-expressing cells might serve as sources to attract tissue and cells towards the termini of the body column and across morphological boundaries. Moreover, a function in morphogenesis and/or differentiation of cells and tissue is suggested.

  18. Lineage-specific evolution of cnidarian Wnt ligands.

    PubMed

    Hensel, Katrin; Lotan, Tamar; Sanders, Steve M; Cartwright, Paulyn; Frank, Uri

    2014-09-01

    We have studied the evolution of Wnt genes in cnidarians and the expression pattern of all Wnt ligands in the hydrozoan Hydractinia echinata. Current views favor a scenario in which 12 Wnt sub-families were jointly inherited by cnidarians and bilaterians from their last common ancestor. Our phylogenetic analyses clustered all medusozoan genes in distinct, well-supported clades, but many orthologous relationships between medusozoan Wnts and anthozoan and bilaterian Wnt genes were poorly supported. Only seven anthozoan genes, Wnt2, Wnt4, Wnt5, Wnt6, Wnt 10, Wnt11, and Wnt16 were recovered with strong support with bilaterian genes and of those, only the Wnt2, Wnt5, Wnt11, and Wnt16 clades also included medusozoan genes. Although medusozoan Wnt8 genes clustered with anthozoan and bilaterian genes, this was not well supported. In situ hybridization studies revealed poor conservation of expression patterns of putative Wnt orthologs within Cnidaria. In polyps, only Wnt1, Wnt3, and Wnt7 were expressed at the same position in the studied cnidarian models Hydra, Hydractinia, and Nematostella. Different expression patterns are consistent with divergent functions. Our data do not fully support previous assertions regarding Wnt gene homology, and suggest a more complex history of Wnt family genes than previously suggested. This includes high rates of sequence divergence and lineage-specific duplications of Wnt genes within medusozoans, followed by functional divergence over evolutionary time scales. © 2014 Wiley Periodicals, Inc.

  19. Coordinated transcriptional regulation patterns associated with infertility phenotypes in men

    PubMed Central

    Ellis, Peter J I; Furlong, Robert A; Conner, Sarah J; Kirkman‐Brown, Jackson; Afnan, Masoud; Barratt, Christopher; Griffin, Darren K; Affara, Nabeel A

    2007-01-01

    Introduction Microarray gene‐expression profiling is a powerful tool for global analysis of the transcriptional consequences of disease phenotypes. Understanding the genetic correlates of particular pathological states is important for more accurate diagnosis and screening of patients, and thus for suggesting appropriate avenues of treatment. As yet, there has been little research describing gene‐expression profiling of infertile and subfertile men, and thus the underlying transcriptional events involved in loss of spermatogenesis remain unclear. Here we present the results of an initial screen of 33 patients with differing spermatogenic phenotypes. Methods Oligonucleotide array expression profiling was performed on testis biopsies for 33 patients presenting for testicular sperm extraction. Significantly regulated genes were selected using a mixed model analysis of variance. Principle components analysis and hierarchical clustering were used to interpret the resulting dataset with reference to the patient history, clinical findings and histological composition of the biopsies. Results Striking patterns of coordinated gene expression were found. The most significant contains multiple germ cell‐specific genes and corresponds to the degree of successful spermatogenesis in each patient, whereas a second pattern corresponds to inflammatory activity within the testis. Smaller‐scale patterns were also observed, relating to unique features of the individual biopsies. PMID:17496197

  20. Erasure and reestablishment of random allelic expression imbalance after epigenetic reprogramming

    PubMed Central

    Jeffries, Aaron Richard; Uwanogho, Dafe Aghogho; Cocks, Graham; Perfect, Leo William; Dempster, Emma; Mill, Jonathan; Price, Jack

    2016-01-01

    Clonal level random allelic expression imbalance and random monoallelic expression provides cellular heterogeneity within tissues by modulating allelic dosage. Although such expression patterns have been observed in multiple cell types, little is known about when in development these stochastic allelic choices are made. We examine allelic expression patterns in human neural progenitor cells before and after epigenetic reprogramming to induced pluripotency, observing that loci previously characterized by random allelic expression imbalance (0.63% of expressed genes) are generally reset to a biallelic state in induced pluripotent stem cells (iPSCs). We subsequently neuralized the iPSCs and profiled isolated clonal neural stem cells, observing that significant random allelic expression imbalance is reestablished at 0.65% of expressed genes, including novel loci not found to show allelic expression imbalance in the original parental neural progenitor cells. Allelic expression imbalance was associated with altered DNA methylation across promoter regulatory regions, with clones characterized by skewed allelic expression being hypermethylated compared to their biallelic sister clones. Our results suggest that random allelic expression imbalance is established during lineage commitment and is associated with increased DNA methylation at the gene promoter. PMID:27539784

  1. Erasure and reestablishment of random allelic expression imbalance after epigenetic reprogramming.

    PubMed

    Jeffries, Aaron Richard; Uwanogho, Dafe Aghogho; Cocks, Graham; Perfect, Leo William; Dempster, Emma; Mill, Jonathan; Price, Jack

    2016-10-01

    Clonal level random allelic expression imbalance and random monoallelic expression provides cellular heterogeneity within tissues by modulating allelic dosage. Although such expression patterns have been observed in multiple cell types, little is known about when in development these stochastic allelic choices are made. We examine allelic expression patterns in human neural progenitor cells before and after epigenetic reprogramming to induced pluripotency, observing that loci previously characterized by random allelic expression imbalance (0.63% of expressed genes) are generally reset to a biallelic state in induced pluripotent stem cells (iPSCs). We subsequently neuralized the iPSCs and profiled isolated clonal neural stem cells, observing that significant random allelic expression imbalance is reestablished at 0.65% of expressed genes, including novel loci not found to show allelic expression imbalance in the original parental neural progenitor cells. Allelic expression imbalance was associated with altered DNA methylation across promoter regulatory regions, with clones characterized by skewed allelic expression being hypermethylated compared to their biallelic sister clones. Our results suggest that random allelic expression imbalance is established during lineage commitment and is associated with increased DNA methylation at the gene promoter. © 2016 Jeffries et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  2. Differential expression of decorin and biglycan genes during mouse tooth development

    NASA Technical Reports Server (NTRS)

    Matsuura, T.; Duarte, W. R.; Cheng, H.; Uzawa, K.; Yamauchi, M.

    2001-01-01

    Small leucine-rich proteoglycans (SLRPs) have a number of biological functions and some of them are thought to regulate collagen mineralizaton in bone and tooth. We have previously identified and immunolocalized two members of the SLRPs family, decorin and biglycan, in bovine tooth/periodontium. To investigate their potential roles in tooth development, we examined the mRNA expression patterns of decorin, biglycan and type I collagen in newborn (day 19) mice tooth germs by in situ hybridization. At this developmental stage, the first maxillary and mandibular molars include stages before and after secretion of the predentin matrix, respectively. The expression of decorin mRNA coincided with that of type I collagen mRNA and was mostly observed in secretory odontoblasts, while the biglycan mRNA was expressed throughout the tooth germ, including pre-secretory odontoblasts/ameloblasts, dental papilla and stellate reticulum. However, its signal in secretory odontoblasts was not as evident as that of decorin. In mandibular incisors, where a significant amount of predentin matrix and a small amount of enamel matrix were already secreted, a similar differential expression pattern was observed. In secretory ameloblasts the biglycan mRNA expression was apparent, while that of decorin was not. These differential expression patterns suggest the distinct roles of biglycan and decorin in the process of tooth development.

  3. Dlx homeobox gene family expression in osteoclasts.

    PubMed

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  4. Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

    PubMed

    Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

    2015-06-01

    Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  5. Hidden among the crowd: differential DNA methylation-expression correlations in cancer occur at important oncogenic pathways

    PubMed Central

    Mosquera Orgueira, Adrián

    2015-01-01

    DNA methylation is a frequent epigenetic mechanism that participates in transcriptional repression. Variations in DNA methylation with respect to gene expression are constant, and, for unknown reasons, some genes with highly methylated promoters are sometimes overexpressed. In this study we have analyzed the expression and methylation patterns of thousands of genes in five groups of cancer and normal tissue samples in order to determine local and genome-wide differences. We observed significant changes in global methylation-expression correlation in all the neoplasms, which suggests that differential correlation events are frequent in cancer. A focused analysis in the breast cancer cohort identified 1662 genes whose correlation varies significantly between normal and cancerous breast, but whose DNA methylation and gene expression patterns do not change substantially. These genes were enriched in cancer-related pathways and repressive chromatin features across various model cell lines, such as PRC2 binding and H3K27me3 marks. Substantial changes in methylation-expression correlation indicate that these genes are subject to epigenetic remodeling, where the differential activity of other factors break the expected relationship between both variables. Our findings suggest a complex regulatory landscape where a redistribution of local and large-scale chromatin repressive domains at differentially correlated genes (DCGs) creates epigenetic hotspots that modulate cancer-specific gene expression. PMID:26029238

  6. X-linked gene expression in the Virginia opossum: differences between the paternally derived Gpd and Pgk-A loci

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Samollow, P.B.; Ford, A.L.; VandeBerg, J.L.

    1987-01-01

    Expression of X-linked glucose-6-phosphate dehydrogenase (G6PD) and phosphoglycerate kinase-A (PGK-A) in the Virginia opossum (Didelphis virginiana) was studied electrophoretically in animals from natural populations and those produced through controlled laboratory crosses. Blood from most of the wild animals exhibited a common single-banded phenotype for both enzymes. Rare variant animals, regardless of sex, exhibited single-banded phenotypes different in mobility from the common mobility class of the respective enzyme. The laboratory crosses confirmed the allelic basis for the common and rare phenotypes. Transmission of PGK-A phenotypes followed the pattern of determinate (nonrandom) inactivation of the paternally derived Pgk-A allele, and transmission ofmore » G6PD also was consistent with this pattern. A survey of tissue-specific expression of G6PD phenotypes of heterozygous females revealed, in almost all tissues, three-banded patterns skewed in favor of the allele that was expressed in blood cells. Three-banded patterns were never observed in males or in putatively homozygous females. These patterns suggest simultaneous, but unequal, expression of the maternally and paternally derived Gpd alleles within individual cells. The absence of such partial expression was noted in a parallel survey of females heterozygous at the Pgd-A locus. Thus, it appears that Gpd and Pgk-A are X-linked in D. virginiana and subject to preferential paternal allele inactivation, but that dosage compensation may not be complete for all paternally derived X-linked genes.« less

  7. EphrinA5 protein distribution in the developing mouse brain

    PubMed Central

    2010-01-01

    Background EphrinA5 is one of the best-studied members of the Eph-ephrin family of guidance molecules, known to be involved in brain developmental processes. Using in situ hybridization, ephrinA5 mRNA expression has been detected in the retinotectal, the thalamocortical, and the olfactory systems; however, no study focused on the distribution of the protein. Considering that this membrane-anchored molecule may act far from the neuron soma expressing the transcript, it is of a crucial interest to localize ephrinA5 protein to better understand its function. Results Using immunohistochemistry, we found that ephrinA5 protein is highly expressed in the developing mouse brain from E12.5 to E16.5. The olfactory bulb, the cortex, the striatum, the thalamus, and the colliculi showed high intensity of labelling, suggesting its implication in topographic mapping of olfactory, retinocollicular, thalamocortical, corticothalamic and mesostriatal systems. In the olfactory nerve, we found an early ephrinA5 protein expression at E12.5 suggesting its implication in the guidance of primary olfactory neurons into the olfactory bulb. In the thalamus, we detected a dynamic graduated protein expression, suggesting its role in the corticothalamic patterning, whereas ephrinA5 protein expression in the target region of mesencephalic dopaminergic neurones indicated its involvement in the mesostriatal topographic mapping. Following E16.5, the signal faded gradually and was barely detectable at P0, suggesting a main role for ephrinA5 in primary molecular events in topographic map formation. Conclusion Our work shows that ephrinA5 protein is expressed in restrictive regions of the developing mouse brain. This expression pattern points out the potential sites of action of this molecule in the olfactory, retinotectal, thalamocortical, corticothalamic and mesostriatal systems, during development. This study is essential to better understand the role of ephrinA5 during developmental topographic mapping of connections and to further characterise the mechanisms involved in pathway restoration following cell transplantation in the damaged brain. PMID:20738842

  8. The fin-to-limb transition as the re-organization of a Turing pattern

    PubMed Central

    Onimaru, Koh; Marcon, Luciano; Musy, Marco; Tanaka, Mikiko; Sharpe, James

    2016-01-01

    A Turing mechanism implemented by BMP, SOX9 and WNT has been proposed to control mouse digit patterning. However, its generality and contribution to the morphological diversity of fins and limbs has not been explored. Here we provide evidence that the skeletal patterning of the catshark Scyliorhinus canicula pectoral fin is likely driven by a deeply conserved Bmp–Sox9–Wnt Turing network. In catshark fins, the distal nodular elements arise from a periodic spot pattern of Sox9 expression, in contrast to the stripe pattern in mouse digit patterning. However, our computer model shows that the Bmp–Sox9–Wnt network with altered spatial modulation can explain the Sox9 expression in catshark fins. Finally, experimental perturbation of Bmp or Wnt signalling in catshark embryos produces skeletal alterations which match in silico predictions. Together, our results suggest that the broad morphological diversity of the distal fin and limb elements arose from the spatial re-organization of a deeply conserved Turing mechanism. PMID:27211489

  9. Antagonistic Self-Organizing Patterning Systems Control Maintenance and Regeneration of the Anteroposterior Axis in Planarians.

    PubMed

    Stückemann, Tom; Cleland, James Patrick; Werner, Steffen; Thi-Kim Vu, Hanh; Bayersdorf, Robert; Liu, Shang-Yun; Friedrich, Benjamin; Jülicher, Frank; Rink, Jochen Christian

    2017-02-06

    Planarian flatworms maintain their body plan in the face of constant internal turnover and can regenerate from arbitrary tissue fragments. Both phenomena require self-maintaining and self-organizing patterning mechanisms, the molecular mechanisms of which remain poorly understood. We show that a morphogenic gradient of canonical Wnt signaling patterns gene expression along the planarian anteroposterior (A/P) axis. Our results demonstrate that gradient formation likely occurs autonomously in the tail and that an autoregulatory module of Wnt-mediated Wnt expression both shapes the gradient at steady state and governs its re-establishment during regeneration. Functional antagonism between the tail Wnt gradient and an unknown head patterning system further determines the spatial proportions of the planarian A/P axis and mediates mutually exclusive molecular fate choices during regeneration. Overall, our results suggest that the planarian A/P axis is patterned by self-organizing patterning systems deployed from either end that are functionally coupled by mutual antagonism. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Using RNA-seq to determine patterns of sex-bias in gene expression in the brain of the sex-role reversed Gulf Pipefish (Syngnathus scovelli).

    PubMed

    Beal, Andria P; Martin, F Douglas; Hale, Matthew C

    2018-02-01

    Sex-bias in gene expression is a widespread mechanism for controlling the development of phenotypes that differ between males and females. Most studies on sex-bias in gene expression have focused on species that exhibit traditional sex-roles (male-male competition and female parental care). By contrast the Syngnathid fishes (sea horses, pipefish, and sea dragons) are a group of organisms where many species exhibit male brooding and sex-role reversal (female-female competition for mates and paternal parental care), and little is known about how patterns of sex-bias in gene expression vary in species with sex-role reversal. Here we utilize RNA-seq technology to investigate patterns of sex-bias in gene expression in the brain tissue of the Gulf Pipefish (Syngnathus scovelli) a species that exhibits sex-role reversal. Gene expression analysis identified 73 sex-biased genes, 26 genes upregulated in females and 47 genes upregulated in males. Gene ontology analysis found 52 terms enriched for the sex-biased genes in a wide range of pathways suggesting that multiple functions and processes differ between the sexes. We focused on two areas of interest: sex steroids/hormones and circadian rhythms, both of which exhibited sex-bias in gene expression, and are known to influence sexual development in other species. Lastly, the work presented herein contributes to a growing body of genome data available for the Syngnathids, increasing our knowledge on patterns of gene expression in these unusual fishes. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Detection of changes in gene regulatory patterns, elicited by perturbations of the Hsp90 molecular chaperone complex, by visualizing multiple experiments with an animation

    PubMed Central

    2011-01-01

    Background To make sense out of gene expression profiles, such analyses must be pushed beyond the mere listing of affected genes. For example, if a group of genes persistently display similar changes in expression levels under particular experimental conditions, and the proteins encoded by these genes interact and function in the same cellular compartments, this could be taken as very strong indicators for co-regulated protein complexes. One of the key requirements is having appropriate tools to detect such regulatory patterns. Results We have analyzed the global adaptations in gene expression patterns in the budding yeast when the Hsp90 molecular chaperone complex is perturbed either pharmacologically or genetically. We integrated these results with publicly accessible expression, protein-protein interaction and intracellular localization data. But most importantly, all experimental conditions were simultaneously and dynamically visualized with an animation. This critically facilitated the detection of patterns of gene expression changes that suggested underlying regulatory networks that a standard analysis by pairwise comparison and clustering could not have revealed. Conclusions The results of the animation-assisted detection of changes in gene regulatory patterns make predictions about the potential roles of Hsp90 and its co-chaperone p23 in regulating whole sets of genes. The simultaneous dynamic visualization of microarray experiments, represented in networks built by integrating one's own experimental with publicly accessible data, represents a powerful discovery tool that allows the generation of new interpretations and hypotheses. PMID:21672238

  12. Missing links: the genetic architecture of flowers [correction of flower] and floral diversification.

    PubMed

    Soltis, Douglas E; Soltis, Pamela S; Albert, Victor A; Oppenheimer, David G; dePamphilis, Claude W; Ma, Hong; Frohlich, Michael W; Theissen, Günter

    2002-01-01

    To understand the genetic architecture of floral development, including the origin and subsequent diversification of the flower, data are needed not only for a few model organisms but also for gymnosperms, basal angiosperm lineages and early-diverging eudicots. We must link what is known about derived model plants such as Arabidopsis, snapdragon and maize with other angiosperms. To this end, we suggest a massive evolutionary genomics effort focused on the identification and expression patterns of floral genes and elucidation of their expression patterns in 'missing-link' taxa differing in the arrangement, number and organization of floral parts.

  13. Wnt signaling underlies evolution and development of the butterfly wing pattern symmetry systems.

    PubMed

    Martin, Arnaud; Reed, Robert D

    2014-11-15

    Most butterfly wing patterns are proposed to be derived from a set of conserved pattern elements known as symmetry systems. Symmetry systems are so-named because they are often associated with parallel color stripes mirrored around linear organizing centers that run between the anterior and posterior wing margins. Even though the symmetry systems are the most prominent and diverse wing pattern elements, their study has been confounded by a lack of knowledge regarding the molecular basis of their development, as well as the difficulty of drawing pattern homologies across species with highly derived wing patterns. Here we present the first molecular characterization of symmetry system development by showing that WntA expression is consistently associated with the major basal, discal, central, and external symmetry system patterns of nymphalid butterflies. Pharmacological manipulations of signaling gradients using heparin and dextran sulfate showed that pattern organizing centers correspond precisely with WntA, wingless, Wnt6, and Wnt10 expression patterns, thus suggesting a role for Wnt signaling in color pattern induction. Importantly, this model is supported by recent genetic and population genomic work identifying WntA as the causative locus underlying wing pattern variation within several butterfly species. By comparing the expression of WntA between nymphalid butterflies representing a range of prototypical symmetry systems, slightly deviated symmetry systems, and highly derived wing patterns, we were able to infer symmetry system homologies in several challenging cases. Our work illustrates how highly divergent morphologies can be derived from modifications to a common ground plan across both micro- and macro-evolutionary time scales. Copyright © 2014 Elsevier Inc. All rights reserved.

  14. Expression of the Diabetes-Associated Gene TCF7L2 in Adult Mouse Brain

    PubMed Central

    LEE, SYANN; LEE, CHARLOTTE E.; ELIAS, CAROL F.; ELMQUIST, JOEL K.

    2014-01-01

    Polymorphisms of the gene TCF7L2 (transcription factor 7-like 2) are strongly associated with the development and progression of type 2 diabetes. TCF7L2 is important in the development of peripheral organs such as adipocytes, pancreas, and the intestine. However, very little is known about its expression elsewhere. In this study we used in situ hybridization histochemistry to show that TCF7L2 has a unique expression pattern in the mouse brain. TCF7L2 is expressed in two distinct populations. First, it is highly ex pressed in thalamic and tectal structures. Additionally, TCF7L2 mRNA is expressed at moderate to low levels in specific cells of the hypothalamus, preoptic nucleus, and circumventricular organs. Collectively, these patterns of expression suggest that TCF7L2 has distinct functions within the brain, with a general role in the development and maintenance of thalamic and midbrain neurons, and then a distinct role in autonomic homeostasis. PMID:19845015

  15. Morphological diversity of the avian foot is related with the pattern of msx gene expression in the developing autopod.

    PubMed

    Gañan, Y; Macias, D; Basco, R D; Merino, R; Hurle, J M

    1998-04-01

    The formation of the digits in amniota embryos is accompanied by apoptotic cell death of the interdigital mesoderm triggered through BMP signaling. Differences in the intensity of this apoptotic process account for the establishment of the different morphological types of feet observed in amniota (i.e., free-digits, webbed digits, lobulated digits). The molecular basis accounting for the differential pattern of interdigital cell death remains uncertain since the reduction of cell death in species with webbed digits is not accompanied by a parallel reduction in the pattern of expression of bmp genes in the interdigital regions. In this study we show that the duck interdigital web mesoderm exhibits an attenuated response to both BMP-induced apoptosis and TGFbeta-induced chondrogenesis in comparison with species with free digits. The attenuated response to these signals is accompanied by a reduced pattern of expression of msx-1 and msx-2 genes. Local application of FGF in the duck interdigit expands the domain of msx-2 expression but not the domain of msx-1 expression. This change in the expression of msx-2 is followed by a parallel increase in spontaneous and exogenous BMP-induced interdigital cell death, while the chondrogenic response to TGFbetas is unchanged. The regression of AER, as deduced by the pattern of extinction of fgf-8 expression, takes place in a similar fashion in the chick and duck regardless of the differences in interdigital cell death and msx gene expression. Implantation of BMP-beads in the distal limb mesoderm induces AER regression in both the chick and duck. This finding suggests an additional role for BMPs in the physiological regression of the AER. It is proposed that the formation of webbed vs free-digit feet in amniota results from a premature differentiation of the interdigital mesoderm into connective tissue caused by a reduced expression of msx genes in the developing autopod. Copyright 1998 Academic Press.

  16. Divergence between motoneurons: gene expression profiling provides a molecular characterization of functionally discrete somatic and autonomic motoneurons

    PubMed Central

    Cui, Dapeng; Dougherty, Kimberly J.; Machacek, David W.; Sawchuk, Michael; Hochman, Shawn; Baro, Deborah J.

    2009-01-01

    Studies in the developing spinal cord suggest that different motoneuron (MN) cell types express very different genetic programs, but the degree to which adult programs differ is unknown. To compare genetic programs between adult MN columnar cell types, we used laser capture micro-dissection (LCM) and Affymetrix microarrays to create expression profiles for three columnar cell types: lateral and medial MNs from lumbar segments and sympathetic preganglionic motoneurons located in the thoracic intermediolateral nucleus. A comparison of the three expression profiles indicated that ~7% (813/11,552) of the genes showed significant differences in their expression levels. The largest differences were observed between sympathetic preganglionic MNs and the lateral motor column, with 6% (706/11,552) of the genes being differentially expressed. Significant differences in expression were observed for 1.8% (207/11,552) of the genes when comparing sympathetic preganglionic MNs with the medial motor column. Lateral and medial MNs showed the least divergence, with 1.3% (150/11,552) of the genes being differentially expressed. These data indicate that the amount of divergence in expression profiles between identified columnar MNs does not strictly correlate with divergence of function as defined by innervation patterns (somatic/muscle vs. autonomic/viscera). Classification of the differentially expressed genes with regard to function showed that they underpin all fundamental cell systems and processes, although most differentially expressed genes encode proteins involved in signal transduction. Mining the expression profiles to examine transcription factors essential for MN development suggested that many of the same transcription factors participatein combinatorial codes in embryonic and adult neurons, but patterns of expression change significantly. PMID:16317082

  17. Expression and regulation of Sef, a novel signaling inhibitor of receptor tyrosine kinases-mediated signaling in the nervous system.

    PubMed

    Grothe, Claudia; Claus, Peter; Haastert, Kirsten; Lutwak, Ela; Ron, Dina

    2008-01-01

    Fibroblast growth factors (FGFs) signal via four distinct high affinity cell surface tyrosine kinase receptors, termed FGFR1-FGFR4 (FGFR-FGF-receptor). Recently, a new modulator of the FGF signaling pathway, the transmembrane protein 'similar expression to FGF genes' (Sef), has been identified in zebrafish and subsequently in mammals. Sef from mouse and human inhibits FGF mitogenic activity. In the present study, we analyzed the expression of Sef in distinct rat brain areas, in the spinal cord and in peripheral nerves and spinal ganglia using semi-quantitative RT-PCR. Furthermore, we studied the cellular expression pattern of Sef in intact spinal ganglia and sciatic nerves and, in addition, after crush lesion, using in situ hybridization and immunohistochemistry. Sef transcripts were expressed in all brain areas evaluated and in the spinal cord. A neuronal expression was found in both intact and injured spinal ganglia. Intact sciatic nerves, however, showed little or no Sef expression. Seven days after injury, high Sef expression was concentrated to the crush site, and Schwann cells seemed to be the source of Sef. The labeling pattern of up-regulated Sef was complementary to the patterns of FGF-2 and FGFR1-3, which were localized proximal and distal to the crush site. These results suggest an involvement of Sef during the nerve regeneration process, possibly by fine-tuning the effects of FGF signaling.

  18. Pervasive Effects of Aging on Gene Expression in Wild Wolves.

    PubMed

    Charruau, Pauline; Johnston, Rachel A; Stahler, Daniel R; Lea, Amanda; Snyder-Mackler, Noah; Smith, Douglas W; vonHoldt, Bridgett M; Cole, Steven W; Tung, Jenny; Wayne, Robert K

    2016-08-01

    Gene expression levels change as an individual ages and responds to environmental conditions. With the exception of humans, such patterns have principally been studied under controlled conditions, overlooking the array of developmental and environmental influences that organisms encounter under conditions in which natural selection operates. We used high-throughput RNA sequencing (RNA-Seq) of whole blood to assess the relative impacts of social status, age, disease, and sex on gene expression levels in a natural population of gray wolves (Canis lupus). Our findings suggest that age is broadly associated with gene expression levels, whereas other examined factors have minimal effects on gene expression patterns. Further, our results reveal evolutionarily conserved signatures of senescence, such as immunosenescence and metabolic aging, between wolves and humans despite major differences in life history and environment. The effects of aging on gene expression levels in wolves exhibit conservation with humans, but the more rapid expression differences observed in aging wolves is evolutionarily appropriate given the species' high level of extrinsic mortality due to intraspecific aggression. Some expression changes that occur with age can facilitate physical age-related changes that may enhance fitness in older wolves. However, the expression of these ancestral patterns of aging in descendant modern dogs living in highly modified domestic environments may be maladaptive and cause disease. This work provides evolutionary insight into aging patterns observed in domestic dogs and demonstrates the applicability of studying natural populations to investigate the mechanisms of aging. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  19. Tlx-1 and Tlx-3 homeobox gene expression in cranial sensory ganglia and hindbrain of the chick embryo: markers of patterned connectivity.

    PubMed

    Logan, C; Wingate, R J; McKay, I J; Lumsden, A

    1998-07-15

    Recent evidence suggests that in vertebrates the formation of distinct neuronal cell types is controlled by specific families of homeodomain transcription factors. Furthermore, the expression domains of a number of these genes correlates with functionally integrated neuronal populations. We have isolated two members of the divergent T-cell leukemia translocation (HOX11/Tlx) homeobox gene family from chick, Tlx-1 and Tlx-3, and show that they are expressed in differentiating neurons of both the peripheral and central nervous systems. In the peripheral nervous system, Tlx-1 and Tlx-3 are expressed in overlapping domains within the placodally derived components of a number of cranial sensory ganglia. Tlx-3, unlike Tlx-1, is also expressed in neural crest-derived dorsal root and sympathetic ganglia. In the CNS, both genes are expressed in longitudinal columns of neurons at specific dorsoventral levels of the hindbrain. Each column has distinct anterior and/or posterior limits that respect inter-rhombomeric boundaries. Tlx-3 is also expressed in D2 and D3 neurons of the spinal cord. Tlx-1 and Tlx-3 expression patterns within the peripheral and central nervous systems suggest that Tlx proteins may be involved not only in the differentiation and/or survival of specific neuronal populations but also in the establishment of neuronal circuitry. Furthermore, by analogy with the LIM genes, Tlx family members potentially define sensory columns early within the developing hindbrain in a combinatorial manner.

  20. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  1. Activation of extrasynaptic, but not synaptic, NMDA receptors modifies amyloid precursor protein expression pattern and increases amyloid-ß production.

    PubMed

    Bordji, Karim; Becerril-Ortega, Javier; Nicole, Olivier; Buisson, Alain

    2010-11-24

    Calcium is a key mediator controlling essential neuronal functions depending on electrical activity. Altered neuronal calcium homeostasis affects metabolism of amyloid precursor protein (APP), leading to increased production of β-amyloid (Aβ), and contributing to the initiation of Alzheimer's disease (AD). A linkage between excessive glutamate receptor activation and neuronal Aβ release was established, and recent reports suggest that synaptic and extrasynaptic NMDA receptor (NMDAR) activation may have distinct consequences in plasticity, gene regulation, and neuronal death. Here, we report for the first time that prolonged activation of extrasynaptic NMDAR, but not synaptic NMDAR, dramatically increased the neuronal production of Aβ. This effect was preceded by a shift from APP695 to Kunitz protease inhibitory domain (KPI) containing APPs (KPI-APPs), isoforms exhibiting an important amyloidogenic potential. Conversely, after synaptic NMDAR activation, we failed to detect any KPI-APP expression and neuronal Aβ production was not modified. Calcium imaging data showed that intracellular calcium concentration after extrasynaptic NMDAR stimulation was lower than after synaptic activation. This suggests distinct signaling pathways for each pool of receptors. We found that modification of neuronal APP expression pattern triggered by extrasynaptic NMDAR activation was regulated at an alternative splicing level involving calcium-/calmodulin-dependent protein kinase IV, but overall APP expression remained identical. Finally, memantine dose-dependently inhibited extrasynaptic NMDAR-induced KPI-APPs expression as well as neuronal Aβ release. Altogether, these data suggest that a chronic activation of extrasynaptic NMDAR promotes amyloidogenic KPI-APP expression leading to neuronal Aβ release, representing a causal risk factor for developing AD.

  2. Phytoplankton-bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge.

    PubMed

    Bertrand, Erin M; McCrow, John P; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B; Delmont, Tom O; Post, Anton F; Sipler, Rachel E; Spackeen, Jenna L; Xu, Kai; Bronk, Deborah A; Hutchins, David A; Allen, Andrew E

    2015-08-11

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton-bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton-bacterial interactions in both positive and negative feedback loops.

  3. Comparative gene expression analysis of Dtg, a novel target gene of Dpp signaling pathway in the early Drosophila melanogaster embryo.

    PubMed

    Hodar, Christian; Zuñiga, Alejandro; Pulgar, Rodrigo; Travisany, Dante; Chacon, Carlos; Pino, Michael; Maass, Alejandro; Cambiazo, Verónica

    2014-02-10

    In the early Drosophila melanogaster embryo, Dpp, a secreted molecule that belongs to the TGF-β superfamily of growth factors, activates a set of downstream genes to subdivide the dorsal region into amnioserosa and dorsal epidermis. Here, we examined the expression pattern and transcriptional regulation of Dtg, a new target gene of Dpp signaling pathway that is required for proper amnioserosa differentiation. We showed that the expression of Dtg was controlled by Dpp and characterized a 524-bp enhancer that mediated expression in the dorsal midline, as well as, in the differentiated amnioserosa in transgenic reporter embryos. This enhancer contained a highly conserved region of 48-bp in which bioinformatic predictions and in vitro assays identified three Mad binding motifs. Mutational analysis revealed that these three motifs were necessary for proper expression of a reporter gene in transgenic embryos, suggesting that short and highly conserved genomic sequences may be indicative of functional regulatory regions in D. melanogaster genes. Dtg orthologs were not detected in basal lineages of Dipterans, which unlike D. melanogaster develop two extra-embryonic membranes, amnion and serosa, nevertheless Dtg orthologs were identified in the transcriptome of Musca domestica, in which dorsal ectoderm patterning leads to the formation of a single extra-embryonic membrane. These results suggest that Dtg was recruited as a new component of the network that controls dorsal ectoderm patterning in the lineage leading to higher Cyclorrhaphan flies, such as D. melanogaster and M. domestica. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. Molecular cloning, mRNA expression and tissue distribution analysis of Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors.

    PubMed

    Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng

    2015-01-25

    Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Phytoplankton–bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge

    PubMed Central

    Bertrand, Erin M.; McCrow, John P.; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B.; Delmont, Tom O.; Post, Anton F.; Sipler, Rachel E.; Spackeen, Jenna L.; Xu, Kai; Bronk, Deborah A.; Hutchins, David A.; Allen, Andrew E.

    2015-01-01

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton–bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton–bacterial interactions in both positive and negative feedback loops. PMID:26221022

  6. Dual mode of embryonic development is highlighted by expression and function of Nasonia pair-rule genes

    PubMed Central

    Rosenberg, Miriam I; Brent, Ava E; Payre, François; Desplan, Claude

    2014-01-01

    Embryonic anterior–posterior patterning is well understood in Drosophila, which uses ‘long germ’ embryogenesis, in which all segments are patterned before cellularization. In contrast, most insects use ‘short germ’ embryogenesis, wherein only head and thorax are patterned in a syncytial environment while the remainder of the embryo is generated after cellularization. We use the wasp Nasonia (Nv) to address how the transition from short to long germ embryogenesis occurred. Maternal and gap gene expression in Nasonia suggest long germ embryogenesis. However, the Nasonia pair-rule genes even-skipped, odd-skipped, runt and hairy are all expressed as early blastoderm pair-rule stripes and late-forming posterior stripes. Knockdown of Nv eve, odd or h causes loss of alternate segments at the anterior and complete loss of abdominal segments. We propose that Nasonia uses a mixed mode of segmentation wherein pair-rule genes pattern the embryo in a manner resembling Drosophila at the anterior and ancestral Tribolium at the posterior. DOI: http://dx.doi.org/10.7554/eLife.01440.001 PMID:24599282

  7. Analyses of the NAC transcription factor gene family in Gossypium raimondii Ulbr.: chromosomal location, structure, phylogeny, and expression patterns.

    PubMed

    Shang, Haihong; Li, Wei; Zou, Changsong; Yuan, Youlu

    2013-07-01

    NAC domain proteins are plant-specific transcription factors known to play diverse roles in various plant developmental processes. In the present study, we performed the first comprehensive study of the NAC gene family in Gossypium raimondii Ulbr., incorporating phylogenetic, chromosomal location, gene structure, conserved motif, and expression profiling analyses. We identified 145 NAC transcription factor (NAC-TF) genes that were phylogenetically clustered into 18 distinct subfamilies. Of these, 127 NAC-TF genes were distributed across the 13 chromosomes, 80 (55%) were preferentially retained duplicates located in both duplicated regions and six were located in triplicated chromosomal regions. The majority of NAC-TF genes showed temporal-, spatial-, and tissue-specific expression patterns based on transcriptomic and qRT-PCR analyses. However, the expression patterns of several duplicate genes were partially redundant, suggesting the occurrence of sub-functionalization during their evolution. Based on their genomic organization, we concluded that genomic duplications contributed significantly to the expansion of the NAC-TF gene family in G. raimondii. Comprehensive analysis of their expression profiles could provide novel insights into the functional divergence among members of the NAC gene family in G. raimondii. © 2013 Institute of Botany, Chinese Academy of Sciences.

  8. The pivotal role of aristaless in development and evolution of diverse antennal morphologies in moths and butterflies.

    PubMed

    Ando, Toshiya; Fujiwara, Haruhiko; Kojima, Tetsuya

    2018-01-25

    Antennae are multi-segmented appendages and main odor-sensing organs in insects. In Lepidoptera (moths and butterflies), antennal morphologies have diversified according to their ecological requirements. While diurnal butterflies have simple, rod-shaped antennae, nocturnal moths have antennae with protrusions or lateral branches on each antennal segment for high-sensitive pheromone detection. A previous study on the Bombyx mori (silk moth) antenna, forming two lateral branches per segment, during metamorphosis has revealed the dramatic change in expression of antennal patterning genes to segmentally reiterated, branch-associated pattern and abundant proliferation of cells contributing almost all the dorsal half of the lateral branch. Thus, localized cell proliferation possibly controlled by the branch-associated expression of antennal patterning genes is implicated in lateral branch formation. Yet, actual gene function in lateral branch formation in Bombyx mori and evolutionary mechanism of various antennal morphologies in Lepidoptera remain elusive. We investigated the function of several genes and signaling specifically in lateral branch formation in Bombyx mori by the electroporation-mediated incorporation of siRNAs or morpholino oligomers. Knock down of aristaless, a homeobox gene expressed specifically in the region of abundant cell proliferation within each antennal segment, during metamorphosis resulted in missing or substantial shortening of lateral branches, indicating its importance for lateral branch formation. aristaless expression during metamorphosis was lost by knock down of Distal-less and WNT signaling but derepressed by knock down of Notch signaling, suggesting the strict determination of the aristaless expression domain within each antennal segment by the combinatorial action of them. In addition, analyses of pupal aristaless expression in antennae with various morphologies of several lepidopteran species revealed that the aristaless expression pattern has a striking correlation with antennal shapes, whereas the segmentally reiterated expression pattern was observed irrespective of antennal morphologies. Our results presented here indicate the significance of aristaless function in lateral branch formation in B. mori and imply that the diversification in the aristaless expression pattern within each antennal segment during metamorphosis is one of the significant determinants of antennal morphologies. According to these findings, we propose a mechanism underlying development and evolution of lepidopteran antennae with various morphologies.

  9. Sex and strategy use matters for pattern separation, adult neurogenesis, and immediate early gene expression in the hippocampus.

    PubMed

    Yagi, Shunya; Chow, Carmen; Lieblich, Stephanie E; Galea, Liisa A M

    2016-01-01

    Adult neurogenesis in the dentate gyrus (DG) plays a crucial role for pattern separation, and there are sex differences in the regulation of neurogenesis. Although sex differences, favoring males, in spatial navigation have been reported, it is not known whether there are sex differences in pattern separation. The current study was designed to determine whether there are sex differences in the ability for separating similar or distinct patterns, learning strategy choice, adult neurogenesis, and immediate early gene (IEG) expression in the DG in response to pattern separation training. Male and female Sprague-Dawley rats received a single injection of the DNA synthesis marker, bromodeoxyuridine (BrdU), and were tested for the ability of separating spatial patterns in a spatial pattern separation version of delayed nonmatching to place task using the eight-arm radial arm maze. Twenty-seven days following BrdU injection, rats received a probe trial to determine whether they were idiothetic or spatial strategy users. We found that male spatial strategy users outperformed female spatial strategy users only when separating similar, but not distinct, patterns. Furthermore, male spatial strategy users had greater neurogenesis in response to pattern separation training than all other groups. Interestingly, neurogenesis was positively correlated with performance on similar pattern trials during pattern separation in female spatial strategy users but negatively correlated with performance in male idiothetic strategy users. These results suggest that the survival of new neurons may play an important positive role for pattern separation of similar patterns in females. Furthermore, we found sex and strategy differences in IEG expression in the CA1 and CA3 regions in response to pattern separation. These findings emphasize the importance of studying biological sex on hippocampal function and neural plasticity. © 2015 Wiley Periodicals, Inc.

  10. Psychiatric Symptoms Among Puerto Ricans in Puerto Rico and New York City

    ERIC Educational Resources Information Center

    Haberman, Paul W.

    1976-01-01

    Findings suggest that the consistently high rates of survey reported symptoms among Puerto Rican respondents derive primarily from culturally patterned differences in modes of expressing distress. (Author/AM)

  11. Cross-regulation in the mouse HoxB complex: the expression of Hoxb2 in rhombomere 4 is regulated by Hoxb1.

    PubMed

    Maconochie, M K; Nonchev, S; Studer, M; Chan, S K; Pöpperl, H; Sham, M H; Mann, R S; Krumlauf, R

    1997-07-15

    Correct regulation of the segment-restricted patterns of Hox gene expression is essential for proper patterning of the vertebrate hindbrain. We have examined the molecular basis of restricted expression of Hoxb2 in rhombomere 4 (r4), by using deletion analysis in transgenic mice to identify an r4 enhancer from the mouse gene. A bipartite Hox/Pbx binding motif is located within this enhancer, and in vitro DNA binding experiments showed that the vertebrate labial-related protein Hoxb1 will cooperatively bind to this site in a Pbx/Exd-dependent manner. The Hoxb2 r4 enhancer can be transactivated in vivo by the ectopic expression of Hoxb1, Hoxa1, and Drosophila labial in transgenic mice. In contrast, ectopic Hoxb2 and Hoxb4 are unable to induce expression, indicating that in vivo this enhancer preferentially responds to labial family members. Mutational analysis demonstrated that the bipartite Hox/Pbx motif is required for r4 enhancer activity and the responses to retinoids and ectopic Hox expression. Furthermore, three copies of the Hoxb2 motif are sufficient to mediate r4 expression in transgenic mouse embryos and a labial pattern in Drosophila embryos. This reporter expression in Drosophila embryos is dependent upon endogenous labial and exd, suggesting that the ability of this Hox/Pbx site to interact with labial-related proteins has been evolutionarily conserved. The endogenous Hoxb2 gene is no longer upregulated in r4 in Hoxb1 homozygous mutant embryos. On the basis of these experiments we conclude that the r4-restricted domain of Hoxb2 in the hindbrain is the result of a direct cross-regulatory interaction by Hoxb1 involving vertebrate Pbx proteins as cofactors. This suggests that part of the functional role of Hoxb1 in maintaining r4 identity may be mediated by the Hoxb2 gene.

  12. Role of heat shock protein Hsp25 in the response of the orofacial nuclei motor system to physiological stress

    NASA Technical Reports Server (NTRS)

    Murashov, A. K.; Talebian, S.; Wolgemuth, D. J.

    1998-01-01

    Although expression of the small heat shock protein family member Hsp25 has been previously observed in the central nervous system (CNS), both constitutively and upon induction, its function in the CNS remains far from clear. In the present study we have characterized the spatial pattern of expression of Hsp25 in the normal adult mouse brain as well as the changes in expression patterns induced by subjecting mice to experimental hyperthermia or hypoxia. Immunohistochemical analysis revealed a surprisingly restricted pattern of constitutive expression of Hsp25 in the brain, limited to the facial, trigeminal, ambiguus, hypoglossal and vagal motor nuclei of the brainstem. After hyperthermia or hypoxia treatment, significant increases in the levels of Hsp25 were observed in these same areas and also in fibers of the facial and trigeminal nerve tracts. Immunoblot analysis of protein lysates from brainstem also showed the same pattern of induction of Hsp25. Surprisingly, no other area in the brain showed expression of Hsp25, in either control or stressed animals. The highly restricted expression of Hsp25 implies that this protein may have a specific physiological role in the orofacial motor nuclei, which govern precise coordination between muscles of mastication and the pharynx, larynx, and face. Its rapid induction after stress further suggests that Hsp25 may serve as a specific molecular chaperone in the lower cholinergic motor neurons and along their fibers under conditions of stress or injury. Copyright 1998 Elsevier Science B.V.

  13. Signaling by Bone Morphogenetic Proteins directs formation of an ectodermal signaling center that regulates craniofacial development

    PubMed Central

    Foppiano, Silvia; Hu, Diane; Marcucio, Ralph S.

    2008-01-01

    We previously described a signaling center, the Frontonasal Ectodermal Zone (FEZ) that regulates growth and patterning of the frontonasal process (FNP). The FEZ is comprised of FNP ectoderm flanking a boundary between Sonic hedgehog (Shh) and Fibroblast growth factor 8 (Fgf8) expression domains. Our objective was to examine BMP signaling during formation of the FEZ. We blocked BMP signaling throughout the FNP prior to FEZ formation by infecting chick embryos at stage 10 (HH10) with a replication competent avian retrovirus encoding the BMP antagonist Noggin. We assessed gene expression patterns in the FNP 72 hours after infection (~HH22) and observed that Shh expression was reduced or absent. In the mesenchyme we observed that Bmp2 transcripts were absent while the Bmp4 expression domain was expanded proximally. In addition to the molecular changes, infected embryos also exhibited facial malformations at 72 and 96 hours after infection suggesting that the FEZ did not form. Our data indicate that reduced cell proliferation, but not apoptosis, in the mesenchyme contributed to the phenotype that we observed. Additionally, adding exogenous SHH into the mesenchyme of RCAS-Noggin infected embryos did not restore Bmp2 and Bmp4 to a normal pattern of expression. These data indicate that BMP signaling mediates interactions between tissues in the FNP that regulate FEZ formation; and that the correct pattern of Bmp2 and Bmp4, but not Bmp7, expression in the FNP mesenchyme requires signaling by the BMP pathway. PMID:18028903

  14. Cadherins in cerebellar development: translation of embryonic patterning into mature functional compartmentalization.

    PubMed

    Redies, Christoph; Neudert, Franziska; Lin, Juntang

    2011-09-01

    Cadherins are cell adhesion molecules with multiple morphogenic functions in brain development, for example, in neuroblast migration and aggregation, axon navigation, neural circuit formation, and synaptogenesis. More than 100 members of the cadherin superfamily are expressed in the developing and mature brain. Most of the cadherins investigated, in particular classic cadherins and δ-protocadherins, are expressed in the cerebellum. For several cadherin subtypes, expression begins at early embryonic stages and persists until mature stages of cerebellar development. At intermediate stages, distinct Purkinje cell clusters exhibit unique rostrocaudal and mediolateral expression profiles for each cadherin. In the chicken, mouse, and other species, the Purkinje cell clusters are separated by intervening raphes of migrating granule cells. This pattern of Purkinje cell clusters/raphes is, at least in part, continuous with the parasagittal striping pattern that is apparent in the mature cerebellar cortex, for example, for zebrin II/aldolase C. Moreover, subregions of the deep cerebellar nuclei, vestibular nuclei and the olivary complex also express cadherins differentially. Neuroanatomical evidence suggests that the nuclear subregions and cortical domains that express the same cadherin subtype are connected to each other, to form neural subcircuits of the cerebellar system. Cadherins thus provide a molecular code that specifies not only embryonic structures but also functional cerebellar compartmentalization. By following the implementation of this code, it can be revealed how mature functional architecture emerges from embryonic patterning during cerebellar development. Dysfunction of some cadherins is associated with psychiatric diseases and developmental impairments and may also affect cerebellar function.

  15. Identifying arsenic trioxide (ATO) functions in leukemia cells by using time series gene expression profiles.

    PubMed

    Yang, Hong; Lin, Shan; Cui, Jingru

    2014-02-10

    Arsenic trioxide (ATO) is presently the most active single agent in the treatment of acute promyelocytic leukemia (APL). In order to explore the molecular mechanism of ATO in leukemia cells with time series, we adopted bioinformatics strategy to analyze expression changing patterns and changes in transcription regulation modules of time series genes filtered from Gene Expression Omnibus database (GSE24946). We totally screened out 1847 time series genes for subsequent analysis. The KEGG (Kyoto encyclopedia of genes and genomes) pathways enrichment analysis of these genes showed that oxidative phosphorylation and ribosome were the top 2 significantly enriched pathways. STEM software was employed to compare changing patterns of gene expression with assigned 50 expression patterns. We screened out 7 significantly enriched patterns and 4 tendency charts of time series genes. The result of Gene Ontology showed that functions of times series genes mainly distributed in profiles 41, 40, 39 and 38. Seven genes with positive regulation of cell adhesion function were enriched in profile 40, and presented the same first increased model then decreased model as profile 40. The transcription module analysis showed that they mainly involved in oxidative phosphorylation pathway and ribosome pathway. Overall, our data summarized the gene expression changes in ATO treated K562-r cell lines with time and suggested that time series genes mainly regulated cell adhesive. Furthermore, our result may provide theoretical basis of molecular biology in treating acute promyelocytic leukemia. Copyright © 2013 Elsevier B.V. All rights reserved.

  16. Neonatal Persistent Exposure to 6-Propyl-2-thiouracil, a Thyroid-Disrupting Chemical, Differentially Modulates Expression of Hepatic Catalase and C/EBP-β in Adult Rats.

    PubMed

    Bunker, Suresh Kumar; Dandapat, Jagneshwar; Sahoo, Sunil Kumar; Roy, Anita; Chainy, Gagan B N

    2016-02-01

    Persistent exposure of rats to 6-propyl-2-thiouracil (PTU) from birth resulted in decreases in plasma thyroid hormone (TH) levels and hepatic expression of catalase and CCAAT enhancer binding protein β (C/EBP-β). Catalase promoter region (-185 to +52) that contains binding sites for C/EBP-β showed an augmentation in the methylation level along with a change in methylation pattern of CpG islands in response to PTU treatment. PTU withdrawal on 30 days of birth restored TH levels and C/EBP-β to control rats in adulthood. Although catalase expression was restored to some extent in adult rats in response to PTU withdrawal, a permanent change in its promoter CpG methylation pattern was recorded. The results suggest that downregulation of adult hepatic catalase gene in response to persistent neonatal PTU exposure may not solely be attributed to thyroid-disrupting properties of PTU. It is possible that besides thyroid-disrupting behavior, PTU may impair expression of hepatic catalase by altering methylation pattern of its promoter. © 2015 Wiley Periodicals, Inc.

  17. Visual search for facial expressions of emotions: a comparison of dynamic and static faces.

    PubMed

    Horstmann, Gernot; Ansorge, Ulrich

    2009-02-01

    A number of past studies have used the visual search paradigm to examine whether certain aspects of emotional faces are processed preattentively and can thus be used to guide attention. All these studies presented static depictions of facial prototypes. Emotional expressions conveyed by the movement patterns of the face have never been examined for their preattentive effect. The present study presented for the first time dynamic facial expressions in a visual search paradigm. Experiment 1 revealed efficient search for a dynamic angry face among dynamic friendly faces, but inefficient search in a control condition with static faces. Experiments 2 to 4 suggested that this pattern of results is due to a stronger movement signal in the angry than in the friendly face: No (strong) advantage of dynamic over static faces is revealed when the degree of movement is controlled. These results show that dynamic information can be efficiently utilized in visual search for facial expressions. However, these results do not generally support the hypothesis that emotion-specific movement patterns are always preattentively discriminated. (c) 2009 APA, all rights reserved

  18. Sequence and expression pattern of the germ line marker vasa in honey bees and stingless bees

    PubMed Central

    2009-01-01

    Queens and workers of social insects differ in the rates of egg laying. Using genomic information we determined the sequence of vasa, a highly conserved gene specific to the germ line of metazoans, for the honey bee and four stingless bees. The vasa sequence of social bees differed from that of other insects in two motifs. By RT-PCR we confirmed the germ line specificity of Amvasa expression in honey bees. In situ hybridization on ovarioles showed that Amvasa is expressed throughout the germarium, except for the transition zone beneath the terminal filament. A diffuse vasa signal was also seen in terminal filaments suggesting the presence of germ line cells. Oocytes showed elevated levels of Amvasa transcripts in the lower germarium and after follicles became segregated. In previtellogenic follicles, Amvasa transcription was detected in the trophocytes, which appear to supply its mRNA to the growing oocyte. A similar picture was obtained for ovarioles of the stingless bee Melipona quadrifasciata, except that Amvasa expression was higher in the oocytes of previtellogenic follicles. The social bees differ in this respect from Drosophila, the model system for insect oogenesis, suggesting that changes in the sequence and expression pattern of vasa may have occurred during social evolution. PMID:21637523

  19. Reconstruction of the genome-scale co-expression network for the Hippo signaling pathway in colorectal cancer.

    PubMed

    Dehghanian, Fariba; Hojati, Zohreh; Hosseinkhan, Nazanin; Mousavian, Zaynab; Masoudi-Nejad, Ali

    2018-05-26

    The Hippo signaling pathway (HSP) has been identified as an essential and complex signaling pathway for tumor suppression that coordinates proliferation, differentiation, cell death, cell growth and stemness. In the present study, we conducted a genome-scale co-expression analysis to reconstruct the HSP in colorectal cancer (CRC). Five key modules were detected through network clustering, and a detailed discussion of two modules containing respectively 18 and 13 over and down-regulated members of HSP was provided. Our results suggest new potential regulatory factors in the HSP. The detected modules also suggest novel genes contributing to CRC. Moreover, differential expression analysis confirmed the differential expression pattern of HSP members and new suggested regulatory factors between tumor and normal samples. These findings can further reveal the importance of HSP in CRC. Copyright © 2018 Elsevier Ltd. All rights reserved.

  20. A Single-Wing Removal Method to Assess Correspondence Between Gene Expression and Phenotype in Butterflies: The Case of Distal-less.

    PubMed

    Adhikari, Kiran; Otaki, Joji M

    2016-02-01

    It is often desirable but difficult to retrieve information on the mature phenotype of an immature tissue sample that has been subjected to gene expression analysis. This problem cannot be ignored when individual variation within a species is large. To circumvent this problem in the butterfly wing system, we developed a new surgical method for removing a single forewing from a pupa using Junonia orithya; the operated pupa was left to develop to an adult without eclosion. The removed right forewing was subjected to gene expression analysis, whereas the non-removed left forewing was examined for color patterns. As a test case, we focused on Distal-less (Dll), which likely plays an active role in inducing elemental patterns, including eyespots. The Dll expression level in forewings was paired with eyespot size data from the same individual. One third of the operated pupae survived and developed wing color patterns. Dll expression levels were significantly higher in males than in females, although male eyespots were smaller in size than female eyespots. Eyespot size data showed weak but significant correlations with the Dll expression level in females. These results demonstrate that a single-wing removal method was successfully applied to the butterfly wing system and suggest the weak and non-exclusive contribution of Dll to eyespot size determination in this butterfly. Our novel methodology for establishing correspondence between gene expression and phenotype can be applied to other candidate genes for color pattern development in butterflies. Conceptually similar methods may also be applicable in other developmental systems.

  1. Application of community phylogenetic approaches to understand gene expression: differential exploration of venom gene space in predatory marine gastropods.

    PubMed

    Chang, Dan; Duda, Thomas F

    2014-06-05

    Predatory marine gastropods of the genus Conus exhibit substantial variation in venom composition both within and among species. Apart from mechanisms associated with extensive turnover of gene families and rapid evolution of genes that encode venom components ('conotoxins'), the evolution of distinct conotoxin expression patterns is an additional source of variation that may drive interspecific differences in the utilization of species' 'venom gene space'. To determine the evolution of expression patterns of venom genes of Conus species, we evaluated the expression of A-superfamily conotoxin genes of a set of closely related Conus species by comparing recovered transcripts of A-superfamily genes that were previously identified from the genomes of these species. We modified community phylogenetics approaches to incorporate phylogenetic history and disparity of genes and their expression profiles to determine patterns of venom gene space utilization. Less than half of the A-superfamily gene repertoire of these species is expressed, and only a few orthologous genes are coexpressed among species. Species exhibit substantially distinct expression strategies, with some expressing sets of closely related loci ('under-dispersed' expression of available genes) while others express sets of more disparate genes ('over-dispersed' expression). In addition, expressed genes show higher dN/dS values than either unexpressed or ancestral genes; this implies that expression exposes genes to selection and facilitates rapid evolution of these genes. Few recent lineage-specific gene duplicates are expressed simultaneously, suggesting that expression divergence among redundant gene copies may be established shortly after gene duplication. Our study demonstrates that venom gene space is explored differentially by Conus species, a process that effectively permits the independent and rapid evolution of venoms in these species.

  2. Population-Level Transcriptomic Responses of the Southern Ocean Salp Salpa thompsoni to Environment Variability of the Western Antarctic Peninsula Region

    NASA Astrophysics Data System (ADS)

    Bucklin, A. C.; Batta Lona, P. G.; Maas, A. E.; O'Neill, R. J.; Wiebe, P. H.

    2015-12-01

    In response to the changing Antarctic climate, the Southern Ocean salp Salpa thompsoni has shown altered patterns of distribution and abundance that are anticipated to have profound impacts on pelagic food webs and ecosystem dynamics. The physiological and molecular processes that underlay ecological function and biogeographical distribution are key to understanding present-day dynamics and predicting future trajectories. This study examined transcriptome-wide patterns of gene expression in relation to biological and physical oceanographic conditions in coastal, shelf and offshore waters of the Western Antarctic Peninsula (WAP) region during austral spring and summer 2011. Based on field observations and collections, seasonal changes in the distribution and abundance of salps of different life stages were associated with differences in water mass structure of the WAP. Our observations are consistent with previous suggestions that bathymetry and currents in Bransfield Strait could generate a retentive cell for an overwintering population of S. thompsoni, which may generate the characteristic salp blooms found throughout the region later in summer. The statistical analysis of transcriptome-wide patterns of gene expression revealed differences among salps collected in different seasons and from different habitats (i.e., coastal versus offshore) in the WAP. Gene expression patterns also clustered by station in austral spring - but not summer - collections, suggesting stronger heterogeneity of environmental conditions. During the summer, differentially expressed genes covered a wider range of functions, including those associated with stress responses. Future research using novel molecular transcriptomic / genomic characterization of S. thompsoni will allow more complete understanding of individual-, population-, and species-level responses to environmental variability and prediction of future dynamics of Southern Ocean food webs and ecosystems.

  3. Gaze Patterns in Auditory-Visual Perception of Emotion by Children with Hearing Aids and Hearing Children

    PubMed Central

    Wang, Yifang; Zhou, Wei; Cheng, Yanhong; Bian, Xiaoying

    2017-01-01

    This study investigated eye-movement patterns during emotion perception for children with hearing aids and hearing children. Seventy-eight participants aged from 3 to 7 were asked to watch videos with a facial expression followed by an oral statement, and these two cues were either congruent or incongruent in emotional valence. Results showed that while hearing children paid more attention to the upper part of the face, children with hearing aids paid more attention to the lower part of the face after the oral statement was presented, especially for the neutral facial expression/neutral oral statement condition. These results suggest that children with hearing aids have an altered eye contact pattern with others and a difficulty in matching visual and voice cues in emotion perception. The negative cause and effect of these gaze patterns should be avoided in earlier rehabilitation for hearing-impaired children with assistive devices. PMID:29312104

  4. Slower skeletal muscle phenotypes are critical for constitutive expression of Hsp70 in overloaded rat plantaris muscle.

    PubMed

    O'Neill, David E T; Aubrey, F Kris; Zeldin, David A; Michel, Robin N; Noble, Earl G

    2006-03-01

    Heat shock protein 72 (Hsp70) is constitutively expressed in rat hindlimb muscles, reportedly in proportion to their content of type I myosin heavy chain. This distribution pattern has been suggested to result from the higher recruitment and activity of such muscles and/or a specific relationship between myosin phenotype and Hsp70 content. To differentiate between these possibilities, the fiber-specific distribution of Hsp70 was examined in male Sprague-Dawley rat plantaris under control conditions, following a fast-to-slow phenotypic shift in response to surgically induced overload (O) and in response to O when the phenotypic shift was prevented by 3,5,3'-triiodo-dl-thyronine administration. Constitutive expression of Hsp70 was restricted to type I and IIa fibers in plantaris from control rats, and this fiber-specific pattern of expression was maintained following O of up to 28 days, although Hsp70 content in the O muscle doubled. When O (for 40 days) of the plantaris was combined with 3,5,3'-triiodo-dl-thyronine administration, despite typical hypertrophy in the overloaded plantaris, prevention of the normal phenotypic transformation also blocked the increased expression of Hsp70 observed in euthyroid controls. Collectively, these data suggest that chronic changes in constitutive expression of Hsp70 with altered contractile activity appear critically dependent on fast-to-slow phenotypic remodeling.

  5. Bisphenol A Exposure May Induce Hepatic Lipid Accumulation via Reprogramming the DNA Methylation Patterns of Genes Involved in Lipid Metabolism

    NASA Astrophysics Data System (ADS)

    Ke, Zhang-Hong; Pan, Jie-Xue; Jin, Lu-Yang; Xu, Hai-Yan; Yu, Tian-Tian; Ullah, Kamran; Rahman, Tanzil Ur; Ren, Jun; Cheng, Yi; Dong, Xin-Yan; Sheng, Jian-Zhong; Huang, He-Feng

    2016-08-01

    Accumulating evidence suggests a role of bisphenol A (BPA) in metabolic disorders. However, the underlying mechanism is still unclear. Using a mouse BPA exposure model, we investigated the effects of long-term BPA exposure on lipid metabolism and the underlying mechanisms. The male mice exposed to BPA (0.5 μg BPA /kg/day, a human relevant dose) for 10 months exhibited significant hepatic accumulation of triglycerides and cholesterol. The liver cells from the BPA-exposed mice showed significantly increased expression levels of the genes related to lipid synthesis. These liver cells showed decreased DNA methylation levels of Srebf1 and Srebf2, and increased expression levels of Srebf1 and Srebf2 that may upregulate the genes related to lipid synthesis. The expression levels of DNA methyltransferases were decreased in BPA-exposed mouse liver. Hepa1-6 cell line treated with BPA showed decreased expression levels of DNA methyltransferases and increased expression levels of genes involved in lipid synthesis. DNA methyltransferase knockdown in Hepa1-6 led to hypo-methylation and increased expression levels of genes involved in lipid synthesis. Our results suggest that long-term BPA exposure could induce hepatic lipid accumulation, which may be due to the epigenetic reprogramming of the genes involved in lipid metabolism, such as the alterations of DNA methylation patterns.

  6. Developmental decoupling of alternative phenotypes: insights from the transcriptomes of horn-polyphenic beetles

    PubMed Central

    Snell-Rood, Emilie C.; Cash, Amy; Han, Mira V.; Kijimoto, Teiya; Andrews, Justen; Moczek, Armin P.

    2010-01-01

    Developmental mechanisms play an important role in determining the costs, limits, and evolutionary consequences of phenotypic plasticity. One issue central to these claims is the hypothesis of developmental decoupling, where alternate morphs result from evolutionarily independent developmental pathways. We address this assumption through a microarray study that tests whether differences in gene expression between alternate morphs are as divergent as those between sexes, a classic example of developmental decoupling. We then examine whether genes with morph-biased expression are less conserved than genes with shared expression between morphs, as predicted if developmental decoupling relaxes pleiotropic constraints on divergence. We focus on the developing horns and brains of two species of horned beetles with spectacular sexual- and morph-dimorphism in the expression of horns and fighting behavior. We find that patterns of gene expression were as divergent between morphs as they were between sexes. However, overall patterns of gene expression were also highly correlated across morphs and sexes. Morph-biased genes were more evolutionarily divergent, suggesting a role of relaxed pleiotropic constraints or relaxed selection. Together these results suggest that alternate morphs are to some extent developmentally decoupled, and that this decoupling has significant evolutionary consequences. However, alternative morphs may not be as developmentally decoupled as sometimes assumed and such hypotheses of development should be revisited and refined. PMID:20731717

  7. Bisphenol A Exposure May Induce Hepatic Lipid Accumulation via Reprogramming the DNA Methylation Patterns of Genes Involved in Lipid Metabolism

    PubMed Central

    Ke, Zhang-Hong; Pan, Jie-Xue; Jin, Lu-Yang; Xu, Hai-Yan; Yu, Tian-Tian; Ullah, Kamran; Rahman, Tanzil Ur; Ren, Jun; Cheng, Yi; Dong, Xin-Yan; Sheng, Jian-Zhong; Huang, He-Feng

    2016-01-01

    Accumulating evidence suggests a role of bisphenol A (BPA) in metabolic disorders. However, the underlying mechanism is still unclear. Using a mouse BPA exposure model, we investigated the effects of long-term BPA exposure on lipid metabolism and the underlying mechanisms. The male mice exposed to BPA (0.5 μg BPA /kg/day, a human relevant dose) for 10 months exhibited significant hepatic accumulation of triglycerides and cholesterol. The liver cells from the BPA-exposed mice showed significantly increased expression levels of the genes related to lipid synthesis. These liver cells showed decreased DNA methylation levels of Srebf1 and Srebf2, and increased expression levels of Srebf1 and Srebf2 that may upregulate the genes related to lipid synthesis. The expression levels of DNA methyltransferases were decreased in BPA-exposed mouse liver. Hepa1-6 cell line treated with BPA showed decreased expression levels of DNA methyltransferases and increased expression levels of genes involved in lipid synthesis. DNA methyltransferase knockdown in Hepa1-6 led to hypo-methylation and increased expression levels of genes involved in lipid synthesis. Our results suggest that long-term BPA exposure could induce hepatic lipid accumulation, which may be due to the epigenetic reprogramming of the genes involved in lipid metabolism, such as the alterations of DNA methylation patterns. PMID:27502578

  8. Expression and evolution of Tiki1 and Tiki2 genes in vertebrates

    PubMed Central

    FEISTEL, KERSTIN; BRITO, JOSE M.; AMADO, NATHALIA G.; XU, CHIWEI; ABREU, JOSE G.; HE, XI

    2015-01-01

    Tiki1 is a Wnt protease and antagonist specifically expressed in the Spemann-Mangold Organizer and is required for head formation in Xenopus embryos. Here we report neighbor-joining phylogenetic analysis of vertebrate Tiki genes and their mRNA expression patterns in chick, mouse, and rabbit embryos. Tiki1 and Tiki2 orthologues are highly conserved, and exhibit similar but also different developmental expression patterns among the vertebrate/mammalian species analyzed. The Tiki1 gene is noticeably absent in the rodent lineage, but is present in lagomorphs and all other vertebrate/mammalian species examined. Expression in Hensen’s node, the equivalent of the Xenopus Organizer, was observed for Chick Tiki2 and Rabbit Tiki1 and Tiki2. Mouse Tiki2 was detected at low levels at gastrulation and head fold stages, but not in the node. Mouse Tiki2 and chick Tiki1 display similar expression in the dorsal spinal cord. Chick Tiki1 expression was also detected in the surface ectoderm and maxillary bud, while chick Tiki2 was found in the anterior intestinal portal, head mensenchyme and primitive atrium. Our expression analyses provide evidence that Tiki1 and Tiki2 are evolutionary conserved among vertebrate species and their expression in the Organizer and other regions suggests contributions of these Wnt inhibitors to embryonic patterning as well as organogenesis. Our analyses further reveal mis-regulation of TIKI1 and TIKI2 in human cancer and diseases. PMID:25354456

  9. Expression of SHOOT MERISTEMLESS, WUSCHEL, and ASYMMETRIC LEAVES1 Homologs in the Shoots of Podostemaceae: Implications for the Evolution of Novel Shoot Organogenesis[W

    PubMed Central

    Katayama, Natsu; Koi, Satoshi; Kato, Masahiro

    2010-01-01

    Podostemaceae (the river weeds) are ecologically and morphologically unusual angiosperms. The subfamily Tristichoideae has typical shoot apical meristems (SAMs) that produce leaves, but Podostemoideae is devoid of SAMs and new leaves arise below the base of older leaves. To reveal the genetic basis for the evolution of novel shoot organogenesis in Podostemaceae, we examined the expression patterns of key regulatory genes for shoot development (i.e., SHOOT MERISTEMLESS (STM), WUSCHEL (WUS), and ASYMMETRIC LEAVES1/ROUGH SHEATH2/PHANTASTICA (ARP) orthologs) in Tristichoideae and Podostemoideae. In the SAM-mediated shoots of Tristichoideae, like in model plants, STM and WUS orthologs were expressed in the SAM. In the SAM-less shoots of Podostemoideae, STM and WUS orthologs were expressed in the initiating leaf/bract primordium. In older leaf/bract primordia, WUS expression disappeared and STM expression became restricted to the basal part, whereas ARP was expressed in the distal part in a complementary pattern to STM expression. In the reproductive shoots of Podostemoideae with a normal mode of flower development, STM and WUS were expressed in the floral meristem, but not in the floral organs, similar to the pattern in model plants. These results suggest that the leaf/bract of Podostemoideae is initiated as a SAM and differentiates into a single apical leaf/bract, resulting in the evolution of novel shoot-leaf mixed organs in Podostemaceae. PMID:20647344

  10. Cloning and expression patterns of two Smad genes during embryonic development and shell formation of the Pacific oyster Crassostrea gigas

    NASA Astrophysics Data System (ADS)

    Liu, Gang; Huan, Pin; Liu, Baozhong

    2014-11-01

    Increasing evidence indicates that transforming growth factor β (TGF-β) signaling pathways play many important roles in the early development of mollusks. However, limited information is known concerning their detailed mechanisms. Here, we describe the identification, cloning and characterization of two Smad genes, the key components of TGF-β signaling pathways, from the Pacific oyster Crassostrea gigas. Sequence analysis of the two genes, designated as cgi-smad1/ 5/ 8 and cgi-smad4, revealed conserved functional characteristics. The two genes were widely expressed in embryos and larvae, suggesting multiple roles in the early development of C. gigas. The mRNA of the two genes aggregated in the D quadrant and cgi-smad4 was highly expressed on the dorsal side of the gastrula, indicating that TGF-β signaling pathways may be involved in dorsoventral patterning in C. gigas. Furthermore, high expression levels of the two genes in the shell fields of embryos at different stages suggested important roles for TGF-β signaling pathways in particular phases of shell development, including the formation of the initial shell field and the biomineralization of larval shells. The results of this study provide fundamental support for elucidating how TGF-β signaling pathways participate in the early development of bivalve mollusks, and suggest that further work is warranted to this end.

  11. Increased sensorimotor network activity in DYT1 dystonia: a functional imaging study

    PubMed Central

    Argyelan, Miklos; Habeck, Christian; Ghilardi, M. Felice; Fitzpatrick, Toni; Dhawan, Vijay; Pourfar, Michael; Bressman, Susan B.; Eidelberg, David

    2010-01-01

    Neurophysiological studies have provided evidence of primary motor cortex hyperexcitability in primary dystonia, but several functional imaging studies suggest otherwise. To address this issue, we measured sensorimotor activation at both the regional and network levels in carriers of the DYT1 dystonia mutation and in control subjects. We used 15Oxygen-labelled water and positron emission tomography to scan nine manifesting DYT1 carriers, 10 non-manifesting DYT1 carriers and 12 age-matched controls while they performed a kinematically controlled motor task; they were also scanned in a non-motor audio-visual control condition. Within- and between-group contrasts were analysed with statistical parametric mapping. For network analysis, we first identified a normal motor-related activation pattern in a set of 39 motor and audio-visual scans acquired in an independent cohort of 18 healthy volunteer subjects. The expression of this pattern was prospectively quantified in the motor and control scans acquired in each of the gene carriers and controls. Network values for the three groups were compared with ANOVA and post hoc contrasts. Voxel-wise comparison of DYT1 carriers and controls revealed abnormally increased motor activation responses in the former group (P < 0.05, corrected; statistical parametric mapping), localized to the sensorimotor cortex, dorsal premotor cortex, supplementary motor area and the inferior parietal cortex. Network analysis of the normative derivation cohort revealed a significant normal motor-related activation pattern topography (P < 0.0001) characterized by covarying neural activity in the sensorimotor cortex, dorsal premotor cortex, supplementary motor area and cerebellum. In the study cohort, normal motor-related activation pattern expression measured during movement was abnormally elevated in the manifesting gene carriers (P < 0.001) but not in their non-manifesting counterparts. In contrast, in the non-motor control condition, abnormal increases in network activity were present in both groups of gene carriers (P < 0.001). In this condition, normal motor-related activation pattern expression in non-manifesting carriers was greater than in controls, but lower than in affected carriers. In the latter group, measures of normal motor-related activation pattern expression in the audio-visual condition correlated with independent dystonia clinical ratings (r = 0.70, P = 0.04). These findings confirm that overexcitability of the sensorimotor system is a robust feature of dystonia. The presence of elevated normal motor-related activation pattern expression in the non-motor condition suggests that abnormal integration of audio-visual input with sensorimotor network activity is an important trait feature of this disorder. Lastly, quantification of normal motor-related activation pattern expression in individual cases may have utility as an objective descriptor of therapeutic response in trials of new treatments for dystonia and related disorders. PMID:20207699

  12. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    PubMed

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  13. Genome-wide classification, evolutionary analysis and gene expression patterns of the kinome in Gossypium

    PubMed Central

    Yan, Jun; Li, Guilin; Guo, Xingqi; Li, Yang; Cao, Xuecheng

    2018-01-01

    The protein kinase (PK, kinome) family is one of the largest families in plants and regulates almost all aspects of plant processes, including plant development and stress responses. Despite their important functions, comprehensive functional classification, evolutionary analysis and expression patterns of the cotton PK gene family has yet to be performed on PK genes. In this study, we identified the cotton kinomes in the Gossypium raimondii, Gossypium arboretum, Gossypium hirsutum and Gossypium barbadense genomes and classified them into 7 groups and 122–24 subfamilies using software HMMER v3.0 scanning and neighbor-joining (NJ) phylogenetic analysis. Some conserved exon-intron structures were identified not only in cotton species but also in primitive plants, ferns and moss, suggesting the significant function and ancient origination of these PK genes. Collinearity analysis revealed that 16.6 million years ago (Mya) cotton-specific whole genome duplication (WGD) events may have played a partial role in the expansion of the cotton kinomes, whereas tandem duplication (TD) events mainly contributed to the expansion of the cotton RLK group. Synteny analysis revealed that tetraploidization of G. hirsutum and G. barbadense contributed to the expansion of G. hirsutum and G. barbadense PKs. Global expression analysis of cotton PKs revealed stress-specific and fiber development-related expression patterns, suggesting that many cotton PKs might be involved in the regulation of the stress response and fiber development processes. This study provides foundational information for further studies on the evolution and molecular function of cotton PKs. PMID:29768506

  14. The ketogenic diet reverses gene expression patterns and reduces reactive oxygen species levels when used as an adjuvant therapy for glioma.

    PubMed

    Stafford, Phillip; Abdelwahab, Mohammed G; Kim, Do Young; Preul, Mark C; Rho, Jong M; Scheck, Adrienne C

    2010-09-10

    Malignant brain tumors affect people of all ages and are the second leading cause of cancer deaths in children. While current treatments are effective and improve survival, there remains a substantial need for more efficacious therapeutic modalities. The ketogenic diet (KD) - a high-fat, low-carbohydrate treatment for medically refractory epilepsy - has been suggested as an alternative strategy to inhibit tumor growth by altering intrinsic metabolism, especially by inducing glycopenia. Here, we examined the effects of an experimental KD on a mouse model of glioma, and compared patterns of gene expression in tumors vs. normal brain from animals fed either a KD or a standard diet. Animals received intracranial injections of bioluminescent GL261-luc cells and tumor growth was followed in vivo. KD treatment significantly reduced the rate of tumor growth and prolonged survival. Further, the KD reduced reactive oxygen species (ROS) production in tumor cells. Gene expression profiling demonstrated that the KD induces an overall reversion to expression patterns seen in non-tumor specimens. Notably, genes involved in modulating ROS levels and oxidative stress were altered, including those encoding cyclooxygenase 2, glutathione peroxidases 3 and 7, and periredoxin 4. Our data demonstrate that the KD improves survivability in our mouse model of glioma, and suggests that the mechanisms accounting for this protective effect likely involve complex alterations in cellular metabolism beyond simply a reduction in glucose.

  15. Skeletal muscle repair in a mouse model of nemaline myopathy

    PubMed Central

    Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

    2012-01-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles. PMID:16877500

  16. Skeletal muscle repair in a mouse model of nemaline myopathy.

    PubMed

    Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

    2006-09-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

  17. The ventralizing activity of Radar, a maternally expressed bone morphogenetic protein, reveals complex bone morphogenetic protein interactions controlling dorso-ventral patterning in zebrafish.

    PubMed

    Goutel, C; Kishimoto, Y; Schulte-Merker, S; Rosa, F

    2000-12-01

    In Xenopus and zebrafish, BMP2, 4 and 7 have been implicated, after the onset of zygotic expression, in inducing and maintaining ventro-lateral cell fate during early development. We provide evidence here that a maternally expressed bone morphogenetic protein (BMP), Radar, may control early ventral specification in zebrafish. We show that Radar ventralizes zebrafish embryos and induces the early expression of bmp2b and bmp4. The analysis of Radar overexpression in both swirl/bmp2b mutants and embryos expressing truncated BMP receptors shows that Radar-induced ventralization is dependent on functional BMP2/4 pathways, and may initially rely on an Alk6-related signaling pathway. Finally, we show that while radar-injected swirl embryos still exhibit a strongly dorsalized phenotype, the overexpression of Radar into swirl/bmp2b mutant embryos restores ventral marker expression, including bmp4 expression. Our results suggest that a complex regulation of different BMP pathways controls dorso-ventral (DV) patterning from early cleavage stages until somitogenesis.

  18. The roles of ERAS during cell lineage specification of mouse early embryonic development.

    PubMed

    Zhao, Zhen-Ao; Yu, Yang; Ma, Huai-Xiao; Wang, Xiao-Xiao; Lu, Xukun; Zhai, Yanhua; Zhang, Xiaoxin; Wang, Haibin; Li, Lei

    2015-08-01

    Eras encodes a Ras-like GTPase protein that was originally identified as an embryonic stem cell-specific Ras. ERAS has been known to be required for the growth of embryonic stem cells and stimulates somatic cell reprogramming, suggesting its roles on mouse early embryonic development. We now report a dynamic expression pattern of Eras during mouse peri-implantation development: its expression increases at the blastocyst stage, and specifically decreases in E7.5 mesoderm. In accordance with its expression pattern, the increased expression of Eras promotes cell proliferation through controlling AKT activation and the commitment from ground to primed state through ERK activation in mouse embryonic stem cells; and the reduced expression of Eras facilitates primitive streak and mesoderm formation through AKT inhibition during gastrulation. The expression of Eras is finely regulated to match its roles in mouse early embryonic development during which Eras expression is negatively regulated by the β-catenin pathway. Thus, beyond its well-known role on cell proliferation, ERAS may also play important roles in cell lineage specification during mouse early embryonic development. © 2015 The Authors.

  19. AUXIN RESPONSE FACTOR17 Is Essential for Pollen Wall Pattern Formation in Arabidopsis1[C][W][OA

    PubMed Central

    Yang, Jun; Tian, Lei; Sun, Ming-Xi; Huang, Xue-Yong; Zhu, Jun; Guan, Yue-Feng; Jia, Qi-Shi; Yang, Zhong-Nan

    2013-01-01

    In angiosperms, pollen wall pattern formation is determined by primexine deposition on the microspores. Here, we show that AUXIN RESPONSE FACTOR17 (ARF17) is essential for primexine formation and pollen development in Arabidopsis (Arabidopsis thaliana). The arf17 mutant exhibited a male-sterile phenotype with normal vegetative growth. ARF17 was expressed in microsporocytes and microgametophytes from meiosis to the bicellular microspore stage. Transmission electron microscopy analysis showed that primexine was absent in the arf17 mutant, which leads to pollen wall-patterning defects and pollen degradation. Callose deposition was also significantly reduced in the arf17 mutant, and the expression of CALLOSE SYNTHASE5 (CalS5), the major gene for callose biosynthesis, was approximately 10% that of the wild type. Chromatin immunoprecipitation and electrophoretic mobility shift assays showed that ARF17 can directly bind to the CalS5 promoter. As indicated by the expression of DR5-driven green fluorescent protein, which is an synthetic auxin response reporter, auxin signaling appeared to be specifically impaired in arf17 anthers. Taken together, our results suggest that ARF17 is essential for pollen wall patterning in Arabidopsis by modulating primexine formation at least partially through direct regulation of CalS5 gene expression. PMID:23580594

  20. Circular RNA profile in gliomas revealed by identification tool UROBORUS.

    PubMed

    Song, Xiaofeng; Zhang, Naibo; Han, Ping; Moon, Byoung-San; Lai, Rose K; Wang, Kai; Lu, Wange

    2016-05-19

    Recent evidence suggests that many endogenous circular RNAs (circRNAs) may play roles in biological processes. However, the expression patterns and functions of circRNAs in human diseases are not well understood. Computationally identifying circRNAs from total RNA-seq data is a primary step in studying their expression pattern and biological roles. In this work, we have developed a computational pipeline named UROBORUS to detect circRNAs in total RNA-seq data. By applying UROBORUS to RNA-seq data from 46 gliomas and normal brain samples, we detected thousands of circRNAs supported by at least two read counts, followed by successful experimental validation on 24 circRNAs from the randomly selected 27 circRNAs. UROBORUS is an efficient tool that can detect circRNAs with low expression levels in total RNA-seq without RNase R treatment. The circRNAs expression profiling revealed more than 476 circular RNAs differentially expressed in control brain tissues and gliomas. Together with parental gene expression, we found that circRNA and its parental gene have diversified expression patterns in gliomas and control brain tissues. This study establishes an efficient and sensitive approach for predicting circRNAs using total RNA-seq data. The UROBORUS pipeline can be accessed freely for non-commercial purposes at http://uroborus.openbioinformatics.org/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Toward the human cellular microRNAome.

    PubMed

    McCall, Matthew N; Kim, Min-Sik; Adil, Mohammed; Patil, Arun H; Lu, Yin; Mitchell, Christopher J; Leal-Rojas, Pamela; Xu, Jinchong; Kumar, Manoj; Dawson, Valina L; Dawson, Ted M; Baras, Alexander S; Rosenberg, Avi Z; Arking, Dan E; Burns, Kathleen H; Pandey, Akhilesh; Halushka, Marc K

    2017-10-01

    MicroRNAs are short RNAs that serve as regulators of gene expression and are essential components of normal development as well as modulators of disease. MicroRNAs generally act cell-autonomously, and thus their localization to specific cell types is needed to guide our understanding of microRNA activity. Current tissue-level data have caused considerable confusion, and comprehensive cell-level data do not yet exist. Here, we establish the landscape of human cell-specific microRNA expression. This project evaluated 8 billion small RNA-seq reads from 46 primary cell types, 42 cancer or immortalized cell lines, and 26 tissues. It identified both specific and ubiquitous patterns of expression that strongly correlate with adjacent superenhancer activity. Analysis of unaligned RNA reads uncovered 207 unknown minor strand (passenger) microRNAs of known microRNA loci and 495 novel putative microRNA loci. Although cancer cell lines generally recapitulated the expression patterns of matched primary cells, their isomiR sequence families exhibited increased disorder, suggesting DROSHA- and DICER1-dependent microRNA processing variability. Cell-specific patterns of microRNA expression were used to de-convolute variable cellular composition of colon and adipose tissue samples, highlighting one use of these cell-specific microRNA expression data. Characterization of cellular microRNA expression across a wide variety of cell types provides a new understanding of this critical regulatory RNA species. © 2017 McCall et al.; Published by Cold Spring Harbor Laboratory Press.

  2. Predatory hunting and exposure to a live predator induce opposite patterns of Fos immunoreactivity in the PAG.

    PubMed

    Comoli, E; Ribeiro-Barbosa, E R; Canteras, Newton Sabino

    2003-01-06

    Considering the periaqueductal gray's (PAG) general roles in mediating motivational responses, in the present study, we compared the Fos expression pattern in the PAG induced by innate behaviors underlain by opposite motivational drivers, in rats, namely, insect predation and defensive behavior evoked by the confrontation with a live predator (a cat). Exposure to the predator was associated with a striking Fos expression in the PAG, where, at rostral levels, an intense Fos expression was found largely distributed in the dorsomedial and dorsolateral regions, whereas, at caudal levels, Fos-labeled cells tended to be mostly found in the lateral and ventrolateral columns, as well as in the dorsal raphe nucleus. Quite the opposite, insect predation was associated with increased Fos expression predominantly in the rostral two thirds of the lateral PAG, where the majority of the Fos-immunoreactive cells were found at the oculomotor nucleus levels. Remarkably, both exposure to the cat and insect predation upregulated Fos expression in the supraoculomotor region and the laterodorsal tegmental nucleus. Overall, the present results clearly suggest that the PAG activation pattern appears to reflect, at least partly, the animal's motivational status. It is well established that the PAG is critical for the expression of defensive responses, and, considering the present findings, it will be important to investigate how the PAG contributes to the expression of the predatory behavior, as well.

  3. Claudin gene expression patterns do not associate with interspecific differences in paracellular nutrient absorption.

    PubMed

    Price, Edwin R; Rott, Katherine H; Caviedes-Vidal, Enrique; Karasov, William H

    2016-01-01

    Bats exhibit higher paracellular absorption of glucose-sized molecules than non-flying mammals, a phenomenon that may be driven by higher permeability of the intestinal tight junctions. The various claudins, occludin, and other proteins making up the tight junctions are thought to determine their permeability properties. Here we show that absorption of the paracellular probe l-arabinose is higher in a bat (Eptesicus fuscus) than in a vole (Microtus pennsylvanicus) or a hedgehog (Atelerix albiventris). Furthermore, histological measurements demonstrated that hedgehogs have many more enterocytes in their intestines, suggesting that bats cannot have higher absorption of arabinose simply by having more tight junctions. We therefore investigated the mRNA levels of several claudins and occludin, because these proteins may affect permeability of tight junctions to macronutrients. To assess the expression levels of claudins per tight junction, we normalized the mRNA levels of the claudins to the constitutively expressed tight junction protein ZO-1, and combined these with measurements previously made in a bat and a rodent to determine if there were among-species differences. Although expression ratios of several genes varied among species, there was not a consistent difference between bats and non-flyers in the expression ratio of any particular gene. Protein expression patterns may differ from mRNA expression patterns, and might better explain differences among species in arabinose absorption. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Transcriptomic features associated with energy production in the muscles of Pacific bluefin tuna and Pacific cod.

    PubMed

    Shibata, Mami; Mekuchi, Miyuki; Mori, Kazuki; Muta, Shigeru; Chowdhury, Vishwajit Sur; Nakamura, Yoji; Ojima, Nobuhiko; Saitoh, Kenji; Kobayashi, Takanori; Wada, Tokio; Inouye, Kiyoshi; Kuhara, Satoru; Tashiro, Kosuke

    2016-06-01

    Bluefin tuna are high-performance swimmers and top predators in the open ocean. Their swimming is grounded by unique features including an exceptional glycolytic potential in white muscle, which is supported by high enzymatic activities. Here we performed high-throughput RNA sequencing (RNA-Seq) in muscles of the Pacific bluefin tuna (Thunnus orientalis) and Pacific cod (Gadus macrocephalus) and conducted a comparative transcriptomic analysis of genes related to energy production. We found that the total expression of glycolytic genes was much higher in the white muscle of tuna than in the other muscles, and that the expression of only six genes for glycolytic enzymes accounted for 83.4% of the total. These expression patterns were in good agreement with the patterns of enzyme activity previously reported. The findings suggest that the mRNA expression of glycolytic genes may contribute directly to the enzymatic activities in the muscles of tuna.

  5. Differential expression of neuroligin genes in the nervous system of zebrafish.

    PubMed

    Davey, Crystal; Tallafuss, Alexandra; Washbourne, Philip

    2010-02-01

    The establishment and maturation of appropriate synaptic connections is crucial in the development of neuronal circuits. Cellular adhesion is believed to play a central role in this process. Neuroligins are neuronal cell adhesion molecules that are hypothesized to act in the initial formation and maturation of synaptic connections. In order to establish the zebrafish as a model to investigate the in vivo role of Neuroligin proteins in nervous system development, we identified the zebrafish orthologs of neuroligin family members and characterized their expression. Zebrafish possess seven neuroligin genes. Synteny analysis and sequence comparisons show that NLGN2, NLGN3, and NLGN4X are duplicated in zebrafish, but NLGN1 has a single zebrafish ortholog. All seven zebrafish neuroligins are expressed in complex patterns in the developing nervous system and in the adult brain. The spatial and temporal expression patterns of these genes suggest that they occupy a role in nervous system development and maintenance.

  6. Expression patterns and role of PTEN in rat peripheral nerve development and injury.

    PubMed

    Chen, Hui; Xiang, Jianping; Wu, Junxia; He, Bo; Lin, Tao; Zhu, Qingtang; Liu, Xiaolin; Zheng, Canbin

    2018-05-29

    Studies have suggested that phosphatase and tensin homolog (PTEN) plays an important role in neuroprotection and neuronal regeneration. To better understand the potential role of PTEN with respect to peripheral nerve development and injury, we investigated the expression pattern of PTEN at different stages of rat peripheral nerve development and injury and subsequently assessed the effect of pharmacological inhibition of PTEN using bpV(pic) on axonal regeneration in a rat sciatic nerve crush injury model. During the early stages of development, PTEN exhibits low expression in neuronal cell bodies and axons. From embryonic day (E) 18.5 and postnatal day (P)5 to adult, PTEN protein becomes more detectable, with high expression in the dorsal root ganglia (DRG) and axons. PTEN expression is inhibited in peripheral nerves, preceding myelination during neuronal development and remyelination after acute nerve injury. Low PTEN expression after nerve injury promotes Akt/mammalian target of rapamycin (mTOR) signaling pathway activity. In vivo pharmacological inhibition of PTEN using bpV(pic) promoted axonal regrowth, increased the number of myelinated nerve fibers, improved locomotive recovery and enhanced the amplitude response and nerve conduction velocity following stimulation in a rat sciatic nerve crush injury model. Thus, we suggest that PTEN may play potential roles in peripheral nerve development and regeneration and that inhibition of PTEN expression is beneficial for nerve regeneration and functional recovery after peripheral nerve injury. Copyright © 2018 Elsevier B.V. All rights reserved.

  7. The Carnegie Protein Trap Library: A Versatile Tool for Drosophila Developmental Studies

    PubMed Central

    Buszczak, Michael; Paterno, Shelley; Lighthouse, Daniel; Bachman, Julia; Planck, Jamie; Owen, Stephenie; Skora, Andrew D.; Nystul, Todd G.; Ohlstein, Benjamin; Allen, Anna; Wilhelm, James E.; Murphy, Terence D.; Levis, Robert W.; Matunis, Erika; Srivali, Nahathai; Hoskins, Roger A.; Spradling, Allan C.

    2007-01-01

    Metazoan physiology depends on intricate patterns of gene expression that remain poorly known. Using transposon mutagenesis in Drosophila, we constructed a library of 7404 protein trap and enhancer trap lines, the Carnegie collection, to facilitate gene expression mapping at single-cell resolution. By sequencing the genomic insertion sites, determining splicing patterns downstream of the enhanced green fluorescent protein (EGFP) exon, and analyzing expression patterns in the ovary and salivary gland, we found that 600–900 different genes are trapped in our collection. A core set of 244 lines trapped different identifiable protein isoforms, while insertions likely to act as GFP-enhancer traps were found in 256 additional genes. At least 8 novel genes were also identified. Our results demonstrate that the Carnegie collection will be useful as a discovery tool in diverse areas of cell and developmental biology and suggest new strategies for greatly increasing the coverage of the Drosophila proteome with protein trap insertions. PMID:17194782

  8. (Not) talking about sex: couple reports of sexual discussion and expression in Bangalore, India.

    PubMed

    McDougall, Janna; Edmeades, Jeffrey; Krishnan, Suneeta

    2011-02-01

    Adolescent marriage is common in India, placing young women at risk of HIV, early pregnancy and poor birth outcomes. Young women's capacity to express their sexual desires is central to negotiating safe and mutually consensual sexuality. Men, too, play an important role in shaping women's sexual and reproductive health outcomes, but little research has examined how men influence women's sexual expression. Using paired husband and wife data, this paper reports on a preliminary investigation into the patterns of and concurrence between women's sexual expression and their husbands' attitudes about it, as well as the influence of men's approval of their wives' sexual expression on women's actual expression of sexual desire. The results suggest that, among this sample, men are more open to sexual expression than their wives and that, for women, expressing desire not to have sex is far more common than expressing desire to have sex. Further, men's approval of sexual expression from wives appears to positively influence women's actual expression. These findings suggest that men may be resources for women to draw upon as they negotiate sexuality in adolescence and early adulthood.

  9. The Influence of Anger Expression on Wound Healing

    PubMed Central

    Gouin, Jean-Philippe; Kiecolt-Glaser, Janice K.; Malarkey, William B.; Glaser, Ronald

    2008-01-01

    Certain patterns of anger expression have been associated with maladaptive alterations in cortisol secretion, immune functioning, and surgical recovery. We hypothesized that outward and inward anger expression and lack of anger control would be associated with delayed wound healing. A sample of 98 community-dwelling participants received standardized blister wounds on their non-dominant forearm. After blistering, the wounds were monitored daily for eight days to assess speed of repair. Logistic regression was used to distinguish fast and slow healers based on their anger expression pattern. Individuals exhibiting lower levels of anger control were more likely to be categorized as slow healers. The anger control variable predicted wound repair over and above differences in hostility, negative affectivity, social support, and health behaviors. Furthermore, participants with lower levels of anger control exhibited higher cortisol reactivity during the blistering procedure. This enhanced cortisol secretion was in turn related to longer time to heal. These findings suggest that the ability to regulate the expression of one’s anger has a clinically relevant impact on wound healing. PMID:18078737

  10. Expression patterns of wnt8 orthologs in two sand dollar species with different developmental modes.

    PubMed

    Nakata, Hidewo; Minokawa, Takuya

    2009-03-01

    Two wnt8 orthologs, Smwnt8 and Pjwnt8, were isolated from an indirect developing sand dollar, Scaphechinus mirabilis, and a direct developing sand dollar, Peronella japonica, respectively. The expression patterns of two genes during early development were examined by whole mount in situ hybridization. The expression of Smwnt8 was initiated in the micromeres at the late 16-cell stage and expanded at the 64-cell stage to the whole vegetal hemisphere, including the presumptive endomesodermal regions. The timing of the initiation of Pjwnt8 transcription in the presumptive endomesoderm region was delayed by 2-3 cell cycles compared to that of Smwnt8. The delay, or molecular heterochrony, of Pjwnt8 transcription strongly suggests the existence of a substantial evolutionary change in the early endomesodermal specification of P. japonica. In addition to the endomesodermal expression during early embryogenesis, bilateral expressions were observed commonly in the ectoderm of two sand dollar species during larval stages.

  11. Identification and expression analysis of zebrafish glypicans during embryonic development.

    PubMed

    Gupta, Mansi; Brand, Michael

    2013-01-01

    Heparan sulfate Proteoglycans (HSPG) are ubiquitous molecules with indispensable functions in various biological processes. Glypicans are a family of HSPG's, characterized by a Gpi-anchor which directs them to the cell surface and/or extracellular matrix where they regulate growth factor signaling during development and disease. We report the identification and expression pattern of glypican genes from zebrafish. The zebrafish genome contains 10 glypican homologs, as opposed to six in mammals, which are highly conserved and are phylogenetically related to the mammalian genes. Some of the fish glypicans like Gpc1a, Gpc3, Gpc4, Gpc6a and Gpc6b show conserved synteny with their mammalian cognate genes. Many glypicans are expressed during the gastrulation stage, but their expression becomes more tissue specific and defined during somitogenesis stages, particularly in the developing central nervous system. Existence of multiple glypican orthologs in fish with diverse expression pattern suggests highly specialized and/or redundant function of these genes during embryonic development.

  12. Comparative analysis of growth-phase-dependent gene expression in virulent and avirulent Streptococcus pneumoniae using a high-density DNA microarray.

    PubMed

    Ko, Kwan Soo; Park, Sulhee; Oh, Won Sup; Suh, Ji-Yoeun; Oh, Taejeong; Ahn, Sungwhan; Chun, Jongsik; Song, Jae-Hoon

    2006-02-28

    The global pattern of growth-dependent gene expres-sion in Streptococcus pneumoniae strains was evalu-ated using a high-density DNA microarray. Total RNAs obtained from an avirulent S. pneumoniae strain R6 and a virulent strain AMC96-6 were used to compare the expression patterns at seven time points (2.5, 3.5, 4.5, 5.5, 6.0, 6.5, and 8.0 h). The expression profile of strain R6 changed between log and station-ary growth (the Log-Stat switch). There were clear differences between the growth-dependent gene ex-pression profiles of the virulent and avirulent pneumo-coccal strains in 367 of 1,112 genes. Transcripts of genes associated with bacterial competence and capsular polysaccharide formation, as well as clpP and cbpA, were higher in the virulent strain. Our data suggest that late log or early stationary phase may be the most virulent phase of S. pneumoniae.

  13. Comparative gene expression profiling of ADAMs, MMPs, TIMPs, EMMPRIN, EGF-R and VEGFA in low grade meningioma.

    PubMed

    Rooprai, Harcharan K; Martin, Andrew J; King, Andrew; Appadu, Usha D; Jones, Huw; Selway, Richard P; Gullan, Richard W; Pilkington, Geoffrey J

    2016-12-01

    MMPs (matrix metalloproteinases), ADAMs (a disintegrin and metalloproteinase) and TIMPs (tissue inhibitors of metalloproteinases) are implicated in invasion and angiogenesis: both are tissue remodeling processes involving regulated proteolysis of the extracellular matrix, growth factors and their receptors. The expression of these three groups and their correlations with clinical behaviour has been reported in gliomas but a similar comprehensive study in meningiomas is lacking. In this study, we aimed to evaluate the patterns of expression of 23 MMPs, 4 TIMPs, 8 ADAMs, selective growth factors and their receptors in 17 benign meningiomas using a quantitative real-time polymerase chain reaction (qPCR). Results indicated very high gene expression of 13 proteases, inhibitors and growth factors studied: MMP2 and MMP14, TIMP-1, -2 and -3, ADAM9, 10, 12, 15 and 17, EGF-R, EMMPRIN and VEGF-A, in almost every meningioma. Expression pattern analysis showed several positive correlations between MMPs, ADAMs, TIMPs and growth factors. Furthermore, our findings suggest that expression of MMP14, ADAM9, 10, 12, 15 and 17, TIMP-2, EGF-R and EMMPRIN reflects histological subtype of meningioma such that fibroblastic subtype had the highest mRNA expression, transitional subtype was intermediate and meningothelial type had the lowest expression. In conclusion, this is the first comprehensive study characterizing gene expression of 8 ADAMs in meningiomas. These neoplasms, although by histological definition benign, have invasive potential. Taken together, the selected elevated gene expression pattern may serve to identify targets for therapeutic intervention or indicators of biological progression and recurrence.

  14. Evolutionary divergence of vertebrate Hoxb2 expression patterns and transcriptional regulatory loci.

    PubMed

    Scemama, Jean-Luc; Hunter, Michael; McCallum, Jeff; Prince, Victoria; Stellwag, Edmund

    2002-10-15

    Hox gene expression is regulated by a complex array of cis-acting elements that control spatial and temporal gene expression in developing embryos. Here, we report the isolation of the striped bass Hoxb2a gene, comparison of its expression to the orthologous gene from zebrafish, and comparative genomic analysis of the upstream regulatory region to that of other vertebrates. Comparison of the Hoxb2a gene expression patterns from striped bass to zebrafish revealed similar expression patterns within rhombomeres 3, 4, and 5 of the hindbrain but a notable absence of expression in neural crest tissues of striped bass while neural crest expression is observed in zebrafish and common to other vertebrates. Comparative genomic analysis of the striped bass Hoxb2a-b3a intergenic region to those from zebrafish, pufferfish, human, and mouse demonstrated the presence of common Meis, Hox/Pbx, Krox-20, and Box 1 elements, which are necessary for rhombomere 3, 4, and 5 expression. Despite their common occurrence, the location and orientation of these transcription elements differed among the five species analyzed, such that Krox-20 and Box 1 elements are located 3' to the Meis, Hox/Pbx elements in striped bass, pufferfish, and human while they are located 5' of this r4 enhancer in zebrafish and mouse. Our results suggest that the plasticity exhibited in the organization of key regulatory elements responsible for rhombomere-specific Hoxb2a expression may reflect the effects of stabilizing selection in the evolution cis-acting elements. Copyright 2002 Wiley-Liss, Inc.

  15. Purkinje Cell Compartmentation in the Cerebellum of the Lysosomal Acid Phosphatase 2 Mutant Mouse (Nax - Naked-Ataxia Mutant Mouse)

    PubMed Central

    Bailey, Karen; Rahimi Balaei, Maryam; Mannan, Ashraf; Del Bigio, Marc R.; Marzban, Hassan

    2014-01-01

    The Acp2 gene encodes the beta subunit of lysosomal acid phosphatase, which is an isoenzyme that hydrolyzes orthophosphoric monoesters. In mice, a spontaneous mutation in Acp2 results in severe cerebellar defects. These include a reduced size, abnormal lobulation, and an apparent anterior cerebellar disorder with an absent or hypoplastic vermis. Based on differential gene expression in the cerebellum, the mouse cerebellar cortex can normally be compartmentalized anteroposteriorly into four transverse zones and mediolaterally into parasagittal stripes. In this study, immunohistochemistry was performed using various Purkinje cell compartmentation markers to examine their expression patterns in the Acp2 mutant. Despite the abnormal lobulation and anterior cerebellar defects, zebrin II and PLCβ4 showed similar expression patterns in the nax mutant and wild type cerebellum. However, fewer stripes were found in the anterior zone of the nax mutant, which could be due to a lack of Purkinje cells or altered expression of the stripe markers. HSP25 expression was uniform in the central zone of the nax mutant cerebellum at around postnatal day (P) 18–19, suggesting that HSP25 immunonegative Purkinje cells are absent or delayed in stripe pattern expression compared to the wild type. HSP25 expression became heterogeneous around P22–23, with twice the number of parasagittal stripes in the nax mutant compared to the wild type. Aside from reduced size and cortical disorganization, both the posterior zone and nodular zone in the nax mutant appeared less abnormal than the rest of the cerebellum. From these results, it is evident that the anterior zone of the nax mutant cerebellum is the most severely affected, and this extends beyond the primary fissure into the rostral central zone/vermis. This suggests that ACP2 has critical roles in the development of the anterior cerebellum and it may regulate anterior and central zone compartmentation. PMID:24722417

  16. Grouping of multicopper oxidases in Lentinula edodes by sequence similarities and expression patterns.

    PubMed

    Sakamoto, Yuichi; Nakade, Keiko; Yoshida, Kentaro; Natsume, Satoshi; Miyazaki, Kazuhiro; Sato, Shiho; van Peer, Arend F; Konno, Naotake

    2015-12-01

    The edible white rot fungus Lentinula edodes possesses a variety of lignin degrading enzymes such as manganese peroxidases and laccases. Laccases belong to the multicopper oxidases, which have a wide range of catalytic activities including polyphenol degradation and synthesis, lignin degradation, and melanin formation. The exact number of laccases in L. edodes is unknown, as are their complete properties and biological functions. We analyzed the draft genome sequence of L. edodes D703PP-9 and identified 13 multicopper oxidase-encoding genes; 11 laccases in sensu stricto, of which three are new, and two ferroxidases. lcc8, a laccase previously reported in L. edodes, was not identified in D703PP-9 genome. Phylogenetic analysis showed that the 13 multicopper oxidases can be classified into laccase sensu stricto subfamily 1, laccase sensu stricto subfamily 2 and ferroxidases. From sequence similarities and expression patterns, laccase sensu stricto subfamily 1 can be divided into two subgroups. Laccase sensu stricto subfamily 1 group A members are mainly secreted from mycelia, while laccase sensu stricto subfamily 1 group B members are expressed mainly in fruiting bodies during growth or after harvesting but are lowly expressed in mycelia. Laccase sensu stricto subfamily 2 members are mainly expressed in mycelia, and two ferroxidases are mainly expressed in the fruiting body during growth or after harvesting, and are expressed at very low levels in mycelium. Our data suggests that L. edodes laccases in same group share expression patterns and would have common biological functions.

  17. bullwinkle and shark regulate dorsal-appendage morphogenesis in Drosophila oogenesis.

    PubMed

    Tran, David H; Berg, Celeste A

    2003-12-01

    bullwinkle (bwk) regulates embryonic anteroposterior patterning and, through a novel germline-to-soma signal, morphogenesis of the eggshell dorsal appendages. We screened for dominant modifiers of the bullwinkle mooseantler eggshell phenotype and identified shark, which encodes an SH2-domain, ankyrin-repeat tyrosine kinase. At the onset of dorsal-appendage formation, shark is expressed in a punctate pattern in the squamous stretch cells overlying the nurse cells. Confocal microscopy with cell-type-specific markers demonstrates that the stretch cells act as a substrate for the migrating dorsal-appendage-forming cells and extend cellular projections towards them. Mosaic analyses reveal that shark is required in follicle cells for cell migration and chorion deposition. Proper shark RNA expression in the stretch cells requires bwk activity, while restoration of shark expression in the stretch cells suppresses the bwk dorsal-appendage phenotype. These results suggest that shark plays an important downstream role in the bwk-signaling pathway. Candidate testing implicates Src42A in a similar role, suggesting conservation with a vertebrate signaling pathway involving non-receptor tyrosine kinases.

  18. Physiological role of ghrelin as revealed by the ghrelin and GOAT knockout mice.

    PubMed

    Kang, Kihwa; Zmuda, Erik; Sleeman, Mark W

    2011-11-01

    Ghrelin is a gastric hormone that has been shown to regulate food intake and energy metabolism. One unique feature of ghrelin is that its activity is regulated post transcriptionally by ghrelin O-acyltransferase (GOAT) through the addition of fatty acid to the serine residue in the N terminal region. Despite much biochemical characterization, to date no other proteins have been shown to be specifically octonylated by GOAT, suggesting a unique matching of the acyl transferase for a single ligand, ghrelin. If this is indeed correct, then genetic deletion of ghrelin or GOAT should produce near identical phenotypes and there should be extensive overlap in expression patterns. This review summarizes the similarities and differences in the phenotypes with the genetic deletion of ghrelin and GOAT in the various knockout mouse lines reported to date. While there is considerable overlap in expression pattern between ghrelin and GOAT, the latter does exhibit some unique tissue expression that could suggest that additional peptides may be acylated and await discovery and characterization. Copyright © 2011 Elsevier Inc. All rights reserved.

  19. Expression and enzymatic activity of phenylalanine ammonia-lyase and p-coumarate 3-hydroxylase in mango (Mangifera indica 'Ataulfo') during ripening.

    PubMed

    Palafox-Carlos, H; Contreras-Vergara, C A; Muhlia-Almazán, A; Islas-Osuna, M A; González-Aguilar, G A

    2014-05-16

    Phenylalanine ammonia lyase (PAL) and p-coumarate 3-hydroxylase (C3H) are key enzymes in the phenylpropanoid pathway. The relative expression of PAL and C3H was evaluated in mango fruit cultivar 'Ataulfo' in four ripening stages (RS1, RS2, RS3, and RS4) by quantitative polymerase chain reaction. In addition, enzyme activity of PAL and C3H was determined in mango fruits during ripening. The PAL levels were downregulated at the RS2 and RS3 stages, while C3H levels were upregulated in fruits only at RS3. The enzyme activity of PAL followed a pattern that was different from that of the PAL expression, thus suggesting regulation at several levels. For C3H, a regulation at the transcriptional level is suggested because a similar pattern was revealed by its activity and transcript level. In this study, the complexity of secondary metabolite biosynthesis regulation is emphasized because PAL and C3H enzymes are involved in the biosynthesis of several secondary metabolites that are active during all mango ripening stages.

  20. Transcriptomics Reveal Several Gene Expression Patterns in the Piezophile Desulfovibrio hydrothermalis in Response to Hydrostatic Pressure

    PubMed Central

    Amrani, Amira; Bergon, Aurélie; Holota, Hélène; Tamburini, Christian; Garel, Marc; Ollivier, Bernard; Imbert, Jean; Dolla, Alain; Pradel, Nathalie

    2014-01-01

    RNA-seq was used to study the response of Desulfovibrio hydrothermalis, isolated from a deep-sea hydrothermal chimney on the East-Pacific Rise at a depth of 2,600 m, to various hydrostatic pressure growth conditions. The transcriptomic datasets obtained after growth at 26, 10 and 0.1 MPa identified only 65 differentially expressed genes that were distributed among four main categories: aromatic amino acid and glutamate metabolisms, energy metabolism, signal transduction, and unknown function. The gene expression patterns suggest that D. hydrothermalis uses at least three different adaptation mechanisms, according to a hydrostatic pressure threshold (HPt) that was estimated to be above 10 MPa. Both glutamate and energy metabolism were found to play crucial roles in these mechanisms. Quantitation of the glutamate levels in cells revealed its accumulation at high hydrostatic pressure, suggesting its role as a piezolyte. ATP measurements showed that the energy metabolism of this bacterium is optimized for deep-sea life conditions. This study provides new insights into the molecular mechanisms linked to hydrostatic pressure adaptation in sulfate-reducing bacteria. PMID:25215865

  1. Evolution of the β-adrenoreceptors in vertebrates.

    PubMed

    Zavala, Kattina; Vandewege, Michael W; Hoffmann, Federico G; Opazo, Juan C

    2017-01-01

    The study of the evolutionary history of genes related to human disease lies at the interface of evolution and medicine. These studies provide the evolutionary context on which medical researchers should work, and are also useful in providing information to suggest further genetic experiments, especially in model species where genetic manipulations can be made. Here we studied the evolution of the β-adrenoreceptor gene family in vertebrates with the aim of adding an evolutionary framework to the already abundant physiological information. Our results show that in addition to the three already described vertebrate β-adrenoreceptor genes there is an additional group containing cyclostome sequences. We suggest that β-adrenoreceptors diversified as a product of the two whole genome duplications that occurred in the ancestor of vertebrates. Gene expression patterns are in general consistent across species, suggesting that expression dynamics were established early in the evolutionary history of vertebrates, and have been maintained since then. Finally, amino acid polymorphisms that are associated to pathological conditions in humans appear to be common in non-human mammals, suggesting that the phenotypic effects of these mutations depend on epistatic interaction with other positions. The evolutionary analysis of the β-adrenoreceptors delivers new insights about the diversity of these receptors in vertebrates, the evolution of the expression patterns and a comparative perspective regarding the polymorphisms that in humans are linked to pathological conditions. Copyright © 2016 Elsevier Inc. All rights reserved.

  2. Expression Divergence Is Correlated with Sequence Evolution but Not Positive Selection in Conifers.

    PubMed

    Hodgins, Kathryn A; Yeaman, Sam; Nurkowski, Kristin A; Rieseberg, Loren H; Aitken, Sally N

    2016-06-01

    The evolutionary and genomic determinants of sequence evolution in conifers are poorly understood, and previous studies have found only limited evidence for positive selection. Using RNAseq data, we compared gene expression profiles to patterns of divergence and polymorphism in 44 seedlings of lodgepole pine (Pinus contorta) and 39 seedlings of interior spruce (Picea glauca × engelmannii) to elucidate the evolutionary forces that shape their genomes and their plastic responses to abiotic stress. We found that rapidly diverging genes tend to have greater expression divergence, lower expression levels, reduced levels of synonymous site diversity, and longer proteins than slowly diverging genes. Similar patterns were identified for the untranslated regions, but with some exceptions. We found evidence that genes with low expression levels had a larger fraction of nearly neutral sites, suggesting a primary role for negative selection in determining the association between evolutionary rate and expression level. There was limited evidence for differences in the rate of positive selection among genes with divergent versus conserved expression profiles and some evidence supporting relaxed selection in genes diverging in expression between the species. Finally, we identified a small number of genes that showed evidence of site-specific positive selection using divergence data alone. However, estimates of the proportion of sites fixed by positive selection (α) were in the range of other plant species with large effective population sizes suggesting relatively high rates of adaptive divergence among conifers. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Rapid evolution and copy number variation of primate RHOXF2, an X-linked homeobox gene involved in male reproduction and possibly brain function.

    PubMed

    Niu, Ao-lei; Wang, Yin-qiu; Zhang, Hui; Liao, Cheng-hong; Wang, Jin-kai; Zhang, Rui; Che, Jun; Su, Bing

    2011-10-12

    Homeobox genes are the key regulators during development, and they are in general highly conserved with only a few reported cases of rapid evolution. RHOXF2 is an X-linked homeobox gene in primates. It is highly expressed in the testicle and may play an important role in spermatogenesis. As male reproductive system is often the target of natural and/or sexual selection during evolution, in this study, we aim to dissect the pattern of molecular evolution of RHOXF2 in primates and its potential functional consequence. We studied sequences and copy number variation of RHOXF2 in humans and 16 nonhuman primate species as well as the expression patterns in human, chimpanzee, white-browed gibbon and rhesus macaque. The gene copy number analysis showed that there had been parallel gene duplications/losses in multiple primate lineages. Our evidence suggests that 11 nonhuman primate species have one RHOXF2 copy, and two copies are present in humans and four Old World monkey species, and at least 6 copies in chimpanzees. Further analysis indicated that the gene duplications in primates had likely been mediated by endogenous retrovirus (ERV) sequences flanking the gene regions. In striking contrast to non-human primates, humans appear to have homogenized their two RHOXF2 copies by the ERV-mediated non-allelic recombination mechanism. Coding sequence and phylogenetic analysis suggested multi-lineage strong positive selection on RHOXF2 during primate evolution, especially during the origins of humans and chimpanzees. All the 8 coding region polymorphic sites in human populations are non-synonymous, implying on-going selection. Gene expression analysis demonstrated that besides the preferential expression in the reproductive system, RHOXF2 is also expressed in the brain. The quantitative data suggests expression pattern divergence among primate species. RHOXF2 is a fast-evolving homeobox gene in primates. The rapid evolution and copy number changes of RHOXF2 had been driven by Darwinian positive selection acting on the male reproductive system and possibly also on the central nervous system, which sheds light on understanding the role of homeobox genes in adaptive evolution.

  4. Expression of emotions related to the experience of cancer in younger and older Arab breast cancer survivors.

    PubMed

    Goldblatt, Hadass; Cohen, Miri; Azaiza, Faisal

    2016-12-01

    Researchers have suggested that older adults express less negative emotions. Yet, emotional expression patterns in older and younger breast cancer survivors, have barely been examined. This study aimed to explore types and intensity of negative and positive emotional expression related to the breast cancer experience by younger and older Arab breast cancer survivors. Participants were 20 younger (aged 32-50) and 20 older (aged 51-75) Muslim and Christian Arab breast cancer survivors (stages I-III), currently free of disease. Data were gathered through in-depth semi-structured interviews. Mixed methods analyses were conducted, including: (1) frequency analysis of participants' emotional expressions; (2) content analysis of emotional expressions, categorized according to negative and positive emotions. Three emotional expression modalities were revealed: (1) Succinct versus comprehensive accounts; (2) expression of emotions versus avoidance of emotions; (3) patterns of expression of positive emotions and a sense of personal growth. Younger women provided more detailed accounts about their illness experiences than older women. Older women's accounts were succinct, action-focused, and included more emotion-avoiding expressions than younger women. Understanding the relationships between emotional expression, emotional experience, and cancer survivors' quality of life, specifically of those from traditional communities, is necessary for developing effective psycho-social interventions.

  5. Differential gene expression in queen–worker caste determination in bumble-bees

    PubMed Central

    Pereboom, Jeffrey J. M; Jordan, William C; Sumner, Seirian; Hammond, Robert L; Bourke, Andrew F. G

    2005-01-01

    Investigating how differential gene expression underlies caste determination in the social Hymenoptera is central to understanding how variation in gene expression underlies adaptive phenotypic diversity. We investigated for the first time the association between differential gene expression and queen–worker caste determination in the bumble-bee Bombus terrestris. Using suppression subtractive hybridization we isolated 12 genes that were differentially expressed in queen- and worker-destined larvae. We found that the sets of genes underlying caste differences in larvae and adults failed to overlap greatly. We also found that B. terrestris shares some of the genes whose differential expression is associated with caste determination in the honeybee, Apis mellifera, but their expression patterns were not identical. Instead, we found B. terrestris to exhibit a novel pattern, whereby most genes upregulated (i.e. showing relatively higher levels of expression) in queen-destined larvae early in development were upregulated in worker-destined larvae late in development. Overall, our results suggest that caste determination in B. terrestris involves a difference not so much in the identity of genes expressed by queen- and worker-destined larvae, but primarily in the relative timing of their expression. This conclusion is of potential importance in the further study of phenotypic diversification via differential gene expression. PMID:16024376

  6. Age-Dependent Brain Gene Expression and Copy Number Anomalies in Autism Suggest Distinct Pathological Processes at Young Versus Mature Ages

    PubMed Central

    Winn, Mary E.; Barnes, Cynthia Carter; Li, Hai-Ri; Weiss, Lauren; Fan, Jian-Bing; Murray, Sarah; April, Craig; Belinson, Haim; Fu, Xiang-Dong; Wynshaw-Boris, Anthony; Schork, Nicholas J.; Courchesne, Eric

    2012-01-01

    Autism is a highly heritable neurodevelopmental disorder, yet the genetic underpinnings of the disorder are largely unknown. Aberrant brain overgrowth is a well-replicated observation in the autism literature; but association, linkage, and expression studies have not identified genetic factors that explain this trajectory. Few studies have had sufficient statistical power to investigate whole-genome gene expression and genotypic variation in the autistic brain, especially in regions that display the greatest growth abnormality. Previous functional genomic studies have identified possible alterations in transcript levels of genes related to neurodevelopment and immune function. Thus, there is a need for genetic studies involving key brain regions to replicate these findings and solidify the role of particular functional pathways in autism pathogenesis. We therefore sought to identify abnormal brain gene expression patterns via whole-genome analysis of mRNA levels and copy number variations (CNVs) in autistic and control postmortem brain samples. We focused on prefrontal cortex tissue where excess neuron numbers and cortical overgrowth are pronounced in the majority of autism cases. We found evidence for dysregulation in pathways governing cell number, cortical patterning, and differentiation in young autistic prefrontal cortex. In contrast, adult autistic prefrontal cortex showed dysregulation of signaling and repair pathways. Genes regulating cell cycle also exhibited autism-specific CNVs in DNA derived from prefrontal cortex, and these genes were significantly associated with autism in genome-wide association study datasets. Our results suggest that CNVs and age-dependent gene expression changes in autism may reflect distinct pathological processes in the developing versus the mature autistic prefrontal cortex. Our results raise the hypothesis that genetic dysregulation in the developing brain leads to abnormal regional patterning, excess prefrontal neurons, cortical overgrowth, and neural dysfunction in autism. PMID:22457638

  7. Age-dependent brain gene expression and copy number anomalies in autism suggest distinct pathological processes at young versus mature ages.

    PubMed

    Chow, Maggie L; Pramparo, Tiziano; Winn, Mary E; Barnes, Cynthia Carter; Li, Hai-Ri; Weiss, Lauren; Fan, Jian-Bing; Murray, Sarah; April, Craig; Belinson, Haim; Fu, Xiang-Dong; Wynshaw-Boris, Anthony; Schork, Nicholas J; Courchesne, Eric

    2012-01-01

    Autism is a highly heritable neurodevelopmental disorder, yet the genetic underpinnings of the disorder are largely unknown. Aberrant brain overgrowth is a well-replicated observation in the autism literature; but association, linkage, and expression studies have not identified genetic factors that explain this trajectory. Few studies have had sufficient statistical power to investigate whole-genome gene expression and genotypic variation in the autistic brain, especially in regions that display the greatest growth abnormality. Previous functional genomic studies have identified possible alterations in transcript levels of genes related to neurodevelopment and immune function. Thus, there is a need for genetic studies involving key brain regions to replicate these findings and solidify the role of particular functional pathways in autism pathogenesis. We therefore sought to identify abnormal brain gene expression patterns via whole-genome analysis of mRNA levels and copy number variations (CNVs) in autistic and control postmortem brain samples. We focused on prefrontal cortex tissue where excess neuron numbers and cortical overgrowth are pronounced in the majority of autism cases. We found evidence for dysregulation in pathways governing cell number, cortical patterning, and differentiation in young autistic prefrontal cortex. In contrast, adult autistic prefrontal cortex showed dysregulation of signaling and repair pathways. Genes regulating cell cycle also exhibited autism-specific CNVs in DNA derived from prefrontal cortex, and these genes were significantly associated with autism in genome-wide association study datasets. Our results suggest that CNVs and age-dependent gene expression changes in autism may reflect distinct pathological processes in the developing versus the mature autistic prefrontal cortex. Our results raise the hypothesis that genetic dysregulation in the developing brain leads to abnormal regional patterning, excess prefrontal neurons, cortical overgrowth, and neural dysfunction in autism.

  8. Histone methylation at gene promoters is associated with developmental regulation and region-specific expression of ionotropic and metabotropic glutamate receptors in human brain.

    PubMed

    Stadler, Florian; Kolb, Gabriele; Rubusch, Lothar; Baker, Stephen P; Jones, Edward G; Akbarian, Schahram

    2005-07-01

    Glutamatergic signaling is regulated, in part, through differential expression of NMDA and AMPA/KA channel subunits and G protein-coupled metabotropic receptors. In human brain, region-specific expression patterns of glutamate receptor genes are maintained over the course of decades, suggesting a role for molecular mechanisms involved in long-term regulation of transcription, including methylation of lysine residues at histone N-terminal tails. Using a native chromatin immunoprecipitation assay, we studied histone methylation marks at proximal promoters of 16 ionotropic and metabotropic glutamate receptor genes (GRIN1,2A-D; GRIA1,3,4; GRIK2,4,5; GRM1,3,4,6,7 ) in cerebellar cortex collected across a wide age range from midgestation to 90 years old. Levels of di- and trimethylated histone H3-lysine 4, which are associated with open chromatin and transcription, showed significant differences between promoters and a robust correlation with corresponding mRNA levels in immature and mature cerebellar cortex. In contrast, levels of trimethylated H3-lysine 27 and H4-lysine 20, two histone modifications defining silenced or condensed chromatin, did not correlate with transcription but were up-regulated overall in adult cerebellum. Furthermore, differential gene expression patterns in prefrontal and cerebellar cortex were reflected by similar differences in H3-lysine 4 methylation at promoters. Together, these findings suggest that histone lysine methylation at gene promoters is involved in developmental regulation and maintenance of region-specific expression patterns of ionotropic and metabotropic glutamate receptors. The association of a specific epigenetic mark, H3-(methyl)-lysine 4, with the molecular architecture of glutamatergic signaling in human brain has potential implications for schizophrenia and other disorders with altered glutamate receptor function.

  9. Threatening joy: approach and avoidance reactions to emotions are influenced by the group membership of the expresser.

    PubMed

    Paulus, Andrea; Wentura, Dirk

    2014-01-01

    It has been repeatedly stated that approach and avoidance reactions to emotional faces are triggered by the intention signalled by the emotion. This line of thought suggests that each emotion signals a specific intention triggering a specific behavioural reaction. However, empirical results examining this assumption are inconsistent, suggesting that it might be too short-sighted. We hypothesise that the same emotional expression can signal different social messages and, therefore, trigger different reactions; which social message is signalled by an emotional expression should be influenced by moderating variables, such as the group membership of the expresser. In two experiments, we show that group membership influences approach and avoidance reactions to emotional expressions: Emotions (fear and happiness) expressed by in-group members elicited concordant behaviour, whereas emotions expressed by out-group members activated the reverse pattern. A third experiment, in which participants directly evaluated smiling and fearful individuals resembling in-group and out-group members supported this result.

  10. Expression and in vitro regulation of integrins by normal human urothelial cells.

    PubMed

    Southgate, J; Kennedy, W; Hutton, K A; Trejdosiewicz, L K

    1995-08-01

    Integrins are thought to be essential adhesion receptors for the maintenance of tissue histioarchitecture. The purpose of this study was to determine integrin expression patterns in the human stratified transitional epithelium of the urinary tract (urothelium). In situ expression patterns were compared with in vitro expression, using a normal cell culture model system in which the effects of cell stratification can be studied independently of differentiation. By immunohistological criteria, the urothelia of bladder, ureter and renal pelvis expressed alpha 2 beta 1 and alpha 3 beta 1 integrins in all layers at intercellular junctions, and cytoplasmically in the lower strata. By contrast, alpha 6 beta 4 and occasionally alpha v beta 4 were expressed only by basal cells and localised to the basal lamina. These expression patterns were unaltered in specimens where an inflammatory cell infiltrate was present. In long-term cultures of normal urothelial cells maintained in a low-Ca++ serum-free medium, the monolayer cultures expressed alpha 2 beta 1, alpha 3 beta 1 and alpha 5 beta 1 integrins at intercellular junctions and in cytoplasmic inclusions, whereas alpha 6 beta 4 was distributed in a random pattern over the substratum. Increasing exogenous Ca++ concentrations induced cell stratification and desmosome formation, but not cytodifferentiation. Under these conditions, alpha 6 beta 4 became cell-, rather than substratum-associated, localising particularly to filopodia and lamellipodia. Quantitation of integrin expression by flow cytometry confirmed increased surface expression of alpha 6 beta 4 in high Ca++ media, and also of alpha 3 and alpha 5, but not alpha 2, subunits. These results suggest that alpha 2 beta 1 and alpha 3 beta 1 integrins, although differentially regulated, are mainly involved in homotypic cell-cell interactions and the maintenance of a stratified morphology, whereas alpha 6 beta 4 is the principal integrin involved in substratum adhesion.

  11. Seasonal Changes in Bacterial and Archaeal Gene Expression Patterns across Salinity Gradients in the Columbia River Coastal Margin

    PubMed Central

    Smith, Maria W.; Herfort, Lydie; Tyrol, Kaitlin; Suciu, Dominic; Campbell, Victoria; Crump, Byron C.; Peterson, Tawnya D.; Zuber, Peter; Baptista, Antonio M.; Simon, Holly M.

    2010-01-01

    Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM). A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April) and late summer (August). Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean) relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition. Furthermore, our results suggest that highly-active particle-attached microbiota in the Columbia River water column may perform dissimilatory nitrate reduction (both dentrification and DNRA) within anoxic particle microniches. PMID:20967204

  12. Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae

    PubMed Central

    Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.

    2014-01-01

    Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905

  13. Full Transcriptome Analysis of Early Dorsoventral Patterning in Zebrafish

    PubMed Central

    Horváth, Balázs; Molnár, János; Nagy, István; Tóth, Gábor; Wilson, Stephen W.; Varga, Máté

    2013-01-01

    Understanding the molecular interactions that lead to the establishment of the major body axes during embryogenesis is one of the main goals of developmental biology. Although the past two decades have revolutionized our knowledge about the genetic basis of these patterning processes, the list of genes involved in axis formation is unlikely to be complete. In order to identify new genes involved in the establishment of the dorsoventral (DV) axis during early stages of zebrafish embryonic development, we employed next generation sequencing for full transcriptome analysis of normal embryos and embryos lacking overt DV pattern. A combination of different statistical approaches yielded 41 differentially expressed candidate genes and we confirmed by in situ hybridization the early dorsal expression of 32 genes that are transcribed shortly after the onset of zygotic transcription. Although promoter analysis of the validated genes suggests no general enrichment for the binding sites of early acting transcription factors, most of these genes carry “bivalent” epigenetic histone modifications at the time when zygotic transcription is initiated, suggesting a “poised” transcriptional status. Our results reveal some new candidates of the dorsal gene regulatory network and suggest that a plurality of the earliest upregulated genes on the dorsal side have a role in the modulation of the canonical Wnt pathway. PMID:23922899

  14. Evolution and inheritance of early embryonic patterning in D. simulans and D. sechellia

    PubMed Central

    Lott, Susan E.; Ludwig, Michael Z.; Kreitman, Martin

    2010-01-01

    Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation which selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth ‘stripe allometry’) in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species D. simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the “margin of error” for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness PMID:21121913

  15. Archetypal analysis of diverse Pseudomonas aeruginosa transcriptomes reveals adaptation in cystic fibrosis airways

    PubMed Central

    2013-01-01

    Background Analysis of global gene expression by DNA microarrays is widely used in experimental molecular biology. However, the complexity of such high-dimensional data sets makes it difficult to fully understand the underlying biological features present in the data. The aim of this study is to introduce a method for DNA microarray analysis that provides an intuitive interpretation of data through dimension reduction and pattern recognition. We present the first “Archetypal Analysis” of global gene expression. The analysis is based on microarray data from five integrated studies of Pseudomonas aeruginosa isolated from the airways of cystic fibrosis patients. Results Our analysis clustered samples into distinct groups with comprehensible characteristics since the archetypes representing the individual groups are closely related to samples present in the data set. Significant changes in gene expression between different groups identified adaptive changes of the bacteria residing in the cystic fibrosis lung. The analysis suggests a similar gene expression pattern between isolates with a high mutation rate (hypermutators) despite accumulation of different mutations for these isolates. This suggests positive selection in the cystic fibrosis lung environment, and changes in gene expression for these isolates are therefore most likely related to adaptation of the bacteria. Conclusions Archetypal analysis succeeded in identifying adaptive changes of P. aeruginosa. The combination of clustering and matrix factorization made it possible to reveal minor similarities among different groups of data, which other analytical methods failed to identify. We suggest that this analysis could be used to supplement current methods used to analyze DNA microarray data. PMID:24059747

  16. Tissue distribution and early developmental expression patterns of aldolase A, B, and C in grass carp Ctenopharyngodon idellus.

    PubMed

    Fan, J J; Bai, J J; Ma, D M; Yu, L Y; Jiang, P

    2017-09-27

    Aldolase is a key enzyme involved in glycolysis, gluconeogenesis, and the pentose phosphate pathway. To establish the expression patterns of all three aldolase isozyme genes in different tissues and during early embryogenesis in lower vertebrates, as well as to explore the functional differences between these three isozymes, the grass carp was selected as a model owing to its relatively high glucose-metabolizing capability. Based on the cDNA sequences of the aldolase A, B, and C genes, the expression patterns of these three isozymes were analyzed in different tissues and during early embryogenesis using quantitative real-time polymerase chain reaction (qRT-PCR). Sequence analysis of cDNAs indicated that aldolase A, B, and C (GenBank accession numbers: KM192250, KM192251, and KM192252) consist of 364, 364, and 363 amino acids, respectively. The qRT-PCR results showed that the expression levels of aldolase A, B, and C were highest in the muscle, liver, and brain, respectively. Aldolase A and C exhibited similar expression patterns during embryogenesis, with high levels observed in unfertilized and fertilized eggs and at the blastocyst stage, followed by a decline and then increase after organogenesis. In contrast, aldolase B transcript was not detected during the unfertilized egg stage, and appeared only from gastrulation; the expression increased markedly during the feeding period (72 h after hatching), at which point the level was higher than those of aldolase A and C. These data suggest that the glucose content of grass carp starter feed should be adjusted according to the metabolic activity of aldolase B.

  17. Differential cadherin expression in the developing postnatal telencephalon of a New World monkey.

    PubMed

    Matsunaga, Eiji; Nambu, Sanae; Oka, Mariko; Iriki, Atsushi

    2013-12-01

    Cadherins are cell adhesion molecules widely expressed in the nervous system, where they play various roles in neural patterning, nuclei formation, axon guidance, and synapse formation and function. Although many published articles have reported on cadherin expression in rodents and ferrets, there are limited data on their expression in primate brains. In this study, in situ hybridization analysis was performed for 10 cadherins [nine classic cadherins (Cdh4, -6, -7, -8, -9, -10, -11, -12, and -20) and T-cadherin (Cdh13)] in the developing postnatal telencephalon of the common marmoset (Callithrix jacchus). Each cadherin showed broad expression in the cerebral cortex, basal ganglia, amygdala, and hippocampus, as previously shown in the rodent brain. However, detailed expression patterns differed between rodents and marmosets. In contrast to rodents, cadherin expression was reduced overall and localized to restricted areas of the brain during the developmental process, suggesting that cadherins are more crucially involved in developmental or maturation processes rather than in neural functioning. These results also highlight the possibility that restricted/less redundant cadherin expression allows primate brains to generate functional diversity among neurons, allowing morphological and functional differences between rodents and primates. Copyright © 2013 Wiley Periodicals, Inc.

  18. [Effects of cytosolic bacteria on cyclic GMP-AMP synthase expression in human gingival tissues and periodontal ligament cells].

    PubMed

    Xiaojun, Yang; Yongmei, Tan; Zhihui, Tian; Ting, Zhou; Wanghong, Zhao; Jin, Hou

    2017-04-01

    This work aims to determine the effect of cytosolic bacteria on the expression of cyclic GMP-AMP synthase (cGAS) in human periodontal ligament cells (hPDLCs) and gingival tissues. The ability of Porphyromonas gingivalis (P. gingivalis) to invade hPDLCs was detected using laser scanning confocal microscope assay at a multiplicity of infection of 10. P. gingivalis-infected cells were sorted by fluorescence-activated cell sorting (FACS). Then, quantitative real time reverse transcription polymerase chain reaction (qRT-PCR) and Western blot were used to detect cGAS expression in infected cells. Finally, the location and expression of cGAS in inflammatory and normal gingival tissues were investigated by immunohistochemistry. P. gingivalis actively invaded hPDLCs. Moreover, cGAS expression significantly increased in P. gingivalis-infected cells. Although cGAS was expressed in the epithelial and subepithelial cells of both inflamed and normal gingival tissues, cGAS expression significantly increased in inflamed gingival tissues. Cytosolic bacteria can upregulate cGAS expression in infected cells. These data suggest that cGAS may act as pattern-recognition receptors and participate in recognizing cytosolic nucleic acid pathogen-associated molecular patterns.
.

  19. Transcriptional responses of metallothionein gene to different stress factors in Pacific abalone (Haliotis discus hannai).

    PubMed

    Lee, Sang Yoon; Nam, Yoon Kwon

    2016-11-01

    A novel metallothionein (MT) gene from the Pacific abalone H. discus hannai was characterized and its mRNA expression patterns (tissue distribution, developmental expression and differential expression in responsive to various in vivo stimulatory treatments) were examined. Abalone MT shares conserved structural features with previously known gastropod orthologs at both genomic (i.e., tripartite organization) and amino acid (conserved Cys motifs) levels. The 5'-flanking regulatory region of abalone MT gene displayed various transcription factor binding motifs particularly including ones related with metal regulation and stress/immune responses. Tissue distribution and basal expression patterns of MT mRNAs indicated a potential association between ovarian MT expression and sexual maturation. Developmental expression pattern suggested the maternal contribution of MT mRNAs to embryonic and early larval developments. Abalone MT mRNAs could be significantly induced by various heavy metals in different tissues (gill, hepatopancreas, muscle and hemocyte) in a tissue- and/or metal-dependent fashion. In addition, the abalone MT gene was highly modulated in responsive to other non-metal, stimulatory treatments such as immune challenge (LPS, polyI:C and bacterial injections), hypoxia (decrease from normoxia 8 ppm-2 ppm), thermal elevation (increase from 20 °C to 30 °C), and xenobiotic exposure (250 ppb of 17α-ethynylestradiol and 0.25 ppb of 2,3,7,8-tetrachlorodibenzodioxin) where differential expression patterns were toward either up- or down-regulation depending on types of stimulations and tissues examined. Taken together, our results highlight that MT is a multifunctional effector playing in wide criteria of cellular pathways especially associated with development and stress responses in this abalone species. Copyright © 2016 Elsevier Ltd. All rights reserved.

  20. A major gene controls mimicry and crypsis in butterflies and moths

    PubMed Central

    Nadeau, Nicola J.; Pardo-Diaz, Carolina; Whibley, Annabel; Supple, Megan; Saenko, Suzanne V.; Wallbank, Richard W. R.; Wu, Grace C.; Maroja, Luana; Ferguson, Laura; Hanly, Joseph J.; Hines, Heather; Salazar, Camilo; Merrill, Richard; Dowling, Andrea; ffrench-Constant, Richard; Llaurens, Violaine; Joron, Mathieu; McMillan, W. Owen; Jiggins, Chris D.

    2016-01-01

    The wing patterns of butterflies and moths (Lepidoptera) are diverse and striking examples of evolutionary diversification by natural selection1,2. Lepidopteran wing colour patterns are a key innovation, consisting of arrays of coloured scales. We still lack a general understanding of how these patterns are controlled and if there is any commonality across the 160,000 moth and 17,000 butterfly species. Here, we identify a gene, cortex, through fine-scale mapping using population genomics and gene expression analyses, which regulates pattern switches in multiple species across the mimetic radiation in Heliconius butterflies. cortex belongs to a fast evolving subfamily of the otherwise highly conserved fizzy family of cell cycle regulators3, suggesting that it most likely regulates pigmentation patterning through regulation of scale cell development. In parallel with findings in the peppered moth (Biston betularia)4, our results suggest that this mechanism is common within Lepidoptera and that cortex has become a major target for natural selection acting on colour and pattern variation in this group of insects. PMID:27251285

  1. The gene cortex controls mimicry and crypsis in butterflies and moths.

    PubMed

    Nadeau, Nicola J; Pardo-Diaz, Carolina; Whibley, Annabel; Supple, Megan A; Saenko, Suzanne V; Wallbank, Richard W R; Wu, Grace C; Maroja, Luana; Ferguson, Laura; Hanly, Joseph J; Hines, Heather; Salazar, Camilo; Merrill, Richard M; Dowling, Andrea J; ffrench-Constant, Richard H; Llaurens, Violaine; Joron, Mathieu; McMillan, W Owen; Jiggins, Chris D

    2016-06-02

    The wing patterns of butterflies and moths (Lepidoptera) are diverse and striking examples of evolutionary diversification by natural selection. Lepidopteran wing colour patterns are a key innovation, consisting of arrays of coloured scales. We still lack a general understanding of how these patterns are controlled and whether this control shows any commonality across the 160,000 moth and 17,000 butterfly species. Here, we use fine-scale mapping with population genomics and gene expression analyses to identify a gene, cortex, that regulates pattern switches in multiple species across the mimetic radiation in Heliconius butterflies. cortex belongs to a fast-evolving subfamily of the otherwise highly conserved fizzy family of cell-cycle regulators, suggesting that it probably regulates pigmentation patterning by regulating scale cell development. In parallel with findings in the peppered moth (Biston betularia), our results suggest that this mechanism is common within Lepidoptera and that cortex has become a major target for natural selection acting on colour and pattern variation in this group of insects.

  2. The retinoic acid signaling pathway regulates anterior/posterior patterning in the nerve cord and pharynx of amphioxus, a chordate lacking neural crest.

    PubMed

    Escriva, Hector; Holland, Nicholas D; Gronemeyer, Hinrich; Laudet, Vincent; Holland, Linda Z

    2002-06-01

    Amphioxus, the closest living invertebrate relative of the vertebrates, has a notochord, segmental axial musculature, pharyngeal gill slits and dorsal hollow nerve cord, but lacks neural crest. In amphioxus, as in vertebrates, exogenous retinoic acid (RA) posteriorizes the embryo. The mouth and gill slits never form, AmphiPax1, which is normally downregulated where gill slits form, remains upregulated and AmphiHox1 expression shifts anteriorly in the nerve cord. To dissect the role of RA signaling in patterning chordate embryos, we have cloned the single retinoic acid receptor (AmphiRAR), retinoid X receptor (AmphiRXR) and an orphan receptor (AmphiTR2/4) from amphioxus. AmphiTR2/4 inhibits AmphiRAR-AmphiRXR-mediated transactivation in the presence of RA by competing for DR5 or IR7 retinoic acid response elements (RAREs). The 5' untranslated region of AmphiTR2/4 contains an IR7 element, suggesting possible auto- and RA-regulation. The patterns of AmphiTR2/4 and AmphiRAR expression during embryogenesis are largely complementary: AmphiTR2/4 is strongly expressed in the cerebral vesicle (homologous to the diencephalon plus anterior midbrain), while AmphiRAR expression is high in the equivalent of the hindbrain and spinal cord. Similarly, while AmphiTR2/4 is expressed most strongly in the anterior and posterior thirds of the endoderm, the highest AmphiRAR expression is in the middle third. Expression of AmphiRAR is upregulated by exogenous RA and completely downregulated by the RA antagonist BMS009. Moreover, BMS009 expands the pharynx posteriorly; the first three gill slit primordia are elongated and shifted posteriorly, but do not penetrate, and additional, non-penetrating gill slit primordia are induced. Thus, in an organism without neural crest, initiation and penetration of gill slits appear to be separate events mediated by distinct levels of RA signaling in the pharyngeal endoderm. Although these compounds have little effect on levels of AmphiTR2/4 expression, RA shifts pharyngeal expression of AmphiTR2/4 anteriorly, while BMS009 extends it posteriorly. Collectively, our results suggest a model for anteroposterior patterning of the amphioxus nerve cord and pharynx, which is probably applicable to vertebrates as well, in which a low anterior level of AmphiRAR (caused, at least in part, by competitive inhibition by AmphiTR2/4) is necessary for patterning the forebrain and formation of gill slits, the posterior extent of both being set by a sharp increase in the level of AmphiRAR. Supplemental data available on-line

  3. The retinoic acid signaling pathway regulates anterior/posterior patterning in the nerve cord and pharynx of amphioxus, a chordate lacking neural crest

    NASA Technical Reports Server (NTRS)

    Escriva, Hector; Holland, Nicholas D.; Gronemeyer, Hinrich; Laudet, Vincent; Holland, Linda Z.

    2002-01-01

    Amphioxus, the closest living invertebrate relative of the vertebrates, has a notochord, segmental axial musculature, pharyngeal gill slits and dorsal hollow nerve cord, but lacks neural crest. In amphioxus, as in vertebrates, exogenous retinoic acid (RA) posteriorizes the embryo. The mouth and gill slits never form, AmphiPax1, which is normally downregulated where gill slits form, remains upregulated and AmphiHox1 expression shifts anteriorly in the nerve cord. To dissect the role of RA signaling in patterning chordate embryos, we have cloned the single retinoic acid receptor (AmphiRAR), retinoid X receptor (AmphiRXR) and an orphan receptor (AmphiTR2/4) from amphioxus. AmphiTR2/4 inhibits AmphiRAR-AmphiRXR-mediated transactivation in the presence of RA by competing for DR5 or IR7 retinoic acid response elements (RAREs). The 5' untranslated region of AmphiTR2/4 contains an IR7 element, suggesting possible auto- and RA-regulation. The patterns of AmphiTR2/4 and AmphiRAR expression during embryogenesis are largely complementary: AmphiTR2/4 is strongly expressed in the cerebral vesicle (homologous to the diencephalon plus anterior midbrain), while AmphiRAR expression is high in the equivalent of the hindbrain and spinal cord. Similarly, while AmphiTR2/4 is expressed most strongly in the anterior and posterior thirds of the endoderm, the highest AmphiRAR expression is in the middle third. Expression of AmphiRAR is upregulated by exogenous RA and completely downregulated by the RA antagonist BMS009. Moreover, BMS009 expands the pharynx posteriorly; the first three gill slit primordia are elongated and shifted posteriorly, but do not penetrate, and additional, non-penetrating gill slit primordia are induced. Thus, in an organism without neural crest, initiation and penetration of gill slits appear to be separate events mediated by distinct levels of RA signaling in the pharyngeal endoderm. Although these compounds have little effect on levels of AmphiTR2/4 expression, RA shifts pharyngeal expression of AmphiTR2/4 anteriorly, while BMS009 extends it posteriorly. Collectively, our results suggest a model for anteroposterior patterning of the amphioxus nerve cord and pharynx, which is probably applicable to vertebrates as well, in which a low anterior level of AmphiRAR (caused, at least in part, by competitive inhibition by AmphiTR2/4) is necessary for patterning the forebrain and formation of gill slits, the posterior extent of both being set by a sharp increase in the level of AmphiRAR. Supplemental data available on-line.

  4. DNA methylation modulates H19 and IGF2 expression in porcine female eye

    PubMed Central

    Wang, Dongxu; Wang, Guodong; Yang, Hao; Liu, Haibo; Li, Cuie; Li, Xiaolan; Lin, Chao; Song, Yuning; Li, Zhanjun; Liu, Dianfeng

    2017-01-01

    Abstract The sexually dimorphic expression of H19/IGF2 is evolutionarily conserved. To investigate whether the expression of H19/IGF2 in the female porcine eye is sex-dependent, gene expression and methylation status were evaluated using quantitative real-time PCR (qPCR) and bisulfite sequencing PCR (BSP). We hypothesized that H19/IGF2 might exhibit a different DNA methylation status in the female eye. In order to evaluate our hypothesis, parthenogenetic (PA) cells were used for analysis by qPCR and BSP. Our results showed that H19 and IGF2 were over-expressed in the female eye compared with the male eye (3-fold and 2-fold, respectively). We observed a normal monoallelic methylation pattern for H19 differentially methylated regions (DMRs). Compared with H19 DMRs, IGF2 DMRs showed a different methylation pattern in the eye. Taken together, these results suggest that elevated expression of H19/IGF2 is caused by a specific chromatin structure that is regulated by the DNA methylation status of IGF2 DMRs in the female eye. PMID:28266684

  5. Seasonal Expression of the Picocyanobacterial Phosphonate Transporter Gene phnD in the Sargasso Sea

    PubMed Central

    Ilikchyan, Irina N.; McKay, Robert Michael L.; Kutovaya, Olga A.; Condon, Rob; Bullerjahn, George S.

    2010-01-01

    In phosphorus-limited marine environments, picocyanobacteria (Synechococcus and Prochlorococcus spp.) can hydrolyze naturally occurring phosphonates as a P source. Utilization of 2-aminoethylphosphonate (2-AEP) is dependent on expression of the phn genes, encoding functions required for uptake, and C–P bond cleavage. Prior work has indicated that expression of picocyanobacterial phnD, encoding the phosphonate binding protein of the phosphonate ABC transporter, is a proxy for the assimilation of phosphonates in natural assemblages of Synechococcus spp. and Prochlorococcus spp (Ilikchyan et al., 2009). In this study, we expand this work to assess seasonal phnD expression in the Sargasso Sea. By RT-PCR, our data confirm that phnD expression is constitutive for the Prochlorococcus spp. detected, but in Synechococcus spp. phnD transcription follows patterns of phosphorus availability in the mixed layer. Specifically, our data suggest that phnD is repressed in the spring when P is bioavailable following deep winter mixing. In the fall, phnD expression follows a depth-dependent pattern reflecting depleted P at the surface following summertime drawdown, and elevated P at depth. PMID:21687717

  6. Expression of pathogenicity-related genes of Xylella fastidiosa in vitro and in planta.

    PubMed

    de Souza, Alessandra A; Takita, Marco A; Pereira, Eridan O; Coletta-Filho, Helvécio D; Machado, Marcos A

    2005-04-01

    Xylella fastidiosa is responsible for several economically important plant diseases. It is currently assumed that the symptoms are caused by vascular occlusion due to biofilm formation. Microarray technology was previously used to examine the global gene expression profile of X. fastidiosa freshly isolated from symptomatic plants or after several passages by axenic culture medium, and different pathogenicity profiles have been obtained. In the present study the expression of some pathogenicity-related genes was evaluated in vitro and in planta by RT-PCR. The results suggest that adhesion is important at the beginning of biofilm formation, while the genes related to adaptation are essential for the organism's maintenance in planta. Similar results were observed in vitro mainly for the adhesion genes. The pattern of expression observed suggests that adhesion modulates biofilm formation whereas the expression of some adaptation genes may be related to the environment in which the organism is living.

  7. Ionotropic crustacean olfactory receptors.

    PubMed

    Corey, Elizabeth A; Bobkov, Yuriy; Ukhanov, Kirill; Ache, Barry W

    2013-01-01

    The nature of the olfactory receptor in crustaceans, a major group of arthropods, has remained elusive. We report that spiny lobsters, Panulirus argus, express ionotropic receptors (IRs), the insect chemosensory variants of ionotropic glutamate receptors. Unlike insects IRs, which are expressed in a specific subset of olfactory cells, two lobster IR subunits are expressed in most, if not all, lobster olfactory receptor neurons (ORNs), as confirmed by antibody labeling and in situ hybridization. Ligand-specific ORN responses visualized by calcium imaging are consistent with a restricted expression pattern found for other potential subunits, suggesting that cell-specific expression of uncommon IR subunits determines the ligand sensitivity of individual cells. IRs are the only type of olfactory receptor that we have detected in spiny lobster olfactory tissue, suggesting that they likely mediate olfactory signaling. Given long-standing evidence for G protein-mediated signaling in activation of lobster ORNs, this finding raises the interesting specter that IRs act in concert with second messenger-mediated signaling.

  8. Expression of an Msx homeobox gene in ascidians: insights into the archetypal chordate expression pattern.

    PubMed

    Ma, L; Swalla, B J; Zhou, J; Dobias, S L; Bell, J R; Chen, J; Maxson, R E; Jeffery, W R

    1996-03-01

    The Msx homeobox genes are expressed in complex patterns during vertebrate development in conjunction with inductive tissue interactions. As a means of understanding the archetypal role of Msx genes in chordates, we have isolated and characterized an Msx gene in ascidians, protochordates with a relatively simple body plan. The Mocu Msx-a and McMsx-a genes, isolated from the ascidians Molgula oculata and Molgula citrina, respectively, have homeodomains that place them in the msh-like subclass of Msx genes. Therefore, the Molgula Msx-a genes are most closely related to the msh genes previously identified in a number of invertebrates. Southern blot analysis suggests that there are one or two copies of the Msx-a gene in the Molgula genome. Northern blot and RNase protection analysis indicate that Msx-a transcripts are restricted to the developmental stages of the life cycle. In situ hybridization showed that Msx-a mRNA first appears just before gastrulation in the mesoderm (presumptive notochord and muscle) and ectoderm (neural plate) cells. Transcript levels decline in mesoderm cells after the completion of gastrulation, but are enhanced in the folding neural plate during neurulation. Later, Msx-a mRNA is also expressed in the posterior ectoderm and in a subset of the tail muscle cells. The ectoderm and mesoderm cells that express Msx-a are undergoing morphogenetic movements during gastrulation, neurulation, and tail formation. Msx-a expression ceases after these cells stop migrating. The ascidian M. citrina, in which adult tissues and organs begin to develop precociously in the larva, was used to study Msx-a expression during adult development. Msx-a transcripts are expressed in the heart primordium and the rudiments of the ampullae, epidermal protrusions with diverse functions in the juvenile. The heart and ampullae develop in regions where mesenchyme cells interact with endodermal or epidermal epithelia. A comparison of the expression patterns of the Molgula genes with those of their vertebrate congeners suggests that the archetypal roles of the Msx genes may be in morphogenetic movements during embryogenesis and in mesenchymal-epithelial interactions during organogenesis.

  9. Zebrafish: an exciting model for investigating the spatio-temporal pattern of enteric nervous system development.

    PubMed

    Doodnath, Reshma; Dervan, Adrian; Wride, Michael A; Puri, Prem

    2010-12-01

    Recently, the zebrafish (Danio rerio) has been shown to be an excellent model for human paediatric research. Advantages over other models include its small size, externally visually accessible development and ease of experimental manipulation. The enteric nervous system (ENS) consists of neurons and enteric glia. Glial cells permit cell bodies and processes of neurons to be arranged and maintained in a proper spatial arrangement, and are essential in the maintenance of basic physiological functions of neurons. Glial fibrillary acidic protein (GFAP) is expressed in astrocytes, but also expressed outside of the central nervous system. The aim of this study was to investigate the spatio-temporal pattern of GFAP expression in developing zebrafish ENS from 24 h post-fertilization (hpf), using transgenic fish that express green fluorescent protein (GFP). Zebrafish embryos were collected from transgenic GFP Tg(GFAP:GFP)(mi2001) adult zebrafish from 24 to 120 hpf, fixed and processed for whole mount immunohistochemistry. Antibodies to Phox2b were used to identify enteric neurons. Specimens were mounted on slides and imaging was performed using a fluorescent laser confocal microscope. GFAP:GFP labelling outside the spinal cord was identified in embryos from 48 hpf. The patterning was intracellular and consisted of elongated profiles that appeared to migrate away from the spinal cord into the periphery. At 72 and 96 hpf, GFAP:GFP was expressed dorsally and ventrally to the intestinal tract. At 120 hpf, GFAP:GFP was expressed throughout the intestinal wall, and clusters of enteric neurons were identified using Phox2b immunofluorescence along the pathway of GFAP:GFP positive processes, indicative of a migratory pathway of ENS precursors from the spinal cord into the intestine. The pattern of migration of GFAP:GFP expressing cells outside the spinal cord suggests an organized, early developing migratory pathway to the ENS. This shows for the first time that Tg(GFAP:GFP)(mi2001) zebrafish model is an ideal one to study spatio-temporal patterning of early ENS development.

  10. Mechanisms controlling neurite outgrowth in a pheochromocytoma cell line: The role of TRPC channels

    PubMed Central

    Kumar, Sanjay; Chakraborty, Saikat; Barbosa, Cindy; Brustovetsky, Tatiana; Brustovetsky, Nickolay; Obukhov, Alexander G.

    2014-01-01

    Transient Receptor Potential Canonical (TRPC) channels are implicated in modulating neurite outgrowth. The expression pattern of TRPC changes significantly during brain development, suggesting that fine-tuning TRPC expression may be important for orchestrating neuritogenesis. To study how alterations in the TRPC expression pattern affect neurite outgrowth, we used nerve growth factor (NGF)-differentiated rat pheochromocytoma 12 (PC12) cells, a model system for neuritogenesis. In PC12 cells, NGF markedly up-regulated TRPC1 and TRPC6 expression, but down-regulated TRPC5 expression while promoting neurite outgrowth. Overexpression of TRPC1 augmented, whereas TRPC5 overexpression decelerated NGF-induced neurite outgrowth. Conversely, shRNA-mediated knockdown of TRPC1 decreased, whereas shRNA-mediated knockdown of TRPC5 increased NGF-induced neurite extension. Endogenous TRPC1 attenuated the anti-neuritogenic effect of overexpressed TRPC5 in part by forming the heteromeric TRPC1–TRPC5 channels. Previous reports suggested that TRPC6 may facilitate neurite outgrowth. However, we found that TRPC6 overexpression slowed down neuritogenesis, whereas dominant negative TRPC6 (DN-TRPC6) facilitated neurite outgrowth in NGF-differentiated PC12 cells. Consistent with these findings, hyperforin, a neurite outgrowth promoting factor, decreased TRPC6 expression in NGF-differentiated PC12 cells. Using pharmacological and molecular biological approaches, we determined that NGF up-regulated TRPC1 and TRPC6 expression via a p75NTR-IKK2-dependent pathway that did not involve TrkA receptor signaling in PC12 cells. Similarly, NGF up-regulated TRPC1 and TRPC6 via an IKK2 dependent pathway in primary cultured hippocampal neurons. Thus, our data suggest that a balance of TRPC1, TRPC5, and TRPC6 expression determines neurite extension rate in neural cells, with TRPC6 emerging as an NGF-dependent “molecular damper” maintaining a submaximal velocity of neurite extension. PMID:21618530

  11. Divergent patterns of age-dependence in ornamental and reproductive traits in the collared flycatcher.

    PubMed

    Evans, Simon R; Gustafsson, Lars; Sheldon, Ben C

    2011-06-01

    Sexual ornaments are predicted to honestly signal individual condition. We might therefore expect ornament expression to show a senescent decline, in parallel with late-life deterioration of other characters. Conversely, life-history theory predicts the reduced residual reproductive value of older individuals will favor increased investment in sexually attractive traits. Using a 25-year dataset of more than 5000 records of breeding collared flycatchers (Ficedula albicollis) of known age, we quantify cross-sectional patterns of age-dependence in ornamental plumage traits and report long-term declines in expression that mask highly significant positive age-dependency. We partition this population-level age-dependency into its between- and within-individual components and show expression of ornamental white plumage patches exhibits within-individual increases with age in both sexes, consistent with life-history theory. For males, ornament expression also covaries with life span, such that, within a cohort, ornamentation indicates survival. Finally, we compared longitudinal age-dependency of reproductive traits and ornamental traits in both sexes, to assess whether these two trait types exhibit similar age-dependency. These analyses revealed contrasting patterns: reproductive traits showed within-individual declines in late-life females consistent with senescence; ornamental traits showed the opposite pattern in both males and females. Hence, our results for both sexes suggest that age-dependent ornament expression is consistent with life-history models of optimal signaling and, unlike reproductive traits, proof against senescence. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  12. Sex bias and dosage compensation in the zebra finch versus chicken genomes: General and specialized patterns among birds

    PubMed Central

    Itoh, Yuichiro; Replogle, Kirstin; Kim, Yong-Hwan; Wade, Juli; Clayton, David F.; Arnold, Arthur P.

    2010-01-01

    We compared global patterns of gene expression between two bird species, the chicken and zebra finch, with regard to sex bias of autosomal versus Z chromosome genes, dosage compensation, and evolution of sex bias. Both species appear to lack a Z chromosome–wide mechanism of dosage compensation, because both have a similar pattern of significantly higher expression of Z genes in males relative to females. Unlike the chicken Z chromosome, which has female-specific expression of the noncoding RNA MHM (male hypermethylated) and acetylation of histone 4 lysine 16 (H4K16) near MHM, the zebra finch Z chromosome appears to lack the MHM sequence and acetylation of H4K16. The zebra finch also does not show the reduced male-to-female (M:F) ratio of gene expression near MHM similar to that found in the chicken. Although the M:F ratios of Z chromosome gene expression are similar across tissues and ages within each species, they differ between the two species. Z genes showing the greatest species difference in M:F ratio were concentrated near the MHM region of the chicken Z chromosome. This study shows that the zebra finch differs from the chicken because it lacks a specialized region of greater dosage compensation along the Z chromosome, and shows other differences in sex bias. These patterns suggest that different avian taxa may have evolved specific compensatory mechanisms. PMID:20357053

  13. Contrasting gene expression patterns induced by levodopa and pramipexole treatments in the rat model of Parkinson's disease.

    PubMed

    Taravini, Irene R; Larramendy, Celia; Gomez, Gimena; Saborido, Mariano D; Spaans, Floor; Fresno, Cristóbal; González, Germán A; Fernández, Elmer; Murer, Mario G; Gershanik, Oscar S

    2016-02-01

    Whether the treatment of Parkinson's disease has to be initiated with levodopa or a D2 agonist like pramipexole remains debatable. Levodopa is more potent against symptoms than D2 agonists, but D2 agonists are less prone to induce motor complications and may have neuroprotective effects. Although regulation of plastic changes in striatal circuits may be the key to their different therapeutic potential, the gene expression patterns induced by de novo treatments with levodopa or D2 agonists are currently unknown. By studying the whole striatal transcriptome in a rodent model of early stage Parkinson's disease, we have identified the gene expression patterns underlying therapeutically comparable chronic treatments with levodopa or pramipexole. Despite the overall relatively small size of mRNA expression changes at the level of individual transcripts, our data show a robust and complete segregation of the transcript expression patterns induced by both treatments. Moreover, transcripts related to oxidative metabolism and mitochondrial function were enriched in levodopa-treated compared to vehicle-treated and pramipexole-treated animals, whereas transcripts related to olfactory transduction pathways were enriched in both treatment groups compared to vehicle-treated animals. Thus, our data reveal the plasticity of genetic striatal networks possibly contributing to the therapeutic effects of the most common initial treatments for Parkinson's disease, suggesting a role for oxidative stress in the long term complications induced by levodopa and identifying previously overlooked signaling cascades as potentially new therapeutic targets. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Differential skeletal muscle proteome of high- and low-active mice

    PubMed Central

    Dangott, Lawrence J.; Schmitt, Emily E.; Vellers, Heather L.; Lightfoot, J. Timothy

    2014-01-01

    Physical inactivity contributes to cardiovascular disease, type II diabetes, obesity, and some types of cancer. While the literature is clear that there is genetic regulation of physical activity with existing gene knockout data suggesting that skeletal muscle mechanisms contribute to the regulation of activity, actual differences in end-protein expression between high- and low-active mice have not been investigated. This study used two-dimensional differential gel electrophoresis coupled with mass spectrometry to evaluate the proteomic differences between high-active (C57L/J) and low-active (C3H/HeJ) mice in the soleus and extensor digitorum longus (EDL). Furthermore, vivo-morpholinos were used to transiently knockdown candidate proteins to confirm their involvement in physical activity regulation. Proteins with higher expression patterns generally fell into the calcium-regulating and Krebs (TCA) cycle pathways in the high-active mice (e.g., annexin A6, P = 0.0031; calsequestrin 1; P = 0.000025), while the overexpressed proteins in the low-active mice generally fell into cytoskeletal structure- and electron transport chain-related pathways (e.g., ATPase, P = 0.031; NADH dehydrogenase, P = 0.027). Transient knockdown of annexin A6 and calsequestrin 1 protein of high-active mice with vivo-morpholinos resulted in decreased physical activity levels (P = 0.001). These data suggest that high- and low-active mice have unique protein expression patterns and that each pattern contributes to the peripheral capability to be either high- or low-active, suggesting that different specific mechanisms regulate activity leading to the high- or low-activity status of the animal. PMID:24505100

  15. Variation in Orthologous Shell-Forming Proteins Contribute to Molluscan Shell Diversity

    PubMed Central

    Jackson, Daniel J.; Reim, Laurin; Randow, Clemens; Cerveau, Nicolas; Degnan, Bernard M.; Fleck, Claudia

    2017-01-01

    Abstract Despite the evolutionary success and ancient heritage of the molluscan shell, little is known about the molecular details of its formation, evolutionary origins, or the interactions between the material properties of the shell and its organic constituents. In contrast to this dearth of information, a growing collection of molluscan shell-forming proteomes and transcriptomes suggest they are comprised of both deeply conserved, and lineage specific elements. Analyses of these sequence data sets have suggested that mechanisms such as exon shuffling, gene co-option, and gene family expansion facilitated the rapid evolution of shell-forming proteomes and supported the diversification of this phylum specific structure. In order to further investigate and test these ideas we have examined the molecular features and spatial expression patterns of two shell-forming genes (Lustrin and ML1A2) and coupled these observations with materials properties measurements of shells from a group of closely related gastropods (abalone). We find that the prominent “GS” domain of Lustrin, a domain believed to confer elastomeric properties to the shell, varies significantly in length between the species we investigated. Furthermore, the spatial expression patterns of Lustrin and ML1A2 also vary significantly between species, suggesting that both protein architecture, and the regulation of spatial gene expression patterns, are important drivers of molluscan shell evolution. Variation in these molecular features might relate to certain materials properties of the shells of these species. These insights reveal an important and underappreciated source of variation within shell-forming proteomes that must contribute to the diversity of molluscan shell phenotypes. PMID:28961798

  16. Selective modes determine evolutionary rates, gene compactness and expression patterns in Brassica.

    PubMed

    Guo, Yue; Liu, Jing; Zhang, Jiefu; Liu, Shengyi; Du, Jianchang

    2017-07-01

    It has been well documented that most nuclear protein-coding genes in organisms can be classified into two categories: positively selected genes (PSGs) and negatively selected genes (NSGs). The characteristics and evolutionary fates of different types of genes, however, have been poorly understood. In this study, the rates of nonsynonymous substitution (K a ) and the rates of synonymous substitution (K s ) were investigated by comparing the orthologs between the two sequenced Brassica species, Brassica rapa and Brassica oleracea, and the evolutionary rates, gene structures, expression patterns, and codon bias were compared between PSGs and NSGs. The resulting data show that PSGs have higher protein evolutionary rates, lower synonymous substitution rates, shorter gene length, fewer exons, higher functional specificity, lower expression level, higher tissue-specific expression and stronger codon bias than NSGs. Although the quantities and values are different, the relative features of PSGs and NSGs have been largely verified in the model species Arabidopsis. These data suggest that PSGs and NSGs differ not only under selective pressure (K a /K s ), but also in their evolutionary, structural and functional properties, indicating that selective modes may serve as a determinant factor for measuring evolutionary rates, gene compactness and expression patterns in Brassica. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  17. Pericentromeric Effects Shape the Patterns of Divergence, Retention, and Expression of Duplicated Genes in the Paleopolyploid Soybean[C][W

    PubMed Central

    Du, Jianchang; Tian, Zhixi; Sui, Yi; Zhao, Meixia; Song, Qijian; Cannon, Steven B.; Cregan, Perry; Ma, Jianxin

    2012-01-01

    The evolutionary forces that govern the divergence and retention of duplicated genes in polyploids are poorly understood. In this study, we first investigated the rates of nonsynonymous substitution (Ka) and the rates of synonymous substitution (Ks) for a nearly complete set of genes in the paleopolyploid soybean (Glycine max) by comparing the orthologs between soybean and its progenitor species Glycine soja and then compared the patterns of gene divergence and expression between pericentromeric regions and chromosomal arms in different gene categories. Our results reveal strong associations between duplication status and Ka and gene expression levels and overall low Ks and low levels of gene expression in pericentromeric regions. It is theorized that deleterious mutations can easily accumulate in recombination-suppressed regions, because of Hill-Robertson effects. Intriguingly, the genes in pericentromeric regions—the cold spots for meiotic recombination in soybean—showed significantly lower Ka and higher levels of expression than their homoeologs in chromosomal arms. This asymmetric evolution of two members of individual whole genome duplication (WGD)-derived gene pairs, echoing the biased accumulation of singletons in pericentromeric regions, suggests that distinct genomic features between the two distinct chromatin types are important determinants shaping the patterns of divergence and retention of WGD-derived genes. PMID:22227891

  18. The value of molecular expression of KIT and KIT ligand analysed using real-time polymerase chain reaction and immunohistochemistry as a prognostic indicator for canine cutaneous mast cell tumours.

    PubMed

    Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M

    2015-03-01

    This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.

  19. Transition from two to one integument in Prunus species: expression pattern of INNER NO OUTER (INO), ABERRANT TESTA SHAPE (ATS) and ETTIN (ETT).

    PubMed

    Lora, Jorge; Hormaza, José I; Herrero, Maria

    2015-10-01

    While gymnosperm ovules have one integument, in most angiosperms two integuments surround the ovules. Unitegmic ovules have arisen independently several times during the evolution of angiosperms, but the ultimate genetic cause of the presence of a single integument remains elusive. We compared species of the genus Prunus that have different numbers of integuments: bitegmic species, such as Prunus armeniaca (apricot) and Prunus persica (peach), and unitegmic species, such as Prunus incisa, analyzing the expression pattern of genes that are involved in integument development in Arabidopsis thaliana: INNER NO OUTER (INO), ABERRANT TESTA SHAPE (ATS) and ETTIN (ETT). Bitegmic and unitegmic species showed similar INO expression patterns, indicative of the conservation of an outer integument. However, expression of ETT, which occurs in the boundary of the outer and inner integuments, was altered in unitegmic ovules, which showed lack of ETT expression. These results strongly suggest that the presence of a single integument could be attributable to the amalgamation of two integuments and support the role of ETT in the fusion of the outer and inner integuments in unitegmic ovules, a situation that could be widespread in other unitegmic species of angiosperms. © 2015 Consejo Superior de Investigaciones Cientificas. New Phytologist © 2015 New Phytologist Trust.

  20. Circadian Rhythms Regulate Amelogenesis

    PubMed Central

    Zheng, Li; Seon, Yoon Ji; Mourão, Marcio A.; Schnell, Santiago; Kim, Doohak; Harada, Hidemitsu; Papagerakis, Silvana; Papagerakis, Petros

    2013-01-01

    Ameloblasts, the cells responsible for making enamel, modify their morphological features in response to specialized functions necessary for synchronized ameloblast differentiation and enamel formation. Secretory and maturation ameloblasts are characterized by the expression of stage-specific genes which follows strictly controlled repetitive patterns. Circadian rhythms are recognized as key regulators of development and diseases of many tissues including bone. Our aim was to gain novel insights on the role of clock genes in enamel formation and to explore the potential links between circadian rhythms and amelogenesis. Our data shows definitive evidence that the main clock genes (Bmal1, Clock, Per1 and Per2) oscillate in ameloblasts at regular circadian (24h) intervals both at RNA and protein levels. This study also reveals that two markers of ameloblast differentiation i.e. amelogenin (Amelx; a marker of secretory ameloblasts) and kallikrein-related peptidase 4 (Klk4, a marker of maturation ameloblasts) are downstream targets of clock genes. Both, Amelx and Klk4 show 24h oscillatory expression patterns and their expression levels are up-regulated after Bmal1 over-expression in HAT-7 ameloblast cells. Taken together, these data suggest that both the secretory and the maturation stage of amelogenesis might be under circadian control. Changes in clock genes expression patterns might result in significant alterations of enamel apposition and mineralization. PMID:23486183

  1. Commonly dysregulated genes in murine APL cells

    PubMed Central

    Yuan, Wenlin; Payton, Jacqueline E.; Holt, Matthew S.; Link, Daniel C.; Watson, Mark A.; DiPersio, John F.; Ley, Timothy J.

    2007-01-01

    To identify genes that are commonly dysregulated in a murine model of acute promyelocytic leukemia (APL), we first defined gene expression patterns during normal murine myeloid development; serial gene expression profiling studies were performed with primary murine hematopoietic progenitors that were induced to undergo myeloid maturation in vitro with G-CSF. Many genes were reproducibly expressed in restricted developmental “windows,” suggesting a structured hierarchy of expression that is relevant for the induction of developmental fates and/or differentiated cell functions. We compared the normal myeloid developmental transcriptome with that of APL cells derived from mice expressing PML-RARα under control of the murine cathepsin G locus. While many promyelocyte-specific genes were highly expressed in all APL samples, 116 genes were reproducibly dysregulated in many independent APL samples, including Fos, Jun, Egr1, Tnf, and Vcam1. However, this set of commonly dysregulated genes was expressed normally in preleukemic, early myeloid cells from the same mouse model, suggesting that dysregulation occurs as a “downstream” event during disease progression. These studies suggest that the genetic events that lead to APL progression may converge on common pathways that are important for leukemia pathogenesis. PMID:17008535

  2. Engrailed negatively regulates the expression of cell adhesion molecules connectin and neuroglian in embryonic Drosophila nervous system.

    PubMed

    Siegler, M V; Jia, X X

    1999-02-01

    Engrailed is expressed in subsets of interneurons that do not express Connectin or appreciable Neuroglian, whereas other neurons that are Engrailed negative strongly express these adhesion molecules. Connectin and Neuroglian expression are virtually eliminated in interneurons when engrailed expression is driven ubiquitously in neurons, and greatly increased when engrailed genes are lacking in mutant embryos. The data suggest that Engrailed is normally a negative regulator of Connectin and neuroglian. These are the first two "effector" genes identified in the nervous system of Drosophila as regulatory targets for Engrailed. We argue that differential Engrailed expression is crucial in determining the pattern of expression of cell adhesion molecules and thus constitutes an important determinant of neuronal shape and perhaps connectivity.

  3. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine.

    PubMed

    Bradford, Emily M; Vairamani, Kanimozhi; Shull, Gary E

    2016-02-15

    To investigate the intestinal functions of the NKCC1 Na(+)-K(+)-2Cl cotransporter (SLC12a2 gene), differential mRNA expression changes in NKCC1-null intestine were analyzed. Microarray analysis of mRNA from intestines of adult wild-type mice and gene-targeted NKCC1-null mice (n = 6 of each genotype) was performed to identify patterns of differential gene expression changes. Differential expression patterns were further examined by Gene Ontology analysis using the online Gorilla program, and expression changes of selected genes were verified using northern blot analysis and quantitative real time-polymerase chain reaction. Histological staining and immunofluorescence were performed to identify cell types in which upregulated pancreatic digestive enzymes were expressed. Genes typically associated with pancreatic function were upregulated. These included lipase, amylase, elastase, and serine proteases indicative of pancreatic exocrine function, as well as insulin and regenerating islet genes, representative of endocrine function. Northern blot analysis and immunohistochemistry showed that differential expression of exocrine pancreas mRNAs was specific to the duodenum and localized to a subset of goblet cells. In addition, a major pattern of changes involving differential expression of olfactory receptors that function in chemical sensing, as well as other chemosensing G-protein coupled receptors, was observed. These changes in chemosensory receptor expression may be related to the failure of intestinal function and dependency on parenteral nutrition observed in humans with SLC12a2 mutations. The results suggest that loss of NKCC1 affects not only secretion, but also goblet cell function and chemosensing of intestinal contents via G-protein coupled chemosensory receptors.

  4. Expression of synaptogyrin-1 in T1R2-expressing type II taste cells and type III taste cells of rat circumvallate taste buds.

    PubMed

    Kotani, Takeshi; Toyono, Takashi; Seta, Yuji; Kitou, Ayae; Kataoka, Shinji; Toyoshima, Kuniaki

    2013-09-01

    Synaptogyrins are conserved components of the exocytic apparatus and function as regulators of Ca(2+)-dependent exocytosis. The synaptogyrin family comprises three isoforms: two neuronal (synaptogyrin-1 and -3) and one ubiquitous (synaptogyrin-2) form. Although the expression patterns of the exocytic proteins synaptotagmin-1, SNAP-25, synaptobrevin-2 and synaptophysin have been elucidated in taste buds, the function and expression pattern of synaptogyrin-1 in rat gustatory tissues have not been determined. Therefore, we examined the expression patterns of synaptogyrin-1 and several cell-specific markers of type II and III cells in rat gustatory tissues. Reverse transcription/polymerase chain reaction assays and immunoblot analysis revealed the expression of synaptogyrin-1 mRNA and its protein in circumvallate papillae. In fungiform, foliate and circumvallate papillae, the antibody against synaptogyrin-1 immunolabeled a subset of taste bud cells and intra- and subgemmal nerve processes. Double-labeling experiments revealed the expression of synaptogyrin-1 in most taste cells immunoreactive for aromatic L-amino acid decarboxylase and the neural cell adhesion molecule. A subset of synaptogyrin-1-immunoreactive taste cells also expressed phospholipase Cβ2, gustducin, or sweet taste receptor (T1R2). In addition, most synaptogyrin-1-immunoreactive taste cells expressed synaptobrevin-2. These results suggest that synaptogyrin-1 plays a regulatory role in transmission at the synapses of type III cells and is involved in exocytic function with synaptobrevin-2 in a subset of type II cells in rat taste buds.

  5. Comparative study of MSX-2, DLX-5, and DLX-7 gene expression during early human tooth development.

    PubMed

    Davideau, J L; Demri, P; Hotton, D; Gu, T T; MacDougall, M; Sharpe, P; Forest, N; Berdal, A

    1999-12-01

    Msx and Dlx family transcription factors are key elements of craniofacial development and act in specific combinations with growth factors to control the position and shape of various skeletal structures in mice. In humans, the mutations of MSX and DLX genes are associated with specific syndromes, such as tooth agenesis, craniosynostosis, and tricho-dento-osseous syndrome. To establish some relationships between those reported human syndromes, previous experimental data in mice, and the expression patterns of MSX and DLX homeogenes in the human dentition, we investigated MSX-2, DLX-5, and DLX-7 expression patterns and compared them in orofacial tissues of 7.5- to 9-wk-old human embryos by using in situ hybridization. Our data showed that MSX-2 was strongly expressed in the progenitor cells of human orofacial skeletal structures, including mandible and maxilla bones, Meckel's cartilage, and tooth germs, as shown for DLX-5. DLX-7 expression was restricted to the vestibular lamina and, later on, to the vestibular part of dental epithelium. The comparison of MSX-2, DLX-5, and DLX-7 expression patterns during the early stages of development of different human tooth types showed the existence of spatially ordered sequences of homeogene expression along the vestibular/lingual axis of dental epithelium. The expression of MSX-2 in enamel knot, as well as the coincident expression of MSX-2, DLX-5, and DLX-7 in a restricted vestibular area of dental epithelium, suggests the existence of various organizing centers involved in the control of human tooth morphogenesis.

  6. Floral Meristem Identity Genes Are Expressed during Tendril Development in Grapevine1

    PubMed Central

    Calonje, Myriam; Cubas, Pilar; Martínez-Zapater, José M.; Carmona, María José

    2004-01-01

    To study the early steps of flower initiation and development in grapevine (Vitis vinifera), we have isolated two MADS-box genes, VFUL-L and VAP1, the putative FUL-like and AP1 grapevine orthologs, and analyzed their expression patterns during vegetative and reproductive development. Both genes are expressed in lateral meristems that, in grapevine, can give rise to either inflorescences or tendrils. They are also coexpressed in inflorescence and flower meristems. During flower development, VFUL-L transcripts are restricted to the central part of young flower meristems and, later, to the prospective carpel-forming region, which is consistent with a role of this gene in floral transition and carpel and fruit development. Expression pattern of VAP1 suggests that it may play a role in flowering transition and flower development. However, its lack of expression in sepal primordia, does not support its role as an A-function gene in grapevine. Neither VFUL-L nor VAP1 expression was detected in vegetative organs such as leaves or roots. In contrast, they are expressed throughout tendril development. Transcription of both genes in tendrils of very young plants that have not undergone flowering transition indicates that this expression is independent of the flowering process. These unique expression patterns of genes typically involved in reproductive development have implications on our understanding of flower induction and initiation in grapevine, on the origin of grapevine tendrils and on the functional roles of AP1-and FUL-like genes in plant development. These results also provide molecular support to the hypothesis that Vitis tendrils are modified reproductive organs adapted to climb. PMID:15247405

  7. Divergence in Patterns of Leaf Growth Polarity Is Associated with the Expression Divergence of miR396

    PubMed Central

    2015-01-01

    Lateral appendages often show allometric growth with a specific growth polarity along the proximo-distal axis. Studies on leaf growth in model plants have identified a basipetal growth direction with the highest growth rate at the proximal end and progressively lower rates toward the distal end. Although the molecular mechanisms governing such a growth pattern have been studied recently, variation in leaf growth polarity and, therefore, its evolutionary origin remain unknown. By surveying 75 eudicot species, here we report that leaf growth polarity is divergent. Leaf growth in the proximo-distal axis is polar, with more growth arising from either the proximal or the distal end; dispersed with no apparent polarity; or bidirectional, with more growth contributed by the central region and less growth at either end. We further demonstrate that the expression gradient of the miR396-GROWTH-REGULATING FACTOR module strongly correlates with the polarity of leaf growth. Altering the endogenous pattern of miR396 expression in transgenic Arabidopsis thaliana leaves only partially modified the spatial pattern of cell expansion, suggesting that the diverse growth polarities might have evolved via concerted changes in multiple gene regulatory networks. PMID:26410303

  8. Diffusion and scaling during early embryonic pattern formation.

    PubMed

    Gregor, Thomas; Bialek, William; de Ruyter van Steveninck, Rob R; Tank, David W; Wieschaus, Eric F

    2005-12-20

    Development of spatial patterns in multicellular organisms depends on gradients in the concentration of signaling molecules that control gene expression. In the Drosophila embryo, Bicoid (Bcd) morphogen controls cell fate along 70% of the anteroposterior axis but is translated from mRNA localized at the anterior pole. Gradients of Bcd and other morphogens are thought to arise through diffusion, but this basic assumption has never been rigorously tested in living embryos. Furthermore, because diffusion sets a relationship between length and time scales, it is hard to see how patterns of gene expression established by diffusion would scale proportionately as egg size changes during evolution. Here, we show that the motion of inert molecules through the embryo is well described by the diffusion equation on the relevant length and time scales, and that effective diffusion constants are essentially the same in closely related dipteran species with embryos of very different size. Nonetheless, patterns of gene expression in these different species scale with egg length. We show that this scaling can be traced back to scaling of the Bcd gradient itself. Our results, together with constraints imposed by the time scales of development, suggest that the mechanism for scaling is a species-specific adaptation of the Bcd lifetime.

  9. Distinct patterns of dysregulated expression of enzymes involved in androgen synthesis and metabolism in metastatic prostate cancer tumors

    PubMed Central

    Mitsiades, Nicholas; Sung, Clifford C.; Schultz, Nikolaus; Danila, Daniel C.; He, Bin; Eedunuri, Vijay Kumar; Fleisher, Martin; Sander, Chris; Sawyers, Charles L.; Scher, Howard I.

    2012-01-01

    Androgen receptor (AR) signaling persists in castration-resistant prostate carcinomas (CRPCs), due to several mechanisms that include increased AR expression and intratumoral androgen metabolism. We investigated the mechanisms underlying aberrant expression of transcripts involved in androgen metabolism in CRPC. We compared gene expression profiles and DNA copy number alteration (CNA) data from 29 normal prostate tissue samples, 127 primary prostate carcinomas (PCas) and 19 metastatic PCas. Steroidogenic enzyme transcripts were evaluated by qRT-PCR in PCa cell lines and circulating tumor cells (CTCs) from CRPC patients. Metastatic PCas expressed higher transcript levels for AR and several steroidogenic enzymes, including SRD5A1, SRD5A3, and AKR1C3, while expression of SRD5A2, CYP3A4, CYP3A5 and CYP3A7 was decreased. This aberrant expression was rarely associated with CNAs. Instead, our data suggest distinct patterns of coordinated aberrant enzyme expression. Inhibition of AR activity by itself stimulated AKR1C3 expression. The aberrant expression of the steroidogenic enzyme transcripts were detected in CTCs from CRPC patients. In conclusion, our findings identify substantial interpatient heterogeneity and distinct patterns of dysregulated expression of enzymes involved in intratumoral androgen metabolism in PCa. These steroidogenic enzymes represent targets for complete suppression of systemic and intratumoral androgen levels, an objective that is supported by the clinical efficacy of the CYP17 inhibitor abiraterone. A comprehensive AR axis targeting approach via simultaneous, frontline enzymatic blockade and/or transcriptional repression of several steroidogenic enzymes, in combination with GnRH analogs and potent anti-androgens, would represent a powerful future strategy for PCa management. PMID:22971343

  10. Expression Patterns of CREBs in Oocyte Growth and Maturation of Fish

    PubMed Central

    Wang, De-Shou; Sudhakumari, Cheni-Chery; Kobayashi, Tohru; Nagahama, Yoshitaka

    2015-01-01

    In fish, oocyte meiotic maturation is regulated by 17α, 20β-dihydroxy-progesterone through cAMP. To study the role of cAMP response element binding protein (CREB) in meiotic maturation, we cloned and characterized the expression pattern of CREBs from two fish models, the Nile tilapia and catfish. In the Nile tilapia three different CREBs were identified where in CREB1 was found in many tissues including gonads with abundant expression in testis. CREB2, few amino acids shorter than CREB1, was expressed in several tissues with abundant expression in ovary. In addition, a 3’UTR variant form, CREB3 was exclusively found in ovary. During natural 14-day ovarian cycle of the Nile tilapia, CREB1 expression was stable throughout vitellogenesis with a sharp decrease on the day of spawning. In contrast, CREB2 remain unchanged throughout the ovarian cycle, however elevated in 11-day full-grown immature ovarian follicle and after hCG-induction. Interestingly, CREB3 expression was induced three folds on the day of spawning as well as during hCG-induced oocyte maturation. Based on the synergistic expression pattern, CREB1 is likely to control oocyte growth, whereas CREB 2 and 3 contribute to oocyte maturation in tilapia and the latter seems to be critical. In catfish, a single form of CREB showed a maximum expression during spawning phase and hCG-induced maturation both in vivo and in vitro augmented CREB expression. These results suggest that spatial and temporal expression of CREBs seems to be important for final oocyte maturation and may also regulate oocyte growth in fish. PMID:26700177

  11. Characterization, expression profiles, intracellular distribution and association analysis of porcine PNAS-4 gene with production traits.

    PubMed

    Mo, Delin; Zhu, Zhengmao; te Pas, Marinus F W; Li, Xinyun; Yang, Shulin; Wang, Heng; Wang, Huanling; Li, Kui

    2008-06-30

    In a previous screen to identify differentially expressed genes associated with embryonic development, the porcine PNAS-4 gene had been found. Considering differentially expressed genes in early stages of muscle development are potential candidate genes to improve meat quality and production efficiency, we determined how porcine PNAS-4 gene regulates meat production. Therefore, this gene has been sequenced, expression analyzed and associated with meat production traits. We cloned the full-length cDNA of porcine PNAS-4 gene encoding a protein of 194 amino acids which was expressed in the Golgi complex. This gene was mapped to chromosome 10, q11-16, in a region of conserved synteny with human chromosome 1 where the human homologous gene was localized. Real-time PCR revealed that PNAS-4 mRNA was widely expressed with highest expression levels in skeletal muscle followed by lymph, liver and other tissues, and showed a down-regulated expression pattern during prenatal development while a up-regulated expression pattern after weaning. Association analysis revealed that allele C of SNP A1813C was prevalent in Chinese indigenous breeds whereas A was dominant allele in Landrace and Large White, and the pigs with homozygous CC had a higher fat content than those of the pigs with other genotypes (P < 0.05). Porcine PNAS-4 protein tagged with green fluorescent protein accumulated in the Golgi complex, and its mRNA showed a widespread expression across many tissues and organs in pigs. It may be an important factor affecting the meat production efficiency, because its down-regulated expression pattern during early embryogenesis suggests involvement in increase of muscle fiber number. In addition, the SNP A1813C associated with fat traits might be a genetic marker for molecular-assisted selection in animal breeding.

  12. C-Type Lectin Receptor MCL Facilitates Mincle Expression and Signaling through Complex Formation.

    PubMed

    Miyake, Yasunobu; Masatsugu, Oh-hora; Yamasaki, Sho

    2015-06-01

    C-type lectin receptors expressed in APCs are recently defined pattern recognition receptors that play a crucial role in immune responses against pathogen-associated molecular patterns. Among pathogen-associated molecular patterns, cord factor (trehalose-6,6'-dimycolate [TDM]) is the most potent immunostimulatory component of the mycobacterial cell wall. Two C-type lectin receptors, macrophage-inducible C-type lectin (Mincle) and macrophage C-type lectin (MCL), are required for immune responses against TDM. Previous studies indicate that MCL is required for TDM-induced Mincle expression. However, the mechanism by which MCL induces Mincle expression has not been fully understood. In this study, we demonstrate that MCL interacts with Mincle to promote its surface expression. After LPS or zymosan stimulation, MCL-deficient bone marrow-derived dendritic cells (BMDCs) had a lower level of Mincle protein expression, although mRNA expression was comparable with wild-type BMDCs. Meanwhile, BMDCs from MCL transgenic mice showed an enhanced level of Mincle expression on the cell surface. MCL was associated with Mincle through the stalk region and this region was necessary and sufficient for the enhancement of Mincle expression. This interaction appeared to be mediated by the hydrophobic repeat of MCL, as substitution of four hydrophobic residues within the stalk region with serine (MCL(4S)) abolished the function to enhance the surface expression of Mincle. MCL(4S) mutant failed to restore the defective TDM responses in MCL-deficient BMDCs. These results suggest that MCL positively regulates Mincle expression through protein-protein interaction via its stalk region, thereby magnifying Mincle-mediated signaling. Copyright © 2015 by The American Association of Immunologists, Inc.

  13. Inhibition of the binding of MSG-intermolt-specific complex, MIC, to the sericin-1 gene promoter and sericin-1 gene expression by POU-M1/SGF-3.

    PubMed

    Kimoto, Mai; Kitagawa, Tsuyuki; Kobayashi, Isao; Nakata, Tomohiro; Kuroiwa, Asato; Takiya, Shigeharu

    2012-11-01

    The sericin-1 gene encoding a glue protein is expressed in the middle silk gland (MSG) of the silkworm, Bombyx mori. A member of the class III POU domain transcription factors, POU-M1, was cloned as the factor bound to the SC site of the sericin-1 promoter and has been proposed to be a positive transcription factor. In this study, we analyzed the expression pattern of the POU-M1 gene in fourth and fifth instars in comparison with the pattern of the sericin-1 gene. The POU-M1 gene was expressed strongly in the region anterior to the sericin-1-expressing portion of the silk gland at both feeding stages. As the sericin-1-expressing region expands from the posterior to middle portions of the MSG in the fifth instar, the POU-M1-expressing region retreated from the middle to anterior portion. Introduction of the expression vector of POU-M1 into the silk glands by gene gun technology repressed promoter activity of the sericin-1 gene, suggesting that POU-M1 regulates the sericin-1 gene negatively. An in vitro binding assay showed that POU-M1 bound not only to the SC site but also to other promoter elements newly detected in vivo. Another spatiotemporal specific factor MIC binds to these elements, and POU-M1 competed with MIC to bind at the -70 site essential for promoter activity. These results suggest that POU-M1 is involved in restricting the anterior boundary of the sericin-1-expressing region in the silk gland by inhibiting the binding of the transcriptional activator to the promoter elements.

  14. Expression pattern of X-linked genes in sex chromosome aneuploid bovine cells.

    PubMed

    Basrur, Parvathi K; Farazmand, Ali; Stranzinger, Gerald; Graphodatskaya, Daria; Reyes, Ed R; King, W Allan

    2004-01-01

    Expression of the X-inactive specific transcript (XIST) gene is a prerequisite step for dosage compensation in mammals, accomplished by silencing one of the two X chromosomes in normal female diploid cells or all X chromosomes in excess of one in sex chromosome aneuploids. Our previous studies showing that XIST expression does not eventuate the inactivation of X-linked genes in fetal bovine testis had suggested that XIST expression may not be an indicator of X inactivation in this species. In this study, we used a semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) approach on cultures of bovine cells with varying sex chromosome constitution (XY, XX, XXY and XXX) to test whether the levels of XIST expressed conform to the number of late replicating (inactive) X chromosomes displayed by proliferating cells in these cultures. Expression patterns of four X-linked genes, including hypoxanthine phosphorybosyl transferase (HPRT), glucose-6-phosphate dehydrogenase (G6PD), zinc finger protein locus on the X (ZFX). and 'selected mouse cDNA on the X' (SMCX), in all these cells were also tested. Results showed that XIST expression was significantly higher (p < 0.05) in XXX cells compared to XX and XXY cells and that G6PD. HPRT, and SMCX loci are subject to X inactivation. The significantly higher levels of ZFX expressed in XXX cells compared to XX and XXY cells (p < 0.05) confirmed that this bovine locus, as human ZFX, escapes X inactivation. However, the levels of XIST and ZFX expressed were not proportional to the X chromosome load in these cells suggesting that X-linked loci escaping inactivation may be regulated at transcription (or post-transcription) level by mechanisms that prevent gene-specific product accumulation beyond certain levels in sex chromosome aneuploids.

  15. Disruption of zebrafish cyclin G-associated kinase (GAK) function impairs the expression of Notch-dependent genes during neurogenesis and causes defects in neuronal development

    PubMed Central

    2010-01-01

    Background The J-domain-containing protein auxilin, a critical regulator in clathrin-mediated transport, has been implicated in Drosophila Notch signaling. To ask if this role of auxilin is conserved and whether auxilin has additional roles in development, we have investigated the functions of auxilin orthologs in zebrafish. Results Like mammals, zebrafish has two distinct auxilin-like molecules, auxilin and cyclin G-associated kinase (GAK), differing in their domain structures and expression patterns. Both zebrafish auxilin and GAK can functionally substitute for the Drosophila auxilin, suggesting that they have overlapping molecular functions. Still, they are not completely redundant, as morpholino-mediated knockdown of the ubiquitously expressed GAK alone can increase the specification of neuronal cells, a known Notch-dependent process, and decrease the expression of Her4, a Notch target gene. Furthermore, inhibition of GAK function caused an elevated level of apoptosis in neural tissues, resulting in severe degeneration of neural structures. Conclusion In support of the notion that endocytosis plays important roles in Notch signaling, inhibition of zebrafish GAK function affects embryonic neuronal cell specification and Her4 expression. In addition, our analysis suggests that zebrafish GAK has at least two functions during the development of neural tissues: an early Notch-dependent role in neuronal patterning and a late role in maintaining the survival of neural cells. PMID:20082716

  16. Different CHD chromatin remodelers are required for expression of distinct gene sets and specific stages during development of Dictyostelium discoideum

    PubMed Central

    Platt, James L.; Rogers, Benjamin J.; Rogers, Kelley C.; Harwood, Adrian J.; Kimmel, Alan R.

    2013-01-01

    Control of chromatin structure is crucial for multicellular development and regulation of cell differentiation. The CHD (chromodomain-helicase-DNA binding) protein family is one of the major ATP-dependent, chromatin remodeling factors that regulate nucleosome positioning and access of transcription factors and RNA polymerase to the eukaryotic genome. There are three mammalian CHD subfamilies and their impaired functions are associated with several human diseases. Here, we identify three CHD orthologs (ChdA, ChdB and ChdC) in Dictyostelium discoideum. These CHDs are expressed throughout development, but with unique patterns. Null mutants lacking each CHD have distinct phenotypes that reflect their expression patterns and suggest functional specificity. Accordingly, using genome-wide (RNA-seq) transcriptome profiling for each null strain, we show that the different CHDs regulate distinct gene sets during both growth and development. ChdC is an apparent ortholog of the mammalian Class III CHD group that is associated with the human CHARGE syndrome, and GO analyses of aberrant gene expression in chdC nulls suggest defects in both cell-autonomous and non-autonomous signaling, which have been confirmed through analyses of chdC nulls developed in pure populations or with low levels of wild-type cells. This study provides novel insight into the broad function of CHDs in the regulation development and disease, through chromatin-mediated changes in directed gene expression. PMID:24301467

  17. R-spondin1 and FOXL2 act into two distinct cellular types during goat ovarian differentiation.

    PubMed

    Kocer, Ayhan; Pinheiro, Iris; Pannetier, Maëlle; Renault, Lauriane; Parma, Pietro; Radi, Orietta; Kim, Kyung-Ah; Camerino, Giovanna; Pailhoux, Eric

    2008-04-02

    Up to now, two loci have been involved in XX sex-reversal in mammals following loss-of-function mutations, PIS (Polled Intersex Syndrome) in goats and R-spondin1 (RSPO1) in humans. Here, we analyze the possible interaction between these two factors during goat gonad development. Furthermore, since functional redundancy between different R-spondins may influence gonad development, we also studied the expression patterns of RSPO2, 3 and 4. Similarly to the mouse, RSPO1 shows a sex-dimorphic expression pattern during goat gonad development with higher levels in the ovaries. Interestingly, the PIS mutation does not seem to influence its level of expression. Moreover, using an RSPO1 specific antibody, the RSPO1 protein was localized in the cortical area of early differentiating ovaries (36 and 40 dpc). This cortical area contains the majority of germ cell that are surrounded by FOXL2 negative somatic cells. At latter stages (50 and 60 dpc) RSPO1 protein remains specifically localized on the germ cell membranes. Interestingly, a time-specific relocation of RSPO1 on the germ cell membrane was noticed, moving from a uniform distribution at 40 dpc to a punctuated staining before and during meiosis (50 and 60 dpc respectively). Interestingly, also RSPO2 and RSPO4 show a sex-dimorphic expression pattern with higher levels in the ovaries. Although RSPO4 was found to be faintly and belatedly expressed, the expression of RSPO2 increases at the crucial 36 dpc stage, as does that of FOXL2. Importantly, RSPO2 expression appears dramatically decreased in XX PIS-/- gonads at all three tested stages (36, 40 and 50 dpc). During goat ovarian development, the pattern of expression of RSPO1 is in agreement with its possible anti-testis function but is not influenced by the PIS mutation. Moreover, our data suggest that RSPO1 may be associated with germ cell development and meiosis. Interestingly, another RSPO gene, RSPO2 shows a sex-dimorphic pattern of expression that is dramatically influenced by the PIS mutation.

  18. R-spondin1 and FOXL2 act into two distinct cellular types during goat ovarian differentiation

    PubMed Central

    Kocer, Ayhan; Pinheiro, Iris; Pannetier, Maëlle; Renault, Lauriane; Parma, Pietro; Radi, Orietta; Kim, Kyung-Ah; Camerino, Giovanna; Pailhoux, Eric

    2008-01-01

    Background Up to now, two loci have been involved in XX sex-reversal in mammals following loss-of-function mutations, PIS (Polled Intersex Syndrome) in goats and R-spondin1 (RSPO1) in humans. Here, we analyze the possible interaction between these two factors during goat gonad development. Furthermore, since functional redundancy between different R-spondins may influence gonad development, we also studied the expression patterns of RSPO2, 3 and 4. Results Similarly to the mouse, RSPO1 shows a sex-dimorphic expression pattern during goat gonad development with higher levels in the ovaries. Interestingly, the PIS mutation does not seem to influence its level of expression. Moreover, using an RSPO1 specific antibody, the RSPO1 protein was localized in the cortical area of early differentiating ovaries (36 and 40 dpc). This cortical area contains the majority of germ cell that are surrounded by FOXL2 negative somatic cells. At latter stages (50 and 60 dpc) RSPO1 protein remains specifically localized on the germ cell membranes. Interestingly, a time-specific relocation of RSPO1 on the germ cell membrane was noticed, moving from a uniform distribution at 40 dpc to a punctuated staining before and during meiosis (50 and 60 dpc respectively). Interestingly, also RSPO2 and RSPO4 show a sex-dimorphic expression pattern with higher levels in the ovaries. Although RSPO4 was found to be faintly and belatedly expressed, the expression of RSPO2 increases at the crucial 36 dpc stage, as does that of FOXL2. Importantly, RSPO2 expression appears dramatically decreased in XX PIS-/- gonads at all three tested stages (36, 40 and 50 dpc). Conclusion During goat ovarian development, the pattern of expression of RSPO1 is in agreement with its possible anti-testis function but is not influenced by the PIS mutation. Moreover, our data suggest that RSPO1 may be associated with germ cell development and meiosis. Interestingly, another RSPO gene, RSPO2 shows a sex-dimorphic pattern of expression that is dramatically influenced by the PIS mutation. PMID:18384673

  19. Cap’n’collar differentiates the mandible from the maxilla in the beetle Tribolium castaneum

    PubMed Central

    2012-01-01

    Background The biting mandible of the arthropods is thought to have evolved in the ancestor of the insects, crustaceans and myriapods: the Mandibulata. A unique origin suggests a common set of developmental genes will be required to pattern the mandible in different arthropods. To date we have functional studies on patterning of the mandibular segment of Drosophila melanogaster showing in particular the effects of the gene cap’n’collar (cnc), however, the dipteran head is far from representative of insects or of more distantly related mandibulates; Drosophila does not even possess a mandibular appendage. To study the development of a more representative insect mandible, we chose the red flour beetle Tribolium castaneum and investigated the function of the Tribolium orthologs of cap’n’collar (Tc-cnc) and the Hox gene Deformed (Tc-Dfd). In order to determine the function of Tc-cnc and Tc-Dfd, transcripts were knocked down by maternal RNA interference (RNAi). The effects of gene knockdown were examined in the developing embryos and larvae. The effect of Tc-cnc and Tc-Dfd knockdown on the expression of other genes was determined by using in situ hybridization on Tribolium embryos. Results Our analyses show that Tc-cnc is required for specification of the identity of the mandibular segment of Tribolium and differentiates the mandible from maxillary identity. Loss of Tc-cnc function results in a transformation of the mandible to maxillary identity as well as deletion of the labrum. Tc-Dfd and the Tribolium homolog of proboscipedia (Tc-mxp = maxillopedia), Hox genes that are required to pattern the maxillary appendage, are expressed in a maxilla-like manner in the transformed mandible. Tribolium homologs of paired (Tc-prd) and Distal-less (Tc-Dll) that are expressed in the endites and telopodites of embryonic appendages are also expressed in a maxilla-like manner in the transformed mandible. We also show that Tc-Dfd is required to activate the collar of Tc-cnc expression in the mandibular segment but not the cap expression in the labrum. Tc-Dfd is also required for the activation of Tc-prd in the endites of the mandible and maxillary appendages. Conclusions Tc-cnc is necessary for patterning the mandibular segment of Tribolium. Together, Tc-cnc and Tc-Dfd cooperate to specify mandibular identity, as in Drosophila. Expression patterns of the homologs of cnc and Dfd are conserved in mandibulate arthropods suggesting that the mandible specifying function of cnc is likely to be conserved across the mandibulate arthropods. PMID:23114106

  20. Altered expression of extracellular matrix molecules and their receptors in chronic pancreatitis and pancreatic adenocarcinoma in comparison with normal pancreas.

    PubMed

    Shimoyama, S; Gansauge, F; Gansauge, S; Oohara, T; Beger, H G

    1995-12-01

    The aim of this study was to elucidate the expression and distribution patterns of both integrins and extracellular matrix (ECM) molecules in chronic pancreatitis (CP) and pancreatic adenocarcinoma (PC) compared with normal pancreas (NP). Expression of nine alpha-subunits (alpha 2-alpha 6, alpha V, alpha L, alpha M, and alpha X), four beta-subunits (beta 1, beta 3-beta 5), and four ECM molecules (type IV collagen, laminin, fibronectin, and vitronectin) was investigated immunohistochemically. In CP, all integrins except alpha V showed nearly the same staining patterns compared with NP. Some acinar cells in CP expressed alpha V. Whereas alpha 2, alpha 3, and alpha 6 expression was stronger and diffuse, no alpha 5 expression was seen in PC. Basement membrane (BM) showed continuous staining in CP, whereas it showed discontinuous/absent staining in PC with antitype IV collagen, laminin, and vitronectin antibodies. Some carcinoma cells showed reverse correlation between alpha 2, alpha 3, and alpha 6 expression and type IV collagen and laminin expression. Fibronectin showed diffuse stromal expression in CP and PC. Some acinar cells or duct cells in CP carcinoma cells in PC showed intracellular VN expression. These results suggest that these integrins and ECM molecules are involved in inflammatory and malignant processes in pancreas.

  1. Faster embryonic segmentation through elevated Delta-Notch signalling

    PubMed Central

    Liao, Bo-Kai; Jörg, David J.; Oates, Andrew C.

    2016-01-01

    An important step in understanding biological rhythms is the control of period. A multicellular, rhythmic patterning system termed the segmentation clock is thought to govern the sequential production of the vertebrate embryo's body segments, the somites. Several genetic loss-of-function conditions, including the Delta-Notch intercellular signalling mutants, result in slower segmentation. Here, we generate DeltaD transgenic zebrafish lines with a range of copy numbers and correspondingly increased signalling levels, and observe faster segmentation. The highest-expressing line shows an altered oscillating gene expression wave pattern and shortened segmentation period, producing embryos with more, shorter body segments. Our results reveal surprising differences in how Notch signalling strength is quantitatively interpreted in different organ systems, and suggest a role for intercellular communication in regulating the output period of the segmentation clock by altering its spatial pattern. PMID:27302627

  2. Irxl1 mutant mice show reduced tendon differentiation and no patterning defects in musculoskeletal system development.

    PubMed

    Kimura, Wataru; Machii, Masashi; Xue, XiaoDong; Sultana, Nishat; Hikosaka, Keisuke; Sharkar, Mohammad T K; Uezato, Tadayoshi; Matsuda, Masashi; Koseki, Haruhiko; Miura, Naoyuki

    2011-01-01

    Irxl1 (Iroquois-related homeobox like-1) is a newly identified three amino-acid loop extension (TALE) homeobox gene, which is expressed in various mesoderm-derived tissues, particularly in the progenitors of the musculoskeletal system. To analyze the roles of Irxl1 during embryonic development, we generated mice carrying a null allele of Irxl1. Mice homozygous for the targeted allele were viable, fertile, and showed reduced tendon differentiation. Skeletal morphology and skeletal muscle weight in Irxl1-knockout mice appeared normal. Expression patterns of several marker genes for cartilage, tendon, and muscle progenitors in homozygous mutant embryos were unchanged. These results suggest that Irxl1 is required for the tendon differentiation but dispensable for the patterning of the musculoskeletal system in development. Copyright © 2010 Wiley-Liss, Inc.

  3. Dynamic patterning by the Drosophila pair-rule network reconciles long-germ and short-germ segmentation

    PubMed Central

    2017-01-01

    Drosophila segmentation is a well-established paradigm for developmental pattern formation. However, the later stages of segment patterning, regulated by the “pair-rule” genes, are still not well understood at the system level. Building on established genetic interactions, I construct a logical model of the Drosophila pair-rule system that takes into account the demonstrated stage-specific architecture of the pair-rule gene network. Simulation of this model can accurately recapitulate the observed spatiotemporal expression of the pair-rule genes, but only when the system is provided with dynamic “gap” inputs. This result suggests that dynamic shifts of pair-rule stripes are essential for segment patterning in the trunk and provides a functional role for observed posterior-to-anterior gap domain shifts that occur during cellularisation. The model also suggests revised patterning mechanisms for the parasegment boundaries and explains the aetiology of the even-skipped null mutant phenotype. Strikingly, a slightly modified version of the model is able to pattern segments in either simultaneous or sequential modes, depending only on initial conditions. This suggests that fundamentally similar mechanisms may underlie segmentation in short-germ and long-germ arthropods. PMID:28953896

  4. NRIP/DCAF6 stabilizes the androgen receptor protein by displacing DDB2 from the CUL4A-DDB1 E3 ligase complex in prostate cancer.

    PubMed

    Chen, Hsin-Hsiung; Fan, Ping; Chang, Szu-Wei; Tsao, Yeou-Ping; Huang, Hsiang-Po; Chen, Show-Li

    2017-03-28

    Both nuclear receptor interaction protein (NRIP) and DNA damage binding protein 2 (DDB2) belong to the Cullin 4 (CUL4)-DDB1 binding protein family and are androgen receptor (AR)-interacting proteins. Here, we investigated the expression patterns of the NRIP, DDB2 and AR proteins in human prostate cancer tissues and found that the expression levels of NRIP and AR were higher, but the DDB2 level was lower, in prostate cancer tissues than in non-neoplastic controls, suggesting NRIP as a candidate tumor promoter and DDB2 as a tumor suppressor in prostate cancer. Furthermore, both NRIP and DDB2 shared the same AR binding domain; they were competitors for the AR, but not for DDB1 binding, in the AR-DDB2-DDB1-CUL4A complex. Conclusively, NRIP stabilizes the AR protein by displacing DDB2 from the AR-DDB2 complex. Consistent with our hypothesis, a specific expression pattern with high levels of NRIP and AR, together with a low level of DDB2, was found more frequently in the human prostate cancer tissues with a cribriform pattern than in non-cribriform tumors, suggesting that disruption of the balance between NRIP and DDB2 may change AR protein homeostasis and contribute to pathogenesis in certain aggressive types of prostate cancer.

  5. NRIP/DCAF6 stabilizes the androgen receptor protein by displacing DDB2 from the CUL4A-DDB1 E3 ligase complex in prostate cancer

    PubMed Central

    Tsao, Yeou-Ping; Huang, Hsiang-Po; Chen, Show-Li

    2017-01-01

    Both nuclear receptor interaction protein (NRIP) and DNA damage binding protein 2 (DDB2) belong to the Cullin 4 (CUL4)-DDB1 binding protein family and are androgen receptor (AR)-interacting proteins. Here, we investigated the expression patterns of the NRIP, DDB2 and AR proteins in human prostate cancer tissues and found that the expression levels of NRIP and AR were higher, but the DDB2 level was lower, in prostate cancer tissues than in non-neoplastic controls, suggesting NRIP as a candidate tumor promoter and DDB2 as a tumor suppressor in prostate cancer. Furthermore, both NRIP and DDB2 shared the same AR binding domain; they were competitors for the AR, but not for DDB1 binding, in the AR-DDB2-DDB1-CUL4A complex. Conclusively, NRIP stabilizes the AR protein by displacing DDB2 from the AR-DDB2 complex. Consistent with our hypothesis, a specific expression pattern with high levels of NRIP and AR, together with a low level of DDB2, was found more frequently in the human prostate cancer tissues with a cribriform pattern than in non-cribriform tumors, suggesting that disruption of the balance between NRIP and DDB2 may change AR protein homeostasis and contribute to pathogenesis in certain aggressive types of prostate cancer. PMID:28212551

  6. Genome-wide identification, expression analysis of auxin-responsive GH3 family genes in maize (Zea mays L.) under abiotic stresses.

    PubMed

    Feng, Shangguo; Yue, Runqing; Tao, Sun; Yang, Yanjun; Zhang, Lei; Xu, Mingfeng; Wang, Huizhong; Shen, Chenjia

    2015-09-01

    Auxin is involved in different aspects of plant growth and development by regulating the expression of auxin-responsive family genes. As one of the three major auxin-responsive families, GH3 (Gretchen Hagen3) genes participate in auxin homeostasis by catalyzing auxin conjugation and bounding free indole-3-acetic acid (IAA) to amino acids. However, how GH3 genes function in responses to abiotic stresses and various hormones in maize is largely unknown. Here, the latest updated maize (Zea mays L.) reference genome sequence was used to characterize and analyze the ZmGH3 family genes from maize. The results showed that 13 ZmGH3 genes were mapped on five maize chromosomes (total 10 chromosomes). Highly diversified gene structures and tissue-specific expression patterns suggested the possibility of function diversification for these genes in response to environmental stresses and hormone stimuli. The expression patterns of ZmGH3 genes are responsive to several abiotic stresses (salt, drought and cadmium) and major stress-related hormones (abscisic acid, salicylic acid and jasmonic acid). Various environmental factors suppress auxin free IAA contents in maize roots suggesting that these abiotic stresses and hormones might alter GH3-mediated auxin levels. The responsiveness of ZmGH3 genes to a wide range of abiotic stresses and stress-related hormones suggested that ZmGH3s are involved in maize tolerance to environmental stresses. © 2014 Institute of Botany, Chinese Academy of Sciences.

  7. Clonal Evolution of Glioblastoma under Therapy

    PubMed Central

    Wang, Jiguang; Cazzato, Emanuela; Ladewig, Erik; Frattini, Veronique; Rosenbloom, Daniel I. S.; Zairis, Sakellarios; Abate, Francesco; Liu, Zhaoqi; Elliott, Oliver; Shin, Yong-Jae; Lee, Jin-Ku; Lee, In-Hee; Park, Woong-Yang; Eoli, Marica; Blumberg, Andrew J.; Lasorella, Anna; Nam, Do-Hyun; Finocchiaro, Gaetano; Iavarone, Antonio; Rabadan, Raul

    2017-01-01

    Glioblastoma (GBM) constitutes the most common and aggressive primary brain tumor. To better understand how GBM evolves we analyzed longitudinal genomic and transcriptomic data of 114 patients. The analysis reveals a highly branched evolutionary pattern in which 63% of patients experience expression-based subtype changes. The branching pattern together with estimates of evolutionary rates suggest that the relapse associated clone typically preexisted years before diagnosis. 15% of tumors present hypermutations at relapse in highly expressed genes with a clear mutational signature. We find that 11% of recurrent tumors harbor mutations in LTBP4, a protein binding to TGF-β. Silencing LTBP4 in GBM cells leads to TGF-β activity suppression and decreased proliferation. In IDH1-wild-type recurrent GBM, high LTBP4 expression is associated with worse prognosis, highlighting the TGF-β pathway as a potential therapeutic target in GBM. PMID:27270107

  8. Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species.

    PubMed

    Nepal, Madhav P; Andersen, Ethan J; Neupane, Surendra; Benson, Benjamin V

    2017-09-30

    Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis , we investigated nTNL orthologs in the genomes of common bean, Medicago , soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis , common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence.

  9. Comparative Genomics of Non-TNL Disease Resistance Genes from Six Plant Species

    PubMed Central

    Andersen, Ethan J.; Neupane, Surendra; Benson, Benjamin V.

    2017-01-01

    Disease resistance genes (R genes), as part of the plant defense system, have coevolved with corresponding pathogen molecules. The main objectives of this project were to identify non-Toll interleukin receptor, nucleotide-binding site, leucine-rich repeat (nTNL) genes and elucidate their evolutionary divergence across six plant genomes. Using reference sequences from Arabidopsis, we investigated nTNL orthologs in the genomes of common bean, Medicago, soybean, poplar, and rice. We used Hidden Markov Models for sequence identification, performed model-based phylogenetic analyses, visualized chromosomal positioning, inferred gene clustering, and assessed gene expression profiles. We analyzed 908 nTNL R genes in the genomes of the six plant species, and classified them into 12 subgroups based on the presence of coiled-coil (CC), nucleotide binding site (NBS), leucine rich repeat (LRR), resistance to Powdery mildew 8 (RPW8), and BED type zinc finger domains. Traditionally classified CC-NBS-LRR (CNL) genes were nested into four clades (CNL A-D) often with abundant, well-supported homogeneous subclades of Type-II R genes. CNL-D members were absent in rice, indicating a unique R gene retention pattern in the rice genome. Genomes from Arabidopsis, common bean, poplar and soybean had one chromosome without any CNL R genes. Medicago and Arabidopsis had the highest and lowest number of gene clusters, respectively. Gene expression analyses suggested unique patterns of expression for each of the CNL clades. Differential gene expression patterns of the nTNL genes were often found to correlate with number of introns and GC content, suggesting structural and functional divergence. PMID:28973974

  10. The spatial and temporal expression of Ch-en, the engrailed gene in the polychaete Chaetopterus, does not support a role in body axis segmentation

    NASA Technical Reports Server (NTRS)

    Seaver, E. C.; Paulson, D. A.; Irvine, S. Q.; Martindale, M. Q.

    2001-01-01

    We are interested in understanding whether the annelids and arthropods shared a common segmented ancestor and have approached this question by characterizing the expression pattern of the segment polarity gene engrailed (en) in a basal annelid, the polychaete Chaetopterus. We have isolated an en gene, Ch-en, from a Chaetopterus cDNA library. Genomic Southern blotting suggests that this is the only en class gene in this animal. The predicted protein sequence of the 1.2-kb cDNA clone contains all five domains characteristic of en proteins in other taxa, including the en class homeobox. Whole-mount in situ hybridization reveals that Ch-en is expressed throughout larval life in a complex spatial and temporal pattern. The Ch-en transcript is initially detected in a small number of neurons associated with the apical organ and in the posterior portion of the prototrochophore. At later stages, Ch-en is expressed in distinct patterns in the three segmented body regions (A, B, and C) of Chaetopterus. In all segments, Ch-en is expressed in a small set of segmentally iterated cells in the CNS. In the A region, Ch-en is also expressed in a small group of mesodermal cells at the base of the chaetal sacs. In the B region, Ch-en is initially expressed broadly in the mesoderm that then resolves into one band/segment coincident with morphological segmentation. The mesodermal expression in the B region is located in the anterior region of each segment, as defined by the position of ganglia in the ventral nerve cord, and is involved in the morphogenesis of segment-specific feeding structures late in larval life. We observe banded mesodermal and ectodermal staining in an anterior-posterior sequence in the C region. We do not observe a segment polarity pattern of expression of Ch-en in the ectoderm, as is observed in arthropods. Copyright 2001 Academic Press.

  11. Amphioxus and lamprey AP-2 genes: implications for neural crest evolution and migration patterns

    NASA Technical Reports Server (NTRS)

    Meulemans, Daniel; Bronner-Fraser, Marianne

    2002-01-01

    The neural crest is a uniquely vertebrate cell type present in the most basal vertebrates, but not in cephalochordates. We have studied differences in regulation of the neural crest marker AP-2 across two evolutionary transitions: invertebrate to vertebrate, and agnathan to gnathostome. Isolation and comparison of amphioxus, lamprey and axolotl AP-2 reveals its extensive expansion in the vertebrate dorsal neural tube and pharyngeal arches, implying co-option of AP-2 genes by neural crest cells early in vertebrate evolution. Expression in non-neural ectoderm is a conserved feature in amphioxus and vertebrates, suggesting an ancient role for AP-2 genes in this tissue. There is also common expression in subsets of ventrolateral neurons in the anterior neural tube, consistent with a primitive role in brain development. Comparison of AP-2 expression in axolotl and lamprey suggests an elaboration of cranial neural crest patterning in gnathostomes. However, migration of AP-2-expressing neural crest cells medial to the pharyngeal arch mesoderm appears to be a primitive feature retained in all vertebrates. Because AP-2 has essential roles in cranial neural crest differentiation and proliferation, the co-option of AP-2 by neural crest cells in the vertebrate lineage was a potentially crucial event in vertebrate evolution.

  12. Patterns of Expression in the Matrix Proteins Responsible for Nucleation and Growth of Aragonite Crystals in Flat Pearls of Pinctada fucata

    PubMed Central

    Xiang, Liang; Su, Jingtan; Zheng, Guilan; Liang, Jian; Zhang, Guiyou; Wang, Hongzhong; Xie, Liping; Zhang, Rongqing

    2013-01-01

    The initial growth of the nacreous layer is crucial for comprehending the formation of nacreous aragonite. A flat pearl method in the presence of the inner-shell film was conducted to evaluate the role of matrix proteins in the initial stages of nacre biomineralization in vivo. We examined the crystals deposited on a substrate and the expression patterns of the matrix proteins in the mantle facing the substrate. In this study, the aragonite crystals nucleated on the surface at 5 days in the inner-shell film system. In the film-free system, the calcite crystals nucleated at 5 days, a new organic film covered the calcite, and the aragonite nucleated at 10 days. This meant that the nacre lamellae appeared in the inner-shell film system 5 days earlier than that in the film-free system, timing that was consistent with the maximum level of matrix proteins during the first 20 days. In addition, matrix proteins (Nacrein, MSI60, N19, N16 and Pif80) had similar expression patterns in controlling the sequential morphologies of the nacre growth in the inner-film system, while these proteins in the film-free system also had similar patterns of expression. These results suggest that matrix proteins regulate aragonite nucleation and growth with the inner-shell film in vivo. PMID:23776687

  13. Candidate chemosensory ionotropic receptors in a Lepidoptera.

    PubMed

    Olivier, V; Monsempes, C; François, M-C; Poivet, E; Jacquin-Joly, E

    2011-04-01

    A new family of candidate chemosensory ionotropic receptors (IRs) related to ionotropic glutamate receptors (iGluRs) was recently discovered in Drosophila melanogaster. Through Blast analyses of an expressed sequenced tag library prepared from male antennae of the noctuid moth Spodoptera littoralis, we identified 12 unigenes encoding proteins related to D. melanogaster and Bombyx mori IRs. Their full length sequences were obtained and the analyses of their expression patterns suggest that they were exclusively expressed or clearly enriched in chemosensory organs. The deduced protein sequences were more similar to B. mori and D. melanogaster IRs than to iGluRs and showed considerable variations in the predicted ligand-binding domains; none have the three glutamate-interacting residues found in iGluRs, suggesting different binding specificities. Our data suggest that we identified members of the insect IR chemosensory receptor family in S. littoralis and we report here the first demonstration of IR expression in Lepidoptera. © 2010 The Authors. Insect Molecular Biology © 2010 The Royal Entomological Society.

  14. Bringing an Ecological Perspective to the Study of Aging and Recognition of Emotional Facial Expressions: Past, Current, and Future Methods

    PubMed Central

    Isaacowitz, Derek M.; Stanley, Jennifer Tehan

    2011-01-01

    Older adults perform worse on traditional tests of emotion recognition accuracy than do young adults. In this paper, we review descriptive research to date on age differences in emotion recognition from facial expressions, as well as the primary theoretical frameworks that have been offered to explain these patterns. We propose that this is an area of inquiry that would benefit from an ecological approach in which contextual elements are more explicitly considered and reflected in experimental methods. Use of dynamic displays and examination of specific cues to accuracy, for example, may reveal more nuanced age-related patterns and may suggest heretofore unexplored underlying mechanisms. PMID:22125354

  15. Gene expression profiling in Ishikawa cells: A fingerprint for estrogen active compounds

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boehme, Kathleen; Simon, Stephanie; Mueller, Stefan O.

    2009-04-01

    Several anthropogenous and naturally occurring substances, referred to as estrogen active compounds (EACs), are able to interfere with hormone and in particular estrogen receptor signaling. EACs can either cause adverse health effects in humans and wildlife populations or have beneficial effects on estrogen-dependent diseases. The aim of this study was to examine global gene expression profiles in estrogen receptor (ER)-proficient Ishikawa plus and ER-deficient Ishikawa minus endometrial cancer cells treated with selected well-known EACs (Diethylstilbestrol, Genistein, Zearalenone, Resveratrol, Bisphenol A and o,p'-DDT). We also investigated the effect of the pure antiestrogen ICI 182,780 (ICI) on the expression patterns caused bymore » these compounds. Transcript levels were quantified 24 h after compound treatment using Illumina BeadChip Arrays. We identified 87 genes with similar expression changes in response to all EAC treatments in Ishikawa plus. ICI lowered the magnitude or reversed the expression of these genes, indicating ER dependent regulation. Apart from estrogenic gene regulation, Bisphenol A, o,p'-DDT, Zearalenone, Genistein and Resveratrol displayed similarities to ICI in their expression patterns, suggesting mixed estrogenic/antiestrogenic properties. In particular, the predominant antiestrogenic expression response of Resveratrol could be clearly distinguished from the other test compounds, indicating a distinct mechanism of action. Divergent gene expression patterns of the phytoestrogens, as well as weaker estrogenic gene expression regulation determined for the anthropogenous chemicals Bisphenol A and o,p'-DDT, warrants a careful assessment of potential detrimental and/or beneficial effects of EACs. The characteristic expression fingerprints and the identified subset of putative marker genes can be used for screening chemicals with an unknown mode of action and for predicting their potential to exert endocrine disrupting effects.« less

  16. A comparative study of cell cycle mediator protein expression patterns in anaplastic and papillary thyroid carcinoma.

    PubMed

    Evans, Juanita J; Crist, Henry S; Durvesh, Saima; Bruggeman, Richard D; Goldenberg, David

    2012-07-01

    Anaplastic thyroid carcinoma (ATC) is an extremely aggressive and rapidly fatal neoplasm. The aim of this study was to identify a limited cell cycle associated protein expression pattern unique to ATC and to correlate that pattern with clinical outcome. This represents one of the largest tissue micro-array projects comparing the cell cycle protein expression data of ATC to other well-differentiated tumors in the literature. Tissue microarrays were created from 21 patients with ATC and an age and gender matched cohort of patients with papillary thyroid carcinoma (PTC). Expression of epidermal growth factor receptor, cyclin D1, cyclin E, p53, p21, p16, aurora kinase A, opioid growth factor (OGF), OGF-receptor, thyroglobulin and Ki-67 was evaluated in a semi-quantitative fashion. Differences in protein expression between the cohorts were evaluated using chi-square tests with Bonferroni adjustments. Survival time and presence of metastasis at presentation were collected. The ATC cohort showed a statistically significant decrease (p < 0.05) in thyroglobulin expression and statistically significant increases (p < 0.05) in Ki-67 and p53 expression as compared with the PTC cohort. A trend toward loss of p16 and p21 expression was noted in the ATC cohort. A trend toward decreased survival was noted with p21 expression. These data indicate disruption of the normal cell cycle with aberrant expression of multiple protein markers suggesting increased proliferative activity and loss of control of cell cycle progression to G₁ phase. These findings support the assertion that ATC may represent the furthest end of a continuum of thyroid carcinoma dedifferentiation.

  17. Temporal Differences in MicroRNA Expression Patterns in Astrocytes and Neurons after Ischemic Injury

    PubMed Central

    Ziu, Mateo; Fletcher, Lauren; Rana, Shushan; Jimenez, David F.; Digicaylioglu, Murat

    2011-01-01

    MicroRNAs (miRNAs) are small, non-protein-coding RNA molecules that modulate gene translation. Their expression is altered in many central nervous system (CNS) injuries suggesting a role in the cellular response to stress. Current studies in brain tissue have not yet described the cell-specific temporal miRNA expression patterns following ischemic injury. In this study, we analyzed the expression alterations of a set of miRNAs in neurons and astrocytes subjected to 60 minutes of ischemia and collected at different time-points following this injury. To mimic ischemic conditions and reperfusion in vitro, cortical primary neuronal and astrocytic cultures prepared from fetal rats were first placed in oxygen and glucose deprived (OGD) medium for 60 minutes, followed by their transfer into normoxic pre-conditioned medium. Total RNA was extracted at different time-points after the termination of the ischemic insult and the expression levels of miRNAs were measured. In neurons exposed to OGD, expression of miR-29b was upregulated 2-fold within 6 h and up to 4-fold at 24 h post-OGD, whereas induction of miR-21 was upregulated 2-fold after 24 h when compared to expression in neurons under normoxic conditions. In contrast, in astrocytes, miR-29b and miR-21 were upregulated only after 12 h. MiR-30b, 107, and 137 showed expression alteration in astrocytes, but not in neurons. Furthermore, we show that expression of miR-29b was significantly decreased in neurons exposed to Insulin-Like Growth Factor I (IGF-I), a well documented neuroprotectant in ischemic models. Our study indicates that miRNAs expression is altered in neurons and astrocytes after ischemic injury. Furthermore, we found that following OGD, specific miRNAs have unique cell-specific temporal expression patterns in CNS. Therefore the specific role of each miRNA in different intracellular processes in ischemic brain and the relevance of their temporal and spatial expression patterns warrant further investigation that may lead to novel strategies for therapeutic interventions. PMID:21373187

  18. Genome-wide analysis and expression profile of the bZIP transcription factor gene family in grapevine (Vitis vinifera)

    PubMed Central

    2014-01-01

    Background Basic leucine zipper (bZIP) transcription factor gene family is one of the largest and most diverse families in plants. Current studies have shown that the bZIP proteins regulate numerous growth and developmental processes and biotic and abiotic stress responses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant bZIP family members remains very limited. Results We identified 55 bZIP transcription factor-encoding genes in the grapevine (Vitis vinifera) genome, and divided them into 10 groups according to the phylogenetic relationship with those in Arabidopsis. The chromosome distribution and the collinearity analyses suggest that expansion of the grapevine bZIP (VvbZIP) transcription factor family was greatly contributed by the segment/chromosomal duplications, which may be associated with the grapevine genome fusion events. Nine intron/exon structural patterns within the bZIP domain and the additional conserved motifs were identified among all VvbZIP proteins, and showed a high group-specificity. The predicted specificities on DNA-binding domains indicated that some highly conserved amino acid residues exist across each major group in the tree of land plant life. The expression patterns of VvbZIP genes across the grapevine gene expression atlas, based on microarray technology, suggest that VvbZIP genes are involved in grapevine organ development, especially seed development. Expression analysis based on qRT-PCR indicated that VvbZIP genes are extensively involved in drought- and heat-responses, with possibly different mechanisms. Conclusions The genome-wide identification, chromosome organization, gene structures, evolutionary and expression analyses of grapevine bZIP genes provide an overall insight of this gene family and their potential involvement in growth, development and stress responses. This will facilitate further research on the bZIP gene family regarding their evolutionary history and biological functions. PMID:24725365

  19. Detailed analysis of the δ-crystallin mRNA-expressing region in early development of the chick pituitary gland.

    PubMed

    Inoue, Makiko; Shiina, Tomoya; Aizawa, Sayaka; Sakata, Ichiro; Takagi, Hiroyasu; Sakai, Takafumi

    2012-06-01

    Although δ-crystallin (δ-crys), also known as lens protein, is transiently expressed in Rathke's pouch (RP) of the chick embryo, detailed temporal and spatial expression patterns have been obscure. In this study, to understand the relationship between the δ-crys mRNA-expressing region and RP formation, we examined the embryonic expression pattern of δ-crys mRNA in the primordium of the adenohypophysis. δ-crys mRNA expression was initially found at stage 15 anterior to the foregut and posterior to the invaginated oral ectoderm. After RP formation, the δ-crys mRNA was expressed in the post-ventral region of RP and the anterior region of RP. δ-crys mRNA expression was then restricted to the cephalic lobe of the pituitary gland. From stage 20, the δ-crys and alpha-glycoprotein subunit (αGSU) mRNA-expressing regions were almost completely overlapping. The αGSU mRNA-expressing region is thought to be the primordium of the pars tuberalis, and these regions were overlapped with the Lhx3 mRNA-expressing region. The intensity of δ-crys mRNA expression gradually decreased with development and completely disappeared by stage 34. These results suggest that the embryonic chick pituitary gland consists of two different regions labeled with δ-crys and Lhx3.

  20. Cell-specific Expression of CYP2A5 in the Mouse Respiratory Tract: Effects of Olfactory Toxicants

    PubMed Central

    Piras, Elena; Franzén, Anna; Fernández, Estíbaliz L.; Bergström, Ulrika; Raffalli-Mathieu, Françoise; Lang, Matti; Brittebo, Eva B.

    2003-01-01

    We performed a detailed analysis of mouse cytochrome P450 2A5 (CYP2A5) expression by in situ hybridization (ISH) and immunohistochemistry (IHC) in the respiratory tissues of mice. The CYP2A5 mRNA and the corresponding protein co-localized at most sites and were predominantly detected in the olfactory region, with an expression in sustentacular cells, Bowman's gland, and duct cells. In the respiratory and transitional epithelium there was no or only weak expression. The nasolacrimal duct and the excretory ducts of nasal and salivary glands displayed expression, whereas no expression occurred in the acini. There was decreasing expression along the epithelial linings of the trachea and lower respiratory tract, whereas no expression occurred in the alveoli. The hepatic CYP2A5 inducers pyrazole and phenobarbital neither changed the CYP2A5 expression pattern nor damaged the olfactory mucosa. In contrast, the olfactory toxicants dichlobenil and methimazole induced characteristic changes. The damaged Bowman's glands displayed no expression, whereas the damaged epithelium expressed the enzyme. The CYP2A5 expression pattern is in accordance with previously reported localization of protein and DNA adducts and the toxicity of some CYP2A5 substrates. This suggests that CYP2A5 is an important determinant for the susceptibility of the nasal and respiratory epithelia to protoxicants and procarcinogens. PMID:14566026

  1. (Not) Talking About Sex: Couple Reports of Sexual Discussion and Expression in Bangalore, India

    PubMed Central

    McDougall, Janna; Edmeades, Jeffrey; Krishnan, Suneeta

    2010-01-01

    Adolescent marriage is common in India, placing young women at risk of HIV, early pregnancy, and poor birth outcomes. Young women’s capacity to express their sexual desires is central to negotiating safe and mutually consensual sexuality. Men too play an important role in shaping women’s sexual and reproductive health outcomes, but little research has examined how men influence women’s sexual expression. Using paired husband and wife data, this paper reports on a preliminary investigation into the patterns of and concurrence between women’s sexual expression and their husbands’ attitudes about it, as well as the influence of men’s approval of their wives’ sexual expression on women’s actual expression of sexual desire. The results suggest that among this sample, men are more open to sexual expression than their wives and that for women, expressing desire not to have sex is far more common than expressing desire to have sex. Further, men’s approval of sexual expression from wives appears to positively influence women’s actual expression. These findings suggest that men may be resources for women to draw upon as they negotiate sexuality in adolescence and early adulthood. PMID:20967650

  2. Neurotensin gene expression increases during proestrus in the rostral medial preoptic nucleus: potential for direct communication with gonadotropin-releasing hormone neurons.

    PubMed

    Smith, M J; Wise, P M

    2001-07-01

    Neurotensin (NT)-containing neurons in the rostral portion of the medial preoptic nucleus (rMPN) of the brain may play a key role in regulating the pattern of secretion of GnRH, thereby influencing the reproductive cycle in females. The major goals of this study were to determine whether NT messenger RNA (mRNA) levels in the rMPN exhibit a unique pattern of expression in temporal association with the preovulatory LH surge and to assess whether NT neurons may communicate directly with GnRH neurons. We analyzed NT gene expression in rats using in situ hybridization over the day of proestrus and compared this with diestrous day 1. We also determined whether the high-affinity NT receptor (NT1) is expressed in GnRH neurons using dual-label in situ hybridization and whether this expression varies over the estrous cycle. We found that NT mRNA levels in the rMPN increase significantly on the day of proestrus, rising before the LH surge. No such change was detected on diestrous day 1, when the LH surge does not occur. Furthermore, we observed that a significant number of GnRH neurons coexpress NT1 mRNA and that the number of GnRH neurons expressing NT1 mRNA peaks on proestrus. Together with previous findings, our results suggest that increased expression of NT in the rMPN may directly stimulate GnRH neurons on proestrus, contributing to the LH surge. In addition, our results suggest that responsiveness of GnRH neurons to NT stimulation is enhanced on proestrus due to increased expression of NT receptors within GnRH neurons.

  3. Mapping heterogeneity in patient-derived melanoma cultures by single-cell RNA-seq

    PubMed Central

    Loeffler-Wirth, Henry; Hopp, Lydia; Schadendorf, Dirk; Schartl, Manfred; Anderegg, Ulf; Camp, Gray; Treutlein, Barbara; Binder, Hans; Kunz, Manfred

    2017-01-01

    Recent technological advances in single-cell genomics make it possible to analyze cellular heterogeneity of tumor samples. Here, we applied single-cell RNA-seq to measure the transcriptomes of 307 single cells cultured from three biopsies of three different patients with a BRAF/NRAS wild type, BRAF mutant/NRAS wild type and BRAF wild type/NRAS mutant melanoma metastasis, respectively. Analysis based on self-organizing maps identified sub-populations defined by multiple gene expression modules involved in proliferation, oxidative phosphorylation, pigmentation and cellular stroma. Gene expression modules had prognostic relevance when compared with gene expression data from published melanoma samples and patient survival data. We surveyed kinome expression patterns across sub-populations of the BRAF/NRAS wild type sample and found that CDK4 and CDK2 were consistently highly expressed in the majority of cells, suggesting that these kinases might be involved in melanoma progression. Treatment of cells with the CDK4 inhibitor palbociclib restricted cell proliferation to a similar, and in some cases greater, extent than MAPK inhibitors. Finally, we identified a low abundant sub-population in this sample that highly expressed a module containing ABC transporter ABCB5, surface markers CD271 and CD133, and multiple aldehyde dehydrogenases (ALDHs). Patient-derived cultures of the BRAF mutant/NRAS wild type and BRAF wild type/NRAS mutant metastases showed more homogeneous single-cell gene expression patterns with gene expression modules for proliferation and ABC transporters. Taken together, our results describe an intertumor and intratumor heterogeneity in melanoma short-term cultures which might be relevant for patient survival, and suggest promising targets for new treatment approaches in melanoma therapy. PMID:27903987

  4. Differential GFP expression patterns induced by different heavy metals in Tg(hsp70:gfp) transgenic medaka (Oryzias latipes).

    PubMed

    Ng, Grace Hwee Boon; Xu, Hongyan; Pi, Na; Kelly, Barry C; Gong, Zhiyuan

    2015-06-01

    Heat shock protein 70 (Hsp70) is one of the most widely used biomarker for monitoring environment perturbations in biological systems. To facilitate the analysis of hsp70 expression as a biomarker, we generated a Tg(hsp70:gfp) transgenic medaka line in which green fluorescence protein (GFP) reporter gene was driven by the medaka hsp70 promoter. Here, we characterized Tg(hsp70:gfp) medaka for inducible GFP expression by seven environment-relevant heavy metals, including mercury, arsenic, lead, cadmium, copper, chromium, and zinc. We found that four of them (mercury, arsenic, lead, and cadmium) induced GFP expression in multiple and different organs. In general, the liver, kidney, gut, and skin are among the most frequent organs to show induced GFP expression. In contrast, no detectable GFP induction was observed to copper, chromium, or zinc, indicating that the transgenic line was not responsive to all heavy metals. RT-qPCR determination of hsp70 mRNA showed similar induction and non-induction by these metals, which also correlated with the levels of metal uptake in medaka exposed to these metals. Our observations suggested that these heavy metals have different mechanisms of toxicity and/or differential bioaccumulation in various organs; different patterns of GFP expression induced by different metals may be used to determine or exclude metals in water samples tested. Furthermore, we also tested several non-metal toxicants such as bisphenol A, 2,3,7,8-tetrachlorodibenzo-p-dioxin, 4-introphenol, and lindane; none of them induced significant GFP expression in Tg(hsp70:gfp) medaka, further suggesting that the inducibility of Tg(hsp70:gfp) for GFP expression is specific to a subset of heavy metals.

  5. Architectural patterns of p16 immunohistochemical expression associated with cancer immunity and prognosis of head and neck squamous cell carcinoma.

    PubMed

    Ryu, Hyang Joo; Kim, Eun Kyung; Heo, Su Jin; Cho, Byoung Chul; Kim, Hye Ryun; Yoon, Sun Och

    2017-11-01

    We evaluated the expression patterns of p16, which is used as a surrogate marker of HPV infection in head and neck squamous cell carcinoma (HNSCC), in regard to their biological and prognostic implications. p16 expression patterns and infiltrated immune cells were analyzed through immunohistochemistry of p16, CD3, CD8, PD-1, FOXP3, and CD163 on surgically resected HNSCCs (n = 393). Patterns of p16 immunoexpression were defined as STRONG (strong, diffuse expression in cytoplasm, and nucleus in >70% of tumor cells), MARGINAL (expression restricted to tumor margins), MOSAIC (ragged, discontinued expression), NUCLEAR (expression in nuclei only), and ABSENT (no expression). The STRONG pattern was more frequent in the oropharynx, and the MARGINAL pattern was noted only in the oral cavity. MOSAIC and NUCLEAR patterns were noted at variable sites. No two patterns of p16 expression showed the same immune cell composition of CD3+ T cells, CD8+ cytotoxic T cells, PD-1+ T cells, FOXP3+ regulatory T cells, and CD163+ macrophages. In overall and disease-free survival analyses, the STRONG pattern showed the most favorable prognosis, while the NUCLEAR pattern had the worst prognosis. HNSCC anatomical sites, tumor-related immune cell components, and patient outcomes were associated with p16 expression patterns. Each architectural pattern of p16 expression may be related to different biological and prognostic phenotypes. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  6. Exposure of honey bees (Apis mellifera) to different classes of insecticides exhibit distinct molecular effect patterns at concentrations that mimic environmental contamination.

    PubMed

    Christen, Verena; Fent, Karl

    2017-07-01

    Pesticides are implicated in the decline of honey bee populations. Many insecticides are neurotoxic and act by different modes of actions. Although a link between insecticide exposure and changed behaviour has been made, molecular effects underlying these effects are poorly understood. Here we elucidated molecular effects at environmental realistic concentrations of two organophosphates, chlorpyrifos and malathion, the pyrethroid cypermethrin, and the ryanodine receptor activator, chlorantraniliprole. We assessed transcriptional alterations of selected genes at three exposure times (24 h, 48 h, 72 h) in caged honey bees exposed to different concentrations of these compounds. Our targeted gene expression concept focused on several transcripts, including nicotinic acetylcholine receptor α 1 and α 2 (nAChRα1, nAChRα2) subunits, the multifunctional gene vitellogenin, immune system related genes of three immune system pathways, genes belonging to the detoxification system and ER stress genes. Our data indicate a dynamic pattern of expressional changes at different exposure times. All four insecticides induced strong alterations in the expression of immune system related genes suggesting negative implications for honey bee health, as well as cytochrome P450 enzyme transcripts suggesting an interference with metabolism. Exposure to neurotoxic chlorpyrifos, malathion and cypermethrin resulted in up-regulation of nAChRα1 and nAChRα2. Moreover, alterations in the expression of vitellogenin occurred, which suggests implications on foraging activity. Chlorantraniliprole induced ER stress which may be related to toxicity. The comparison of all transcriptional changes indicated that the expression pattern is rather compound-specific and related to its mode of action, but clusters of common transcriptional changes between different compounds occurred. As transcriptional alterations occurred at environmental concentrations our data provide a molecular basis for observed adverse effects of these insecticides to bees. Copyright © 2017 Elsevier Ltd. All rights reserved.

  7. Layer-specific gene expression in epileptogenic type II focal cortical dysplasia: normal-looking neurons reveal the presence of a hidden laminar organization

    PubMed Central

    2014-01-01

    Background Type II focal cortical dysplasias (FCDs) are malformations of cortical development characterised by the disorganisation of the normal neocortical structure and the presence of dysmorphic neurons (DNs) and balloon cells (BCs). The pathogenesis of FCDs has not yet been clearly established, although a number of histopathological patterns and molecular findings suggest that they may be due to abnormal neuronal and glial proliferation and migration processes. In order to gain further insights into cortical layering disruption and investigate the origin of DNs and BCs, we used in situ RNA hybridisation of human surgical specimens with a neuropathologically definite diagnosis of Type IIa/b FCD and a panel of layer-specific genes (LSGs) whose expression covers all cortical layers. We also used anti-phospho-S6 ribosomal protein antibody to investigate mTOR pathway hyperactivation. Results LSGs were expressed in both normal and abnormal cells (BCs and DNs) but their distribution was different. Normal-looking neurons, which were visibly reduced in the core of the lesion, were apparently located in the appropriate cortical laminae thus indicating a partial laminar organisation. On the contrary, DNs and BCs, labelled with anti-phospho-S6 ribosomal protein antibody, were spread throughout the cortex without any apparent rule and showed a highly variable LSG expression pattern. Moreover, LSGs did not reveal any differences between Type IIa and IIb FCD. Conclusion These findings suggest the existence of hidden cortical lamination involving normal-looking neurons, which retain their ability to migrate correctly in the cortex, unlike DNs which, in addition to their morphological abnormalities and mTOR hyperactivation, show an altered migratory pattern. Taken together these data suggest that an external or environmental hit affecting selected precursor cells during the very early stages of cortical development may disrupt normal cortical development. PMID:24735483

  8. E- and P-cadherin expression during murine hair follicle morphogenesis and cycling.

    PubMed

    Müller-Röver, S; Tokura, Y; Welker, P; Furukawa, F; Wakita, H; Takigawa, M; Paus, R

    1999-08-01

    The role of adhesion molecules in the control of hair follicle (HF) morphogenesis, regression and cycling is still rather enigmatic. Since the adhesion molecules E- and P-cadherin (Ecad and Pcad) are functionally important, e.g. during embryonic pattern formation, we have studied their expression patterns during neonatal HF morphogenesis and cycling in C57/BL6 mice by immunohistology and semi-quantitative RT-PCR. The expression of both cadherins was strikingly hair cycle-dependent and restricted to distinct anatomical HF compartments. During HF morphogenesis, hair bud keratinocytes displayed strong Ecad and Pcad immunoreactivity (IR). While neonatal epidermis showed Ecad IR in all epidermal layers, Pcad IR was restricted to the basal layer. During later stages of HF morphogenesis and during anagen IV-VI of the adolescent murine hair cycle, the outer root sheath showed strong E- and Pcad IR. Instead, the outermost portion of the hair matrix and the inner root sheath displayed isolated Ecad IR, while the innermost portion of the hair matrix exhibited isolated Pcad IR. During telogen, all epidermal and follicular keratinocytes showed strong Ecad IR. This is in contrast to Pcad, whose IR was stringently restricted to matrix and secondary hair germ keratinocytes which are in closest proximity to the dermal papilla. These findings suggest that isolated or combined E- and/or Pcad expression is involved in follicular pattern formation by segregating HF keratinocytes into functionally distinct subpopulations; most notably, isolated Pcad expression may segregate those hair matrix keratinocytes into one functional epithelial tissue unit, which is particularly susceptible to growth control by dermal papilla-derived morphogens. The next challenge is to define which secreted agents implicated in hair growth control modulate these follicular cadherin expression patterns, and to define how these basic parameters of HF topobiology are altered during common hair growth disorders.

  9. Hybridization between Yellowstone cutthroat trout and rainbow trout alters the expression of muscle growth-related genes and their relationships with growth patterns

    USGS Publications Warehouse

    Ostberg, Carl O.; Chase, Dorothy M.; Hauser, Lorenz

    2015-01-01

    Hybridization creates novel gene combinations that may generate important evolutionary novelty, but may also reduce existing adaptation by interrupting inherent biological processes, such as genotype-environment interactions. Hybridization often causes substantial change in patterns of gene expression, which, in turn, may cause phenotypic change. Rainbow trout (Oncorhynchus mykiss) and cutthroat trout (O. clarkii) produce viable hybrids in the wild, and introgressive hybridization with introduced rainbow trout is a major conservation concern for native cutthroat trout. The two species differ in body shape, which is likely an evolutionary adaptation to their native environments, and their hybrids tend to show intermediate morphology. The characterization of gene expression patterns may provide insights on the genetic basis of hybrid and parental morphologies, as well as on the ecological performance of hybrids in the wild. Here, we evaluated the expression of eight growth-related genes (MSTN-1a, MSTN-1b, MyoD1a, MyoD1b, MRF-4, IGF-1, IGF-2, and CAST-L) and the relationship of these genes with growth traits (length, weight, and condition factor) in six line crosses: both parental species, both reciprocal F1 hybrids, and both first-generation backcrosses (F1 x rainbow trout and F1 x cutthroat trout). Four of these genes were differentially expressed among rainbow, cutthroat, and their hybrids. Transcript abundance was significantly correlated with growth traits across the parent species, but not across hybrids. Our findings suggest that rainbow and cutthroat trout exhibit differences in muscle growth regulation, that transcriptional networks may be modified by hybridization, and that hybridization disrupts intrinsic relationships between gene expression and growth patterns that may be functionally important for phenotypic adaptations.

  10. Diurnal Corticosterone Presence and Phase Modulate Clock Gene Expression in the Male Rat Prefrontal Cortex

    PubMed Central

    Chun, Lauren E.; Hinds, Laura R.; Spencer, Robert L.

    2016-01-01

    Mood disorders are associated with dysregulation of prefrontal cortex (PFC) function, circadian rhythms, and diurnal glucocorticoid (corticosterone [CORT]) circulation. Entrainment of clock gene expression in some peripheral tissues depends on CORT. In this study, we characterized over the course of the day the mRNA expression pattern of the core clock genes Per1, Per2, and Bmal1 in the male rat PFC and suprachiasmatic nucleus (SCN) under different diurnal CORT conditions. In experiment 1, rats were left adrenal-intact (sham) or were adrenalectomized (ADX) followed by 10 daily antiphasic (opposite time of day of the endogenous CORT peak) ip injections of either vehicle or 2.5 mg/kg CORT. In experiment 2, all rats received ADX surgery followed by 13 daily injections of vehicle or CORT either antiphasic or in-phase with the endogenous CORT peak. In sham rats clock gene mRNA levels displayed a diurnal pattern of expression in the PFC and the SCN, but the phase differed between the 2 structures. ADX substantially altered clock gene expression patterns in the PFC. This alteration was normalized by in-phase CORT treatment, whereas antiphasic CORT treatment appears to have eliminated a diurnal pattern (Per1 and Bmal1) or dampened/inverted its phase (Per2). There was very little effect of CORT condition on clock gene expression in the SCN. These experiments suggest that an important component of glucocorticoid circadian physiology entails CORT regulation of the molecular clock in the PFC. Consequently, they also point to a possible mechanism that contributes to PFC disrupted function in disorders associated with abnormal CORT circulation. PMID:26901093

  11. The expression of the clock gene cycle has rhythmic pattern and is affected by photoperiod in the moth Sesamia nonagrioides.

    PubMed

    Kontogiannatos, Dimitrios; Gkouvitsas, Theodoros; Kourti, Anna

    2017-06-01

    To obtain clues to the link between the molecular mechanism of circadian and photoperiod clocks, we have cloned the circadian clock gene cycle (Sncyc) in the corn stalk borer, Sesamia nonagrioides, which undergoes facultative diapause controlled by photoperiod. Sequence analysis revealed a high degree of conservation among insects for this gene. SnCYC consists of 667 amino acids and structural analysis showed that it contains a BCTR domain in its C-terminal in addition to the common domains found in Drosophila CYC, i.e. bHLH, PAS-A, PAS-B domains. The results revealed that the sequence of Sncyc showed a similarity to that of its mammalian orthologue, Bmal1. We also investigated the expression patterns of Sncyc in the brain of larvae growing under long-day 16L: 8D (LD), constant darkness (DD) and short-day 10L: 14D (SD) conditions using qRT-PCR assays. The mRNAs of Sncyc expression was rhythmic in LD, DD and SD cycles. Also, it is remarkable that the photoperiodic conditions affect the expression patterns and/or amplitudes of circadian clock gene Sncyc. This gene is associated with diapause in S. nonagrioides, because under SD (diapause conditions) the photoperiodic signal altered mRNA accumulation. Sequence and expression analysis of cyc in S. nonagrioides shows interesting differences compared to Drosophila where this gene does not oscillate or change in expression patterns in response to photoperiod, suggesting that this species is an interesting new model to study the molecular control of insect circadian and photoperiodic clocks. Copyright © 2017 Elsevier Inc. All rights reserved.

  12. Genome-Wide Identification and Expression Profiling Analysis of ZmPIN, ZmPILS, ZmLAX and ZmABCB Auxin Transporter Gene Families in Maize (Zea mays L.) under Various Abiotic Stresses

    PubMed Central

    Sun, Tao; Zhang, Lei; Yang, Yanjun; Qi, Jianshuang; Yan, Shufeng; Han, Xiaohua; Wang, Huizhong; Shen, Chenjia

    2015-01-01

    The auxin influx carriers auxin resistant 1/like aux 1 (AUX/LAX), efflux carriers pin-formed (PIN) (together with PIN-like proteins) and efflux/conditional P-glycoprotein (ABCB) are major protein families involved in auxin polar transport. However, how they function in responses to exogenous auxin and abiotic stresses in maize is largely unknown. In this work, the latest updated maize (Zea mays L.) reference genome sequence was used to characterize and analyze the ZmLAX, ZmPIN, ZmPILS and ZmABCB family genes from maize. The results showed that five ZmLAXs, fifteen ZmPINs, nine ZmPILSs and thirty-five ZmABCBs were mapped on all ten maize chromosomes. Highly diversified gene structures, nonconservative transmembrane helices and tissue-specific expression patterns suggested the possibility of function diversification for these genes. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to analyze the expression patterns of ZmLAX, ZmPIN, ZmPILS and ZmABCB genes under exogenous auxin and different environmental stresses. The expression levels of most ZmPIN, ZmPILS, ZmLAX and ZmABCB genes were induced in shoots and were reduced in roots by various abiotic stresses (drought, salt and cold stresses). The opposite expression response patterns indicated the dynamic auxin transport between shoots and roots under abiotic stresses. Analysis of the expression patterns of ZmPIN, ZmPILS, ZmLAX and ZmABCB genes under drought, salt and cold treatment may help us to understand the possible roles of maize auxin transporter genes in responses and tolerance to environmental stresses. PMID:25742625

  13. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner

    PubMed Central

    Pai, Vaibhav P.; Willocq, Valerie; Pitcairn, Emily J.; Lemire, Joan M.; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A.

    2017-01-01

    ABSTRACT Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels (Ih currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal, Lefty, and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. PMID:28818840

  14. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

    PubMed

    Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

    2017-10-15

    Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

  15. CLOCK expression identifies developing circadian oscillator neurons in the brains of Drosophila embryos.

    PubMed

    Houl, Jerry H; Ng, Fanny; Taylor, Pete; Hardin, Paul E

    2008-12-18

    The Drosophila circadian oscillator is composed of transcriptional feedback loops in which CLOCK-CYCLE (CLK-CYC) heterodimers activate their feedback regulators period (per) and timeless (tim) via E-box mediated transcription. These feedback loop oscillators are present in distinct clusters of dorsal and lateral neurons in the adult brain, but how this pattern of expression is established during development is not known. Since CLK is required to initiate feedback loop function, defining the pattern of CLK expression in embryos and larvae will shed light on oscillator neuron development. A novel CLK antiserum is used to show that CLK expression in the larval CNS and adult brain is limited to circadian oscillator cells. CLK is initially expressed in presumptive small ventral lateral neurons (s-LNvs), dorsal neurons 2 s (DN2s), and dorsal neuron 1 s (DN1s) at embryonic stage (ES) 16, and this CLK expression pattern persists through larval development. PER then accumulates in all CLK-expressing cells except presumptive DN2s during late ES 16 and ES 17, consistent with the delayed accumulation of PER in adult oscillator neurons and antiphase cycling of PER in larval DN2s. PER is also expressed in non-CLK-expressing cells in the embryonic CNS starting at ES 12. Although PER expression in CLK-negative cells continues in ClkJrk embryos, PER expression in cells that co-express PER and CLK is eliminated. These data demonstrate that brain oscillator neurons begin development during embryogenesis, that PER expression in non-oscillator cells is CLK-independent, and that oscillator phase is an intrinsic characteristic of brain oscillator neurons. These results define the temporal and spatial coordinates of factors that initiate Clk expression, imply that circadian photoreceptors are not activated until the end of embryogenesis, and suggest that PER functions in a different capacity before oscillator cell development is initiated.

  16. LateBiclustering: Efficient Heuristic Algorithm for Time-Lagged Bicluster Identification.

    PubMed

    Gonçalves, Joana P; Madeira, Sara C

    2014-01-01

    Identifying patterns in temporal data is key to uncover meaningful relationships in diverse domains, from stock trading to social interactions. Also of great interest are clinical and biological applications, namely monitoring patient response to treatment or characterizing activity at the molecular level. In biology, researchers seek to gain insight into gene functions and dynamics of biological processes, as well as potential perturbations of these leading to disease, through the study of patterns emerging from gene expression time series. Clustering can group genes exhibiting similar expression profiles, but focuses on global patterns denoting rather broad, unspecific responses. Biclustering reveals local patterns, which more naturally capture the intricate collaboration between biological players, particularly under a temporal setting. Despite the general biclustering formulation being NP-hard, considering specific properties of time series has led to efficient solutions for the discovery of temporally aligned patterns. Notably, the identification of biclusters with time-lagged patterns, suggestive of transcriptional cascades, remains a challenge due to the combinatorial explosion of delayed occurrences. Herein, we propose LateBiclustering, a sensible heuristic algorithm enabling a polynomial rather than exponential time solution for the problem. We show that it identifies meaningful time-lagged biclusters relevant to the response of Saccharomyces cerevisiae to heat stress.

  17. Differential expression of syndecan isoforms during mouse incisor amelogenesis.

    PubMed

    Muto, Taro; Miyoshi, Keiko; Munesue, Seiichi; Nakada, Hiroshi; Okayama, Minoru; Matsuo, Takashi; Noma, Takafumi

    2007-08-01

    Syndecans are transmembranous heparan sulfate proteoglycans (HSPGs) with covalently attached glycosaminoglycan side-chains located on the cell surface. The mammalian syndecan family is composed of four types of syndecans (syndecan-1 to -4). Syndecans interact with the intracellular cytoskeleton through the cytoplasmic domains of their core proteins and membrane proteins, extracellular enzymes, growth factors, and matrix components, through their heparan-sulfate chains, to regulate developmental processes.Here, as a first step to assess the possible roles of syndecan proteins in amelogenesis, we examined the expression patterns of all syndecan isoforms in continuously growing mouse incisors, in which we can overview major differentiation stages of amelogenesis at a glance. Understanding the expression domain of each syndecan isoform during specific developmental stages seems useful for investigating their physiological roles in amelogenesis. Immunohistochemical analysis of syndecan core proteins in the lower incisors from postnatal day 1 mice revealed spatially and temporally specific expression patterns, with syndecan-1 expressed in undifferentiated epithelial and mesenchymal cells, and syndecan-2, -3, and -4 in more differentiated cells. These findings suggest that each syndecan isoform functions distinctly during the amelogenesis of the incisors of mice.

  18. BFDCA: A Comprehensive Tool of Using Bayes Factor for Differential Co-Expression Analysis.

    PubMed

    Wang, Duolin; Wang, Juexin; Jiang, Yuexu; Liang, Yanchun; Xu, Dong

    2017-02-03

    Comparing the gene-expression profiles between biological conditions is useful for understanding gene regulation underlying complex phenotypes. Along this line, analysis of differential co-expression (DC) has gained attention in the recent years, where genes under one condition have different co-expression patterns compared with another. We developed an R package Bayes Factor approach for Differential Co-expression Analysis (BFDCA) for DC analysis. BFDCA is unique in integrating various aspects of DC patterns (including Shift, Cross, and Re-wiring) into one uniform Bayes factor. We tested BFDCA using simulation data and experimental data. Simulation results indicate that BFDCA outperforms existing methods in accuracy and robustness of detecting DC pairs and DC modules. Results of using experimental data suggest that BFDCA can cluster disease-related genes into functional DC subunits and estimate the regulatory impact of disease-related genes well. BFDCA also achieves high accuracy in predicting case-control phenotypes by using significant DC gene pairs as markers. BFDCA is publicly available at http://dx.doi.org/10.17632/jdz4vtvnm3.1. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Transcriptional Innate Immune Response of the Developing Chicken Embryo to Newcastle Disease Virus Infection

    PubMed Central

    Schilling, Megan A.; Katani, Robab; Memari, Sahar; Cavanaugh, Meredith; Buza, Joram; Radzio-Basu, Jessica; Mpenda, Fulgence N.; Deist, Melissa S.; Lamont, Susan J.; Kapur, Vivek

    2018-01-01

    Traditional approaches to assess the immune response of chickens to infection are through animal trials, which are expensive, require enhanced biosecurity, compromise welfare, and are frequently influenced by confounding variables. Since the chicken embryo becomes immunocompetent prior to hatch, we here characterized the transcriptional response of selected innate immune genes to Newcastle disease virus (NDV) infection in chicken embryos at days 10, 14, and 18 of embryonic development. The results suggest that the innate immune response 72 h after challenge of 18-day chicken embryo is both consistent and robust. The expression of CCL5, Mx1, and TLR3 in lung tissues of NDV challenged chicken embryos from the outbred Kuroiler and Tanzanian local ecotype lines showed that their expression was several orders of magnitude higher in the Kuroiler than in the local ecotypes. Next, the expression patterns of three additional innate-immunity related genes, IL-8, IRF-1, and STAT1, were examined in the highly congenic Fayoumi (M5.1 and M15.2) and Leghorn (Ghs6 and Ghs13) sublines that differ only at the microchromosome bearing the major histocompatibility locus. The results show that the Ghs13 Leghorn subline had a consistently higher expression of all genes except IL-8 and expression seemed to be subline-dependent rather than breed-dependent, suggesting that the innate immune response of chicken embryos to NDV infection may be genetically controlled by the MHC-locus. Taken together, the results suggest that the chicken embryo may represent a promising model to studying the patterns and sources of variation of the avian innate immune response to infection with NDV and related pathogens. PMID:29535762

  20. Gingival transcriptome patterns during induction and resolution of experimental gingivitis in humans.

    PubMed

    Offenbacher, Steven; Barros, Silvana P; Paquette, David W; Winston, J Leslie; Biesbrock, Aaron R; Thomason, Ryan G; Gibb, Roger D; Fulmer, Andy W; Tiesman, Jay P; Juhlin, Kenton D; Wang, Shuo L; Reichling, Tim D; Chen, Ker-Sang; Ho, Begonia

    2009-12-01

    To our knowledge, changes in the patterns of whole-transcriptome gene expression that occur during the induction and resolution of experimental gingivitis in humans were not previously explored using bioinformatic tools. Gingival biopsy samples collected from 14 subjects during a 28-day stent-induced experimental gingivitis model, followed by treatment, and resolution at days 28 through 35 were analyzed using gene-expression arrays. Biopsy samples were collected at different sites within each subject at baseline (day 0), at the peak of gingivitis (day 28), and at resolution (day 35) and processed using whole-transcriptome gene-expression arrays. Gene-expression data were analyzed to identify biologic themes and pathways associated with changes in gene-expression profiles that occur during the induction and resolution of experimental gingivitis using bioinformatic tools. During disease induction and resolution, the dominant expression pathway was the immune response, with 131 immune response genes significantly up- or downregulated during induction, during resolution, or during both at P <0.05. During induction, there was significant transient increase in the expression of inflammatory and oxidative stress mediators, including interleukin (IL)-1 alpha (IL1A), IL-1 beta (IL1B), IL8, RANTES, colony stimulating factor 3 (CSF3), and superoxide dismutase 2 (SOD2), and a decreased expression of IP10, interferon inducible T-cell alpha chemoattractant (ITAC), matrix metalloproteinase 10 (MMP10), and beta 4 defensin (DEFB4). These genes reversed expression patterns upon resolution in parallel with the reversal of gingival inflammation. A relatively small subset (11.9%) of the immune response genes analyzed by array was transiently activated in response to biofilm overgrowth, suggesting a degree of specificity in the transcriptome-expression response. The fact that this same subset demonstrates a reversal in expression patterns during clinical resolution implicates these genes as being critical for maintaining tissue homeostasis at the biofilm-gingival interface. In addition to the immune response pathway as the dominant response theme, new candidate genes and pathways were identified as being selectively modulated in experimental gingivitis, including neural processes, epithelial defenses, angiogenesis, and wound healing.

  1. HEY1 is expressed independent of NOTCH1 and is associated with poor prognosis in head and neck squamous cell carcinoma.

    PubMed

    Rettig, Eleni M; Bishop, Justin A; Agrawal, Nishant; Chung, Christine H; Sharma, Rajni; Zamuner, Fernando; Li, Ryan J; Koch, Wayne M; Califano, Joseph A; Guo, Theresa; Gaykalova, Daria A; Fakhry, Carole

    2018-07-01

    Notch signaling is frequently altered in head and neck squamous cell carcinoma (HNSCC). However, the nature and clinical implications of this dysregulation are not well understood. We previously described an association of transcriptionally active NOTCH1 Intracellular Domain (NICD1) immunohistochemical (IHC) expression pattern with high-risk pathologic characteristics. Here we further characterize Notch signaling in HNSCC. IHC expression patterns and clinicopathologic associations of Notch pathway molecules were evaluated among 78 tumors with known NOTCH1 mutation status. IHC was performed for JAG1, a NOTCH1 activating ligand, and HEY1, an NICD1 transcriptional target and Notch pathway activation marker. IHC pattern and H-score (% staining × intensity) were recorded and compared to clinicopathologic characteristics and survival. Survival was analyzed using Kaplan Meier method and Cox proportional hazards models (HR). JAG1 and NICD1 expression patterns were highly concordant among tumors without truncating NOTCH1 mutations (p < 0.001), but were dissimilar among tumors with truncating NOTCH1 mutations (p = 0.24). There was evidence for JAG1-independent NOTCH1 activation among seven tumors, all with wild-type NOTCH1. HEY1 expression was associated with neither JAG1 nor NICD1 expression, but was associated with NOTCH1 mutation status (p = 0.03). Twelve (16%) tumors expressed HEY1 but not NICD1. Higher HEY1 H-score was significantly associated with worse overall (adjusted hazard ratio [aHR] 2.0, 95% CI = 1.0-4.2) and disease-specific (aHR = 3.3, 95% CI = 1.4-7.9) survival, whereas JAG1 and NICD1 expression were not associated with survival. These findings suggest both NOTCH1-dependent and -independent HEY1 regulation, and imply a previously unrecognized prognostic role for HEY1 in HNSCC. Copyright © 2018 Elsevier Ltd. All rights reserved.

  2. Nodal patterning without Lefty inhibitory feedback is functional but fragile

    PubMed Central

    Gagnon, James A; Pauli, Andrea; Zimmerman, Steven; Aksel, Deniz C; Reyon, Deepak; Tsai, Shengdar Q; Joung, J Keith

    2017-01-01

    Developmental signaling pathways often activate their own inhibitors. Such inhibitory feedback has been suggested to restrict the spatial and temporal extent of signaling or mitigate signaling fluctuations, but these models are difficult to rigorously test. Here, we determine whether the ability of the mesendoderm inducer Nodal to activate its inhibitor Lefty is required for development. We find that zebrafish lefty mutants exhibit excess Nodal signaling and increased specification of mesendoderm, resulting in embryonic lethality. Strikingly, development can be fully restored without feedback: Lethal patterning defects in lefty mutants can be rescued by ectopic expression of lefty far from its normal expression domain or by spatially and temporally uniform exposure to a Nodal inhibitor drug. While drug-treated mutants are less tolerant of mild perturbations to Nodal signaling levels than wild type embryos, they can develop into healthy adults. These results indicate that patterning without inhibitory feedback is functional but fragile. PMID:29215332

  3. Spatio-Temporal Distribution of Smads and Role of Smads/TGF-β/BMP-4 in the Regulation of Mouse Bladder Organogenesis

    PubMed Central

    Islam, Syed S.; Mokhtari, Reza Bayat; Kumar, Sushil; Maalouf, Joe; Arab, Sara; Yeger, Herman; Farhat, Walid A.

    2013-01-01

    Although Shh, TGF-β and BMP-4 regulate radial patterning of the bladder mesenchyme and smooth muscle differentiation, it is not known what transcription factors, local environmental cues or signaling cascades mediate bladder smooth muscle differentiation. We investigated the expression patterns of signaling mediated by Smad2 and Smad3 in the mouse embryonic bladder from E12.5 to E16.5 by using qRT-PCR, in situ hybridization and antibodies specifically recognizing individual Smad proteins. The role of Smad2 and Smad3 during smooth muscle formation was examined by disrupting the Smad2/3 signaling pathway using TβR1 inhibitor SB-431542 in organ culture system. qRT-PCR results showed that R-Smads, Co-Smad and I-Smads were all expressed during bladder development. RNA ISH for BMP-4 and immunostaining of TGF-β1 showed that BMP-4 and TGF-β1 were expressed in the transitional epithelium, lamina propia and muscularis mucosa. Smad1, Smad5 and Smad8 were first expressed in the bladder epithelium and continued to be expressed in the transitional epithelium, muscularis mesenchyme and lamina propia as the bladder developed. Smad2, Smad3 and Smad4 were first detected in the bladder epithelium and subsequently were expressed in the muscularis mesenchyme and lamina propia. Smad6 and Smad7 showed overlapping expression with R-Smads, which are critical for bladder development. In bladder explants (E12.5 to E16.5) culture, Smad2 and Smad3 were found localized within the nuclei, suggesting critical transcriptional regulatory effects during bladder development. E12.5 to E16.5 bladders were cultured with and without TβR1 inhibitor SB-431542 and assessed by qRT-PCR and immunofluorescence. After three days in culture in SB-431542, α-SMA, Smad2 and Smad3 expressions were significantly decreased compared with controls, however, with no significant changes in the expression of smooth muscle myosin heavy chain (SM-Myh. Based on the Smad expression patterns, we suggest that individual or combinations of Smads may be necessary during mouse bladder organogenesis and may be critical mediators for bladder smooth muscle differentiation. PMID:23620745

  4. Evolution and inheritance of early embryonic patterning in Drosophila simulans and D. sechellia.

    PubMed

    Lott, Susan E; Ludwig, Michael Z; Kreitman, Martin

    2011-05-01

    Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation that selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth "stripe allometry") in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species Drosophila simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the "margin of error" for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.

  5. Identification of rice genes associated with cosmic-ray response via co-expression gene network analysis.

    PubMed

    Hwang, Sun-Goo; Kim, Dong Sub; Hwang, Jung Eun; Han, A-Reum; Jang, Cheol Seong

    2014-05-15

    In order to better understand the biological systems that are affected in response to cosmic ray (CR), we conducted weighted gene co-expression network analysis using the module detection method. By using the Pearson's correlation coefficient (PCC) value, we evaluated complex gene-gene functional interactions between 680 CR-responsive probes from integrated microarray data sets, which included large-scale transcriptional profiling of 1000 microarray samples. These probes were divided into 6 distinct modules that contained 20 enriched gene ontology (GO) functions, such as oxidoreductase activity, hydrolase activity, and response to stimulus and stress. In particular, modules 1 and 2 commonly showed enriched annotation categories such as oxidoreductase activity, including enriched cis-regulatory elements known as ROS-specific regulators. These results suggest that the ROS-mediated irradiation response pathway is affected by CR in modules 1 and 2. We found 243 ionizing radiation (IR)-responsive probes that exhibited similarities in expression patterns in various irradiation microarray data sets. The expression patterns of 6 randomly selected IR-responsive genes were evaluated by quantitative reverse transcription polymerase chain reaction following treatment with CR, gamma rays (GR), and ion beam (IB); similar patterns were observed among these genes under these 3 treatments. Moreover, we constructed subnetworks of IR-responsive genes and evaluated the expression levels of their neighboring genes following GR treatment; similar patterns were observed among them. These results of network-based analyses might provide a clue to understanding the complex biological system related to the CR response in plants. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. Distinct endothelial phenotypes evoked by arterial waveforms derived from atherosclerosis-susceptible and -resistant regions of human vasculature

    NASA Astrophysics Data System (ADS)

    Dai, Guohao; Kaazempur-Mofrad, Mohammad R.; Natarajan, Sripriya; Zhang, Yuzhi; Vaughn, Saran; Blackman, Brett R.; Kamm, Roger D.; García-Cardeña, Guillermo; Gimbrone, Michael A., Jr.

    2004-10-01

    Atherosclerotic lesion localization to regions of disturbed flow within certain arterial geometries, in humans and experimental animals, suggests an important role for local hemodynamic forces in atherogenesis. To explore how endothelial cells (EC) acquire functional/dysfunctional phenotypes in response to vascular region-specific flow patterns, we have used an in vitro dynamic flow system to accurately reproduce arterial shear stress waveforms on cultured human EC and have examined the effects on EC gene expression by using a high-throughput transcriptional profiling approach. The flow patterns in the carotid artery bifurcations of several normal human subjects were characterized by using 3D flow analysis based on actual vascular geometries and blood flow profiles. Two prototypic arterial waveforms, "athero-prone" and "athero-protective," were defined as representative of the wall shear stresses in two distinct regions of the carotid artery (carotid sinus and distal internal carotid artery) that are typically "susceptible" or "resistant," respectively, to atherosclerotic lesion development. These two waveforms were applied to cultured EC, and cDNA microarrays were used to analyze the differential patterns of EC gene expression. In addition, the differential effects of athero-prone vs. athero-protective waveforms were further characterized on several parameters of EC structure and function, including actin cytoskeletal organization, expression and localization of junctional proteins, activation of the NF-B transcriptional pathway, and expression of proinflammatory cytokines and adhesion molecules. These global gene expression patterns and functional data reveal a distinct phenotypic modulation in response to the wall shear stresses present in atherosclerosis-susceptible vs. atherosclerosis-resistant human arterial geometries.

  7. SCARLESS SKIN WOUND HEALING IN FOXN1 DEFICIENT (NUDE) MICE IS ASSOCIATED WITH DISTINCTIVE MATRIX METALLOPROTEINASE EXPRESSION

    PubMed Central

    Gawronska-Kozak, Barbara

    2011-01-01

    Similar to mammalian fetuses FOXN1 deficient (nude) mice are able to restore the structure and integrity of injured skin in a scarless healing process by mechanisms independent of the genetic background. Matrix metalloproteinases (MMPs) are required for regular skin wound healing and the distinctive pattern of their expression has been implicated to promote scarless healing. In this study, we analyzed the temporal and spatial expression patterns of these molecules during the incisional skin wounds in adult nude mice. Macroscopic and histological analyses of skin wounds revealed an accelerated wound healing process, minimal granulation tissue formation and markedly diminished scarring in nude mice. Quantitative RT-PCR (Mmp-2,-3,-8,-9,-10,-12,-13,-14 and Timp-1, -2, -3), Western blots (MMP-13) and gelatin zymography (MMP-9) revealed that MMP-9 and MMP-13 showed a unique, bimodal pattern of up-regulation during the early and late phases of wound healing in nude mice. Immunohistochemically MMP-9 and MMP-13 were generally detected in epidermis during the early phase and in dermis during the late (remodeling) phase. Consistent with these in vivo observations, dermal fibroblasts cultured from nude mice expressed higher levels of type I and III collagen, MMP-9 and MMP-13 mRNA levels and higher MMP enzyme activity than wild type controls. Collectively, these finding suggest that the bimodal pattern of MMP-9 and MMP-13 expression during skin repair process in nude mice could be a major component of their ability for scarless healing. PMID:21539913

  8. Serum microRNA expression patterns that predict early treatment failure in prostate cancer patients.

    PubMed

    Singh, Prashant K; Preus, Leah; Hu, Qiang; Yan, Li; Long, Mark D; Morrison, Carl D; Nesline, Mary; Johnson, Candace S; Koochekpour, Shahriar; Kohli, Manish; Liu, Song; Trump, Donald L; Sucheston-Campbell, Lara E; Campbell, Moray J

    2014-02-15

    We aimed to identify microRNA (miRNA) expression patterns in the serum of prostate cancer (CaP) patients that predict the risk of early treatment failure following radical prostatectomy (RP). Microarray and Q-RT-PCR analyses identified 43 miRNAs as differentiating disease stages within 14 prostate cell lines and reflectedpublically available patient data. 34 of these miRNA were detectable in the serum of CaP patients. Association with time to biochemical progression was examined in a cohort of CaP patients following RP. A greater than two-fold increase in hazard of biochemical progression associated with altered expression of miR-103, miR-125b and miR-222 (p<.0008) in the serum of CaP patients. Prediction models based on penalized regression analyses showed that the levels of the miRNAs and PSA together were better at detecting false positives than models without miRNAs, for similar level of sensitivity. Analyses of publically available data revealed significant and reciprocal relationships between changes in CpG methylation and miRNA expression patterns suggesting a role for CpG methylation to regulate miRNA. Exploratory validation supported roles for miR-222 and miR-125b to predict progression risk in CaP. The current study established that expression patterns of serum-detectable miRNAs taken at the time of RP are prognostic for men who are at risk of experiencing subsequent early biochemical progression. These non-invasive approaches could be used to augment treatment decisions.

  9. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine

    PubMed Central

    Bradford, Emily M; Vairamani, Kanimozhi; Shull, Gary E

    2016-01-01

    AIM: To investigate the intestinal functions of the NKCC1 Na+-K+-2Cl cotransporter (SLC12a2 gene), differential mRNA expression changes in NKCC1-null intestine were analyzed. METHODS: Microarray analysis of mRNA from intestines of adult wild-type mice and gene-targeted NKCC1-null mice (n = 6 of each genotype) was performed to identify patterns of differential gene expression changes. Differential expression patterns were further examined by Gene Ontology analysis using the online Gorilla program, and expression changes of selected genes were verified using northern blot analysis and quantitative real time-polymerase chain reaction. Histological staining and immunofluorescence were performed to identify cell types in which upregulated pancreatic digestive enzymes were expressed. RESULTS: Genes typically associated with pancreatic function were upregulated. These included lipase, amylase, elastase, and serine proteases indicative of pancreatic exocrine function, as well as insulin and regenerating islet genes, representative of endocrine function. Northern blot analysis and immunohistochemistry showed that differential expression of exocrine pancreas mRNAs was specific to the duodenum and localized to a subset of goblet cells. In addition, a major pattern of changes involving differential expression of olfactory receptors that function in chemical sensing, as well as other chemosensing G-protein coupled receptors, was observed. These changes in chemosensory receptor expression may be related to the failure of intestinal function and dependency on parenteral nutrition observed in humans with SLC12a2 mutations. CONCLUSION: The results suggest that loss of NKCC1 affects not only secretion, but also goblet cell function and chemosensing of intestinal contents via G-protein coupled chemosensory receptors. PMID:26909237

  10. Disorganized Steroidogenesis in Adrenocortical Carcinoma, a Case Study.

    PubMed

    Uchida, Toyoyoshi; Nishimoto, Koshiro; Fukumura, Yuki; Asahina, Miki; Goto, Hiromasa; Kawano, Yui; Shimizu, Fumitaka; Tsujimura, Akira; Seki, Tsugio; Mukai, Kuniaki; Kabe, Yasuaki; Suematsu, Makoto; Gomez-Sanchez, Celso E; Yao, Takashi; Horie, Shigeo; Watada, Hirotaka

    2017-03-01

    Most adrenocortical carcinomas (ACCs) produce excessive amounts of steroid hormones including aldosterone, cortisol, and steroid precursors. However, aldosterone- and cortisol-producing cells in ACCs have not yet been immunohistochemically described. We present a case of ACC causing mild primary aldosteronism and subclinical Cushing's syndrome. Removal of the tumor cured both conditions. In order to examine the expression patterns of the steroidogenic enzymes responsible for adrenocortical hormone production, 10 tumor portions were immunohistochemically analyzed for aldosterone synthase (CYP11B2), 11β-hydroxylase (CYP11B1, cortisol-synthesizing enzyme), 3β-hydroxysteroid dehydrogenase (3βHSD, upstream enzyme for both CYP11B2 and CYP11B1), and 17α-hydroxylase/C17-20 lyase (CYP17, upstream enzyme for CYP11B1, but not for CYP11B1). CYP11B2, CYP11B1, and 3βHSD were expressed sporadically, and their expression patterns varied significantly among the different tumor portions examined. The expression of these enzymes was random and not associated with each other. CYP17 was expressed throughout the tumor, even in CYP11B2-positive cells. Small tumor cell populations were aldosterone- or cortisol-producing cells, as judged by 3βHSD coinciding with either CYP11B2 or CYP11B1, respectively. These results suggest that the tumor produced limited amounts of aldosterone and cortisol due to the lack of the coordinated expression of steroidogenic enzymes, which led to mild clinical expression in this case. We delineated the expression patterns of steroidogenic enzymes in ACC. The coordinated expression of steroidogenic enzymes in normal and adenoma cells was disturbed in ACC cells, resulting in the inefficient production of steroid hormones in relation to the large tumor volume.

  11. Placental expression of EG-VEGF and its receptors PKR1 (prokineticin receptor-1) and PKR2 throughout mouse gestation.

    PubMed

    Hoffmann, P; Feige, J-J; Alfaidy, N

    2007-10-01

    Compelling evidence indicates that vascular endothelial growth factor (VEGF) is an important mediator of placental angiogenesis and appears to be disregulated in pre-eclampsia (PE). Recently, we characterised the expression of EG-VEGF (endocrine gland-derived vascular endothelial growth factor), also known as prokineticin 1 (PK1) in human placenta during the first trimester of pregnancy and showed that this factor is likely to play an important role in human placentation. However, because it is impossible to prospectively study placentation in humans, it has been impossible to further characterise EG-VEGF expression throughout complete gestation and especially at critical gestational ages for PE development. In the present study, we used mouse placenta to further characterise EG-VEGF expression throughout gestation. We investigated the pattern of expression of EG-VEGF and its receptors, PKR1 and PKR2 at the mRNA and protein levels. Our results show that EG-VEGF and VEGF exhibit different patterns of expression and different localisations in the mouse placenta. EG-VEGF was mainly localised in the labyrinth whereas VEGF was mainly present in glycogen and giant cells. EG-VEGF mRNA and protein levels were highest before 10.5days post coitus (dpc) whereas those of VEGF showed stable expression throughout gestation. PKR1 protein was localised to the labyrinth layer and showed the same pattern of expression as EG-VEGF whereas PKR2 expression was maintained over 10.5dpc with both trophoblastic and endothelial cell localisations. Altogether these findings suggest that EG-VEGF may have a direct effect on both endothelial and trophoblastic cells and is likely to play an important role in mouse placentation.

  12. Social Isolation Modulates CLOCK Protein and Beta-Catenin Expression Pattern in Gonadotropin-Inhibitory Hormone Neurons in Male Rats.

    PubMed

    Teo, Chuin Hau; Soga, Tomoko; Parhar, Ishwar S

    2017-01-01

    Postweaning social isolation reduces the amplitude of the daily variation of CLOCK protein in the brain and induces lower reproductive activity. Gonadotropin-inhibitory hormone (GnIH) acts as an inhibitor in the reproductive system and has been linked to stress. Social isolation has been shown to lower neuronal activity of GnIH-expressing neurons in the dorsomedial hypothalamus (DMH). The exact mechanism by which social isolation may affect GnIH is still unclear. We investigated the impact of social isolation on regulatory cellular mechanisms in GnIH neurons. We examined via immunohistochemistry the expression of CLOCK protein at four different times throughout the day in GnIH cells tagged with enhanced fluorescent green protein (EGFP-GnIH) in 9-week-old adult male rats that have been raised for 6 weeks under postweaning social isolation and compared them with group-raised control rats of the same age. We also studied the expression of β-catenin-which has been shown to be affected by circadian proteins such as Bmal1-in EGFP-GnIH neurons to determine whether it could play a role in linking CLOCK in GnIH neurons. We found that social isolation modifies the pattern of CLOCK expression in GnIH neurons in the DMH. Socially isolated rats displayed greater CLOCK expression in the dark phase, while control rats displayed increased CLOCK expression in the light phase. Furthermore, β-catenin expression pattern in GnIH cells was disrupted by social isolation. This suggests that social isolation triggers changes in CLOCK and GnIH expression, which may be associated with an increase in nuclear β-catenin during the dark phase.

  13. Expression of hLAMP-1-Positive Particles During Early Heart Development in the Chick.

    PubMed

    Abd-Elhamid, T H; Conway, M L; Sinning, A R

    2017-10-01

    Heart development requires coordinated activity of various factors, the disturbance of which can lead to congenital heart defects. Heart lectin-associated matrix protein-1 (hLAMP-1) is a matrix protein expressed within Hensen's node at Hamburger-Hamilton (HH) stage 4, in the lateral mesoderm by HH stages 5-6 and enhanced within the left pre-cardiac field at HH stage 7. At HH stages 15-16, hLAMP-1 expression is observed in the atrioventricular canal and the outflow tract. Also, the role of hLAMP-1 in induction of mesenchyme formation in chick heart has been well documented. To further elucidate the role of this molecule in heart development, we examined its expression patterns during HH stages 8-14 in the chick. In this regard, we immunostained sections of the heart during HH stages 8-14 with antibodies specific to hLAMP-1. Our results showed prominent expression of hLAMP-1-positive particles in the extracellular matrix associated with the pre-cardiac mesoderm, the endoderm, ectoderm as well as neuroectoderm at HH stages 8-9. After formation of the linear heart tube at HH stage 10, the expression of hLAMP-1-stained particles disappears in those regions of original contact between the endoderm and heart forming fields due to rupture of the dorsal mesocardium while their expression becomes confined to the arterial and venous poles of the heart tube. This expression pattern is maintained until HH stage 14. This expression pattern suggests that hLAMP-1 may be involved in the formation of the endocardial tube. © 2017 Blackwell Verlag GmbH.

  14. An interspecific fungal hybrid reveals cross-kingdom rules for allopolyploid gene expression patterns.

    PubMed

    Cox, Murray P; Dong, Ting; Shen, Genggeng; Dalvi, Yogesh; Scott, D Barry; Ganley, Austen R D

    2014-03-01

    Polyploidy, a state in which the chromosome complement has undergone an increase, is a major force in evolution. Understanding the consequences of polyploidy has received much attention, and allopolyploids, which result from the union of two different parental genomes, are of particular interest because they must overcome a suite of biological responses to this merger, known as "genome shock." A key question is what happens to gene expression of the two gene copies following allopolyploidization, but until recently the tools to answer this question on a genome-wide basis were lacking. Here we utilize high throughput transcriptome sequencing to produce the first genome-wide picture of gene expression response to allopolyploidy in fungi. A novel pipeline for assigning sequence reads to the gene copies was used to quantify their expression in a fungal allopolyploid. We find that the transcriptional response to allopolyploidy is predominantly conservative: both copies of most genes are retained; over half the genes inherit parental gene expression patterns; and parental differential expression is often lost in the allopolyploid. Strikingly, the patterns of gene expression change are highly concordant with the genome-wide expression results of a cotton allopolyploid. The very different nature of these two allopolyploids implies a conserved, eukaryote-wide transcriptional response to genome merger. We provide evidence that the transcriptional responses we observe are mostly driven by intrinsic differences between the regulatory systems in the parent species, and from this propose a mechanistic model in which the cross-kingdom conservation in transcriptional response reflects conservation of the mutational processes underlying eukaryotic gene regulatory evolution. This work provides a platform to develop a universal understanding of gene expression response to allopolyploidy and suggests that allopolyploids are an exceptional system to investigate gene regulatory changes that have evolved in the parental species prior to allopolyploidization.

  15. Large-scale transcriptome analysis reveals arabidopsis metabolic pathways are frequently influenced by different pathogens.

    PubMed

    Jiang, Zhenhong; He, Fei; Zhang, Ziding

    2017-07-01

    Through large-scale transcriptional data analyses, we highlighted the importance of plant metabolism in plant immunity and identified 26 metabolic pathways that were frequently influenced by the infection of 14 different pathogens. Reprogramming of plant metabolism is a common phenomenon in plant defense responses. Currently, a large number of transcriptional profiles of infected tissues in Arabidopsis (Arabidopsis thaliana) have been deposited in public databases, which provides a great opportunity to understand the expression patterns of metabolic pathways during plant defense responses at the systems level. Here, we performed a large-scale transcriptome analysis based on 135 previously published expression samples, including 14 different pathogens, to explore the expression pattern of Arabidopsis metabolic pathways. Overall, metabolic genes are significantly changed in expression during plant defense responses. Upregulated metabolic genes are enriched on defense responses, and downregulated genes are enriched on photosynthesis, fatty acid and lipid metabolic processes. Gene set enrichment analysis (GSEA) identifies 26 frequently differentially expressed metabolic pathways (FreDE_Paths) that are differentially expressed in more than 60% of infected samples. These pathways are involved in the generation of energy, fatty acid and lipid metabolism as well as secondary metabolite biosynthesis. Clustering analysis based on the expression levels of these 26 metabolic pathways clearly distinguishes infected and control samples, further suggesting the importance of these metabolic pathways in plant defense responses. By comparing with FreDE_Paths from abiotic stresses, we find that the expression patterns of 26 FreDE_Paths from biotic stresses are more consistent across different infected samples. By investigating the expression correlation between transcriptional factors (TFs) and FreDE_Paths, we identify several notable relationships. Collectively, the current study will deepen our understanding of plant metabolism in plant immunity and provide new insights into disease-resistant crop improvement.

  16. Tissue-specific regulation of malic enzyme by thyroid hormone in the neonatal rat.

    PubMed

    Sood, A; Schwartz, H L; Oppenheimer, J H

    1996-05-15

    Two recent studies have claimed that thyroid hormone administration accelerates malic enzyme gene expression in the neonatal brain in contrast to the well-documented lack of effect of triiodothyronine on malic enzyme gene expression in the adult brain. Since these observations conflict with earlier observations in our laboratory, we reinvestigated the effect of thyroid hormone status on the ontogeny of malic enzyme gene expression in the neonatal rat. Neither hypothyroidism nor hyperthyroidism influenced the ontogenesis of malic enzyme activity in neonatal brain whereas the patterns of gene expression and enzyme activity in liver were markedly affected. Our results suggest that tissue-specific factors in brain block thyroid hormone-induced gene expression by thyroid hormone.

  17. Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory.

    PubMed

    Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J; Honjo, Mie N; Fukuda, Hirokazu

    2015-01-01

    In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions.

  18. Transcriptome Analysis of Plant Hormone-Related Tomato (Solanum lycopersicum) Genes in a Sunlight-Type Plant Factory

    PubMed Central

    Tanigaki, Yusuke; Higashi, Takanobu; Takayama, Kotaro; Nagano, Atsushi J.; Honjo, Mie N.; Fukuda, Hirokazu

    2015-01-01

    In plant factories, measurements of plant conditions are necessary at an early stage of growth to predict harvest times of high value-added crops. Moreover, harvest qualities depend largely on environmental stresses that elicit plant hormone responses. However, the complexities of plant hormone networks have not been characterized under nonstress conditions. In the present study, we determined temporal expression profiles of all genes and then focused on plant hormone pathways using RNA-Seq analyses of gene expression in tomato leaves every 2 h for 48 h. In these experiments, temporally expressed genes were found in the hormone synthesis pathways for salicylic acid, abscisic acid, ethylene, and jasmonic acid. The timing of CAB expression 1 (TOC1) and abscisic acid insensitive 1 (ABA1) and open stomata 1 (OST1) control gating stomata. In this study, compare with tomato and Arabidopsis thaliana, expression patterns of TOC1 have similarity. In contrast, expression patterns of tomato ABI1 and OST1 had expression peak at different time. These findings suggest that the regulation of gating stomata does not depend predominantly on TOC1 and significantly reflects the extracellular environment. The present data provide new insights into relationships between temporally expressed plant hormone-related genes and clock genes under normal sunlight conditions. PMID:26624004

  19. Transient activation of c-MYC expression is critical for efficient platelet generation from human induced pluripotent stem cells

    PubMed Central

    Takayama, Naoya; Nishimura, Satoshi; Nakamura, Sou; Shimizu, Takafumi; Ohnishi, Ryoko; Endo, Hiroshi; Yamaguchi, Tomoyuki; Otsu, Makoto; Nishimura, Ken; Nakanishi, Mahito; Sawaguchi, Akira; Nagai, Ryozo; Takahashi, Kazutoshi; Yamanaka, Shinya; Nakauchi, Hiromitsu

    2010-01-01

    Human (h) induced pluripotent stem cells (iPSCs) are a potentially abundant source of blood cells, but how best to select iPSC clones suitable for this purpose from among the many clones that can be simultaneously established from an identical source is not clear. Using an in vitro culture system yielding a hematopoietic niche that concentrates hematopoietic progenitors, we show that the pattern of c-MYC reactivation after reprogramming influences platelet generation from hiPSCs. During differentiation, reduction of c-MYC expression after initial reactivation of c-MYC expression in selected hiPSC clones was associated with more efficient in vitro generation of CD41a+CD42b+ platelets. This effect was recapitulated in virus integration-free hiPSCs using a doxycycline-controlled c-MYC expression vector. In vivo imaging revealed that these CD42b+ platelets were present in thrombi after laser-induced vessel wall injury. In contrast, sustained and excessive c-MYC expression in megakaryocytes was accompanied by increased p14 (ARF) and p16 (INK4A) expression, decreased GATA1 expression, and impaired production of functional platelets. These findings suggest that the pattern of c-MYC expression, particularly its later decline, is key to producing functional platelets from selected iPSC clones. PMID:21098095

  20. Responses in the right posterior superior temporal sulcus show a feature-based response to facial expression.

    PubMed

    Flack, Tessa R; Andrews, Timothy J; Hymers, Mark; Al-Mosaiwi, Mohammed; Marsden, Samuel P; Strachan, James W A; Trakulpipat, Chayanit; Wang, Liang; Wu, Tian; Young, Andrew W

    2015-08-01

    The face-selective region of the right posterior superior temporal sulcus (pSTS) plays an important role in analysing facial expressions. However, it is less clear how facial expressions are represented in this region. In this study, we used the face composite effect to explore whether the pSTS contains a holistic or feature-based representation of facial expression. Aligned and misaligned composite images were created from the top and bottom halves of faces posing different expressions. In Experiment 1, participants performed a behavioural matching task in which they judged whether the top half of two images was the same or different. The ability to discriminate the top half of the face was affected by changes in the bottom half of the face when the images were aligned, but not when they were misaligned. This shows a holistic behavioural response to expression. In Experiment 2, we used fMR-adaptation to ask whether the pSTS has a corresponding holistic neural representation of expression. Aligned or misaligned images were presented in blocks that involved repeating the same image or in which the top or bottom half of the images changed. Increased neural responses were found in the right pSTS regardless of whether the change occurred in the top or bottom of the image, showing that changes in expression were detected across all parts of the face. However, in contrast to the behavioural data, the pattern did not differ between aligned and misaligned stimuli. This suggests that the pSTS does not encode facial expressions holistically. In contrast to the pSTS, a holistic pattern of response to facial expression was found in the right inferior frontal gyrus (IFG). Together, these results suggest that pSTS reflects an early stage in the processing of facial expression in which facial features are represented independently. Copyright © 2015 Elsevier Ltd. All rights reserved.

  1. Dogs Evaluate Threatening Facial Expressions by Their Biological Validity – Evidence from Gazing Patterns

    PubMed Central

    Somppi, Sanni; Törnqvist, Heini; Kujala, Miiamaaria V.; Hänninen, Laura; Krause, Christina M.; Vainio, Outi

    2016-01-01

    Appropriate response to companions’ emotional signals is important for all social creatures. The emotional expressions of humans and non-human animals have analogies in their form and function, suggesting shared evolutionary roots, but very little is known about how animals other than primates view and process facial expressions. In primates, threat-related facial expressions evoke exceptional viewing patterns compared with neutral or positive stimuli. Here, we explore if domestic dogs (Canis familiaris) have such an attentional bias toward threatening social stimuli and whether observed emotional expressions affect dogs’ gaze fixation distribution among the facial features (eyes, midface and mouth). We recorded the voluntary eye gaze of 31 domestic dogs during viewing of facial photographs of humans and dogs with three emotional expressions (threatening, pleasant and neutral). We found that dogs’ gaze fixations spread systematically among facial features. The distribution of fixations was altered by the seen expression, but eyes were the most probable targets of the first fixations and gathered longer looking durations than mouth regardless of the viewed expression. The examination of the inner facial features as a whole revealed more pronounced scanning differences among expressions. This suggests that dogs do not base their perception of facial expressions on the viewing of single structures, but the interpretation of the composition formed by eyes, midface and mouth. Dogs evaluated social threat rapidly and this evaluation led to attentional bias, which was dependent on the depicted species: threatening conspecifics’ faces evoked heightened attention but threatening human faces instead an avoidance response. We propose that threatening signals carrying differential biological validity are processed via distinctive neurocognitive pathways. Both of these mechanisms may have an adaptive significance for domestic dogs. The findings provide a novel perspective on understanding the processing of emotional expressions and sensitivity to social threat in non-primates. PMID:26761433

  2. Competition between anthocyanin and flavonol biosynthesis produces spatial pattern variation of floral pigments between Mimulus species

    PubMed Central

    Yuan, Yao-Wu; Rebocho, Alexandra B.; Sagawa, Janelle M.; Stanley, Lauren E.; Bradshaw, Harvey D.

    2016-01-01

    Flower color patterns have long served as a model for developmental genetics because pigment phenotypes are visually striking, yet generally not required for plant viability, facilitating the genetic analysis of color and pattern mutants. The evolution of novel flower colors and patterns has played a key role in the adaptive radiation of flowering plants via their specialized interactions with different pollinator guilds (e.g., bees, butterflies, birds), motivating the search for allelic differences affecting flower color pattern in closely related plant species with different pollinators. We have identified LIGHT AREAS1 (LAR1), encoding an R2R3-MYB transcription factor, as the causal gene underlying the spatial pattern variation of floral anthocyanin pigmentation between two sister species of monkeyflower: the bumblebee-pollinated Mimulus lewisii and the hummingbird-pollinated Mimulus cardinalis. We demonstrated that LAR1 positively regulates FLAVONOL SYNTHASE (FLS), essentially eliminating anthocyanin biosynthesis in the white region (i.e., light areas) around the corolla throat of M. lewisii flowers by diverting dihydroflavonol into flavonol biosynthesis from the anthocyanin pigment pathway. FLS is preferentially expressed in the light areas of the M. lewisii flower, thus prepatterning the corolla. LAR1 expression in M. cardinalis flowers is much lower than in M. lewisii, explaining the unpatterned phenotype and recessive inheritance of the M. cardinalis allele. Furthermore, our gene-expression analysis and genetic mapping results suggest that cis-regulatory change at the LAR1 gene played a critical role in the evolution of different pigmentation patterns between the two species. PMID:26884205

  3. Competition between anthocyanin and flavonol biosynthesis produces spatial pattern variation of floral pigments between Mimulus species.

    PubMed

    Yuan, Yao-Wu; Rebocho, Alexandra B; Sagawa, Janelle M; Stanley, Lauren E; Bradshaw, Harvey D

    2016-03-01

    Flower color patterns have long served as a model for developmental genetics because pigment phenotypes are visually striking, yet generally not required for plant viability, facilitating the genetic analysis of color and pattern mutants. The evolution of novel flower colors and patterns has played a key role in the adaptive radiation of flowering plants via their specialized interactions with different pollinator guilds (e.g., bees, butterflies, birds), motivating the search for allelic differences affecting flower color pattern in closely related plant species with different pollinators. We have identified LIGHT AREAS1 (LAR1), encoding an R2R3-MYB transcription factor, as the causal gene underlying the spatial pattern variation of floral anthocyanin pigmentation between two sister species of monkeyflower: the bumblebee-pollinated Mimulus lewisii and the hummingbird-pollinated Mimulus cardinalis. We demonstrated that LAR1 positively regulates FLAVONOL SYNTHASE (FLS), essentially eliminating anthocyanin biosynthesis in the white region (i.e., light areas) around the corolla throat of M. lewisii flowers by diverting dihydroflavonol into flavonol biosynthesis from the anthocyanin pigment pathway. FLS is preferentially expressed in the light areas of the M. lewisii flower, thus prepatterning the corolla. LAR1 expression in M. cardinalis flowers is much lower than in M. lewisii, explaining the unpatterned phenotype and recessive inheritance of the M. cardinalis allele. Furthermore, our gene-expression analysis and genetic mapping results suggest that cis-regulatory change at the LAR1 gene played a critical role in the evolution of different pigmentation patterns between the two species.

  4. Correct Patterning of the Primitive Streak Requires the Anterior Visceral Endoderm

    PubMed Central

    Stuckey, Daniel W.; Di Gregorio, Aida; Clements, Melanie; Rodriguez, Tristan A.

    2011-01-01

    Anterior-posterior axis specification in the mouse requires signalling from a specialised extra-embryonic tissue called the anterior visceral endoderm (AVE). AVE precursors are induced at the distal tip of the embryo and move to the prospective anterior. Embryological and genetic analysis has demonstrated that the AVE is required for anterior patterning and for correctly positioning the site of primitive streak formation by inhibiting Nodal activity. We have carried out a genetic ablation of the Hex-expressing cells of the AVE (Hex-AVE) by knocking the Diphtheria toxin subunit A into the Hex locus in an inducible manner. Using this model we have identified that, in addition to its requirement in the anterior of the embryo, the Hex-AVE sub-population has a novel role between 5.5 and 6.5dpc in patterning the primitive streak. Embryos lacking the Hex-AVE display delayed initiation of primitive streak formation and miss-patterning of the anterior primitive streak. We demonstrate that in the absence of the Hex-AVE the restriction of Bmp2 expression to the proximal visceral endoderm is also defective and expression of Wnt3 and Nodal is not correctly restricted to the posterior epiblast. These results, coupled with the observation that reducing Nodal signalling in Hex-AVE ablated embryos increases the frequency of phenotypes observed, suggests that these primitive streak patterning defects are due to defective Nodal signalling. Together, our experiments demonstrate that the AVE is not only required for anterior patterning, but also that specific sub-populations of this tissue are required to pattern the posterior of the embryo. PMID:21445260

  5. Arabidopsis floral phytomer development: auxin response relative to biphasic modes of organ initiation

    PubMed Central

    Chandler, J. W.; Werr, W.

    2014-01-01

    In the Arabidopsis inflorescence meristem (IM), auxin is considered a prepatterning signal for floral primordia, whereas a centripetal mode of positional information for floral organ identity is inherent to the ABCE model. However, spatio-temporal patterns of organ initiation in each whorl at the earliest initiation stages are largely unknown. Evidence suggests that initial flower development occurs along an abaxial/adaxial axis and conforms to phytomer theory. Use of the founder cell marker DORNRÖSCHEN-LIKE (DRNL) as a tool in leafy, puchi, and apetala 1 cauliflower mutant backgrounds suggests that bract founder cells are marked at the IM periphery. The DRNL transcription domain in the wild-type IM is spatially discrete from DR5 expression, suggesting that bract initiation is independent of canonical auxin response. When bracts develop in lfy and puchi mutant floral primordia the initiation of lateral sepals precedes the specification of medial sepals compared with wild type, showing an interplay between bract and abaxial sepal founder cell recruitment. In the perianthia (pan) mutant background, DRNL expression indicates that a radial outer whorl arrangement derives from splitting of sepal founder cell populations at abaxial and adaxial positions. This splitting of incipient sepal primordia is partially dependent on PRESSED FLOWER (PRS) activity and implies that sepal specification is independent of WUSCHEL and CLAVATA3 expression, as both marker genes only regain activity in stage-2 flowers, when patterning of inner floral organs switches to a centripetal mode. The transition from an initially abaxial/adaxial into a centripetal patterning programme, and its timing represent an adaptive trait that possibly contributes to variation in floral morphology, especially unidirectional organ initiation. PMID:24744428

  6. Complex and extensive post-transcriptional regulation revealed by integrative proteomic and transcriptomic analysis of metabolite stress response in Clostridium acetobutylicum.

    PubMed

    Venkataramanan, Keerthi P; Min, Lie; Hou, Shuyu; Jones, Shawn W; Ralston, Matthew T; Lee, Kelvin H; Papoutsakis, E Terry

    2015-01-01

    Clostridium acetobutylicum is a model organism for both clostridial biology and solvent production. The organism is exposed to its own toxic metabolites butyrate and butanol, which trigger an adaptive stress response. Integrative analysis of proteomic and RNAseq data may provide novel insights into post-transcriptional regulation. The identified iTRAQ-based quantitative stress proteome is made up of 616 proteins with a 15 % genome coverage. The differentially expressed proteome correlated poorly with the corresponding differential RNAseq transcriptome. Up to 31 % of the differentially expressed proteins under stress displayed patterns opposite to those of the transcriptome, thus suggesting significant post-transcriptional regulation. The differential proteome of the translation machinery suggests that cells employ a different subset of ribosomal proteins under stress. Several highly upregulated proteins but with low mRNA levels possessed mRNAs with long 5'UTRs and strong RBS scores, thus supporting the argument that regulatory elements on the long 5'UTRs control their translation. For example, the oxidative stress response rubrerythrin was upregulated only at the protein level up to 40-fold without significant mRNA changes. We also identified many leaderless transcripts, several displaying different transcriptional start sites, thus suggesting mRNA-trimming mechanisms under stress. Downregulation of Rho and partner proteins pointed to changes in transcriptional elongation and termination under stress. The integrative proteomic-transcriptomic analysis demonstrated complex expression patterns of a large fraction of the proteome. Such patterns could not have been detected with one or the other omic analyses. Our analysis proposes the involvement of specific molecular mechanisms of post-transcriptional regulation to explain the observed complex stress response.

  7. Variation in Orthologous Shell-Forming Proteins Contribute to Molluscan Shell Diversity.

    PubMed

    Jackson, Daniel J; Reim, Laurin; Randow, Clemens; Cerveau, Nicolas; Degnan, Bernard M; Fleck, Claudia

    2017-11-01

    Despite the evolutionary success and ancient heritage of the molluscan shell, little is known about the molecular details of its formation, evolutionary origins, or the interactions between the material properties of the shell and its organic constituents. In contrast to this dearth of information, a growing collection of molluscan shell-forming proteomes and transcriptomes suggest they are comprised of both deeply conserved, and lineage specific elements. Analyses of these sequence data sets have suggested that mechanisms such as exon shuffling, gene co-option, and gene family expansion facilitated the rapid evolution of shell-forming proteomes and supported the diversification of this phylum specific structure. In order to further investigate and test these ideas we have examined the molecular features and spatial expression patterns of two shell-forming genes (Lustrin and ML1A2) and coupled these observations with materials properties measurements of shells from a group of closely related gastropods (abalone). We find that the prominent "GS" domain of Lustrin, a domain believed to confer elastomeric properties to the shell, varies significantly in length between the species we investigated. Furthermore, the spatial expression patterns of Lustrin and ML1A2 also vary significantly between species, suggesting that both protein architecture, and the regulation of spatial gene expression patterns, are important drivers of molluscan shell evolution. Variation in these molecular features might relate to certain materials properties of the shells of these species. These insights reveal an important and underappreciated source of variation within shell-forming proteomes that must contribute to the diversity of molluscan shell phenotypes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  8. Arabidopsis floral phytomer development: auxin response relative to biphasic modes of organ initiation.

    PubMed

    Chandler, J W; Werr, W

    2014-07-01

    In the Arabidopsis inflorescence meristem (IM), auxin is considered a prepatterning signal for floral primordia, whereas a centripetal mode of positional information for floral organ identity is inherent to the ABCE model. However, spatio-temporal patterns of organ initiation in each whorl at the earliest initiation stages are largely unknown. Evidence suggests that initial flower development occurs along an abaxial/adaxial axis and conforms to phytomer theory. Use of the founder cell marker DORNRÖSCHEN-LIKE (DRNL) as a tool in leafy, puchi, and apetala 1 cauliflower mutant backgrounds suggests that bract founder cells are marked at the IM periphery. The DRNL transcription domain in the wild-type IM is spatially discrete from DR5 expression, suggesting that bract initiation is independent of canonical auxin response. When bracts develop in lfy and puchi mutant floral primordia the initiation of lateral sepals precedes the specification of medial sepals compared with wild type, showing an interplay between bract and abaxial sepal founder cell recruitment. In the perianthia (pan) mutant background, DRNL expression indicates that a radial outer whorl arrangement derives from splitting of sepal founder cell populations at abaxial and adaxial positions. This splitting of incipient sepal primordia is partially dependent on PRESSED FLOWER (PRS) activity and implies that sepal specification is independent of WUSCHEL and CLAVATA3 expression, as both marker genes only regain activity in stage-2 flowers, when patterning of inner floral organs switches to a centripetal mode. The transition from an initially abaxial/adaxial into a centripetal patterning programme, and its timing represent an adaptive trait that possibly contributes to variation in floral morphology, especially unidirectional organ initiation. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  9. Sex- and brain region-specific patterns of gene expression associated with socially-mediated puberty in a eusocial mammal

    PubMed Central

    Monks, D. Ashley; Zovkic, Iva B.; Holmes, Melissa M.

    2018-01-01

    The social environment can alter pubertal timing through neuroendocrine mechanisms that are not fully understood; it is thought that stress hormones (e.g., glucocorticoids or corticotropin-releasing hormone) influence the hypothalamic-pituitary-gonadal axis to inhibit puberty. Here, we use the eusocial naked mole-rat, a unique species in which social interactions in a colony (i.e. dominance of a breeding female) suppress puberty in subordinate animals. Removing subordinate naked mole-rats from this social context initiates puberty, allowing for experimental control of pubertal timing. The present study quantified gene expression for reproduction- and stress-relevant genes acting upstream of gonadotropin-releasing hormone in brain regions with reproductive and social functions in pre-pubertal, post-pubertal, and opposite sex-paired animals (which are in various stages of pubertal transition). Results indicate sex differences in patterns of neural gene expression. Known functions of genes in brain suggest stress as a key contributing factor in regulating male pubertal delay. Network analysis implicates neurokinin B (Tac3) in the arcuate nucleus of the hypothalamus as a key node in this pathway. Results also suggest an unappreciated role for the nucleus accumbens in regulating puberty. PMID:29474488

  10. Stability of DNA methylation patterns in mouse spermatogonia under conditions of MTHFR deficiency and methionine supplementation.

    PubMed

    Garner, Justine L; Niles, Kirsten M; McGraw, Serge; Yeh, Jonathan R; Cushnie, Duncan W; Hermo, Louis; Nagano, Makoto C; Trasler, Jacquetta M

    2013-11-01

    Little is known about the conditions contributing to the stability of DNA methylation patterns in male germ cells. Altered folate pathway enzyme activity and methyl donor supply are two clinically significant factors that can affect the methylation of DNA. 5,10-Methylenetetrahydrofolate reductase (MTHFR) is a key folate pathway enzyme involved in providing methyl groups from dietary folate for DNA methylation. Mice heterozygous for a targeted mutation in the Mthfr gene (Mthfr(+/-)) are a good model for humans homozygous for the MTHFR 677C>T polymorphism, which is found in 10% of the population and is associated with decreased MTHFR activity and infertility. High-dose folic acid is administered as an empirical treatment for male infertility. Here, we examined MTHFR expression in developing male germ cells and evaluated DNA methylation patterns and effects of a range of methionine concentrations in spermatogonia from Mthfr(+/-) as compared to wild-type, Mthfr(+/+) mice. MTHFR was expressed in prospermatogonia and spermatogonia at times of DNA methylation acquisition in the male germline; its expression was also found in early spermatocytes and Sertoli cells. DNA methylation patterns were similar at imprinted genes and intergenic sites across chromosome 9 in neonatal Mthfr(+/+) and Mthfr(+/-) spermatogonia. Using spermatogonia from Mthfr(+/+) and Mthfr(+/-) mice in the spermatogonial stem cell (SSC) culture system, we examined the stability of DNA methylation patterns and determined effects of low or high methionine concentrations. No differences were detected between early and late passages, suggesting that DNA methylation patterns are generally stable in culture. Twenty-fold normal concentrations of methionine resulted in an overall increase in the levels of DNA methylation across chromosome 9, suggesting that DNA methylation can be perturbed in culture. Mthfr(+/-) cells showed a significantly increased variance of DNA methylation at multiple loci across chromosome 9 compared to Mthfr(+/+) cells when cultured with 0.25- to 2-fold normal methionine concentrations. Taken together, our results indicate that DNA methylation patterns in undifferentiated spermatogonia, including SSCs, are relatively stable in culture over time under conditions of altered methionine and MTHFR levels.

  11. The G protein-coupled estrogen receptor (GPER) is expressed in two different subcellular localizations reflecting distinct tumor properties in breast cancer.

    PubMed

    Samartzis, Eleftherios P; Noske, Aurelia; Meisel, Alexander; Varga, Zsuzsanna; Fink, Daniel; Imesch, Patrick

    2014-01-01

    The G protein-coupled estrogen receptor (GPER) is a novel estrogen receptor that mediates proliferative effects induced by estrogen but also by tamoxifen. The aim of our study was to analyze the frequency of GPER in a large collective of primary invasive breast carcinomas, with special emphasis on the subcellular expression and to evaluate the association with clinicopathological parameters and patient overall survival. The tissue microarrays from formalin-fixed, paraffin embedded samples of primary invasive breast carcinomas (n = 981) were analyzed for GPER expression using immunohistochemistry. Expression data were compared to the clinicopathological parameters and overall survival. GPER localization was also analyzed in two immortalized breast cancer cell lines T47D and MCF7 by confocal immunofluorescence microscopy. A predominantly cytoplasmic GPER expression was found in 189 carcinomas (19.3%), whereas a predominantly nuclear expression was observed in 529 cases (53.9%). A simultaneous comparable positive expression of both patterns was found in 32 of 981 cases (3.2%), and negative staining was detected in 295 cases (30%). Confocal microscopy confirmed the occurrence of cytoplasmic and nuclear GPER expression in T47D and MCF7. Cytoplasmic GPER expression was significantly associated with non-ductal histologic subtypes, low tumor stage, better histologic differentiation, as well as Luminal A and B subtypes. In contrast, nuclear GPER expression was significantly associated with poorly differentiated carcinomas and the triple-negative subtype. In univariate analysis, cytoplasmic GPER expression was associated with better overall survival (p = 0.012). Our data suggest that predominantly cytoplasmic and/or nuclear GPER expression are two distinct immunohistochemical patterns in breast carcinomas and may reflect different biological features, reason why these patterns should be clearly distinguished in histological evaluations. Prospective studies will be needed to assess whether the expression status of GPER in breast carcinomas should be routinely observed by clinicians, for instance, before implementing endocrine breast cancer treatment.

  12. The G Protein-Coupled Estrogen Receptor (GPER) Is Expressed in Two Different Subcellular Localizations Reflecting Distinct Tumor Properties in Breast Cancer

    PubMed Central

    Samartzis, Eleftherios P.; Noske, Aurelia; Meisel, Alexander; Varga, Zsuzsanna; Fink, Daniel; Imesch, Patrick

    2014-01-01

    Introduction The G protein-coupled estrogen receptor (GPER) is a novel estrogen receptor that mediates proliferative effects induced by estrogen but also by tamoxifen. The aim of our study was to analyze the frequency of GPER in a large collective of primary invasive breast carcinomas, with special emphasis on the subcellular expression and to evaluate the association with clinicopathological parameters and patient overall survival. Methods The tissue microarrays from formalin-fixed, paraffin embedded samples of primary invasive breast carcinomas (n = 981) were analyzed for GPER expression using immunohistochemistry. Expression data were compared to the clinicopathological parameters and overall survival. GPER localization was also analyzed in two immortalized breast cancer cell lines T47D and MCF7 by confocal immunofluorescence microscopy. Results A predominantly cytoplasmic GPER expression was found in 189 carcinomas (19.3%), whereas a predominantly nuclear expression was observed in 529 cases (53.9%). A simultaneous comparable positive expression of both patterns was found in 32 of 981 cases (3.2%), and negative staining was detected in 295 cases (30%). Confocal microscopy confirmed the occurrence of cytoplasmic and nuclear GPER expression in T47D and MCF7. Cytoplasmic GPER expression was significantly associated with non-ductal histologic subtypes, low tumor stage, better histologic differentiation, as well as Luminal A and B subtypes. In contrast, nuclear GPER expression was significantly associated with poorly differentiated carcinomas and the triple-negative subtype. In univariate analysis, cytoplasmic GPER expression was associated with better overall survival (p = 0.012). Conclusion Our data suggest that predominantly cytoplasmic and/or nuclear GPER expression are two distinct immunohistochemical patterns in breast carcinomas and may reflect different biological features, reason why these patterns should be clearly distinguished in histological evaluations. Prospective studies will be needed to assess whether the expression status of GPER in breast carcinomas should be routinely observed by clinicians, for instance, before implementing endocrine breast cancer treatment. PMID:24421881

  13. Mechanisms of macroevolution: polyphagous plasticity in butterfly larvae revealed by RNA-Seq.

    PubMed

    de la Paz Celorio-Mancera, Maria; Wheat, Christopher W; Vogel, Heiko; Söderlind, Lina; Janz, Niklas; Nylin, Sören

    2013-10-01

    Transcriptome studies of insect herbivory are still rare, yet studies in model systems have uncovered patterns of transcript regulation that appear to provide insights into how insect herbivores attain polyphagy, such as a general increase in expression breadth and regulation of ribosomal, digestion- and detoxification-related genes. We investigated the potential generality of these emerging patterns, in the Swedish comma, Polygonia c-album, which is a polyphagous, widely-distributed butterfly. Urtica dioica and Ribes uva-crispa are hosts of P. c-album, but Ribes represents a recent evolutionary shift onto a very divergent host. Utilizing the assembled transcriptome for read mapping, we assessed gene expression finding that caterpillar life-history (i.e. 2nd vs. 4th-instar regulation) had a limited influence on gene expression plasticity. In contrast, differential expression in response to host-plant identified genes encoding serine-type endopeptidases, membrane-associated proteins and transporters. Differential regulation of genes involved in nucleic acid binding was also observed suggesting that polyphagy involves large scale transcriptional changes. Additionally, transcripts coding for structural constituents of the cuticle were differentially expressed in caterpillars in response to their diet indicating that the insect cuticle may be a target for plant defence. Our results state that emerging patterns of transcript regulation from model species appear relevant in species when placed in an evolutionary context. © 2013 John Wiley & Sons Ltd.

  14. Comparison of the Structure and Expression of Odd-Skipped and Two Related Genes That Encode a New Family of Zinc Finger Proteins in Drosophila

    PubMed Central

    Hart, M. C.; Wang, L.; Coulter, D. E.

    1996-01-01

    The odd-skipped (odd) gene, which was identified on the basis of a pair-rule segmentation phenotype in mutant embryos, is initially expressed in the Drosophila embryo in seven pair-rule stripes, but later exhibits a segment polarity-like pattern for which no phenotypic correlate is apparent. We have molecularly characterized two embryonically expressed odd-cognate genes, sob and bowel (bowl), that encode proteins with highly conserved C(2)H(2) zinc fingers. While the Sob and Bowl proteins each contain five tandem fingers, the Odd protein lacks a fifth (C-terminal) finger and is also less conserved among the four common fingers. Reminiscent of many segmentation gene paralogues, the closely linked odd and sob genes are expressed during embryogenesis in similar striped patterns; in contrast, the less-tightly linked bowl gene is expressed in a distinctly different pattern at the termini of the early embryo. Although our results indicate that odd and sob are more likely than bowl to share overlapping developmental roles, some functional divergence between the Odd and Sob proteins is suggested by the absence of homology outside the zinc fingers, and also by amino acid substitutions in the Odd zinc fingers at positions that appear to be constrained in Sob and Bowl. PMID:8878683

  15. The Differential Expression of Sucrose Synthase in Relation to Diverse Patterns of Carbon Partitioning in Developing Cotton Seed.

    PubMed Central

    Ruan, Y. L.; Chourey, P. S.; Delmer, D. P.; Perez-Grau, L.

    1997-01-01

    Developing cotton (Gossypium hirsutum L.) seed exhibits complex patterns of carbon allocation in which incoming sucrose (Suc) is partitioned to three major sinks: the fibers, seed coat, and cotyledons, which synthesize cellulose, starch, and storage proteins or oils, respectively. In this study we investigated the role of Suc synthase (SuSy) in the mobilization of Suc into such sinks. Assessments of SuSy gene expression at various levels led to the surprising conclusion that, in contrast to that found for other plants, SuSy does not appear to play a role in starch synthesis in the cotton seed. However, our demonstration of functional symplastic connections between the phloem-unloading area and the fiber cells, as well as the SuSy expression pattern in fibers, indicates a major role of SuSy in partitioning carbon to fiber cellulose synthesis. SuSy expression is also high in transfer cells of the seed coat facing the cotyledons. Such high levels of SuSy could contribute to the synthesis of the thickened cell walls and to the energy generation for Suc efflux to the seed apoplast. The expression of SuSy in cotyledons also suggests a role in protein and lipid synthesis. In summary, the developing cotton seed provides an excellent example of the diverse roles played by SuSy in carbon metabolism. PMID:12223814

  16. Circadian rhythms regulate amelogenesis.

    PubMed

    Zheng, Li; Seon, Yoon Ji; Mourão, Marcio A; Schnell, Santiago; Kim, Doohak; Harada, Hidemitsu; Papagerakis, Silvana; Papagerakis, Petros

    2013-07-01

    Ameloblasts, the cells responsible for making enamel, modify their morphological features in response to specialized functions necessary for synchronized ameloblast differentiation and enamel formation. Secretory and maturation ameloblasts are characterized by the expression of stage-specific genes which follows strictly controlled repetitive patterns. Circadian rhythms are recognized as key regulators of the development and diseases of many tissues including bone. Our aim was to gain novel insights on the role of clock genes in enamel formation and to explore the potential links between circadian rhythms and amelogenesis. Our data shows definitive evidence that the main clock genes (Bmal1, Clock, Per1 and Per2) oscillate in ameloblasts at regular circadian (24 h) intervals both at RNA and protein levels. This study also reveals that the two markers of ameloblast differentiation i.e. amelogenin (Amelx; a marker of secretory stage ameloblasts) and kallikrein-related peptidase 4 (Klk4, a marker of maturation stage ameloblasts) are downstream targets of clock genes. Both, Amelx and Klk4 show 24h oscillatory expression patterns and their expression levels are up-regulated after Bmal1 over-expression in HAT-7 ameloblast cells. Taken together, these data suggest that both the secretory and the maturation stages of amelogenesis might be under circadian control. Changes in clock gene expression patterns might result in significant alterations of enamel apposition and mineralization. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Mutual regulatory interactions of the trunk gap genes during blastoderm patterning in the hemipteran Oncopeltus fasciatus.

    PubMed

    Ben-David, Jonathan; Chipman, Ariel D

    2010-10-01

    The early embryo of the milkweed bug, Oncopeltus fasciatus, appears as a single cell layer - the embryonic blastoderm - covering the entire egg. It is at this blastoderm stage that morphological domains are first determined, long before the appearance of overt segmentation. Central to the process of patterning the blastoderm into distinct domains are a group of transcription factors known as gap genes. In Drosophila melanogaster these genes form a network of interactions, and maintain sharp expression boundaries through strong mutual repression. Their restricted expression domains define specific areas along the entire body. We have studied the expression domains of the four trunk gap gene homologues in O. fasciatus and have determined their interactions through dsRNA gene knockdown experiments, followed by expression analyses. While the blastoderm in O. fasciatus includes only the first six segments of the embryo, the expression domains of the gap genes within these segments are broadly similar to those in Drosophila where the blastoderm includes all 15 segments. However, the interactions between the gap genes are surprisingly different from those in Drosophila, and mutual repression between the genes seems to play a much less significant role. This suggests that the well-studied interaction pattern in Drosophila is evolutionarily derived, and has evolved from a less strongly interacting network. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. A Modified ABCDE Model of Flowering in Orchids Based on Gene Expression Profiling Studies of the Moth Orchid Phalaenopsis aphrodite

    PubMed Central

    Lee, Ann-Ying; Chen, Chun-Yi; Chang, Yao-Chien Alex; Chao, Ya-Ting; Shih, Ming-Che

    2013-01-01

    Previously we developed genomic resources for orchids, including transcriptomic analyses using next-generation sequencing techniques and construction of a web-based orchid genomic database. Here, we report a modified molecular model of flower development in the Orchidaceae based on functional analysis of gene expression profiles in Phalaenopsis aphrodite (a moth orchid) that revealed novel roles for the transcription factors involved in floral organ pattern formation. Phalaenopsis orchid floral organ-specific genes were identified by microarray analysis. Several critical transcription factors including AP3, PI, AP1 and AGL6, displayed distinct spatial distribution patterns. Phylogenetic analysis of orchid MADS box genes was conducted to infer the evolutionary relationship among floral organ-specific genes. The results suggest that gene duplication MADS box genes in orchid may have resulted in their gaining novel functions during evolution. Based on these analyses, a modified model of orchid flowering was proposed. Comparison of the expression profiles of flowers of a peloric mutant and wild-type Phalaenopsis orchid further identified genes associated with lip morphology and peloric effects. Large scale investigation of gene expression profiles revealed that homeotic genes from the ABCDE model of flower development classes A and B in the Phalaenopsis orchid have novel functions due to evolutionary diversification, and display differential expression patterns. PMID:24265826

  19. AmphiPax3/7, an amphioxus paired box gene: insights into chordate myogenesis, neurogenesis, and the possible evolutionary precursor of definitive vertebrate neural crest.

    PubMed

    Holland, L Z; Schubert, M; Kozmik, Z; Holland, N D

    1999-01-01

    Amphioxus probably has only a single gene (AmphiPax3/7) in the Pax3/7 subfamily. Like its vertebrate homologs (Pax3 and Pax7), amphioxus AmphiPax3/7 is probably involved in specifying the axial musculature and muscularized notochord. During nervous system development, AmphiPax3/7 is first expressed in bilateral anteroposterior stripes along the edges of the neural plate. This early neural expression may be comparable to the transcription of Pax3 and Pax7 in some of the anterior neural crest cells of vertebrates. Previous studies by others and ourselves have demonstrated that several genes homologous to genetic markers for vertebrate neural crest are expressed along the neural plate-epidermis boundary in embryos of tunicates and amphioxus. Taken together, the early neural expression patterns of AmphiPax3/7 and other neural crest markers of amphioxus and tunicates suggest that cell populations that eventually gave rise to definitive vertebrate neural crest may have been present in ancestral invertebrate chordates. During later neurogenesis in amphioxus, AmphiPax3/7, like its vertebrate homologs, is expressed dorsally and dorsolaterally in the neural tube and may be involved in dorsoventral patterning. However, unlike its vertebrate homologs, AmphiPax3/7 is expressed only at the anterior end of the central nervous system instead of along much of the neuraxis; this amphioxus pattern may represent the loss of a primitive chordate character.

  20. R-spondin 3 regulates dorsoventral and anteroposterior patterning by antagonizing Wnt/β-catenin signaling in zebrafish embryos.

    PubMed

    Rong, Xiaozhi; Chen, Chen; Zhou, Pin; Zhou, Yumei; Li, Yun; Lu, Ling; Liu, Yunzhang; Zhou, Jianfeng; Duan, Cunming

    2014-01-01

    The Wnt/β-catenin or canonical Wnt signaling pathway plays fundamental roles in early development and in maintaining adult tissue homeostasis. R-spondin 3 (Rspo3) is a secreted protein that has been implicated in activating the Wnt/β-catenin signaling in amphibians and mammals. Here we report that zebrafish Rspo3 plays a negative role in regulating the zygotic Wnt/β-catenin signaling. Zebrafish Rspo3 has a unique domain structure. It contains a third furin-like (FU3) domain. This FU3 is present in other four ray-finned fish species studied but not in elephant shark. In zebrafish, rspo3 mRNA is maternally deposited and has a ubiquitous expression in early embryonic stages. After 12 hpf, its expression becomes tissue-specific. Forced expression of rspo3 promotes dorsoanterior patterning and increases the expression of dorsal and anterior marker genes. Knockdown of rspo3 increases ventral-posterior development and stimulates ventral and posterior marker genes expression. Forced expression of rspo3 abolishes exogenous Wnt3a action and reduces the endogenous Wnt signaling activity. Knockdown of rspo3 results in increased Wnt/β-catenin signaling activity. Further analyses indicate that Rspo3 does not promote maternal Wnt signaling. Human RSPO3 has similar action when tested in zebrafish embryos. These results suggest that Rspo3 regulates dorsoventral and anteroposterior patterning by negatively regulating the zygotic Wnt/β-catenin signaling in zebrafish embryos.

  1. R-Spondin 3 Regulates Dorsoventral and Anteroposterior Patterning by Antagonizing Wnt/β-Catenin Signaling in Zebrafish Embryos

    PubMed Central

    Zhou, Pin; Zhou, Yumei; Li, Yun; Lu, Ling; Liu, Yunzhang; Zhou, Jianfeng; Duan, Cunming

    2014-01-01

    The Wnt/β-catenin or canonical Wnt signaling pathway plays fundamental roles in early development and in maintaining adult tissue homeostasis. R-spondin 3 (Rspo3) is a secreted protein that has been implicated in activating the Wnt/β-catenin signaling in amphibians and mammals. Here we report that zebrafish Rspo3 plays a negative role in regulating the zygotic Wnt/β-catenin signaling. Zebrafish Rspo3 has a unique domain structure. It contains a third furin-like (FU3) domain. This FU3 is present in other four ray-finned fish species studied but not in elephant shark. In zebrafish, rspo3 mRNA is maternally deposited and has a ubiquitous expression in early embryonic stages. After 12 hpf, its expression becomes tissue-specific. Forced expression of rspo3 promotes dorsoanterior patterning and increases the expression of dorsal and anterior marker genes. Knockdown of rspo3 increases ventral-posterior development and stimulates ventral and posterior marker genes expression. Forced expression of rspo3 abolishes exogenous Wnt3a action and reduces the endogenous Wnt signaling activity. Knockdown of rspo3 results in increased Wnt/β-catenin signaling activity. Further analyses indicate that Rspo3 does not promote maternal Wnt signaling. Human RSPO3 has similar action when tested in zebrafish embryos. These results suggest that Rspo3 regulates dorsoventral and anteroposterior patterning by negatively regulating the zygotic Wnt/β-catenin signaling in zebrafish embryos. PMID:24918770

  2. Isolation of a transcription factor expressed in neural crest from the region of 22q11 deleted in DiGeorge syndrome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wadey, R.; Roberts, C.; Daw, S.

    1994-09-01

    Deletions within chromosome 22q11 cause a wide variety of birth defects including DiGeorge syndrome and Shprintzen syndrome. We have defined a commonly deleted region of over 2 Mb, and a critical region of 300 kb. A gene, TUPLE1, has been isolated from this critical region encoding a transcriptional regulator similar to the yeast HIR1 histone regulator gene. Since it has been suggested that DGS results from a defective neural crest, the expression of Tuple1 was examined in whole mouse and chick embryos, tissue sections and neural tube explants: Tuple1 is expressed in a dynamic pattern with high levels in regionsmore » containing migrating crest. Prior to crest migration Tuple1 is expressed in a rhombomere-specific expression pattern. Later Tuple1 is expressed in discrete domains within the developing neural tube. A remarkable feature of the experiments was the detection of a similar dynamic pattern with sense probe; i.e., there is an antisense Tuple1 transcript. This was confirmed using RPA. Tuple1 is being screened for mutations in non-deletion patients and constructs assembled for homologous recombination in ES cells. Tuple1 maps to MMU16 extending the homology of linkage with human chromosome 22. From these data we predict that the human homologue of the murine scid mutation maps to 22q11.« less

  3. CONSERVED ROLES FOR CYTOSKELETAL COMPONENTS IN DETERMINING LATERALITY

    PubMed Central

    McDowell, Gary S.; Lemire, Joan M.; Paré, Jean-Francois; Cammarata, Garrett; Lowery, Laura Anne; Levin, Michael

    2016-01-01

    SUMMARY Consistently-biased left-right (LR) patterning is required for the proper placement of organs including the heart and viscera. The LR axis is especially fascinating as an example of multi-scale pattern formation, since here chiral events at the subcellular level are integrated and amplified into asymmetric transcriptional cascades and ultimately into the anatomical patterning of the entire body. In contrast to the other two body axes, there is considerable controversy about the earliest mechanisms of embryonic laterality. Many molecular components of asymmetry have not been widely tested among phyla with diverse bodyplans, and it is unknown whether parallel (redundant) pathways may exist that could reverse abnormal asymmetry states at specific checkpoints in development. To address conservation of the early steps of LR patterning, we used the Xenopus laevis (frog) embryo to functionally test a number of protein targets known to direct asymmetry in plants, fruit fly, and rodent. Using the same reagents that randomize asymmetry in Arabidopsis, Drosophila, and mouse embryos, we show that manipulation of the microtubule and actin cytoskeleton immediately post-fertilization, but not later, results in laterality defects in Xenopus embryos. Moreover, we observed organ-specific randomization effects and a striking dissociation of organ situs from effects on the expression of left side control genes, which parallel data from Drosophila and mouse. Remarkably, some early manipulations that disrupt laterality of transcriptional asymmetry determinants can be subsequently “rescued” by the embryo, resulting in normal organ situs. These data reveal the existence of novel corrective mechanisms, demonstrate that asymmetric expression of Nodal is not a definitive marker of laterality, and suggest the existence of amplification pathways that connect early cytoskeletal processes to control of organ situs bypassing Nodal. Counter to alternative models of symmetry breaking during neurulation (via ciliary structures absent in many phyla), our data suggest a widely-conserved role for the cytoskeleton in regulating left-right axis formation immediately after fertilization of the egg. The novel mechanisms that rescue organ situs, even after incorrect expression of genes previously considered to be left-side master regulators, suggest LR patterning as a new context in which to explore multi-scale redundancy and integration of patterning from the subcellular structure to the entire bodyplan. PMID:26928161

  4. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants

    PubMed Central

    Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irvin R.

    2008-01-01

    The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4′-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1–3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA’s. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as “expression signatures”. The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action. PMID:16488489

  5. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants.

    PubMed

    Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R

    2006-05-25

    The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4'-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1-3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA's. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as "expression signatures". The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action.

  6. Novel transcriptional networks regulated by CLOCK in human neurons.

    PubMed

    Fontenot, Miles R; Berto, Stefano; Liu, Yuxiang; Werthmann, Gordon; Douglas, Connor; Usui, Noriyoshi; Gleason, Kelly; Tamminga, Carol A; Takahashi, Joseph S; Konopka, Genevieve

    2017-11-01

    The molecular mechanisms underlying human brain evolution are not fully understood; however, previous work suggested that expression of the transcription factor CLOCK in the human cortex might be relevant to human cognition and disease. In this study, we investigated this novel transcriptional role for CLOCK in human neurons by performing chromatin immunoprecipitation sequencing for endogenous CLOCK in adult neocortices and RNA sequencing following CLOCK knockdown in differentiated human neurons in vitro. These data suggested that CLOCK regulates the expression of genes involved in neuronal migration, and a functional assay showed that CLOCK knockdown increased neuronal migratory distance. Furthermore, dysregulation of CLOCK disrupts coexpressed networks of genes implicated in neuropsychiatric disorders, and the expression of these networks is driven by hub genes with human-specific patterns of expression. These data support a role for CLOCK-regulated transcriptional cascades involved in human brain evolution and function. © 2017 Fontenot et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Ancestral Patterning of Tergite Formation in a Centipede Suggests Derived Mode of Trunk Segmentation in Trilobites

    PubMed Central

    Ortega-Hernández, Javier; Brena, Carlo

    2012-01-01

    Trilobites have a rich and abundant fossil record, but little is known about the intrinsic mechanisms that orchestrate their body organization. To date, there is disagreement regarding the correspondence, or lack thereof, of the segmental units that constitute the trilobite trunk and their associated exoskeletal elements. The phylogenetic position of trilobites within total-group Euarthropoda, however, allows inferences about the underlying organization in these extinct taxa to be made, as some of the fundamental genetic processes for constructing the trunk segments are remarkably conserved among living arthropods. One example is the expression of the segment polarity gene engrailed, which at embryonic and early postembryonic stages is expressed in extant panarthropods (i.e. tardigrades, onychophorans, euarthropods) as transverse stripes that define the posteriormost region of each trunk segment. Due to its conservative morphology and allegedly primitive trunk tagmosis, we have utilized the centipede Strigamia maritima to study the correspondence between the expression of engrailed during late embryonic to postembryonic stages, and the development of the dorsal exoskeletal plates (i.e. tergites). The results corroborate the close correlation between the formation of the tergite borders and the dorsal expression of engrailed, and suggest that this association represents a symplesiomorphy within Euarthropoda. This correspondence between the genetic and phenetic levels enables making accurate inferences about the dorsoventral expression domains of engrailed in the trunk of exceptionally preserved trilobites and their close relatives, and is suggestive of the widespread occurrence of a distinct type of genetic segmental mismatch in these extinct arthropods. The metameric organization of the digestive tract in trilobites provides further support to this new interpretation. The wider evolutionary implications of these findings suggest the presence of a derived morphogenetic patterning mechanism responsible for the reiterated occurrence of different types of trunk dorsoventral segmental mismatch in several phylogenetically distant, extinct and extant, arthropod groups. PMID:23285116

  8. Nanotopography Promotes Pancreatic Differentiation of Human Embryonic Stem Cells and Induced Pluripotent Stem Cells.

    PubMed

    Kim, Jong Hyun; Kim, Hyung Woo; Cha, Kyoung Je; Han, Jiyou; Jang, Yu Jin; Kim, Dong Sung; Kim, Jong-Hoon

    2016-03-22

    Although previous studies suggest that nanotopographical features influence properties and behaviors of stem cells, only a few studies have attempted to derive clinically useful somatic cells from human pluripotent stem cells using nanopatterned surfaces. In the present study, we report that polystyrene nanopore-patterned surfaces significantly promote the pancreatic differentiation of human embryonic and induced pluripotent stem cells. We compared different diameters of nanopores and showed that 200 nm nanopore-patterned surfaces highly upregulated the expression of PDX1, a critical transcription factor for pancreatic development, leading to an approximately 3-fold increase in the percentage of differentiating PDX1(+) pancreatic progenitors compared with control flat surfaces. Furthermore, in the presence of biochemical factors, 200 nm nanopore-patterned surfaces profoundly enhanced the derivation of pancreatic endocrine cells producing insulin, glucagon, or somatostatin. We also demonstrate that nanopore-patterned surface-induced upregulation of PDX1 is associated with downregulation of TAZ, suggesting the potential role of TAZ in nanopore-patterned surface-mediated mechanotransduction. Our study suggests that appropriate cytokine treatments combined with nanotopographical stimulation could be a powerful tool for deriving a high purity of desired cells from human pluripotent stem cells.

  9. Distinctive expression pattern of OCT4 variants in different types of breast cancer.

    PubMed

    Soheili, Saamaaneh; Asadi, Malek Hossein; Farsinejad, Alireza

    2017-01-01

    OCT4 is a key regulator of self-renewal and pluripotency in embryonic stem cells which can potentially encode three spliced variants designated OCT4A, OCT4B and OCT4B1. Based on cancer stem cell concept, it is suggested that the stemness factors misexpressed in cancer cells and potentially is involved in tumorigenesis. Accordingly, in this study, we investigated the potential expression of OCT4 variants in breast cancer tissues. A total of 94 tumoral and peritumoral breast specimens were evaluated with respect to the expression of OCT4 variants using quantitative RT-PCR and immunohistochemical (IHC) analysis. We detected the expression of OCT4 variants in breast tumor tissues with no or very low levels of expression in peritumoral samples of the same patients. While OCT4B was highly expressed in lobular type of breast cancer, OCT4A and OCTB1 variants are highly expressed in low grade (I and II) ductal tumors. Furthermore, the results of this study revealed a considerable association between the expression level of OCT4 variants and the expression of ER, PR, Her2 and P53 factors. All data demonstrated a distinctive expression pattern of OCT4 spliced variants in different types of breast cancer and provide further evidence for the involvement of embryonic genes in carcinogenesis.

  10. Sodium-Hydrogen-Exchanger expression in human sperm and its relationship with semen parameters.

    PubMed

    Zhang, Zhe; Yang, Yuzhuo; Wu, Han; Zhang, Hongliang; Zhang, Haitao; Mao, Jiaming; Liu, Defeng; Zhao, Lianming; Lin, Haocheng; Tang, Wenhao; Hong, Kai; Jiang, Hui

    2017-06-01

    Sperm-specific sodium-hydrogen exchanger (sNHE) is essential to maintain sperm normal function in mice; however, its role in human sperm has not been clarified to date. The aim of this study is to investigate the expression pattern of sNHE in human spermatozoa and its relationship with sperm functional parameters. Semen samples from 68 asthenozoospermic and 61 normozoospermic men were analyzed for sperm concentration, motility, and acrosome reaction, and high motile spermatozoa were collected by swim-up method. The expression of sNHE in spermatozoa was detected by Western blot and immunofluorescence staining. The relationship between sNHE expression and sperm parameters was assessed. We identified sNHE is mainly localized to the principal piece of the human sperm tail. The expression of sNHE was positively correlated with sperm concentration, total number, and progressive motility. Moreover, sNHE expression was upregulated in swim-up sperm and associated with most of sperm motility parameters including straight line velocity and curvilinear velocity. Our results also showed that sNHE expression is decreased in sperm from patients with asthenozoospermia compared with that from normal controls. However, no correlation was found between sNHE expression and acrosome reaction in spermatozoa. The expression pattern of sNHE suggested that this protein may be involved in the regulation of sperm motility, and aberration of its expression in sperm may contribute to the pathogenesis of asthenozoospermia.

  11. Rejuvenation of Gene Expression Pattern of Aged Human Skin by Broadband Light Treatment: A Pilot Study

    PubMed Central

    Chang, Anne Lynn S; Bitter, Patrick H; Qu, Kun; Lin, Meihong; Rapicavoli, Nicole A; Chang, Howard Y

    2013-01-01

    Studies in model organisms suggest that aged cells can be functionally rejuvenated, but whether this concept applies to human skin is unclear. Here we apply 3′-end sequencing for expression quantification (“3-seq”) to discover the gene expression program associated with human photoaging and intrinsic skin aging (collectively termed “skin aging”), and the impact of broadband light (BBL) treatment. We find that skin aging was associated with a significantly altered expression level of 2,265 coding and noncoding RNAs, of which 1,293 became “rejuvenated” after BBL treatment; i.e., they became more similar to their expression level in youthful skin. Rejuvenated genes (RGs) included several known key regulators of organismal longevity and their proximal long noncoding RNAs. Skin aging is not associated with systematic changes in 3′-end mRNA processing. Hence, BBL treatment can restore gene expression pattern of photoaged and intrinsically aged human skin to resemble young skin. In addition, our data reveal, to our knowledge, a previously unreported set of targets that may lead to new insights into the human skin aging process. PMID:22931923

  12. Modification of carotenoid levels by abscission agents and expression of carotenoid biosynthetic genes in 'valencia' sweet orange.

    PubMed

    Alferez, Fernando; Pozo, Luis V; Rouseff, Russell R; Burns, Jacqueline K

    2013-03-27

    The effect of 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMNP) and ethephon on peel color, flavedo carotenoid gene expression, and carotenoid accumulation was investigated in mature 'Valencia' orange ( Citrus sinensis L. Osbeck) fruit flavedo at three maturation stages. Abscission agent application altered peel color. CMNP was more effective than ethephon in promoting green-to-red (a) and blue-to-yellow (b) color at the middle and late maturation stages and total carotenoid changes at all maturation stages. Altered flow of carotenoid precursors during maturation due to abscission agents was suggested by changes in phytoene desaturase (Pds) and ζ-carotene desaturase (Zds) gene expression. However, each abscission agent affected downstream expression differentially. Ethephon application increased β-carotene hydroxilase (β-Chx) transcript accumulation 12-fold as maturation advanced from the early to middle and late stages. CMNP markedly increased β- and ε-lycopene cyclase (Lcy) transcript accumulation 45- and 15-fold, respectively, at midmaturation. Patterns of carotenoid accumulation in flavedo were supported in part by gene expression changes. CMNP caused greater accumulation of total flavedo carotenoids at all maturation stages when compared with ethephon or controls. In general, CMNP treatment increased total red carotenoids more than ethephon or the control but decreased total yellow carotenoids at each maturation stage. In control fruit flavedo, total red carotenoids increased and yellow carotenoids decreased as maturation progressed. Trends in total red carotenoids during maturation were consistent with measured a values. Changes in carotenoid accumulation and expression patterns in flavedo suggest that regulation of carotenoid accumulation is under transcriptional, translational, and post-translational control.

  13. The yan gene is highly conserved in Drosophila and its expression suggests a complex role throughout development.

    PubMed

    Price, M D; Lai, Z

    1999-04-01

    Competence for cell fate determination and cellular differentiation is under tight control of regulatory genes. Yan, a nuclear target of receptor tyrosine kinase (RTK) signaling, is an E twenty six (ETS) DNA-binding protein that functions as a negative regulator of cell differentiation and proliferation in Drosophila. Most members of RTK signaling pathways are highly conserved through evolution, yet no yan orthologues have been identified to date in vertebrates. To investigate the degree of yan conservation during evolution, we have characterized a yan homologue from a sibling species of D. melanogaster, D. virilis. Our results show that the organization, primary structure and expression pattern of yan are highly conserved. Both genes span over 20 kb and contain four exons with introns at identical positions. The areas with highest amino acid similarity include the Pointed and ETS domain but there are other discrete regions with a high degree of similarity. Phylogenetic analysis reveals that yan's closest relative is the human tel gene, a negative regulator of differentiation in hematopoetic precursors. In both species, Yan is dynamically expressed beginning as early as stage 4/5 and persisting throughout embryogenesis. In third instar larvae, Yan is expressed in and behind the morphogenetic furrow of the eye imaginal disc as well as in the laminar precursor cells of the brain. Ovarian follicle cells also contain Yan protein. Conservation of the structure and expression patterns of yan genes strongly suggests that regulatory mechanisms for their expression are also conserved in these two species.

  14. Differential involvement of Hedgehog signaling in butterfly wing and eyespot development.

    PubMed

    Tong, Xiaoling; Lindemann, Anna; Monteiro, Antónia

    2012-01-01

    Butterfly eyespots may have evolved from the recruitment of pre-existent gene circuits or regulatory networks into novel locations on the wing. Gene expression data suggests one such circuit, the Hedgehog (Hh) signaling pathway and its target gene engrailed (en), was recruited from a role in patterning the anterior-posterior insect wing axis to a role patterning butterfly eyespots. However, while Junonia coenia expresses hh and en both in the posterior compartment of the wing and in eyespot centers, Bicyclus anynana lacks hh eyespot-specific expression. This suggests that Hh signaling may not be functioning in eyespot development in either species or that it functions in J. coenia but not in B. anynana. In order to test these hypotheses, we performed functional tests of Hh signaling in these species. We investigated the effects of Hh protein sequestration during the larval stage on en expression levels, and on wing size and eyespot size in adults. Hh sequestration led to significantly reduced en expression and to significantly smaller wings and eyespots in both species. But while eyespot size in B. anynana was reduced proportionately to wing size, in J. coenia, eyespots were reduced disproportionately, indicating an independent role of Hh signaling in eyespot development in J. coenia. We conclude that while Hh signaling retains a conserved role in promoting wing growth across nymphalid butterflies, it plays an additional role in eyespot development in some, but not all, lineages of nymphalid butterflies. We discuss our findings in the context of alternative evolutionary scenarios that led to the differential expression of hh and other Hh pathway signaling members across nymphalid species.

  15. Characterization and Expression Pattern Analysis of the T-Complex Protein-1 Zeta Subunit in Musca domestica L (Diptera).

    PubMed

    Zhao, Xuejun; Xiu, Jiangfan; Li, Yan; Ma, Huiling; Wu, Jianwei; Wang, Bo; Guo, Guo

    2017-07-01

    Chaperonins, belonging to the T-complex protein-1 (TCP-1) family, assist in the correct folding of nascent and misfolded proteins. It is well-known that in mammals, the zeta subunit of the TCP-1 complex (TCP-1ζ) plays a vital role in the folding and assembly of cytoskeleta proteins. This study reported for the first time the cloning, characterization and expression pattern analysis of the TCP-1ζ from Musca domestica, which was named as MdTCP-1ζ. The MdTCP-1ζ cDNA is 1,803 bp long with a 1,596 bp open reading frame that encodes a protein with 531 bp amino acids. The analysis of the transcriptional profile of MdTCP-1ζ using qRT-PCR revealed relatively high expression in the salivary glands and trachea at the tissues while among the developmental stages. The highest expression was observed only in the eggs suggesting that the MdTCP-1ζ may play a role in embryonic development. The expression of MdTCP-1ζ was also significantly induced after exposure to short-term heat shock and infection by Escherichia coli, Staphylococcus aureus, or Candida albicans. This suggested that MdTCP-1ζ may take part in the immune responses of housefly and perhaps contribute to the protection against cellular injury. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  16. Cheilitis glandularis: immunohistochemical expression of protein water channels (aquaporins) in minor labial salivary glands.

    PubMed

    Nico, M M S; Melo, J N; Lourenço, S V

    2014-03-01

    Cheilitis glandularis (CG) is a rare condition in which thick saliva is secreted from dilated ostia of swollen minor salivary glands from the lips. Aquaporins (AQPs) are membrane proteins that exhibit channel activity specific for water and small solutes. AQPs are essential for corporal homeostasis, and are widely expressed through human tissues. Most AQPs studies are based on renal and nervous pathophysiology; few involve salivary glands. Some previous investigators hypothesized that minor salivary gland structure and function is normal on CG. To study possible salivary synthesis alterations in CG, we compared the expression of AQPs present in minor salivary glands in specimens with CG and controls by using immunohistochemistry.   Seven cases of CG and three normal controls were studied. Intensity and patterns of expression of AQP 1, 2 and 8 differed in CG compared with controls. AQP 4 and 5 (the most important AQP in salivary function) showed identical patterns in CG and controls. Our findings suggest that the expression and arguably, function of some of the AQPs may be altered in CG; consequently, water flow mechanism abnormalities with possible alteration in salivary composition seem to occur. External factors (mainly UV rays) seem to play an important role in CG; nonetheless, our findings suggest that there might be some degree of alteration on water transportation. © 2013 The Authors. Journal of the European Academy of Dermatology and Venereology © 2013 European Academy of Dermatology and Venereology.

  17. Development of a cDNA microarray to identify gene expression of Puccinellia tenuiflora under saline-alkali stress.

    PubMed

    Wang, Yucheng; Yang, Chuanping; Liu, Guifeng; Jiang, Jing

    2007-08-01

    Puccinellia tenuiflora is the main grass species growing in the saline-alkali soil of the Songnen plain in northeastern China, suggesting it has a high tolerance to saline stress. In this study, cDNA microarrays containing 1067 clones of P. tenuiflora were constructed to investigate gene expression patterns resulting from saline-alkali (NaHCO(3)) stress. RNA was extracted from P. tenuiflora treated with 400 mmol L(-1) NaHCO(3) for 6, 12, 24 and 48 h. Untreated (no saline-alkali stress) samples were used as control. A total of 95 transcripts were differentially regulated under the conditions studied, and 38, 35, 25 and 49 genes were differentially expressed with NaHCO(3) stress for 6, 12, 24 and 48h, respectively. Among these, approximately 40% were putative novel or functionally unknown genes, and the remainder function in photosynthesis, cell rescue, defense, transport, metabolism, transcription regulation and protein destination, etc. Analysis of the P. tenuiflora genes demonstrated the complexity of, and differences in, gene expression patterns resulting from different NaHCO(3) stress times. The genetic relationship between P. tenuiflora and other plants was investigated by BlastN analysis. The results showed nearly 20% of the expressed sequence tags from P. tenuiflora shared significant similarities with rice Oryza sativa, an important food crop. The close genetic relationship between these two species suggests that P. tenuiflora may be a good plant model for studying saline-alkali tolerance mechanisms in O. sativa.

  18. Evolutionary stasis in Euphorbiaceae pollen: selection and constraints.

    PubMed

    Matamoro-Vidal, A; Furness, C A; Gouyon, P-H; Wurdack, K J; Albert, B

    2012-06-01

    Although much attention has been paid to the role of stabilizing selection, empirical analyses testing the role of developmental constraints in evolutionary stasis remain rare, particularly for plants. This topic is studied here with a focus on the evolution of a pollen ontogenetic feature, the last points of callose deposition (LPCD) pattern, involved in the determination of an adaptive morphological pollen character (aperture pattern). The LPCD pattern exhibits a low level of evolution in eudicots, as compared to the evolution observed in monocots. Stasis in this pattern might be explained by developmental constraints expressed during male meiosis (microsporogenesis) or by selective pressures expressed through the adaptive role of the aperture pattern. Here, we demonstrate that the LPCD pattern is conserved in Euphorbiaceae s.s. and that this conservatism is primarily due to selective pressures. A phylogenetic association was found between the putative removal of selective pressures on pollen morphology after the origin of inaperturate pollen, and the appearance of variation in microsporogenesis and in the resulting LPCD pattern, suggesting that stasis was due to these selective pressures. However, even in a neutral context, variation in microsporogenesis was biased. This should therefore favour the appearance of some developmental and morphological phenotypes rather than others. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  19. AINTEGUMENTA homolog expression in Gnetum (gymnosperms) and implications for the evolution of ovulate axes in seed plants.

    PubMed

    Yamada, Toshihiro; Hirayama, Yumiko; Imaichi, Ryoko; Kato, Masahiro

    2008-01-01

    The expression of GpANTL1, a homolog of AINTEGUMENTA (ANT) found in the gymnosperm Gnetum parvifolium, was analyzed by RT-PCR and in situ hybridization. GpANTL1 was expressed in the leaf primordia, root tips, and young ovules. In the ovulate axis, expression was detected as four distinct rings around the outer, middle, and inner envelope primordia as well as around the nucellar tip. This pattern of expression is similar to that of ANT in Arabidopsis thaliana. A comparison of the expression of GpANTL1 with that of PtANTL1 in the conifer Pinus thunbergii suggests that the integrated expression of PtANTL1 may have been caused by congenital fusion of the integument, ovuliferous scale, and bract.

  20. Altered in vivo left ventricular torsion and principal strains in hypothyroid rats

    PubMed Central

    Chen, Yong; Somji, Aleefia; Yu, Xin

    2010-01-01

    The twisting and untwisting motions of the left ventricle (LV) lead to efficient ejection of blood during systole and filling of the ventricle during diastole. Global LV mechanical performance is dependent on the contractile properties of cardiac myocytes; however, it is not known how changes in contractile protein expression affect the pattern and timing of LV rotation. At the myofilament level, contractile performance is largely dependent on the isoforms of myosin heavy chain (MHC) that are expressed. Therefore, in this study, we used MRI to examine the in vivo mechanical consequences of altered MHC isoform expression by comparing the contractile properties of hypothyroid rats, which expressed only the slow β-MHC isoform, and euthyroid rats, which predominantly expressed the fast α-MHC isoform. Unloaded shortening velocity (Vo) and apparent rate constants of force development (ktr) were measured in the skinned ventricular myocardium isolated from euthyroid and hypothyroid hearts. Increased expression of β-MHC reduced LV torsion and fiber strain and delayed the development of peak torsion and strain during systole. Depressed in vivo mechanical performance in hypothyroid rats was related to slowed cross-bridge performance, as indicated by significantly slower Vo and ktr, compared with euthyroid rats. Dobutamine infusion in hypothyroid hearts produced smaller increases in torsion and strain and aberrant transmural torsion patterns, suggesting that the myocardial response to β-adrenergic stress is compromised. Thus, increased expression of β-MHC alters the pattern and decreases the magnitude of LV rotation, contributing to reduced mechanical performance during systole, especially in conditions of increased workload. PMID:20729398

  1. Expression of surface markers on the human monocytic leukaemia cell line, THP-1, as indicators for the sensitizing potential of chemicals.

    PubMed

    An, Susun; Kim, Seoyoung; Huh, Yong; Lee, Tae Ryong; Kim, Han-Kon; Park, Kui-Lea; Eun, Hee Chul

    2009-04-01

    Evaluation of skin sensitization potential is an important part of the safety assessment of cosmetic ingredients and topical drugs. Recently, evaluation of changes in surface marker expression induced in dendritic cells (DC) or DC surrogate cell lines following exposure to chemicals represents one approach for in vitro test methods. The study aimed to test the change of expression patterns of surface markers on THP-1 cells by chemicals as a predictive in vitro method for contact sensitization. We investigated the expression of CD54, CD86, CD83, CD80, and CD40 after a 1-day exposure to sensitizers (1-chloro-2,4-dinitrobenzene; 2,4-dinitrofluorobenzene; benzocaine; 5-chloro-2-methyl-4-isothiazolin-3-one; hexyl cinnamic aldehyde; eugenol; nickel sulfate hexahydrate; potassium dichromate; cobalt sulfate; 2-mercaptobenzothiazole; and ammonium tetrachloroplatinate) and non-sensitizers (sodium lauryl sulfate, benzalkonium chloride, lactic acid, salicylic acid, isopropanol, and dimethyl sulphoxide). The test concentrations were 0.1x, 0.5x, and 1x of the 50% inhibitory concentration, and the relative fluorescence intensity was used as an expression indicator. By evaluating the expression patterns of CD54, CD86, and CD40, we could classify the chemicals as sensitizers or non-sensitizers, but CD80 and CD83 showed non-specific patterns of expression. These data suggest that the THP-1 cells are good model for screening contact sensitizers and CD40 could be a useful marker complementary to CD54 and CD86.

  2. Changing the spatial pattern of TFL1 expression reveals its key role in the shoot meristem in controlling Arabidopsis flowering architecture

    PubMed Central

    Baumann, Kim; Venail, Julien; Berbel, Ana; Domenech, Maria Jose; Money, Tracy; Conti, Lucio; Hanzawa, Yoshie; Madueno, Francisco; Bradley, Desmond

    2015-01-01

    Models for the control of above-ground plant architectures show how meristems can be programmed to be either shoots or flowers. Molecular, genetic, transgenic, and mathematical studies have greatly refined these models, suggesting that the phase of the shoot reflects different genes contributing to its repression of flowering, its vegetativeness (‘veg’), before activators promote flower development. Key elements of how the repressor of flowering and shoot meristem gene TFL1 acts have now been tested, by changing its spatiotemporal pattern. It is shown that TFL1 can act outside of its normal expression domain in leaf primordia or floral meristems to repress flower identity. These data show how the timing and spatial pattern of TFL1 expression affect overall plant architecture. This reveals that the underlying pattern of TFL1 interactors is complex and that they may be spatially more widespread than TFL1 itself, which is confined to shoots. However, the data show that while TFL1 and floral genes can both act and compete in the same meristem, it appears that the main shoot meristem is more sensitive to TFL1 rather than floral genes. This spatial analysis therefore reveals how a difference in response helps maintain the ‘veg’ state of the shoot meristem. PMID:26019254

  3. Divergence in Patterns of Leaf Growth Polarity Is Associated with the Expression Divergence of miR396.

    PubMed

    Das Gupta, Mainak; Nath, Utpal

    2015-10-01

    Lateral appendages often show allometric growth with a specific growth polarity along the proximo-distal axis. Studies on leaf growth in model plants have identified a basipetal growth direction with the highest growth rate at the proximal end and progressively lower rates toward the distal end. Although the molecular mechanisms governing such a growth pattern have been studied recently, variation in leaf growth polarity and, therefore, its evolutionary origin remain unknown. By surveying 75 eudicot species, here we report that leaf growth polarity is divergent. Leaf growth in the proximo-distal axis is polar, with more growth arising from either the proximal or the distal end; dispersed with no apparent polarity; or bidirectional, with more growth contributed by the central region and less growth at either end. We further demonstrate that the expression gradient of the miR396-GROWTH-REGULATING FACTOR module strongly correlates with the polarity of leaf growth. Altering the endogenous pattern of miR396 expression in transgenic Arabidopsis thaliana leaves only partially modified the spatial pattern of cell expansion, suggesting that the diverse growth polarities might have evolved via concerted changes in multiple gene regulatory networks. © 2015 American Society of Plant Biologists. All rights reserved.

  4. Diffusion and scaling during early embryonic pattern formation

    PubMed Central

    Gregor, Thomas; Bialek, William; van Steveninck, Rob R. de Ruyter; Tank, David W.; Wieschaus, Eric F.

    2005-01-01

    Development of spatial patterns in multicellular organisms depends on gradients in the concentration of signaling molecules that control gene expression. In the Drosophila embryo, Bicoid (Bcd) morphogen controls cell fate along 70% of the anteroposterior axis but is translated from mRNA localized at the anterior pole. Gradients of Bcd and other morphogens are thought to arise through diffusion, but this basic assumption has never been rigorously tested in living embryos. Furthermore, because diffusion sets a relationship between length and time scales, it is hard to see how patterns of gene expression established by diffusion would scale proportionately as egg size changes during evolution. Here, we show that the motion of inert molecules through the embryo is well described by the diffusion equation on the relevant length and time scales, and that effective diffusion constants are essentially the same in closely related dipteran species with embryos of very different size. Nonetheless, patterns of gene expression in these different species scale with egg length. We show that this scaling can be traced back to scaling of the Bcd gradient itself. Our results, together with constraints imposed by the time scales of development, suggest that the mechanism for scaling is a species-specific adaptation of the Bcd lifetime. PMID:16352710

  5. The multiple functions of plant serine protease inhibitors

    PubMed Central

    Giri, Ashok P; Kaur, Harleen; Baldwin, Ian T

    2011-01-01

    Plant protease inhibitors (PIs) are a diverse group of proteins which have been intensely investigated due to their potential function in protecting plants against herbivorous insects by inhibiting digestive proteases. Although this mechanism has been well documented for a number of single PIs and their target enzymes, whether this mechanism protects plants in nature remains unclear. Moreover, many plants express a number of different PIs and it was unknown if these proteins work synergistically as defenses or if they also have other functions. We recently identified four serine PIs (SPI) of Solanum nigrum and demonstrated that they differ substantially in substrate specificity, accumulation patterns, and their effect against different natural herbivorous insects in field- and glasshouse experiments. These differences suggest that SPIs have at least partially diversified to provide protection against different attackers. Although we could not detect effects on plant development or growth when silencing SPIs, gene- and tissue-specific expression patterns suggest multiple functions in generative tissues, including a possible involvement in development. PMID:22004998

  6. Artemisinin resistance in Plasmodium falciparum is associated with an altered temporal pattern of transcription

    PubMed Central

    2011-01-01

    Background Artemisinin resistance in Plasmodium falciparum malaria has emerged in Western Cambodia. This is a major threat to global plans to control and eliminate malaria as the artemisinins are a key component of antimalarial treatment throughout the world. To identify key features associated with the delayed parasite clearance phenotype, we employed DNA microarrays to profile the physiological gene expression pattern of the resistant isolates. Results In the ring and trophozoite stages, we observed reduced expression of many basic metabolic and cellular pathways which suggests a slower growth and maturation of these parasites during the first half of the asexual intraerythrocytic developmental cycle (IDC). In the schizont stage, there is an increased expression of essentially all functionalities associated with protein metabolism which indicates the prolonged and thus increased capacity of protein synthesis during the second half of the resistant parasite IDC. This modulation of the P. falciparum intraerythrocytic transcriptome may result from differential expression of regulatory proteins such as transcription factors or chromatin remodeling associated proteins. In addition, there is a unique and uniform copy number variation pattern in the Cambodian parasites which may represent an underlying genetic background that contributes to the resistance phenotype. Conclusions The decreased metabolic activities in the ring stages are consistent with previous suggestions of higher resilience of the early developmental stages to artemisinin. Moreover, the increased capacity of protein synthesis and protein turnover in the schizont stage may contribute to artemisinin resistance by counteracting the protein damage caused by the oxidative stress and/or protein alkylation effect of this drug. This study reports the first global transcriptional survey of artemisinin resistant parasites and provides insight to the complexities of the molecular basis of pathogens with drug resistance phenotypes in vivo. PMID:21810278

  7. Multiple PAR and E4BP4 bZIP transcription factors in zebrafish: diverse spatial and temporal expression patterns.

    PubMed

    Ben-Moshe, Zohar; Vatine, Gad; Alon, Shahar; Tovin, Adi; Mracek, Philipp; Foulkes, Nicholas S; Gothilf, Yoav

    2010-09-01

    Circadian rhythms of physiology and behavior are generated by an autonomous circadian oscillator that is synchronized daily with the environment, mainly by light input. The PAR subfamily of transcriptional activators and the related E4BP4 repressor belonging to the basic leucine zipper (bZIP) family are clock-controlled genes that are suggested to mediate downstream circadian clock processes and to feedback onto the core oscillator. Here, the authors report the characterization of these genes in the zebrafish, an increasingly important model in the field of chronobiology. Five novel PAR and six novel e4bp4 zebrafish homolog genes were identified using bioinformatic tools and their coding sequences were cloned. Based on their evolutionary relationships, these genes were annotated as ztef2, zhlf1 and zhlf2, zdbp1 and zdbp2, and ze4bp4-1 to -6. The spatial and temporal mRNA expression pattern of each of these factors was characterized in zebrafish embryos in the context of a functional circadian clock and regulation by light. Nine of the factors exhibited augmented and rhythmic expression in the pineal gland, a central clock organ in zebrafish. Moreover, these genes were found to be regulated, to variable extents, by the circadian clock and/or by light. Differential expression patterns of multiple paralogs in zebrafish suggest multiple roles for these factors within the vertebrate circadian clock. This study, in the genetically accessible zebrafish model, lays the foundation for further research regarding the involvement and specific roles of PAR and E4BP4 transcription factors in the vertebrate circadian clock mechanism.

  8. Bisphenol A disrupts the temporal pattern of histofunctional changes in the female reproductive tract of Caiman latirostris.

    PubMed

    Galoppo, Germán H; Canesini, Guillermina; Tavalieri, Yamil E; Stoker, Cora; Kass, Laura; Luque, Enrique H; Muñoz-de-Toro, Mónica

    2017-12-01

    Recently, we have described the ontogeny of histofunctional differentiation changes in the oviduct of Caiman latirostris. The expression of estrogen receptor alpha and progesterone receptor shows that the caiman oviduct could be a target of the action of xenoestrogens such as the widely environmentally present Bisphenol A (BPA), early in life. The aims of this study were: to complement oviduct characterization by establishing the ontogenetic changes in androgen receptor (AR) expression and assessing the effects of early postnatal exposure to 17-β-estradiol (E2) or BPA on the histofunctional features of the oviduct. AR was expressed in all the stages studied. The spatial pattern of AR immunostaining changed from neonatal to juvenile caimans. In the luminal epithelium, changes were at the subcellular level, from cytoplasmic to nuclear. In the subepithelium, although both cytoplasmic and nuclear AR expression was observed, changes were mainly at tissue level, from the subepithelial compartment to the outer muscular layer. The oviduct was highly sensitive to E2 and BPA at the early postnatal developmental stage. E2- and BPA-exposed caimans showed increased luminal epithelial height and higher proliferative activity. Changes in histomorphological features (measured by a scoring system), steroid hormone receptors, collagen remodeling and muscle-associated proteins suggest a precocious oviduct histofunctional differentiation in E2- and BPA-exposed caimans. The modification of the temporal pattern of oviductal biomarkers suggests that organizational changes could impair C. latirostris reproductive health later in life. The alterations in the caiman female reproductive tract exposed to BPA highlight the importance of preserving aquatic environments from plastic pollution. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Cryptochromes and Hormone Signal Transduction under Near-Zero Magnetic Fields: New Clues to Magnetic Field Effects in a Rice Planthopper.

    PubMed

    Wan, Gui-Jun; Wang, Wen-Jing; Xu, Jing-Jing; Yang, Quan-Feng; Dai, Ming-Jiang; Zhang, Feng-Jiao; Sword, Gregory A; Pan, Wei-Dong; Chen, Fa-Jun

    2015-01-01

    Although there are considerable reports of magnetic field effects (MFE) on organisms, very little is known so far about the MFE-related signal transduction pathways. Here we establish a manipulative near-zero magnetic field (NZMF) to investigate the potential signal transduction pathways involved in MFE. We show that exposure of migratory white-backed planthopper, Sogatella furcifera, to the NZMF results in delayed egg and nymphal development, increased frequency of brachypterous females, and reduced longevity of macropterous female adults. To understand the changes in gene expression underlying these phenotypes, we examined the temporal patterns of gene expression of (i) CRY1 and CRY2 as putative magnetosensors, (ii) JHAMT, FAMeT and JHEH in the juvenile hormone pathway, (iii) CYP307A1 in the ecdysone pathway, and (iv) reproduction-related Vitellogenin (Vg). The significantly altered gene expression of CRY1 and CRY2 under the NZMF suggest their developmental stage-specific patterns and potential upstream location in magnetic response. Gene expression patterns of JHAMT, JHEH and CYP307A1 were consistent with the NZMF-triggered delay in nymphal development, higher proportion of brachypterous female adults, and the shortened longevity of macropterous female adults, which show feasible links between hormone signal transduction and phenotypic MFE. By conducting manipulative NZMF experiments, our study suggests an important role of the geomagnetic field (GMF) in modulating development and physiology of insects, provides new insights into the complexity of MFE-magnetosensitivity interactions, and represents an initial but crucial step forward in understanding the molecular basis of cryptochromes and hormone signal transduction involved in MFE.

  10. Rice No Pollen 1 (NP1) is required for anther cuticle formation and pollen exine patterning.

    PubMed

    Liu, Ze; Lin, Sen; Shi, Jianxin; Yu, Jing; Zhu, Lu; Yang, Xiujuan; Zhang, Dabing; Liang, Wanqi

    2017-07-01

    Angiosperm male reproductive organs (anthers and pollen grains) have complex and interesting morphological features, but mechanisms that underlie their patterning are poorly understood. Here we report the isolation and characterization of a male sterile mutant of No Pollen 1 (NP1) in rice (Oryza sativa). The np1-4 mutant exhibited smaller anthers with a smooth cuticle surface, abnormal Ubisch bodies, and aborted pollen grains covered with irregular exine. Wild-type exine has two continuous layers; but np1-4 exine showed a discontinuous structure with large granules of varying size. Chemical analysis revealed reduction in most of the cutin monomers in np1-4 anthers, and less cuticular wax. Map-based cloning suggested that NP1 encodes a putative glucose-methanol-choline oxidoreductase; and expression analyses found NP1 preferentially expressed in the tapetal layer from stage 8 to stage 10 of anther development. Additionally, the expression of several genes involved in biosynthesis and in the transport of lipid monomers of sporopollenin and cutin was decreased in np1-4 mutant anthers. Taken together, these observations suggest that NP1 is required for anther cuticle formation, and for patterning of Ubisch bodies and the exine. We propose that products of NP1 are likely important metabolites in the development of Ubisch bodies and pollen exine, necessary for polymerization, assembly, or both. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  11. Somatic isoform of angiotensin I-converting enzyme in the pathology of testicular germ cell tumors.

    PubMed

    Franke, F E; Pauls, K; Kerkman, L; Steger, K; Klonisch, T; Metzger, R; Alhenc-Gelas, F; Burkhardt, E; Bergmann, M; Danilov, S M

    2000-12-01

    Retained fetal expression of angiotensin I-converting enzyme (ACE, CD143) has recently been shown in intratubular germ cell neoplasms (IGCN) and invasive germ cell tumors (GCT), suggesting the somatic isoform (sACE) as a characteristic component of neoplastic germ cells. We analyzed the distribution of sACE in 159 testicular GCT, including 87 IGCN. sACE protein was determined by immunohistochemistry (MAb CG2) on routinely formalin-fixed and paraffin-embedded tissue sections, supplemented by mRNA expression analysis using in situ hybridization. These data were compared with those obtained by germ cell/placental alkaline phosphatases (PIAP; MAbs PL8-F6 and 8A9) employing an uniform score system for the evaluation of immunoreactivity (IRS; possible values from 0 to 12). Expression of sACE and PIAP was found in all 87 analyzed IGCN (IRS > 4, median IRS of 12). Heterogeneous staining patterns were not related to the type of adjacent GCT but correlated with low expression in adjacent seminomas (P =.032 for sACE; P =.005 for PIAP). Both sACE and PIAP often showed a decreased and more heterogeneous but still moderate expression in 91 classic seminomas (median IRS of 8) and were completely absent in tumor cells of spermatocytic seminomas. Despite all similarities, we found sACE and PIAP differently regulated during GCT progression. This was documented by a well-preserved expression of either sACE or PIAP or both in all classic seminomas, low PIAP immunoreactivity in metastasis of seminomas, and completely diverging expression patterns in nonseminomatous GCT. Our findings underline the close molecular relationship between IGCN and seminoma, and suggest sACE as an appropriate marker for seminomatous differentiated tumors. HUM PATHOL 31:1466-1476. Copyright 2000 by W.B. Saunders Company

  12. Gene expression profiling reveals distinct molecular signatures associated with the rupture of intracranial aneurysm.

    PubMed

    Nakaoka, Hirofumi; Tajima, Atsushi; Yoneyama, Taku; Hosomichi, Kazuyoshi; Kasuya, Hidetoshi; Mizutani, Tohru; Inoue, Ituro

    2014-08-01

    The rupture of intracranial aneurysm (IA) causes subarachnoid hemorrhage associated with high morbidity and mortality. We compared gene expression profiles in aneurysmal domes between unruptured IAs and ruptured IAs (RIAs) to elucidate biological mechanisms predisposing to the rupture of IA. We determined gene expression levels of 8 RIAs, 5 unruptured IAs, and 10 superficial temporal arteries with the Agilent microarrays. To explore biological heterogeneity of IAs, we classified the samples into subgroups showing similar gene expression patterns, using clustering methods. The clustering analysis identified 4 groups: superficial temporal arteries and unruptured IAs were aggregated into their own clusters, whereas RIAs segregated into 2 distinct subgroups (early and late RIAs). Comparing gene expression levels between early RIAs and unruptured IAs, we identified 430 upregulated and 617 downregulated genes in early RIAs. The upregulated genes were associated with inflammatory and immune responses and phagocytosis including S100/calgranulin genes (S100A8, S100A9, and S100A12). The downregulated genes suggest mechanical weakness of aneurysm walls. The expressions of Krüppel-like family of transcription factors (KLF2, KLF12, and KLF15), which were anti-inflammatory regulators, and CDKN2A, which was located on chromosome 9p21 that was the most consistently replicated locus in genome-wide association studies of IA, were also downregulated. We demonstrate that gene expression patterns of RIAs were different according to the age of patients. The results suggest that macrophage-mediated inflammation is a key biological pathway for IA rupture. The identified genes can be good candidates for molecular markers of rupture-prone IAs and therapeutic targets. © 2014 American Heart Association, Inc.

  13. Investigating pianists' individuality in the performance of five timbral nuances through patterns of articulation, touch, dynamics, and pedaling

    PubMed Central

    Bernays, Michel; Traube, Caroline

    2014-01-01

    Timbre is an essential expressive feature in piano performance. Concert pianists use a vast palette of timbral nuances to color their performances at the microstructural level. Although timbre is generally envisioned in the pianistic community as an abstract concept carried through an imaged vocabulary, performers may share some common strategies of timbral expression in piano performance. Yet there may remain further leeway for idiosyncratic processes in the production of piano timbre nuances. In this study, we examined the patterns of timbral expression in performances by four expert pianists. Each pianist performed four short pieces, each with five different timbral intentions (bright, dark, dry, round, and velvety). The performances were recorded with the high-accuracy Bösendorfer CEUS system. Fine-grained performance features of dynamics, touch, articulation and pedaling were extracted. Reduced PCA performance spaces and descriptive performance portraits confirmed that pianists exhibited unique, specific profiles for different timbral intentions, derived from underlying traits of general individuality, while sharing some broad commonalities of dynamics and articulation for each timbral intention. These results confirm that pianists' abstract notions of timbre correspond to reliable patterns of performance technique. Furthermore, these effects suggest that pianists can express individual styles while complying with specific timbral intentions. PMID:24624099

  14. Expression-Linked Patterns of Codon Usage, Amino Acid Frequency, and Protein Length in the Basally Branching Arthropod Parasteatoda tepidariorum

    PubMed Central

    Whittle, Carrie A.; Extavour, Cassandra G.

    2016-01-01

    Abstract Spiders belong to the Chelicerata, the most basally branching arthropod subphylum. The common house spider, Parasteatoda tepidariorum, is an emerging model and provides a valuable system to address key questions in molecular evolution in an arthropod system that is distinct from traditionally studied insects. Here, we provide evidence suggesting that codon usage, amino acid frequency, and protein lengths are each influenced by expression-mediated selection in P. tepidariorum. First, highly expressed genes exhibited preferential usage of T3 codons in this spider, suggestive of selection. Second, genes with elevated transcription favored amino acids with low or intermediate size/complexity (S/C) scores (glycine and alanine) and disfavored those with large S/C scores (such as cysteine), consistent with the minimization of biosynthesis costs of abundant proteins. Third, we observed a negative correlation between expression level and coding sequence length. Together, we conclude that protein-coding genes exhibit signals of expression-related selection in this emerging, noninsect, arthropod model. PMID:27017527

  15. Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain

    PubMed Central

    Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

    2013-01-01

    An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain. PMID:23440889

  16. Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain.

    PubMed

    Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

    2013-01-01

    An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain.

  17. Systems analysis of cis-regulatory motifs in C4 photosynthesis genes using maize and rice leaf transcriptomic data during a process of de-etiolation

    PubMed Central

    Xu, Jiajia; Bräutigam, Andrea; Weber, Andreas P. M.; Zhu, Xin-Guang

    2016-01-01

    Identification of potential cis-regulatory motifs controlling the development of C4 photosynthesis is a major focus of current research. In this study, we used time-series RNA-seq data collected from etiolated maize and rice leaf tissues sampled during a de-etiolation process to systematically characterize the expression patterns of C4-related genes and to further identify potential cis elements in five different genomic regions (i.e. promoter, 5′UTR, 3′UTR, intron, and coding sequence) of C4 orthologous genes. The results demonstrate that although most of the C4 genes show similar expression patterns, a number of them, including chloroplast dicarboxylate transporter 1, aspartate aminotransferase, and triose phosphate transporter, show shifted expression patterns compared with their C3 counterparts. A number of conserved short DNA motifs between maize C4 genes and their rice orthologous genes were identified not only in the promoter, 5′UTR, 3′UTR, and coding sequences, but also in the introns of core C4 genes. We also identified cis-regulatory motifs that exist in maize C4 genes and also in genes showing similar expression patterns as maize C4 genes but that do not exist in rice C3 orthologs, suggesting a possible recruitment of pre-existing cis-elements from genes unrelated to C4 photosynthesis into C4 photosynthesis genes during C4 evolution. PMID:27436282

  18. Tissue and cell-type co-expression networks of transcription factors and wood component genes in Populus trichocarpa.

    PubMed

    Shi, Rui; Wang, Jack P; Lin, Ying-Chung; Li, Quanzi; Sun, Ying-Hsuan; Chen, Hao; Sederoff, Ronald R; Chiang, Vincent L

    2017-05-01

    Co-expression networks based on transcriptomes of Populus trichocarpa major tissues and specific cell types suggest redundant control of cell wall component biosynthetic genes by transcription factors in wood formation. We analyzed the transcriptomes of five tissues (xylem, phloem, shoot, leaf, and root) and two wood forming cell types (fiber and vessel) of Populus trichocarpa to assemble gene co-expression subnetworks associated with wood formation. We identified 165 transcription factors (TFs) that showed xylem-, fiber-, and vessel-specific expression. Of these 165 TFs, 101 co-expressed (correlation coefficient, r > 0.7) with the 45 secondary cell wall cellulose, hemicellulose, and lignin biosynthetic genes. Each cell wall component gene co-expressed on average with 34 TFs, suggesting redundant control of the cell wall component gene expression. Co-expression analysis showed that the 101 TFs and the 45 cell wall component genes each has two distinct groups (groups 1 and 2), based on their co-expression patterns. The group 1 TFs (44 members) are predominantly xylem and fiber specific, and are all highly positively co-expressed with the group 1 cell wall component genes (30 members), suggesting their roles as major wood formation regulators. Group 1 TFs include a lateral organ boundary domain gene (LBD) that has the highest number of positively correlated cell wall component genes (36) and TFs (47). The group 2 TFs have 57 members, including 14 vessel-specific TFs, and are generally less correlated with the cell wall component genes. An exception is a vessel-specific basic helix-loop-helix (bHLH) gene that negatively correlates with 20 cell wall component genes, and may function as a key transcriptional suppressor. The co-expression networks revealed here suggest a well-structured transcriptional homeostasis for cell wall component biosynthesis during wood formation.

  19. Identifying spatially similar gene expression patterns in early stage fruit fly embryo images: binary feature versus invariant moment digital representations

    PubMed Central

    Gurunathan, Rajalakshmi; Van Emden, Bernard; Panchanathan, Sethuraman; Kumar, Sudhir

    2004-01-01

    Background Modern developmental biology relies heavily on the analysis of embryonic gene expression patterns. Investigators manually inspect hundreds or thousands of expression patterns to identify those that are spatially similar and to ultimately infer potential gene interactions. However, the rapid accumulation of gene expression pattern data over the last two decades, facilitated by high-throughput techniques, has produced a need for the development of efficient approaches for direct comparison of images, rather than their textual descriptions, to identify spatially similar expression patterns. Results The effectiveness of the Binary Feature Vector (BFV) and Invariant Moment Vector (IMV) based digital representations of the gene expression patterns in finding biologically meaningful patterns was compared for a small (226 images) and a large (1819 images) dataset. For each dataset, an ordered list of images, with respect to a query image, was generated to identify overlapping and similar gene expression patterns, in a manner comparable to what a developmental biologist might do. The results showed that the BFV representation consistently outperforms the IMV representation in finding biologically meaningful matches when spatial overlap of the gene expression pattern and the genes involved are considered. Furthermore, we explored the value of conducting image-content based searches in a dataset where individual expression components (or domains) of multi-domain expression patterns were also included separately. We found that this technique improves performance of both IMV and BFV based searches. Conclusions We conclude that the BFV representation consistently produces a more extensive and better list of biologically useful patterns than the IMV representation. The high quality of results obtained scales well as the search database becomes larger, which encourages efforts to build automated image query and retrieval systems for spatial gene expression patterns. PMID:15603586

  20. miRNA-21 is developmentally regulated in mouse brain and is co-expressed with SOX2 in glioma

    PubMed Central

    2012-01-01

    Background MicroRNAs (miRNAs) and their role during tumor development have been studied in great detail during the last decade, albeit their expression pattern and regulation during normal development are however not so well established. Previous studies have shown that miRNAs are differentially expressed in solid human tumors. Platelet-derived growth factor (PDGF) signaling is known to be involved in normal development of the brain as well as in malignant primary brain tumors, gliomas, but the complete mechanism is still lacking. We decided to investigate the expression of the oncogenic miR-21 during normal mouse development and glioma, focusing on PDGF signaling as a potential regulator of miR-21. Methods We generated mouse glioma using the RCAS/tv-a system for driving PDGF-BB expression in a cell-specific manner. Expression of miR-21 in mouse cell cultures and mouse brain were assessed using Northern blot analysis and in situ hybridization. Immunohistochemistry and Western blot analysis were used to investigate SOX2 expression. LNA-modified siRNA was used for irreversible depletion of miR-21. For inhibition of PDGF signaling Gleevec (imatinib mesylate), Rapamycin and U0126, as well as siRNA were used. Statistical significance was calculated using double-sided unpaired Student´s t-test. Results We identified miR-21 to be highly expressed during embryonic and newborn brain development followed by a gradual decrease until undetectable at postnatal day 7 (P7), this pattern correlated with SOX2 expression. Furthermore, miR-21 and SOX2 showed up-regulation and overlapping expression pattern in RCAS/tv-a generated mouse brain tumor specimens. Upon irreversible depletion of miR-21 the expression of SOX2 was strongly diminished in both mouse primary glioma cultures and human glioma cell lines. Interestingly, in normal fibroblasts the expression of miR-21 was induced by PDGF-BB, and inhibition of PDGF signaling in mouse glioma primary cultures resulted in suppression of miR-21 suggesting that miR-21 is indeed regulated by PDGF signaling. Conclusions Our data show that miR-21 and SOX2 are tightly regulated already during embryogenesis and define a distinct population with putative tumor cell of origin characteristics. Furthermore, we believe that miR-21 is a mediator of PDGF-driven brain tumors, which suggests miR-21 as a promising target for treatment of glioma. PMID:22931209

  1. Cis-regulatory underpinnings of human GLI3 expression in embryonic craniofacial structures and internal organs.

    PubMed

    Abbasi, Amir A; Minhas, Rashid; Schmidt, Ansgar; Koch, Sabine; Grzeschik, Karl-Heinz

    2013-10-01

    The zinc finger transcription factor Gli3 is an important mediator of Sonic hedgehog (Shh) signaling. During early embryonic development Gli3 participates in patterning and growth of the central nervous system, face, skeleton, limb, tooth and gut. Precise regulation of the temporal and spatial expression of Gli3 is crucial for the proper specification of these structures in mammals and other vertebrates. Previously we reported a set of human intronic cis-regulators controlling almost the entire known repertoire of endogenous Gli3 expression in mouse neural tube and limbs. However, the genetic underpinning of GLI3 expression in other embryonic domains such as craniofacial structures and internal organs remain elusive. Here we demonstrate in a transgenic mice assay the potential of a subset of human/fish conserved non-coding sequences (CNEs) residing within GLI3 intronic intervals to induce reporter gene expression at known regions of endogenous Gli3 transcription in embryonic domains other than central nervous system (CNS) and limbs. Highly specific reporter expression was observed in craniofacial structures, eye, gut, and genitourinary system. Moreover, the comparison of expression patterns directed by these intronic cis-acting regulatory elements in mouse and zebrafish embryos suggests that in accordance with sequence conservation, the target site specificity of a subset of these elements remains preserved among these two lineages. Taken together with our recent investigations, it is proposed here that during vertebrate evolution the Gli3 expression control acquired multiple, independently acting, intronic enhancers for spatiotemporal patterning of CNS, limbs, craniofacial structures and internal organs. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  2. Expression patterns of miR-146a and miR-146b in mastitis infected dairy cattle.

    PubMed

    Wang, Xing Ping; Luoreng, Zhuo Ma; Zan, Lin Sen; Raza, Sayed Haidar Abbas; Li, Feng; Li, Na; Liu, Shuan

    2016-10-01

    This study reports a significant up-regulation of bta-miR-146a and bta-miR-146b expression levels in bovine mammary tissues infected with subclinical, clinical and experimental mastitis. Potential target genes are involved in multiple immunological pathways. These results suggest a regulatory function of both miRNAs for the bovine inflammatory response in mammary tissue. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. A Role for Caenorhabditis elegans Importin IMA-2 in Germ Line and Embryonic Mitosis

    PubMed Central

    Geles, Kenneth G.; Johnson, Jeffrey J.; Jong, Sena; Adam, Stephen A.

    2002-01-01

    The importin α family of nuclear-cytoplasmic transport factors mediates the nuclear localization of proteins containing classical nuclear localization signals. Metazoan animals express multiple importin α proteins, suggesting their possible roles in cell differentiation and development. Adult Caenorhabditis elegans hermaphrodites express three importin α proteins, IMA-1, IMA-2, and IMA-3, each with a distinct expression and localization pattern. IMA-2 was expressed exclusively in germ line cells from the early embryonic through adult stages. The protein has a dynamic pattern of localization dependent on the stage of the cell cycle. In interphase germ cells and embryonic cells, IMA-2 is cytoplasmic and nuclear envelope associated, whereas in developing oocytes, the protein is cytoplasmic and intranuclear. During mitosis in germ line cells and embryos, IMA-2 surrounded the condensed chromosomes but was not directly associated with the mitotic spindle. The timing of IMA-2 nuclear localization suggested that the protein surrounded the chromosomes after fenestration of the nuclear envelope in prometaphase. Depletion of IMA-2 by RNA-mediated gene interference (RNAi) resulted in embryonic lethality and a terminal aneuploid phenotype. ima-2(RNAi) embryos have severe defects in nuclear envelope formation, accumulating nucleoporins and lamin in the cytoplasm. We conclude that IMA-2 is required for proper chromosome dynamics in germ line and early embryonic mitosis and is involved in nuclear envelope assembly at the conclusion of mitosis. PMID:12221121

  4. Expression and Interaction Analysis among Saffron ALDHs and Crocetin Dialdehyde.

    PubMed

    Gómez-Gómez, Lourdes; Pacios, Luis F; Diaz-Perales, Araceli; Garrido-Arandia, María; Argandoña, Javier; Rubio-Moraga, Ángela; Ahrazem, Oussama

    2018-05-09

    In saffron, the cleavage of zeaxanthin by means of CCD2 generates crocetin dialdehyde, which is then converted by an unknown aldehyde dehydrogenase to crocetin. A proteome from saffron stigma was released recently and, based on the expression pattern and correlation analyses, five aldehyde dehydrogenases (ALDHs) were suggested as possible candidates to generate crocetin from crocetin dialdehydes. We selected four of the suggested ALDHs and analyzed their expression in different tissues, determined their activity over crocetin dialdehyde, and performed structure modeling and docking calculation to find their specificity. All the ALDHs were able to convert crocetin dialdehyde to crocetin, but two of them were stigma tissue-specific. Structure modeling and docking analyses revealed that, in all cases, there was a high coverage of residues in the models. All of them showed a very close conformation, indicated by the low root-mean-square deviation (RMSD) values of backbone atoms, which indicate a high similarity among them. However, low affinity between the enzymes and the crocetin dialdehyde were observed. Phylogenetic analysis and binding affinities calculations, including some ALDHs from Gardenia jasmonoides , Crocus sieberi , and Buddleja species that accumulate crocetin and Bixa orellana synthetizing the apocarotenoid bixin selected on their expression pattern matching with the accumulation of either crocins or bixin, pointed out that family 2 C4 members might be involved in the conversion of crocetin dialdehyde to crocetin with high specificity.

  5. The paired domain-containing nuclear factor pax[b] is expressed in specific commissural interneurons in zebrafish embryos.

    PubMed

    Mikkola, I; Fjose, A; Kuwada, J Y; Wilson, S; Guddal, P H; Krauss, S

    1992-10-01

    The zebrafish paired box (Pax) genes are expressed in the early neural tube and are thought to be transcription factors that regulate the differentiation of cells in the central nervous system (CNS). The protein product of one of these Pax genes, pax[b], is detectable as a nuclear antigen in all the regions of the embryo that transcribe the gene including the posterior midbrain, the nephritic primordium, the Wolffian duct, the optic stalk, and, in specific neurons, in the hindbrain and spinal cord. The timing and pattern of axonal outgrowth by the early pax[b]-positive neurons suggest that they are the commissural secondary ascending (CoSA) interneurons in the spinal cord; the primary commissural interneurons (MiD2c and MiD3c) in hindbrain rhombomeres mi2 and mi3; and a previously unclassified set of commissural interneurons that we termed the commissural caudalrhombomere ascending (CoCaA) interneurons in the caudal hindbrain. In contrast, the Mauthner interneurons do not express pax[b] early in development. Shortly after the appearance of the first pax[b]-positive interneurons, additional nuclei adjacent to the first pax[b]-positive interneurons become pax[b] positive. This pattern of expression suggests that the pax[b] protein may be involved in determining the identity of specific commissural interneurons.

  6. Petal-specific subfunctionalization of an APETALA3 paralog in the Ranunculales and its implications for petal evolution.

    PubMed

    Sharma, Bharti; Guo, Chunce; Kong, Hongzhi; Kramer, Elena M

    2011-08-01

    • The petals of the lower eudicot family Ranunculaceae are thought to have been derived many times independently from stamens. However, investigation of the genetic basis of their identity has suggested an alternative hypothesis: that they share a commonly inherited petal identity program. This theory is based on the fact that an ancient paralogous lineage of APETALA3 (AP3) in the Ranunculaceae appears to have a conserved, petal-specific expression pattern. • Here, we have used a combination of approaches, including RNAi, comparative gene expression and molecular evolutionary studies, to understand the function of this petal-specific AP3 lineage. • Functional analysis of the Aquilegia locus AqAP3-3 has demonstrated that the paralog is required for petal identity with little contribution to the identity of the other floral organs. Expanded expression studies and analyses of molecular evolutionary patterns provide further evidence that orthologs of AqAP3-3 are primarily expressed in petals and are under higher purifying selection across the family than the other AP3 paralogs. • Taken together, these findings suggest that the AqAP3-3 lineage underwent progressive subfunctionalization within the order Ranunculales, ultimately yielding a specific role in petal identity that has probably been conserved, in stark contrast with the multiple independent origins predicted by botanical theories. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  7. Paradoxical expression of E-cadherin in prostatic bone metastases.

    PubMed

    Bryden, A A; Freemont, A J; Clarke, N W; George, N J

    1999-12-01

    To determine whether the calcium-dependent cell adhesion molecule E-cadherin is expressed in metastatic deposits of prostate cancer in bone. Ten bone biopsies containing metastatic deposits of untreated prostatic cancer were obtained and immunohistochemically stained for E-cadherin with the monoclonal antibody HECD-1, using the streptavidin-biotin complex technique. Benign prostatic tissue was used as the control. Of the 10 specimens, nine showed positive expression of E-cadherin, graded as strong in four. E-cadherin expression was strongest in well-differentiated metastases and decreased with increasing tumour grade. In some specimens there were mixed patterns of expression. E-cadherin is strongly expressed in prostatic bone metastases and the degree of expression appears to reflect local tumour grade. This suggests that loss of E-cadherin expression may not be critically linked to metastatic potential.

  8. Developmental and Individual Differences in the Neural Processing of Dynamic Expressions of Pain and Anger

    PubMed Central

    Missana, Manuela; Grigutsch, Maren; Grossmann, Tobias

    2014-01-01

    We examined the processing of facial expressions of pain and anger in 8-month-old infants and adults by measuring event-related brain potentials (ERPs) and frontal EEG alpha asymmetry. The ERP results revealed that while adults showed a late positive potential (LPP) to emotional expressions that was enhanced to pain expressions, reflecting increased evaluation and emotional arousal to pain expressions, infants showed a negative component (Nc) to emotional expressions that was enhanced to angry expressions, reflecting increased allocation of attention to angry faces. Moreover, infants and adults showed opposite patterns in their frontal asymmetry responses to pain and anger, suggesting developmental differences in the motivational processes engendered by these facial expressions. These findings are discussed in the light of associated individual differences in infant temperament and adult dispositional empathy. PMID:24705497

  9. Identification of General Patterns of Sex-Biased Expression in Daphnia, a Genus with Environmental Sex Determination

    PubMed Central

    Molinier, Cécile; Reisser, Céline M.O.; Fields, Peter; Ségard, Adeline; Galimov, Yan; Haag, Christoph R.

    2018-01-01

    Daphnia reproduce by cyclic-parthenogenesis, where phases of asexual reproduction are intermitted by sexual production of diapause stages. This life cycle, together with environmental sex determination, allow the comparison of gene expression between genetically identical males and females. We investigated gene expression differences between males and females in four genotypes of Daphnia magna and compared the results with published data on sex-biased gene expression in two other Daphnia species, each representing one of the major phylogenetic clades within the genus. We found that 42% of all annotated genes showed sex-biased expression in D. magna. This proportion is similar both to estimates from other Daphnia species as well as from species with genetic sex determination, suggesting that sex-biased expression is not reduced under environmental sex determination. Among 7453 single copy, one-to-one orthologs in the three Daphnia species, 707 consistently showed sex-biased expression and 675 were biased in the same direction in all three species. Hence these genes represent a core-set of genes with consistent sex-differential expression in the genus. A functional analysis identified that several of them are involved in known sex determination pathways. Moreover, 75% were overexpressed in females rather than males, a pattern that appears to be a general feature of sex-biased gene expression in Daphnia. PMID:29535148

  10. Identification of General Patterns of Sex-Biased Expression in Daphnia, a Genus with Environmental Sex Determination.

    PubMed

    Molinier, Cécile; Reisser, Céline M O; Fields, Peter; Ségard, Adeline; Galimov, Yan; Haag, Christoph R

    2018-05-04

    Daphnia reproduce by cyclic-parthenogenesis, where phases of asexual reproduction are intermitted by sexual production of diapause stages. This life cycle, together with environmental sex determination, allow the comparison of gene expression between genetically identical males and females. We investigated gene expression differences between males and females in four genotypes of Daphnia magna and compared the results with published data on sex-biased gene expression in two other Daphnia species, each representing one of the major phylogenetic clades within the genus. We found that 42% of all annotated genes showed sex-biased expression in D. magna This proportion is similar both to estimates from other Daphnia species as well as from species with genetic sex determination, suggesting that sex-biased expression is not reduced under environmental sex determination. Among 7453 single copy, one-to-one orthologs in the three Daphnia species, 707 consistently showed sex-biased expression and 675 were biased in the same direction in all three species. Hence these genes represent a core-set of genes with consistent sex-differential expression in the genus. A functional analysis identified that several of them are involved in known sex determination pathways. Moreover, 75% were overexpressed in females rather than males, a pattern that appears to be a general feature of sex-biased gene expression in Daphnia . Copyright © 2018 Molinier et al.

  11. Long non-coding RNA expression profile in cervical cancer tissues

    PubMed Central

    Zhu, Hua; Chen, Xiangjian; Hu, Yan; Shi, Zhengzheng; Zhou, Qing; Zheng, Jingjie; Wang, Yifeng

    2017-01-01

    Cervical cancer (CC), one of the most common types of cancer of the female population, presents an enormous challenge in diagnosis and treatment. Long non-coding (lnc)RNAs, non-coding (nc)RNAs with length >200 nucleotides, have been identified to be associated with multiple types of cancer, including CC. This class of nc transcripts serves an important role in tumor suppression and oncogenic signaling pathways. In the present study, the microarray method was used to obtain the expression profile of lncRNAs and protein-coding mRNAs and to compare the expression of lncRNAs between CC tissues and corresponding adjacent non-cancerous tissues in order to screen potential lncRNAs for associations with CC. Overall, 3356 lncRNAs with significantly different expression pattern in CC tissues compared with adjacent non-cancerous tissues were identified, while 1,857 of them were upregulated. These differentially expressed lncRNAs were additionally classified into 5 subgroups. Reverse transcription quantitative polymerase chain reactions were performed to validate the expression pattern of 5 random selected lncRNAs, and 2lncRNAs were identified to have significantly different expression in CC samples compared with adjacent non-cancerous tissues. This finding suggests that those lncRNAs with different expression may serve important roles in the development of CC, and the expression data may provide information for additional study on the involvement of lncRNAs in CC. PMID:28789353

  12. Unstable genomes elevate transcriptome dynamics

    PubMed Central

    Stevens, Joshua B.; Liu, Guo; Abdallah, Batoul Y.; Horne, Steven D.; Ye, Karen J.; Bremer, Steven W.; Ye, Christine J.; Krawetz, Stephen A.; Heng, Henry H.

    2015-01-01

    The challenge of identifying common expression signatures in cancer is well known, however the reason behind this is largely unclear. Traditionally variation in expression signatures has been attributed to technological problems, however recent evidence suggests that chromosome instability (CIN) and resultant karyotypic heterogeneity may be a large contributing factor. Using a well-defined model of immortalization, we systematically compared the pattern of genome alteration and expression dynamics during somatic evolution. Co-measurement of global gene expression and karyotypic alteration throughout the immortalization process reveals that karyotype changes influence gene expression as major structural and numerical karyotypic alterations result in large gene expression deviation. Replicate samples from stages with stable genomes are more similar to each other than are replicate samples with karyotypic heterogeneity. Karyotypic and gene expression change during immortalization is dynamic as each stage of progression has a unique expression pattern. This was further verified by comparing global expression in two replicates grown in one flask with known karyotypes. Replicates with higher karyotypic instability were found to be less similar than replicates with stable karyotypes. This data illustrates the karyotype, transcriptome, and transcriptome determined pathways are in constant flux during somatic cellular evolution (particularly during the macroevolutionary phase) and this flux is an inextricable feature of CIN and essential for cancer formation. The findings presented here underscore the importance of understanding the evolutionary process of cancer in order to design improved treatment modalities. PMID:24122714

  13. Mapping of Human FOXP2 Enhancers Reveals Complex Regulation.

    PubMed

    Becker, Martin; Devanna, Paolo; Fisher, Simon E; Vernes, Sonja C

    2018-01-01

    Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators - FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2 . Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders.

  14. Mapping of Human FOXP2 Enhancers Reveals Complex Regulation

    PubMed Central

    Becker, Martin; Devanna, Paolo; Fisher, Simon E.; Vernes, Sonja C.

    2018-01-01

    Mutations of the FOXP2 gene cause a severe speech and language disorder, providing a molecular window into the neurobiology of language. Individuals with FOXP2 mutations have structural and functional alterations affecting brain circuits that overlap with sites of FOXP2 expression, including regions of the cortex, striatum, and cerebellum. FOXP2 displays complex patterns of expression in the brain, as well as in non-neuronal tissues, suggesting that sophisticated regulatory mechanisms control its spatio-temporal expression. However, to date, little is known about the regulation of FOXP2 or the genomic elements that control its expression. Using chromatin conformation capture (3C), we mapped the human FOXP2 locus to identify putative enhancer regions that engage in long-range interactions with the promoter of this gene. We demonstrate the ability of the identified enhancer regions to drive gene expression. We also show regulation of the FOXP2 promoter and enhancer regions by candidate regulators – FOXP family and TBR1 transcription factors. These data point to regulatory elements that may contribute to the temporal- or tissue-specific expression patterns of human FOXP2. Understanding the upstream regulatory pathways controlling FOXP2 expression will bring new insight into the molecular networks contributing to human language and related disorders. PMID:29515369

  15. Toll-Like Receptor and Accessory Molecule mRNA Expression in Humans and Mice as Well as in Murine Autoimmunity, Transient Inflammation, and Progressive Fibrosis

    PubMed Central

    Ramaiah, Santhosh Kumar Vankayala; Günthner, Roman; Lech, Maciej; Anders, Hans-Joachim

    2013-01-01

    The cell type-, organ-, and species-specific expression of the Toll-like receptors (TLRs) are well described, but little is known about the respective expression profiles of their accessory molecules. We therefore determined the mRNA expression levels of LBP, MD2, CD36, CD14, granulin, HMGB1, LL37, GRP94, UNC93b1, TRIL, PRAT4A, AP3B1, AEP and the respective TLRs in human and mouse solid organs. Humans and mice displayed significant differences between their respective mRNA expression patterns of these factors. In addition, the expression profiles in transient tissue inflammation upon renal ischemia-reperfusion injury, in spleens and kidneys from mice with lupus-like systemic autoimmunity, and in progressive tissue fibrosis upon unilateral ureteral obstruction were studied. Several TLR co-factors were specifically regulated during the different phases of these disease entities, suggesting a functional involvement in the disease process. Thus, the organ- and species-specific expression patterns need to be considered in the design and interpretation of studies related to TLR-mediated innate immunity, which seems to be involved in the tissue injury phase, in the phase of tissue regeneration, and in progressive tissue remodelling. PMID:23803655

  16. The GMD1 and GMD2 genes of Arabidopsis encode isoforms of GDP-D-mannose 4,6-dehydratase with cell type-specific expression patterns.

    PubMed

    Bonin, Christopher P; Freshour, Glenn; Hahn, Michael G; Vanzin, Gary F; Reiter, Wolf-Dieter

    2003-06-01

    l-Fucose (l-Fuc) is a monosaccharide constituent of plant cell wall polysaccharides and glycoproteins. The committing step in the de novo synthesis of l-Fuc is catalyzed by GDP-d-mannose 4,6-dehydratase, which, in Arabidopsis, is encoded by the GMD1 and GMD2 (MUR1) genes. To determine the functional significance of this genetic redundancy, the expression patterns of both genes were investigated via promoter-beta-glucuronidase fusions and immunolocalization of a Fuc-containing epitope. GMD2 is expressed in most cell types of the root, with the notable exception of the root tip where strong expression of GMD1 is observed. Within shoot organs, GMD1::GUS expression is confined to stipules and pollen grains leading to fucosylation of the walls of these cell types in the mur1 mutant. These results suggest that GMD2 represents the major housekeeping gene for the de novo synthesis of GDP-l-Fuc, whereas GMD1 expression is limited to a number of specialized cell types. We conclude that the synthesis of GDP-l-Fuc is controlled in a cell-autonomous manner by differential expression of two isoforms of the same enzyme.

  17. Spatiotemporal expression of caveolin-1 and EMMPRIN during mouse tooth development.

    PubMed

    Shi, Lu; Li, Lingyun; Wang, Ding; Li, Shu; Chen, Zhi; An, Zhengwen

    2016-06-01

    Caveolin-1 is a scaffolding protein involved in the formation of cholesterol-rich caveolae lipid rafts within the plasma membrane and is capable of collecting signaling molecules into the caveolae and regulating their activity, including extracellular matrix metalloproteinase inducer (EMMPRIN). However, detailed expression patterns of caveolin-1 and EMMPRIN in the developing dental germ are largely unknown. The present study investigated the expression patterns of caveolin-1 and EMMPRIN in the developing mouse tooth germ by immunohistochemistry and real-time polymerase chain reaction. At the bud stage, caveolin-1 expression was initiated in the epithelium bud and mesenchymal cells, while EMMPRIN was weakly expressed at this stage. At the cap stage, caveolin-1 protein was located in the lingual part of the tooth germ; however, EMMPRIN protein was located in the labial part. From the bell stage to 2 days postnatal, caveolin-1 expression was detected in the ameloblasts and cervical loop area; with EMMPRIN expression in the ameloblasts and odontoblasts. Real-time polymerase chain reaction results showed that both caveolin-1 and EMMPRIN mRNA levels increased gradually with progression of developmental stages, and peaked at day two postnatal. The current finding suggests that both caveolin-1 and EMMPRIN take part in mouse tooth development, especially in the differentiation and organization of odontogenic tissues.

  18. Expression profiles of sugarcane under drought conditions: Variation in gene regulation.

    PubMed

    Andrade, Júlio César Farias de; Terto, Jackeline; Silva, José Vieira; Almeida, Cícero

    2015-12-01

    Drought is a major factor in decreased sugarcane productivity because of the resulting morphophysiological effects that it causes. Gene expression studies that have examined the influence of water stress in sugarcane have yielded divergent results, indicating the absence of a fixed pattern of changes in gene expression. In this work, we investigated the expression profiles of 12 genes in the leaves of a drought-tolerant genotype (RB72910) of sugarcane and compared the results with those of other studies. The genotype was subjected to 80-100% water availability (control condition) and 0-20% water availability (simulated drought). To analyze the physiological status, the SPAD index, Fv/Fm ratio, net photosynthesis (A), stomatal conductance (gs) and stomatal transpiration (E) were measured. Total RNA was extracted from leaves and the expression of SAMDC, ZmPIP2-1 protein, ZmTIP4-2 protein, WIP protein, LTP protein, histone H3, DNAj, ferredoxin I, β-tubulin, photosystem I, gene 1 and gene 2 was analyzed by quantitative real-time PCR (RT-PCR). Important differences in the expression profiles of these genes were observed when compared with other genotypes, suggesting that complex defense mechanisms are activated in response to water stress. However, there was no recognizable pattern for the changes in expression of the different proteins associated with tolerance to drought stress.

  19. Correlated tuning of the speckle pattern in an interferometer based on a multimode fiber-optic waveguide

    NASA Astrophysics Data System (ADS)

    Bykovskii, Iu. A.; Kul'Chin, Iu. N.; Obukh, V. F.; Smirnov, V. L.

    1990-08-01

    The correlated tuning of the speckle pattern in the radiation field of a single-fiber multimode interferometer is investigated experimentally and analytically in the presence of external action. It is found that correlated changes in the speckle pattern are observed in both the near and the far emission fields of the waveguide. An expression is obtained which provides a way to determine the maximum size of the speckle correlation region. The use of spatial filtering for isolating the effect of correlated speckle pattern tuning is suggested. It is shown that the use of a spatial filter makes it possible to increase the efficiency of fiber-optic transducers.

  20. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gindhart, J.G. Jr.; Kaufman, T.C.

    1995-02-01

    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products.more » When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.« less

  1. BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

    DOE PAGES

    Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana; ...

    2016-02-04

    Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

  2. BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana

    Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

  3. Calmodulin Gene Family in Potato: Developmental and Touch-Induced Expression of the mRNA Encoding a Novel Isoform

    NASA Technical Reports Server (NTRS)

    Takezawa, D.; Liu, Z. H.; An, G.; Poovaiah, B. W.

    1995-01-01

    Eight genomic clones of potato calmodulin (PCM1 to 8) were isolated and characterized. Sequence comparisons of different genes revealed that the deduced amino acid sequence of PCM1 had several unique substitutions, especially in the fourth Ca(2+)-binding area. The expression patterns of different genes were studied by northern analysis using the 3'-untranslated regions as probes. The expression of PCM1, 5, and 8 was highest in the stolon tip and it decreased during tuber development. The expression of PCM6 did not vary much in the tissues tested, except in the leaves, where the expression was lower; whereas, the expression of PCM4 was very low in all the tissues. The expression of PCM2 and PCM3 was not detected in any of the tissues tested. Among these genes, only PCM1 showed increased expression following touch stimulation. To study the regulation of PCM1, transgenic potato plants carrying the PCM1 promoter fused to the beta-glucuronidase (GUS) reporter gene were produced. GUS expression was found to be developmentally regulated and touch-responsive, indicating a positive correlation between the expression of PCM1 and GUS mRNAs. These results suggest that the 5'-flanking region of PCM1 controls developmental and touch-induced expression. X-Gluc staining patterns revealed that GUS localization is high in meristematic tissues such as the stem apex, stolon tip, and vascular regions.

  4. Importance of correlation between gene expression levels: application to the type I interferon signature in rheumatoid arthritis.

    PubMed

    Reynier, Frédéric; Petit, Fabien; Paye, Malick; Turrel-Davin, Fanny; Imbert, Pierre-Emmanuel; Hot, Arnaud; Mougin, Bruno; Miossec, Pierre

    2011-01-01

    The analysis of gene expression data shows that many genes display similarity in their expression profiles suggesting some co-regulation. Here, we investigated the co-expression patterns in gene expression data and proposed a correlation-based research method to stratify individuals. Using blood from rheumatoid arthritis (RA) patients, we investigated the gene expression profiles from whole blood using Affymetrix microarray technology. Co-expressed genes were analyzed by a biclustering method, followed by gene ontology analysis of the relevant biclusters. Taking the type I interferon (IFN) pathway as an example, a classification algorithm was developed from the 102 RA patients and extended to 10 systemic lupus erythematosus (SLE) patients and 100 healthy volunteers to further characterize individuals. We developed a correlation-based algorithm referred to as Classification Algorithm Based on a Biological Signature (CABS), an alternative to other approaches focused specifically on the expression levels. This algorithm applied to the expression of 35 IFN-related genes showed that the IFN signature presented a heterogeneous expression between RA, SLE and healthy controls which could reflect the level of global IFN signature activation. Moreover, the monitoring of the IFN-related genes during the anti-TNF treatment identified changes in type I IFN gene activity induced in RA patients. In conclusion, we have proposed an original method to analyze genes sharing an expression pattern and a biological function showing that the activation levels of a biological signature could be characterized by its overall state of correlation.

  5. Conservation of Pax gene expression in ectodermal placodes of the lamprey

    NASA Technical Reports Server (NTRS)

    McCauley, David W.; Bronner-Fraser, Marianne

    2002-01-01

    Ectodermal placodes contribute to the cranial ganglia and sense organs of the head and, together with neural crest cells, represent defining features of the vertebrate embryo. The identity of different placodes appears to be specified in part by the expression of different Pax genes, with Pax-3/7 class genes being expressed in the trigeminal placode of mice, chick, frogs and fish, and Pax-2/5/8 class genes expressed in the otic placode. Here, we present the cloning and expression pattern of lamprey Pax-7 and Pax-2, which mark the trigeminal and otic placodes, respectively, as well as other structures characteristic of vertebrate Pax genes. These results suggest conservation of Pax genes and placodal structures in basal and derived vertebrates.

  6. High cell density suppresses BMP4-induced differentiation of human pluripotent stem cells to produce macroscopic spatial patterning in a unidirectional perfusion culture chamber.

    PubMed

    Tashiro, Shota; Le, Minh Nguyen Tuyet; Kusama, Yuta; Nakatani, Eri; Suga, Mika; Furue, Miho K; Satoh, Taku; Sugiura, Shinji; Kanamori, Toshiyuki; Ohnuma, Kiyoshi

    2018-04-19

    Spatial pattern formation is a critical step in embryogenesis. Bone morphogenetic protein 4 (BMP4) and its inhibitors are major factors for the formation of spatial patterns during embryogenesis. However, spatial patterning of the human embryo is unclear because of ethical issues and isotropic culture environments resulting from conventional culture dishes. Here, we utilized human pluripotent stem cells (hiPSCs) and a simple anisotropic (unidirectional perfusion) culture chamber, which creates unidirectional conditions, to measure the cell community effect. The influence of cell density on BMP4-induced differentiation was explored during static culture using a conventional culture dish. Immunostaining of the early differentiation marker SSEA-1 and the mesendoderm marker BRACHYURY revealed that high cell density suppressed differentiation, with small clusters of differentiated and undifferentiated cells formed. Addition of five-fold higher concentration of BMP4 showed similar results, suggesting that suppression was not caused by depletion of BMP4 but rather by high cell density. Quantitative RT-PCR array analysis showed that BMP4 induced multi-lineage differentiation, which was also suppressed under high-density conditions. We fabricated an elongated perfusion culture chamber, in which proteins were transported unidirectionally, and hiPSCs were cultured with BMP4. At low density, the expression was the same throughout the chamber. However, at high density, SSEA-1 and BRACHYURY were expressed only in upstream cells, suggesting that some autocrine/paracrine factors inhibited the action of BMP4 in downstream cells to form the spatial pattern. Human iPSCs cultured in a perfusion culture chamber might be useful for studying in vitro macroscopic pattern formation in human embryogenesis. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  7. Genomic dysregulation in gastric tumors.

    PubMed

    Janjigian, Yelena Y; Kelsen, David P

    2013-03-01

    Gastric cancer is among the most common human malignancies and the second leading cause of cancer-related death. The different epidemiologic and histopathology of subtypes of gastric cancer are associated with different genomic patterns. Data suggests that gene expression patterns of proximal, distal gastric cancers-intestinal type, and diffuse/signet cell are well separated. This review summarizes the genetic and epigenetic changes thought to drive gastric cancer and the emerging paradigm of gastric cancer as three unique disease subtypes. Copyright © 2012 Wiley Periodicals, Inc.

  8. Disgust, Fear, and the Anxiety Disorders: A Critical Review

    PubMed Central

    Cisler, Josh M.; Olatunji, Bunmi O.; Lohr, Jeffrey M.

    2010-01-01

    Anxiety disorders have traditionally been conceptualized as reflecting the emotions of fear and anxiety. A developing program of research demonstrates a relation between disgust and three specific anxiety disorders: blood-injection-injury (BII) phobia, spider phobia, and contamination-related obsessive-compulsive disorder (OCD). This review serves three purposes. First, the authors review the response patterns predicted to be observed if the emotional response in these disorders involved disgust versus fear. The review suggests specific response patterns that characterize disgust and fear in the domains of heart rate, facial expression, neural activity, and cognitive processes. Second, the authors review extant research employing measures of these domains in spider phobia, BII phobia, and contamination-related OCD. The evidence suggests that both fear and disgust characterize each of these disorders, but the magnitude at which the emotions characterize the disorders may depend on the response domain measured. For example, disgust may be more involved in spider phobia in appraisals and facial expression, but less involved in neural correlates or heart rate domains. Third, the authors suggest guidelines for future research, including concurrent use of specific measures as well as examining whether the different emotions in different response domains respond to similar interventions (e.g., exposure). PMID:18977061

  9. Zic3 is required in the migrating primitive streak for node morphogenesis and left–right patterning

    PubMed Central

    Sutherland, Mardi J.; Wang, Shuyun; Quinn, Malgorzata E.; Haaning, Allison; Ware, Stephanie M.

    2013-01-01

    In humans, loss-of-function mutations in ZIC3 cause isolated cardiovascular malformations and X-linked heterotaxy, a disorder with abnormal left–right asymmetry of organs. Zic3 null mice recapitulate the human heterotaxy phenotype but also have early gastrulation defects, axial patterning defects and neural tube defects complicating an assessment of the role of Zic3 in cardiac development. Zic3 is expressed ubiquitously during critical stages of left–right patterning but its later expression in the developing heart remains controversial and the molecular mechanism(s) by which it causes heterotaxy are unknown. To define the temporal and spatial requirements, for Zic3 in left–right patterning, we generated conditional Zic3 mice and Zic3-LacZ-BAC reporter mice. The latter provide compelling evidence that Zic3 is expressed in the mouse node and absent in the heart. Conditional deletion using T-Cre identifies a requirement for Zic3 in the primitive streak and migrating mesoderm for proper left–right patterning and cardiac development. In contrast, Zic3 is not required in heart progenitors or the cardiac compartment. In addition, the data demonstrate abnormal node morphogenesis in Zic3 null mice and identify similar node dysplasia when Zic3 was specifically deleted from the migrating mesoderm and primitive streak. These results define the temporal and spatial requirements for Zic3 in node morphogenesis, left–right patterning and cardiac development and suggest the possibility that a requirement for Zic3 in node ultrastructure underlies its role in heterotaxy and laterality disorders. PMID:23303524

  10. Heat shock proteins in relation to heat stress tolerance of creeping bentgrass at different N levels.

    PubMed

    Wang, Kehua; Zhang, Xunzhong; Goatley, Mike; Ervin, Erik

    2014-01-01

    Heat stress is a primary factor causing summer bentgrass decline. Changes in gene expression at the transcriptional and/or translational level are thought to be a fundamental mechanism in plant response to environmental stresses. Heat stress redirects protein synthesis in higher plants and results in stress protein synthesis, particularly heat shock proteins (HSPs). The goal of this work was to analyze the expression pattern of major HSPs in creeping bentgrass (Agrostis stolonifera L.) during different heat stress periods and to study the influence of nitrogen (N) on the HSP expression patterns. A growth chamber study on 'Penn-A4' creeping bentgrass subjected to 38/28°C day/night for 50 days, was conducted with four nitrate rates (no N-0, low N-2.5, medium N-7.5, and high N-12.5 kg N ha-1) applied biweekly. Visual turfgrass quality (TQ), normalized difference vegetation index (NDVI), photochemical efficiency of photosystem II (Fv/Fm), shoot electrolyte leakage (ShEL), and root viability (RV) were monitored, along with the expression pattern of HSPs. There was no difference in measured parameters between treatments until week seven, except TQ at week five. At week seven, grass at medium N had better TQ, NDVI, and Fv/Fm accompanied by lower ShEL and higher RV, suggesting a major role in improved heat tolerance. All the investigated HSPs (HSP101, HSP90, HSP70, and sHSPs) were up-regulated by heat stress. Their expression patterns indicated cooperation between different HSPs and their roles in bentgrass thermotolerance. In addition, their production seems to be resource dependent. This study could further improve our understanding about how different N levels affect bentgrass thermotolerance.

  11. Expression Analysis of the Theileria parva Subtelomere-Encoded Variable Secreted Protein Gene Family

    PubMed Central

    Schmied, Stéfanie; Affentranger, Sarah; Parvanova, Iana; Kang'a, Simon; Nene, Vishvanath; Katzer, Frank; McKeever, Declan; Müller, Joachim; Bishop, Richard; Pain, Arnab; Dobbelaere, Dirk A. E.

    2009-01-01

    Background The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs) form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm. Methodology/Principal Findings We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals. Conclusions Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic proteins. PMID:19325907

  12. Comprehensive microarray-based analysis for stage-specific larval camouflage pattern-associated genes in the swallowtail butterfly, Papilio xuthus

    PubMed Central

    2012-01-01

    Background Body coloration is an ecologically important trait that is often involved in prey-predator interactions through mimicry and crypsis. Although this subject has attracted the interest of biologists and the general public, our scientific knowledge on the subject remains fragmentary. In the caterpillar of the swallowtail butterfly Papilio xuthus, spectacular changes in the color pattern are observed; the insect mimics bird droppings (mimetic pattern) as a young larva, and switches to a green camouflage coloration (cryptic pattern) in the final instar. Despite the wide variety and significance of larval color patterns, few studies have been conducted at a molecular level compared with the number of studies on adult butterfly wing patterns. Results To obtain a catalog of genes involved in larval mimetic and cryptic pattern formation, we constructed expressed sequence tag (EST) libraries of larval epidermis for P. xuthus, and P. polytes that contained 20,736 and 5,376 clones, respectively, representing one of the largest collections available in butterflies. A comparison with silkworm epidermal EST information revealed the high expression of putative blue and yellow pigment-binding proteins in Papilio species. We also designed a microarray from the EST dataset information, analyzed more than five stages each for six markings, and confirmed spatial expression patterns by whole-mount in situ hybridization. Hence, we succeeded in elucidating many novel marking-specific genes for mimetic and cryptic pattern formation, including pigment-binding protein genes, the melanin-associated gene yellow-h3, the ecdysteroid synthesis enzyme gene 3-dehydroecdysone 3b-reductase, and Papilio-specific genes. We also found many cuticular protein genes with marking specificity that may be associated with the unique surface nanostructure of the markings. Furthermore, we identified two transcription factors, spalt and ecdysteroid signal-related E75, as genes expressed in larval eyespot markings. This finding suggests that E75 is a strong candidate mediator of the hormone-dependent coordination of larval pattern formation. Conclusions This study is one of the most comprehensive molecular analyses of complicated morphological features, and it will serve as a new resource for studying insect mimetic and cryptic pattern formation in general. The wide variety of marking-associated genes (both regulatory and structural genes) identified by our screening indicates that a similar strategy will be effective for understanding other complex traits. PMID:22651552

  13. Reconfiguration of the pontomedullary respiratory network: a computational modeling study with coordinated in vivo experiments.

    PubMed

    Rybak, I A; O'Connor, R; Ross, A; Shevtsova, N A; Nuding, S C; Segers, L S; Shannon, R; Dick, T E; Dunin-Barkowski, W L; Orem, J M; Solomon, I C; Morris, K F; Lindsey, B G

    2008-10-01

    A large body of data suggests that the pontine respiratory group (PRG) is involved in respiratory phase-switching and the reconfiguration of the brain stem respiratory network. However, connectivity between the PRG and ventral respiratory column (VRC) in computational models has been largely ad hoc. We developed a network model with PRG-VRC connectivity inferred from coordinated in vivo experiments. Neurons were modeled in the "integrate-and-fire" style; some neurons had pacemaker properties derived from the model of Breen et al. We recapitulated earlier modeling results, including reproduction of activity profiles of different respiratory neurons and motor outputs, and their changes under different conditions (vagotomy, pontine lesions, etc.). The model also reproduced characteristic changes in neuronal and motor patterns observed in vivo during fictive cough and during hypoxia in non-rapid eye movement sleep. Our simulations suggested possible mechanisms for respiratory pattern reorganization during these behaviors. The model predicted that network- and pacemaker-generated rhythms could be co-expressed during the transition from gasping to eupnea, producing a combined "burst-ramp" pattern of phrenic discharges. To test this prediction, phrenic activity and multiple single neuron spike trains were monitored in vagotomized, decerebrate, immobilized, thoracotomized, and artificially ventilated cats during hypoxia and recovery. In most experiments, phrenic discharge patterns during recovery from hypoxia were similar to those predicted by the model. We conclude that under certain conditions, e.g., during recovery from severe brain hypoxia, components of a distributed network activity present during eupnea can be co-expressed with gasp patterns generated by a distinct, functionally "simplified" mechanism.

  14. Size-dependent regulation of dorsal-ventral patterning in the early Drosophila embryo

    PubMed Central

    Garcia, Mayra; Nahmad, Marcos; Reeves, Gregory T.; Stathopoulos, Angelike

    2013-01-01

    How natural variation in embryo size affects patterning of the Drosophila embryo dorsal-ventral (DV) axis is not known. Here we examined quantitatively the relationship between nuclear distribution of the Dorsal transcription factor, boundary positions for several target genes, and DV axis length. Data were obtained from embryos of a wild-type background as well as from mutant lines inbred to size select embryos of smaller or larger sizes. Our data show that the width of the nuclear Dorsal gradient correlates with DV axis length. In turn, for some genes expressed along the DV axis, the boundary positions correlate closely with nuclear Dorsal levels and with DV axis length; while the expression pattern of others is relatively constant and independent of the width of the Dorsal gradient. In particular, the patterns of snail (sna) and ventral nervous-system defective (vnd) correlate with nuclear Dorsal levels and exhibit scaling to DV length; while the pattern of intermediate neuroblasts defective (ind) remains relatively constant with respect to changes in Dorsal and DV length. However, in mutants that exhibit an abnormal expansion of the Dorsal gradient which fails to scale to DV length, only sna follows the Dorsal distribution and exhibits overexpansion; in contrast, vnd and ind do not overexpand suggesting some additional mechanism acts to refine the dorsal boundaries of these two genes. Thus, our results argue against the idea that the Dorsal gradient works as a global system of relative coordinates along the DV axis and suggest that individual targets respond to changes in embryo size in a gene-specific manner. PMID:23800450

  15. A Simulation Study of Mutations in the Genetic Regulatory Hierarchy for Butterfly Eyespot Focus Determination

    PubMed Central

    Marcus, Jeffrey M.; Evans, Travis M.

    2008-01-01

    The color patterns on the wings of butterflies have been an important model system in evolutionary developmental biology. A recent computational model tested genetic regulatory hierarchies hypothesized to underlie the formation of butterfly eyespot foci (Evans and Marcus, 2006). The computational model demonstrated that one proposed hierarchy was incapable of reproducing the known patterns of gene expression associated with eyespot focus determination in wild-type butterflies, but that two slightly modified alternative hierarchies were capable of reproducing all of the known gene expressions patterns. Here we extend the computational models previously implemented in Delphi 2.0 to two mutants derived from the squinting bush brown butterfly (Bicyclus anynana). These two mutants, comet and Cyclops, have aberrantly shaped eyespot foci that are produced by different mechanisms. The comet mutation appears to produce a modified interaction between the wing margin and the eyespot focus that results in a series of comet-shaped eyespot foci. The Cyclops mutation causes the failure of wing vein formation between two adjacent wing-cells and the fusion of two adjacent eyespot foci to form a single large elongated focus in their place. The computational approach to modeling pattern formation in these mutants allows us to make predictions about patterns of gene expression, which are largely unstudied in butterfly mutants. It also suggests a critical experiment that will allow us to distinguish between two hypothesized genetic regulatory hierarchies that may underlie all butterfly eyespot foci. PMID:18586070

  16. Genome-wide analyses of four major histone modifications in Arabidopsis hybrids at the germinating seed stage.

    PubMed

    Zhu, Anyu; Greaves, Ian K; Dennis, Elizabeth S; Peacock, W James

    2017-02-07

    Hybrid vigour (heterosis) has been used for decades in cropping agriculture, especially in the production of maize and rice, because hybrid varieties exceed their parents in plant biomass and seed yield. The molecular basis of hybrid vigour is not fully understood. Previous studies have suggested that epigenetic systems could play a role in heterosis. In this project, we investigated genome-wide patterns of four histone modifications in Arabidopsis hybrids in germinating seeds. We found that although hybrids have similar histone modification patterns to the parents in most regions of the genome, they have altered patterns at specific loci. A small subset of genes show changes in histone modifications in the hybrids that correlate with changes in gene expression. Our results also show that genome-wide patterns of histone modifications in geminating seeds parallel those at later developmental stages of seedlings. Ler/C24 hybrids showed similar genome-wide patterns of histone modifications as the parents at an early germination stage. However, a small subset of genes, such as FLC, showed correlated changes in histone modification and in gene expression in the hybrids. The altered patterns of histone modifications for those genes in hybrids could be related to some heterotic traits in Arabidopsis, such as flowering time, and could play a role in hybrid vigour establishment.

  17. Patterns of Parental Reaction to Student Grades.

    ERIC Educational Resources Information Center

    Pollio, Howard R.; And Others

    1991-01-01

    Analysis of parent (n=584) responses to good and bad grades received by their children in college allowed categorization of reactions into five categories. Results suggest that parental reactions are not only attempts at changing student behavior but also may be viewed as emotional responses expressing personal needs and values. (Author/MSE)

  18. Expression Profile of NOTCH3 in Mouse Spermatogonia.

    PubMed

    Okada, Ryu; Fujimagari, Megumi; Koya, Eri; Hirose, Yoshikazu; Sato, Tomomi; Nishina, Yukio

    2017-01-01

    Stable and sustainable spermatogenesis is supported by the strict regulation of self-renewal and differentiation of spermatogonial stem cells (SSC), which are a rare population of undifferentiated spermatogonia. It has been revealed that some signaling factors regulate the self-renewal of SSC; however, the molecular mechanism of SSC maintenance is still not completely understood. Notch signaling is an evolutionarily conserved juxtacrine signaling that plays important roles in the cell fate determination of various tissue stem cells. Recently, analyses of loss- and gain-of-function suggested that Notch signaling was necessary for normal spermatogenesis. However, the expression of Notch signal components in spermatogonia is still unclear. Here, we analyzed the distribution of NOTCH3-expressing spermatogonia and the target genes. Double immunostaining with differentiation markers revealed that NOTCH3 was expressed in some undifferentiated and differentiated spermatogonia in mouse testes. To define the target gene of Notch3 signaling in spermatogonia, we analyzed the mRNA expression pattern of Hes and Hey family genes during testis development. Hes1 abundance was decreased during testis development, suggesting that spermatogonia may express Hes1. Immunohistochemical analysis showed that HES1 was expressed in prepubertal spermatogonia, whereas it was expressed predominantly in adult Sertoli cells and weakly in adult spermatogonia. Furthermore, NOTCH3-HES1 double-positive spermatogonia were in pup and adult testes. These results suggest that Notch3 signaling in spermatogonia could promote Hes1 expression. © 2017 S. Karger AG, Basel.

  19. Stability-driven nonnegative matrix factorization to interpret spatial gene expression and build local gene networks

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wu, Siqi; Joseph, Antony; Hammonds, Ann S.

    Spatial gene expression patterns enable the detection of local covariability and are extremely useful for identifying local gene interactions during normal development. The abundance of spatial expression data in recent years has led to the modeling and analysis of regulatory networks. The inherent complexity of such data makes it a challenge to extract biological information. We developed staNMF, a method that combines a scalable implementation of nonnegative matrix factorization (NMF) with a new stability-driven model selection criterion. When applied to a set of Drosophila early embryonic spatial gene expression images, one of the largest datasets of its kind, staNMF identifiedmore » 21 principal patterns (PP). Providing a compact yet biologically interpretable representation of Drosophila expression patterns, PP are comparable to a fate map generated experimentally by laser ablation and show exceptional promise as a data-driven alternative to manual annotations. Our analysis mapped genes to cell-fate programs and assigned putative biological roles to uncharacterized genes. Finally, we used the PP to generate local transcription factor regulatory networks. Spatially local correlation networks were constructed for six PP that span along the embryonic anterior-posterior axis. Using a two-tail 5% cutoff on correlation, we reproduced 10 of the 11 links in the well-studied gap gene network. In conclusion, the performance of PP with the Drosophila data suggests that staNMF provides informative decompositions and constitutes a useful computational lens through which to extract biological insight from complex and often noisy gene expression data.« less

  20. Natural language indicators of differential gene regulation in the human immune system.

    PubMed

    Mehl, Matthias R; Raison, Charles L; Pace, Thaddeus W W; Arevalo, Jesusa M G; Cole, Steve W

    2017-11-21

    Adverse social conditions have been linked to a conserved transcriptional response to adversity (CTRA) in circulating leukocytes that may contribute to social gradients in disease. However, the CNS mechanisms involved remain obscure, in part because CTRA gene-expression profiles often track external social-environmental variables more closely than they do self-reported internal affective states such as stress, depression, or anxiety. This study examined the possibility that variations in patterns of natural language use might provide more sensitive indicators of the automatic threat-detection and -response systems that proximally regulate autonomic induction of the CTRA. In 22,627 audio samples of natural speech sampled from the daily interactions of 143 healthy adults, both total language output and patterns of function-word use covaried with CTRA gene expression. These language features predicted CTRA gene expression substantially better than did conventional self-report measures of stress, depression, and anxiety and did so independently of demographic and behavioral factors (age, sex, race, smoking, body mass index) and leukocyte subset distributions. This predictive relationship held when language and gene expression were sampled more than a week apart, suggesting that associations reflect stable individual differences or chronic life circumstances. Given the observed relationship between personal expression and gene expression, patterns of natural language use may provide a useful behavioral indicator of nonconsciously evaluated well-being (implicit safety vs. threat) that is distinct from conscious affective experience and more closely tracks the neurobiological processes involved in peripheral gene regulation. Copyright © 2017 the Author(s). Published by PNAS.

  1. Stability-driven nonnegative matrix factorization to interpret spatial gene expression and build local gene networks

    DOE PAGES

    Wu, Siqi; Joseph, Antony; Hammonds, Ann S.; ...

    2016-04-06

    Spatial gene expression patterns enable the detection of local covariability and are extremely useful for identifying local gene interactions during normal development. The abundance of spatial expression data in recent years has led to the modeling and analysis of regulatory networks. The inherent complexity of such data makes it a challenge to extract biological information. We developed staNMF, a method that combines a scalable implementation of nonnegative matrix factorization (NMF) with a new stability-driven model selection criterion. When applied to a set of Drosophila early embryonic spatial gene expression images, one of the largest datasets of its kind, staNMF identifiedmore » 21 principal patterns (PP). Providing a compact yet biologically interpretable representation of Drosophila expression patterns, PP are comparable to a fate map generated experimentally by laser ablation and show exceptional promise as a data-driven alternative to manual annotations. Our analysis mapped genes to cell-fate programs and assigned putative biological roles to uncharacterized genes. Finally, we used the PP to generate local transcription factor regulatory networks. Spatially local correlation networks were constructed for six PP that span along the embryonic anterior-posterior axis. Using a two-tail 5% cutoff on correlation, we reproduced 10 of the 11 links in the well-studied gap gene network. In conclusion, the performance of PP with the Drosophila data suggests that staNMF provides informative decompositions and constitutes a useful computational lens through which to extract biological insight from complex and often noisy gene expression data.« less

  2. Divergence of Gene Body DNA Methylation and Evolution of Plant Duplicate Genes

    PubMed Central

    Wang, Jun; Marowsky, Nicholas C.; Fan, Chuanzhu

    2014-01-01

    It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica) genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences) of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes. PMID:25310342

  3. Neurogenesis and ontogeny of specific cell phenotypes within the hamster suprachiasmatic nucleus.

    PubMed

    Antle, Michael C; LeSauter, Joseph; Silver, Rae

    2005-06-09

    The hamster suprachiasmatic nucleus (SCN) is anatomically and functionally heterogeneous. A group of cells in the SCN shell, delineated by vasopressin-ergic neurons, are rhythmic with respect to Period gene expression and electrical activity but do not receive direct retinal input. In contrast, some cells in the SCN core, marked by neurons containing calbindin-D28k, gastrin-releasing peptide (GRP), substance P (SP), and vasoactive intestinal polypeptide (VIP), are not rhythmic with respect to Period gene expression and electrical activity but do receive direct retinal input. Examination of the timing of neurogenesis using bromodeoxyuridine indicates that SCN cells are born between embryonic day 9.5 and 12.5. Calbindin, GRP, substance P, and VIP cells are born only during early SCN neurogenesis, between embryonic days 9.5-11.0. Vasopressin cells are born over the whole period of SCN neurogenesis, appearing as late as embryonic day 12.5. Examination of the ontogeny of peptide expression in these cell types reveals transient expression of calbindin in a cluster of dorsolateral SCN cells on postnatal days 1-2. The adult pattern of calbindin expression is detected in a different ventrolateral cell cluster starting on postnatal day 2. GRP and SP expression appear on postnatal day 8 and 10, respectively, after the retinohypothalamic tract has innervated the SCN. In summary, the present study describes the ontogeny-specific peptidergic phenotypes in the SCN and compares these developmental patterns to previously identified patterns in the appearance of circadian functions. These comparisons suggest the possibility that these coincident appearances may be causally related, with the direction of causation to be determined.

  4. Sequencing of mRNA identifies re-expression of fetal splice variants in cardiac hypertrophy

    PubMed Central

    Ames, EG; Lawson, MJ; Mackey, AJ; Holmes, JW

    2013-01-01

    Cardiac hypertrophy has been well-characterized at the level of transcription. During cardiac hypertrophy, genes normally expressed primarily during fetal heart development are reexpressed, and this fetal gene program is believed to be a critical component of the hypertrophic process. Recently, alternative splicing of mRNA transcripts has been shown to be temporally regulated during heart development, leading us to consider whether fetal patterns of splicing also reappear during hypertrophy. We hypothesized that patterns of alternative splicing occurring during heart development are recapitulated during cardiac hypertrophy. Here we present a study of isoform expression during pressure-overload cardiac hypertrophy induced by 10 days of transverse aortic constriction (TAC) in rats and in developing fetal rat hearts compared to sham-operated adult rat hearts, using high-throughput sequencing of poly(A) tail mRNA. We find a striking degree of overlap between the isoforms expressed differentially in fetal and pressure-overloaded hearts compared to control: forty-four percent of the isoforms with significantly altered expression in TAC hearts are also expressed at significantly different levels in fetal hearts compared to control (P < 0.001). The isoforms that are shared between hypertrophy and fetal heart development are significantly enriched for genes involved in cytoskeletal organization, RNA processing, developmental processes, and metabolic enzymes. Our data strongly support the concept that mRNA splicing patterns normally associated with heart development recur as part of the hypertrophic response to pressure overload. These findings suggest that cardiac hypertrophy shares post-transcriptional as well as transcriptional regulatory mechanisms with fetal heart development. PMID:23688780

  5. Conservation of Endo16 expression in sea urchins despite evolutionary divergence in both cis and trans-acting components of transcriptional regulation

    NASA Technical Reports Server (NTRS)

    Romano, Laura A.; Wray, Gregory A.

    2003-01-01

    Evolutionary changes in transcriptional regulation undoubtedly play an important role in creating morphological diversity. However, there is little information about the evolutionary dynamics of cis-regulatory sequences. This study examines the functional consequence of evolutionary changes in the Endo16 promoter of sea urchins. The Endo16 gene encodes a large extracellular protein that is expressed in the endoderm and may play a role in cell adhesion. Its promoter has been characterized in exceptional detail in the purple sea urchin, Strongylocentrotus purpuratus. We have characterized the structure and function of the Endo16 promoter from a second sea urchin species, Lytechinus variegatus. The Endo16 promoter sequences have evolved in a strongly mosaic manner since these species diverged approximately 35 million years ago: the most proximal region (module A) is conserved, but the remaining modules (B-G) are unalignable. Despite extensive divergence in promoter sequences, the pattern of Endo16 transcription is largely conserved during embryonic and larval development. Transient expression assays demonstrate that 2.2 kb of upstream sequence in either species is sufficient to drive GFP reporter expression that correctly mimics this pattern of Endo16 transcription. Reciprocal cross-species transient expression assays imply that changes have also evolved in the set of transcription factors that interact with the Endo16 promoter. Taken together, these results suggest that stabilizing selection on the transcriptional output may have operated to maintain a similar pattern of Endo16 expression in S. purpuratus and L. variegatus, despite dramatic divergence in promoter sequence and mechanisms of transcriptional regulation.

  6. Effects of intense magnetic fields on sedimentation pattern and gene expression profile in budding yeast

    NASA Astrophysics Data System (ADS)

    Ikehata, Masateru; Iwasaka, Masakazu; Miyakoshi, Junji; Ueno, Shoogo; Koana, Takao

    2003-05-01

    Effects of magnetic fields (MFs) on biological systems are usually investigated using biological indices such as gene expression profiles. However, to precisely evaluate the biological effects of MF, the effects of intense MFs on systematic material transport processes including experimental environment must be seriously taken into consideration. In this study, a culture of the budding yeast, Saccharomyces cerevisiae, was used as a model for an in vitro biological test system. After exposure to 5 T static vertical MF, we found a difference in the sedimentation pattern of cells depending on the location of the dish in the magnet bore. Sedimented cells were localized in the center of the dish when they were placed in the lower part of the magnet bore while the sedimentation of the cells was uniform in dishes placed in the upper part of the bore because of the diamagnetic force. Genome wide gene expression profile of the yeast cells after exposure to 5 T static MF for 2 h suggested that the MF did not affect the expression level of any gene in yeast cells although the sedimentation pattern was altered. In addition, exposure to 10 T for 1 h and 5 T for 24 h also did not affect the gene expression. On the other hand, a slight change in expressions of several genes which are related to respiration was observed by exposure to a 14 T static MF for 24 h. The necessity of estimating the indirect effects of MFs on a study of its biological effect of MF in vitro will be discussed.

  7. Sorting Five Human Tumor Types Reveals Specific Biomarkers and Background Classification Genes.

    PubMed

    Roche, Kimberly E; Weinstein, Marvin; Dunwoodie, Leland J; Poehlman, William L; Feltus, Frank A

    2018-05-25

    We applied two state-of-the-art, knowledge independent data-mining methods - Dynamic Quantum Clustering (DQC) and t-Distributed Stochastic Neighbor Embedding (t-SNE) - to data from The Cancer Genome Atlas (TCGA). We showed that the RNA expression patterns for a mixture of 2,016 samples from five tumor types can sort the tumors into groups enriched for relevant annotations including tumor type, gender, tumor stage, and ethnicity. DQC feature selection analysis discovered 48 core biomarker transcripts that clustered tumors by tumor type. When these transcripts were removed, the geometry of tumor relationships changed, but it was still possible to classify the tumors using the RNA expression profiles of the remaining transcripts. We continued to remove the top biomarkers for several iterations and performed cluster analysis. Even though the most informative transcripts were removed from the cluster analysis, the sorting ability of remaining transcripts remained strong after each iteration. Further, in some iterations we detected a repeating pattern of biological function that wasn't detectable with the core biomarker transcripts present. This suggests the existence of a "background classification" potential in which the pattern of gene expression after continued removal of "biomarker" transcripts could still classify tumors in agreement with the tumor type.

  8. Beta-catenin (CTNNB1) induces Bmp expression in urogenital sinus epithelium and participates in prostatic bud initiation and patterning

    PubMed Central

    Mehta, Vatsal; Schmitz, Christopher T.; Keil, Kimberly P.; Joshi, Pinak S.; Abler, Lisa L.; Lin, Tien-Min; Taketo, Makoto M.; Sun, Xin; Vezina, Chad M.

    2013-01-01

    Fetal prostate development is initiated by androgens and patterned by androgen dependent and independent signals. How these signals integrate to control epithelial cell differentiation and prostatic bud patterning is not fully understood. To test the role of beta-catenin (Ctnnb1) in this process, we used a genetic approach to conditionally delete or stabilize Ctnnb1 in urogenital sinus (UGS) epithelium from which the prostate derives. Two opposing mechanisms of action were revealed. By deleting Ctnnb1, we found it is required for separation of UGS from cloaca, emergence or maintenance of differentiated UGS basal epithelium and formation of prostatic buds. By genetically inducing a patchy subset of UGS epithelial cells to express excess CTNNB1, we found its excess abundance increases Bmp expression and leads to a global impairment of prostatic bud formation. Addition of NOGGIN partially restores prostatic budding in UGS explants with excess Ctnnb1. These results indicate a requirement for Ctnnb1 in UGS basal epithelial cell differentiation, prostatic bud initiation and bud spacing and suggest some of these actions are mediated in part through activation of BMP signaling. PMID:23396188

  9. TRMM-TMI Satellite Observed Soil Moisture and Vegetation Density (1998-2005) Show Strong Connection with El Nino in Eastern Australia

    NASA Technical Reports Server (NTRS)

    Liu, Yi; van Dijk, Albert I.J.M.; Owe, Manfred

    2007-01-01

    Spatiotemporal patterns in soil moisture and vegetation water content across mainland Australia were investigated from 1998 through 2005, using TRMMITMI passive microwave observations. The Empirical Orthogonal Function technique was used to extract dominant spatial and temporal patterns in retrieved estimates of moisture content for the top 1-cm of soil (theta) and vegetation moisture content (via optical depth tau). The dominant temporal theta and tau patterns were strongly correlated to El Nino/Southern Oscillation (ENSO) in spring (3 = 0.90), and to a progressively lesser extent autumn, summer and winter. The Indian Ocean Dipole (IOD) index also explained part of the variation in spring 8 and z. Cluster analysis suggested that the regions most affected by ENS0 are mainly located in eastern Australia. The results suggest that the drought conditions experienced in eastern Australia since 2000 an clearly expressed in these satellite observations have a strong connection with ENSO patterns.

  10. Initiation of olfactory placode development and neurogenesis is blocked in mice lacking both Six1 and Six4.

    PubMed

    Chen, Binglai; Kim, Eun-Hee; Xu, Pin-Xian

    2009-02-01

    Mouse olfactory epithelium (OE) originates from ectodermally derived placode, the olfactory placode that arises at the anterior end of the neural plate. Tissue grafting and recombination experiments suggest that the placode is derived from a common preplacodal domain around the neural plate and its development is directed by signals arising from the underlying mesoderm and adjacent neuroectoderm. In mice, loss of Six1 affects OE morphogenesis but not placode formation. We show here that embryos lacking both Six1 and Six4 failed to form the olfactory placode but the preplacodal region appeared to be specified as judged by the expression of Eya2, which marks the common preplacodal domain, suggesting a synergistic requirement of Six1 and Six4 in patterning the preplacodal ectoderm to a morphologic placode. Our results show that Six1 and Six4 are coexpressed in the preplacodal ectoderm from E8.0. In the olfactory pit, Six4 expression was observed in the peripheral precursors that overlap with Mash1-expressing cells, the early committed neuronal lineage. In contrast, Six1 is highly distributed in the peripheral regions where stem cells reside at E10.5 and it overlaps with Sox2 expression. Both genes are expressed in the basal and apical neuronal progenitors in the OE. Analyses of Six1;Six4 double mutant embryos demonstrated that the slightly thickened epithelium observed in the mutant was not induced for neuronal development. In contrast, in Six1(-/-) embryos, all neuronal lineage markers were initially expressed but the pattern of their expression was altered. Although very few, the pioneer neurons were initially present in the Six1 mutant OE. However, neurogenesis ceased by E12.5 due to markedly increased cell apoptosis and reduced proliferation, thus defining the cellular defects occurring in Six1(-/-) OE that have not been previously observed. Our findings demonstrate that Six1/4 function at the top of early events controlling olfactory placode formation and neuronal development. Our analyses show that the threshold of Six1/4 may be crucial for the expression of olfactory specific genes and that Six1 and Six4 may act synergistically to mediate olfactory placode specification and patterning through Fgf and Bmp signaling pathways.

  11. A forkhead Transcription Factor Is Wound-Induced at the Planarian Midline and Required for Anterior Pole Regeneration

    PubMed Central

    Scimone, M. Lucila; Lapan, Sylvain W.; Reddien, Peter W.

    2014-01-01

    Planarian regeneration requires positional information to specify the identity of tissues to be replaced as well as pluripotent neoblasts capable of differentiating into new cell types. We found that wounding elicits rapid expression of a gene encoding a Forkhead-family transcription factor, FoxD. Wound-induced FoxD expression is specific to the ventral midline, is regulated by Hedgehog signaling, and is neoblast-independent. FoxD is subsequently expressed within a medial subpopulation of neoblasts at wounds involving head regeneration. Ultimately, FoxD is co-expressed with multiple anterior markers at the anterior pole. Inhibition of FoxD with RNA interference (RNAi) results in the failure to specify neoblasts expressing anterior markers (notum and prep) and in anterior pole formation defects. FoxD(RNAi) animals fail to regenerate a new midline and to properly pattern the anterior blastema, consistent with a role for the anterior pole in organizing pattern of the regenerating head. Our results suggest that wound signaling activates a forkhead transcription factor at the midline and, if the head is absent, FoxD promotes specification of neoblasts at the prior midline for anterior pole regeneration. PMID:24415944

  12. Characterization and expression patterns of small RNAs in synthesized Brassica hexaploids.

    PubMed

    Shen, Yanyue; Zhao, Qin; Zou, Jun; Wang, Wenliang; Gao, Yi; Meng, Jinling; Wang, Jianbo

    2014-06-01

    Polyploidy has played an important role in promoting plant evolution through genomic merging and doubling. We used high-throughput sequencing to compare miRNA expression profiles between Brassica hexaploid and its parents. A total of 613, 784 and 742 known miRNAs were identified in Brassica rapa, Brassica carinata, and Brassica hexaploid, respectively. We detected 618 miRNAs were differentially expressed (log(2)Ratio ≥ 1, P ≤ 0.05) between Brassica hexaploid and its parents, and 425 miRNAs were non-additively expressed in Brassica hexaploid, which suggest a trend of non-additive miRNA regulation following hybridization and polyploidization. Remarkably, majority of the non-additively expressed miRNAs in the Brassica hexaploid are repressed, and there was a bias toward repression of B. rapa miRNAs, which is consistent with the progenitor-biased gene repression in the synthetic allopolyploids. In addition, we identified 653 novel mature miRNAs in Brassica hexaploid and its parents. Finally, we found that almost all the non-additive accumulation of siRNA clusters exhibited a low-parent pattern in Brassica hexaploid. Non-additive small RNA regulation is involved in a range of biological pathways, probably providing a driving force for variation and adaptation in allopolyploids.

  13. Pirin Inhibits Cellular Senescence in Melanocytic Cells

    PubMed Central

    Licciulli, Silvia; Luise, Chiara; Scafetta, Gaia; Capra, Maria; Giardina, Giuseppina; Nuciforo, Paolo; Bosari, Silvano; Viale, Giuseppe; Mazzarol, Giovanni; Tonelli, Chiara; Lanfrancone, Luisa; Alcalay, Myriam

    2011-01-01

    Cellular senescence has been widely recognized as a tumor suppressing mechanism that acts as a barrier to cancer development after oncogenic stimuli. A prominent in vivo model of the senescence barrier is represented by nevi, which are composed of melanocytes that, after an initial phase of proliferation induced by activated oncogenes (most commonly BRAF), are blocked in a state of cellular senescence. Transformation to melanoma occurs when genes involved in controlling senescence are mutated or silenced and cells reacquire the capacity to proliferate. Pirin (PIR) is a highly conserved nuclear protein that likely functions as a transcriptional regulator whose expression levels are altered in different types of tumors. We analyzed the expression pattern of PIR in adult human tissues and found that it is expressed in melanocytes and has a complex pattern of regulation in nevi and melanoma: it is rarely detected in mature nevi, but is expressed at high levels in a subset of melanomas. Loss of function and overexpression experiments in normal and transformed melanocytic cells revealed that PIR is involved in the negative control of cellular senescence and that its expression is necessary to overcome the senescence barrier. Our results suggest that PIR may have a relevant role in melanoma progression. PMID:21514450

  14. Hormonal control of GTP cyclohydrolase I gene expression and enzyme activity during color pattern development in wings of Precis coenia.

    PubMed

    Sawada, H; Nakagoshi, M; Reinhardt, R K; Ziegler, I; Koch, P B

    2002-06-01

    Color patterns of butterfly wings are composed of single color points represented by each scale. In the case of Precis coenia, at the end of pupal development, different types of pigments are synthesized sequentially in the differently colored scales beginning with white (pterins) followed by red (ommatins) and then black (melanin). In order to explain how formation of these different colors is regulated, we examined the expression of an mRNA-encoding guanosine triphosphate-cyclohydrolase I (GTP-CH I; EC 3.5.4.16), the first key enzyme in the biosynthesis of pteridines, during pigment formation in the wings of P. coenia. The strongest positive signal was recognized around pigment formation one day before butterfly emergence. This GTP-CH I gene expression is paralleled by GTP-CH I enzyme activity measured in wing extracts. We also investigated the effect of 20-hydroxyecdysone on the expression of GTP-CH I mRNA and the enzyme activity during color formation. The results strongly suggest that the onset and duration of the expression of a GTP-CH I mRNA is triggered by a declining ecdysteroid hormone titer during late pupal development.

  15. Differential Expression of MicroRNA and Predicted Targets in Pulmonary Sarcoidosis

    PubMed Central

    Crouser, Elliott D.; Julian, Mark W.; Crawford, Melissa; Shao, Guohong; Yu, Lianbo; Planck, Stephen R.; Rosenbaum, James T.; Nana-Sinkam, S. Patrick

    2014-01-01

    Background Recent studies show that various inflammatory diseases are regulated at the level of RNA translation by small non-coding RNAs, termed microRNAs (miRNAs). We sought to determine whether sarcoidosis tissues harbor a distinct pattern of miRNA expression and then considered their potential molecular targets. Methods and Results Genome-wide microarray analysis of miRNA expression in lung tissue and peripheral blood mononuclear cells (PBMCs) was performed and differentially expressed (DE)-miRNAs were then validated by real-time PCR. A distinct pattern of DE-miRNA expression was identified in both lung tissue and PBMCs of sarcoidosis patients. A subgroup of DE-miRNAs common to lung and lymph node tissues were predicted to target transforming growth factor (TGFβ)-regulated pathways. Likewise, the DE-miRNAs identified in PBMCs of sarcoidosis patients were predicted to target the TGFβ-regulated “wingless and integrase-1” (WNT) pathway. Conclusions This study is the first to profile miRNAs in sarcoidosis tissues and to consider their possible roles in disease pathogenesis. Our results suggest that miRNA regulate TGFβ and related WNT pathways in sarcoidosis tissues, pathways previously incriminated in the pathogenesis of sarcoidosis. PMID:22209793

  16. Genetic Networks and Anticipation of Gene Expression Patterns

    NASA Astrophysics Data System (ADS)

    Gebert, J.; Lätsch, M.; Pickl, S. W.; Radde, N.; Weber, G.-W.; Wünschiers, R.

    2004-08-01

    An interesting problem for computational biology is the analysis of time-series expression data. Here, the application of modern methods from dynamical systems, optimization theory, numerical algorithms and the utilization of implicit discrete information lead to a deeper understanding. In [1], we suggested to represent the behavior of time-series gene expression patterns by a system of ordinary differential equations, which we analytically and algorithmically investigated under the parametrical aspect of stability or instability. Our algorithm strongly exploited combinatorial information. In this paper, we deepen, extend and exemplify this study from the viewpoint of underlying mathematical modelling. This modelling consists in evaluating DNA-microarray measurements as the basis of anticipatory prediction, in the choice of a smooth model given by differential equations, in an approach of the right-hand side with parametric matrices, and in a discrete approximation which is a least squares optimization problem. We give a mathematical and biological discussion, and pay attention to the special case of a linear system, where the matrices do not depend on the state of expressions. Here, we present first numerical examples.

  17. Comparative Analysis of Two Flavonol Synthases from Different-Colored Onions Provides Insight into Flavonoid Biosynthesis.

    PubMed

    Park, Sangkyu; Kim, Da-Hye; Lee, Jong-Yeol; Ha, Sun-Hwa; Lim, Sun-Hyung

    2017-07-05

    We isolated cDNAs encoding flavonol synthase (FLS) from the red onion "H6" (AcFLS-H6) and the yellow onion "Hwangryongball" (AcFLS-HRB). We found three amino acid variations between the two sequences. Kinetic analysis with recombinant proteins revealed that AcFLS-HRB exhibited approximately 2-fold higher catalytic efficiencies than AcFLS-H6 for dihydroflavonol substrates and that both proteins preferred dihydroquercetin to dihydrokaempferol. The expression patterns of flavonoid biosynthesis genes corresponded to the accumulation patterns of flavonoid aglycones in both onions. Whereas the other flavonoid biosynthesis genes were weakly expressed in the HRB sheath compared to that of H6, the expression of FLS was similar in both onions. This relatively enhanced FLS expression, along with the higher activity of AcFLS-HRB, could increase the quercetin production in the HRB sheath. The quercetin content was approximately 12-fold higher than the cyanidin content in the H6 sheath, suggesting that FLS has priority in the competition between FLS and dihydroflavonol 4-reductase (DFR) for their substrate dihydroquercetin.

  18. Molecular basis of floral petaloidy: insights from androecia of Canna indica

    PubMed Central

    Fu, Qian; Liu, Huanfang; Almeida, Ana M. R.; Kuang, Yanfeng; Zou, Pu; Liao, Jingping

    2014-01-01

    Floral organs that take on the characteristics of petals can occur in all whorls of the monocot order Zingiberales. In Canna indica, the most ornamental or ‘petaloid’ parts of the flowers are of androecial origin and are considered staminodes. However, the precise nature of these petaloid organs is yet to be determined. In order to gain a better understanding of the genetic basis of androecial identity, a molecular investigation of B- and C-class genes was carried out. Two MADS-box genes GLOBOSA (GLO) and AGAMOUS (AG) were isolated from young inflorescences of C. indica by 3′ rapid amplification of cDNA ends polymerase chain reaction (3′-RACE PCR). Sequence characterization and phylogenetic analyses show that CiGLO and CiAG belong to the B- and C-class MADS-box gene family, respectively. CiAG is expressed in petaloid staminodes, the labellum, the fertile stamen and carpels. CiGLO is expressed in petals, petaloid staminodes, the labellum, the fertile stamen and carpels. Expression patterns in mature tissues of CiGLO and CiAG suggest that petaloid staminodes and the labellum are of androecial identity, in agreement with their position within the flower and with described Arabidopsis thaliana expression patterns. Although B- and C-class genes are important components of androecial determination, their expression patterns are not sufficient to explain the distinct morphology observed in staminodes and the fertile stamen in C. indica. PMID:24876297

  19. Transcriptomic variation of eyestalk reveals the genes and biological processes associated with molting in Portunus trituberculatus

    PubMed Central

    Zhang, Longtao; Liu, Ping; Li, Jian

    2017-01-01

    Background Molting is an essential biological process throughout the life history of crustaceans, which is regulated by many neuropeptide hormones expressed in the eyestalk. To better understand the molting mechanism in Portunus trituberculatus, we used digital gene expression (DGE) to analyze single eyestalk samples during the molting cycle by high-throughput sequencing. Results We obtained 14,387,942, 12,631,508 and 13,060,062 clean sequence reads from inter-molt (InM), pre-molt (PrM) and post-molt (PoM) cDNA libraries, respectively. A total of 1,394 molt-related differentially expressed genes (DEGs) were identified. GO and KEGG enrichment analysis identified some important processes and pathways with key roles in molting regulation, such as chitin metabolism, peptidase inhibitor activity, and the ribosome. We first observed a pattern associated with the neuromodulator-related pathways during the molting cycle, which were up-regulated in PrM and down-regulated in PoM. Four categories of important molting-related transcripts were clustered and most of them had similar expression patterns, which suggests that there is a connection between these genes throughout the molt cycle. Conclusion Our work is the first molt-related investigation of P. trituberculatus focusing on the eyestalk at the whole transcriptome level. Together, our results, including DEGs, identification of molting-related biological processes and pathways, and observed expression patterns of important genes, provide a novel insight into the function of the eyestalk in molting regulation. PMID:28394948

  20. Stability-driven nonnegative matrix factorization to interpret spatial gene expression and build local gene networks.

    PubMed

    Wu, Siqi; Joseph, Antony; Hammonds, Ann S; Celniker, Susan E; Yu, Bin; Frise, Erwin

    2016-04-19

    Spatial gene expression patterns enable the detection of local covariability and are extremely useful for identifying local gene interactions during normal development. The abundance of spatial expression data in recent years has led to the modeling and analysis of regulatory networks. The inherent complexity of such data makes it a challenge to extract biological information. We developed staNMF, a method that combines a scalable implementation of nonnegative matrix factorization (NMF) with a new stability-driven model selection criterion. When applied to a set ofDrosophilaearly embryonic spatial gene expression images, one of the largest datasets of its kind, staNMF identified 21 principal patterns (PP). Providing a compact yet biologically interpretable representation ofDrosophilaexpression patterns, PP are comparable to a fate map generated experimentally by laser ablation and show exceptional promise as a data-driven alternative to manual annotations. Our analysis mapped genes to cell-fate programs and assigned putative biological roles to uncharacterized genes. Finally, we used the PP to generate local transcription factor regulatory networks. Spatially local correlation networks were constructed for six PP that span along the embryonic anterior-posterior axis. Using a two-tail 5% cutoff on correlation, we reproduced 10 of the 11 links in the well-studied gap gene network. The performance of PP with theDrosophiladata suggests that staNMF provides informative decompositions and constitutes a useful computational lens through which to extract biological insight from complex and often noisy gene expression data.

Top