Sample records for expression patterns consistent

  1. Identifying spatially similar gene expression patterns in early stage fruit fly embryo images: binary feature versus invariant moment digital representations

    PubMed Central

    Gurunathan, Rajalakshmi; Van Emden, Bernard; Panchanathan, Sethuraman; Kumar, Sudhir

    2004-01-01

    Background Modern developmental biology relies heavily on the analysis of embryonic gene expression patterns. Investigators manually inspect hundreds or thousands of expression patterns to identify those that are spatially similar and to ultimately infer potential gene interactions. However, the rapid accumulation of gene expression pattern data over the last two decades, facilitated by high-throughput techniques, has produced a need for the development of efficient approaches for direct comparison of images, rather than their textual descriptions, to identify spatially similar expression patterns. Results The effectiveness of the Binary Feature Vector (BFV) and Invariant Moment Vector (IMV) based digital representations of the gene expression patterns in finding biologically meaningful patterns was compared for a small (226 images) and a large (1819 images) dataset. For each dataset, an ordered list of images, with respect to a query image, was generated to identify overlapping and similar gene expression patterns, in a manner comparable to what a developmental biologist might do. The results showed that the BFV representation consistently outperforms the IMV representation in finding biologically meaningful matches when spatial overlap of the gene expression pattern and the genes involved are considered. Furthermore, we explored the value of conducting image-content based searches in a dataset where individual expression components (or domains) of multi-domain expression patterns were also included separately. We found that this technique improves performance of both IMV and BFV based searches. Conclusions We conclude that the BFV representation consistently produces a more extensive and better list of biologically useful patterns than the IMV representation. The high quality of results obtained scales well as the search database becomes larger, which encourages efforts to build automated image query and retrieval systems for spatial gene expression patterns. PMID:15603586

  2. Communication of emotions in vocal expression and music performance: different channels, same code?

    PubMed

    Juslin, Patrik N; Laukka, Petri

    2003-09-01

    Many authors have speculated about a close relationship between vocal expression of emotions and musical expression of emotions. but evidence bearing on this relationship has unfortunately been lacking. This review of 104 studies of vocal expression and 41 studies of music performance reveals similarities between the 2 channels concerning (a) the accuracy with which discrete emotions were communicated to listeners and (b) the emotion-specific patterns of acoustic cues used to communicate each emotion. The patterns are generally consistent with K. R. Scherer's (1986) theoretical predictions. The results can explain why music is perceived as expressive of emotion, and they are consistent with an evolutionary perspective on vocal expression of emotions. Discussion focuses on theoretical accounts and directions for future research.

  3. Acquiring Constraints on Morphosyntactic Variation: Children's Spanish Subject Pronoun Expression

    ERIC Educational Resources Information Center

    Shin, Naomi Lapidus

    2016-01-01

    Constraints on linguistic variation are consistent across adult speakers, yielding probabilistic and systematic patterns. Yet, little is known about the development of such patterns during childhood. This study investigates Spanish subject pronoun expression in naturalistic data from 154 monolingual children in Mexico, divided into four age…

  4. Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain

    PubMed Central

    Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

    2013-01-01

    An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain. PMID:23440889

  5. Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain.

    PubMed

    Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

    2013-01-01

    An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain.

  6. Divergent patterns of age-dependence in ornamental and reproductive traits in the collared flycatcher.

    PubMed

    Evans, Simon R; Gustafsson, Lars; Sheldon, Ben C

    2011-06-01

    Sexual ornaments are predicted to honestly signal individual condition. We might therefore expect ornament expression to show a senescent decline, in parallel with late-life deterioration of other characters. Conversely, life-history theory predicts the reduced residual reproductive value of older individuals will favor increased investment in sexually attractive traits. Using a 25-year dataset of more than 5000 records of breeding collared flycatchers (Ficedula albicollis) of known age, we quantify cross-sectional patterns of age-dependence in ornamental plumage traits and report long-term declines in expression that mask highly significant positive age-dependency. We partition this population-level age-dependency into its between- and within-individual components and show expression of ornamental white plumage patches exhibits within-individual increases with age in both sexes, consistent with life-history theory. For males, ornament expression also covaries with life span, such that, within a cohort, ornamentation indicates survival. Finally, we compared longitudinal age-dependency of reproductive traits and ornamental traits in both sexes, to assess whether these two trait types exhibit similar age-dependency. These analyses revealed contrasting patterns: reproductive traits showed within-individual declines in late-life females consistent with senescence; ornamental traits showed the opposite pattern in both males and females. Hence, our results for both sexes suggest that age-dependent ornament expression is consistent with life-history models of optimal signaling and, unlike reproductive traits, proof against senescence. © 2011 The Author(s). Evolution© 2011 The Society for the Study of Evolution.

  7. Aging and Gene Expression in the Primate Brain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fraser, Hunter B.; Khaitovich, Philipp; Plotkin, Joshua B.

    2005-02-18

    It is well established that gene expression levels in many organisms change during the aging process, and the advent of DNA microarrays has allowed genome-wide patterns of transcriptional changes associated with aging to be studied in both model organisms and various human tissues. Understanding the effects of aging on gene expression in the human brain is of particular interest, because of its relation to both normal and pathological neurodegeneration. Here we show that human cerebral cortex, human cerebellum, and chimpanzee cortex each undergo different patterns of age-related gene expression alterations. In humans, many more genes undergo consistent expression changes inmore » the cortex than in the cerebellum; in chimpanzees, many genes change expression with age in cortex, but the pattern of changes in expression bears almost no resemblance to that of human cortex. These results demonstrate the diversity of aging patterns present within the human brain, as well as how rapidly genome-wide patterns of aging can evolve between species; they may also have implications for the oxidative free radical theory of aging, and help to improve our understanding of human neurodegenerative diseases.« less

  8. High-resolution gene expression data from blastoderm embryos of the scuttle fly Megaselia abdita

    PubMed Central

    Wotton, Karl R; Jiménez-Guri, Eva; Crombach, Anton; Cicin-Sain, Damjan; Jaeger, Johannes

    2015-01-01

    Gap genes are involved in segment determination during early development in dipteran insects (flies, midges, and mosquitoes). We carried out a systematic quantitative comparative analysis of the gap gene network across different dipteran species. Our work provides mechanistic insights into the evolution of this pattern-forming network. As a central component of our project, we created a high-resolution quantitative spatio-temporal data set of gap and maternal co-ordinate gene expression in the blastoderm embryo of the non-drosophilid scuttle fly, Megaselia abdita. Our data include expression patterns in both wild-type and RNAi-treated embryos. The data—covering 10 genes, 10 time points, and over 1,000 individual embryos—consist of original embryo images, quantified expression profiles, extracted positions of expression boundaries, and integrated expression patterns, plus metadata and intermediate processing steps. These data provide a valuable resource for researchers interested in the comparative study of gene regulatory networks and pattern formation, an essential step towards a more quantitative and mechanistic understanding of developmental evolution. PMID:25977812

  9. Preservation affinity in consensus modules among stages of HIV-1 progression.

    PubMed

    Mosaddek Hossain, Sk Md; Ray, Sumanta; Mukhopadhyay, Anirban

    2017-03-20

    Analysis of gene expression data provides valuable insights into disease mechanism. Investigating relationship among co-expression modules of different stages is a meaningful tool to understand the way in which a disease progresses. Identifying topological preservation of modular structure also contributes to that understanding. HIV-1 disease provides a well-documented progression pattern through three stages of infection: acute, chronic and non-progressor. In this article, we have developed a novel framework to describe the relationship among the consensus (or shared) co-expression modules for each pair of HIV-1 infection stages. The consensus modules are identified to assess the preservation of network properties. We have investigated the preservation patterns of co-expression networks during HIV-1 disease progression through an eigengene-based approach. We discovered that the expression patterns of consensus modules have a strong preservation during the transitions of three infection stages. In particular, it is noticed that between acute and non-progressor stages the preservation is slightly more than the other pair of stages. Moreover, we have constructed eigengene networks for the identified consensus modules and observed the preservation structure among them. Some consensus modules are marked as preserved in two pairs of stages and are analyzed further to form a higher order meta-network consisting of a group of preserved modules. Additionally, we observed that module membership (MM) values of genes within a module are consistent with the preservation characteristics. The MM values of genes within a pair of preserved modules show strong correlation patterns across two infection stages. We have performed an extensive analysis to discover preservation pattern of co-expression network constructed from microarray gene expression data of three different HIV-1 progression stages. The preservation pattern is investigated through identification of consensus modules in each pair of infection stages. It is observed that the preservation of the expression pattern of consensus modules remains more prominent during the transition of infection from acute stage to non-progressor stage. Additionally, we observed that the module membership values of genes are coherent with preserved modules across the HIV-1 progression stages.

  10. Gene expression pattern recognition algorithm inferences to classify samples exposed to chemical agents

    NASA Astrophysics Data System (ADS)

    Bushel, Pierre R.; Bennett, Lee; Hamadeh, Hisham; Green, James; Ableson, Alan; Misener, Steve; Paules, Richard; Afshari, Cynthia

    2002-06-01

    We present an analysis of pattern recognition procedures used to predict the classes of samples exposed to pharmacologic agents by comparing gene expression patterns from samples treated with two classes of compounds. Rat liver mRNA samples following exposure for 24 hours with phenobarbital or peroxisome proliferators were analyzed using a 1700 rat cDNA microarray platform. Sets of genes that were consistently differentially expressed in the rat liver samples following treatment were stored in the MicroArray Project System (MAPS) database. MAPS identified 238 genes in common that possessed a low probability (P < 0.01) of being randomly detected as differentially expressed at the 95% confidence level. Hierarchical cluster analysis on the 238 genes clustered specific gene expression profiles that separated samples based on exposure to a particular class of compound.

  11. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    PubMed

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  12. Adult mouse brain gene expression patterns bear an embryologic imprint

    PubMed Central

    Zapala, Matthew A.; Hovatta, Iiris; Ellison, Julie A.; Wodicka, Lisa; Del Rio, Jo A.; Tennant, Richard; Tynan, Wendy; Broide, Ron S.; Helton, Rob; Stoveken, Barbara S.; Winrow, Christopher; Lockhart, Daniel J.; Reilly, John F.; Young, Warren G.; Bloom, Floyd E.; Lockhart, David J.; Barlow, Carrolee

    2005-01-01

    The current model to explain the organization of the mammalian nervous system is based on studies of anatomy, embryology, and evolution. To further investigate the molecular organization of the adult mammalian brain, we have built a gene expression-based brain map. We measured gene expression patterns for 24 neural tissues covering the mouse central nervous system and found, surprisingly, that the adult brain bears a transcriptional “imprint” consistent with both embryological origins and classic evolutionary relationships. Embryonic cellular position along the anterior–posterior axis of the neural tube was shown to be closely associated with, and possibly a determinant of, the gene expression patterns in adult structures. We also observed a significant number of embryonic patterning and homeobox genes with region-specific expression in the adult nervous system. The relationships between global expression patterns for different anatomical regions and the nature of the observed region-specific genes suggest that the adult brain retains a degree of overall gene expression established during embryogenesis that is important for regional specificity and the functional relationships between regions in the adult. The complete collection of extensively annotated gene expression data along with data mining and visualization tools have been made available on a publicly accessible web site (www.barlow-lockhart-brainmapnimhgrant.org). PMID:16002470

  13. Intratumoral Heterogeneity of SMAD4 Immunohistochemical Expression and Its Role in Prediction of Recurrence Pattern in Patients with Resectable Pancreatic Cancer.

    PubMed

    Pokataev, Ilya; Kudaibergenova, Asel; Artemyeva, Anna; Popova, Anna; Rumyantsev, Alexey; Podluzhny, Danil; Kudashkin, Nikolay; Fedyanin, Mikhail; Tryakin, Alexey; Tjulandin, Sergey

    2018-04-20

    The aim of our study was to evaluate consistency of SMAD4 expression in different tumor areas and its correlation with recurrence pattern in patients after resection for pancreatic cancer (PC). Records of patients who underwent resection for nonmetastatic PC between 2001 and 2015 were analyzed. Formalin-fixed, paraffin-embedded tissue sections from different areas of primary tumor and lymph node metastases were analyzed immunohistochemically (IHC) for SMAD4 expression using TMA technology. SMAD4 expression was assessed in 356 tissue sections obtained from 91 patients. SMAD4 expression was positive in all assessed tumor slides only in 7 of 26 patients (26.9%). There were 54 recurrences (9 locoregional, 41 distant, and 4 both local and distant) with median follow-up of 21.7 months. There was no correlation between SMAD4 expression and locoregional recurrence pattern (p = 0.30). SMAD4 status influenced neither distant recurrence-free survival (p = 0.99) nor overall survival (p = 0.13). Different areas inside primary tumor and lymph node metastases express SMAD4 heterogeneously. SMAD4 IHC expression is not a biomarker of the recurrence pattern after surgical resection for PC.

  14. Zebrafish: an exciting model for investigating the spatio-temporal pattern of enteric nervous system development.

    PubMed

    Doodnath, Reshma; Dervan, Adrian; Wride, Michael A; Puri, Prem

    2010-12-01

    Recently, the zebrafish (Danio rerio) has been shown to be an excellent model for human paediatric research. Advantages over other models include its small size, externally visually accessible development and ease of experimental manipulation. The enteric nervous system (ENS) consists of neurons and enteric glia. Glial cells permit cell bodies and processes of neurons to be arranged and maintained in a proper spatial arrangement, and are essential in the maintenance of basic physiological functions of neurons. Glial fibrillary acidic protein (GFAP) is expressed in astrocytes, but also expressed outside of the central nervous system. The aim of this study was to investigate the spatio-temporal pattern of GFAP expression in developing zebrafish ENS from 24 h post-fertilization (hpf), using transgenic fish that express green fluorescent protein (GFP). Zebrafish embryos were collected from transgenic GFP Tg(GFAP:GFP)(mi2001) adult zebrafish from 24 to 120 hpf, fixed and processed for whole mount immunohistochemistry. Antibodies to Phox2b were used to identify enteric neurons. Specimens were mounted on slides and imaging was performed using a fluorescent laser confocal microscope. GFAP:GFP labelling outside the spinal cord was identified in embryos from 48 hpf. The patterning was intracellular and consisted of elongated profiles that appeared to migrate away from the spinal cord into the periphery. At 72 and 96 hpf, GFAP:GFP was expressed dorsally and ventrally to the intestinal tract. At 120 hpf, GFAP:GFP was expressed throughout the intestinal wall, and clusters of enteric neurons were identified using Phox2b immunofluorescence along the pathway of GFAP:GFP positive processes, indicative of a migratory pathway of ENS precursors from the spinal cord into the intestine. The pattern of migration of GFAP:GFP expressing cells outside the spinal cord suggests an organized, early developing migratory pathway to the ENS. This shows for the first time that Tg(GFAP:GFP)(mi2001) zebrafish model is an ideal one to study spatio-temporal patterning of early ENS development.

  15. Genes@Work: an efficient algorithm for pattern discovery and multivariate feature selection in gene expression data.

    PubMed

    Lepre, Jorge; Rice, J Jeremy; Tu, Yuhai; Stolovitzky, Gustavo

    2004-05-01

    Despite the growing literature devoted to finding differentially expressed genes in assays probing different tissues types, little attention has been paid to the combinatorial nature of feature selection inherent to large, high-dimensional gene expression datasets. New flexible data analysis approaches capable of searching relevant subgroups of genes and experiments are needed to understand multivariate associations of gene expression patterns with observed phenotypes. We present in detail a deterministic algorithm to discover patterns of multivariate gene associations in gene expression data. The patterns discovered are differential with respect to a control dataset. The algorithm is exhaustive and efficient, reporting all existent patterns that fit a given input parameter set while avoiding enumeration of the entire pattern space. The value of the pattern discovery approach is demonstrated by finding a set of genes that differentiate between two types of lymphoma. Moreover, these genes are found to behave consistently in an independent dataset produced in a different laboratory using different arrays, thus validating the genes selected using our algorithm. We show that the genes deemed significant in terms of their multivariate statistics will be missed using other methods. Our set of pattern discovery algorithms including a user interface is distributed as a package called Genes@Work. This package is freely available to non-commercial users and can be downloaded from our website (http://www.research.ibm.com/FunGen).

  16. Partial co-option of the appendage patterning pathway in the development of abdominal appendages in the sepsid fly Themira biloba

    PubMed Central

    Nijhout, H. Frederik

    2014-01-01

    The abdominal appendages on male Themira biloba (Diptera: Sepsidae) are complex novel structures used during mating. These abdominal appendages superficially resemble the serially homologous insect appendages in that they have a joint and a short segment that can be rotated. Non-genital appendages do not occur in adult pterygote insects, so these abdominal appendages are novel structures with no obvious ancestry. We investigated whether the genes that pattern the serially homologous insect appendages have been co-opted to pattern these novel abdominal appendages. Immunohistochemistry was used to determine the expression patterns of the genes extradenticle (exd), Distal-less (Dll), engrailed (en), Notch, and the Bithorax Complex in the appendages of T. biloba during pupation. The expression patterns of Exd, En, and Notch were consistent with the hypothesis that a portion of the patterning pathway that establishes the coxopodite has been co-opted to pattern the developing abdominal appendages. However, Dll was only expressed in the bristles of the developing appendages and not the proximal–distal axis of the appendage itself. The lack of Dll expression indicates the absence of a distal domain of the appendage suggesting that sepsid abdominal appendages only use genes that normally pattern the base of segmental appendages. PMID:20182886

  17. Osteosarcoma tissues and cell lines from patients with differing serum alkaline phosphatase concentrations display minimal differences in gene expression patterns

    PubMed Central

    de Sá Rodrigues, L. C.; Holmes, K. E.; Thompson, V.; Piskun, C. M.; Lana, S. E.; Newton, M. A.; Stein, T. J.

    2016-01-01

    Serum alkaline phosphatase (ALP) concentration is a prognostic factor for osteosarcoma in multiple studies, although its biological significance remains incompletely understood. To determine whether gene expression patterns differed in osteosarcoma from patients with differing serum ALP concentrations, microarray analysis was performed on 18 primary osteosarcoma samples and six osteosarcoma cell lines from dogs with normal and increased serum ALP concentration. No differences in gene expression patterns were noted between tumours or cell lines with differing serum ALP concentration using a gene-specific two-sample t-test. Using a more sensitive empirical Bayes procedure, defective in cullin neddylation 1 domain containing 1 (DCUN1D1) was increased in both the tissue and cell lines of the normal ALP group. Using quantitative PCR (qPCR), differences in DCUN1D1 expression between the two groups failed to reach significance. The homogeneity of gene expression patterns of osteosarcoma associated differing serum ALP concentrations are consistent with previous studies suggesting serum ALP concentration is not associated with intrinsic differences of osteosarcoma cells. PMID:25643733

  18. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures

    PubMed Central

    Liu, Juan; Franks, Robert G.; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin;  (Jenny) Xiang, Qiu-Yun

    2013-01-01

    Background and Aims LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Methods Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT–PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. Key Results cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. Conclusions The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories. PMID:24052556

  19. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures.

    PubMed

    Liu, Juan; Franks, Robert G; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun

    2013-11-01

    LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT-PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories.

  20. Self-Injurious Behavior in Correctional and Noncorrectional Psychiatric Patients.

    ERIC Educational Resources Information Center

    Hillbrand, Marc

    1993-01-01

    Examined prevalence and selected correlates of self-injurious behavior (SIB) among inmates (n=23) referred for treatment to maximum-security forensic hospital, non-SIB inmates (n=23), and noncorrections SIB patients (n=30). Found two distinct patterns of SIB: pattern consistent with conceptualization of SIB as expression of generalized behavioral…

  1. Behavioral Values and Family Structure in American Society.

    ERIC Educational Resources Information Center

    Schwerin, Karl H.

    Looking at holiday observances and patterns of contact and interaction among kinsmen, this paper examines the values middle class people hold about both close and distant kinsmen and investigates how consistent their actual behavioral patterns are to these expressed values. A questionaire was constructed and administered to a class of…

  2. Computational genetic neuroanatomy of the developing mouse brain: dimensionality reduction, visualization, and clustering.

    PubMed

    Ji, Shuiwang

    2013-07-11

    The structured organization of cells in the brain plays a key role in its functional efficiency. This delicate organization is the consequence of unique molecular identity of each cell gradually established by precise spatiotemporal gene expression control during development. Currently, studies on the molecular-structural association are beginning to reveal how the spatiotemporal gene expression patterns are related to cellular differentiation and structural development. In this article, we aim at a global, data-driven study of the relationship between gene expressions and neuroanatomy in the developing mouse brain. To enable visual explorations of the high-dimensional data, we map the in situ hybridization gene expression data to a two-dimensional space by preserving both the global and the local structures. Our results show that the developing brain anatomy is largely preserved in the reduced gene expression space. To provide a quantitative analysis, we cluster the reduced data into groups and measure the consistency with neuroanatomy at multiple levels. Our results show that the clusters in the low-dimensional space are more consistent with neuroanatomy than those in the original space. Gene expression patterns and developing brain anatomy are closely related. Dimensionality reduction and visual exploration facilitate the study of this relationship.

  3. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants

    PubMed Central

    Hehle, Verena K.; Paul, Matthew J.; Roberts, Victoria A.; van Dolleweerd, Craig J.; Ma, Julian K.-C.

    2016-01-01

    This study examined the degradation pattern of a murine IgG1κ monoclonal antibody expressed in and extracted from transformed Nicotiana tabacum. Gel electrophoresis of leaf extracts revealed a consistent pattern of recombinant immunoglobulin bands, including intact and full-length antibody, as well as smaller antibody fragments. N-terminal sequencing revealed these smaller fragments to be proteolytic cleavage products and identified a limited number of protease-sensitive sites in the antibody light and heavy chain sequences. No strictly conserved target sequence was evident, although the peptide bonds that were susceptible to proteolysis were predominantly and consistently located within or near to the interdomain or solvent-exposed regions in the antibody structure. Amino acids surrounding identified cleavage sites were mutated in an attempt to increase resistance. Different Guy’s 13 antibody heavy and light chain mutant combinations were expressed transiently in N. tabacum and demonstrated intensity shifts in the fragmentation pattern, resulting in alterations to the full-length antibody-to-fragment ratio. The work strengthens the understanding of proteolytic cleavage of antibodies expressed in plants and presents a novel approach to stabilize full-length antibody by site-directed mutagenesis.—Hehle, V. K., Paul, M. J., Roberts, V. A., van Dolleweerd, C. J., Ma, J. K.-C. Site-targeted mutagenesis for stabilization of recombinant monoclonal antibody expressed in tobacco (Nicotiana tabacum) plants. PMID:26712217

  4. Honey Bee Aggression Supports a Link Between Gene Regulation and Behavioral Evolution

    USDA-ARS?s Scientific Manuscript database

    A prominent theory holds that animal phenotypes arise by evolutionary changes in the regulation of gene expression. Emerging from studies of animal development, evidence for this theory consists largely of differences in temporal or spatial patterns of gene expression that are related to morphologi...

  5. Gender cognition in transgender children.

    PubMed

    Olson, Kristina R; Key, Aidan C; Eaton, Nicholas R

    2015-04-01

    A visible and growing cohort of transgender children in North America live according to their expressed gender rather than their natal sex, yet scientific research has largely ignored this population. In the current study, we adopted methodological advances from social-cognition research to investigate whether 5- to 12-year-old prepubescent transgender children (N = 32), who were presenting themselves according to their gender identity in everyday life, showed patterns of gender cognition more consistent with their expressed gender or their natal sex, or instead appeared to be confused about their gender identity. Using implicit and explicit measures, we found that transgender children showed a clear pattern: They viewed themselves in terms of their expressed gender and showed preferences for their expressed gender, with response patterns mirroring those of two cisgender (nontransgender) control groups. These results provide evidence that, early in development, transgender youth are statistically indistinguishable from cisgender children of the same gender identity. © The Author(s) 2015.

  6. Epigenetic dysregulation of the dopamine system in diet-induced obesity.

    PubMed

    Vucetic, Zivjena; Carlin, Jesse Lea; Totoki, Kathy; Reyes, Teresa M

    2012-03-01

    Chronic intake of high-fat (HF) diet is known to alter brain neurotransmitter systems that participate in the central regulation of food intake. Dopamine (DA) system changes in response to HF diet have been observed in the hypothalamus, important in the homeostatic control of food intake, as well as within the central reward circuitry [ventral tegmental area (VTA), nucleus accumbens (NAc), and pre-frontal cortex (PFC)], critical for coding the rewarding properties of palatable food and important in hedonically driven feeding behavior. Using a mouse model of diet-induced obesity (DIO), significant alterations in the expression of DA-related genes were documented in adult animals, and the general pattern of gene expression changes was opposite within the hypothalamus versus the reward circuitry (increased vs. decreased, respectively). Differential DNA methylation was identified within the promoter regions of tyrosine hydroxylase (TH) and dopamine transporter (DAT), and the pattern of this response was consistent with the pattern of gene expression. Behaviors consistent with increased hypothalamic DA and decreased reward circuitry DA were observed. These data identify differential DNA methylation as an epigenetic mechanism linking the chronic intake of HF diet with altered DA-related gene expression, and this response varies by brain region and DNA sequence. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.

  7. Expression pattern of G protein-coupled receptor 30 in human seminiferous tubular cells.

    PubMed

    Oliveira, Pedro F; Alves, Marco G; Martins, Ana D; Correia, Sara; Bernardino, Raquel L; Silva, Joaquina; Barros, Alberto; Sousa, Mário; Cavaco, José E; Socorro, Sílvia

    2014-05-15

    The role of estrogens in male reproductive physiology has been intensively studied over the last few years. Yet, the involvement of their specific receptors has long been a matter of debate. The selective testicular expression of the classic nuclear estrogen receptors (ERα and ERβ) argues in favor of ER-specific functions in the spermatogenic event. Recently, the existence of a G protein-coupled estrogen receptor (GPR30) mediating non-genomic effects of estrogens has also been described. However, little is known about the specific testicular expression pattern of GPR30, as well as on its participation in the control of male reproductive function. Herein, by means of immunohistochemical and molecular biology techniques (RT-PCR and Western blot), we aimed to present the first exhaustive evaluation of GPR30 expression in non-neoplastic human testicular cells. Indeed, we were able to demonstrate that GPR30 was expressed in human testicular tissue and that the staining pattern was consistent with its cytoplasmic localization. Additionally, by using cultured human Sertoli cells (SCs) and isolated haploid and diploid germ cells fractions, we confirmed that GPR30 is expressed in SCs and diploid germ cells but not in haploid germ cells. This specific expression pattern suggests a role for GPR30 in spermatogenesis. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Identification of General Patterns of Sex-Biased Expression in Daphnia, a Genus with Environmental Sex Determination

    PubMed Central

    Molinier, Cécile; Reisser, Céline M.O.; Fields, Peter; Ségard, Adeline; Galimov, Yan; Haag, Christoph R.

    2018-01-01

    Daphnia reproduce by cyclic-parthenogenesis, where phases of asexual reproduction are intermitted by sexual production of diapause stages. This life cycle, together with environmental sex determination, allow the comparison of gene expression between genetically identical males and females. We investigated gene expression differences between males and females in four genotypes of Daphnia magna and compared the results with published data on sex-biased gene expression in two other Daphnia species, each representing one of the major phylogenetic clades within the genus. We found that 42% of all annotated genes showed sex-biased expression in D. magna. This proportion is similar both to estimates from other Daphnia species as well as from species with genetic sex determination, suggesting that sex-biased expression is not reduced under environmental sex determination. Among 7453 single copy, one-to-one orthologs in the three Daphnia species, 707 consistently showed sex-biased expression and 675 were biased in the same direction in all three species. Hence these genes represent a core-set of genes with consistent sex-differential expression in the genus. A functional analysis identified that several of them are involved in known sex determination pathways. Moreover, 75% were overexpressed in females rather than males, a pattern that appears to be a general feature of sex-biased gene expression in Daphnia. PMID:29535148

  9. Identification of General Patterns of Sex-Biased Expression in Daphnia, a Genus with Environmental Sex Determination.

    PubMed

    Molinier, Cécile; Reisser, Céline M O; Fields, Peter; Ségard, Adeline; Galimov, Yan; Haag, Christoph R

    2018-05-04

    Daphnia reproduce by cyclic-parthenogenesis, where phases of asexual reproduction are intermitted by sexual production of diapause stages. This life cycle, together with environmental sex determination, allow the comparison of gene expression between genetically identical males and females. We investigated gene expression differences between males and females in four genotypes of Daphnia magna and compared the results with published data on sex-biased gene expression in two other Daphnia species, each representing one of the major phylogenetic clades within the genus. We found that 42% of all annotated genes showed sex-biased expression in D. magna This proportion is similar both to estimates from other Daphnia species as well as from species with genetic sex determination, suggesting that sex-biased expression is not reduced under environmental sex determination. Among 7453 single copy, one-to-one orthologs in the three Daphnia species, 707 consistently showed sex-biased expression and 675 were biased in the same direction in all three species. Hence these genes represent a core-set of genes with consistent sex-differential expression in the genus. A functional analysis identified that several of them are involved in known sex determination pathways. Moreover, 75% were overexpressed in females rather than males, a pattern that appears to be a general feature of sex-biased gene expression in Daphnia . Copyright © 2018 Molinier et al.

  10. The segment polarity network is a robust developmental module

    NASA Astrophysics Data System (ADS)

    von Dassow, George; Meir, Eli; Munro, Edwin M.; Odell, Garrett M.

    2000-07-01

    All insects possess homologous segments, but segment specification differs radically among insect orders. In Drosophila, maternal morphogens control the patterned activation of gap genes, which encode transcriptional regulators that shape the patterned expression of pair-rule genes. This patterning cascade takes place before cellularization. Pair-rule gene products subsequently `imprint' segment polarity genes with reiterated patterns, thus defining the primordial segments. This mechanism must be greatly modified in insect groups in which many segments emerge only after cellularization. In beetles and parasitic wasps, for instance, pair-rule homologues are expressed in patterns consistent with roles during segmentation, but these patterns emerge within cellular fields. In contrast, although in locusts pair-rule homologues may not control segmentation, some segment polarity genes and their interactions are conserved. Perhaps segmentation is modular, with each module autonomously expressing a characteristic intrinsic behaviour in response to transient stimuli. If so, evolution could rearrange inputs to modules without changing their intrinsic behaviours. Here we suggest, using computer simulations, that the Drosophila segment polarity genes constitute such a module, and that this module is resistant to variations in the kinetic constants that govern its behaviour.

  11. Cross-situational consistency of trait expressions and injunctive norms among Asian Canadian and European Canadian undergraduates.

    PubMed

    Locke, Kenneth D; Sadler, Pamela; McDonald, Kelly

    2018-06-14

    In the current paper, we sought to clarify when and why Asian Americans/Canadians and European Americans/Canadians differ in self-consistency (the consistency of personality traits across situations). European Canadian (n = 220) and second-generation Asian Canadian (n = 166) undergraduates (Mage = 19 years) described the traits they expressed and the traits others wanted them to express (i.e., injunctive norms, or injunctions) in four different social situations (i.e., with parents, with friends, with siblings, and with professors). Self-consistency was greater among European Canadians than Asian Canadians, but only when comparing behavior with parents versus with peers (i.e., friends and siblings). The same pattern was found for injunctive consistency (cross-situational consistency of trait injunctions). Injunctions strongly predicted the behavior of both Asian and European Canadians, but because the injunctions from parents versus peers diverged more for Asian Canadians, so did their behaviors. Controlling for the effect of inconsistent injunctions across situations eliminated the ethnic difference in self-consistency. Finally, Asian Canadians who perceived their immigrant parents as embracing a Canadian identity were as cross-situationally consistent as European Canadians because they tended to behave-and believe their parents approved of their behaving-with parents similarly to how they behaved with peers (e.g., more carefree and outspoken). Contrary to previous theorizing, cultural influences on broad cognitive or motivational dispositions (e.g., dialecticism, collectivism) alone cannot explain the observed pattern of ethnic differences in consistency. To understand when bicultural individuals are less consistent across situations also requires an understanding of the specific situations across which they tend to encounter divergent social norms. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

  12. Hyperinnervation improves Xenopus laevis limb regeneration.

    PubMed

    Mitogawa, Kazumasa; Makanae, Aki; Satoh, Akira

    2018-01-15

    Xenopus laevis (an anuran amphibian) shows limb regeneration ability between that of urodele amphibians and that of amniotes. Xenopus frogs can initiate limb regeneration but fail to form patterned limbs. Regenerated limbs mainly consist of cone-shaped cartilage without any joints or branches. These pattern defects are thought to be caused by loss of proper expressions of patterning-related genes. This study shows that hyperinnervation surgery resulted in the induction of a branching regenerate. The hyperinnervated blastema allows the identification and functional analysis of the molecules controlling this patterning of limb regeneration. This paper focuses on the nerve affects to improve Xenopus limb patterning ability during regeneration. The nerve molecules, which regulate limb patterning, were also investigated. Blastemas grown in a hyperinnervated forelimb upregulate limb patterning-related genes (shh, lmx1b, and hoxa13). Nerves projecting their axons to limbs express some growth factors (bmp7, fgf2, fgf8, and shh). Inputs of these factors to a blastema upregulated some limb patterning-related genes and resulted in changes in the cartilage patterns in the regenerates. These results indicate that additional nerve factors enhance Xenopus limb patterning-related gene expressions and limb regeneration ability, and that bmp, fgf, and shh are candidate nerve substitute factors. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  13. Mapping gene expression patterns during myeloid differentiation using the EML hematopoietic progenitor cell line.

    PubMed

    Du, Yang; Campbell, Janee L; Nalbant, Demet; Youn, Hyewon; Bass, Ann C Hughes; Cobos, Everardo; Tsai, Schickwann; Keller, Jonathan R; Williams, Simon C

    2002-07-01

    The detailed examination of the molecular events that control the early stages of myeloid differentiation has been hampered by the relative scarcity of hematopoietic stem cells and the lack of suitable cell line models. In this study, we examined the expression of several myeloid and nonmyeloid genes in the murine EML hematopoietic stem cell line. Expression patterns for 19 different genes were examined by Northern blotting and RT-PCR in RNA samples from EML, a variety of other immortalized cell lines, and purified murine hematopoietic stem cells. Representational difference analysis (RDA) was performed to identify differentially expressed genes in EML. Expression patterns of genes encoding transcription factors (four members of the C/EBP family, GATA-1, GATA-2, PU.1, CBFbeta, SCL, and c-myb) in EML were examined and were consistent with the proposed functions of these proteins in hematopoietic differentiation. Expression levels of three markers of terminal myeloid differentiation (neutrophil elastase, proteinase 3, and Mac-1) were highest in EML cells at the later stages of differentiation. In a search for genes that were differentially expressed in EML cells during myeloid differentiation, six cDNAs were isolated. These included three known genes (lysozyme, histidine decarboxylase, and tryptophan hydroxylase) and three novel genes. Expression patterns of known genes in differentiating EML cells accurately reflected their expected expression patterns based on previous studies. The identification of three novel genes, two of which encode proteins that may act as regulators of hematopoietic differentiation, suggests that EML is a useful model system for the molecular analysis of hematopoietic differentiation.

  14. Molecular profiling of tumor progression in head and neck cancer.

    PubMed

    Belbin, Thomas J; Singh, Bhuvanesh; Smith, Richard V; Socci, Nicholas D; Wreesmann, Volkert B; Sanchez-Carbayo, Marta; Masterson, Jessica; Patel, Snehal; Cordon-Cardo, Carlos; Prystowsky, Michael B; Childs, Geoffrey

    2005-01-01

    To assess gene expression changes associated with tumor progression in patients with squamous cell carcinoma of the oral cavity. A microarray containing 17 840 complementary DNA clones was used to measure gene expression changes associated with tumor progression in 9 patients with squamous cell carcinoma of the oral cavity. Samples were taken for analysis from the primary tumor, nodal metastasis, and "normal" mucosa from the patients' oral cavity. Tertiary care facility. Patients Nine patients with stage III or stage IV untreated oral cavity squamous cell carcinoma. Our analysis to categorize genes based on their expression patterns has identified 140 genes that consistently increased in expression during progression from normal tissue to invasive tumor and subsequently to metastatic node (in at least 4 of the 9 cases studied). A similar list of 94 genes has been identified that decreased in expression during tumor progression and metastasis. We validated this gene discovery approach by selecting moesin (a member of the ezrin/radixin/moesin [ERM] family of cytoskeletal proteins) and one of the genes that consistently increased in expression during tumor progression for subsequent immunohistochemical analysis using a head and neck squamous cell carcinoma tissue array. A distinct pattern of gene expression, with progressive up- or down-regulation of expression, is found during the progression from histologically normal tissue to primary carcinoma and to nodal metastasis.

  15. Colour and pattern change against visually heterogeneous backgrounds in the tree frog Hyla japonica.

    PubMed

    Kang, Changku; Kim, Ye Eun; Jang, Yikweon

    2016-03-02

    Colour change in animals can be adaptive phenotypic plasticity in heterogeneous environments. Camouflage through background colour matching has been considered a primary force that drives the evolution of colour changing ability. However, the mechanism to which animals change their colour and patterns under visually heterogeneous backgrounds (i.e. consisting of more than one colour) has only been identified in limited taxa. Here, we investigated the colour change process of the Japanese tree frog (Hyla japonica) against patterned backgrounds and elucidated how the expression of dorsal patterns changes against various achromatic/chromatic backgrounds with/without patterns. Our main findings are i) frogs primarily responded to the achromatic differences in background, ii) their contrasting dorsal patterns were conditionally expressed dependent on the brightness of backgrounds, iii) against mixed coloured background, frogs adopted intermediate forms between two colours. Using predator (avian and snake) vision models, we determined that colour differences against different backgrounds yielded perceptible changes in dorsal colours. We also found substantial individual variation in colour changing ability and the levels of dorsal pattern expression between individuals. We discuss the possibility of correlational selection on colour changing ability and resting behaviour that maintains the high variation in colour changing ability within population.

  16. Interactions between Bmp-4 and Msx-1 act to restrict gene expression to odontogenic mesenchyme.

    PubMed

    Tucker, A S; Al Khamis, A; Sharpe, P T

    1998-08-01

    Tooth development is regulated by a reciprocal series of epithelial-mesenchymal interactions. Bmp4 has been identified as a candidate signalling molecule in these interactions, initially as an epithelial signal and then later at the bud stage as a mesenchymal signal (Vainio et al. [1993] Cell 75:45-58). A target gene for Bmp4 signalling is the homeobox gene Msx-1, identified by the ability of recombinant Bmp4 protein to induce expression in mesenchyme. There is, however, no evidence that Bmp4 is the endogenous inducer of Msx-1 expression. Msx-1 and Bmp-4 show dynamic, interactive patterns of expression in oral epithelium and ectomesenchyme during the early stages of tooth development. In this study, we compare the temporal and spatial expression of these two genes to determine whether the changing expression patterns of these genes are consistent with interactions between the two molecules. We show that changes in Bmp-4 expression precede changes in Msx-1 expression. At embryonic day (E)10.5-E11.0, expression patterns are consistent with BMP4 from the epithelium, inducing or maintaining Msx-1 in underlying mesenchyme. At E11.5, Bmp-4 expression shifts from epithelium to mesenchyme and is rapidly followed by localised up-regulation of Msx-1 expression at the sites of Bmp-4 expression. Using cultured explants of developing mandibles, we confirm that exogenous BMP4 is capable of replacing the endogenous source in epithelium and inducing Msx-1 gene expression in mesenchyme. By using noggin, a BMP inhibitor, we show that endogenous Msx-1 expression can be inhibited at E10.5 and E11.5, providing the first evidence that endogenous Bmp-4 from the epithelium is responsible for regulating the early spatial expression of Msx-1. We also show that the mesenchymal shift in Bmp-4 is responsible for up-regulating Msx-1 specifically at the sites of future tooth formation. Thus, we establish that a reciprocal series of interactions act to restrict expression of both genes to future sites of tooth formation, creating a positive feedback loop that maintains expression of both genes in tooth mesenchymal cells.

  17. Comparative methods for the analysis of gene-expression evolution: an example using yeast functional genomic data.

    PubMed

    Oakley, Todd H; Gu, Zhenglong; Abouheif, Ehab; Patel, Nipam H; Li, Wen-Hsiung

    2005-01-01

    Understanding the evolution of gene function is a primary challenge of modern evolutionary biology. Despite an expanding database from genomic and developmental studies, we are lacking quantitative methods for analyzing the evolution of some important measures of gene function, such as gene-expression patterns. Here, we introduce phylogenetic comparative methods to compare different models of gene-expression evolution in a maximum-likelihood framework. We find that expression of duplicated genes has evolved according to a nonphylogenetic model, where closely related genes are no more likely than more distantly related genes to share common expression patterns. These results are consistent with previous studies that found rapid evolution of gene expression during the history of yeast. The comparative methods presented here are general enough to test a wide range of evolutionary hypotheses using genomic-scale data from any organism.

  18. Computational genetic neuroanatomy of the developing mouse brain: dimensionality reduction, visualization, and clustering

    PubMed Central

    2013-01-01

    Background The structured organization of cells in the brain plays a key role in its functional efficiency. This delicate organization is the consequence of unique molecular identity of each cell gradually established by precise spatiotemporal gene expression control during development. Currently, studies on the molecular-structural association are beginning to reveal how the spatiotemporal gene expression patterns are related to cellular differentiation and structural development. Results In this article, we aim at a global, data-driven study of the relationship between gene expressions and neuroanatomy in the developing mouse brain. To enable visual explorations of the high-dimensional data, we map the in situ hybridization gene expression data to a two-dimensional space by preserving both the global and the local structures. Our results show that the developing brain anatomy is largely preserved in the reduced gene expression space. To provide a quantitative analysis, we cluster the reduced data into groups and measure the consistency with neuroanatomy at multiple levels. Our results show that the clusters in the low-dimensional space are more consistent with neuroanatomy than those in the original space. Conclusions Gene expression patterns and developing brain anatomy are closely related. Dimensionality reduction and visual exploration facilitate the study of this relationship. PMID:23845024

  19. Pattern-Recognition Receptor Signaling Regulator mRNA Expression in Humans and Mice, and in Transient Inflammation or Progressive Fibrosis

    PubMed Central

    Günthner, Roman; Kumar, Vankayala Ramaiah Santhosh; Lorenz, Georg; Anders, Hans-Joachim; Lech, Maciej

    2013-01-01

    The cell type-, organ-, and species-specific expression of the pattern-recognition receptors (PRRs) are well described but little is known about the respective expression profiles of their negative regulators. We therefore determined the mRNA expression levels of A20, CYLD, DUBA, ST2, CD180, SIGIRR, TANK, SOCS1, SOCS3, SHIP, IRAK-M, DOK1, DOK2, SHP1, SHP2, TOLLIP, IRF4, SIKE, NLRX1, ERBIN, CENTB1, and Clec4a2 in human and mouse solid organs. Humans and mice displayed significant differences between their respective mRNA expression patterns of these factors. Additionally, we characterized their expression profiles in mononuclear blood cells upon bacterial endotoxin, which showed a consistent induction of A20, SOCS3, IRAK-M, and Clec4a2 in human and murine cells. Furthermore, we studied the expression pattern in transient kidney ischemia-reperfusion injury versus post-ischemic atrophy and fibrosis in mice. A20, CD180, ST2, SOCS1, SOCS3, SHIP, IRAK-M, DOK1, DOK2, IRF4, CENTB1, and Clec4a2 were all induced, albeit at different times of injury and repair. Progressive fibrosis was associated with a persistent induction of these factors. Thus, the organ- and species-specific expression patterns need to be considered in the design and interpretation of studies related to PRR-mediated innate immunity, which seems to be involved in tissue injury, tissue regeneration and in progressive tissue scarring. PMID:24009023

  20. Expression of the Fanconi anemia group A gene (Fanca) during mouse embryogenesis.

    PubMed

    Abu-Issa, R; Eichele, G; Youssoufian, H

    1999-07-15

    About 80% of all cases of Fanconi anemia (FA) can be accounted for by complementation groups A and C. To understand the relationship between these groups, we analyzed the expression pattern of the mouse FA group-A gene (Fanca) during embryogenesis and compared it with the known pattern of the group-C gene (Fancc). Northern analysis of RNA from mouse embryos at embryonic days 7, 11, 15, and 17 showed a predominant 4.5 kb band in all stages. By in situ hybridization, Fanca transcripts were found in the whisker follicles, teeth, brain, retina, kidney, liver, and limbs. There was also stage-specific variation in Fanca expression, particularly within the developing whiskers and the brain. Some tissues known to express Fancc (eg, gut) failed to show Fanca expression. These observations show that (1) Fanca is under both tissue- and stage-specific regulation in several tissues; (2) the expression pattern of Fanca is consistent with the phenotype of the human disease; and (3) Fanca expression is not necessarily coupled to that of Fancc. The presence of distinct tissue targets for FA genes suggests that some of the variability in the clinical phenotype can be attributed to the complementation group assignment.

  1. HLA-C expression pattern is spatially different between psoriasis and eczema skin lesions.

    PubMed

    Carlén, Lina; Sakuraba, Kazuko; Ståhle, Mona; Sánchez, Fabio

    2007-02-01

    Interactions between genetic and environmental factors underlie the immune dysregulation and keratinocyte abnormalities that characterize psoriasis. Among known psoriasis susceptibility loci (PSORS), PSORS1 on chromosome 6 has the strongest association to disease. Altered expression of some PSORS1 candidate genes has been reported but little is known about HLA-C expression in psoriasis. This study compared expression of major histocompatibility complex class Ia and HLA-C in psoriasis, allergic contact eczema, and normal skin. Although HLA-C was abundant in protein extracts from both eczema and psoriasis, a consistent and intriguing difference in the expression pattern was observed; strong immunoreactivity in the basal cell layer, polarized towards the basement membrane in psoriasis, whereas in eczema lesions HLA-C immunostaining was present mostly in suprabasal cells. Inflammatory cells in the dermis were strongly stained in both diseases. Normal skin epithelium showed less intense but similar HLA-C staining as eczema lesions. HLA class Ia expression overall resembled that of HLA-C in all samples. The distinct HLA-C expression patterns in psoriasis and eczema suggest a functional role in the specific psoriasis immune response and not only a general feature of inflammation.

  2. Expression patterns of WRKY genes in di-haploid Populus simonii × P. nigra in response to salinity stress revealed by quantitative real-time PCR and RNA sequencing.

    PubMed

    Wang, Shengji; Wang, Jiying; Yao, Wenjing; Zhou, Boru; Li, Renhua; Jiang, Tingbo

    2014-10-01

    Spatio-temporal expression patterns of 13 out of 119 poplar WRKY genes indicated dynamic and tissue-specific roles of WRKY family proteins in salinity stress tolerance. To understand the expression patterns of poplar WRKY genes under salinity stress, 51 of the 119 WRKY genes were selected from di-haploid Populus simonii × P. nigra by quantitative real-time PCR (qRT-PCR). We used qRT-PCR to profile the expression of the top 13 genes under salinity stress across seven time points, and employed RNA-Seq platforms to cross-validate it. Results demonstrated that all the 13 WRKY genes were expressed in root, stem, and leaf tissues, but their expression levels and overall patterns varied notably in these tissues. Regarding overall gene expression in roots, the 13 genes were significantly highly expressed at all six time points after the treatment, reaching the plateau of expression at hour 9. In leaves, the 13 genes were similarly up-regulated from 3 to 12 h in response to NaCl treatment. In stems, however, expression levels of the 13 genes did not show significant changes after the NaCl treatment. Regarding individual gene expression across the time points and the three tissues, the 13 genes can be classified into three clusters: the lowly expressed Cluster 1 containing PthWRKY28, 45 and 105; intermediately expressed Clusters 2 including PthWRKY56, 88 and 116; and highly expressed Cluster 3 consisting of PthWRKY41, 44, 51, 61, 62, 75 and 106. In general, genes in Cluster 2 and 3 displayed a dynamic pattern of "induced amplification-recovering", suggesting that these WRKY genes and corresponding pathways may play a critical role in mediating salt response and tolerance in a dynamic and tissue-specific manner.

  3. Psychiatric Symptoms Among Puerto Ricans in Puerto Rico and New York City

    ERIC Educational Resources Information Center

    Haberman, Paul W.

    1976-01-01

    Findings suggest that the consistently high rates of survey reported symptoms among Puerto Rican respondents derive primarily from culturally patterned differences in modes of expressing distress. (Author/AM)

  4. Medium-throughput processing of whole mount in situ hybridisation experiments into gene expression domains.

    PubMed

    Crombach, Anton; Cicin-Sain, Damjan; Wotton, Karl R; Jaeger, Johannes

    2012-01-01

    Understanding the function and evolution of developmental regulatory networks requires the characterisation and quantification of spatio-temporal gene expression patterns across a range of systems and species. However, most high-throughput methods to measure the dynamics of gene expression do not preserve the detailed spatial information needed in this context. For this reason, quantification methods based on image bioinformatics have become increasingly important over the past few years. Most available approaches in this field either focus on the detailed and accurate quantification of a small set of gene expression patterns, or attempt high-throughput analysis of spatial expression through binary pattern extraction and large-scale analysis of the resulting datasets. Here we present a robust, "medium-throughput" pipeline to process in situ hybridisation patterns from embryos of different species of flies. It bridges the gap between high-resolution, and high-throughput image processing methods, enabling us to quantify graded expression patterns along the antero-posterior axis of the embryo in an efficient and straightforward manner. Our method is based on a robust enzymatic (colorimetric) in situ hybridisation protocol and rapid data acquisition through wide-field microscopy. Data processing consists of image segmentation, profile extraction, and determination of expression domain boundary positions using a spline approximation. It results in sets of measured boundaries sorted by gene and developmental time point, which are analysed in terms of expression variability or spatio-temporal dynamics. Our method yields integrated time series of spatial gene expression, which can be used to reverse-engineer developmental gene regulatory networks across species. It is easily adaptable to other processes and species, enabling the in silico reconstitution of gene regulatory networks in a wide range of developmental contexts.

  5. Machine-learning approach identifies a pattern of gene expression in peripheral blood that can accurately detect ischaemic stroke

    PubMed Central

    O’Connell, Grant C; Petrone, Ashley B; Treadway, Madison B; Tennant, Connie S; Lucke-Wold, Noelle; Chantler, Paul D; Barr, Taura L

    2016-01-01

    Early and accurate diagnosis of stroke improves the probability of positive outcome. The objective of this study was to identify a pattern of gene expression in peripheral blood that could potentially be optimised to expedite the diagnosis of acute ischaemic stroke (AIS). A discovery cohort was recruited consisting of 39 AIS patients and 24 neurologically asymptomatic controls. Peripheral blood was sampled at emergency department admission, and genome-wide expression profiling was performed via microarray. A machine-learning technique known as genetic algorithm k-nearest neighbours (GA/kNN) was then used to identify a pattern of gene expression that could optimally discriminate between groups. This pattern of expression was then assessed via qRT-PCR in an independent validation cohort, where it was evaluated for its ability to discriminate between an additional 39 AIS patients and 30 neurologically asymptomatic controls, as well as 20 acute stroke mimics. GA/kNN identified 10 genes (ANTXR2, STK3, PDK4, CD163, MAL, GRAP, ID3, CTSZ, KIF1B and PLXDC2) whose coordinate pattern of expression was able to identify 98.4% of discovery cohort subjects correctly (97.4% sensitive, 100% specific). In the validation cohort, the expression levels of the same 10 genes were able to identify 95.6% of subjects correctly when comparing AIS patients to asymptomatic controls (92.3% sensitive, 100% specific), and 94.9% of subjects correctly when comparing AIS patients with stroke mimics (97.4% sensitive, 90.0% specific). The transcriptional pattern identified in this study shows strong diagnostic potential, and warrants further evaluation to determine its true clinical efficacy. PMID:29263821

  6. The shoot stem cell niche in angiosperms: expression patterns of WUS orthologues in rice and maize imply major modifications in the course of mono- and dicot evolution.

    PubMed

    Nardmann, Judith; Werr, Wolfgang

    2006-12-01

    In Arabidopsis, stem cell homeostasis in the shoot apical meristem (SAM) is controlled by a feedback loop between WUS and CLV functions. We have identified WUS orthologues in maize and rice by a detailed phylogenetic analysis of the WOX gene family and subsequent cloning. A single WUS orthologue is present in the rice genome (OsWUS), whereas the allotetraploid maize genome contains 2 WUS paralogues (ZmWUS1 and ZmWUS2). None of the isolated grass WUS orthologues displays an organizing center-type expression pattern in the vegetative SAM as in Arabidopsis. In contrast, the grass-specific expression patterns relate to the specification of new phytomers consistent with the transcriptional expression patterns of TD1 and FON1 (CLV1 orthologues of maize and rice, respectively). Moreover, the grass WUS and CLV1 orthologues are coexpressed in all reproductive meristems, where fasciation and supernumerary floral organs occur in td1 or fon1 loss-of-function mutants. The expression patterns of WUS orthologues in both grass species compared with those of dicots imply that major changes in WUS function, which are correlated with changes in CLV1 signaling, have occurred during angiosperm evolution and raise doubts about the uniqueness of the WUS/CLV antagonism in the maintenance of the shoot stem cell niche in grasses.

  7. Complexities of gene expression patterns in natural populations of an extremophile fish (Poecilia mexicana, Poeciliidae)

    PubMed Central

    Passow, Courtney N.; Brown, Anthony P.; Arias-Rodriguez, Lenin; Yee, Muh-Ching; Sockell, Alexandra; Schartl, Manfred; Warren, Wesley C.; Bustamante, Carlos; Kelley, Joanna L.; Tobler, Michael

    2017-01-01

    Variation in gene expression can provide insights into organismal responses to environmental stress and physiological mechanisms mediating adaptation to habitats with contrasting environmental conditions. We performed an RNA-sequencing experiment to quantify gene expression patterns in fish adapted to habitats with different combinations of environmental stressors, including the presence of toxic hydrogen sulphide (H2S) and the absence of light in caves. We specifically asked how gene expression varies among populations living in different habitats, whether population differences were consistent among organs, and whether there is evidence for shared expression responses in populations exposed to the same stressors. We analysed organ-specific transcriptome-wide data from four ecotypes of Poecilia mexicana (nonsulphidic surface, sulphidic surface, nonsulphidic cave and sulphidic cave). The majority of variation in gene expression was correlated with organ type, and the presence of specific environmental stressors elicited unique expression differences among organs. Shared patterns of gene expression between populations exposed to the same environmental stressors increased with levels of organismal organization (from transcript to gene to physiological pathway). In addition, shared patterns of gene expression were more common between populations from sulphidic than populations from cave habitats, potentially indicating that physiochemical stressors with clear biochemical consequences can constrain the diversity of adaptive solutions that mitigate their adverse effects. Overall, our analyses provided insights into transcriptional variation in a unique system, in which adaptation to H2S and darkness coincide. Functional annotations of differentially expressed genes provide a springboard for investigating physiological mechanisms putatively underlying adaptation to extreme environments. PMID:28598519

  8. Sox genes in the coral Acropora millepora: divergent expression patterns reflect differences in developmental mechanisms within the Anthozoa

    PubMed Central

    2008-01-01

    Background Sox genes encode transcription factors that function in a wide range of developmental processes across the animal kingdom. To better understand both the evolution of the Sox family and the roles of these genes in cnidarians, we are studying the Sox gene complement of the coral, Acropora millepora (Class Anthozoa). Results Based on overall domain structures and HMG box sequences, the Acropora Sox genes considered here clearly fall into four of the five major Sox classes. AmSoxC is expressed in the ectoderm during development, in cells whose morphology is consistent with their assignment as sensory neurons. The expression pattern of the Nematostella ortholog of this gene is broadly similar to that of AmSoxC, but there are subtle differences – for example, expression begins significantly earlier in Acropora than in Nematostella. During gastrulation, AmSoxBb and AmSoxB1 transcripts are detected only in the presumptive ectoderm while AmSoxE1 transcription is restricted to the presumptive endoderm, suggesting that these Sox genes might play roles in germ layer specification. A third type B Sox gene, AmSoxBa, and a Sox F gene AmSoxF also have complex and specific expression patterns during early development. Each of these genes has a clear Nematostella ortholog, but in several cases the expression pattern observed in Acropora differs significantly from that reported in Nematostella. Conclusion These differences in expression patterns between Acropora and Nematostella largely reflect fundamental differences in developmental processes, underscoring the diversity of mechanisms within the anthozoan Sub-Class Hexacorallia (Zoantharia). PMID:19014479

  9. An ancient rule for constructing dodecagonal quasiperiodic patterns

    NASA Astrophysics Data System (ADS)

    Ajlouni, Rima

    2017-02-01

    The discovery of complex dodecagonal patterns in historical Islamic architecture is generating a renewed interest into understanding the mathematical principles of traditional Islamic geometry. By employing a compass and a straightedge, ancient craftsmen utilized consistent design principles that allowed for diverse geometric expressions to be realized throughout the ancient world. Derived from these principles, a global multi-level structural model is proposed that provides a general guiding principle for constructing a wide variety of infinite dodecagon-based quasiperiodic patterns.

  10. Transcriptomic correlates of neuron electrophysiological diversity

    PubMed Central

    Li, Brenna; Crichlow, Cindy-Lee; Mancarci, B. Ogan; Pavlidis, Paul

    2017-01-01

    How neuronal diversity emerges from complex patterns of gene expression remains poorly understood. Here we present an approach to understand electrophysiological diversity through gene expression by integrating pooled- and single-cell transcriptomics with intracellular electrophysiology. Using neuroinformatics methods, we compiled a brain-wide dataset of 34 neuron types with paired gene expression and intrinsic electrophysiological features from publically accessible sources, the largest such collection to date. We identified 420 genes whose expression levels significantly correlated with variability in one or more of 11 physiological parameters. We next trained statistical models to infer cellular features from multivariate gene expression patterns. Such models were predictive of gene-electrophysiological relationships in an independent collection of 12 visual cortex cell types from the Allen Institute, suggesting that these correlations might reflect general principles relating expression patterns to phenotypic diversity across very different cell types. Many associations reported here have the potential to provide new insights into how neurons generate functional diversity, and correlations of ion channel genes like Gabrd and Scn1a (Nav1.1) with resting potential and spiking frequency are consistent with known causal mechanisms. Our work highlights the promise and inherent challenges in using cell type-specific transcriptomics to understand the mechanistic origins of neuronal diversity. PMID:29069078

  11. Regulation of MET by FOXP2, genes implicated in higher cognitive dysfunction and autism risk.

    PubMed

    Mukamel, Zohar; Konopka, Genevieve; Wexler, Eric; Osborn, Gregory E; Dong, Hongmei; Bergman, Mica Y; Levitt, Pat; Geschwind, Daniel H

    2011-08-10

    Autism spectrum disorder (ASD) is a highly heritable, behaviorally defined, heterogeneous disorder of unknown pathogenesis. Several genetic risk genes have been identified, including the gene encoding the receptor tyrosine kinase MET, which regulates neuronal differentiation and growth. An ASD-associated polymorphism disrupts MET gene transcription, and there are reduced levels of MET protein expression in the mature temporal cortex of subjects with ASD. To address the possible neurodevelopmental contribution of MET to ASD pathogenesis, we examined the expression and transcriptional regulation of MET by a transcription factor, FOXP2, which is implicated in regulation of cognition and language, two functions altered in ASD. MET mRNA expression in the midgestation human fetal cerebral cortex is strikingly restricted, localized to portions of the temporal and occipital lobes. Within the cortical plate of the temporal lobe, the pattern of MET expression is highly complementary to the expression pattern of FOXP2, suggesting the latter may play a role in repression of gene expression. Consistent with this, MET and FOXP2 also are reciprocally expressed by differentiating normal human neuronal progenitor cells (NHNPs) in vitro, leading us to assess whether FOXP2 transcriptionally regulates MET. Indeed, FOXP2 binds directly to the 5' regulatory region of MET, and overexpression of FOXP2 results in transcriptional repression of MET. The expression of MET in restricted human neocortical regions, and its regulation in part by FOXP2, is consistent with genetic evidence for MET contributing to ASD risk.

  12. Analysis of the expression and function of Wnt-5a and Wnt-5b in developing and regenerating axolotl (Ambystoma mexicanum) limbs.

    PubMed

    Ghosh, Sukla; Roy, Stéphane; Séguin, Carl; Bryant, Susan V; Gardiner, David M

    2008-05-01

    Urodele amphibians are unique adult vertebrates because they are able to regenerate body parts after amputation. Studies of urodele limb regeneration, the key model system for vertebrate regeneration, have led to an understanding of the origin of blastema cells and the importance of positional interactions between blastema cells in the control of growth and pattern formation. Progress is now being made in the identification of the signaling pathways that regulate dedifferentiation, blastema morphogenesis, growth and pattern formation. Members of the Wnt family of secreted proteins are expressed in developing and regenerating limbs, and have the potential to control growth, pattern formation and differentiation. We have studied the expression of two non-canonical Wnt genes, Wnt-5a and Wnt-5b. We report that they are expressed in equivalent patterns during limb development and limb regeneration in the axolotl (Ambystoma mexicanum), and during limb development in other tetrapods, implying conservation of function. Our analysis of the effects of ectopic Wnt-5a expression is consistent with the hypothesis that canonical Wnt signaling functions during the early stages of regeneration to control the dedifferentiation of stump cells giving rise to the regeneration-competent cells of the blastema.

  13. Phytoplankton-bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge.

    PubMed

    Bertrand, Erin M; McCrow, John P; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B; Delmont, Tom O; Post, Anton F; Sipler, Rachel E; Spackeen, Jenna L; Xu, Kai; Bronk, Deborah A; Hutchins, David A; Allen, Andrew E

    2015-08-11

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton-bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton-bacterial interactions in both positive and negative feedback loops.

  14. Phytoplankton–bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge

    PubMed Central

    Bertrand, Erin M.; McCrow, John P.; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B.; Delmont, Tom O.; Post, Anton F.; Sipler, Rachel E.; Spackeen, Jenna L.; Xu, Kai; Bronk, Deborah A.; Hutchins, David A.; Allen, Andrew E.

    2015-01-01

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton–bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton–bacterial interactions in both positive and negative feedback loops. PMID:26221022

  15. Expression of c-Fes protein isoforms correlates with differentiation in myeloid leukemias.

    PubMed

    Carlson, Anne; Berkowitz, Jeanne McAdara; Browning, Damaris; Slamon, Dennis J; Gasson, Judith C; Yates, Karen E

    2005-05-01

    The cellular fes gene encodes a 93-kilodalton protein-tyrosine kinase (p93) that is expressed in both normal and neoplastic myeloid cells. Increased c-Fes expression is associated with differentiation in normal myeloid cells and cell lines. Our hypothesis was that primary leukemia cells would show a similar pattern of increased expression in more differentiated cells. Therefore, we compared c-Fes expression in cells with an undifferentiated, blast phenotype (acute myelogenous leukemia--AML) to cells with a differentiated phenotype (chronic myelogenous leukemia--CML). Instead of differences in p93 expression levels, we found complex patterns of c-Fes immunoreactive proteins that corresponded with differentiation in normal and leukemic myeloid cells. The "blast" pattern consisted of c-Fes immunoreactive proteins p93, p74, and p70; the "differentiated" pattern showed two additional c-Fes immunoreactive proteins, p67 and p62. Using mRNA from mouse and human cell lines, we found deletion of one or more exons in the c-fes mRNA. Those deletions predicted truncation of conserved domains (CDC15/FCH and SH2) involved in protein-protein interactions. No deletions were found, however, within the kinase domain. We infer that alternative splicing generates a family of c-Fes proteins. This may be a mechanism to direct the c-Fes kinase domain to different subcellular locations and/or substrates at specific stages of myeloid cell differentiation.

  16. Colour and pattern change against visually heterogeneous backgrounds in the tree frog Hyla japonica

    PubMed Central

    Kang, Changku; Kim, Ye Eun; Jang, Yikweon

    2016-01-01

    Colour change in animals can be adaptive phenotypic plasticity in heterogeneous environments. Camouflage through background colour matching has been considered a primary force that drives the evolution of colour changing ability. However, the mechanism to which animals change their colour and patterns under visually heterogeneous backgrounds (i.e. consisting of more than one colour) has only been identified in limited taxa. Here, we investigated the colour change process of the Japanese tree frog (Hyla japonica) against patterned backgrounds and elucidated how the expression of dorsal patterns changes against various achromatic/chromatic backgrounds with/without patterns. Our main findings are i) frogs primarily responded to the achromatic differences in background, ii) their contrasting dorsal patterns were conditionally expressed dependent on the brightness of backgrounds, iii) against mixed coloured background, frogs adopted intermediate forms between two colours. Using predator (avian and snake) vision models, we determined that colour differences against different backgrounds yielded perceptible changes in dorsal colours. We also found substantial individual variation in colour changing ability and the levels of dorsal pattern expression between individuals. We discuss the possibility of correlational selection on colour changing ability and resting behaviour that maintains the high variation in colour changing ability within population. PMID:26932675

  17. Optimal consistency in microRNA expression analysis using reference-gene-based normalization.

    PubMed

    Wang, Xi; Gardiner, Erin J; Cairns, Murray J

    2015-05-01

    Normalization of high-throughput molecular expression profiles secures differential expression analysis between samples of different phenotypes or biological conditions, and facilitates comparison between experimental batches. While the same general principles apply to microRNA (miRNA) normalization, there is mounting evidence that global shifts in their expression patterns occur in specific circumstances, which pose a challenge for normalizing miRNA expression data. As an alternative to global normalization, which has the propensity to flatten large trends, normalization against constitutively expressed reference genes presents an advantage through their relative independence. Here we investigated the performance of reference-gene-based (RGB) normalization for differential miRNA expression analysis of microarray expression data, and compared the results with other normalization methods, including: quantile, variance stabilization, robust spline, simple scaling, rank invariant, and Loess regression. The comparative analyses were executed using miRNA expression in tissue samples derived from subjects with schizophrenia and non-psychiatric controls. We proposed a consistency criterion for evaluating methods by examining the overlapping of differentially expressed miRNAs detected using different partitions of the whole data. Based on this criterion, we found that RGB normalization generally outperformed global normalization methods. Thus we recommend the application of RGB normalization for miRNA expression data sets, and believe that this will yield a more consistent and useful readout of differentially expressed miRNAs, particularly in biological conditions characterized by large shifts in miRNA expression.

  18. Temporal Asthma Patterns Using Repeated Questionnaires over 13 Years in a Large French Cohort of Women

    PubMed Central

    Sanchez, Margaux; Bousquet, Jean; Le Moual, Nicole; Jacquemin, Bénédicte; Clavel-Chapelon, Françoise; Humbert, Marc; Kauffmann, Francine; Tubert-Bitter, Pascale; Varraso, Raphaëlle

    2013-01-01

    Variable expression is one aspect of the heterogeneity of asthma. We aimed to define a variable pattern, which is relevant in general health epidemiological cohorts. Our objectives were to assess whether: 1) asthma patterns defined using simple asthma questions through repeated measurements could reflect disease variability 2) these patterns may further be classified according to asthma severity/control. Among 70,428 French women, we used seven questionnaires (1992–2005) and a comprehensive reimbursement database (2004–2009) to define three reliable asthma patterns based on repeated positive answers to the ever asthma attack question: “never asthma” (n = 64,061); “inconsistent” (“yes” followed by “no”, n = 3,514); “consistent” (fully consistent positive answers, n = 2,853). The “Inconsistent” pattern was related to both long-term (childhood-onset asthma with remission in adulthood) and short-term (reported asthma attack in the last 12 months, associated with asthma medication) asthma variability, showing that repeated questions are relevant markers of the variable expression of asthma. Furthermore, in this pattern, the number of positive responses (1992–2005) predicted asthma drug consumption in subsequent years, a marker of disease severity. The “Inconsistent” pattern is a phenotype that may capture the variable expression of asthma. Repeated answers, even to a simple question, are too often neglected. PMID:23741466

  19. Developmental stage related patterns of codon usage and genomic GC content: searching for evolutionary fingerprints with models of stem cell differentiation

    PubMed Central

    2007-01-01

    Background The usage of synonymous codons shows considerable variation among mammalian genes. How and why this usage is non-random are fundamental biological questions and remain controversial. It is also important to explore whether mammalian genes that are selectively expressed at different developmental stages bear different molecular features. Results In two models of mouse stem cell differentiation, we established correlations between codon usage and the patterns of gene expression. We found that the optimal codons exhibited variation (AT- or GC-ending codons) in different cell types within the developmental hierarchy. We also found that genes that were enriched (developmental-pivotal genes) or specifically expressed (developmental-specific genes) at different developmental stages had different patterns of codon usage and local genomic GC (GCg) content. Moreover, at the same developmental stage, developmental-specific genes generally used more GC-ending codons and had higher GCg content compared with developmental-pivotal genes. Further analyses suggest that the model of translational selection might be consistent with the developmental stage-related patterns of codon usage, especially for the AT-ending optimal codons. In addition, our data show that after human-mouse divergence, the influence of selective constraints is still detectable. Conclusion Our findings suggest that developmental stage-related patterns of gene expression are correlated with codon usage (GC3) and GCg content in stem cell hierarchies. Moreover, this paper provides evidence for the influence of natural selection at synonymous sites in the mouse genome and novel clues for linking the molecular features of genes to their patterns of expression during mammalian ontogenesis. PMID:17349061

  20. X-linked gene expression in the Virginia opossum: differences between the paternally derived Gpd and Pgk-A loci

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Samollow, P.B.; Ford, A.L.; VandeBerg, J.L.

    1987-01-01

    Expression of X-linked glucose-6-phosphate dehydrogenase (G6PD) and phosphoglycerate kinase-A (PGK-A) in the Virginia opossum (Didelphis virginiana) was studied electrophoretically in animals from natural populations and those produced through controlled laboratory crosses. Blood from most of the wild animals exhibited a common single-banded phenotype for both enzymes. Rare variant animals, regardless of sex, exhibited single-banded phenotypes different in mobility from the common mobility class of the respective enzyme. The laboratory crosses confirmed the allelic basis for the common and rare phenotypes. Transmission of PGK-A phenotypes followed the pattern of determinate (nonrandom) inactivation of the paternally derived Pgk-A allele, and transmission ofmore » G6PD also was consistent with this pattern. A survey of tissue-specific expression of G6PD phenotypes of heterozygous females revealed, in almost all tissues, three-banded patterns skewed in favor of the allele that was expressed in blood cells. Three-banded patterns were never observed in males or in putatively homozygous females. These patterns suggest simultaneous, but unequal, expression of the maternally and paternally derived Gpd alleles within individual cells. The absence of such partial expression was noted in a parallel survey of females heterozygous at the Pgd-A locus. Thus, it appears that Gpd and Pgk-A are X-linked in D. virginiana and subject to preferential paternal allele inactivation, but that dosage compensation may not be complete for all paternally derived X-linked genes.« less

  1. Parallel Gene Expression Differences between Low and High Latitude Populations of Drosophila melanogaster and D. simulans

    PubMed Central

    Zhao, Li; Wit, Janneke; Svetec, Nicolas; Begun, David J.

    2015-01-01

    Gene expression variation within species is relatively common, however, the role of natural selection in the maintenance of this variation is poorly understood. Here we investigate low and high latitude populations of Drosophila melanogaster and its sister species, D. simulans, to determine whether the two species show similar patterns of population differentiation, consistent with a role for spatially varying selection in maintaining gene expression variation. We compared at two temperatures the whole male transcriptome of D. melanogaster and D. simulans sampled from Panama City (Panama) and Maine (USA). We observed a significant excess of genes exhibiting differential expression in both species, consistent with parallel adaptation to heterogeneous environments. Moreover, the majority of genes showing parallel expression differentiation showed the same direction of differential expression in the two species and the magnitudes of expression differences between high and low latitude populations were correlated across species, further bolstering the conclusion that parallelism for expression phenotypes results from spatially varying selection. However, the species also exhibited important differences in expression phenotypes. For example, the genomic extent of genotype × environment interaction was much more common in D. melanogaster. Highly differentiated SNPs between low and high latitudes were enriched in the 3’ UTRs and CDS of the geographically differently expressed genes in both species, consistent with an important role for cis-acting variants in driving local adaptation for expression-related phenotypes. PMID:25950438

  2. Parallel Gene Expression Differences between Low and High Latitude Populations of Drosophila melanogaster and D. simulans.

    PubMed

    Zhao, Li; Wit, Janneke; Svetec, Nicolas; Begun, David J

    2015-05-01

    Gene expression variation within species is relatively common, however, the role of natural selection in the maintenance of this variation is poorly understood. Here we investigate low and high latitude populations of Drosophila melanogaster and its sister species, D. simulans, to determine whether the two species show similar patterns of population differentiation, consistent with a role for spatially varying selection in maintaining gene expression variation. We compared at two temperatures the whole male transcriptome of D. melanogaster and D. simulans sampled from Panama City (Panama) and Maine (USA). We observed a significant excess of genes exhibiting differential expression in both species, consistent with parallel adaptation to heterogeneous environments. Moreover, the majority of genes showing parallel expression differentiation showed the same direction of differential expression in the two species and the magnitudes of expression differences between high and low latitude populations were correlated across species, further bolstering the conclusion that parallelism for expression phenotypes results from spatially varying selection. However, the species also exhibited important differences in expression phenotypes. For example, the genomic extent of genotype × environment interaction was much more common in D. melanogaster. Highly differentiated SNPs between low and high latitudes were enriched in the 3' UTRs and CDS of the geographically differently expressed genes in both species, consistent with an important role for cis-acting variants in driving local adaptation for expression-related phenotypes.

  3. Discovering biclusters in gene expression data based on high-dimensional linear geometries

    PubMed Central

    Gan, Xiangchao; Liew, Alan Wee-Chung; Yan, Hong

    2008-01-01

    Background In DNA microarray experiments, discovering groups of genes that share similar transcriptional characteristics is instrumental in functional annotation, tissue classification and motif identification. However, in many situations a subset of genes only exhibits consistent pattern over a subset of conditions. Conventional clustering algorithms that deal with the entire row or column in an expression matrix would therefore fail to detect these useful patterns in the data. Recently, biclustering has been proposed to detect a subset of genes exhibiting consistent pattern over a subset of conditions. However, most existing biclustering algorithms are based on searching for sub-matrices within a data matrix by optimizing certain heuristically defined merit functions. Moreover, most of these algorithms can only detect a restricted set of bicluster patterns. Results In this paper, we present a novel geometric perspective for the biclustering problem. The biclustering process is interpreted as the detection of linear geometries in a high dimensional data space. Such a new perspective views biclusters with different patterns as hyperplanes in a high dimensional space, and allows us to handle different types of linear patterns simultaneously by matching a specific set of linear geometries. This geometric viewpoint also inspires us to propose a generic bicluster pattern, i.e. the linear coherent model that unifies the seemingly incompatible additive and multiplicative bicluster models. As a particular realization of our framework, we have implemented a Hough transform-based hyperplane detection algorithm. The experimental results on human lymphoma gene expression dataset show that our algorithm can find biologically significant subsets of genes. Conclusion We have proposed a novel geometric interpretation of the biclustering problem. We have shown that many common types of bicluster are just different spatial arrangements of hyperplanes in a high dimensional data space. An implementation of the geometric framework using the Fast Hough transform for hyperplane detection can be used to discover biologically significant subsets of genes under subsets of conditions for microarray data analysis. PMID:18433477

  4. Evolution-development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures.

    PubMed

    Kohsokabe, Takahiro; Kaneko, Kunihiko

    2016-01-01

    Search for possible relationships between phylogeny and ontogeny is important in evolutionary-developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell-to-cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi-stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical-systems theory, which lead to the evolution-development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc.

  5. Evolution‐development congruence in pattern formation dynamics: Bifurcations in gene expression and regulation of networks structures

    PubMed Central

    Kohsokabe, Takahiro

    2016-01-01

    ABSTRACT Search for possible relationships between phylogeny and ontogeny is important in evolutionary‐developmental biology. Here we uncover such relationships by numerical evolution and unveil their origin in terms of dynamical systems theory. By representing developmental dynamics of spatially located cells with gene expression dynamics with cell‐to‐cell interaction under external morphogen gradient, gene regulation networks are evolved under mutation and selection with the fitness to approach a prescribed spatial pattern of expressed genes. For most numerical evolution experiments, evolution of pattern over generations and development of pattern by an evolved network exhibit remarkable congruence. Both in the evolution and development pattern changes consist of several epochs where stripes are formed in a short time, while for other temporal regimes, pattern hardly changes. In evolution, these quasi‐stationary regimes are generations needed to hit relevant mutations, while in development, they are due to some gene expression that varies slowly and controls the pattern change. The morphogenesis is regulated by combinations of feedback or feedforward regulations, where the upstream feedforward network reads the external morphogen gradient, and generates a pattern used as a boundary condition for the later patterns. The ordering from up to downstream is common in evolution and development, while the successive epochal changes in development and evolution are represented as common bifurcations in dynamical‐systems theory, which lead to the evolution‐development congruence. Mechanism of exceptional violation of the congruence is also unveiled. Our results provide a new look on developmental stages, punctuated equilibrium, developmental bottlenecks, and evolutionary acquisition of novelty in morphogenesis. J. Exp. Zool. (Mol. Dev. Evol.) 326B:61–84, 2016. © 2015 The Authors. Journal of Experimental Zoology Part B: Molecular and Developmental Evolution Published by Wiley Periodicals, Inc. PMID:26678220

  6. Wnt signaling underlies evolution and development of the butterfly wing pattern symmetry systems.

    PubMed

    Martin, Arnaud; Reed, Robert D

    2014-11-15

    Most butterfly wing patterns are proposed to be derived from a set of conserved pattern elements known as symmetry systems. Symmetry systems are so-named because they are often associated with parallel color stripes mirrored around linear organizing centers that run between the anterior and posterior wing margins. Even though the symmetry systems are the most prominent and diverse wing pattern elements, their study has been confounded by a lack of knowledge regarding the molecular basis of their development, as well as the difficulty of drawing pattern homologies across species with highly derived wing patterns. Here we present the first molecular characterization of symmetry system development by showing that WntA expression is consistently associated with the major basal, discal, central, and external symmetry system patterns of nymphalid butterflies. Pharmacological manipulations of signaling gradients using heparin and dextran sulfate showed that pattern organizing centers correspond precisely with WntA, wingless, Wnt6, and Wnt10 expression patterns, thus suggesting a role for Wnt signaling in color pattern induction. Importantly, this model is supported by recent genetic and population genomic work identifying WntA as the causative locus underlying wing pattern variation within several butterfly species. By comparing the expression of WntA between nymphalid butterflies representing a range of prototypical symmetry systems, slightly deviated symmetry systems, and highly derived wing patterns, we were able to infer symmetry system homologies in several challenging cases. Our work illustrates how highly divergent morphologies can be derived from modifications to a common ground plan across both micro- and macro-evolutionary time scales. Copyright © 2014 Elsevier Inc. All rights reserved.

  7. Juxtaposed genes in 7q21-22 amplicon contribute for two major gastric cancer sub-Types by mutual exclusive expression.

    PubMed

    Tamilzhalagan, Sembulingam; Muthuswami, Muthulakshmi; Ganesan, Kumaresan

    2017-04-01

    Genomic Copy Number Variations (CNV) and the associated gene signatures are useful for cancer prognosis, diagnosis, and targeted therapeutics. Earlier, 7q21-22 region was reported for frequent amplification in gastric cancer and potential candidate genes were identified. An analysis of the expression pattern of the 159 genes located in this amplicon revealed the consistent elevated expression of 21 genes in gastric tumors. These genes are closely arranged within the 20 Mb region, and they showed a bimodal expression pattern. SHFM1 and 14 other genes are expressed in intestinal type gastric tumors. COL1A2 and PCOLCE genes of this region are expressed in diffuse type gastric tumors. Similarly, genome-wide expression neighbors of SHFM1 and COL1A2 also showed mutually exclusive expression pattern, and stratify intestinal and diffuse type gastric tumors. The expression of COL1A2 gene-set is associated with poor prognosis, whereas the SHFM1 gene-set is associated with better prognosis among the gastric cancer patients. Despite being physical neighbors, the SHFM1 and COL1A2 genes express differentially in the two major clinical sub-types of gastric cancer in a mutually exclusive manner. The tight gene regulations operating between these juxtaposed genes deserve investigation to understand the molecular regulatory switch defining the determinants of the gastric cancer sub-types. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  8. Whole Genome Gene Expression Meta-Analysis of Inflammatory Bowel Disease Colon Mucosa Demonstrates Lack of Major Differences between Crohn's Disease and Ulcerative Colitis

    PubMed Central

    Østvik, Ann E.; Drozdov, Ignat; Gustafsson, Bjørn I.; Kidd, Mark; Beisvag, Vidar; Torp, Sverre H.; Waldum, Helge L.; Martinsen, Tom Christian; Damås, Jan Kristian; Espevik, Terje; Sandvik, Arne K.

    2013-01-01

    Background In inflammatory bowel disease (IBD), genetic susceptibility together with environmental factors disturbs gut homeostasis producing chronic inflammation. The two main IBD subtypes are Ulcerative colitis (UC) and Crohn’s disease (CD). We present the to-date largest microarray gene expression study on IBD encompassing both inflamed and un-inflamed colonic tissue. A meta-analysis including all available, comparable data was used to explore important aspects of IBD inflammation, thereby validating consistent gene expression patterns. Methods Colon pinch biopsies from IBD patients were analysed using Illumina whole genome gene expression technology. Differential expression (DE) was identified using LIMMA linear model in the R statistical computing environment. Results were enriched for gene ontology (GO) categories. Sets of genes encoding antimicrobial proteins (AMP) and proteins involved in T helper (Th) cell differentiation were used in the interpretation of the results. All available data sets were analysed using the same methods, and results were compared on a global and focused level as t-scores. Results Gene expression in inflamed mucosa from UC and CD are remarkably similar. The meta-analysis confirmed this. The patterns of AMP and Th cell-related gene expression were also very similar, except for IL23A which was consistently higher expressed in UC than in CD. Un-inflamed tissue from patients demonstrated minimal differences from healthy controls. Conclusions There is no difference in the Th subgroup involvement between UC and CD. Th1/Th17 related expression, with little Th2 differentiation, dominated both diseases. The different IL23A expression between UC and CD suggests an IBD subtype specific role. AMPs, previously little studied, are strongly overexpressed in IBD. The presented meta-analysis provides a sound background for further research on IBD pathobiology. PMID:23468882

  9. Whole genome gene expression meta-analysis of inflammatory bowel disease colon mucosa demonstrates lack of major differences between Crohn's disease and ulcerative colitis.

    PubMed

    Granlund, Atle van Beelen; Flatberg, Arnar; Østvik, Ann E; Drozdov, Ignat; Gustafsson, Bjørn I; Kidd, Mark; Beisvag, Vidar; Torp, Sverre H; Waldum, Helge L; Martinsen, Tom Christian; Damås, Jan Kristian; Espevik, Terje; Sandvik, Arne K

    2013-01-01

    In inflammatory bowel disease (IBD), genetic susceptibility together with environmental factors disturbs gut homeostasis producing chronic inflammation. The two main IBD subtypes are Ulcerative colitis (UC) and Crohn's disease (CD). We present the to-date largest microarray gene expression study on IBD encompassing both inflamed and un-inflamed colonic tissue. A meta-analysis including all available, comparable data was used to explore important aspects of IBD inflammation, thereby validating consistent gene expression patterns. Colon pinch biopsies from IBD patients were analysed using Illumina whole genome gene expression technology. Differential expression (DE) was identified using LIMMA linear model in the R statistical computing environment. Results were enriched for gene ontology (GO) categories. Sets of genes encoding antimicrobial proteins (AMP) and proteins involved in T helper (Th) cell differentiation were used in the interpretation of the results. All available data sets were analysed using the same methods, and results were compared on a global and focused level as t-scores. Gene expression in inflamed mucosa from UC and CD are remarkably similar. The meta-analysis confirmed this. The patterns of AMP and Th cell-related gene expression were also very similar, except for IL23A which was consistently higher expressed in UC than in CD. Un-inflamed tissue from patients demonstrated minimal differences from healthy controls. There is no difference in the Th subgroup involvement between UC and CD. Th1/Th17 related expression, with little Th2 differentiation, dominated both diseases. The different IL23A expression between UC and CD suggests an IBD subtype specific role. AMPs, previously little studied, are strongly overexpressed in IBD. The presented meta-analysis provides a sound background for further research on IBD pathobiology.

  10. Social Risk and Depression: Evidence from Manual and Automatic Facial Expression Analysis

    PubMed Central

    Girard, Jeffrey M.; Cohn, Jeffrey F.; Mahoor, Mohammad H.; Mavadati, Seyedmohammad; Rosenwald, Dean P.

    2014-01-01

    Investigated the relationship between change over time in severity of depression symptoms and facial expression. Depressed participants were followed over the course of treatment and video recorded during a series of clinical interviews. Facial expressions were analyzed from the video using both manual and automatic systems. Automatic and manual coding were highly consistent for FACS action units, and showed similar effects for change over time in depression severity. For both systems, when symptom severity was high, participants made more facial expressions associated with contempt, smiled less, and those smiles that occurred were more likely to be accompanied by facial actions associated with contempt. These results are consistent with the “social risk hypothesis” of depression. According to this hypothesis, when symptoms are severe, depressed participants withdraw from other people in order to protect themselves from anticipated rejection, scorn, and social exclusion. As their symptoms fade, participants send more signals indicating a willingness to affiliate. The finding that automatic facial expression analysis was both consistent with manual coding and produced the same pattern of depression effects suggests that automatic facial expression analysis may be ready for use in behavioral and clinical science. PMID:24598859

  11. Analysis of the pattern of expression of the Fanconi anemia group C (Facc) gene during murine development

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krasnoshtein, F.; Buchwald, M.

    1994-09-01

    Fanconi anemia (FA) is an autosomal recessive disorder characterized by a variety of congenital and skeletal malformations, progressive pancytopanenia and predisposition to malignancies. FA cells display chromosomal instability and hypersensitivity to DNA-damaging agents. Both the human and the corresponding murine cDNAs have been cloned in our lab. Here we describe the expression of Facc during mouse development, using mRNA in situ hybridization. Our aim is to obtain clues on the possible function of the Facc gene product during development that may help elucidate basic defect(s) in FA. In addition, knowledge of the exact pattern of Facc expression will assist inmore » interpreting the phenotypes of mutant mice, currently being developed. In embryos the gene is diffusely expressed over the entire embryo, with higher hybridization levels in the mesenchyme and in both upper and lower extremities. Specific expression of Facc is seen in the perichondrium and marrow of long bones of hind limbs/hip; long bones of front limbs/shoulder region; developing digits of front and hind paws; and ribs. The signal is also detected in the following regions: cranial/frontal; facial/periorbital and maxillary/mandibular, hair follicles, diaphragm and lung. In addition, generalized Facc expression is seen during these embryonic stages. The pattern of Facc expression is consistent with the known skeletal abnormalities in FA patients, which include radial ray deformities, metacarpal hypoplasia, and abnormalities of lower limbs, ribs, head and face. The signal in the lung is consistent with the lung lobe absence and abnormal pulmonary drainage that have been detected in some FA patients. The sloped forehead and microcephaly in FA patients may have some association with the signal seen in the frontal region of the mouse cranium. Taken together, our results suggest that Facc is directly involved in the development of various embryonic tissues, particularly bone.« less

  12. Isolation and expression of scabrous, a gene regulating neurogenesis in Drosophila.

    PubMed

    Mlodzik, M; Baker, N E; Rubin, G M

    1990-11-01

    Mutations in the Drosophila scabrous (sca) gene affect eye and bristle development, leading to irregular spacing of ommatidia and bristle duplications in the adult fly. We have cloned the sca gene by P-element tagging. The sca transcription unit is 12 kb and consists of four exons that are joined in a 3.2-kb mRNA. In an enhancer trap screen we have isolated several P[lacZ] insertions close to the sca transcription start site. We have examined the expression pattern of sca by in situ hybridization to sca transcripts, by beta-galactosidase localization in the P[lacZ] lines, and by immunocytochemistry with an anti-sca antiserum. During embryogenesis, sca is expressed in a dynamic pattern associated with neural development. During imaginal development, sca is mainly expressed in the R8 photoreceptor precursor cells in the eye imaginal disc and in sensory organ precursor cells in other discs. In the wing disc, sca expression is coextensive with the anlagen for bristles and is controlled by genes of the achaete-scute complex. Based on its loss-of-function phenotype, expression pattern, and the predicted structure of its product, a secreted peptide with homology to the fibrinogen gene family, we propose that sca encodes a signal involved in lateral inhibition within individual domains of the developing nervous system.

  13. Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization[OPEN

    PubMed Central

    Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Peng, Huiru; Sun, Qixin; Ni, Zhongfu

    2018-01-01

    Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid (Aegilops spp), tetraploid, and hexaploid wheat (Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. PMID:29298834

  14. Who I am depends on how I feel: the role of affect in the expression of culture.

    PubMed

    Ashton-James, Claire E; Maddux, William W; Galinsky, Adam D; Chartrand, Tanya L

    2009-03-01

    We present a novel role of affect in the expression of culture. Four experiments tested whether individuals' affective states moderate the expression of culturally normative cognitions and behaviors. We consistently found that value expressions, self-construals, and behaviors were less consistent with cultural norms when individuals were experiencing positive rather than negative affect. Positive affect allowed individuals to explore novel thoughts and behaviors that departed from cultural constraints, whereas negative affect bound people to cultural norms. As a result, when Westerners experienced positive rather than negative affect, they valued self-expression less, showed a greater preference for objects that reflected conformity, viewed the self in more interdependent terms, and sat closer to other people. East Asians showed the reverse pattern for each of these measures, valuing and expressing individuality and independence more when experiencing positive than when experiencing negative affect. The results suggest that affect serves an important functional purpose of attuning individuals more or less closely to their cultural heritage.

  15. Local Context Finder (LCF) reveals multidimensional relationships among mRNA expression profiles of Arabidopsis responding to pathogen infection

    PubMed Central

    Katagiri, Fumiaki; Glazebrook, Jane

    2003-01-01

    A major task in computational analysis of mRNA expression profiles is definition of relationships among profiles on the basis of similarities among them. This is generally achieved by pattern recognition in the distribution of data points representing each profile in a high-dimensional space. Some drawbacks of commonly used pattern recognition algorithms stem from their use of a globally linear space and/or limited degrees of freedom. A pattern recognition method called Local Context Finder (LCF) is described here. LCF uses nonlinear dimensionality reduction for pattern recognition. Then it builds a network of profiles based on the nonlinear dimensionality reduction results. LCF was used to analyze mRNA expression profiles of the plant host Arabidopsis interacting with the bacterial pathogen Pseudomonas syringae. In one case, LCF revealed two dimensions essential to explain the effects of the NahG transgene and the ndr1 mutation on resistant and susceptible responses. In another case, plant mutants deficient in responses to pathogen infection were classified on the basis of LCF analysis of their profiles. The classification by LCF was consistent with the results of biological characterization of the mutants. Thus, LCF is a powerful method for extracting information from expression profile data. PMID:12960373

  16. Ectopic application of recombinant BMP-2 and BMP-4 can change patterning of developing chick facial primordia.

    PubMed

    Barlow, A J; Francis-West, P H

    1997-01-01

    The facial primordia initially consist of buds of undifferentiated mesenchyme, which give rise to a variety of tissues including cartilage, muscle and nerve. These must be arranged in a precise spatial order for correct function. The signals that control facial outgrowth and patterning are largely unknown. The bone morphogenetic proteins Bmp-2 and Bmp-4 are expressed in discrete regions at the distal tips of the early facial primordia suggesting possible roles for BMP-2 and BMP-4 during chick facial development. We show that expression of Bmp-4 and Bmp-2 is correlated with the expression of Msx-1 and Msx-2 and that ectopic application of BMP-2 and BMP-4 can activate Msx-1 and Msx-2 gene expression in the developing facial primordia. We correlate this activation of gene expression with changes in skeletal development. For example, activation of Msx-1 gene expression across the distal tip of the mandibular primordium is associated with an extension of Fgf-4 expression in the epithelium and bifurcation of Meckel's cartilage. In the maxillary primordium, extension of the normal domain of Msx-1 gene expression is correlated with extended epithelial expression of shh and bifurcation of the palatine bone. We also show that application of BMP-2 can increase cell proliferation of the mandibular primordia. Our data suggest that BMP-2 and BMP-4 are part of a signalling cascade that controls outgrowth and patterning of the facial primordia.

  17. Expression profiling of genes modulated by minocycline in a rat model of neuropathic pain

    PubMed Central

    2014-01-01

    Background The molecular mechanisms underlying neuropathic pain are constantly being studied to create new opportunities to prevent or alleviate neuropathic pain. The aim of our study was to determine the gene expression changes induced by sciatic nerve chronic constriction injury (CCI) that are modulated by minocycline, which can effectively diminish neuropathic pain in animal studies. The genes associated with minocycline efficacy in neuropathic pain should provide insight into the etiology of neuropathic pain and identify novel therapeutic targets. Results We screened the ipsilateral dorsal part of the lumbar spinal cord of the rat CCI model for differentially expressed genes. Out of 22,500 studied transcripts, the abundance levels of 93 transcripts were altered following sciatic nerve ligation. Percentage analysis revealed that 54 transcripts were not affected by the repeated administration of minocycline (30 mg/kg, i.p.), but the levels of 39 transcripts were modulated following minocycline treatment. We then selected two gene expression patterns, B1 and B2. The first transcription pattern, B1, consisted of 10 mRNA transcripts that increased in abundance after injury, and minocycline treatment reversed or inhibited the effect of the injury; the B2 transcription pattern consisted of 7 mRNA transcripts whose abundance decreased following sciatic nerve ligation, and minocycline treatment reversed the effect of the injury. Based on the literature, we selected seven genes for further analysis: Cd40, Clec7a, Apobec3b, Slc7a7, and Fam22f from pattern B1 and Rwdd3 and Gimap5 from pattern B2. Additionally, these genes were analyzed using quantitative PCR to determine the transcriptional changes strongly related to the development of neuropathic pain; the ipsilateral DRGs (L4-L6) were also collected and analyzed in these rats using qPCR. Conclusion In this work, we confirmed gene expression alterations previously identified by microarray analysis in the spinal cord and analyzed the expression of selected genes in the DRG. Moreover, we reviewed the literature to illustrate the relevance of these findings for neuropathic pain development and therapy. Further studies are needed to elucidate the roles of the individual genes in neuropathic pain and to determine the therapeutic role of minocycline in the rat neuropathic pain model. PMID:25038616

  18. A Machine Learning Approach to Discover Rules for Expressive Performance Actions in Jazz Guitar Music.

    PubMed

    Giraldo, Sergio I; Ramirez, Rafael

    2016-01-01

    Expert musicians introduce expression in their performances by manipulating sound properties such as timing, energy, pitch, and timbre. Here, we present a data driven computational approach to induce expressive performance rule models for note duration, onset, energy, and ornamentation transformations in jazz guitar music. We extract high-level features from a set of 16 commercial audio recordings (and corresponding music scores) of jazz guitarist Grant Green in order to characterize the expression in the pieces. We apply machine learning techniques to the resulting features to learn expressive performance rule models. We (1) quantitatively evaluate the accuracy of the induced models, (2) analyse the relative importance of the considered musical features, (3) discuss some of the learnt expressive performance rules in the context of previous work, and (4) assess their generailty. The accuracies of the induced predictive models is significantly above base-line levels indicating that the audio performances and the musical features extracted contain sufficient information to automatically learn informative expressive performance patterns. Feature analysis shows that the most important musical features for predicting expressive transformations are note duration, pitch, metrical strength, phrase position, Narmour structure, and tempo and key of the piece. Similarities and differences between the induced expressive rules and the rules reported in the literature were found. Differences may be due to the fact that most previously studied performance data has consisted of classical music recordings. Finally, the rules' performer specificity/generality is assessed by applying the induced rules to performances of the same pieces performed by two other professional jazz guitar players. Results show a consistency in the ornamentation patterns between Grant Green and the other two musicians, which may be interpreted as a good indicator for generality of the ornamentation rules.

  19. A Machine Learning Approach to Discover Rules for Expressive Performance Actions in Jazz Guitar Music

    PubMed Central

    Giraldo, Sergio I.; Ramirez, Rafael

    2016-01-01

    Expert musicians introduce expression in their performances by manipulating sound properties such as timing, energy, pitch, and timbre. Here, we present a data driven computational approach to induce expressive performance rule models for note duration, onset, energy, and ornamentation transformations in jazz guitar music. We extract high-level features from a set of 16 commercial audio recordings (and corresponding music scores) of jazz guitarist Grant Green in order to characterize the expression in the pieces. We apply machine learning techniques to the resulting features to learn expressive performance rule models. We (1) quantitatively evaluate the accuracy of the induced models, (2) analyse the relative importance of the considered musical features, (3) discuss some of the learnt expressive performance rules in the context of previous work, and (4) assess their generailty. The accuracies of the induced predictive models is significantly above base-line levels indicating that the audio performances and the musical features extracted contain sufficient information to automatically learn informative expressive performance patterns. Feature analysis shows that the most important musical features for predicting expressive transformations are note duration, pitch, metrical strength, phrase position, Narmour structure, and tempo and key of the piece. Similarities and differences between the induced expressive rules and the rules reported in the literature were found. Differences may be due to the fact that most previously studied performance data has consisted of classical music recordings. Finally, the rules' performer specificity/generality is assessed by applying the induced rules to performances of the same pieces performed by two other professional jazz guitar players. Results show a consistency in the ornamentation patterns between Grant Green and the other two musicians, which may be interpreted as a good indicator for generality of the ornamentation rules. PMID:28066290

  20. Plant adaptive radiation mediated by polyploid plasticity in transcriptomes.

    PubMed

    Shimizu-Inatsugi, Rie; Terada, Aika; Hirose, Kyosuke; Kudoh, Hiroshi; Sese, Jun; Shimizu, Kentaro K

    2017-01-01

    The habitats of polyploid species are generally distinct from their parental species. Stebbins described polyploids as 'general purpose genotypes', which can tolerate a wide range of environmental conditions. However, little is known about its molecular basis because of the complexity of polyploid genomes. We hypothesized that allopolyploid species might utilize the expression patterns of both parents depending on environments (polyploid plasticity hypothesis). We focused on hydrological niche segregation along fine-scale soil moisture and waterlogging gradients. Two diploid species, Cardamine amara and Cardamine hirsuta, grew best in submerged and unsubmerged conditions, respectively, consistent with their natural habitats. Interestingly, the allotetraploid Cardamine flexuosa derived from them grew similarly in fluctuating as well as submerged and unsubmerged conditions, consistent with its wide environmental tolerance. A similar pattern was found in another species trio: allotetraploid Cardamine scutata and its parents. Using the close relatedness of Cardamine and Arabidopsis, we quantified genomewide expression patterns following dry and wet treatments using an Arabidopsis microarray. Hierarchical clustering analysis revealed that the expression pattern of C. flexuosa clustered with C. hirsuta in the dry condition and with C. amara in the wet condition, supporting our hypothesis. Furthermore, the induction levels of most genes in the allopolyploid were lower than in a specialist diploid species. This reflects a disadvantage of being allopolyploid arising from fixed heterozygosity. We propose that recurrent allopolyploid speciation along soil moisture and waterlogging gradients confers niche differentiation and reproductive isolation simultaneously and serves as a model for studying the molecular basis of ecological speciation and adaptive radiation. © 2016 The Authors. Molecular Ecology Published by John Wiley & Sons Ltd.

  1. Claudin gene expression patterns do not associate with interspecific differences in paracellular nutrient absorption.

    PubMed

    Price, Edwin R; Rott, Katherine H; Caviedes-Vidal, Enrique; Karasov, William H

    2016-01-01

    Bats exhibit higher paracellular absorption of glucose-sized molecules than non-flying mammals, a phenomenon that may be driven by higher permeability of the intestinal tight junctions. The various claudins, occludin, and other proteins making up the tight junctions are thought to determine their permeability properties. Here we show that absorption of the paracellular probe l-arabinose is higher in a bat (Eptesicus fuscus) than in a vole (Microtus pennsylvanicus) or a hedgehog (Atelerix albiventris). Furthermore, histological measurements demonstrated that hedgehogs have many more enterocytes in their intestines, suggesting that bats cannot have higher absorption of arabinose simply by having more tight junctions. We therefore investigated the mRNA levels of several claudins and occludin, because these proteins may affect permeability of tight junctions to macronutrients. To assess the expression levels of claudins per tight junction, we normalized the mRNA levels of the claudins to the constitutively expressed tight junction protein ZO-1, and combined these with measurements previously made in a bat and a rodent to determine if there were among-species differences. Although expression ratios of several genes varied among species, there was not a consistent difference between bats and non-flyers in the expression ratio of any particular gene. Protein expression patterns may differ from mRNA expression patterns, and might better explain differences among species in arabinose absorption. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Mechanisms Underlying Adaptation to Life in Hydrogen Sulfide–Rich Environments

    PubMed Central

    Kelley, Joanna L.; Arias-Rodriguez, Lenin; Patacsil Martin, Dorrelyn; Yee, Muh-Ching; Bustamante, Carlos D.; Tobler, Michael

    2016-01-01

    Hydrogen sulfide (H2S) is a potent toxicant interfering with oxidative phosphorylation in mitochondria and creating extreme environmental conditions in aquatic ecosystems. The mechanistic basis of adaptation to perpetual exposure to H2S remains poorly understood. We investigated evolutionarily independent lineages of livebearing fishes that have colonized and adapted to springs rich in H2S and compared their genome-wide gene expression patterns with closely related lineages from adjacent, nonsulfidic streams. Significant differences in gene expression were uncovered between all sulfidic and nonsulfidic population pairs. Variation in the number of differentially expressed genes among population pairs corresponded to differences in divergence times and rates of gene flow, which is consistent with neutral drift driving a substantial portion of gene expression variation among populations. Accordingly, there was little evidence for convergent evolution shaping large-scale gene expression patterns among independent sulfide spring populations. Nonetheless, we identified a small number of genes that was consistently differentially expressed in the same direction in all sulfidic and nonsulfidic population pairs. Functional annotation of shared differentially expressed genes indicated upregulation of genes associated with enzymatic H2S detoxification and transport of oxidized sulfur species, oxidative phosphorylation, energy metabolism, and pathways involved in responses to oxidative stress. Overall, our results suggest that modification of processes associated with H2S detoxification and toxicity likely complement each other to mediate elevated H2S tolerance in sulfide spring fishes. Our analyses allow for the development of novel hypotheses about biochemical and physiological mechanisms of adaptation to extreme environments. PMID:26861137

  3. Expression profiling of snoRNAs in normal hematopoiesis and AML

    PubMed Central

    Warner, Wayne A.; Spencer, David H.; Trissal, Maria; White, Brian S.; Helton, Nichole; Ley, Timothy J.

    2018-01-01

    Small nucleolar RNAs (snoRNAs) are noncoding RNAs that contribute to ribosome biogenesis and RNA splicing by modifying ribosomal RNA and spliceosome RNAs, respectively. We optimized a next-generation sequencing approach and a custom analysis pipeline to identify and quantify expression of snoRNAs in acute myeloid leukemia (AML) and normal hematopoietic cell populations. We show that snoRNAs are expressed in a lineage- and development-specific fashion during hematopoiesis. The most striking examples involve snoRNAs located in 2 imprinted loci, which are highly expressed in hematopoietic progenitors and downregulated during myeloid differentiation. Although most snoRNAs are expressed at similar levels in AML cells compared with CD34+, a subset of snoRNAs showed consistent differential expression, with the great majority of these being decreased in the AML samples. Analysis of host gene expression, splicing patterns, and whole-genome sequence data for mutational events did not identify transcriptional patterns or genetic alterations that account for these expression differences. These data provide a comprehensive analysis of the snoRNA transcriptome in normal and leukemic cells and should be helpful in the design of studies to define the contribution of snoRNAs to normal and malignant hematopoiesis. PMID:29365324

  4. Evolution and inheritance of early embryonic patterning in D. simulans and D. sechellia

    PubMed Central

    Lott, Susan E.; Ludwig, Michael Z.; Kreitman, Martin

    2010-01-01

    Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation which selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth ‘stripe allometry’) in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species D. simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the “margin of error” for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness PMID:21121913

  5. The miR172 target TOE3 represses AGAMOUS expression during Arabidopsis floral patterning.

    PubMed

    Jung, Jae-Hoon; Lee, Sangmin; Yun, Ju; Lee, Minyoung; Park, Chung-Mo

    2014-02-01

    microRNA172 (miR172) regulates phase transition and floral patterning in Arabidopsis by repressing targets that encode the APETALA2 (AP2) and AP2-like transcription factors. The miR172-mediated repression of the AP2 gene restricts AGAMOUS (AG) expression. In addition, most miR172 targets, including AP2, redundantly act as floral repressors, and the overexpression of the target genes causes delayed flowering. However, how miR172 targets other than AP2 regulate both of the developmental processes remains unclear. Here, we demonstrate that miR172-mediated repression of the TARGET OF EAT 3 (TOE3) gene is critical for floral patterning in Arabidopsis. Transgenic plants that overexpress a miR172-resistant TOE3 gene (rTOE3-ox) exhibit indeterminate flowers with numerous stamens and carpelloid organs, which is consistent with previous observations in transgenic plants that overexpress a miR172-resistant AP2 gene. TOE3 binds to the second intron of the AG gene. Accordingly, AG expression is significantly reduced in rTOE3-ox plants. TOE3 also interacts with AP2 in the nucleus. Given the major role of AP2 in floral patterning, miR172 likely regulates TOE3 in floral patterning, at least in part via AP2. In addition, a miR156 target SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 3 directly activates TOE3 expression, revealing a novel signaling interaction between miR156 and miR172 in floral patterning. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  6. Pattern Genes Suggest Functional Connectivity of Organs

    NASA Astrophysics Data System (ADS)

    Qin, Yangmei; Pan, Jianbo; Cai, Meichun; Yao, Lixia; Ji, Zhiliang

    2016-05-01

    Human organ, as the basic structural and functional unit in human body, is made of a large community of different cell types that organically bound together. Each organ usually exerts highly specified physiological function; while several related organs work smartly together to perform complicated body functions. In this study, we present a computational effort to understand the roles of genes in building functional connection between organs. More specifically, we mined multiple transcriptome datasets sampled from 36 human organs and tissues, and quantitatively identified 3,149 genes whose expressions showed consensus modularly patterns: specific to one organ/tissue, selectively expressed in several functionally related tissues and ubiquitously expressed. These pattern genes imply intrinsic connections between organs. According to the expression abundance of the 766 selective genes, we consistently cluster the 36 human organs/tissues into seven functional groups: adipose & gland, brain, muscle, immune, metabolism, mucoid and nerve conduction. The organs and tissues in each group either work together to form organ systems or coordinate to perform particular body functions. The particular roles of specific genes and selective genes suggest that they could not only be used to mechanistically explore organ functions, but also be designed for selective biomarkers and therapeutic targets.

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in themore » genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural territories in larval and juvenile polyp stages. This pattern is consistent with a possible role in patterning the Nematostella nervous system. We propose a scenario in which Lhx genes play a homologous role in neural patterning across eumetazoans.« less

  8. Tissue distribution and early developmental expression patterns of aldolase A, B, and C in grass carp Ctenopharyngodon idellus.

    PubMed

    Fan, J J; Bai, J J; Ma, D M; Yu, L Y; Jiang, P

    2017-09-27

    Aldolase is a key enzyme involved in glycolysis, gluconeogenesis, and the pentose phosphate pathway. To establish the expression patterns of all three aldolase isozyme genes in different tissues and during early embryogenesis in lower vertebrates, as well as to explore the functional differences between these three isozymes, the grass carp was selected as a model owing to its relatively high glucose-metabolizing capability. Based on the cDNA sequences of the aldolase A, B, and C genes, the expression patterns of these three isozymes were analyzed in different tissues and during early embryogenesis using quantitative real-time polymerase chain reaction (qRT-PCR). Sequence analysis of cDNAs indicated that aldolase A, B, and C (GenBank accession numbers: KM192250, KM192251, and KM192252) consist of 364, 364, and 363 amino acids, respectively. The qRT-PCR results showed that the expression levels of aldolase A, B, and C were highest in the muscle, liver, and brain, respectively. Aldolase A and C exhibited similar expression patterns during embryogenesis, with high levels observed in unfertilized and fertilized eggs and at the blastocyst stage, followed by a decline and then increase after organogenesis. In contrast, aldolase B transcript was not detected during the unfertilized egg stage, and appeared only from gastrulation; the expression increased markedly during the feeding period (72 h after hatching), at which point the level was higher than those of aldolase A and C. These data suggest that the glucose content of grass carp starter feed should be adjusted according to the metabolic activity of aldolase B.

  9. Global transgenerational gene expression dynamics in two newly synthesized allohexaploid wheat (Triticum aestivum) lines

    PubMed Central

    2012-01-01

    Background Alteration in gene expression resulting from allopolyploidization is a prominent feature in plants, but its spectrum and extent are not fully known. Common wheat (Triticum aestivum) was formed via allohexaploidization about 10,000 years ago, and became the most important crop plant. To gain further insights into the genome-wide transcriptional dynamics associated with the onset of common wheat formation, we conducted microarray-based genome-wide gene expression analysis on two newly synthesized allohexaploid wheat lines with chromosomal stability and a genome constitution analogous to that of the present-day common wheat. Results Multi-color GISH (genomic in situ hybridization) was used to identify individual plants from two nascent allohexaploid wheat lines between Triticum turgidum (2n = 4x = 28; genome BBAA) and Aegilops tauschii (2n = 2x = 14; genome DD), which had a stable chromosomal constitution analogous to that of common wheat (2n = 6x = 42; genome BBAADD). Genome-wide analysis of gene expression was performed for these allohexaploid lines along with their parental plants from T. turgidum and Ae. tauschii, using the Affymetrix Gene Chip Wheat Genome-Array. Comparison with the parental plants coupled with inclusion of empirical mid-parent values (MPVs) revealed that whereas the great majority of genes showed the expected parental additivity, two major patterns of alteration in gene expression in the allohexaploid lines were identified: parental dominance expression and non-additive expression. Genes involved in each of the two altered expression patterns could be classified into three distinct groups, stochastic, heritable and persistent, based on their transgenerational heritability and inter-line conservation. Strikingly, whereas both altered patterns of gene expression showed a propensity of inheritance, identity of the involved genes was highly stochastic, consistent with the involvement of diverse Gene Ontology (GO) terms. Nonetheless, those genes showing non-additive expression exhibited a significant enrichment for vesicle-function. Conclusions Our results show that two patterns of global alteration in gene expression are conditioned by allohexaploidization in wheat, that is, parental dominance expression and non-additive expression. Both altered patterns of gene expression but not the identity of the genes involved are likely to play functional roles in stabilization and establishment of the newly formed allohexaploid plants, and hence, relevant to speciation and evolution of T. aestivum. PMID:22277161

  10. Genomic Imprinting Was Evolutionarily Conserved during Wheat Polyploidization.

    PubMed

    Yang, Guanghui; Liu, Zhenshan; Gao, Lulu; Yu, Kuohai; Feng, Man; Yao, Yingyin; Peng, Huiru; Hu, Zhaorong; Sun, Qixin; Ni, Zhongfu; Xin, Mingming

    2018-01-01

    Genomic imprinting is an epigenetic phenomenon that causes genes to be differentially expressed depending on their parent of origin. To evaluate the evolutionary conservation of genomic imprinting and the effects of ploidy on this process, we investigated parent-of-origin-specific gene expression patterns in the endosperm of diploid ( Aegilops spp), tetraploid, and hexaploid wheat ( Triticum spp) at various stages of development via high-throughput transcriptome sequencing. We identified 91, 135, and 146 maternally or paternally expressed genes (MEGs or PEGs, respectively) in diploid, tetraploid, and hexaploid wheat, respectively, 52.7% of which exhibited dynamic expression patterns at different developmental stages. Gene Ontology enrichment analysis suggested that MEGs and PEGs were involved in metabolic processes and DNA-dependent transcription, respectively. Nearly half of the imprinted genes exhibited conserved expression patterns during wheat hexaploidization. In addition, 40% of the homoeolog pairs originating from whole-genome duplication were consistently maternally or paternally biased in the different subgenomes of hexaploid wheat. Furthermore, imprinted expression was found for 41.2% and 50.0% of homolog pairs that evolved by tandem duplication after genome duplication in tetraploid and hexaploid wheat, respectively. These results suggest that genomic imprinting was evolutionarily conserved between closely related Triticum and Aegilops species and in the face of polyploid hybridization between species in these genera. © 2018 American Society of Plant Biologists. All rights reserved.

  11. An Integrated Analysis of MicroRNA and mRNA Expression Profiles to Identify RNA Expression Signatures in Lambskin Hair Follicles in Hu Sheep

    PubMed Central

    Lv, Xiaoyang; Sun, Wei; Yin, Jinfeng; Ni, Rong; Su, Rui; Wang, Qingzeng; Gao, Wen; Bao, Jianjun; Yu, Jiarui; Wang, Lihong; Chen, Ling

    2016-01-01

    Wave patterns in lambskin hair follicles are an important factor determining the quality of sheep’s wool. Hair follicles in lambskin from Hu sheep, a breed unique to China, have 3 types of waves, designated as large, medium, and small. The quality of wool from small wave follicles is excellent, while the quality of large waves is considered poor. Because no molecular and biological studies on hair follicles of these sheep have been conducted to date, the molecular mechanisms underlying the formation of different wave patterns is currently unknown. The aim of this article was to screen the candidate microRNAs (miRNA) and genes for the development of hair follicles in Hu sheep. Two-day-old Hu lambs were selected from full-sib individuals that showed large, medium, and small waves. Integrated analysis of microRNA and mRNA expression profiles employed high-throughout sequencing technology. Approximately 13, 24, and 18 differentially expressed miRNAs were found between small and large waves, small and medium waves, and medium and large waves, respectively. A total of 54, 190, and 81 differentially expressed genes were found between small and large waves, small and medium waves, and medium and large waves, respectively, by RNA sequencing (RNA-seq) analysis. Differentially expressed genes were classified using gene ontology and pathway analyses. They were found to be mainly involved in cell differentiation, proliferation, apoptosis, growth, immune response, and ion transport, and were associated with MAPK and the Notch signaling pathway. Reverse transcription-polymerase chain reaction (RT-PCR) analyses of differentially-expressed miRNA and genes were consistent with sequencing results. Integrated analysis of miRNA and mRNA expression indicated that, compared to small waves, large waves included 4 downregulated miRNAs that had regulatory effects on 8 upregulated genes and 3 upregulated miRNAs, which in turn influenced 13 downregulated genes. Compared to small waves, medium waves included 13 downregulated miRNAs that had regulatory effects on 64 upregulated genes and 4 upregulated miRNAs, which in turn had regulatory effects on 22 downregulated genes. Compared to medium waves, large waves consisted of 13 upregulated miRNAs that had regulatory effects on 48 downregulated genes. These differentially expressed miRNAs and genes may play a significant role in forming different patterns, and provide evidence for the molecular mechanisms underlying the formation of hair follicles of varying patterns. PMID:27404636

  12. Depression, self-esteem and anger expression patterns of Korean nursing students.

    PubMed

    Cha, N H; Sok, S R

    2014-03-01

    According to previous studies, nursing students' anger expression patterns, depression and self-esteem significantly affected the physical and mental well-being of patients. It is of utmost importance that the relationship among them is thoroughly investigated in this study. The purpose of this study was to examine the degrees of anger expression patterns, depression and self-esteem of Korean nursing students and to examine the correlations among them. This was a descriptive cross-sectional study. The subjects consisted of 320 Korean nursing students at colleges in S and G city, Korea. The measurements were based on the Korean standard STAXI (State-Trait Anger Expression Inventory), SCL-90-R (Symptom Checklist-90-Revision) and SLCS-R (Self-Liking/Self-Competence Scale-Revised Version). In the analysis of the degrees of variances, the subjects showed lower anger repression, anger expression, control of anger and depression. The degree of self-esteem revealed a higher than the median value. There were significant correlations among anger expression patterns (anger repression, anger expression and anger control), depression and self-esteem. The study limitations were the degree of representativeness of the setting and sample, and its generalizability. Based on the findings of this study, interventions are needed for Korean nursing students in order to promote anger management and improved self-esteem. The development of an anger control programme for nursing students should focus on lowering depression and enhancing self-esteem. One of the policy issues focused on providing anger management programmes for lowering depression and enhancing self-esteem. This study will enable nursing students to recognize the importance of controlling their anger, enhancing their self-esteem, establishing positive emotions and improving their overall well-being as future professional nurses. © 2013 International Council of Nurses.

  13. Neurally Derived Tissues in Xenopus laevis Embryos Exhibit a Consistent Bioelectrical Left-Right Asymmetry

    PubMed Central

    Pai, Vaibhav P.; Vandenberg, Laura N.; Blackiston, Douglas; Levin, Michael

    2012-01-01

    Consistent left-right asymmetry in organ morphogenesis is a fascinating aspect of bilaterian development. Although embryonic patterning of asymmetric viscera, heart, and brain is beginning to be understood, less is known about possible subtle asymmetries present in anatomically identical paired structures. We investigated two important developmental events: physiological controls of eye development and specification of neural crest derivatives, in Xenopus laevis embryos. We found that the striking hyperpolarization of transmembrane potential (V mem) demarcating eye induction usually occurs in the right eye field first. This asymmetry is randomized by perturbing visceral left-right patterning, suggesting that eye asymmetry is linked to mechanisms establishing primary laterality. Bilateral misexpression of a depolarizing channel mRNA affects primarily the right eye, revealing an additional functional asymmetry in the control of eye patterning by V mem. The ATP-sensitive K+ channel subunit transcript, SUR1, is asymmetrically expressed in the eye primordia, thus being a good candidate for the observed physiological asymmetries. Such subtle asymmetries are not only seen in the eye: consistent asymmetry was also observed in the migration of differentiated melanocytes on the left and right sides. These data suggest that even anatomically symmetrical structures may possess subtle but consistent laterality and interact with other developmental left-right patterning pathways. PMID:23346115

  14. Neurally Derived Tissues in Xenopus laevis Embryos Exhibit a Consistent Bioelectrical Left-Right Asymmetry.

    PubMed

    Pai, Vaibhav P; Vandenberg, Laura N; Blackiston, Douglas; Levin, Michael

    2012-01-01

    Consistent left-right asymmetry in organ morphogenesis is a fascinating aspect of bilaterian development. Although embryonic patterning of asymmetric viscera, heart, and brain is beginning to be understood, less is known about possible subtle asymmetries present in anatomically identical paired structures. We investigated two important developmental events: physiological controls of eye development and specification of neural crest derivatives, in Xenopus laevis embryos. We found that the striking hyperpolarization of transmembrane potential (V(mem)) demarcating eye induction usually occurs in the right eye field first. This asymmetry is randomized by perturbing visceral left-right patterning, suggesting that eye asymmetry is linked to mechanisms establishing primary laterality. Bilateral misexpression of a depolarizing channel mRNA affects primarily the right eye, revealing an additional functional asymmetry in the control of eye patterning by V(mem). The ATP-sensitive K(+) channel subunit transcript, SUR1, is asymmetrically expressed in the eye primordia, thus being a good candidate for the observed physiological asymmetries. Such subtle asymmetries are not only seen in the eye: consistent asymmetry was also observed in the migration of differentiated melanocytes on the left and right sides. These data suggest that even anatomically symmetrical structures may possess subtle but consistent laterality and interact with other developmental left-right patterning pathways.

  15. Seasonal Changes in Bacterial and Archaeal Gene Expression Patterns across Salinity Gradients in the Columbia River Coastal Margin

    PubMed Central

    Smith, Maria W.; Herfort, Lydie; Tyrol, Kaitlin; Suciu, Dominic; Campbell, Victoria; Crump, Byron C.; Peterson, Tawnya D.; Zuber, Peter; Baptista, Antonio M.; Simon, Holly M.

    2010-01-01

    Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM). A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April) and late summer (August). Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean) relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition. Furthermore, our results suggest that highly-active particle-attached microbiota in the Columbia River water column may perform dissimilatory nitrate reduction (both dentrification and DNRA) within anoxic particle microniches. PMID:20967204

  16. Floral Meristem Identity Genes Are Expressed during Tendril Development in Grapevine1

    PubMed Central

    Calonje, Myriam; Cubas, Pilar; Martínez-Zapater, José M.; Carmona, María José

    2004-01-01

    To study the early steps of flower initiation and development in grapevine (Vitis vinifera), we have isolated two MADS-box genes, VFUL-L and VAP1, the putative FUL-like and AP1 grapevine orthologs, and analyzed their expression patterns during vegetative and reproductive development. Both genes are expressed in lateral meristems that, in grapevine, can give rise to either inflorescences or tendrils. They are also coexpressed in inflorescence and flower meristems. During flower development, VFUL-L transcripts are restricted to the central part of young flower meristems and, later, to the prospective carpel-forming region, which is consistent with a role of this gene in floral transition and carpel and fruit development. Expression pattern of VAP1 suggests that it may play a role in flowering transition and flower development. However, its lack of expression in sepal primordia, does not support its role as an A-function gene in grapevine. Neither VFUL-L nor VAP1 expression was detected in vegetative organs such as leaves or roots. In contrast, they are expressed throughout tendril development. Transcription of both genes in tendrils of very young plants that have not undergone flowering transition indicates that this expression is independent of the flowering process. These unique expression patterns of genes typically involved in reproductive development have implications on our understanding of flower induction and initiation in grapevine, on the origin of grapevine tendrils and on the functional roles of AP1-and FUL-like genes in plant development. These results also provide molecular support to the hypothesis that Vitis tendrils are modified reproductive organs adapted to climb. PMID:15247405

  17. Gene expression correlates of postinfective fatigue syndrome after infectious mononucleosis.

    PubMed

    Cameron, Barbara; Galbraith, Sally; Zhang, Yun; Davenport, Tracey; Vollmer-Conna, Ute; Wakefield, Denis; Hickie, Ian; Dunsmuir, William; Whistler, Toni; Vernon, Suzanne; Reeves, William C; Lloyd, Andrew R

    2007-07-01

    Infectious mononucleosis (IM) commonly triggers a protracted postinfective fatigue syndrome (PIFS) of unknown pathogenesis. Seven subjects with PIFS with 6 or more months of disabling symptoms and 8 matched control subjects who had recovered promptly from documented IM were studied. The expression of 30,000 genes was examined in the peripheral blood by microarray analysis in 65 longitudinally collected samples. Gene expression patterns associated with PIFS were sought by correlation with symptom factor scores. Differential expression of 733 genes was identified when samples collected early during the illness and at the late (recovered) time point were compared. Of these genes, 234 were found to be significantly correlated with the reported severity of the fatigue symptom factor, and 180 were found to be correlated with the musculoskeletal pain symptom factor. Validation by analysis of the longitudinal expression pattern revealed 35 genes for which changes in expression were consistent with the illness course. These genes included several that are involved in signal transduction pathways, metal ion binding, and ion channel activity. Gene expression correlates of the cardinal symptoms of PIFS after IM have been identified. Further studies of these gene products may help to elucidate the pathogenesis of PIFS.

  18. Nuclear ribosome biogenesis mediated by the DIM1A rRNA dimethylase is required for organized root growth and epidermal patterning in Arabidopsis.

    PubMed

    Wieckowski, Yana; Schiefelbein, John

    2012-07-01

    Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development.

  19. Nuclear Ribosome Biogenesis Mediated by the DIM1A rRNA Dimethylase Is Required for Organized Root Growth and Epidermal Patterning in Arabidopsis[C][W

    PubMed Central

    Wieckowski, Yana; Schiefelbein, John

    2012-01-01

    Position-dependent patterning of hair and non-hair cells in the Arabidopsis thaliana root epidermis is a powerful system to study the molecular basis of cell fate specification. Here, we report an epidermal patterning mutant affecting the ADENOSINE DIMETHYL TRANSFERASE 1A (DIM1A) rRNA dimethylase gene, predicted to participate in rRNA posttranscriptional processing and base modification. Consistent with a role in ribosome biogenesis, DIM1A is preferentially expressed in regions of rapid growth, and its product is nuclear localized with nucleolus enrichment. Furthermore, DIM1A preferentially accumulates in the developing hair cells, and the dim1A point mutant alters the cell-specific expression of the transcriptional regulators GLABRA2, CAPRICE, and WEREWOLF. Together, these findings suggest that establishment of cell-specific gene expression during root epidermis development is dependent upon proper ribosome biogenesis, possibly due to the sensitivity of the cell fate decision to relatively small differences in gene regulatory activities. Consistent with its effect on the predicted S-adenosyl-l-Met binding site, dim1A plants lack the two 18S rRNA base modifications but exhibit normal pre-rRNA processing. In addition to root epidermal defects, the dim1A mutant exhibits abnormal root meristem division, leaf development, and trichome branching. Together, these findings provide new insights into the importance of rRNA base modifications and translation regulation for plant growth and development. PMID:22829145

  20. Hox gene expression during postlarval development of the polychaete Alitta virens.

    PubMed

    Bakalenko, Nadezhda I; Novikova, Elena L; Nesterenko, Alexander Y; Kulakova, Milana A

    2013-05-01

    Hox genes are the family of transcription factors that play a key role in the patterning of the anterior-posterior axis of all bilaterian animals. These genes display clustered organization and colinear expression. Expression boundaries of individual Hox genes usually correspond with morphological boundaries of the body. Previously, we studied Hox gene expression during larval development of the polychaete Alitta virens (formerly Nereis virens) and discovered that Hox genes are expressed in nereid larva according to the spatial colinearity principle. Adult Alitta virens consist of multiple morphologically similar segments, which are formed sequentially in the growth zone. Since the worm grows for most of its life, postlarval segments constantly change their position along the anterior-posterior axis. We studied the expression dynamics of the Hox cluster during postlarval development of the nereid Alitta virens and found that 8 out of 11 Hox genes are transcribed as wide gene-specific gradients in the ventral nerve cord, ectoderm, and mesoderm. The expression domains constantly shift in accordance with the changing proportions of the growing worm, so expression domains of most Hox genes do not have stable anterior or/and posterior boundaries.In the course of our study, we revealed long antisense RNA (asRNA) for some Hox genes. Expression patterns of two of these genes were analyzed using whole-mount in-situ hybridization. This is the first discovery of antisense RNA for Hox genes in Lophotrochozoa. Hox gene expression in juvenile A. virens differs significantly from Hox gene expression patterns both in A. virens larva and in other Bilateria.We suppose that the postlarval function of the Hox genes in this polychaete is to establish and maintain positional coordinates in a constantly growing body, as opposed to creating morphological difference between segments.

  1. Patterns of Expression in the Matrix Proteins Responsible for Nucleation and Growth of Aragonite Crystals in Flat Pearls of Pinctada fucata

    PubMed Central

    Xiang, Liang; Su, Jingtan; Zheng, Guilan; Liang, Jian; Zhang, Guiyou; Wang, Hongzhong; Xie, Liping; Zhang, Rongqing

    2013-01-01

    The initial growth of the nacreous layer is crucial for comprehending the formation of nacreous aragonite. A flat pearl method in the presence of the inner-shell film was conducted to evaluate the role of matrix proteins in the initial stages of nacre biomineralization in vivo. We examined the crystals deposited on a substrate and the expression patterns of the matrix proteins in the mantle facing the substrate. In this study, the aragonite crystals nucleated on the surface at 5 days in the inner-shell film system. In the film-free system, the calcite crystals nucleated at 5 days, a new organic film covered the calcite, and the aragonite nucleated at 10 days. This meant that the nacre lamellae appeared in the inner-shell film system 5 days earlier than that in the film-free system, timing that was consistent with the maximum level of matrix proteins during the first 20 days. In addition, matrix proteins (Nacrein, MSI60, N19, N16 and Pif80) had similar expression patterns in controlling the sequential morphologies of the nacre growth in the inner-film system, while these proteins in the film-free system also had similar patterns of expression. These results suggest that matrix proteins regulate aragonite nucleation and growth with the inner-shell film in vivo. PMID:23776687

  2. Off-line monitoring of bacterial stress response during recombinant protein production using an optical biosensor.

    PubMed

    Vostiar, Igor; Tkac, Jan; Mandenius, Carl-Fredrik

    2004-07-15

    A surface plasmon resonance (SPR) biosensor was used to monitor the profiles of the heat-shock protein (DnaK) and the expression of a heterologous protein to map the dynamics of the cellular stress response in Escherichia coli. As expression system was used an E. coli strain overproducing human recombinant superoxide dismutase (rhSOD). Expression of DnaK showed complex patterns differing with strength of induction. The strong up-regulation of DnaK expression was observed in all cultivations which over-produced of rhSOD. Similar patterns were not observed in non-induced reference cultures. Differences in DnaK concentration profiles were correlated with induction strength. Presented data, carried out in shake flask and glucose limited fed-batch cultivation, show a good consistency with previously published transcriptional profiling results and provide complementary information to understand stress response related to overproduction of recombinant protein. The study also demonstrates the feasibility of using the SPR as a two channel protein array for monitoring of intracellular components.

  3. Personality expression in Chinese language use.

    PubMed

    Qiu, Lin; Lu, Jiahui; Ramsay, Jonathan; Yang, Shanshan; Qu, Weina; Zhu, Tingshao

    2017-12-01

    To date, little research has investigated personality expressions in languages other than English. Given that the Chinese language has the largest number of native speakers in the world, it is vitally important to examine the associations between personality and Chinese language use. In this research, we analysed Chinese microblogs and identified word categories and factorial structures associated with personality traits. We also compared our results with previous findings in English and showed that linguistic expression of personality has both universal- and language-specific aspects. Expression of personality via content words is more likely to be consistent across languages than expression via function words. This makes an important step towards uncovering universal patterns of personality expression in language. © 2016 International Union of Psychological Science.

  4. Lateralization for dynamic facial expressions in human superior temporal sulcus.

    PubMed

    De Winter, François-Laurent; Zhu, Qi; Van den Stock, Jan; Nelissen, Koen; Peeters, Ronald; de Gelder, Beatrice; Vanduffel, Wim; Vandenbulcke, Mathieu

    2015-02-01

    Most face processing studies in humans show stronger activation in the right compared to the left hemisphere. Evidence is largely based on studies with static stimuli focusing on the fusiform face area (FFA). Hence, the pattern of lateralization for dynamic faces is less clear. Furthermore, it is unclear whether this property is common to human and non-human primates due to predisposing processing strategies in the right hemisphere or that alternatively left sided specialization for language in humans could be the driving force behind this phenomenon. We aimed to address both issues by studying lateralization for dynamic facial expressions in monkeys and humans. Therefore, we conducted an event-related fMRI experiment in three macaques and twenty right handed humans. We presented human and monkey dynamic facial expressions (chewing and fear) as well as scrambled versions to both species. We studied lateralization in independently defined face-responsive and face-selective regions by calculating a weighted lateralization index (LIwm) using a bootstrapping method. In order to examine if lateralization in humans is related to language, we performed a separate fMRI experiment in ten human volunteers including a 'speech' expression (one syllable non-word) and its scrambled version. Both within face-responsive and selective regions, we found consistent lateralization for dynamic faces (chewing and fear) versus scrambled versions in the right human posterior superior temporal sulcus (pSTS), but not in FFA nor in ventral temporal cortex. Conversely, in monkeys no consistent pattern of lateralization for dynamic facial expressions was observed. Finally, LIwms based on the contrast between different types of dynamic facial expressions (relative to scrambled versions) revealed left-sided lateralization in human pSTS for speech-related expressions compared to chewing and emotional expressions. To conclude, we found consistent laterality effects in human posterior STS but not in visual cortex of monkeys. Based on our results, it is tempting to speculate that lateralization for dynamic face processing in humans may be driven by left-hemispheric language specialization which may not have been present yet in the common ancestor of human and macaque monkeys. Copyright © 2014 Elsevier Inc. All rights reserved.

  5. Anterior-posterior regionalized gene expression in the Ciona notochord

    PubMed Central

    Veeman, Michael

    2014-01-01

    Background In the simple ascidian chordate Ciona the signaling pathways and gene regulatory networks giving rise to initial notochord induction are largely understood and the mechanisms of notochord morphogenesis are being systematically elucidated. The notochord has generally been thought of as a non-compartmentalized or regionalized organ that is not finely patterned at the level of gene expression. Quantitative imaging methods have recently shown, however, that notochord cell size, shape and behavior vary consistently along the anterior-posterior (AP) axis. Results Here we screen candidate genes by whole mount in situ hybridization for potential AP asymmetry. We identify 4 genes that show non-uniform expression in the notochord. Ezrin/radixin/moesin (ERM) is expressed more strongly in the secondary notochord lineage than the primary. CTGF is expressed stochastically in a subset of notochord cells. A novel calmodulin-like gene (BCamL) is expressed more strongly at both the anterior and posterior tips of the notochord. A TGF-β ortholog is expressed in a gradient from posterior to anterior. The asymmetries in ERM, BCamL and TGF-β expression are evident even before the notochord cells have intercalated into a single-file column. Conclusions We conclude that the Ciona notochord is not a homogeneous tissue but instead shows distinct patterns of regionalized gene expression. PMID:24288133

  6. Anterior-posterior regionalized gene expression in the Ciona notochord.

    PubMed

    Reeves, Wendy; Thayer, Rachel; Veeman, Michael

    2014-04-01

    In the simple ascidian chordate Ciona, the signaling pathways and gene regulatory networks giving rise to initial notochord induction are largely understood and the mechanisms of notochord morphogenesis are being systematically elucidated. The notochord has generally been thought of as a non-compartmentalized or regionalized organ that is not finely patterned at the level of gene expression. Quantitative imaging methods have recently shown, however, that notochord cell size, shape, and behavior vary consistently along the anterior-posterior (AP) axis. Here we screen candidate genes by whole mount in situ hybridization for potential AP asymmetry. We identify 4 genes that show non-uniform expression in the notochord. Ezrin/radixin/moesin (ERM) is expressed more strongly in the secondary notochord lineage than the primary. CTGF is expressed stochastically in a subset of notochord cells. A novel calmodulin-like gene (BCamL) is expressed more strongly at both the anterior and posterior tips of the notochord. A TGF-β ortholog is expressed in a gradient from posterior to anterior. The asymmetries in ERM, BCamL, and TGF-β expression are evident even before the notochord cells have intercalated into a single-file column. We conclude that the Ciona notochord is not a homogeneous tissue but instead shows distinct patterns of regionalized gene expression. Copyright © 2013 Wiley Periodicals, Inc.

  7. Widespread Over-Expression of the X Chromosome in Sterile F1 Hybrid Mice

    PubMed Central

    Good, Jeffrey M.; Giger, Thomas; Dean, Matthew D.; Nachman, Michael W.

    2010-01-01

    The X chromosome often plays a central role in hybrid male sterility between species, but it is unclear if this reflects underlying regulatory incompatibilities. Here we combine phenotypic data with genome-wide expression data to directly associate aberrant expression patterns with hybrid male sterility between two species of mice. We used a reciprocal cross in which F1 males are sterile in one direction and fertile in the other direction, allowing us to associate expression differences with sterility rather than with other hybrid phenotypes. We found evidence of extensive over-expression of the X chromosome during spermatogenesis in sterile but not in fertile F1 hybrid males. Over-expression was most pronounced in genes that are normally expressed after meiosis, consistent with an X chromosome-wide disruption of expression during the later stages of spermatogenesis. This pattern was not a simple consequence of faster evolutionary divergence on the X chromosome, because X-linked expression was highly conserved between the two species. Thus, transcriptional regulation of the X chromosome during spermatogenesis appears particularly sensitive to evolutionary divergence between species. Overall, these data provide evidence for an underlying regulatory basis to reproductive isolation in house mice and underscore the importance of transcriptional regulation of the X chromosome to the evolution of hybrid male sterility. PMID:20941395

  8. Widespread over-expression of the X chromosome in sterile F₁hybrid mice.

    PubMed

    Good, Jeffrey M; Giger, Thomas; Dean, Matthew D; Nachman, Michael W

    2010-09-30

    The X chromosome often plays a central role in hybrid male sterility between species, but it is unclear if this reflects underlying regulatory incompatibilities. Here we combine phenotypic data with genome-wide expression data to directly associate aberrant expression patterns with hybrid male sterility between two species of mice. We used a reciprocal cross in which F₁ males are sterile in one direction and fertile in the other direction, allowing us to associate expression differences with sterility rather than with other hybrid phenotypes. We found evidence of extensive over-expression of the X chromosome during spermatogenesis in sterile but not in fertile F₁ hybrid males. Over-expression was most pronounced in genes that are normally expressed after meiosis, consistent with an X chromosome-wide disruption of expression during the later stages of spermatogenesis. This pattern was not a simple consequence of faster evolutionary divergence on the X chromosome, because X-linked expression was highly conserved between the two species. Thus, transcriptional regulation of the X chromosome during spermatogenesis appears particularly sensitive to evolutionary divergence between species. Overall, these data provide evidence for an underlying regulatory basis to reproductive isolation in house mice and underscore the importance of transcriptional regulation of the X chromosome to the evolution of hybrid male sterility.

  9. Detailed analysis of the δ-crystallin mRNA-expressing region in early development of the chick pituitary gland.

    PubMed

    Inoue, Makiko; Shiina, Tomoya; Aizawa, Sayaka; Sakata, Ichiro; Takagi, Hiroyasu; Sakai, Takafumi

    2012-06-01

    Although δ-crystallin (δ-crys), also known as lens protein, is transiently expressed in Rathke's pouch (RP) of the chick embryo, detailed temporal and spatial expression patterns have been obscure. In this study, to understand the relationship between the δ-crys mRNA-expressing region and RP formation, we examined the embryonic expression pattern of δ-crys mRNA in the primordium of the adenohypophysis. δ-crys mRNA expression was initially found at stage 15 anterior to the foregut and posterior to the invaginated oral ectoderm. After RP formation, the δ-crys mRNA was expressed in the post-ventral region of RP and the anterior region of RP. δ-crys mRNA expression was then restricted to the cephalic lobe of the pituitary gland. From stage 20, the δ-crys and alpha-glycoprotein subunit (αGSU) mRNA-expressing regions were almost completely overlapping. The αGSU mRNA-expressing region is thought to be the primordium of the pars tuberalis, and these regions were overlapped with the Lhx3 mRNA-expressing region. The intensity of δ-crys mRNA expression gradually decreased with development and completely disappeared by stage 34. These results suggest that the embryonic chick pituitary gland consists of two different regions labeled with δ-crys and Lhx3.

  10. Characterization of the molecular features and expression patterns of two serine proteases in Hermetia illucens (Diptera: Stratiomyidae) larvae.

    PubMed

    Kim, Wontae; Bae, Sungwoo; Kim, Ayoung; Park, Kwanho; Lee, Sangbeom; Choi, Youngcheol; Han, Sangmi; Park, Younghan; Koh, Youngho

    2011-06-01

    To investigate the molecular scavenging capabilities of the larvae of Hermetia illucens, two serine proteases (SPs) were cloned and characterized. Multiple sequence alignments and phylogenetic tree analysis of the deduced amino acid sequences of Hi-SP1 and Hi-SP2 were suggested that Hi-SP1 may be a chymotrypsin- and Hi-SP2 may be a trypsin-like protease. Hi-SP1 and Hi-SP2 3-D homology models revealed that a catalytic triad, three disulfide bonds, and a substrate-binding pocket were highly conserved, as would be expected of a SP. E. coli expressed Hi-SP1 and Hi-SP2 showed chymotrypsin or trypsin activities, respectively. Hi-SP2 mRNAs were consistently expressed during larval development. In contrast, the expression of Hi-SP1 mRNA fluctuated between feeding and molting stages and disappeared at the pupal stages. These expression pattern differences suggest that Hi-SP1 may be a larval specific chymotrypsin-like protease involved with food digestion, while Hi-SP2 may be a trypsin-like protease with diverse functions at different stages.

  11. The Development of Reciprocal Self-Disclosure in Opposite-Sex Interaction

    ERIC Educational Resources Information Center

    Kohen, Janet A. S.

    1975-01-01

    Sex differences, personal consistency, and development of reciprocity in the pattern of self-disclosure exchange and the amount of disclosures expressed were expected in opposite-sex interaction dyads. Time analysis of transcripts of conversations between 59 dyadic partners demonstrated no sex differences, a moderate degree of personal consistency…

  12. Subdivision of arthropod cap-n-collar expression domains is restricted to Mandibulata

    PubMed Central

    2014-01-01

    Background The monophyly of Mandibulata - the division of arthropods uniting pancrustaceans and myriapods - is consistent with several morphological characters, such as the presence of sensory appendages called antennae and the eponymous biting appendage, the mandible. Functional studies have demonstrated that the patterning of the mandible requires the activity of the Hox gene Deformed and the transcription factor cap-n-collar (cnc) in at least two holometabolous insects: the fruit fly Drosophila melanogaster and the beetle Tribolium castaneum. Expression patterns of cnc from two non-holometabolous insects and a millipede have suggested conservation of the labral and mandibular domains within Mandibulata. However, the activity of cnc is unknown in crustaceans and chelicerates, precluding understanding of a complete scenario for the evolution of patterning of this appendage within arthropods. To redress these lacunae, here we investigate the gene expression of the ortholog of cnc in Parhyale hawaiensis, a malacostracan crustacean, and two chelicerates: the harvestman Phalangium opilio, and the scorpion Centruroides sculpturatus. Results In the crustacean P. hawaiensis, the segmental expression of Ph-cnc is the same as that reported previously in hexapods and myriapods, with two distinct head domains in the labrum and the mandibular segment. In contrast, Po-cnc and Cs-cnc expression is not enriched in the labrum of either chelicerate, but instead is expressed at comparable levels in all appendages. In further contrast to mandibulate orthologs, the expression domain of Po-cnc posterior to the labrum is not confined within the expression domain of Po-Dfd. Conclusions Expression data from two chelicerate outgroup taxa suggest that the signature two-domain head expression pattern of cnc evolved at the base of Mandibulata. The observation of the archetypal labral and mandibular segment domains in a crustacean exemplar supports the synapomorphic nature of mandibulate cnc expression. The broader expression of Po-cnc with respect to Po-Dfd in chelicerates further suggests that the regulation of cnc by Dfd was also acquired at the base of Mandibulata. To test this hypothesis, future studies examining panarthropod cnc evolution should investigate expression of the cnc ortholog in arthropod outgroups, such as Onychophora and Tardigrada. PMID:24405788

  13. Foxp2 Regulates Identities and Projection Patterns of Thalamic Nuclei During Development.

    PubMed

    Ebisu, Haruka; Iwai-Takekoshi, Lena; Fujita-Jimbo, Eriko; Momoi, Takashi; Kawasaki, Hiroshi

    2017-07-01

    The molecular mechanisms underlying the formation of the thalamus during development have been investigated intensively. Although transcription factors distinguishing the thalamic primordium from adjacent brain structures have been uncovered, those involved in patterning inside the thalamus are largely unclear. Here, we show that Foxp2, a member of the forkhead transcription factor family, regulates thalamic patterning during development. We found a graded expression pattern of Foxp2 in the thalamic primordium of the mouse embryo. The expression levels of Foxp2 were high in the posterior region and low in the anterior region of the thalamic primordium. In Foxp2 (R552H) knockin mice, which have a missense loss-of-function mutation in the forkhead domain of Foxp2, thalamic nuclei of the posterior region of the thalamus were shrunken, while those of the intermediate region were expanded. Consistently, Foxp2 (R552H) knockin mice showed changes in thalamocortical projection patterns. Our results uncovered important roles of Foxp2 in thalamic patterning and thalamocortical projections during development. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  14. Difference magnitude is not measured by discrimination steps for order of point patterns.

    PubMed

    Protonotarios, Emmanouil D; Johnston, Alan; Griffin, Lewis D

    2016-07-01

    We have shown in previous work that the perception of order in point patterns is consistent with an interval scale structure (Protonotarios, Baum, Johnston, Hunter, & Griffin, 2014). The psychophysical scaling method used relies on the confusion between stimuli with similar levels of order, and the resulting discrimination scale is expressed in just-noticeable differences (jnds). As with other perceptual dimensions, an interesting question is whether suprathreshold (perceptual) differences are consistent with distances between stimuli on the discrimination scale. To test that, we collected discrimination data, and data based on comparison of perceptual differences. The stimuli were jittered square lattices of dots, covering the range from total disorder (Poisson) to perfect order (square lattice), roughly equally spaced on the discrimination scale. Observers picked the most ordered pattern from a pair, and the pair of patterns with the greatest difference in order from two pairs. Although the judgments of perceptual difference were found to be consistent with an interval scale, like the discrimination judgments, no common interval scale that could predict both sets of data was possible. In particular, the midpattern of the perceptual scale is 11 jnds away from the ordered end, and 5 jnds from the disordered end of the discrimination scale.

  15. A MS-lesion pattern discrimination plot based on geostatistics.

    PubMed

    Marschallinger, Robert; Schmidt, Paul; Hofmann, Peter; Zimmer, Claus; Atkinson, Peter M; Sellner, Johann; Trinka, Eugen; Mühlau, Mark

    2016-03-01

    A geostatistical approach to characterize MS-lesion patterns based on their geometrical properties is presented. A dataset of 259 binary MS-lesion masks in MNI space was subjected to directional variography. A model function was fit to express the observed spatial variability in x, y, z directions by the geostatistical parameters Range and Sill. Parameters Range and Sill correlate with MS-lesion pattern surface complexity and total lesion volume. A scatter plot of ln(Range) versus ln(Sill), classified by pattern anisotropy, enables a consistent and clearly arranged presentation of MS-lesion patterns based on geometry: the so-called MS-Lesion Pattern Discrimination Plot. The geostatistical approach and the graphical representation of results are considered efficient exploratory data analysis tools for cross-sectional, follow-up, and medication impact analysis.

  16. Unique spatial and cellular expression patterns of Hoxa5, Hoxb4 and Hoxb6 proteins in normal developing murine lung are modified in pulmonary hypoplasia

    PubMed Central

    Volpe, MaryAnn Vitoria; Wang, Karen Ting Wai; Nielsen, Heber Carl; Chinoy, Mala Romeshchandra

    2009-01-01

    Background Hox transcription factors modulate signaling pathways controlling organ morphogenesis and maintain cell fate and differentiation in adults. Retinoid signaling, key in regulating Hox expression, is altered in pulmonary hypoplasia. Information on pattern-specific expression of Hox proteins in normal lung development and in pulmonary hypoplasia is minimal. Our objective was to determine how pulmonary hypoplasia alters temporal, spatial and cellular expression of Hoxa5, Hoxb4 and Hoxb6 proteins compared to normal lung development. Methods Temporal, spatial and cellular Hoxa5, Hoxb4 and Hoxb6 expression was studied in normal (untreated) and nitrofen-induced hypoplastic (NT-PH) lungs from gestational day 13.5, 16, 19 fetuses and neonates using western blot and immunohistochemistry. Results Modification of protein levels and spatial and cellular Hox expression patterns in NT-PH lungs was consistent with delayed lung development. Distinct protein isoforms were detected for each Hox protein. Expression levels of the Hoxa5 and Hoxb6 isoforms changed with development and further in NT-PH lungs. Compared to normal lungs, Gd19 and neonatal NT-PH lungs had decreased Hoxb6 and increased Hoxa5 and Hoxb4. Hoxa5 cellular localization changed from mesenchyme to epithelia earlier in normal lungs. Hoxb4 was expressed in mesenchyme and epithelial cells throughout development. Hoxb6 remained mainly in mesenchymal cells around distal airways. Conclusions Unique spatial and cellular expression of Hoxa5, Hoxb4 and Hoxb6 participates in branching morphogenesis and terminal sac formation. Altered Hox protein temporal and cellular balance of expression either contributes to pulmonary hypoplasia or functions as a compensatory mechanism attempting to correct abnormal lung development and maturation in this condition. PMID:18553509

  17. Transcriptomic insights into the genetic basis of mammalian limb diversity.

    PubMed

    Maier, Jennifer A; Rivas-Astroza, Marcelo; Deng, Jenny; Dowling, Anna; Oboikovitz, Paige; Cao, Xiaoyi; Behringer, Richard R; Cretekos, Chris J; Rasweiler, John J; Zhong, Sheng; Sears, Karen E

    2017-03-23

    From bat wings to whale flippers, limb diversification has been crucial to the evolutionary success of mammals. We performed the first transcriptome-wide study of limb development in multiple species to explore the hypothesis that mammalian limb diversification has proceeded through the differential expression of conserved shared genes, rather than by major changes to limb patterning. Specifically, we investigated the manner in which the expression of shared genes has evolved within and among mammalian species. We assembled and compared transcriptomes of bat, mouse, opossum, and pig fore- and hind limbs at the ridge, bud, and paddle stages of development. Results suggest that gene expression patterns exhibit larger variation among species during later than earlier stages of limb development, while within species results are more mixed. Consistent with the former, results also suggest that genes expressed at later developmental stages tend to have a younger evolutionary age than genes expressed at earlier stages. A suite of key limb-patterning genes was identified as being differentially expressed among the homologous limbs of all species. However, only a small subset of shared genes is differentially expressed in the fore- and hind limbs of all examined species. Similarly, a small subset of shared genes is differentially expressed within the fore- and hind limb of a single species and among the forelimbs of different species. Taken together, results of this study do not support the existence of a phylotypic period of limb development ending at chondrogenesis, but do support the hypothesis that the hierarchical nature of development translates into increasing variation among species as development progresses.

  18. Digital gene expression analysis of gene expression differences within Brassica diploids and allopolyploids.

    PubMed

    Jiang, Jinjin; Wang, Yue; Zhu, Bao; Fang, Tingting; Fang, Yujie; Wang, Youping

    2015-01-27

    Brassica includes many successfully cultivated crop species of polyploid origin, either by ancestral genome triplication or by hybridization between two diploid progenitors, displaying complex repetitive sequences and transposons. The U's triangle, which consists of three diploids and three amphidiploids, is optimal for the analysis of complicated genomes after polyploidization. Next-generation sequencing enables the transcriptome profiling of polyploids on a global scale. We examined the gene expression patterns of three diploids (Brassica rapa, B. nigra, and B. oleracea) and three amphidiploids (B. napus, B. juncea, and B. carinata) via digital gene expression analysis. In total, the libraries generated between 5.7 and 6.1 million raw reads, and the clean tags of each library were mapped to 18547-21995 genes of B. rapa genome. The unambiguous tag-mapped genes in the libraries were compared. Moreover, the majority of differentially expressed genes (DEGs) were explored among diploids as well as between diploids and amphidiploids. Gene ontological analysis was performed to functionally categorize these DEGs into different classes. The Kyoto Encyclopedia of Genes and Genomes analysis was performed to assign these DEGs into approximately 120 pathways, among which the metabolic pathway, biosynthesis of secondary metabolites, and peroxisomal pathway were enriched. The non-additive genes in Brassica amphidiploids were analyzed, and the results indicated that orthologous genes in polyploids are frequently expressed in a non-additive pattern. Methyltransferase genes showed differential expression pattern in Brassica species. Our results provided an understanding of the transcriptome complexity of natural Brassica species. The gene expression changes in diploids and allopolyploids may help elucidate the morphological and physiological differences among Brassica species.

  19. Altered expression pattern of circular RNAs in primary and metastatic sites of epithelial ovarian carcinoma.

    PubMed

    Ahmed, Ikhlak; Karedath, Thasni; Andrews, Simeon S; Al-Azwani, Iman K; Mohamoud, Yasmin Ali; Querleu, Denis; Rafii, Arash; Malek, Joel A

    2016-06-14

    Recently, a class of endogenous species of RNA called circular RNA (circRNA) has been shown to regulate gene expression in mammals and their role in cellular function is just beginning to be understood. To investigate the role of circRNAs in ovarian cancer, we performed paired-end RNA sequencing of primary sites, peritoneal and lymph node metastases from three patients with stage IIIC ovarian cancer. We developed an in-house computational pipeline to identify and characterize the circRNA expression from paired-end RNA-Seq libraries. This pipeline revealed thousands of circular isoforms in Epithelial Ovarian Carcinoma (EOC). These circRNAs are enriched for potentially effective miRNA seed matches. A significantly larger number of circRNAs are differentially expressed between tumor sites than mRNAs. Circular and linear expression exhibits an inverse trend for many cancer related pathways and signaling pathways like NFkB, PI3k/AKT and TGF-β typically activated for mRNA in metastases are inhibited for circRNA expression. Further, circRNAs show a more robust expression pattern across patients than mRNA forms indicating their suitability as biomarkers in highly heterogeneous cancer transcriptomes. The consistency of circular RNA expression may offer new candidates for cancer treatment and prognosis.

  20. Altered expression pattern of circular RNAs in primary and metastatic sites of epithelial ovarian carcinoma

    PubMed Central

    Ahmed, Ikhlak; Karedath, Thasni; Andrews, Simeon S.; Al, Iman K.; Mohamoud, Yasmin Ali; Querleu, Denis; Rafii, Arash; Malek, Joel A.

    2016-01-01

    Recently, a class of endogenous species of RNA called circular RNA (circRNA) has been shown to regulate gene expression in mammals and their role in cellular function is just beginning to be understood. To investigate the role of circRNAs in ovarian cancer, we performed paired-end RNA sequencing of primary sites, peritoneal and lymph node metastases from three patients with stage IIIC ovarian cancer. We developed an in-house computational pipeline to identify and characterize the circRNA expression from paired-end RNA-Seq libraries. This pipeline revealed thousands of circular isoforms in Epithelial Ovarian Carcinoma (EOC). These circRNAs are enriched for potentially effective miRNA seed matches. A significantly larger number of circRNAs are differentially expressed between tumor sites than mRNAs. Circular and linear expression exhibits an inverse trend for many cancer related pathways and signaling pathways like NFkB, PI3k/AKT and TGF-β typically activated for mRNA in metastases are inhibited for circRNA expression. Further, circRNAs show a more robust expression pattern across patients than mRNA forms indicating their suitability as biomarkers in highly heterogeneous cancer transcriptomes. The consistency of circular RNA expression may offer new candidates for cancer treatment and prognosis. PMID:27119352

  1. Segmentation of the zebrafish axial skeleton relies on notochord sheath cells and not on the segmentation clock

    PubMed Central

    Lleras Forero, Laura; Narayanan, Rachna; Huitema, Leonie FA; VanBergen, Maaike; Apschner, Alexander; Peterson-Maduro, Josi; Logister, Ive; Valentin, Guillaume

    2018-01-01

    Segmentation of the axial skeleton in amniotes depends on the segmentation clock, which patterns the paraxial mesoderm and the sclerotome. While the segmentation clock clearly operates in teleosts, the role of the sclerotome in establishing the axial skeleton is unclear. We severely disrupt zebrafish paraxial segmentation, yet observe a largely normal segmentation process of the chordacentra. We demonstrate that axial entpd5+ notochord sheath cells are responsible for chordacentrum mineralization, and serve as a marker for axial segmentation. While autonomous within the notochord sheath, entpd5 expression and centrum formation show some plasticity and can respond to myotome pattern. These observations reveal for the first time the dynamics of notochord segmentation in a teleost, and are consistent with an autonomous patterning mechanism that is influenced, but not determined by adjacent paraxial mesoderm. This behavior is not consistent with a clock-type mechanism in the notochord. PMID:29624170

  2. Population Level Purifying Selection and Gene Expression Shape Subgenome Evolution in Maize.

    PubMed

    Pophaly, Saurabh D; Tellier, Aurélien

    2015-12-01

    The maize ancestor experienced a recent whole-genome duplication (WGD) followed by gene erosion which generated two subgenomes, the dominant subgenome (maize1) experiencing fewer deletions than maize2. We take advantage of available extensive polymorphism and gene expression data in maize to study purifying selection and gene expression divergence between WGD retained paralog pairs. We first report a strong correlation in nucleotide diversity between duplicate pairs, except for upstream regions. We then show that maize1 genes are under stronger purifying selection than maize2. WGD retained genes have higher gene dosage and biased Gene Ontologies consistent with previous studies. The relative gene expression of paralogs across tissues demonstrates that 98% of duplicate pairs have either subfunctionalized in a tissuewise manner or have diverged consistently in their expression thereby preventing functional complementation. Tissuewise subfunctionalization seems to be a hallmark of transcription factors, whereas consistent repression occurs for macromolecular complexes. We show that dominant gene expression is a strong determinant of the strength of purifying selection, explaining the inferred stronger negative selection on maize1 genes. We propose a novel expression-based classification of duplicates which is more robust to explain observed polymorphism patterns than the subgenome location. Finally, upstream regions of repressed genes exhibit an enrichment in transposable elements which indicates a possible mechanism for expression divergence. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Evolution and inheritance of early embryonic patterning in Drosophila simulans and D. sechellia.

    PubMed

    Lott, Susan E; Ludwig, Michael Z; Kreitman, Martin

    2011-05-01

    Pattern formation in Drosophila is a widely studied example of a robust developmental system. Such robust systems pose a challenge to adaptive evolution, as they mask variation that selection may otherwise act upon. Yet we find variation in the localization of expression domains (henceforth "stripe allometry") in the pattern formation pathway. Specifically, we characterize differences in the gap genes giant and Kruppel, and the pair-rule gene even-skipped, which differ between the sibling species Drosophila simulans and D. sechellia. In a double-backcross experiment, stripe allometry is consistent with maternal inheritance of stripe positioning and multiple genetic factors, with a distinct genetic basis from embryo length. Embryos produced by F1 and F2 backcross mothers exhibit novel spatial patterns of gene expression relative to the parental species, with no measurable increase in positional variance among individuals. Buffering of novel spatial patterns in the backcross genotypes suggests that robustness need not be disrupted in order for the trait to evolve, and perhaps the system is incapable of evolving to prevent the expression of all genetic variation. This limitation, and the ability of natural selection to act on minute genetic differences that are within the "margin of error" for the buffering mechanism, indicates that developmentally buffered traits can evolve without disruption of robustness. © 2010 The Author(s). Evolution© 2010 The Society for the Study of Evolution.

  4. Developmental expression of Drosophila Wiskott-Aldrich Syndrome family proteins

    PubMed Central

    Rodriguez-Mesa, Evelyn; Abreu-Blanco, Maria Teresa; Rosales-Nieves, Alicia E.; Parkhurst, Susan M.

    2012-01-01

    Background Wiskott-Aldrich Syndrome (WASP) family proteins participate in many cellular processes involving rearrangements of the actin cytoskeleton. To the date, four WASP subfamily members have been described in Drosophila: Wash, WASp, SCAR, and Whamy. Wash, WASp, and SCAR are essential during early Drosophila development where they function in orchestrating cytoplasmic events including membrane-cytoskeleton interactions. A mutant for Whamy has not yet been reported. Results We generated monoclonal antibodies that are specific to Drosophila Wash, WASp, SCAR, and Whamy, and use these to describe their spatial and temporal localization patterns. Consistent with the importance of WASP family proteins in flies, we find that Wash, WASp, SCAR, and Whamy are dynamically expressed throughout oogenesis and embryogenesis. For example, we find that Wash accumulates at the oocyte cortex. WASp is highly expressed in the PNS, while SCAR is the most abundantly expressed in the CNS. Whamy exhibits an asymmetric subcellular localization that overlaps with mitochondria and is highly expressed in muscle. Conclusion All four WASP family members show specific expression patterns, some of which reflect their previously known roles and others revealing new potential functions. The monoclonal antibodies developed offer valuable new tools to investigate how WASP family proteins regulate actin cytoskeleton dynamics. PMID:22275148

  5. The expression of the clock gene cycle has rhythmic pattern and is affected by photoperiod in the moth Sesamia nonagrioides.

    PubMed

    Kontogiannatos, Dimitrios; Gkouvitsas, Theodoros; Kourti, Anna

    2017-06-01

    To obtain clues to the link between the molecular mechanism of circadian and photoperiod clocks, we have cloned the circadian clock gene cycle (Sncyc) in the corn stalk borer, Sesamia nonagrioides, which undergoes facultative diapause controlled by photoperiod. Sequence analysis revealed a high degree of conservation among insects for this gene. SnCYC consists of 667 amino acids and structural analysis showed that it contains a BCTR domain in its C-terminal in addition to the common domains found in Drosophila CYC, i.e. bHLH, PAS-A, PAS-B domains. The results revealed that the sequence of Sncyc showed a similarity to that of its mammalian orthologue, Bmal1. We also investigated the expression patterns of Sncyc in the brain of larvae growing under long-day 16L: 8D (LD), constant darkness (DD) and short-day 10L: 14D (SD) conditions using qRT-PCR assays. The mRNAs of Sncyc expression was rhythmic in LD, DD and SD cycles. Also, it is remarkable that the photoperiodic conditions affect the expression patterns and/or amplitudes of circadian clock gene Sncyc. This gene is associated with diapause in S. nonagrioides, because under SD (diapause conditions) the photoperiodic signal altered mRNA accumulation. Sequence and expression analysis of cyc in S. nonagrioides shows interesting differences compared to Drosophila where this gene does not oscillate or change in expression patterns in response to photoperiod, suggesting that this species is an interesting new model to study the molecular control of insect circadian and photoperiodic clocks. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Convergent, modular expression of ebony and tan in the mimetic wing patterns of Heliconius butterflies.

    PubMed

    Ferguson, Laura C; Maroja, Luana; Jiggins, Chris D

    2011-12-01

    The evolution of pigmentation in vertebrates and flies has involved repeated divergence at a small number of genes related to melanin synthesis. Here, we study insect melanin synthesis genes in Heliconius butterflies, a group characterised by its diversity of wing patterns consisting of black (melanin), and yellow and red (ommochrome) pigmented scales. Consistent with their respective biochemical roles in Drosophila melanogaster, ebony is upregulated in non-melanic wing regions destined to be pigmented red whilst tan is upregulated in melanic regions. Wing regions destined to be pigmented yellow, however, are downregulated for both genes. This pattern is conserved across multiple divergent and convergent phenotypes within the Heliconii, suggesting a conserved mechanism for the development of black, red and yellow pattern elements across the genus. Linkage mapping of five melanin biosynthesis genes showed that, in contrast to other organisms, these genes do not control pattern polymorphism. Thus, the pigmentation genes themselves are not the locus of evolutionary change but lie downstream of a wing pattern regulatory factor. The results suggest a modular system in which particular combinations of genes are switched on whenever red, yellow or black pattern elements are favoured by natural selection for diverse and mimetic wing patterns. © Springer-Verlag 2011

  7. Iron Biofortification and Homeostasis in Transgenic Cassava Roots Expressing the Algal Iron Assimilatory Gene, FEA1

    PubMed Central

    Ihemere, Uzoma E.; Narayanan, Narayanan N.; Sayre, Richard T.

    2012-01-01

    We have engineered the tropical root crop cassava (Manihot esculenta) to express the Chlamydomonas reinhardtii iron assimilatory gene, FEA1, in its storage roots with the objective of enhancing the root nutritional qualities. Iron levels in mature cassava storage roots were increased from 10 to 36 ppm in the highest iron accumulating transgenic lines. These iron levels are sufficient to meet the minimum daily requirement for iron in a 500 g meal. Significantly, the expression of the FEA1 gene in storage roots did not alter iron levels in leaves. Transgenic plants also had normal levels of zinc in leaves and roots consistent with the specific uptake of ferrous iron mediated by the FEA1 protein. Relative to wild-type plants, fibrous roots of FEA1 expressing plants had reduced Fe (III) chelate reductase activity consistent with the more efficient uptake of iron in the transgenic plants. We also show that multiple cassava genes involved in iron homeostasis have altered tissue-specific patterns of expression in leaves, stems, and roots of transgenic plants consistent with increased iron sink strength in transgenic roots. These results are discussed in terms of strategies for the iron biofortification of plants. PMID:22993514

  8. SCARLESS SKIN WOUND HEALING IN FOXN1 DEFICIENT (NUDE) MICE IS ASSOCIATED WITH DISTINCTIVE MATRIX METALLOPROTEINASE EXPRESSION

    PubMed Central

    Gawronska-Kozak, Barbara

    2011-01-01

    Similar to mammalian fetuses FOXN1 deficient (nude) mice are able to restore the structure and integrity of injured skin in a scarless healing process by mechanisms independent of the genetic background. Matrix metalloproteinases (MMPs) are required for regular skin wound healing and the distinctive pattern of their expression has been implicated to promote scarless healing. In this study, we analyzed the temporal and spatial expression patterns of these molecules during the incisional skin wounds in adult nude mice. Macroscopic and histological analyses of skin wounds revealed an accelerated wound healing process, minimal granulation tissue formation and markedly diminished scarring in nude mice. Quantitative RT-PCR (Mmp-2,-3,-8,-9,-10,-12,-13,-14 and Timp-1, -2, -3), Western blots (MMP-13) and gelatin zymography (MMP-9) revealed that MMP-9 and MMP-13 showed a unique, bimodal pattern of up-regulation during the early and late phases of wound healing in nude mice. Immunohistochemically MMP-9 and MMP-13 were generally detected in epidermis during the early phase and in dermis during the late (remodeling) phase. Consistent with these in vivo observations, dermal fibroblasts cultured from nude mice expressed higher levels of type I and III collagen, MMP-9 and MMP-13 mRNA levels and higher MMP enzyme activity than wild type controls. Collectively, these finding suggest that the bimodal pattern of MMP-9 and MMP-13 expression during skin repair process in nude mice could be a major component of their ability for scarless healing. PMID:21539913

  9. Algorithms for Hidden Markov Models Restricted to Occurrences of Regular Expressions

    PubMed Central

    Tataru, Paula; Sand, Andreas; Hobolth, Asger; Mailund, Thomas; Pedersen, Christian N. S.

    2013-01-01

    Hidden Markov Models (HMMs) are widely used probabilistic models, particularly for annotating sequential data with an underlying hidden structure. Patterns in the annotation are often more relevant to study than the hidden structure itself. A typical HMM analysis consists of annotating the observed data using a decoding algorithm and analyzing the annotation to study patterns of interest. For example, given an HMM modeling genes in DNA sequences, the focus is on occurrences of genes in the annotation. In this paper, we define a pattern through a regular expression and present a restriction of three classical algorithms to take the number of occurrences of the pattern in the hidden sequence into account. We present a new algorithm to compute the distribution of the number of pattern occurrences, and we extend the two most widely used existing decoding algorithms to employ information from this distribution. We show experimentally that the expectation of the distribution of the number of pattern occurrences gives a highly accurate estimate, while the typical procedure can be biased in the sense that the identified number of pattern occurrences does not correspond to the true number. We furthermore show that using this distribution in the decoding algorithms improves the predictive power of the model. PMID:24833225

  10. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner

    PubMed Central

    Pai, Vaibhav P.; Willocq, Valerie; Pitcairn, Emily J.; Lemire, Joan M.; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A.

    2017-01-01

    ABSTRACT Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels (Ih currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal, Lefty, and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. PMID:28818840

  11. HCN4 ion channel function is required for early events that regulate anatomical left-right patterning in a nodal and lefty asymmetric gene expression-independent manner.

    PubMed

    Pai, Vaibhav P; Willocq, Valerie; Pitcairn, Emily J; Lemire, Joan M; Paré, Jean-François; Shi, Nian-Qing; McLaughlin, Kelly A; Levin, Michael

    2017-10-15

    Laterality is a basic characteristic of all life forms, from single cell organisms to complex plants and animals. For many metazoans, consistent left-right asymmetric patterning is essential for the correct anatomy of internal organs, such as the heart, gut, and brain; disruption of left-right asymmetry patterning leads to an important class of birth defects in human patients. Laterality functions across multiple scales, where early embryonic, subcellular and chiral cytoskeletal events are coupled with asymmetric amplification mechanisms and gene regulatory networks leading to asymmetric physical forces that ultimately result in distinct left and right anatomical organ patterning. Recent studies have suggested the existence of multiple parallel pathways regulating organ asymmetry. Here, we show that an isoform of the hyperpolarization-activated cyclic nucleotide-gated (HCN) family of ion channels (hyperpolarization-activated cyclic nucleotide-gated channel 4, HCN4) is important for correct left-right patterning. HCN4 channels are present very early in Xenopus embryos. Blocking HCN channels ( I h currents) with pharmacological inhibitors leads to errors in organ situs. This effect is only seen when HCN4 channels are blocked early (pre-stage 10) and not by a later block (post-stage 10). Injections of HCN4-DN (dominant-negative) mRNA induce left-right defects only when injected in both blastomeres no later than the 2-cell stage. Analysis of key asymmetric genes' expression showed that the sidedness of Nodal , Lefty , and Pitx2 expression is largely unchanged by HCN4 blockade, despite the randomization of subsequent organ situs, although the area of Pitx2 expression was significantly reduced. Together these data identify a novel, developmental role for HCN4 channels and reveal a new Nodal-Lefty-Pitx2 asymmetric gene expression-independent mechanism upstream of organ positioning during embryonic left-right patterning. © 2017. Published by The Company of Biologists Ltd.

  12. Methylation-Dependent Activation of CDX1 through NF-κB

    PubMed Central

    Rau, Tilman T.; Rogler, Anja; Frischauf, Myrjam; Jung, Andreas; Konturek, Peter C.; Dimmler, Arno; Faller, Gerhard; Sehnert, Bettina; El-Rifai, Wael; Hartmann, Arndt; Voll, Reinhard E.; Schneider-Stock, Regine

    2013-01-01

    The caudal homeobox factor 1 (CDX1) is an essential transcription factor for intestinal differentiation. Its aberrant expression in intestinal metaplasia of the upper gastrointestinal tract is a hallmark within the gastritis-metaplasia-carcinoma sequence. CDX1 expression is influenced by certain pathways, such as Wnt, Ras, or NF-κB signaling; however, these pathways alone cannot explain the transient expression of CDX1 in intestinal metaplasia or the molecular inactivation mechanism of its loss in cases of advanced gastric cancer. In this study, we investigated the epigenetic inactivation of CDX1 by promoter methylation, as well as the functional link of CDX1 promoter methylation to the inflammatory NF-κB signaling pathway. We identified methylation-dependent NF-κB binding to the CDX1 promoter and quantified it using competitive electrophoretic mobility shift assays and chromatin immunoprecipitation. A methylated CDX1 promoter was associated with closed chromatin structure, reduced NF-κB binding, and transcriptional silencing. Along the gastritis-metaplasia-carcinoma sequence, we observed a biphasic pattern of tumor necrosis factor-α (TNF-α) protein expression and an inverse biphasic pattern of CDX1 promoter methylation; both are highly consistent with CDX1 protein expression. The stages of hyper-, hypo-, and hyper-methylation patterns of the CDX1 promoter were inversely correlated with the NF-κB signaling activity along this sequence. In conclusion, these functionally interacting events drive CDX1 expression and contribute to intestinal metaplasia, epithelial dedifferentiation, and carcinogenesis in the human stomach. PMID:22749770

  13. HIV promoter integration site primarily modulates transcriptional burst size rather than frequency.

    PubMed

    Skupsky, Ron; Burnett, John C; Foley, Jonathan E; Schaffer, David V; Arkin, Adam P

    2010-09-30

    Mammalian gene expression patterns, and their variability across populations of cells, are regulated by factors specific to each gene in concert with its surrounding cellular and genomic environment. Lentiviruses such as HIV integrate their genomes into semi-random genomic locations in the cells they infect, and the resulting viral gene expression provides a natural system to dissect the contributions of genomic environment to transcriptional regulation. Previously, we showed that expression heterogeneity and its modulation by specific host factors at HIV integration sites are key determinants of infected-cell fate and a possible source of latent infections. Here, we assess the integration context dependence of expression heterogeneity from diverse single integrations of a HIV-promoter/GFP-reporter cassette in Jurkat T-cells. Systematically fitting a stochastic model of gene expression to our data reveals an underlying transcriptional dynamic, by which multiple transcripts are produced during short, infrequent bursts, that quantitatively accounts for the wide, highly skewed protein expression distributions observed in each of our clonal cell populations. Interestingly, we find that the size of transcriptional bursts is the primary systematic covariate over integration sites, varying from a few to tens of transcripts across integration sites, and correlating well with mean expression. In contrast, burst frequencies are scattered about a typical value of several per cell-division time and demonstrate little correlation with the clonal means. This pattern of modulation generates consistently noisy distributions over the sampled integration positions, with large expression variability relative to the mean maintained even for the most productive integrations, and could contribute to specifying heterogeneous, integration-site-dependent viral production patterns in HIV-infected cells. Genomic environment thus emerges as a significant control parameter for gene expression variation that may contribute to structuring mammalian genomes, as well as be exploited for survival by integrating viruses.

  14. Large-scale transcriptome analysis reveals arabidopsis metabolic pathways are frequently influenced by different pathogens.

    PubMed

    Jiang, Zhenhong; He, Fei; Zhang, Ziding

    2017-07-01

    Through large-scale transcriptional data analyses, we highlighted the importance of plant metabolism in plant immunity and identified 26 metabolic pathways that were frequently influenced by the infection of 14 different pathogens. Reprogramming of plant metabolism is a common phenomenon in plant defense responses. Currently, a large number of transcriptional profiles of infected tissues in Arabidopsis (Arabidopsis thaliana) have been deposited in public databases, which provides a great opportunity to understand the expression patterns of metabolic pathways during plant defense responses at the systems level. Here, we performed a large-scale transcriptome analysis based on 135 previously published expression samples, including 14 different pathogens, to explore the expression pattern of Arabidopsis metabolic pathways. Overall, metabolic genes are significantly changed in expression during plant defense responses. Upregulated metabolic genes are enriched on defense responses, and downregulated genes are enriched on photosynthesis, fatty acid and lipid metabolic processes. Gene set enrichment analysis (GSEA) identifies 26 frequently differentially expressed metabolic pathways (FreDE_Paths) that are differentially expressed in more than 60% of infected samples. These pathways are involved in the generation of energy, fatty acid and lipid metabolism as well as secondary metabolite biosynthesis. Clustering analysis based on the expression levels of these 26 metabolic pathways clearly distinguishes infected and control samples, further suggesting the importance of these metabolic pathways in plant defense responses. By comparing with FreDE_Paths from abiotic stresses, we find that the expression patterns of 26 FreDE_Paths from biotic stresses are more consistent across different infected samples. By investigating the expression correlation between transcriptional factors (TFs) and FreDE_Paths, we identify several notable relationships. Collectively, the current study will deepen our understanding of plant metabolism in plant immunity and provide new insights into disease-resistant crop improvement.

  15. In vivo biomarker expression patterns are preserved in 3D cultures of Prostate Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Windus, Louisa C.E.; Kiss, Debra L.; Glover, Tristan

    2012-11-15

    Here we report that Prostate Cancer (PCa) cell-lines DU145, PC3, LNCaP and RWPE-1 grown in 3D matrices in contrast to conventional 2D monolayers, display distinct differences in cell morphology, proliferation and expression of important biomarker proteins associated with cancer progression. Consistent with in vivo growth rates, in 3D cultures, all PCa cell-lines were found to proliferate at significantly lower rates in comparison to their 2D counterparts. Moreover, when grown in a 3D matrix, metastatic PC3 cell-lines were found to mimic more precisely protein expression patterns of metastatic tumour formation as found in vivo. In comparison to the prostate epithelial cell-linemore » RWPE-1, metastatic PC3 cell-lines exhibited a down-regulation of E-cadherin and {alpha}6 integrin expression and an up-regulation of N-cadherin, Vimentin and {beta}1 integrin expression and re-expressed non-transcriptionally active AR. In comparison to the non-invasive LNCaP cell-lines, PC3 cells were found to have an up-regulation of chemokine receptor CXCR4, consistent with a metastatic phenotype. In 2D cultures, there was little distinction in protein expression between metastatic, non-invasive and epithelial cells. These results suggest that 3D cultures are more representative of in vivo morphology and may serve as a more biologically relevant model in the drug discovery pipeline. -- Highlights: Black-Right-Pointing-Pointer We developed and optimised 3D culturing techniques for Prostate Cancer cell-lines. Black-Right-Pointing-Pointer We investigated biomarker expression in 2D versus 3D culture techniques. Black-Right-Pointing-Pointer Metastatic PC3 cells re-expressed non-transcriptionally active androgen receptor. Black-Right-Pointing-Pointer Metastatic PCa cell lines retain in vivo-like antigenic profiles in 3D cultures.« less

  16. Sex differences in autism: a resting-state fMRI investigation of functional brain connectivity in males and females

    PubMed Central

    Swinnen, Stephan P.; Wenderoth, Nicole

    2016-01-01

    Autism spectrum disorders (ASD) are far more prevalent in males than in females. Little is known however about the differential neural expression of ASD in males and females. We used a resting-state fMRI-dataset comprising 42 males/42 females with ASD and 75 male/75 female typical-controls to examine whether autism-related alterations in intrinsic functional connectivity are similar or different in males and females, and particularly whether alterations reflect ‘neural masculinization’, as predicted by the Extreme Male Brain theory. Males and females showed a differential neural expression of ASD, characterized by highly consistent patterns of hypo-connectivity in males with ASD (compared to typical males), and hyper-connectivity in females with ASD (compared to typical females). Interestingly, patterns of hyper-connectivity in females with ASD reflected a shift towards the (high) connectivity levels seen in typical males (neural masculinization), whereas patterns of hypo-connectivity observed in males with ASD reflected a shift towards the (low) typical feminine connectivity patterns (neural feminization). Our data support the notion that ASD is a disorder of sexual differentiation rather than a disorder characterized by masculinization in both genders. Future work is needed to identify underlying factors such as sex hormonal alterations that drive these sex-specific neural expressions of ASD. PMID:26989195

  17. CLOCK expression identifies developing circadian oscillator neurons in the brains of Drosophila embryos.

    PubMed

    Houl, Jerry H; Ng, Fanny; Taylor, Pete; Hardin, Paul E

    2008-12-18

    The Drosophila circadian oscillator is composed of transcriptional feedback loops in which CLOCK-CYCLE (CLK-CYC) heterodimers activate their feedback regulators period (per) and timeless (tim) via E-box mediated transcription. These feedback loop oscillators are present in distinct clusters of dorsal and lateral neurons in the adult brain, but how this pattern of expression is established during development is not known. Since CLK is required to initiate feedback loop function, defining the pattern of CLK expression in embryos and larvae will shed light on oscillator neuron development. A novel CLK antiserum is used to show that CLK expression in the larval CNS and adult brain is limited to circadian oscillator cells. CLK is initially expressed in presumptive small ventral lateral neurons (s-LNvs), dorsal neurons 2 s (DN2s), and dorsal neuron 1 s (DN1s) at embryonic stage (ES) 16, and this CLK expression pattern persists through larval development. PER then accumulates in all CLK-expressing cells except presumptive DN2s during late ES 16 and ES 17, consistent with the delayed accumulation of PER in adult oscillator neurons and antiphase cycling of PER in larval DN2s. PER is also expressed in non-CLK-expressing cells in the embryonic CNS starting at ES 12. Although PER expression in CLK-negative cells continues in ClkJrk embryos, PER expression in cells that co-express PER and CLK is eliminated. These data demonstrate that brain oscillator neurons begin development during embryogenesis, that PER expression in non-oscillator cells is CLK-independent, and that oscillator phase is an intrinsic characteristic of brain oscillator neurons. These results define the temporal and spatial coordinates of factors that initiate Clk expression, imply that circadian photoreceptors are not activated until the end of embryogenesis, and suggest that PER functions in a different capacity before oscillator cell development is initiated.

  18. The chemiluminescence based Ziplex automated workstation focus array reproduces ovarian cancer Affymetrix GeneChip expression profiles.

    PubMed

    Quinn, Michael C J; Wilson, Daniel J; Young, Fiona; Dempsey, Adam A; Arcand, Suzanna L; Birch, Ashley H; Wojnarowicz, Paulina M; Provencher, Diane; Mes-Masson, Anne-Marie; Englert, David; Tonin, Patricia N

    2009-07-06

    As gene expression signatures may serve as biomarkers, there is a need to develop technologies based on mRNA expression patterns that are adaptable for translational research. Xceed Molecular has recently developed a Ziplex technology, that can assay for gene expression of a discrete number of genes as a focused array. The present study has evaluated the reproducibility of the Ziplex system as applied to ovarian cancer research of genes shown to exhibit distinct expression profiles initially assessed by Affymetrix GeneChip analyses. The new chemiluminescence-based Ziplex gene expression array technology was evaluated for the expression of 93 genes selected based on their Affymetrix GeneChip profiles as applied to ovarian cancer research. Probe design was based on the Affymetrix target sequence that favors the 3' UTR of transcripts in order to maximize reproducibility across platforms. Gene expression analysis was performed using the Ziplex Automated Workstation. Statistical analyses were performed to evaluate reproducibility of both the magnitude of expression and differences between normal and tumor samples by correlation analyses, fold change differences and statistical significance testing. Expressions of 82 of 93 (88.2%) genes were highly correlated (p < 0.01) in a comparison of the two platforms. Overall, 75 of 93 (80.6%) genes exhibited consistent results in normal versus tumor tissue comparisons for both platforms (p < 0.001). The fold change differences were concordant for 87 of 93 (94%) genes, where there was agreement between the platforms regarding statistical significance for 71 (76%) of 87 genes. There was a strong agreement between the two platforms as shown by comparisons of log2 fold differences of gene expression between tumor versus normal samples (R = 0.93) and by Bland-Altman analysis, where greater than 90% of expression values fell within the 95% limits of agreement. Overall concordance of gene expression patterns based on correlations, statistical significance between tumor and normal ovary data, and fold changes was consistent between the Ziplex and Affymetrix platforms. The reproducibility and ease-of-use of the technology suggests that the Ziplex array is a suitable platform for translational research.

  19. Molecular characterization and expression analysis of Triticum aestivum squamosa-promoter binding protein-box genes involved in ear development.

    PubMed

    Zhang, Bin; Liu, Xia; Zhao, Guangyao; Mao, Xinguo; Li, Ang; Jing, Ruilian

    2014-06-01

    Wheat (Triticum aestivum L.) is one of the most important crops in the world. Squamosa-promoter binding protein (SBP)-box genes play a critical role in regulating flower and fruit development. In this study, 10 novel SBP-box genes (TaSPL genes) were isolated from wheat ((Triticum aestivum L.) cultivar Yanzhan 4110). Phylogenetic analysis classified the TaSPL genes into five groups (G1-G5). The motif combinations and expression patterns of the TaSPL genes varied among the five groups with each having own distinctive characteristics: TaSPL20/21 in G1 and TaSPL17 in G2 mainly expressed in the shoot apical meristem and the young ear, and their expression levels responded to development of the ear; TaSPL6/15 belonging to G3 were upregulated and TaSPL1/23 in G4 were downregulated during grain development; the gene in G5 (TaSPL3) expressed constitutively. Thus, the consistency of the phylogenetic analysis, motif compositions, and expression patterns of the TaSPL genes revealed specific gene structures and functions. On the other hand, the diverse gene structures and different expression patterns suggested that wheat SBP-box genes have a wide range of functions. The results also suggest a potential role for wheat SBP-box genes in ear development. This study provides a significant beginning of functional analysis of SBP-box genes in wheat. © 2014 The Authors. Journal of Integrative Plant Biology Published by Wiley Publishing Asia Pty Ltd on behalf of Institute of Botany, Chinese Academy of Sciences.

  20. A mesh generation and machine learning framework for Drosophila gene expression pattern image analysis

    PubMed Central

    2013-01-01

    Background Multicellular organisms consist of cells of many different types that are established during development. Each type of cell is characterized by the unique combination of expressed gene products as a result of spatiotemporal gene regulation. Currently, a fundamental challenge in regulatory biology is to elucidate the gene expression controls that generate the complex body plans during development. Recent advances in high-throughput biotechnologies have generated spatiotemporal expression patterns for thousands of genes in the model organism fruit fly Drosophila melanogaster. Existing qualitative methods enhanced by a quantitative analysis based on computational tools we present in this paper would provide promising ways for addressing key scientific questions. Results We develop a set of computational methods and open source tools for identifying co-expressed embryonic domains and the associated genes simultaneously. To map the expression patterns of many genes into the same coordinate space and account for the embryonic shape variations, we develop a mesh generation method to deform a meshed generic ellipse to each individual embryo. We then develop a co-clustering formulation to cluster the genes and the mesh elements, thereby identifying co-expressed embryonic domains and the associated genes simultaneously. Experimental results indicate that the gene and mesh co-clusters can be correlated to key developmental events during the stages of embryogenesis we study. The open source software tool has been made available at http://compbio.cs.odu.edu/fly/. Conclusions Our mesh generation and machine learning methods and tools improve upon the flexibility, ease-of-use and accuracy of existing methods. PMID:24373308

  1. Altered procollagen gene expression in mid-gestational mouse excisional wounds.

    PubMed

    Goldberg, Stephanie R; Quirk, Gerald L; Sykes, Virginia W; Kordula, Tomasz; Lanning, David A

    2007-11-01

    Many pathologic conditions are characterized by excessive tissue contraction and scar formation. Previously, we developed a murine model of excisional wound healing in which mid-gestational wounds heal scarlessly compared with late-gestational wounds. We theorized that variations in procollagen gene expression may contribute to the scarless and rapid closure. Time-dated pregnant FVB strain mice underwent laparotomy and hysterotomy on embryonic days 15 (E15) and 18 (E18). Full-thickness, excisional wounds (3 mm) were made on each of 4 fetuses per doe and then harvested at 32, 48, or 72 h. Control tissue consisted of age-matched normal fetal skin. Procollagen types 1alpha1, 1alpha2, and 3 gene expressions were measured by real-time polymerase chain reaction and normalized to glyceraldehyde-3-phosphate dehydrogenase. Trichrome staining was also performed. Procollagen 1alpha1 expression was decreased in E15 wounds at 32 h compared with their normal skin groups. Procollagen types 1alpha2 and 3 expressions were both increased in the E15 groups compared with the E18 groups at 48 h. At 72 h, the E15 wounds had a collagen density similar to the surrounding normal skin while E18 wounds exhibited increased collagen deposition in a disorganized pattern. This study demonstrates that the pattern of gene expression for types 1 and 3 collagen varies between mid- and late-gestational mouse excisional wounds. These alterations in procollagen expression may contribute to a pattern of collagen deposition in the mid-gestational fetuses that is more favorable for scarless healing with less type 1 and more type 3 collagen.

  2. Evaluation of in vitro macrophage differentiation during space flight

    NASA Astrophysics Data System (ADS)

    Ortega, M. Teresa; Lu, Nanyan; Chapes, Stephen K.

    2012-05-01

    We differentiated mouse bone marrow cells in the presence of recombinant macrophage colony stimulating (rM-CSF) factor for 14 days during the flight of space shuttle Space Transportation System (STS)-126. We tested the hypothesis that the receptor expression for M-CSF, c-Fms was reduced. We used flow cytometry to assess molecules on cells that were preserved during flight to define the differentiation state of the developing bone marrow macrophages; including CD11b, CD31, CD44, Ly6C, Ly6G, F4/80, Mac2, c-Fos as well as c-Fms. In addition, RNA was preserved during the flight and was used to perform a gene microarray. We found that there were significant differences in the number of macrophages that developed in space compared to controls maintained on Earth. We found that there were significant changes in the distribution of cells that expressed CD11b, CD31, F4/80, Mac2, Ly6C and c-Fos. However, there were no changes in c-Fms expression and no consistent pattern of advanced or retarded differentiation during space flight. We also found a pattern of transcript levels that would be consistent with a relatively normal differentiation outcome but increased proliferation by the bone marrow macrophages that were assayed after 14 days of space flight. There also was a surprising pattern of space flight influence on genes of the coagulation pathway. These data confirm that a space flight can have an impact on the in vitro development of macrophages from mouse bone marrow cells.

  3. Evaluation of in vitro macrophage differentiation during space flight.

    PubMed

    Ortega, M Teresa; Lu, Nanyan; Chapes, Stephen K

    2012-05-15

    We differentiated mouse bone marrow cells in the presence of recombinant macrophage colony stimulating (rM-CSF) factor for 14 days during the flight of space shuttle Space Transportation System (STS)-126. We tested the hypothesis that the receptor expression for M-CSF, c-Fms was reduced. We used flow cytometry to assess molecules on cells that were preserved during flight to define the differentiation state of the developing bone marrow macrophages; including CD11b, CD31, CD44, Ly6C, Ly6G, F4/80, Mac2, c-Fos as well as c-Fms. In addition, RNA was preserved during the flight and was used to perform a gene microarray. We found that there were significant differences in the number of macrophages that developed in space compared to controls maintained on Earth. We found that there were significant changes in the distribution of cells that expressed CD11b, CD31, F4/80, Mac2, Ly6C and c-Fos. However, there were no changes in c-Fms expression and no consistent pattern of advanced or retarded differentiation during space flight. We also found a pattern of transcript levels that would be consistent with a relatively normal differentiation outcome but increased proliferation by the bone marrow macrophages that were assayed after 14 days of space flight. There also was a surprising pattern of space flight influence on genes of the coagulation pathway. These data confirm that a space flight can have an impact on the in vitro development of macrophages from mouse bone marrow cells.

  4. The Toll pathway is required in the epidermis for muscle development in the Drosophila embryo

    NASA Technical Reports Server (NTRS)

    Halfon, M. S.; Keshishian, H.

    1998-01-01

    The Toll signaling pathway functions in several Drosophila processes, including dorsal-ventral pattern formation and the immune response. Here, we demonstrate that this pathway is required in the epidermis for proper muscle development. Previously, we showed that the zygotic Toll protein is necessary for normal muscle development; in the absence of zygotic Toll, close to 50% of hemisegments have muscle patterning defects consisting of missing, duplicated and misinserted muscle fibers (Halfon, M.S., Hashimoto, C., and Keshishian, H., Dev. Biol. 169, 151-167, 1995). We have now also analyzed the requirements for easter, spatzle, tube, and pelle, all of which function in the Toll-mediated dorsal-ventral patterning pathway. We find that spatzle, tube, and pelle, but not easter, are necessary for muscle development. Mutations in these genes give a phenotype identical to that seen in Toll mutants, suggesting that elements of the same pathway used for Toll signaling in dorsal-ventral development are used during muscle development. By expressing the Toll cDNA under the control of distinct Toll enhancer elements in Toll mutant flies, we have examined the spatial requirements for Toll expression during muscle development. Expression of Toll in a subset of epidermal cells that includes the epidermal muscle attachment cells, but not Toll expression in the musculature, is necessary for proper muscle development. Our results suggest that signals received by the epidermis early during muscle development are an important part of the muscle patterning process.

  5. Vascular Gene Expression in Nonneoplastic and Malignant Brain

    PubMed Central

    Madden, Stephen L.; Cook, Brian P.; Nacht, Mariana; Weber, William D.; Callahan, Michelle R.; Jiang, Yide; Dufault, Michael R.; Zhang, Xiaoming; Zhang, Wen; Walter-Yohrling, Jennifer; Rouleau, Cecile; Akmaev, Viatcheslav R.; Wang, Clarence J.; Cao, Xiaohong; St. Martin, Thia B.; Roberts, Bruce L.; Teicher, Beverly A.; Klinger, Katherine W.; Stan, Radu-Virgil; Lucey, Brenden; Carson-Walter, Eleanor B.; Laterra, John; Walter, Kevin A.

    2004-01-01

    Malignant gliomas are uniformly lethal tumors whose morbidity is mediated in large part by the angiogenic response of the brain to the invading tumor. This profound angiogenic response leads to aggressive tumor invasion and destruction of surrounding brain tissue as well as blood-brain barrier breakdown and life-threatening cerebral edema. To investigate the molecular mechanisms governing the proliferation of abnormal microvasculature in malignant brain tumor patients, we have undertaken a cell-specific transcriptome analysis from surgically harvested nonneoplastic and tumor-associated endothelial cells. SAGE-derived endothelial cell gene expression patterns from glioma and nonneoplastic brain tissue reveal distinct gene expression patterns and consistent up-regulation of certain glioma endothelial marker genes across patient samples. We define the G-protein-coupled receptor RDC1 as a tumor endothelial marker whose expression is distinctly induced in tumor endothelial cells of both brain and peripheral vasculature. Further, we demonstrate that the glioma-induced gene, PV1, shows expression both restricted to endothelial cells and coincident with endothelial cell tube formation. As PV1 provides a framework for endothelial cell caveolar diaphragms, this protein may serve to enhance glioma-induced disruption of the blood-brain barrier and transendothelial exchange. Additional characterization of this extensive brain endothelial cell gene expression database will provide unique molecular insights into vascular gene expression. PMID:15277233

  6. Clustering Algorithms: Their Application to Gene Expression Data

    PubMed Central

    Oyelade, Jelili; Isewon, Itunuoluwa; Oladipupo, Funke; Aromolaran, Olufemi; Uwoghiren, Efosa; Ameh, Faridah; Achas, Moses; Adebiyi, Ezekiel

    2016-01-01

    Gene expression data hide vital information required to understand the biological process that takes place in a particular organism in relation to its environment. Deciphering the hidden patterns in gene expression data proffers a prodigious preference to strengthen the understanding of functional genomics. The complexity of biological networks and the volume of genes present increase the challenges of comprehending and interpretation of the resulting mass of data, which consists of millions of measurements; these data also inhibit vagueness, imprecision, and noise. Therefore, the use of clustering techniques is a first step toward addressing these challenges, which is essential in the data mining process to reveal natural structures and identify interesting patterns in the underlying data. The clustering of gene expression data has been proven to be useful in making known the natural structure inherent in gene expression data, understanding gene functions, cellular processes, and subtypes of cells, mining useful information from noisy data, and understanding gene regulation. The other benefit of clustering gene expression data is the identification of homology, which is very important in vaccine design. This review examines the various clustering algorithms applicable to the gene expression data in order to discover and provide useful knowledge of the appropriate clustering technique that will guarantee stability and high degree of accuracy in its analysis procedure. PMID:27932867

  7. Transcriptional response of honey bee larvae infected with the bacterial pathogen Paenibacillus larvae.

    PubMed

    Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D

    2013-01-01

    American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis.

  8. Specific Tandem 3'UTR Patterns and Gene Expression Profiles in Mouse Thy1+ Germline Stem Cells

    PubMed Central

    Lin, Zhuoheng; Feng, Xuyang; Jiang, Xue; Songyang, Zhou; Huang, Junjiu

    2015-01-01

    A recently developed strategy of sequencing alternative polyadenylation (APA) sites (SAPAS) with second-generation sequencing technology can be used to explore complete genome-wide patterns of tandem APA sites and global gene expression profiles. spermatogonial stem cells (SSCs) maintain long-term reproductive abilities in male mammals. The detailed mechanisms by which SSCs self-renew and generate mature spermatozoa are not clear. To understand the specific alternative polyadenylation pattern and global gene expression profile of male germline stem cells (GSCs, mainly referred to SSCs here), we isolated and purified mouse Thy1+ cells from testis by magnetic-activated cell sorting (MACS) and then used the SAPAS method for analysis, using pluripotent embryonic stem cells (ESCs) and differentiated mouse embryonic fibroblast cells (MEFs) as controls. As a result, we obtained 99,944 poly(A) sites, approximately 40% of which were newly detected in our experiments. These poly(A) sites originated from three mouse cell types and covered 17,499 genes, including 831 long non-coding RNA (lncRNA) genes. We observed that GSCs tend to have shorter 3'UTR lengths while MEFs tend towards longer 3'UTR lengths. We also identified 1337 genes that were highly expressed in GSCs, and these genes were highly consistent with the functional characteristics of GSCs. Our detailed bioinformatics analysis identified APA site-switching events at 3'UTRs and many new specifically expressed genes in GSCs, which we experimentally confirmed. Furthermore, qRT-PCR was performed to validate several events of the 334 genes with distal-to-proximal poly(A) switch in GSCs. Consistently APA reporter assay confirmed the total 3'UTR shortening in GSCs compared to MEFs. We also analyzed the cis elements around the proximal poly(A) site preferentially used in GSCs and found C-rich elements may contribute to this regulation. Overall, our results identified the expression level and polyadenylation site profiles and these data provide new insights into the processes potentially involved in the GSC life cycle and spermatogenesis. PMID:26713853

  9. Neuronal defects in the hindbrain of Hoxa1, Hoxb1 and Hoxb2 mutants reflect regulatory interactions among these Hox genes.

    PubMed

    Gavalas, Anthony; Ruhrberg, Christiana; Livet, Jean; Henderson, Christopher E; Krumlauf, Robb

    2003-12-01

    Hox genes are instrumental in assigning segmental identity in the developing hindbrain. Auto-, cross- and para-regulatory interactions help establish and maintain their expression. To understand to what extent such regulatory interactions shape neuronal patterning in the hindbrain, we analysed neurogenesis, neuronal differentiation and motoneuron migration in Hoxa1, Hoxb1 and Hoxb2 mutant mice. This comparison revealed that neurogenesis and differentiation of specific neuronal subpopulations in r4 was impaired in a similar fashion in all three mutants, but with different degrees of severity. In the Hoxb1 mutants, neurons derived from the presumptive r4 territory were re-specified towards an r2-like identity. Motoneurons derived from that territory resembled trigeminal motoneurons in both their migration patterns and the expression of molecular markers. Both migrating motoneurons and the resident territory underwent changes consistent with a switch from an r4 to r2 identity. Abnormally migrating motoneurons initially formed ectopic nuclei that were subsequently cleared. Their survival could be prolonged through the introduction of a block in the apoptotic pathway. The Hoxa1 mutant phenotype is consistent with a partial misspecification of the presumptive r4 territory that results from partial Hoxb1 activation. The Hoxb2 mutant phenotype is a hypomorph of the Hoxb1 mutant phenotype, consistent with the overlapping roles of these genes in facial motoneuron specification. Therefore, we have delineated the functional requirements in hindbrain neuronal patterning that follow the establishment of the genetic regulatory hierarchy between Hoxa1, Hoxb1 and Hoxb2.

  10. Modulation of haloperidol-induced patterns of the transcription factor Nur77 and Nor-1 expression by serotonergic and adrenergic drugs in the mouse brain

    PubMed Central

    Maheux, Jérôme; Vuillier, Laura; Mahfouz, Mylène; Rouillard, Claude; Lévesque, Daniel

    2015-01-01

    Different patterns of expression of the transcription factors of Nur77 and Nor-1 are induced following acute administration of typical and atypical antipsychotic drugs. The pharmacological profile of atypical antipsychotics suggests that serotonergic and/or adrenergic receptors might contribute to these reported differences. In order to test this possibility, we examined the abilities of serotonin 5-HT1A and 5-HT2A/2C, and α1- and α2-adrenergic receptor drugs to modify the pattern of Nur77 (NR4A1) and Nor-1 (NR4A3) mRNA expression induced by haloperidol. Various groups of mice were treated with either saline, DOI, a 5-HT2A/2C agonist, MDL11939, a 5-HT2A antagonist, 8-OH-DPAT, a 5-HT1A agonist, prazosin, an α1-adrenergic antagonist and idazoxan, an α2-adrenergic antagonist, alone or in combination with haloperidol. The 5-HT2A/2C agonist DOI alone significantly increased Nur77 expression in the medial striatum and nucleus accumbens. DOI reduced Nor-1 expression, while MDL11939 increased the expression of this transcript in the cortex. Prazosin reduced Nur77 expression in the dorsal striatum and nucleus accumbens. Interestingly, 8-OH-DPAT and MDL11939 partially prevented haloperidol-induced Nur77 up-regulation, while MDL11939 completely abolished Nor-1 expression in the striatum. In addition, MDL11939 decreased haloperidol-induced Nur77 and Nor-1 mRNA levels in the ventral tegmental area. On the contrary, idazoxan (α2 antagonist) consistently potentiated haloperidol-induced Nur77, but not Nor-1 mRNA levels in the striatum, whereas prazosin (α1 antagonist) remained without effect. Taken together, these results show the ability of a 5-HT1A agonist or a 5-HT2A antagonist to reduce haloperidol-induced Nur77 and Nor-1 striatal expression, suggesting that these serotonin receptor subtypes participate in the differential pattern of gene expression induced by typical and atypical antipsychotic drugs. PMID:21524335

  11. Genetic Networks and Anticipation of Gene Expression Patterns

    NASA Astrophysics Data System (ADS)

    Gebert, J.; Lätsch, M.; Pickl, S. W.; Radde, N.; Weber, G.-W.; Wünschiers, R.

    2004-08-01

    An interesting problem for computational biology is the analysis of time-series expression data. Here, the application of modern methods from dynamical systems, optimization theory, numerical algorithms and the utilization of implicit discrete information lead to a deeper understanding. In [1], we suggested to represent the behavior of time-series gene expression patterns by a system of ordinary differential equations, which we analytically and algorithmically investigated under the parametrical aspect of stability or instability. Our algorithm strongly exploited combinatorial information. In this paper, we deepen, extend and exemplify this study from the viewpoint of underlying mathematical modelling. This modelling consists in evaluating DNA-microarray measurements as the basis of anticipatory prediction, in the choice of a smooth model given by differential equations, in an approach of the right-hand side with parametric matrices, and in a discrete approximation which is a least squares optimization problem. We give a mathematical and biological discussion, and pay attention to the special case of a linear system, where the matrices do not depend on the state of expressions. Here, we present first numerical examples.

  12. Analysis of Microbe-Associated Molecular Pattern-Responsive Synthetic Promoters with the Parsley Protoplast System.

    PubMed

    Kanofsky, Konstantin; Lehmeyer, Mona; Schulze, Jutta; Hehl, Reinhard

    2016-01-01

    Plants recognize pathogens by microbe-associated molecular patterns (MAMPs) and subsequently induce an immune response. The regulation of gene expression during the immune response depends largely on cis-sequences conserved in promoters of MAMP-responsive genes. These cis-sequences can be analyzed by constructing synthetic promoters linked to a reporter gene and by testing these constructs in transient expression systems. Here, the use of the parsley (Petroselinum crispum) protoplast system for analyzing MAMP-responsive synthetic promoters is described. The synthetic promoter consists of four copies of a potential MAMP-responsive cis-sequence cloned upstream of a minimal promoter and the uidA reporter gene. The reporter plasmid contains a second reporter gene, which is constitutively expressed and hence eliminates the requirement of a second plasmid used as a transformation control. The reporter plasmid is transformed into parsley protoplasts that are elicited by the MAMP Pep25. The MAMP responsiveness is validated by comparing the reporter gene activity from MAMP-treated and untreated cells and by normalizing reporter gene activity using the constitutively expressed reporter gene.

  13. Analysis of Thioester-Containing Proteins during the Innate Immune Response of Drosophila melanogaster

    PubMed Central

    Bou Aoun, Richard; Hetru, Charles; Troxler, Laurent; Doucet, Daniel; Ferrandon, Dominique; Matt, Nicolas

    2010-01-01

    Thioester-containing proteins (TEPs) are conserved proteins among insects that are thought to be involved in innate immunity. In Drosophila, the Tep family is composed of 6 genes named Tep1–Tep6. In this study, we investigated the phylogeny, expression pattern and roles of these genes in the host defense of Drosophila. Protostomian Tep genes are clustered in 3 distinct branches, 1 of which is specific to mosquitoes. Most D. melanogaster Tep genes are expressed in hemocytes, can be induced in the fat body, and are expressed in specific regions of the hypodermis. This expression pattern is consistent with a role in innate immunity. However, we find that TEP1, TEP2, and TEP4 are not strictly required in the body cavity to fight several bacterial and fungal infections. One possibility is that Drosophila TEPs act redundantly or that their absence can be compensated by other components of the immune response. TEPs may thus provide a subtle selective advantage during evolution. Alternatively, they may be required in host defense against specific as yet unidentified natural pathogens of Drosophila. PMID:21063077

  14. BnEPFL6, an EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) secreted peptide gene, is required for filament elongation in Brassica napus.

    PubMed

    Huang, Yi; Tao, Zhangsheng; Liu, Qiong; Wang, Xinfa; Yu, Jingyin; Liu, Guihua; Wang, Hanzhong

    2014-07-01

    Inflorescence architecture, pedicel length and stomata patterning in Arabidopsis thaliana are specified by inter-tissue communication mediated by ERECTA and its signaling ligands in the EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) family of secreted cysteine-rich peptides. Here, we identified and characterized BnEPFL6 from Brassica napus. Heterologous expression of this gene under the double enhanced CaMV promoter (D35S) in Arabidopsis resulted in shortened stamen filaments, filaments degradation, and reduced filament cell size that displayed down-regulated expression of AHK2, in which phenotypic variation of ahk2-1 mutant presented highly consistent with that of BnEPFL6 transgenic lines. Especially, the expression level of BnEPFL6 in the shortened filaments of four B. napus male sterile lines (98A, 86A, SA, and Z11A) was similar to that of BnEPFL6 in the transgenic Arabidopsis lines. The activity of pBnEPFL6.2::GUS was intensive in the filaments of transgenic lines. These observations reveal that BnEPFL6 plays an important role in filament elongation and may also affect organ morphology and floral organ specification via a BnEPFL6-mediated cascade.

  15. Selective inhibition of yeast regulons by daunorubicin: A transcriptome-wide analysis

    PubMed Central

    Rojas, Marta; Casado, Marta; Portugal, José; Piña, Benjamin

    2008-01-01

    Background The antitumor drug daunorubicin exerts some of its cytotoxic effects by binding to DNA and inhibiting the transcription of different genes. We analysed this effect in vivo at the transcriptome level using the budding yeast Saccharomyces cerevisiae as a model and sublethal (IC40) concentrations of the drug to minimise general toxic effects. Results Daunorubicin affected a minor proportion (14%) of the yeast transcriptome, increasing the expression of 195 genes and reducing expression of 280 genes. Daunorubicin down-regulated genes included essentially all genes involved in the glycolytic pathway, the tricarboxylic acid cycle and alcohol metabolism, whereas transcription of ribosomal protein genes was not affected or even slightly increased. This pattern is consistent with a specific inhibition of glucose usage in treated cells, with only minor effects on proliferation or other basic cell functions. Analysis of promoters of down-regulated genes showed that they belong to a limited number of transcriptional regulatory units (regulons). Consistently, data mining showed that daunorubicin-induced changes in expression patterns were similar to those observed in yeast strains deleted for some transcription factors functionally related to the glycolysis and/or the cAMP regulatory pathway, which appeared to be particularly sensitive to daunorubicin. Conclusion The effects of daunorubicin treatment on the yeast transcriptome are consistent with a model in which this drug impairs binding of different transcription factors by competing for their DNA binding sequences, therefore limiting their effectiveness and affecting the corresponding regulatory networks. This proposed mechanism might have broad therapeutic implications against cancer cells growing under hypoxic conditions. PMID:18667070

  16. A forkhead Transcription Factor Is Wound-Induced at the Planarian Midline and Required for Anterior Pole Regeneration

    PubMed Central

    Scimone, M. Lucila; Lapan, Sylvain W.; Reddien, Peter W.

    2014-01-01

    Planarian regeneration requires positional information to specify the identity of tissues to be replaced as well as pluripotent neoblasts capable of differentiating into new cell types. We found that wounding elicits rapid expression of a gene encoding a Forkhead-family transcription factor, FoxD. Wound-induced FoxD expression is specific to the ventral midline, is regulated by Hedgehog signaling, and is neoblast-independent. FoxD is subsequently expressed within a medial subpopulation of neoblasts at wounds involving head regeneration. Ultimately, FoxD is co-expressed with multiple anterior markers at the anterior pole. Inhibition of FoxD with RNA interference (RNAi) results in the failure to specify neoblasts expressing anterior markers (notum and prep) and in anterior pole formation defects. FoxD(RNAi) animals fail to regenerate a new midline and to properly pattern the anterior blastema, consistent with a role for the anterior pole in organizing pattern of the regenerating head. Our results suggest that wound signaling activates a forkhead transcription factor at the midline and, if the head is absent, FoxD promotes specification of neoblasts at the prior midline for anterior pole regeneration. PMID:24415944

  17. Characterization and expression patterns of small RNAs in synthesized Brassica hexaploids.

    PubMed

    Shen, Yanyue; Zhao, Qin; Zou, Jun; Wang, Wenliang; Gao, Yi; Meng, Jinling; Wang, Jianbo

    2014-06-01

    Polyploidy has played an important role in promoting plant evolution through genomic merging and doubling. We used high-throughput sequencing to compare miRNA expression profiles between Brassica hexaploid and its parents. A total of 613, 784 and 742 known miRNAs were identified in Brassica rapa, Brassica carinata, and Brassica hexaploid, respectively. We detected 618 miRNAs were differentially expressed (log(2)Ratio ≥ 1, P ≤ 0.05) between Brassica hexaploid and its parents, and 425 miRNAs were non-additively expressed in Brassica hexaploid, which suggest a trend of non-additive miRNA regulation following hybridization and polyploidization. Remarkably, majority of the non-additively expressed miRNAs in the Brassica hexaploid are repressed, and there was a bias toward repression of B. rapa miRNAs, which is consistent with the progenitor-biased gene repression in the synthetic allopolyploids. In addition, we identified 653 novel mature miRNAs in Brassica hexaploid and its parents. Finally, we found that almost all the non-additive accumulation of siRNA clusters exhibited a low-parent pattern in Brassica hexaploid. Non-additive small RNA regulation is involved in a range of biological pathways, probably providing a driving force for variation and adaptation in allopolyploids.

  18. Developmental changes in facial expressions of emotions in the strange situation during the second year of life.

    PubMed

    Izard, Carroll E; Abe, Jo Ann A

    2004-09-01

    Infants' expressions of discrete emotions were coded during the more stressful episodes (4 through 8) of the Strange Situation at 13 and 18 months. The data showed a significant decrease in full-face expressions (more complex configurations of movements) and a significant increase in component expressions (simpler and more constrained patterns of movements). The authors interpreted this trend as a developmental change toward more regulated and less intense emotions. Consistent with this view, the aggregate index of infants' full-face negative emotion expressions, interpreted as reflecting relatively unregulated intense emotions, correlated significantly with maternal ratings of difficult temperament. The authors discuss alternative interpretations of the findings in terms of changes in reactivity/arousability and the emerging capacity for self-regulation. (c) 2004 APA, all rights reserved

  19. Complex phylogeny and gene expression patterns of members of the NITRATE TRANSPORTER 1/PEPTIDE TRANSPORTER family (NPF) in wheat

    PubMed Central

    Buchner, Peter; Hawkesford, Malcolm J.

    2014-01-01

    NPF (formerly referred to as low-affinity NRT1) and ‘high-affinity’ NRT2 nitrate transporter genes are involved in nitrate uptake by the root, and transport and distribution of nitrate within the plant. The NPF gene family consists of 53 members in Arabidopsis thaliana, however only 11 of these have been functionally characterized. Although homologous genes have been identified in genomes of different plant species including some cereals, there is little information available for wheat (Triticum aestivum). Sixteen genes were identified in wheat homologous to characterized Arabidopsis low-affinity nitrate transporter NPF genes, suggesting a complex wheat NPF gene family. The regulation of wheat NFP genes by plant N-status indicated involvement of these transporters in substrate transport in relation to N-metabolism. The complex expression pattern in relation to tissue specificity, nitrate availability and senescence may be associated with the complex growth patterns of wheat depending on sink/source demands, as well as remobilization during grain filling. PMID:24913625

  20. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  1. Identification of a spatially specific enhancer element in the chicken Msx-2 gene that regulates its expression in the apical ectodermal ridge of the developing limb buds of transgenic mice.

    PubMed

    Sumoy, L; Wang, C K; Lichtler, A C; Pierro, L J; Kosher, R A; Upholt, W B

    1995-07-01

    Msx-2 is a member of the Msx family of homeobox-containing genes expressed in a variety of embryonic tissues involved in epithelial-mesenchymal interactions and pattern formation. In the developing chick limb bud, Msx-2 is expressed in the apical ectodermal ridge, which plays a crucial role in directing the growth and patterning of limb mesoderm. In addition, Msx-2 is expressed in the anterior nonskeletal-forming mesoderm of the limb bud, in the posterior necrotic zone, and in the interdigital mesenchyme. Studies of the altered expression patterns of Msx-2 in amelic and polydactylous mutant chick limbs have suggested that the apical ectodermal ridge and mesodermal domains of Msx-2 expression are independently regulated and that there might be separate cis-regulatory elements in the Msx-2 gene controlling its spatially distinct domains of expression. To test this hypothesis, we have isolated the chicken Msx-2 gene and have tested the ability of various regions of the gene to target expression of LacZ reporter gene to specific regions of the limbs of transgenic mice. A variety of these constructs are consistently expressed only in the apical ectodermal ridge and the ectoderm of the genital tubercle and are not expressed in the mesoderm of the limb bud or in other regions of the embryo where the endogenous Msx-2 gene is expressed. These results suggest the presence of spatially specific cis-regulatory elements in the Msx-2 gene. We identified a 348-bp region in the 5' flanking region of the Msx-2 gene which can act as an apical ectodermal ridge enhancer element when placed in reverse orientation in front of the reporter gene with transcription initiation directed by the minimal hsp68 promoter.

  2. Genetic Variation in Melatonin Pathway Enzymes in Children with Autism Spectrum Disorder and Comorbid Sleep Onset Delay

    ERIC Educational Resources Information Center

    Veatch, Olivia J.; Pendergast, Julie S.; Allen, Melissa J.; Leu, Roberta M.; Johnson, Carl Hirschie; Elsea, Sarah H.; Malow, Beth A.

    2015-01-01

    Sleep disruption is common in individuals with autism spectrum disorder (ASD). Genes whose products regulate endogenous melatonin modify sleep patterns and have been implicated in ASD. Genetic factors likely contribute to comorbid expression of sleep disorders in ASD. We studied a clinically unique ASD subgroup, consisting solely of children with…

  3. Analyzing Performance by Grade 10 Hispanic High School Students on the Massachusetts State Assessment. Issues & Answers. REL 2009-No. 071

    ERIC Educational Resources Information Center

    Sanchez, Maria Teresa; Ehrlich, Stacy; Midouhas, Emily; O'Dwyer, Laura

    2009-01-01

    Massachusetts policymakers recently expressed a desire to better understand Hispanic student achievement patterns in their state. Scores on the Massachusetts Comprehensive Assessment System (MCAS) tests have consistently revealed a gap in performance between Hispanic students and students from other subgroups, a gap corresponding to national…

  4. Formation of polarity convergences underlying shoot outgrowths

    PubMed Central

    Abley, Katie; Sauret-Güeto, Susanna; Marée, Athanasius FM; Coen, Enrico

    2016-01-01

    The development of outgrowths from plant shoots depends on formation of epidermal sites of cell polarity convergence with high intracellular auxin at their centre. A parsimonious model for generation of convergence sites is that cell polarity for the auxin transporter PIN1 orients up auxin gradients, as this spontaneously generates convergent alignments. Here we test predictions of this and other models for the patterns of auxin biosynthesis and import. Live imaging of outgrowths from kanadi1 kanadi2 Arabidopsis mutant leaves shows that they arise by formation of PIN1 convergence sites within a proximodistal polarity field. PIN1 polarities are oriented away from regions of high auxin biosynthesis enzyme expression, and towards regions of high auxin importer expression. Both expression patterns are required for normal outgrowth emergence, and may form part of a common module underlying shoot outgrowths. These findings are more consistent with models that spontaneously generate tandem rather than convergent alignments. DOI: http://dx.doi.org/10.7554/eLife.18165.001 PMID:27478985

  5. Canonical Genetic Signatures of the Adult Human Brain

    PubMed Central

    Hawrylycz, Michael; Miller, Jeremy A.; Menon, Vilas; Feng, David; Dolbeare, Tim; Guillozet-Bongaarts, Angela L.; Jegga, Anil G.; Aronow, Bruce J.; Lee, Chang-Kyu; Bernard, Amy; Glasser, Matthew F.; Dierker, Donna L.; Menche, Jörge; Szafer, Aaron; Collman, Forrest; Grange, Pascal; Berman, Kenneth A.; Mihalas, Stefan; Yao, Zizhen; Stewart, Lance; Barabási, Albert-László; Schulkin, Jay; Phillips, John; Ng, Lydia; Dang, Chinh; Haynor, David R.; Jones, Allan; Van Essen, David C.; Koch, Christof; Lein, Ed

    2015-01-01

    The structure and function of the human brain are highly stereotyped, implying a conserved molecular program responsible for its development, cellular structure, and function. We applied a correlation-based metric of “differential stability” (DS) to assess reproducibility of gene expression patterning across 132 structures in six individual brains, revealing meso-scale genetic organization. The highest DS genes are highly biologically relevant, with enrichment for brain-related biological annotations, disease associations, drug targets, and literature citations. Using high DS genes we identified 32 anatomically diverse and reproducible gene expression signatures, which represent distinct cell types, intracellular components, and/or associations with neurodevelopmental and neurodegenerative disorders. Genes in neuron-associated compared to non-neuronal networks showed higher preservation between human and mouse; however, many diversely-patterned genes displayed dramatic shifts in regulation between species. Finally, highly consistent transcriptional architecture in neocortex is correlated with resting state functional connectivity, suggesting a link between conserved gene expression and functionally relevant circuitry. PMID:26571460

  6. Analysis of differential protein expression in normal and neoplastic human breast epithelial cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, K.; Chubb, C.; Huberman, E.

    High resolution two dimensional get electrophoresis (2DE) and database analysis was used to establish protein expression patterns for cultured normal human mammary epithelial cells and thirteen breast cancer cell lines. The Human Breast Epithelial Cell database contains the 2DE protein patterns, including relative protein abundances, for each cell line, plus a composite pattern that contains all the common and specifically expressed proteins from all the cell lines. Significant differences in protein expression, both qualitative and quantitative, were observed not only between normal cells and tumor cells, but also among the tumor cell lines. Eight percent of the consistently detected proteinsmore » were found in significantly (P < 0.001) variable levels among the cell lines. Using a combination of immunostaining, comigration with purified protein, subcellular fractionation, and amino-terminal protein sequencing, we identified a subset of the differentially expressed proteins. These identified proteins include the cytoskeletal proteins actin, tubulin, vimentin, and cytokeratins. The cell lines can be classified into four distinct groups based on their intermediate filament protein profile. We also identified heat shock proteins; hsp27, hsp60, and hsp70 varied in abundance and in some cases in the relative phosphorylation levels among the cell lines. Finally, we identified IMP dehydrogenase in each of the cell lines, and found the levels of this enzyme in the tumor cell lines elevated 2- to 20-fold relative to the levels in normal cells.« less

  7. Deep sequencing reveals cell-type-specific patterns of single-cell transcriptome variation.

    PubMed

    Dueck, Hannah; Khaladkar, Mugdha; Kim, Tae Kyung; Spaethling, Jennifer M; Francis, Chantal; Suresh, Sangita; Fisher, Stephen A; Seale, Patrick; Beck, Sheryl G; Bartfai, Tamas; Kuhn, Bernhard; Eberwine, James; Kim, Junhyong

    2015-06-09

    Differentiation of metazoan cells requires execution of different gene expression programs but recent single-cell transcriptome profiling has revealed considerable variation within cells of seeming identical phenotype. This brings into question the relationship between transcriptome states and cell phenotypes. Additionally, single-cell transcriptomics presents unique analysis challenges that need to be addressed to answer this question. We present high quality deep read-depth single-cell RNA sequencing for 91 cells from five mouse tissues and 18 cells from two rat tissues, along with 30 control samples of bulk RNA diluted to single-cell levels. We find that transcriptomes differ globally across tissues with regard to the number of genes expressed, the average expression patterns, and within-cell-type variation patterns. We develop methods to filter genes for reliable quantification and to calibrate biological variation. All cell types include genes with high variability in expression, in a tissue-specific manner. We also find evidence that single-cell variability of neuronal genes in mice is correlated with that in rats consistent with the hypothesis that levels of variation may be conserved. Single-cell RNA-sequencing data provide a unique view of transcriptome function; however, careful analysis is required in order to use single-cell RNA-sequencing measurements for this purpose. Technical variation must be considered in single-cell RNA-sequencing studies of expression variation. For a subset of genes, biological variability within each cell type appears to be regulated in order to perform dynamic functions, rather than solely molecular noise.

  8. Patterns of homoeologous gene expression shown by RNA sequencing in hexaploid bread wheat

    PubMed Central

    2014-01-01

    Background Bread wheat (Triticum aestivum) has a large, complex and hexaploid genome consisting of A, B and D homoeologous chromosome sets. Therefore each wheat gene potentially exists as a trio of A, B and D homoeoloci, each of which may contribute differentially to wheat phenotypes. We describe a novel approach combining wheat cytogenetic resources (chromosome substitution ‘nullisomic-tetrasomic’ lines) with next generation deep sequencing of gene transcripts (RNA-Seq), to directly and accurately identify homoeologue-specific single nucleotide variants and quantify the relative contribution of individual homoeoloci to gene expression. Results We discover, based on a sample comprising ~5-10% of the total wheat gene content, that at least 45% of wheat genes are expressed from all three distinct homoeoloci. Most of these genes show strikingly biased expression patterns in which expression is dominated by a single homoeolocus. The remaining ~55% of wheat genes are expressed from either one or two homoeoloci only, through a combination of extensive transcriptional silencing and homoeolocus loss. Conclusions We conclude that wheat is tending towards functional diploidy, through a variety of mechanisms causing single homoeoloci to become the predominant source of gene transcripts. This discovery has profound consequences for wheat breeding and our understanding of wheat evolution. PMID:24726045

  9. eMBI: Boosting Gene Expression-based Clustering for Cancer Subtypes.

    PubMed

    Chang, Zheng; Wang, Zhenjia; Ashby, Cody; Zhou, Chuan; Li, Guojun; Zhang, Shuzhong; Huang, Xiuzhen

    2014-01-01

    Identifying clinically relevant subtypes of a cancer using gene expression data is a challenging and important problem in medicine, and is a necessary premise to provide specific and efficient treatments for patients of different subtypes. Matrix factorization provides a solution by finding checker-board patterns in the matrices of gene expression data. In the context of gene expression profiles of cancer patients, these checkerboard patterns correspond to genes that are up- or down-regulated in patients with particular cancer subtypes. Recently, a new matrix factorization framework for biclustering called Maximum Block Improvement (MBI) is proposed; however, it still suffers several problems when applied to cancer gene expression data analysis. In this study, we developed many effective strategies to improve MBI and designed a new program called enhanced MBI (eMBI), which is more effective and efficient to identify cancer subtypes. Our tests on several gene expression profiling datasets of cancer patients consistently indicate that eMBI achieves significant improvements in comparison with MBI, in terms of cancer subtype prediction accuracy, robustness, and running time. In addition, the performance of eMBI is much better than another widely used matrix factorization method called nonnegative matrix factorization (NMF) and the method of hierarchical clustering, which is often the first choice of clinical analysts in practice.

  10. eMBI: Boosting Gene Expression-based Clustering for Cancer Subtypes

    PubMed Central

    Chang, Zheng; Wang, Zhenjia; Ashby, Cody; Zhou, Chuan; Li, Guojun; Zhang, Shuzhong; Huang, Xiuzhen

    2014-01-01

    Identifying clinically relevant subtypes of a cancer using gene expression data is a challenging and important problem in medicine, and is a necessary premise to provide specific and efficient treatments for patients of different subtypes. Matrix factorization provides a solution by finding checker-board patterns in the matrices of gene expression data. In the context of gene expression profiles of cancer patients, these checkerboard patterns correspond to genes that are up- or down-regulated in patients with particular cancer subtypes. Recently, a new matrix factorization framework for biclustering called Maximum Block Improvement (MBI) is proposed; however, it still suffers several problems when applied to cancer gene expression data analysis. In this study, we developed many effective strategies to improve MBI and designed a new program called enhanced MBI (eMBI), which is more effective and efficient to identify cancer subtypes. Our tests on several gene expression profiling datasets of cancer patients consistently indicate that eMBI achieves significant improvements in comparison with MBI, in terms of cancer subtype prediction accuracy, robustness, and running time. In addition, the performance of eMBI is much better than another widely used matrix factorization method called nonnegative matrix factorization (NMF) and the method of hierarchical clustering, which is often the first choice of clinical analysts in practice. PMID:25374455

  11. Gene-specific cell labeling using MiMIC transposons

    PubMed Central

    Gnerer, Joshua P.; Venken, Koen J. T.; Dierick, Herman A.

    2015-01-01

    Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. PMID:25712101

  12. Arc/Arg3.1 mRNA expression reveals a subcellular trace of prior sound exposure in adult primary auditory cortex.

    PubMed

    Ivanova, T N; Matthews, A; Gross, C; Mappus, R C; Gollnick, C; Swanson, A; Bassell, G J; Liu, R C

    2011-05-05

    Acquiring the behavioral significance of sound has repeatedly been shown to correlate with long term changes in response properties of neurons in the adult primary auditory cortex. However, the molecular and cellular basis for such changes is still poorly understood. To address this, we have begun examining the auditory cortical expression of an activity-dependent effector immediate early gene (IEG) with documented roles in synaptic plasticity and memory consolidation in the hippocampus: Arc/Arg3.1. For initial characterization, we applied a repeated 10 min (24 h separation) sound exposure paradigm to determine the strength and consistency of sound-evoked Arc/Arg3.1 mRNA expression in the absence of explicit behavioral contingencies for the sound. We used 3D surface reconstruction methods in conjunction with fluorescent in situ hybridization (FISH) to assess the layer-specific subcellular compartmental expression of Arc/Arg3.1 mRNA. We unexpectedly found that both the intranuclear and cytoplasmic patterns of expression depended on the prior history of sound stimulation. Specifically, the percentage of neurons with expression only in the cytoplasm increased for repeated versus singular sound exposure, while intranuclear expression decreased. In contrast, the total cellular expression did not differ, consistent with prior IEG studies of primary auditory cortex. Our results were specific for cortical layers 3-6, as there was virtually no sound driven Arc/Arg3.1 mRNA in layers 1-2 immediately after stimulation. Our results are consistent with the kinetics and/or detectability of cortical subcellular Arc/Arg3.1 mRNA expression being altered by the initial exposure to the sound, suggesting exposure-induced modifications in the cytoplasmic Arc/Arg3.1 mRNA pool. Copyright © 2011 IBRO. Published by Elsevier Ltd. All rights reserved.

  13. Arc/Arg3.1 mRNA expression reveals a sub-cellular trace of prior sound exposure in adult primary auditory cortex

    PubMed Central

    Ivanova, Tamara; Matthews, Andrew; Gross, Christina; Mappus, Rudolph C.; Gollnick, Clare; Swanson, Andrew; Bassell, Gary J.; Liu, Robert C.

    2011-01-01

    Acquiring the behavioral significance of a sound has repeatedly been shown to correlate with long term changes in response properties of neurons in the adult primary auditory cortex. However, the molecular and cellular basis for such changes is still poorly understood. To address this, we have begun examining the auditory cortical expression of an activity-dependent effector immediate early gene (IEG) with documented roles in synaptic plasticity and memory consolidation in the hippocampus: Arc/Arg3.1. For initial characterization, we applied a repeated 10 minute (24 hour separation) sound exposure paradigm to determine the strength and consistency of sound-evoked Arc/Arg3.1 mRNA expression in the absence of explicit behavioral contingencies for the sound. We used 3D surface reconstruction methods in conjunction with fluorescent in-situ hybridization (FISH) to assess the layer-specific sub-cellular compartmental expression of Arc/Arg3.1 mRNA. We unexpectedly found that both the intranuclear and cytoplasmic patterns of expression depended on the prior history of sound stimulation. Specifically, the percentage of neurons with expression only in the cytoplasm increased for repeated versus singular sound exposure, while intranuclear expression decreased. In contrast, the total cellular expression did not differ, consistent with prior IEG studies of primary auditory cortex. Our results were specific for cortical layers 3–6, as there was virtually no sound driven Arc/Arg3.1 mRNA in layers 1–2 immediately after stimulation. Our results are consistent with the kinetics and/or detectability of cortical sub-cellular Arc/Arg3.1 mRNA expression being altered by the initial exposure to the sound, suggesting exposure-induced modifications in the cytoplasmic Arc/Arg3.1 mRNA pool. PMID:21334422

  14. Methane monooxygenase gene expression mediated by methanobactin in the presence of mineral copper sources

    PubMed Central

    Knapp, Charles W.; Fowle, David A.; Kulczycki, Ezra; Roberts, Jennifer A.; Graham, David W.

    2007-01-01

    Methane is a major greenhouse gas linked to global warming; however, patterns of in situ methane oxidation by methane-oxidizing bacteria (methanotrophs), nature's main biological mechanism for methane suppression, are often inconsistent with laboratory predictions. For example, one would expect a strong relationship between methanotroph ecology and Cu level because methanotrophs require Cu to sustain particulate methane monooxygenase (pMMO), the most efficient enzyme for methane oxidation. However, no correlation has been observed in nature, which is surprising because methane monooxygenase (MMO) gene expression has been unequivocally linked to Cu availability. Here we provide a fundamental explanation for this lack of correlation. We propose that MMO expression in nature is largely controlled by solid-phase Cu geochemistry and the relative ability of Cu acquisition systems in methanotrophs, such as methanobactins (mb), to obtain Cu from mineral sources. To test this hypothesis, RT-PCR expression assays were developed for Methylosinus trichosporium OB3b (which produces mb) to quantify pMMO, soluble MMO (the alternate MMO expressed when Cu is “unavailable”), and 16S-rRNA gene expression under progressively more stringent Cu supply conditions. When Cu was provided as CuCl2, pMMO transcript levels increased significantly consistent with laboratory work. However, when Cu was provided as Cu-doped iron oxide, pMMO transcript levels increased only when mb was also present. Finally, when Cu was provided as Cu-doped borosilicate glass, pMMO transcription patterns varied depending on the ambient mb:Cu supply ratio. Cu geochemistry clearly influences MMO expression in terrestrial systems, and, as such, local Cu mineralogy might provide an explanation for methane oxidation patterns in the natural environment. PMID:17615240

  15. Characterization of NvLWamide-like neurons reveals stereotypy in Nematostella nerve net development.

    PubMed

    Havrilak, Jamie A; Faltine-Gonzalez, Dylan; Wen, Yiling; Fodera, Daniella; Simpson, Ayanna C; Magie, Craig R; Layden, Michael J

    2017-11-15

    The organization of cnidarian nerve nets is traditionally described as diffuse with randomly arranged neurites that show minimal reproducibility between animals. However, most observations of nerve nets are conducted using cross-reactive antibodies that broadly label neurons, which potentially masks stereotyped patterns produced by individual neuronal subtypes. Additionally, many cnidarians species have overt structures such as a nerve ring, suggesting higher levels of organization and stereotypy exist, but mechanisms that generated that stereotypy are unknown. We previously demonstrated that NvLWamide-like is expressed in a small subset of the Nematostella nerve net and speculated that observing a few neurons within the developing nerve net would provide a better indication of potential stereotypy. Here we document NvLWamide-like expression more systematically. NvLWamide-like is initially expressed in the typical neurogenic salt and pepper pattern within the ectoderm at the gastrula stage, and expression expands to include endodermal salt and pepper expression at the planula larval stage. Expression persists in both ectoderm and endoderm in adults. We characterized our NvLWamide-like::mCherry transgenic reporter line to visualize neural architecture and found that NvLWamide-like is expressed in six neural subtypes identifiable by neural morphology and location. Upon completing development the numbers of neurons in each neural subtype are minimally variable between animals and the projection patterns of each subtype are consistent. Furthermore, between the juvenile polyp and adult stages the number of neurons for each subtype increases. We conclude that development of the Nematostella nerve net is stereotyped between individuals. Our data also imply that one aspect of generating adult cnidarian nervous systems is to modify the basic structural architecture generated in the juvenile by increasing neural number proportionally with size. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  16. MyoD and Myf6 gene expression patterns in skeletal muscle during embryonic and posthatch development in the domestic duck (Anas platyrhynchos domestica).

    PubMed

    Li, H; Zhu, C; Tao, Z; Xu, W; Song, W; Hu, Y; Zhu, W; Song, C

    2014-06-01

    The MyoD and Myf6 genes, which are muscle regulatory factors (MRFs), play major roles in muscle growth and development and initiate muscle fibre formation via the regulation of muscle-specific gene translation. Therefore, MyoD and Myf6 are potential candidate genes for meat production traits in animals and poultry. The objective of this study was to evaluate MyoD and Myf6 gene expression patterns in the skeletal muscle during early developmental stage of ducks. Gene expression levels were detected using the quantitative RT-PCR method in the breast muscle (BM) and leg muscle (LM) at embryonic days 13, 17, 21, 25, 27, as well as at 1 week posthatching in Gaoyou and Jinding ducks (Anas platyrhynchos domestica). The MyoD and Myf6 gene profiles in the two duck breeds were consistent during early development, and MyoD gene expression showed a 'wave' trend in BM and an approximate 'anti-√' trend in LM. Myf6 gene expression in BM showed the highest level at embryonic day 21, which subsequently decreased, although remained relatively high, while levels at embryonic days 13, 17 and 21 were higher in LM. The results of correlation analysis showed that MyoD and Myf6 gene expression levels were more strongly correlated in LM than in BM in both duck breeds. These results indicated that different expression patterns of the MyoD and Myf6 genes in BM and LM may be related to muscle development and differentiation, suggesting that MyoD and Myf6 are integral to skeletal muscle development. © 2013 Blackwell Verlag GmbH.

  17. Single sea urchin phagocytes express messages of a single sequence from the diverse Sp185/333 gene family in response to bacterial challenge.

    PubMed

    Majeske, Audrey J; Oren, Matan; Sacchi, Sandro; Smith, L Courtney

    2014-12-01

    Immune systems in animals rely on fast and efficient responses to a wide variety of pathogens. The Sp185/333 gene family in the purple sea urchin, Strongylocentrotus purpuratus, consists of an estimated 50 (±10) members per genome that share a basic gene structure but show high sequence diversity, primarily due to the mosaic appearance of short blocks of sequence called elements. The genes show significantly elevated expression in three subpopulations of phagocytes responding to marine bacteria. The encoded Sp185/333 proteins are highly diverse and have central effector functions in the immune system. In this study we report the Sp185/333 gene expression in single sea urchin phagocytes. Sea urchins challenged with heat-killed marine bacteria resulted in a typical increase in coelomocyte concentration within 24 h, which included an increased proportion of phagocytes expressing Sp185/333 proteins. Phagocyte fractions enriched from coelomocytes were used in limiting dilutions to obtain samples of single cells that were evaluated for Sp185/333 gene expression by nested RT-PCR. Amplicon sequences showed identical or nearly identical Sp185/333 amplicon sequences in single phagocytes with matches to six known Sp185/333 element patterns, including both common and rare element patterns. This suggested that single phagocytes show restricted expression from the Sp185/333 gene family and infers a diverse, flexible, and efficient response to pathogens. This type of expression pattern from a family of immune response genes in single cells has not been identified previously in other invertebrates. Copyright © 2014 by The American Association of Immunologists, Inc.

  18. Sex differences in autism: a resting-state fMRI investigation of functional brain connectivity in males and females.

    PubMed

    Alaerts, Kaat; Swinnen, Stephan P; Wenderoth, Nicole

    2016-06-01

    Autism spectrum disorders (ASD) are far more prevalent in males than in females. Little is known however about the differential neural expression of ASD in males and females. We used a resting-state fMRI-dataset comprising 42 males/42 females with ASD and 75 male/75 female typical-controls to examine whether autism-related alterations in intrinsic functional connectivity are similar or different in males and females, and particularly whether alterations reflect 'neural masculinization', as predicted by the Extreme Male Brain theory. Males and females showed a differential neural expression of ASD, characterized by highly consistent patterns of hypo-connectivity in males with ASD (compared to typical males), and hyper-connectivity in females with ASD (compared to typical females). Interestingly, patterns of hyper-connectivity in females with ASD reflected a shift towards the (high) connectivity levels seen in typical males (neural masculinization), whereas patterns of hypo-connectivity observed in males with ASD reflected a shift towards the (low) typical feminine connectivity patterns (neural feminization). Our data support the notion that ASD is a disorder of sexual differentiation rather than a disorder characterized by masculinization in both genders. Future work is needed to identify underlying factors such as sex hormonal alterations that drive these sex-specific neural expressions of ASD. © The Author (2016). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  19. Characteristics of microRNAs enriched in specific cell types and primary tissue types in solid organs.

    PubMed

    Kriegel, Alison J; Liu, Yong; Liu, Pengyuan; Baker, Maria Angeles; Hodges, Matthew R; Hua, Xing; Liang, Mingyu

    2013-12-01

    Knowledge of miRNA expression and function in specific cell types in solid organs is limited because of difficulty in obtaining appropriate specimens. We used laser capture microdissection to obtain nine tissue regions from rats, including the nucleus of the solitary tract, hypoglossal motor nucleus, ventral respiratory column/pre-Bötzinger complex, and midline raphe nucleus from the brain stem, myocardium and coronary artery from the heart, and glomerulus, proximal convoluted tubule, and medullary thick ascending limb from the kidney. Each tissue region consists of or is enriched for a specific cell type. Differential patterns of miRNA expression obtained by deep sequencing of minute amounts of laser-captured cells were highly consistent with data obtained from real-time PCR analysis. miRNA expression patterns correctly clustered the specimens by tissue regions and then by primary tissue types (neural, muscular, or epithelial). The aggregate difference in miRNA profiles between tissue regions that contained the same primary tissue type was as large as one-half of the aggregate difference between primary tissue types. miRNAs differentially expressed between primary tissue types are more likely to be abundant miRNAs, while miRNAs differentially expressed between tissue regions containing the same primary tissue type were distributed evenly across the abundance spectrum. The tissue type-enriched miRNAs were more likely to target genes enriched for specific functional categories compared with either cell type-enriched miRNAs or randomly selected miRNAs. These data indicate that the role of miRNAs in determining characteristics of primary tissue types may be different than their role in regulating cell type-specific functions in solid organs.

  20. Transcriptional Innate Immune Response of the Developing Chicken Embryo to Newcastle Disease Virus Infection

    PubMed Central

    Schilling, Megan A.; Katani, Robab; Memari, Sahar; Cavanaugh, Meredith; Buza, Joram; Radzio-Basu, Jessica; Mpenda, Fulgence N.; Deist, Melissa S.; Lamont, Susan J.; Kapur, Vivek

    2018-01-01

    Traditional approaches to assess the immune response of chickens to infection are through animal trials, which are expensive, require enhanced biosecurity, compromise welfare, and are frequently influenced by confounding variables. Since the chicken embryo becomes immunocompetent prior to hatch, we here characterized the transcriptional response of selected innate immune genes to Newcastle disease virus (NDV) infection in chicken embryos at days 10, 14, and 18 of embryonic development. The results suggest that the innate immune response 72 h after challenge of 18-day chicken embryo is both consistent and robust. The expression of CCL5, Mx1, and TLR3 in lung tissues of NDV challenged chicken embryos from the outbred Kuroiler and Tanzanian local ecotype lines showed that their expression was several orders of magnitude higher in the Kuroiler than in the local ecotypes. Next, the expression patterns of three additional innate-immunity related genes, IL-8, IRF-1, and STAT1, were examined in the highly congenic Fayoumi (M5.1 and M15.2) and Leghorn (Ghs6 and Ghs13) sublines that differ only at the microchromosome bearing the major histocompatibility locus. The results show that the Ghs13 Leghorn subline had a consistently higher expression of all genes except IL-8 and expression seemed to be subline-dependent rather than breed-dependent, suggesting that the innate immune response of chicken embryos to NDV infection may be genetically controlled by the MHC-locus. Taken together, the results suggest that the chicken embryo may represent a promising model to studying the patterns and sources of variation of the avian innate immune response to infection with NDV and related pathogens. PMID:29535762

  1. Basal cell carcinoma: CD56 and cytokeratin 5/6 staining patterns in the differential diagnosis with Merkel cell carcinoma.

    PubMed

    Panse, Gauri; McNiff, Jennifer M; Ko, Christine J

    2017-06-01

    Basal cell carcinoma (BCC) can resemble Merkel cell carcinoma (MCC) on histopathological examination and while CK20 is a useful marker in this differential, it is occasionally negative in MCC. CD56, a sensitive marker of neuroendocrine differentiation, is sometimes used to identify MCC, but has been reportedly variably positive in BCC as well. In contrast, CK5/6 consistently labels BCC but is not expressed in neuroendocrine tumors. We evaluated 20 cases of BCC for the pattern of CD56 and cytokeratin 5/6 (CK5/6) staining, hypothesizing that these 2 stains could differentiate BCC from MCC in difficult cases. Seventeen cases of MCC previously stained with CD56 were also examined. All BCCs showed patchy expression of CD56 except for 2 cases, which showed staining of greater than 70% of tumor. CK5/6 was diffusely positive in all cases of BCC. Fifteen of 17 MCCs were diffusely positive for CD56. The difference in the pattern of CD56 expression between MCC and BCC (diffuse vs patchy, respectively) was statistically significant (P < .05). BCC typically shows patchy CD56 expression and diffuse CK5/6 positivity. These 2 markers can be used to distinguish between BCC and MCC in challenging cases. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Expression of Wnt pathway genes in polyps and medusa-like structures of Ectopleura larynx (Cnidaria: Hydrozoa).

    PubMed

    Nawrocki, Annalise M; Cartwright, Paulyn

    2013-01-01

    The canonical Wnt signaling pathway is conserved in its role in axial patterning throughout Metazoa. In some hydrozoans (Phylum Cnidaria), Wnt signaling is implicated in oral-aboral patterning of the different life cycle stages-the planula, polyp and medusa. Unlike most hydrozoans, members of Aplanulata lack a planula larva and the polyp instead develops directly from a brooded or encysted embryo. The Aplanulata species Ectopleura larynx broods such embryos within gonophores. These gonophores are truncated medusae that remain attached to the polyps from which they bud, and retain evolutionary remnants of medusa structures. In E. larynx, gonophores differ between males and females in their degree of medusa truncation, making them an ideal system for examining truncated medusa development. Using next-generation sequencing, we isolated genes from Wnt signaling pathways and examined their expression in E. larynx. Our data are consistent with the Wnt pathway being involved in axial patterning of the polyp and truncated medusa. Changes in the spatial expression of Wnt pathway genes are correlated with the development of different oral structures in male and female gonophores. The absence of expression of components of the Wnt pathway and presence of a Wnt pathway antagonist SFRP in the developing anterior end of the gonophore suggest that downregulation of the Wnt pathway could play a role in medusa reduction in E. larynx. © 2013 Wiley Periodicals, Inc.

  3. Lineage-specific evolution of cnidarian Wnt ligands.

    PubMed

    Hensel, Katrin; Lotan, Tamar; Sanders, Steve M; Cartwright, Paulyn; Frank, Uri

    2014-09-01

    We have studied the evolution of Wnt genes in cnidarians and the expression pattern of all Wnt ligands in the hydrozoan Hydractinia echinata. Current views favor a scenario in which 12 Wnt sub-families were jointly inherited by cnidarians and bilaterians from their last common ancestor. Our phylogenetic analyses clustered all medusozoan genes in distinct, well-supported clades, but many orthologous relationships between medusozoan Wnts and anthozoan and bilaterian Wnt genes were poorly supported. Only seven anthozoan genes, Wnt2, Wnt4, Wnt5, Wnt6, Wnt 10, Wnt11, and Wnt16 were recovered with strong support with bilaterian genes and of those, only the Wnt2, Wnt5, Wnt11, and Wnt16 clades also included medusozoan genes. Although medusozoan Wnt8 genes clustered with anthozoan and bilaterian genes, this was not well supported. In situ hybridization studies revealed poor conservation of expression patterns of putative Wnt orthologs within Cnidaria. In polyps, only Wnt1, Wnt3, and Wnt7 were expressed at the same position in the studied cnidarian models Hydra, Hydractinia, and Nematostella. Different expression patterns are consistent with divergent functions. Our data do not fully support previous assertions regarding Wnt gene homology, and suggest a more complex history of Wnt family genes than previously suggested. This includes high rates of sequence divergence and lineage-specific duplications of Wnt genes within medusozoans, followed by functional divergence over evolutionary time scales. © 2014 Wiley Periodicals, Inc.

  4. Segmentation of the zebrafish axial skeleton relies on notochord sheath cells and not on the segmentation clock.

    PubMed

    Lleras Forero, Laura; Narayanan, Rachna; Huitema, Leonie Fa; VanBergen, Maaike; Apschner, Alexander; Peterson-Maduro, Josi; Logister, Ive; Valentin, Guillaume; Morelli, Luis G; Oates, Andrew C; Schulte-Merker, Stefan

    2018-04-06

    Segmentation of the axial skeleton in amniotes depends on the segmentation clock, which patterns the paraxial mesoderm and the sclerotome. While the segmentation clock clearly operates in teleosts, the role of the sclerotome in establishing the axial skeleton is unclear. We severely disrupt zebrafish paraxial segmentation, yet observe a largely normal segmentation process of the chordacentra. We demonstrate that axial entpd5+ notochord sheath cells are responsible for chordacentrum mineralization, and serve as a marker for axial segmentation. While autonomous within the notochord sheath, entpd5 expression and centrum formation show some plasticity and can respond to myotome pattern. These observations reveal for the first time the dynamics of notochord segmentation in a teleost, and are consistent with an autonomous patterning mechanism that is influenced, but not determined by adjacent paraxial mesoderm. This behavior is not consistent with a clock-type mechanism in the notochord. © 2018, Lleras Forero et al.

  5. Replication pattern of the pericentromeric region of chromosome 10q and expression of the RET protooncogene.

    PubMed

    Cinti, R; Schena, F; Passalacqua, M; Ceccherini, I; Ravazzolo, R

    2004-08-15

    Regulation of the RET gene is highly specific during embryo development and is strictly tissue-specific. Control of transcription depends on mechanisms influenced by epigenetic processes, in particular, histone acetylation at regions flanking the 5' end of the gene. Since the RET gene is mapped in the pericentromeric region of the human chromosome 10, the implication of epigenetic processes is even more striking and worth to be investigated in an extended chromosomal tract. One experimental approach to study the chromatin status in relationship with gene transcription is to assess the replication timing, which we did by using fluorescent in situ hybridization in cells expressing or not expressing the RET gene. By using probes spanning a 700-kb genomic region from the RET locus toward the centromere, we found a relationship between RET expression and early replication. Different patterns were observed between cells naturally expressing RET and cells induced to expression of RET by treatment with sodium butyrate, an inhibitor of histone deacetylases. Three-dimensional analysis of the nuclear localization of fluorescent signals by confocal microscopy showed difference of localization between the RET probe and a probe for a housekeeping gene, G3PDH, located at 12p13.3, in cells that do not express RET, in accordance with previous data for other genes and chromosomal regions. However, RET-expressing cells showed a localization of signals which was not consistent with that expected for expressed genes.

  6. Dominance and Sexual Dimorphism Pervade the Salix purpurea L. Transcriptome

    DOE PAGES

    Carlson, Craig H.; Choi, Yongwook; Chan, Agnes P.; ...

    2017-09-01

    The heritability of gene expression is critical in understanding heterosis and is dependent on allele-specific regulation by local and remote factors in the genome. We used RNA-Seq to test whether variation in gene expression among F 1 and F 2 intraspecific Salix purpurea progeny is attributable to cis- and trans-regulatory divergence. We assessed the mode of inheritance based on gene expression levels and allele-specific expression for F1 and F2 intraspecific progeny in two distinct tissue types: shoot tip and stem internode. In addition, we explored sexually dimorphic patterns of inheritance and regulatory divergence among F 1 progeny individuals. We showmore » that in S. purpurea intraspecific crosses, gene expression inheritance largely exhibits a maternal dominant pattern, regardless of tissue type or pedigree. A significantly greater number of cis- and trans-regulated genes coincided with upregulation of the maternal parent allele in the progeny, irrespective of the magnitude, whereas the paternal allele was higher expressed for genes showing cis × trans or compensatory regulation. Importantly, consistent with previous genetic mapping results for sex in shrub willow, we have delimited sex-biased gene expression to a 2 Mb pericentromeric region on S. purpurea chr15 and further refined the sex determination region. Lastly, altogether, our results offer insight into the inheritance of gene expression in S. purpurea as well as evidence of sexually dimorphic expression which may have contributed to the evolution of dioecy in Salix.« less

  7. Dominance and Sexual Dimorphism Pervade the Salix purpurea L. Transcriptome

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Carlson, Craig H.; Choi, Yongwook; Chan, Agnes P.

    The heritability of gene expression is critical in understanding heterosis and is dependent on allele-specific regulation by local and remote factors in the genome. We used RNA-Seq to test whether variation in gene expression among F 1 and F 2 intraspecific Salix purpurea progeny is attributable to cis- and trans-regulatory divergence. We assessed the mode of inheritance based on gene expression levels and allele-specific expression for F1 and F2 intraspecific progeny in two distinct tissue types: shoot tip and stem internode. In addition, we explored sexually dimorphic patterns of inheritance and regulatory divergence among F 1 progeny individuals. We showmore » that in S. purpurea intraspecific crosses, gene expression inheritance largely exhibits a maternal dominant pattern, regardless of tissue type or pedigree. A significantly greater number of cis- and trans-regulated genes coincided with upregulation of the maternal parent allele in the progeny, irrespective of the magnitude, whereas the paternal allele was higher expressed for genes showing cis × trans or compensatory regulation. Importantly, consistent with previous genetic mapping results for sex in shrub willow, we have delimited sex-biased gene expression to a 2 Mb pericentromeric region on S. purpurea chr15 and further refined the sex determination region. Lastly, altogether, our results offer insight into the inheritance of gene expression in S. purpurea as well as evidence of sexually dimorphic expression which may have contributed to the evolution of dioecy in Salix.« less

  8. Image-based Analysis of Emotional Facial Expressions in Full Face Transplants.

    PubMed

    Bedeloglu, Merve; Topcu, Çagdas; Akgul, Arzu; Döger, Ela Naz; Sever, Refik; Ozkan, Ozlenen; Ozkan, Omer; Uysal, Hilmi; Polat, Ovunc; Çolak, Omer Halil

    2018-01-20

    In this study, it is aimed to determine the degree of the development in emotional expression of full face transplant patients from photographs. Hence, a rehabilitation process can be planned according to the determination of degrees as a later work. As envisaged, in full face transplant cases, the determination of expressions can be confused or cannot be achieved as the healthy control group. In order to perform image-based analysis, a control group consist of 9 healthy males and 2 full-face transplant patients participated in the study. Appearance-based Gabor Wavelet Transform (GWT) and Local Binary Pattern (LBP) methods are adopted for recognizing neutral and 6 emotional expressions which consist of angry, scared, happy, hate, confused and sad. Feature extraction was carried out by using both methods and combination of these methods serially. In the performed expressions, the extracted features of the most distinct zones in the facial area where the eye and mouth region, have been used to classify the emotions. Also, the combination of these region features has been used to improve classifier performance. Control subjects and transplant patients' ability to perform emotional expressions have been determined with K-nearest neighbor (KNN) classifier with region-specific and method-specific decision stages. The results have been compared with healthy group. It has been observed that transplant patients don't reflect some emotional expressions. Also, there were confusions among expressions.

  9. Graphical modeling of gene expression in monocytes suggests molecular mechanisms explaining increased atherosclerosis in smokers.

    PubMed

    Verdugo, Ricardo A; Zeller, Tanja; Rotival, Maxime; Wild, Philipp S; Münzel, Thomas; Lackner, Karl J; Weidmann, Henri; Ninio, Ewa; Trégouët, David-Alexandre; Cambien, François; Blankenberg, Stefan; Tiret, Laurence

    2013-01-01

    Smoking is a risk factor for atherosclerosis with reported widespread effects on gene expression in circulating blood cells. We hypothesized that a molecular signature mediating the relation between smoking and atherosclerosis may be found in the transcriptome of circulating monocytes. Genome-wide expression profiles and counts of atherosclerotic plaques in carotid arteries were collected in 248 smokers and 688 non-smokers from the general population. Patterns of co-expressed genes were identified by Independent Component Analysis (ICA) and network structure of the pattern-specific gene modules was inferred by the PC-algorithm. A likelihood-based causality test was implemented to select patterns that fit models containing a path "smoking→gene expression→plaques". Robustness of the causal inference was assessed by bootstrapping. At a FDR ≤0.10, 3,368 genes were associated to smoking or plaques, of which 93% were associated to smoking only. SASH1 showed the strongest association to smoking and PPARG the strongest association to plaques. Twenty-nine gene patterns were identified by ICA. Modules containing SASH1 and PPARG did not show evidence for the "smoking→gene expression→plaques" causality model. Conversely, three modules had good support for causal effects and exhibited a network topology consistent with gene expression mediating the relation between smoking and plaques. The network with the strongest support for causal effects was connected to plaques through SLC39A8, a gene with known association to HDL-cholesterol and cellular uptake of cadmium from tobacco, while smoking was directly connected to GAS6, a gene reported to have anti-inflammatory effects in atherosclerosis and to be up-regulated in the placenta of women smoking during pregnancy. Our analysis of the transcriptome of monocytes recovered genes relevant for association to smoking and atherosclerosis, and connected genes that before, were only studied in separate contexts. Inspection of correlation structure revealed candidates that would be missed by expression-phenotype association analysis alone.

  10. Graphical Modeling of Gene Expression in Monocytes Suggests Molecular Mechanisms Explaining Increased Atherosclerosis in Smokers

    PubMed Central

    Verdugo, Ricardo A.; Zeller, Tanja; Rotival, Maxime; Wild, Philipp S.; Münzel, Thomas; Lackner, Karl J.; Weidmann, Henri; Ninio, Ewa; Trégouët, David-Alexandre; Cambien, François; Blankenberg, Stefan; Tiret, Laurence

    2013-01-01

    Smoking is a risk factor for atherosclerosis with reported widespread effects on gene expression in circulating blood cells. We hypothesized that a molecular signature mediating the relation between smoking and atherosclerosis may be found in the transcriptome of circulating monocytes. Genome-wide expression profiles and counts of atherosclerotic plaques in carotid arteries were collected in 248 smokers and 688 non-smokers from the general population. Patterns of co-expressed genes were identified by Independent Component Analysis (ICA) and network structure of the pattern-specific gene modules was inferred by the PC-algorithm. A likelihood-based causality test was implemented to select patterns that fit models containing a path “smoking→gene expression→plaques”. Robustness of the causal inference was assessed by bootstrapping. At a FDR ≤0.10, 3,368 genes were associated to smoking or plaques, of which 93% were associated to smoking only. SASH1 showed the strongest association to smoking and PPARG the strongest association to plaques. Twenty-nine gene patterns were identified by ICA. Modules containing SASH1 and PPARG did not show evidence for the “smoking→gene expression→plaques” causality model. Conversely, three modules had good support for causal effects and exhibited a network topology consistent with gene expression mediating the relation between smoking and plaques. The network with the strongest support for causal effects was connected to plaques through SLC39A8, a gene with known association to HDL-cholesterol and cellular uptake of cadmium from tobacco, while smoking was directly connected to GAS6, a gene reported to have anti-inflammatory effects in atherosclerosis and to be up-regulated in the placenta of women smoking during pregnancy. Our analysis of the transcriptome of monocytes recovered genes relevant for association to smoking and atherosclerosis, and connected genes that before, were only studied in separate contexts. Inspection of correlation structure revealed candidates that would be missed by expression-phenotype association analysis alone. PMID:23372645

  11. Differential expression of Meis2, Mab21l2 and Tbx3 during limb development associated with diversification of limb morphology in mammals.

    PubMed

    Dai, Mengyao; Wang, Yao; Fang, Lu; Irwin, David M; Zhu, Tengteng; Zhang, Junpeng; Zhang, Shuyi; Wang, Zhe

    2014-01-01

    Bats are the only mammals capable of self-powered flight using wings. Differing from mouse or human limbs, four elongated digits within a broad wing membrane support the bat wing, and the foot of the bat has evolved a long calcar that spread the interfemoral membrane. Our recent mRNA sequencing (mRNA-Seq) study found unique expression patterns for genes at the 5' end of the Hoxd gene cluster and for Tbx3 that are associated with digit elongation and wing membrane growth in bats. In this study, we focused on two additional genes, Meis2 and Mab21l2, identified from the mRNA-Seq data. Using whole-mount in situ hybridization (WISH) we validated the mRNA-Seq results for differences in the expression patterns of Meis2 and Mab21l2 between bat and mouse limbs, and further characterize the timing and location of the expression of these two genes. These analyses suggest that Meis2 may function in wing membrane growth and Mab21l2 may have a role in AP and DV axial patterning. In addition, we found that Tbx3 is uniquely expressed in the unique calcar structure found in the bat hindlimb, suggesting a role for this gene in calcar growth and elongation. Moreover, analysis of the coding sequences for Meis2, Mab21l2 and Tbx3 showed that Meis2 and Mab21l2 have high sequence identity, consistent with the functions of genes being conserved, but that Tbx3 showed accelerated evolution in bats. However, evidence for positive selection in Tbx3 was not found, which would suggest that the function of this gene has not been changed. Together, our findings support the hypothesis that the modulation of the spatiotemporal expression patterns of multiple functional conserved genes control limb morphology and drive morphological change in the diversification of mammalian limbs.

  12. Differential Expression of Meis2, Mab21l2 and Tbx3 during Limb Development Associated with Diversification of Limb Morphology in Mammals

    PubMed Central

    Fang, Lu; Irwin, David M.; Zhu, Tengteng; Zhang, Junpeng; Zhang, Shuyi; Wang, Zhe

    2014-01-01

    Bats are the only mammals capable of self-powered flight using wings. Differing from mouse or human limbs, four elongated digits within a broad wing membrane support the bat wing, and the foot of the bat has evolved a long calcar that spread the interfemoral membrane. Our recent mRNA sequencing (mRNA-Seq) study found unique expression patterns for genes at the 5′ end of the Hoxd gene cluster and for Tbx3 that are associated with digit elongation and wing membrane growth in bats. In this study, we focused on two additional genes, Meis2 and Mab21l2, identified from the mRNA-Seq data. Using whole-mount in situ hybridization (WISH) we validated the mRNA-Seq results for differences in the expression patterns of Meis2 and Mab21l2 between bat and mouse limbs, and further characterize the timing and location of the expression of these two genes. These analyses suggest that Meis2 may function in wing membrane growth and Mab21l2 may have a role in AP and DV axial patterning. In addition, we found that Tbx3 is uniquely expressed in the unique calcar structure found in the bat hindlimb, suggesting a role for this gene in calcar growth and elongation. Moreover, analysis of the coding sequences for Meis2, Mab21l2 and Tbx3 showed that Meis2 and Mab21l2 have high sequence identity, consistent with the functions of genes being conserved, but that Tbx3 showed accelerated evolution in bats. However, evidence for positive selection in Tbx3 was not found, which would suggest that the function of this gene has not been changed. Together, our findings support the hypothesis that the modulation of the spatiotemporal expression patterns of multiple functional conserved genes control limb morphology and drive morphological change in the diversification of mammalian limbs. PMID:25166052

  13. A Proposed Pattern of Enterprise Architecture

    DTIC Science & Technology

    2013-02-01

    consistent architecture descriptions. UPDM comprises extensions to both OMG’s Unified Modelling Language (UML) and Systems Modelling Language ( SysML ...those who use UML and SysML . These represent significant advancements that enable architecture trade-off analyses, architecture model execution...Language ( SysML ), and thus provides for architectural descriptions that contain a rich set of (formally) connected DoDAF/MoDAF viewpoints expressed

  14. Evolutionary conservation of the presumptive neural plate markers AmphiSox1/2/3 and AmphiNeurogenin in the invertebrate chordate amphioxus

    NASA Technical Reports Server (NTRS)

    Holland, L. Z.; Schubert, M.; Holland, N. D.; Neuman, T.

    2000-01-01

    Amphioxus, as the closest living invertebrate relative of the vertebrates, can give insights into the evolutionary origin of the vertebrate body plan. Therefore, to investigate the evolution of genetic mechanisms for establishing and patterning the neuroectoderm, we cloned and determined the embryonic expression of two amphioxus transcription factors, AmphiSox1/2/3 and AmphiNeurogenin. These genes are the earliest known markers for presumptive neuroectoderm in amphioxus. By the early neurula stage, AmphiNeurogenin expression becomes restricted to two bilateral columns of segmentally arranged neural plate cells, which probably include precursors of motor neurons. This is the earliest indication of segmentation in the amphioxus nerve cord. Later, expression extends to dorsal cells in the nerve cord, which may include precursors of sensory neurons. By the midneurula, AmphiSox1/2/3 expression becomes limited to the dorsal part of the forming neural tube. These patterns resemble those of their vertebrate and Drosophila homologs. Taken together with the evolutionarily conserved expression of the dorsoventral patterning genes, BMP2/4 and chordin, in nonneural and neural ectoderm, respectively, of chordates and Drosophila, our results are consistent with the evolution of the chordate dorsal nerve cord and the insect ventral nerve cord from a longitudinal nerve cord in a common bilaterian ancestor. However, AmphiSox1/2/3 differs from its vertebrate homologs in not being expressed outside the CNS, suggesting that additional roles for this gene have evolved in connection with gene duplication in the vertebrate lineage. In contrast, expression in the midgut of AmphiNeurogenin together with the gene encoding the insulin-like peptide suggests that amphioxus may have homologs of vertebrate pancreatic islet cells, which express neurogenin3. In addition, AmphiNeurogenin, like its vertebrate and Drosophila homologs, is expressed in apparent precursors of epidermal chemosensory and possibly mechanosensory cells, suggesting a common origin for protostome and deuterostome epidermal sensory cells in the ancestral bilaterian. Copyright 2000 Academic Press.

  15. STATUS OF THE SYSTEM OF SIGNALING PATTERN RECOGNITION RECEPTORS OF MONOCYTES AND GRANULOCYTES IN COSMONAUTS' PERIPHERAL BLOOD BEFORE AND AFTER LONG-DURATION MISSIONS TO THE INTERNATIONAL SPACE STATION.

    PubMed

    Ponomarev, S A; Berendeeva, T A; Kalinin, S A; Muranova, A V

    The system of signaling pattern recognition receptors was studied in 8 cosmonauts aged 35 to 56 years before and after (R+) long-duration missions to the International space station. Peripheral blood samples were analyzed for the content of monocytes and granulocytes that express the signaling pattern recognition Toll- like (TLR) receptors localized as on cell surface (TLR1, TLR2, TLR4, TLR5, TLR6), so inside cells (TLR3, TLR8, TLR9). In parallel, serum concentrations of TLR2 (HSP60) and TLR4 ligands (HSP70, HMGB1) were measured. The results of investigations showed growth of HSP60, HSP70 and HMGB1 concentrations on R+1. In the;majority of cosmonauts increases in endogenous ligands were followed by growth in the number of both monocytes and granulocytes that express TLR2 1 TLR4. This consistency gives ground to assume that changes in the system of signaling pattern recognition receptors can stem .from the predominantly endogenous ligands' response to the effects of long-duration space flight on human organism.

  16. Molecular Cloning, Expression Profile and 5′ Regulatory Region Analysis of Two Chemosensory Protein Genes from the Diamondback Moth, Plutella xylostella

    PubMed Central

    Gong, Liang; Zhong, Guo-Hua; Hu, Mei-Ying; Luo, Qian; Ren, Zhen-Zhen

    2010-01-01

    Chemosensory proteins play an important role in transporting chemical compounds to their receptors on dendrite membranes. In this study, two full-length cDNA codings for chemosensory proteins of Plutella xylostella (Lepidoptera: Plutellidae) were obtained by RACE-PCR. PxylCSP3 and Pxyl-CSP4, with GenBank accession numbers ABM92663 and ABM92664, respectively, were cloned and sequenced. The gene sequences both consisted of three exons and two introns. RT-PCR analysis showed that Pxyl-CSP3 and Pxyl-CSP4 had different expression patterns in the examined developmental stages, but were expressed in all larval stages. Phylogenetic analysis indicated that lepidopteran insects consist of three branches, and Pxyl-CSP3 and Pxyl-CSP4 belong to different branches. The 5′regulatory regions of Pxyl-CSP3 and Pxyl-CSP4 were isolated and analyzed, and the results consist of not only the core promoter sequences (TATA-box), but also several transcriptional elements (BR-C Z4, Hb, Dfd, CF2-II, etc.). This study provides clues to better understanding the various physiological functions of CSPs in P. xylostella and other insects. PMID:21073345

  17. SOCS3 promotes apoptosis of mammary differentiated cells.

    PubMed

    Le Provost, Fabienne; Miyoshi, Keiko; Vilotte, Jean-Luc; Bierie, Brian; Robinson, Gertraud W; Hennighausen, Lothar

    2005-12-30

    Growth and function of the mammary gland is regulated by cytokines and modulated by suppressor of cytokine signalling (SOCS) proteins. In vitro experiments demonstrated that SOCS3 can inhibit PRL induction of milk protein gene expression and STAT5 activation. We explored the SOCS3 expression pattern during mouse mammary development and its regulation by PRL and GH in wild-type and STAT5a-null mammary tissue. Our results suggest that, in vivo, PRL stimulates SOCS3 expression in stromal adipocytes, independently of STAT5a stimulation. In mammary epithelial cells, SOCS3 expression appears to be related to STAT3 activation. Together, our results are consistent with a role of SOCS3 in the mammary gland by promoting apoptosis of differentiated cells (adipocytes during gestation and epithelial cells during involution).

  18. Involvement of Hedgehog and FGF signalling in the lamprey telencephalon: evolution of regionalization and dorsoventral patterning of the vertebrate forebrain.

    PubMed

    Sugahara, Fumiaki; Aota, Shin-ichi; Kuraku, Shigehiro; Murakami, Yasunori; Takio-Ogawa, Yoko; Hirano, Shigeki; Kuratani, Shigeru

    2011-03-01

    Dorsoventral (DV) specification is a crucial step for the development of the vertebrate telencephalon. Clarifying the origin of this mechanism will lead to a better understanding of vertebrate central nervous system (CNS) evolution. Based on the lamprey, a sister group of the gnathostomes (jawed vertebrates), we identified three lamprey Hedgehog (Hh) homologues, which are thought to play central signalling roles in telencephalon patterning. However, unlike in gnathostomes, none of these genes, nor Lhx6/7/8, a marker for the migrating interneuron subtype, was expressed in the ventral telencephalon, consistent with the reported absence of the medial ganglionic eminence (MGE) in this animal. Homologues of Gsh2, Isl1/2 and Sp8, which are involved in the patterning of the lateral ganglionic eminence (LGE) of gnathostomes, were expressed in the lamprey subpallium, as in gnathostomes. Hh signalling is necessary for induction of the subpallium identity in the gnathostome telencephalon. When Hh signalling was inhibited, the ventral identity was disrupted in the lamprey, suggesting that prechordal mesoderm-derived Hh signalling might be involved in the DV patterning of the telencephalon. By blocking fibroblast growth factor (FGF) signalling, the ventral telencephalon was suppressed in the lamprey, as in gnathostomes. We conclude that Hh- and FGF-dependent DV patterning, together with the resultant LGE identity, are likely to have been established in a common ancestor before the divergence of cyclostomes and gnathostomes. Later, gnathostomes would have acquired a novel Hh expression domain corresponding to the MGE, leading to the obtainment of cortical interneurons.

  19. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  20. Alternative life histories shape brain gene expression profiles in males of the same population

    USGS Publications Warehouse

    Aubin-Horth, N.; Landry, C.R.; Letcher, B.H.; Hofmann, H.A.

    2005-01-01

    Atlantic salmon (Salmo salar) undergo spectacular marine migrations before homing to spawn in natal rivers. However, males that grow fastest early in life can adopt an alternative 'sneaker' tactic by maturing earlier at greatly reduced size without leaving freshwater. While the ultimate evolutionary causes have been well studied, virtually nothing is known about the molecular bases of this developmental plasticity. We investigate the nature and extent of coordinated molecular changes that accompany such a fundamental transformation by comparing the brain transcription profiles of wild mature sneaker males to age-matched immature males (future large anadromous males) and immature females. Of the ca. 3000 genes surveyed, 15% are differentially expressed in the brains of the two male types. These genes are involved in a wide range of processes, including growth, reproduction and neural plasticity. Interestingly, despite the potential for wide variation in gene expression profiles among individuals sampled in nature, consistent patterns of gene expression were found for individuals of the same reproductive tactic. Notably, gene expression patterns in immature males were different both from immature females and sneakers, indicating that delayed maturation and sea migration by immature males, the 'default' life cycle, may actually result from an active inhibition of development into a sneaker. ?? 2005 The Royal Society.

  1. Alternative life histories shape brain gene expression profiles in males of the same population

    PubMed Central

    Aubin-Horth, Nadia; Landry, Christian R; Letcher, Benjamin H; Hofmann, Hans A

    2005-01-01

    Atlantic salmon (Salmo salar) undergo spectacular marine migrations before homing to spawn in natal rivers. However, males that grow fastest early in life can adopt an alternative ‘sneaker’ tactic by maturing earlier at greatly reduced size without leaving freshwater. While the ultimate evolutionary causes have been well studied, virtually nothing is known about the molecular bases of this developmental plasticity. We investigate the nature and extent of coordinated molecular changes that accompany such a fundamental transformation by comparing the brain transcription profiles of wild mature sneaker males to age-matched immature males (future large anadromous males) and immature females. Of the ca. 3000 genes surveyed, 15% are differentially expressed in the brains of the two male types. These genes are involved in a wide range of processes, including growth, reproduction and neural plasticity. Interestingly, despite the potential for wide variation in gene expression profiles among individuals sampled in nature, consistent patterns of gene expression were found for individuals of the same reproductive tactic. Notably, gene expression patterns in immature males were different both from immature females and sneakers, indicating that delayed maturation and sea migration by immature males, the ‘default’ life cycle, may actually result from an active inhibition of development into a sneaker. PMID:16087419

  2. Alternative life histories shape brain gene expression profiles in males of the same population.

    PubMed

    Aubin-Horth, Nadia; Landry, Christian R; Letcher, Benjamin H; Hofmann, Hans A

    2005-08-22

    Atlantic salmon (Salmo salar) undergo spectacular marine migrations before homing to spawn in natal rivers. However, males that grow fastest early in life can adopt an alternative 'sneaker' tactic by maturing earlier at greatly reduced size without leaving freshwater. While the ultimate evolutionary causes have been well studied, virtually nothing is known about the molecular bases of this developmental plasticity. We investigate the nature and extent of coordinated molecular changes that accompany such a fundamental transformation by comparing the brain transcription profiles of wild mature sneaker males to age-matched immature males (future large anadromous males) and immature females. Of the ca. 3000 genes surveyed, 15% are differentially expressed in the brains of the two male types. These genes are involved in a wide range of processes, including growth, reproduction and neural plasticity. Interestingly, despite the potential for wide variation in gene expression profiles among individuals sampled in nature, consistent patterns of gene expression were found for individuals of the same reproductive tactic. Notably, gene expression patterns in immature males were different both from immature females and sneakers, indicating that delayed maturation and sea migration by immature males, the 'default' life cycle, may actually result from an active inhibition of development into a sneaker.

  3. Gene expression profile of mouse prostate tumors reveals dysregulations in major biological processes and identifies potential murine targets for preclinical development of human prostate cancer therapy.

    PubMed

    Haram, Kerstyn M; Peltier, Heidi J; Lu, Bin; Bhasin, Manoj; Otu, Hasan H; Choy, Bob; Regan, Meredith; Libermann, Towia A; Latham, Gary J; Sanda, Martin G; Arredouani, Mohamed S

    2008-10-01

    Translation of preclinical studies into effective human cancer therapy is hampered by the lack of defined molecular expression patterns in mouse models that correspond to the human counterpart. We sought to generate an open source TRAMP mouse microarray dataset and to use this array to identify differentially expressed genes from human prostate cancer (PCa) that have concordant expression in TRAMP tumors, and thereby represent lead targets for preclinical therapy development. We performed microarrays on total RNA extracted and amplified from eight TRAMP tumors and nine normal prostates. A subset of differentially expressed genes was validated by QRT-PCR. Differentially expressed TRAMP genes were analyzed for concordant expression in publicly available human prostate array datasets and a subset of resulting genes was analyzed by QRT-PCR. Cross-referencing differentially expressed TRAMP genes to public human prostate array datasets revealed 66 genes with concordant expression in mouse and human PCa; 56 between metastases and normal and 10 between primary tumor and normal tissues. Of these 10 genes, two, Sox4 and Tubb2a, were validated by QRT-PCR. Our analysis also revealed various dysregulations in major biologic pathways in the TRAMP prostates. We report a TRAMP microarray dataset of which a gene subset was validated by QRT-PCR with expression patterns consistent with previous gene-specific TRAMP studies. Concordance analysis between TRAMP and human PCa associated genes supports the utility of the model and suggests several novel molecular targets for preclinical therapy.

  4. Local binary pattern variants-based adaptive texture features analysis for posed and nonposed facial expression recognition

    NASA Astrophysics Data System (ADS)

    Sultana, Maryam; Bhatti, Naeem; Javed, Sajid; Jung, Soon Ki

    2017-09-01

    Facial expression recognition (FER) is an important task for various computer vision applications. The task becomes challenging when it requires the detection and encoding of macro- and micropatterns of facial expressions. We present a two-stage texture feature extraction framework based on the local binary pattern (LBP) variants and evaluate its significance in recognizing posed and nonposed facial expressions. We focus on the parametric limitations of the LBP variants and investigate their effects for optimal FER. The size of the local neighborhood is an important parameter of the LBP technique for its extraction in images. To make the LBP adaptive, we exploit the granulometric information of the facial images to find the local neighborhood size for the extraction of center-symmetric LBP (CS-LBP) features. Our two-stage texture representations consist of an LBP variant and the adaptive CS-LBP features. Among the presented two-stage texture feature extractions, the binarized statistical image features and adaptive CS-LBP features were found showing high FER rates. Evaluation of the adaptive texture features shows competitive and higher performance than the nonadaptive features and other state-of-the-art approaches, respectively.

  5. Plant immunity triggered by engineered in vivo release of oligogalacturonides, damage-associated molecular patterns.

    PubMed

    Benedetti, Manuel; Pontiggia, Daniela; Raggi, Sara; Cheng, Zhenyu; Scaloni, Flavio; Ferrari, Simone; Ausubel, Frederick M; Cervone, Felice; De Lorenzo, Giulia

    2015-04-28

    Oligogalacturonides (OGs) are fragments of pectin that activate plant innate immunity by functioning as damage-associated molecular patterns (DAMPs). We set out to test the hypothesis that OGs are generated in planta by partial inhibition of pathogen-encoded polygalacturonases (PGs). A gene encoding a fungal PG was fused with a gene encoding a plant polygalacturonase-inhibiting protein (PGIP) and expressed in transgenic Arabidopsis plants. We show that expression of the PGIP-PG chimera results in the in vivo production of OGs that can be detected by mass spectrometric analysis. Transgenic plants expressing the chimera under control of a pathogen-inducible promoter are more resistant to the phytopathogens Botrytis cinerea, Pectobacterium carotovorum, and Pseudomonas syringae. These data provide strong evidence for the hypothesis that OGs released in vivo act as a DAMP signal to trigger plant immunity and suggest that controlled release of these molecules upon infection may be a valuable tool to protect plants against infectious diseases. On the other hand, elevated levels of expression of the chimera cause the accumulation of salicylic acid, reduced growth, and eventually lead to plant death, consistent with the current notion that trade-off occurs between growth and defense.

  6. Plant immunity triggered by engineered in vivo release of oligogalacturonides, damage-associated molecular patterns

    PubMed Central

    Benedetti, Manuel; Pontiggia, Daniela; Raggi, Sara; Cheng, Zhenyu; Scaloni, Flavio; Ferrari, Simone; Ausubel, Frederick M.; Cervone, Felice; De Lorenzo, Giulia

    2015-01-01

    Oligogalacturonides (OGs) are fragments of pectin that activate plant innate immunity by functioning as damage-associated molecular patterns (DAMPs). We set out to test the hypothesis that OGs are generated in planta by partial inhibition of pathogen-encoded polygalacturonases (PGs). A gene encoding a fungal PG was fused with a gene encoding a plant polygalacturonase-inhibiting protein (PGIP) and expressed in transgenic Arabidopsis plants. We show that expression of the PGIP–PG chimera results in the in vivo production of OGs that can be detected by mass spectrometric analysis. Transgenic plants expressing the chimera under control of a pathogen-inducible promoter are more resistant to the phytopathogens Botrytis cinerea, Pectobacterium carotovorum, and Pseudomonas syringae. These data provide strong evidence for the hypothesis that OGs released in vivo act as a DAMP signal to trigger plant immunity and suggest that controlled release of these molecules upon infection may be a valuable tool to protect plants against infectious diseases. On the other hand, elevated levels of expression of the chimera cause the accumulation of salicylic acid, reduced growth, and eventually lead to plant death, consistent with the current notion that trade-off occurs between growth and defense. PMID:25870275

  7. Developmental patterns of expressive language hemispheric lateralization in children, adolescents and adults using functional near-infrared spectroscopy.

    PubMed

    Paquette, Natacha; Lassonde, Maryse; Vannasing, Phetsamone; Tremblay, Julie; González-Frankenberger, Berta; Florea, Olivia; Béland, Renée; Lepore, Franco; Gallagher, Anne

    2015-02-01

    The development of language hemispheric specialization is not well understood in young children, especially regarding expressive language functions. In this study, we investigated age-related changes in expressive language lateralization patterns in a population of children (3-6 and 7-10 years old), adolescents (11-16 years old), and young adults (19-30 years old). During functional near-infrared spectroscopy recordings, all participants performed a verbal fluency task, which consisted in naming as many words as possible belonging to a given semantic category. Hemoglobin concentration changes were measured in bilateral frontal and temporal cortical areas. During the language task, results showed a strong left hemisphere response along with weaker right hemisphere activation in all groups. Age-related increases in hemodynamic responses were found bilaterally, with younger children showing smaller hemodynamic responses than adolescents and adults in both hemispheres. Overall, these findings confirm that a left hemisphere specialization is already established in young children and persists through adulthood. Early left hemisphere specialization for expressive language suggests that language development hinges on structural and functional properties of the human brain with little reorganization occurring with development. Copyright © 2015 Elsevier Ltd. All rights reserved.

  8. A Systematic Survey of Expression and Function of Zebrafish frizzled Genes

    PubMed Central

    Nikaido, Masataka; Law, Edward W. P.; Kelsh, Robert N.

    2013-01-01

    Wnt signaling is crucial for the regulation of numerous processes in development. Consistent with this, the gene families for both the ligands (Wnts) and receptors (Frizzleds) are very large. Surprisingly, while we have a reasonable understanding of the Wnt ligands likely to mediate specific Wnt-dependent processes, the corresponding receptors usually remain to be elucidated. Taking advantage of the zebrafish model's excellent genomic and genetic properties, we undertook a comprehensive analysis of the expression patterns of frizzled (fzd) genes in zebrafish. To explore their functions, we focused on testing their requirement in several developmental events known to be regulated by Wnt signaling, convergent extension movements of gastrulation, neural crest induction, and melanocyte specification. We found fourteen distinct fzd genes in the zebrafish genome. Systematic analysis of their expression patterns between 1-somite and 30 hours post-fertilization revealed complex, dynamic and overlapping expression patterns. This analysis demonstrated that only fzd3a, fzd9b, and fzd10 are expressed in the dorsal neural tube at stages corresponding to the timing of melanocyte specification. Surprisingly, however, morpholino knockdown of these, alone or in combination, gave no indication of reduction of melanocytes, suggesting the important involvement of untested fzds or another type of Wnt receptor in this process. Likewise, we found only fzd7b and fzd10 expressed at the border of the neural plate at stages appropriate for neural crest induction. However, neural crest markers were not reduced by knockdown of these receptors. Instead, these morpholino knockdown studies showed that fzd7a and fzd7b work co-operatively to regulate convergent extension movement during gastrulation. Furthermore, we show that the two fzd7 genes function together with fzd10 to regulate epiboly movements and mesoderm differentiation. PMID:23349976

  9. Molecular cloning, mRNA expression and tissue distribution analysis of Slc7a11 gene in alpaca (Lama paco) skins associated with different coat colors.

    PubMed

    Tian, Xue; Meng, Xiaolin; Wang, Liangyan; Song, Yunfei; Zhang, Danli; Ji, Yuankai; Li, Xuejun; Dong, Changsheng

    2015-01-25

    Slc7a11 encoding solute carrier family 7 member 11 (amionic amino acid transporter light chain, xCT), has been identified to be a critical genetic regulator of pheomelanin synthesis in hair and melanocytes. To better understand the molecular characterization of Slc7a11 and the expression patterns in skin of white versus brown alpaca (lama paco), we cloned the full length coding sequence (CDS) of alpaca Slc7a11 gene and analyzed the expression patterns using Real Time PCR, Western blotting and immunohistochemistry. The full length CDS of 1512bp encodes a 503 amino acid polypeptide. Sequence analysis showed that alpaca xCT contains 12 transmembrane regions consistent with the highly conserved amino acid permease (AA_permease_2) domain similar to other vertebrates. Sequence alignment and phylogenetic analysis revealed that alpaca xCT had the highest identity and shared the same branch with Camelus ferus. Real Time PCR and Western blotting suggested that xCT was expressed at significantly high levels in brown alpaca skin, and transcripts and protein possessed the same expression pattern in white and brown alpaca skins. Additionally, immunohistochemical analysis further demonstrated that xCT staining was robustly increased in the matrix and root sheath of brown alpaca skin compared with that of white. These results suggest that Slc7a11 functions in alpaca coat color regulation and offer essential information for further exploration on the role of Slc7a11 in melanogenesis. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Binocular pattern deprivation interferes with the expression of proteins involved in primary visual cortex maturation in the cat.

    PubMed

    Laskowska-Macios, Karolina; Nys, Julie; Hu, Tjing-Tjing; Zapasnik, Monika; Van der Perren, Anke; Kossut, Malgorzata; Burnat, Kalina; Arckens, Lutgarde

    2015-08-14

    Binocular pattern deprivation from eye opening (early BD) delays the maturation of the primary visual cortex. This delay is more pronounced for the peripheral than the central visual field representation within area 17, particularly between the age of 2 and 4 months [Laskowska-Macios, Cereb Cortex, 2014]. In this study, we probed for related dynamic changes in the cortical proteome. We introduced age, cortical region and BD as principal variables in a 2-D DIGE screen of area 17. In this way we explored the potential of BD-related protein expression changes between central and peripheral area 17 of 2- and 4-month-old BD (2BD, 4BD) kittens as a valid parameter towards the identification of brain maturation-related molecular processes. Consistent with the maturation delay, distinct developmental protein expression changes observed for normal kittens were postponed by BD, especially in the peripheral region. These BD-induced proteomic changes suggest a negative regulation of neurite outgrowth, synaptic transmission and clathrin-mediated endocytosis, thereby implicating these processes in normal experience-induced visual cortex maturation. Verification of the expression of proteins from each of the biological processes via Western analysis disclosed that some of the transient proteomic changes correlate to the distinct behavioral outcome in adult life, depending on timing and duration of the BD period [Neuroscience 2013;255:99-109]. Taken together, the plasticity potential to recover from BD, in relation to ensuing restoration of normal visual input, appears to rely on specific protein expression changes and cellular processes induced by the loss of pattern vision in early life.

  11. Expression of the pair-rule gene homologs runt, Pax3/7, even-skipped-1 and even-skipped-2 during larval and juvenile development of the polychaete annelid Capitella teleta does not support a role in segmentation

    PubMed Central

    2012-01-01

    Background Annelids and arthropods each possess a segmented body. Whether this similarity represents an evolutionary convergence or inheritance from a common segmented ancestor is the subject of ongoing investigation. Methods To investigate whether annelids and arthropods share molecular components that control segmentation, we isolated orthologs of the Drosophila melanogaster pair-rule genes, runt, paired (Pax3/7) and eve, from the polychaete annelid Capitella teleta and used whole mount in situ hybridization to characterize their expression patterns. Results When segments first appear, expression of the single C. teleta runt ortholog is only detected in the brain. Later, Ct-runt is expressed in the ventral nerve cord, foregut and hindgut. Analysis of Pax genes in the C. teleta genome reveals the presence of a single Pax3/7 ortholog. Ct-Pax3/7 is initially detected in the mid-body prior to segmentation, but is restricted to two longitudinal bands in the ventral ectoderm. Each of the two C. teleta eve orthologs has a unique and complex expression pattern, although there is partial overlap in several tissues. Prior to and during segment formation, Ct-eve1 and Ct-eve2 are both expressed in the bilaterial pair of mesoteloblasts, while Ct-eve1 is expressed in the descendant mesodermal band cells. At later stages, Ct-eve2 is expressed in the central and peripheral nervous system, and in mesoderm along the dorsal midline. In late stage larvae and adults, Ct-eve1 and Ct-eve2 are expressed in the posterior growth zone. Conclusions C. teleta eve, Pax3/7 and runt homologs all have distinct expression patterns and share expression domains with homologs from other bilaterians. None of the pair-rule orthologs examined in C. teleta exhibit segmental or pair-rule stripes of expression in the ectoderm or mesoderm, consistent with an independent origin of segmentation between annelids and arthropods. PMID:22510249

  12. Architectural patterns of p16 immunohistochemical expression associated with cancer immunity and prognosis of head and neck squamous cell carcinoma.

    PubMed

    Ryu, Hyang Joo; Kim, Eun Kyung; Heo, Su Jin; Cho, Byoung Chul; Kim, Hye Ryun; Yoon, Sun Och

    2017-11-01

    We evaluated the expression patterns of p16, which is used as a surrogate marker of HPV infection in head and neck squamous cell carcinoma (HNSCC), in regard to their biological and prognostic implications. p16 expression patterns and infiltrated immune cells were analyzed through immunohistochemistry of p16, CD3, CD8, PD-1, FOXP3, and CD163 on surgically resected HNSCCs (n = 393). Patterns of p16 immunoexpression were defined as STRONG (strong, diffuse expression in cytoplasm, and nucleus in >70% of tumor cells), MARGINAL (expression restricted to tumor margins), MOSAIC (ragged, discontinued expression), NUCLEAR (expression in nuclei only), and ABSENT (no expression). The STRONG pattern was more frequent in the oropharynx, and the MARGINAL pattern was noted only in the oral cavity. MOSAIC and NUCLEAR patterns were noted at variable sites. No two patterns of p16 expression showed the same immune cell composition of CD3+ T cells, CD8+ cytotoxic T cells, PD-1+ T cells, FOXP3+ regulatory T cells, and CD163+ macrophages. In overall and disease-free survival analyses, the STRONG pattern showed the most favorable prognosis, while the NUCLEAR pattern had the worst prognosis. HNSCC anatomical sites, tumor-related immune cell components, and patient outcomes were associated with p16 expression patterns. Each architectural pattern of p16 expression may be related to different biological and prognostic phenotypes. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  13. Selection-driven evolution of sex-biased genes is consistent with sexual selection in Arabidopsis thaliana.

    PubMed

    Gossmann, Toni I; Schmid, Marc W; Grossniklaus, Ueli; Schmid, Karl J

    2014-03-01

    Sex-biased genes are genes with a preferential or specific expression in one sex and tend to show an accelerated rate of evolution in animals. Various hypotheses--which are not mutually exclusive--have been put forth to explain observed patterns of rapid evolution. One possible explanation is positive selection, but this has been shown only in few animal species and mostly for male-specific genes. Here, we present a large-scale study that investigates evolutionary patterns of sex-biased genes in the predominantly self-fertilizing plant Arabidopsis thaliana. Unlike most animal species, A. thaliana does not possess sex chromosomes, its flowers develop both male and female sexual organs, and it is characterized by low outcrossing rates. Using cell-specific gene expression data, we identified genes whose expression is enriched in comparison with all other tissues in the male and female gametes (sperm, egg, and central cell), as well as in synergids, pollen, and pollen tubes, which also play an important role in reproduction. Genes specifically expressed in gametes and synergids show higher rates of protein evolution compared with the genome-wide average and no evidence for positive selection. In contrast, pollen- and pollen tube-specific genes not only have lower rates of protein evolution but also exhibit a higher proportion of adaptive amino acid substitutions. We show that this is the result of increased levels of purifying and positive selection among genes with pollen- and pollen tube-specific expression. The increased proportion of adaptive substitutions cannot be explained by the fact that pollen- and pollen tube-expressed genes are enriched in segmental duplications, are on average older, or have a larger effective population size. Our observations are consistent with prezygotic sexual selection as a result of interactions during pollination and pollen tube growth such as pollen tube competition.

  14. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii.

    PubMed

    Ali, Muhammad Y; Pavasovic, Ana; Dammannagoda, Lalith K; Mather, Peter B; Prentis, Peter J

    2017-01-01

    Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na + /K + -ATPase (NKA), H + -ATPase (HAT), Na + /K + /2Cl - cotransporter (NKCC), Na + /Cl - /HCO[Formula: see text] cotransporter (NBC), Na + /H + exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca +2 -ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish , Cherax quadricarinatus, C. destructor and C. cainii , with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types.

  15. Express saccades in distinct populations: east, west, and in-between.

    PubMed

    Knox, Paul C; Wolohan, Felicity D A; Helmy, Mai S

    2017-12-01

    Express saccades are low latency (80-130 ms), visually guided saccades. While their occurrence is encouraged by the use of gap tasks (the fixation target is extinguished 200 ms prior to the saccade target appearing) and suppressed by the use of overlap tasks (the fixation target remains present when the saccade target appears), there are some healthy, adult participants, "express saccade makers" (ESMs), who persist in generating high proportions (> 30%) of express saccades in overlap conditions. These participants are encountered much more frequently in Chinese participant groups than amongst the Caucasian participants tested to date. What is not known is whether this high number of ESMs is only a feature of Chinese participant groups. More broadly, there are few comparative studies of saccade behaviour across large participant groups drawn from different populations. We, therefore, tested an independent group of 70 healthy adult Egyptian participants, using the same equipment and procedures as employed in the previous studies. Each participant was exposed to two blocks of 200 gap, and two blocks of 200 overlap trials, with block order counterbalanced. Results from the Schwartz Value Survey were used to confirm that this group of participants was culturally distinct from the Chinese and Caucasian (white British) groups tested previously. Fourteen percent (10/70) of this new group were ESMs, and the pattern of latency distribution in these ESMs was identical to that identified in the other participant groups, with a prominent peak in the express latency range in overlap conditions. Overall, we identified three modes in the distribution of saccade latency in overlap conditions, the timing of which (express peak at 110 ms, subsequent peaks at 160 and 210 ms) were strikingly consistent with our previous observations. That these behavioural patterns of saccade latency are observed consistently in large participant groups, drawn from geographically, ethnically, and culturally distinct populations, suggests that they relate to the underlying architecture of the saccade system.

  16. Gene expression profiling of long-lived dwarf mice: longevity-associated genes and relationships with diet, gender and aging

    PubMed Central

    Swindell, William R

    2007-01-01

    Background Long-lived strains of dwarf mice carry mutations that suppress growth hormone (GH) and insulin-like growth factor I (IGF-I) signaling. The downstream effects of these endocrine abnormalities, however, are not well understood and it is unclear how these processes interact with aging mechanisms. This study presents a comparative analysis of microarray experiments that have measured hepatic gene expression levels in long-lived strains carrying one of four mutations (Prop1df/df, Pit1dw/dw, Ghrhrlit/lit, GHR-KO) and describes how the effects of these mutations relate to one another at the transcriptional level. Points of overlap with the effects of calorie restriction (CR), CR mimetic compounds, low fat diets, gender dimorphism and aging were also examined. Results All dwarf mutations had larger and more consistent effects on IGF-I expression than dietary treatments. In comparison to dwarf mutations, however, the transcriptional effects of CR (and some CR mimetics) overlapped more strongly with those of aging. Surprisingly, the Ghrhrlit/lit mutation had much larger effects on gene expression than the GHR-KO mutation, even though both mutations affect the same endocrine pathway. Several genes potentially regulated or co-regulated with the IGF-I transcript in liver tissue were identified, including a DNA repair gene (Snm1) that is upregulated in proportion to IGF-I inhibition. A total of 13 genes exhibiting parallel differential expression patterns among all four strains of long-lived dwarf mice were identified, in addition to 30 genes with matching differential expression patterns in multiple long-lived dwarf strains and under CR. Conclusion Comparative analysis of microarray datasets can identify patterns and consistencies not discernable from any one dataset individually. This study implements new analytical approaches to provide a detailed comparison among the effects of life-extending mutations, dietary treatments, gender and aging. This comparison provides insight into a broad range of issues relevant to the study of mammalian aging. In this context, 43 longevity-associated genes are identified and individual genes with the highest level of support among all microarray experiments are highlighted. These results provide promising targets for future experimental investigation as well as potential clues for understanding the functional basis of lifespan extension in mammalian systems. PMID:17915019

  17. The transcriptional landscape of seasonal coat colour moult in the snowshoe hare.

    PubMed

    Ferreira, Mafalda S; Alves, Paulo C; Callahan, Colin M; Marques, João P; Mills, L Scott; Good, Jeffrey M; Melo-Ferreira, José

    2017-08-01

    Seasonal coat colour change is an important adaptation to seasonally changing environments but the evolution of this and other circannual traits remains poorly understood. In this study, we use gene expression to understand seasonal coat colour moulting in wild snowshoe hares (Lepus americanus). We used hair colour to follow the progression of the moult, simultaneously sampling skin from three moulting stages in hares collected during the peak of the spring moult from white winter to brown summer pelage. Using RNA sequencing, we tested whether patterns of expression were consistent with predictions based on the established phases of the hair growth cycle. We found functionally consistent clustering across skin types, with 766 genes differentially expressed between moult stages. "White" pelage showed more differentially expressed genes that were upregulated relative to other skin types, involved in the transition between late telogen (quiescent stage) and the onset of anagen (proliferative stage). Skin samples from transitional "intermediate" and "brown" pelage were transcriptionally similar and resembled the regressive transition to catagen (regressive stage). We also detected differential expression of several key circadian clock and pigmentation genes, providing important means to dissect the bases of alternate seasonal colour morphs. Our results reveal that pelage colour is a useful biomarker for seasonal change but that there is a consistent lag between the main gene expression waves and change in visible coat colour. These experiments establish that developmental sampling from natural populations of nonmodel organisms can provide a crucial resource to dissect the genetic basis and evolution of complex seasonally changing traits. © 2017 John Wiley & Sons Ltd.

  18. Gene-specific cell labeling using MiMIC transposons.

    PubMed

    Gnerer, Joshua P; Venken, Koen J T; Dierick, Herman A

    2015-04-30

    Binary expression systems such as GAL4/UAS, LexA/LexAop and QF/QUAS have greatly enhanced the power of Drosophila as a model organism by allowing spatio-temporal manipulation of gene function as well as cell and neural circuit function. Tissue-specific expression of these heterologous transcription factors relies on random transposon integration near enhancers or promoters that drive the binary transcription factor embedded in the transposon. Alternatively, gene-specific promoter elements are directly fused to the binary factor within the transposon followed by random or site-specific integration. However, such insertions do not consistently recapitulate endogenous expression. We used Minos-Mediated Integration Cassette (MiMIC) transposons to convert host loci into reliable gene-specific binary effectors. MiMIC transposons allow recombinase-mediated cassette exchange to modify the transposon content. We developed novel exchange cassettes to convert coding intronic MiMIC insertions into gene-specific binary factor protein-traps. In addition, we expanded the set of binary factor exchange cassettes available for non-coding intronic MiMIC insertions. We show that binary factor conversions of different insertions in the same locus have indistinguishable expression patterns, suggesting that they reliably reflect endogenous gene expression. We show the efficacy and broad applicability of these new tools by dissecting the cellular expression patterns of the Drosophila serotonin receptor gene family. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Predation drives interpopulation differences in parental care expression.

    PubMed

    Huang, Wen-San; Lin, Si-Min; Dubey, Sylvain; Pike, David A

    2013-03-01

    Expressing parental care after oviposition or parturition is usually an obligate (evolved) trait within a species, despite evolutionary theory predicting that widespread species should vary in whether or not they express parental care according to local selection pressures. The lizard Eutropis longicaudata expresses maternal care only in a single population throughout its large geographical range, but why this pattern occurs is unknown. We used reciprocal translocation and predator exclusion experiments to test whether this intraspecific variation is a fixed trait within populations and whether predator abundance explains this perplexing pattern. Wild-caught female lizards that were reciprocally translocated consistently guarded or abandoned eggs in line with their population of origin. By contrast, most lizards raised in a common garden environment and subsequently released as adults adopted the maternal care strategy of the recipient population, even when the parents originated from a population lacking maternal care. Egg predation represents a significant fitness cost in the populations where females display egg-guarding behaviour, but guarding eggs outweighs this potential cost by increasing hatching success. These results imply that predators can be a driving force in the expression of parental care in instances where it is normally absent and that local selection pressure is sufficient to cause behavioural divergence in whether or not parental care is expressed. © 2012 The Authors. Journal of Animal Ecology © 2012 British Ecological Society.

  20. Transcriptional Response of Honey Bee Larvae Infected with the Bacterial Pathogen Paenibacillus larvae

    PubMed Central

    Cornman, Robert Scott; Lopez, Dawn; Evans, Jay D.

    2013-01-01

    American foulbrood disease of honey bees is caused by the bacterium Paenibacillus larvae. Infection occurs per os in larvae and systemic infection requires a breaching of the host peritrophic matrix and midgut epithelium. Genetic variation exists for both bacterial virulence and host resistance, and a general immunity is achieved by larvae as they age, the basis of which has not been identified. To quickly identify a pool of candidate genes responsive to P. larvae infection, we sequenced transcripts from larvae inoculated with P. larvae at 12 hours post-emergence and incubated for 72 hours, and compared expression levels to a control cohort. We identified 75 genes with significantly higher expression and six genes with significantly lower expression. In addition to several antimicrobial peptides, two genes encoding peritrophic-matrix domains were also up-regulated. Extracellular matrix proteins, proteases/protease inhibitors, and members of the Osiris gene family were prevalent among differentially regulated genes. However, analysis of Drosophila homologs of differentially expressed genes revealed spatial and temporal patterns consistent with developmental asynchrony as a likely confounder of our results. We therefore used qPCR to measure the consistency of gene expression changes for a subset of differentially expressed genes. A replicate experiment sampled at both 48 and 72 hours post infection allowed further discrimination of genes likely to be involved in host response. The consistently responsive genes in our test set included a hymenopteran-specific protein tyrosine kinase, a hymenopteran specific serine endopeptidase, a cytochrome P450 (CYP9Q1), and a homolog of trynity, a zona pellucida domain protein. Of the known honey bee antimicrobial peptides, apidaecin was responsive at both time-points studied whereas hymenoptaecin was more consistent in its level of change between biological replicates and had the greatest increase in expression by RNA-seq analysis. PMID:23762370

  1. Collaborations between CpG sites in DNA methylation

    NASA Astrophysics Data System (ADS)

    Song, You; Ren, Honglei; Lei, Jinzhi

    2017-08-01

    DNA methylation patterns have profound impacts on genome stability, gene expression and development. The molecular base of DNA methylation patterns has long been focused at single CpG sites level. Here, we construct a kinetic model of DNA methylation with collaborations between CpG sites, from which a correlation function was established based on experimental data. The function consists of three parts that suggest three possible sources of the correlation: movement of enzymes along DNA, collaboration between DNA methylation and nucleosome modification, and global enzyme concentrations within a cell. Moreover, the collaboration strength between DNA methylation and nucleosome modification is universal for mouse early embryo cells. The obtained correlation function provides insightful understanding for the mechanisms of inheritance of DNA methylation patterns.

  2. Many human accelerated regions are developmental enhancers

    PubMed Central

    Capra, John A.; Erwin, Genevieve D.; McKinsey, Gabriel; Rubenstein, John L. R.; Pollard, Katherine S.

    2013-01-01

    The genetic changes underlying the dramatic differences in form and function between humans and other primates are largely unknown, although it is clear that gene regulatory changes play an important role. To identify regulatory sequences with potentially human-specific functions, we and others used comparative genomics to find non-coding regions conserved across mammals that have acquired many sequence changes in humans since divergence from chimpanzees. These regions are good candidates for performing human-specific regulatory functions. Here, we analysed the DNA sequence, evolutionary history, histone modifications, chromatin state and transcription factor (TF) binding sites of a combined set of 2649 non-coding human accelerated regions (ncHARs) and predicted that at least 30% of them function as developmental enhancers. We prioritized the predicted ncHAR enhancers using analysis of TF binding site gain and loss, along with the functional annotations and expression patterns of nearby genes. We then tested both the human and chimpanzee sequence for 29 ncHARs in transgenic mice, and found 24 novel developmental enhancers active in both species, 17 of which had very consistent patterns of activity in specific embryonic tissues. Of these ncHAR enhancers, five drove expression patterns suggestive of different activity for the human and chimpanzee sequence at embryonic day 11.5. The changes to human non-coding DNA in these ncHAR enhancers may modify the complex patterns of gene expression necessary for proper development in a human-specific manner and are thus promising candidates for understanding the genetic basis of human-specific biology. PMID:24218637

  3. Stress, fighting and neuroendocrine function.

    NASA Technical Reports Server (NTRS)

    Conner, R. L.; Levine, S.; Vernikos-Danellis, J.

    1971-01-01

    Plasma concentrations of pituitary adrenocorticotrophic hormone (ACTH) and adrenocortical steroids in rats after testing in the shock-induced fighting paradigm were examined. The investigations provide data consistent with the view that psychological aspects of the stressful situation are important in determining the effects of shock on physiological function. The data indicate that the pituitary-adrenal response can be attenuated by the expression of an organized pattern of behavior.

  4. The gene complement of the ancestral bilaterian - was Urbilateria a monster?

    PubMed Central

    2009-01-01

    Expressed sequence tag analyses of the annelid Pomatoceros lamarckii, recently published in BMC Evolutionary Biology, are consistent with less extensive gene loss in the Lophotrochozoa than in the Ecdysozoa, but it would be premature to generalize about patterns of gene loss on the basis of the limited data available. See research article http://www.biomedcentral.com/1471-2148/9/240. PMID:19939290

  5. Population-Level Transcriptomic Responses of the Southern Ocean Salp Salpa thompsoni to Environment Variability of the Western Antarctic Peninsula Region

    NASA Astrophysics Data System (ADS)

    Bucklin, A. C.; Batta Lona, P. G.; Maas, A. E.; O'Neill, R. J.; Wiebe, P. H.

    2015-12-01

    In response to the changing Antarctic climate, the Southern Ocean salp Salpa thompsoni has shown altered patterns of distribution and abundance that are anticipated to have profound impacts on pelagic food webs and ecosystem dynamics. The physiological and molecular processes that underlay ecological function and biogeographical distribution are key to understanding present-day dynamics and predicting future trajectories. This study examined transcriptome-wide patterns of gene expression in relation to biological and physical oceanographic conditions in coastal, shelf and offshore waters of the Western Antarctic Peninsula (WAP) region during austral spring and summer 2011. Based on field observations and collections, seasonal changes in the distribution and abundance of salps of different life stages were associated with differences in water mass structure of the WAP. Our observations are consistent with previous suggestions that bathymetry and currents in Bransfield Strait could generate a retentive cell for an overwintering population of S. thompsoni, which may generate the characteristic salp blooms found throughout the region later in summer. The statistical analysis of transcriptome-wide patterns of gene expression revealed differences among salps collected in different seasons and from different habitats (i.e., coastal versus offshore) in the WAP. Gene expression patterns also clustered by station in austral spring - but not summer - collections, suggesting stronger heterogeneity of environmental conditions. During the summer, differentially expressed genes covered a wider range of functions, including those associated with stress responses. Future research using novel molecular transcriptomic / genomic characterization of S. thompsoni will allow more complete understanding of individual-, population-, and species-level responses to environmental variability and prediction of future dynamics of Southern Ocean food webs and ecosystems.

  6. Whole blood gene expression in adolescent chronic fatigue syndrome: an exploratory cross-sectional study suggesting altered B cell differentiation and survival.

    PubMed

    Nguyen, Chinh Bkrong; Alsøe, Lene; Lindvall, Jessica M; Sulheim, Dag; Fagermoen, Even; Winger, Anette; Kaarbø, Mari; Nilsen, Hilde; Wyller, Vegard Bruun

    2017-05-11

    Chronic fatigue syndrome (CFS) is a prevalent and disabling condition affecting adolescents. The pathophysiology is poorly understood, but immune alterations might be an important component. This study compared whole blood gene expression in adolescent CFS patients and healthy controls, and explored associations between gene expression and neuroendocrine markers, immune markers and clinical markers within the CFS group. CFS patients (12-18 years old) were recruited nation-wide to a single referral center as part of the NorCAPITAL project. A broad case definition of CFS was applied, requiring 3 months of unexplained, disabling chronic/relapsing fatigue of new onset, whereas no accompanying symptoms were necessary. Healthy controls having comparable distribution of gender and age were recruited from local schools. Whole blood samples were subjected to RNA sequencing. Immune markers were blood leukocyte counts, plasma cytokines, serum C-reactive protein and immunoglobulins. Neuroendocrine markers encompassed plasma and urine levels of catecholamines and cortisol, as well as heart rate variability indices. Clinical markers consisted of questionnaire scores for symptoms of post-exertional malaise, inflammation, fatigue, depression and trait anxiety, as well as activity recordings. A total of 29 CFS patients and 18 healthy controls were included. We identified 176 genes as differentially expressed in patients compared to controls, adjusting for age and gender factors. Gene set enrichment analyses suggested impairment of B cell differentiation and survival, as well as enhancement of innate antiviral responses and inflammation in the CFS group. A pattern of co-expression could be identified, and this pattern, as well as single gene transcripts, was significantly associated with indices of autonomic nervous activity, plasma cortisol, and blood monocyte and eosinophil counts. Also, an association with symptoms of post-exertional malaise was demonstrated. Adolescent CFS is characterized by differential gene expression pattern in whole blood suggestive of impaired B cell differentiation and survival, and enhanced innate antiviral responses and inflammation. This expression pattern is associated with neuroendocrine markers of altered HPA axis and autonomic nervous activity, and with symptoms of post-exertional malaise. Trial registration Clinical Trials NCT01040429.

  7. Expression of gentisate 1,2-dioxygenase (gdoA) genes involved in aromatic degradation in two haloarchaeal genera.

    PubMed

    Fairley, D J; Wang, G; Rensing, C; Pepper, I L; Larkin, M J

    2006-12-01

    Gentisate-1,2-dioxygenase genes (gdoA), with homology to a number of bacterial dioxygenases, and genes encoding a putative coenzyme A (CoA)-synthetase subunit (acdB) and a CoA-thioesterase (tieA) were identified in two haloarchaeal isolates. In Haloarcula sp. D1, gdoA was expressed during growth on 4-hydroxybenzoate but not benzoate, and acdB and tieA were not expressed during growth on any of the aromatic substrates tested. In contrast, gdoA was expressed in Haloferax sp. D1227 during growth on benzoate, 3-hydroxybenzoate, cinnamate and phenylpropionate, and both acdB and tieA were expressed during growth on benzoate, cinnamate and phenylpropionate, but not on 3-hydroxybenzoate. This pattern of induction is consistent with these genes encoding steps in a CoA-mediated benzoate pathway in this strain.

  8. Discovering causal signaling pathways through gene-expression patterns

    PubMed Central

    Parikh, Jignesh R.; Klinger, Bertram; Xia, Yu; Marto, Jarrod A.; Blüthgen, Nils

    2010-01-01

    High-throughput gene-expression studies result in lists of differentially expressed genes. Most current meta-analyses of these gene lists include searching for significant membership of the translated proteins in various signaling pathways. However, such membership enrichment algorithms do not provide insight into which pathways caused the genes to be differentially expressed in the first place. Here, we present an intuitive approach for discovering upstream signaling pathways responsible for regulating these differentially expressed genes. We identify consistently regulated signature genes specific for signal transduction pathways from a panel of single-pathway perturbation experiments. An algorithm that detects overrepresentation of these signature genes in a gene group of interest is used to infer the signaling pathway responsible for regulation. We expose our novel resource and algorithm through a web server called SPEED: Signaling Pathway Enrichment using Experimental Data sets. SPEED can be freely accessed at http://speed.sys-bio.net/. PMID:20494976

  9. Ionotropic crustacean olfactory receptors.

    PubMed

    Corey, Elizabeth A; Bobkov, Yuriy; Ukhanov, Kirill; Ache, Barry W

    2013-01-01

    The nature of the olfactory receptor in crustaceans, a major group of arthropods, has remained elusive. We report that spiny lobsters, Panulirus argus, express ionotropic receptors (IRs), the insect chemosensory variants of ionotropic glutamate receptors. Unlike insects IRs, which are expressed in a specific subset of olfactory cells, two lobster IR subunits are expressed in most, if not all, lobster olfactory receptor neurons (ORNs), as confirmed by antibody labeling and in situ hybridization. Ligand-specific ORN responses visualized by calcium imaging are consistent with a restricted expression pattern found for other potential subunits, suggesting that cell-specific expression of uncommon IR subunits determines the ligand sensitivity of individual cells. IRs are the only type of olfactory receptor that we have detected in spiny lobster olfactory tissue, suggesting that they likely mediate olfactory signaling. Given long-standing evidence for G protein-mediated signaling in activation of lobster ORNs, this finding raises the interesting specter that IRs act in concert with second messenger-mediated signaling.

  10. Accelerated recruitment of new brain development genes into the human genome.

    PubMed

    Zhang, Yong E; Landback, Patrick; Vibranovski, Maria D; Long, Manyuan

    2011-10-01

    How the human brain evolved has attracted tremendous interests for decades. Motivated by case studies of primate-specific genes implicated in brain function, we examined whether or not the young genes, those emerging genome-wide in the lineages specific to the primates or rodents, showed distinct spatial and temporal patterns of transcription compared to old genes, which had existed before primate and rodent split. We found consistent patterns across different sources of expression data: there is a significantly larger proportion of young genes expressed in the fetal or infant brain of humans than in mouse, and more young genes in humans have expression biased toward early developing brains than old genes. Most of these young genes are expressed in the evolutionarily newest part of human brain, the neocortex. Remarkably, we also identified a number of human-specific genes which are expressed in the prefrontal cortex, which is implicated in complex cognitive behaviors. The young genes upregulated in the early developing human brain play diverse functional roles, with a significant enrichment of transcription factors. Genes originating from different mechanisms show a similar expression bias in the developing brain. Moreover, we found that the young genes upregulated in early brain development showed rapid protein evolution compared to old genes also expressed in the fetal brain. Strikingly, genes expressed in the neocortex arose soon after its morphological origin. These four lines of evidence suggest that positive selection for brain function may have contributed to the origination of young genes expressed in the developing brain. These data demonstrate a striking recruitment of new genes into the early development of the human brain.

  11. Sexual selection drives evolution and rapid turnover of male gene expression.

    PubMed

    Harrison, Peter W; Wright, Alison E; Zimmer, Fabian; Dean, Rebecca; Montgomery, Stephen H; Pointer, Marie A; Mank, Judith E

    2015-04-07

    The profound and pervasive differences in gene expression observed between males and females, and the unique evolutionary properties of these genes in many species, have led to the widespread assumption that they are the product of sexual selection and sexual conflict. However, we still lack a clear understanding of the connection between sexual selection and transcriptional dimorphism, often termed sex-biased gene expression. Moreover, the relative contribution of sexual selection vs. drift in shaping broad patterns of expression, divergence, and polymorphism remains unknown. To assess the role of sexual selection in shaping these patterns, we assembled transcriptomes from an avian clade representing the full range of sexual dimorphism and sexual selection. We use these species to test the links between sexual selection and sex-biased gene expression evolution in a comparative framework. Through ancestral reconstruction of sex bias, we demonstrate a rapid turnover of sex bias across this clade driven by sexual selection and show it to be primarily the result of expression changes in males. We use phylogenetically controlled comparative methods to demonstrate that phenotypic measures of sexual selection predict the proportion of male-biased but not female-biased gene expression. Although male-biased genes show elevated rates of coding sequence evolution, consistent with previous reports in a range of taxa, there is no association between sexual selection and rates of coding sequence evolution, suggesting that expression changes may be more important than coding sequence in sexual selection. Taken together, our results highlight the power of sexual selection to act on gene expression differences and shape genome evolution.

  12. YAP expression in normal and neoplastic breast tissue: an immunohistochemical study.

    PubMed

    Jaramillo-Rodríguez, Yolanda; Cerda-Flores, Ricardo M; Ruiz-Ramos, Ruben; López-Márquez, Francisco C; Calderón-Garcidueñas, Ana Laura

    2014-04-01

    Yes-associated protein (YAP) is a transcriptional factor involved in normal cell proliferation, apoptosis and carcinogenesis; however, its contribution to breast cancer (BC) is still controversial. We undertook this study to compare the expression of YAP by immunohistochemistry (IHC) in normal breast tissue of women without breast cancer (BC) (controls), non-neoplastic breast tissue in women with cancer (internal controls) and in four different subtypes of invasive ductal carcinoma. There were 17 controls and 105 tumor cases (53 luminal A, 15 luminal B, 20 overexpression of HER2 and 17 triple negative cases) studied by IHC. Statistical analysis included χ(2) for linear trend (Extended Mantel-Haenszel). There were 40% of internal controls that showed expression of YAP in myoepithelial cells, whereas in controls expression was 100%. In controls, 3/17 (17.6%) showed cytoplasmic staining in luminal cells. There was a significant difference in nuclear expression between the ductal BC subtypes. Luminal A had 4% of positive cases with <10% of cells affected in each case; in contrast, there were 17-20% of positive cases in the other groups with 50% or more of stained cells. YAP expression in stromal cells was not observed in controls or in triple-negative cases, and luminal B pattern had the highest YAP nuclear expression (20%). YAP showed decreased expression in tumor cells compared with normal breast tissue. These findings are consistent with a role of YAP as a suppressor gene in BC and show differences in YAP expression in different patterns of ductal BC. Copyright © 2014 IMSS. Published by Elsevier Inc. All rights reserved.

  13. WEREWOLF, a Regulator of Root Hair Pattern Formation, Controls Flowering Time through the Regulation of FT mRNA Stability1[C][W][OA

    PubMed Central

    Seo, Eunjoo; Yu, Jihyeon; Ryu, Kook Hui; Lee, Myeong Min; Lee, Ilha

    2011-01-01

    A key floral activator, FT, integrates stimuli from long-day, vernalization, and autonomous pathways and triggers flowering by directly regulating floral meristem identity genes in Arabidopsis (Arabidopsis thaliana). Since a small amount of FT transcript is sufficient for flowering, the FT level is strictly regulated by diverse genes. In this study, we show that WEREWOLF (WER), a MYB transcription factor regulating root hair pattern, is another regulator of FT. The mutant wer flowers late in long days but normal in short days and shows a weak sensitivity to vernalization, which indicates that WER controls flowering time through the photoperiod pathway. The expression and double mutant analyses showed that WER modulates FT transcript level independent of CONSTANS and FLOWERING LOCUS C. The histological analysis of WER shows that it is expressed in the epidermis of leaves, where FT is not expressed. Consistently, WER regulates not the transcription but the stability of FT mRNA. Our results reveal a novel regulatory mechanism of FT that is non cell autonomous. PMID:21653190

  14. WEREWOLF, a regulator of root hair pattern formation, controls flowering time through the regulation of FT mRNA stability.

    PubMed

    Seo, Eunjoo; Yu, Jihyeon; Ryu, Kook Hui; Lee, Myeong Min; Lee, Ilha

    2011-08-01

    A key floral activator, FT, integrates stimuli from long-day, vernalization, and autonomous pathways and triggers flowering by directly regulating floral meristem identity genes in Arabidopsis (Arabidopsis thaliana). Since a small amount of FT transcript is sufficient for flowering, the FT level is strictly regulated by diverse genes. In this study, we show that WEREWOLF (WER), a MYB transcription factor regulating root hair pattern, is another regulator of FT. The mutant wer flowers late in long days but normal in short days and shows a weak sensitivity to vernalization, which indicates that WER controls flowering time through the photoperiod pathway. The expression and double mutant analyses showed that WER modulates FT transcript level independent of CONSTANS and FLOWERING LOCUS C. The histological analysis of WER shows that it is expressed in the epidermis of leaves, where FT is not expressed. Consistently, WER regulates not the transcription but the stability of FT mRNA. Our results reveal a novel regulatory mechanism of FT that is non cell autonomous.

  15. Altered invertase activities of symptomatic tissues on Beet severe curly top virus (BSCTV) infected Arabidopsis thaliana.

    PubMed

    Park, Jungan; Kim, Soyeon; Choi, Eunseok; Auh, Chung-Kyun; Park, Jong-Bum; Kim, Dong-Giun; Chung, Young-Jae; Lee, Taek-Kyun; Lee, Sukchan

    2013-09-01

    Arabidopsis thaliana infected with Beet severe curly top virus (BSCTV) exhibits systemic symptoms such as stunting of plant growth, callus induction on shoot tips, and curling of leaves and shoot tips. The regulation of sucrose metabolism is essential for obtaining the energy required for viral replication and the development of symptoms in BSCTV-infected A. thaliana. We evaluated the changed transcript level and enzyme activity of invertases in the inflorescence stems of BSCTV-infected A. thaliana. These results were consistent with the increased pattern of ribulose-1,5-bisphosphate carboxylase/oxygenase activity and photosynthetic pigment concentration in virus-infected plants to supply more energy for BSCTV multiplication. The altered gene expression of invertases during symptom development was functionally correlated with the differential expression patterns of D-type cyclins, E2F isoforms, and invertase-related genes. Taken together, our results indicate that sucrose sensing by BSCTV infection may regulate the expression of sucrose metabolism and result in the subsequent development of viral symptoms in relation with activation of cell cycle regulation.

  16. GABAA receptor subunit gene expression in human prefrontal cortex: comparison of schizophrenics and controls

    NASA Technical Reports Server (NTRS)

    Akbarian, S.; Huntsman, M. M.; Kim, J. J.; Tafazzoli, A.; Potkin, S. G.; Bunney, W. E. Jr; Jones, E. G.; Bloom, F. E. (Principal Investigator)

    1995-01-01

    The prefrontal cortex of schizophrenics is hypoactive and displays changes related to inhibitory, GABAergic neurons, and GABAergic synapses. These changes include decreased levels of glutamic acid decarboxylase (GAD), the enzyme for GABA synthesis, upregulation of muscimol binding, and downregulation of benzodiazepine binding to GABAA receptors. Studies in the visual cortex of nonhuman primates have demonstrated that gene expression for GAD and for several GABAA receptor subunit polypeptides is under control of neuronal activity, raising the possibility that similar mechanisms in the hypoactive prefrontal cortex of schizophrenics may explain the abnormalities in GAD and in GABAA receptor regulation. In the present study, which is the first of its type on human cerebral cortex, levels of mRNAs for six GABAA receptor subunits (alpha 1, alpha 2, alpha 5, beta 1, beta 2, gamma 2) and their laminar expression patterns were analyzed in the prefrontal cortex of schizophrenics and matched controls, using in situ hybridization histochemistry and densitometry. Three types of laminar expression pattern were observed: mRNAs for the alpha 1, beta 2, and gamma 2 subunits, which are the predominant receptor subunits expressed in the mature cortex, were expressed at comparatively high levels by cells of all six cortical layers, but most intensely by cells in lower layer III and layer IV. mRNAs for the alpha 2, alpha 5, and beta 1 subunits were expressed at lower levels; alpha 2 and beta 1 were expressed predominantly by cells in layers II, III, and IV; alpha 5 was expressed predominantly in layers IV, V, and VI. There were no significant changes in overall mRNA levels for any of the receptor subunits in the prefrontal cortex of schizophrenics, and the laminar expression pattern of all six receptor subunit mRNAs did not differ between schizophrenics and controls. Because gene expression for GABAA receptor subunits is not consistently altered in the prefrontal cortex of schizophrenics, the previously reported upregulation of muscimol binding sites and downregulation of benzodiazepine binding sites in the prefrontal and adjacent cingulate cortex of schizophrenics are possibly due to posttranscriptional modifications of mRNAs and their translated polypeptides.

  17. A Novel Persistence Associated EBV miRNA Expression Profile Is Disrupted in Neoplasia

    PubMed Central

    Qiu, Jin; Cosmopoulos, Katherine; Pegtel, Michiel; Hopmans, Erik; Murray, Paul; Middeldorp, Jaap; Shapiro, Michael; Thorley-Lawson, David A.

    2011-01-01

    We have performed the first extensive profiling of Epstein-Barr virus (EBV) miRNAs on in vivo derived normal and neoplastic infected tissues. We describe a unique pattern of viral miRNA expression by normal infected cells in vivo expressing restricted viral latency programs (germinal center: Latency II and memory B: Latency I/0). This includes the complete absence of 15 of the 34 miRNAs profiled. These consist of 12 BART miRNAs (including approximately half of Cluster 2) and 3 of the 4 BHRF1 miRNAs. All but 2 of these absent miRNAs become expressed during EBV driven growth (Latency III). Furthermore, EBV driven growth is accompanied by a 5–10 fold down regulation in the level of the BART miRNAs expressed in germinal center and memory B cells. Therefore, Latency III also expresses a unique pattern of viral miRNAs. We refer to the miRNAs that are specifically expressed in EBV driven growth as the Latency III associated miRNAs. In EBV associated tumors that employ Latency I or II (Burkitt's lymphoma, Hodgkin's disease, nasopharyngeal carcinoma and gastric carcinoma), the Latency III associated BART but not BHRF1 miRNAs are up regulated. Thus BART miRNA expression is deregulated in the EBV associated tumors. This is the first demonstration that Latency III specific genes (the Latency III associated BARTs) can be expressed in these tumors. The EBV associated tumors demonstrate very similar patterns of miRNA expression yet were readily distinguished when the expression data were analyzed either by heat-map/clustering or principal component analysis. Systematic analysis revealed that the information distinguishing the tumor types was redundant and distributed across all the miRNAs. This resembles “secret sharing” algorithms where information can be distributed among a large number of recipients in such a way that any combination of a small number of recipients is able to understand the message. Biologically, this may be a consequence of functional redundancy between the miRNAs. PMID:21901094

  18. Perception of Climate Risk among Rural Farmers in Vietnam: Consistency within Households and with the Empirical Record.

    PubMed

    Cullen, Alison C; Anderson, C Leigh

    2017-03-01

    Rural farmers in Vietnamese communes perceive climate risk and potential impacts on livelihood within a complex context that may influence individual and household decisions. In a primary survey of 1,145 residents of the Thach Ha district of Ha Tinh province, we gathered data regarding perception about stability in climate, potential risks to livelihood, demographic characteristics, orientation toward risk, and interest in expanding economic activity. Temporal analysis of meteorological and economic indicator data forms an empirical basis for comparison with human perception. We ask the basic question: Are rural farmers' perceptions of climate consistent with the historical record and reproducible within households? We find that respondents do perceive climate anomalies, with some anchoring on recent extreme events as revealed by climate observational data, and further that spouses disproportionately share perceptions relative to randomly simulated pairings. To put climate-related risk perception in a larger context, we examine patterns across a range of risks to livelihood faced by farmers (livestock disease, pests, markets, health), using dimension reduction techniques. We find that our respondents distinguish among potential causes of low economic productivity, with substantial emphasis on climate-related impacts. They do not express uniform concern across risks, but rather average patterns reveal common modes and distinguish climate concern. Still, among those expressing concern about climate-related risks to livelihood we do not find an association with expressed intention to pursue changes in economic activity as a risk management response. © 2016 Society for Risk Analysis.

  19. Cell type-specific expression of FoxP2 in the ferret and mouse retina.

    PubMed

    Sato, Chihiro; Iwai-Takekoshi, Lena; Ichikawa, Yoshie; Kawasaki, Hiroshi

    2017-04-01

    Although the anatomical and physiological properties of subtypes of retinal ganglion cells (RGCs) have been extensively investigated, their molecular properties are still unclear. Here, we examined the expression patterns of FoxP2 in the retina of ferrets and mice. We found that FoxP2 was expressed in small subsets of neurons in the adult ferret retina. FoxP2-positive neurons in the ganglion cell layer were divided into two groups. Large FoxP2-positive neurons expressed Brn3a and were retrogradely labeled with cholera toxin subunit B injected into the optic nerve, indicating that they are RGCs. The soma size and the projection pattern of FoxP2-positive RGCs were consistent with those of X cells. Because we previously reported that FoxP2 was selectively expressed in X cells in the ferret lateral geniculate nucleus (LGN), our findings indicate that FoxP2 is specifically expressed in the parvocellular pathway from the retina to the LGN. Small FoxP2-positive neurons were positive for GAD65/67, suggesting that they are GABAergic amacrine cells. Most Foxp2-positive cells were RGCs in the adult mouse retina. Dendritic morphological analyses suggested that Foxp2-positive RGCs included direction-selective RGCs in mice. Thus, our findings suggest that FoxP2 is expressed in specific subtypes of RGCs in the retina of ferrets and mice. Copyright © 2016 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.

  20. A major gene controls mimicry and crypsis in butterflies and moths

    PubMed Central

    Nadeau, Nicola J.; Pardo-Diaz, Carolina; Whibley, Annabel; Supple, Megan; Saenko, Suzanne V.; Wallbank, Richard W. R.; Wu, Grace C.; Maroja, Luana; Ferguson, Laura; Hanly, Joseph J.; Hines, Heather; Salazar, Camilo; Merrill, Richard; Dowling, Andrea; ffrench-Constant, Richard; Llaurens, Violaine; Joron, Mathieu; McMillan, W. Owen; Jiggins, Chris D.

    2016-01-01

    The wing patterns of butterflies and moths (Lepidoptera) are diverse and striking examples of evolutionary diversification by natural selection1,2. Lepidopteran wing colour patterns are a key innovation, consisting of arrays of coloured scales. We still lack a general understanding of how these patterns are controlled and if there is any commonality across the 160,000 moth and 17,000 butterfly species. Here, we identify a gene, cortex, through fine-scale mapping using population genomics and gene expression analyses, which regulates pattern switches in multiple species across the mimetic radiation in Heliconius butterflies. cortex belongs to a fast evolving subfamily of the otherwise highly conserved fizzy family of cell cycle regulators3, suggesting that it most likely regulates pigmentation patterning through regulation of scale cell development. In parallel with findings in the peppered moth (Biston betularia)4, our results suggest that this mechanism is common within Lepidoptera and that cortex has become a major target for natural selection acting on colour and pattern variation in this group of insects. PMID:27251285

  1. The gene cortex controls mimicry and crypsis in butterflies and moths.

    PubMed

    Nadeau, Nicola J; Pardo-Diaz, Carolina; Whibley, Annabel; Supple, Megan A; Saenko, Suzanne V; Wallbank, Richard W R; Wu, Grace C; Maroja, Luana; Ferguson, Laura; Hanly, Joseph J; Hines, Heather; Salazar, Camilo; Merrill, Richard M; Dowling, Andrea J; ffrench-Constant, Richard H; Llaurens, Violaine; Joron, Mathieu; McMillan, W Owen; Jiggins, Chris D

    2016-06-02

    The wing patterns of butterflies and moths (Lepidoptera) are diverse and striking examples of evolutionary diversification by natural selection. Lepidopteran wing colour patterns are a key innovation, consisting of arrays of coloured scales. We still lack a general understanding of how these patterns are controlled and whether this control shows any commonality across the 160,000 moth and 17,000 butterfly species. Here, we use fine-scale mapping with population genomics and gene expression analyses to identify a gene, cortex, that regulates pattern switches in multiple species across the mimetic radiation in Heliconius butterflies. cortex belongs to a fast-evolving subfamily of the otherwise highly conserved fizzy family of cell-cycle regulators, suggesting that it probably regulates pigmentation patterning by regulating scale cell development. In parallel with findings in the peppered moth (Biston betularia), our results suggest that this mechanism is common within Lepidoptera and that cortex has become a major target for natural selection acting on colour and pattern variation in this group of insects.

  2. Nonstimulated human uncommitted mesenchymal stem cells express cell markers of mesenchymal and neural lineages.

    PubMed

    Minguell, José J; Fierro, Fernando A; Epuñan, María J; Erices, Alejandro A; Sierralta, Walter D

    2005-08-01

    Ex vivo cultures of human bone marrow-derived mesenchymal stem cells (MSCs) contain subsets of progenitors exhibiting dissimilar properties. One of these subsets comprises uncommitted progenitors displaying distinctive features, such as morphology, a quiescent condition, growth factor production, and restricted tissue biodistribution after transplantation. In this study, we assessed the competence of these cells to express, in the absence of differentiation stimuli, markers of mesoderm and ectodermic (neural) cell lineages. Fluorescence microscopy analysis showed a unique pattern of expression of osteogenic, chondrogenic, muscle, and neural markers. The depicted "molecular signature" of these early uncommitted progenitors, in the absence of differentiation stimuli, is consistent with their multipotentiality and plasticity as suggested by several in vitro and in vivo studies.

  3. Differentially expressed microRNAs in lung adenocarcinoma invert effects of copy number aberrations of prognostic genes

    PubMed Central

    Tokar, Tomas; Pastrello, Chiara; Ramnarine, Varune R.; Zhu, Chang-Qi; Craddock, Kenneth J.; Pikor, Larrisa A.; Vucic, Emily A.; Vary, Simon; Shepherd, Frances A.; Tsao, Ming-Sound; Lam, Wan L.; Jurisica, Igor

    2018-01-01

    In many cancers, significantly down- or upregulated genes are found within chromosomal regions with DNA copy number alteration opposite to the expression changes. Generally, this paradox has been overlooked as noise, but can potentially be a consequence of interference of epigenetic regulatory mechanisms, including microRNA-mediated control of mRNA levels. To explore potential associations between microRNAs and paradoxes in non-small-cell lung cancer (NSCLC) we curated and analyzed lung adenocarcinoma (LUAD) data, comprising gene expressions, copy number aberrations (CNAs) and microRNA expressions. We integrated data from 1,062 tumor samples and 241 normal lung samples, including newly-generated array comparative genomic hybridization (aCGH) data from 63 LUAD samples. We identified 85 “paradoxical” genes whose differential expression consistently contrasted with aberrations of their copy numbers. Paradoxical status of 70 out of 85 genes was validated on sample-wise basis using The Cancer Genome Atlas (TCGA) LUAD data. Of these, 41 genes are prognostic and form a clinically relevant signature, which we validated on three independent datasets. By meta-analysis of results from 9 LUAD microRNA expression studies we identified 24 consistently-deregulated microRNAs. Using TCGA-LUAD data we showed that deregulation of 19 of these microRNAs explains differential expression of the paradoxical genes. Our results show that deregulation of paradoxical genes is crucial in LUAD and their expression pattern is maintained epigenetically, defying gene copy number status. PMID:29507679

  4. Measuring the Evolution of Contemporary Western Popular Music

    PubMed Central

    Serrà, Joan; Corral, Álvaro; Boguñá, Marián; Haro, Martín; Arcos, Josep Ll.

    2012-01-01

    Popular music is a key cultural expression that has captured listeners' attention for ages. Many of the structural regularities underlying musical discourse are yet to be discovered and, accordingly, their historical evolution remains formally unknown. Here we unveil a number of patterns and metrics characterizing the generic usage of primary musical facets such as pitch, timbre, and loudness in contemporary western popular music. Many of these patterns and metrics have been consistently stable for a period of more than fifty years. However, we prove important changes or trends related to the restriction of pitch transitions, the homogenization of the timbral palette, and the growing loudness levels. This suggests that our perception of the new would be rooted on these changing characteristics. Hence, an old tune could perfectly sound novel and fashionable, provided that it consisted of common harmonic progressions, changed the instrumentation, and increased the average loudness. PMID:22837813

  5. Measuring the Evolution of Contemporary Western Popular Music

    NASA Astrophysics Data System (ADS)

    Serrà, Joan; Corral, Álvaro; Boguñá, Marián; Haro, Martín; Arcos, Josep Ll.

    2012-07-01

    Popular music is a key cultural expression that has captured listeners' attention for ages. Many of the structural regularities underlying musical discourse are yet to be discovered and, accordingly, their historical evolution remains formally unknown. Here we unveil a number of patterns and metrics characterizing the generic usage of primary musical facets such as pitch, timbre, and loudness in contemporary western popular music. Many of these patterns and metrics have been consistently stable for a period of more than fifty years. However, we prove important changes or trends related to the restriction of pitch transitions, the homogenization of the timbral palette, and the growing loudness levels. This suggests that our perception of the new would be rooted on these changing characteristics. Hence, an old tune could perfectly sound novel and fashionable, provided that it consisted of common harmonic progressions, changed the instrumentation, and increased the average loudness.

  6. Measuring the evolution of contemporary western popular music.

    PubMed

    Serrà, Joan; Corral, Alvaro; Boguñá, Marián; Haro, Martín; Arcos, Josep Ll

    2012-01-01

    Popular music is a key cultural expression that has captured listeners' attention for ages. Many of the structural regularities underlying musical discourse are yet to be discovered and, accordingly, their historical evolution remains formally unknown. Here we unveil a number of patterns and metrics characterizing the generic usage of primary musical facets such as pitch, timbre, and loudness in contemporary western popular music. Many of these patterns and metrics have been consistently stable for a period of more than fifty years. However, we prove important changes or trends related to the restriction of pitch transitions, the homogenization of the timbral palette, and the growing loudness levels. This suggests that our perception of the new would be rooted on these changing characteristics. Hence, an old tune could perfectly sound novel and fashionable, provided that it consisted of common harmonic progressions, changed the instrumentation, and increased the average loudness.

  7. Color-pattern analysis of eyespots in butterfly wings: a critical examination of morphogen gradient models.

    PubMed

    Otaki, Joji M

    2011-06-01

    Butterfly wing color patterns consist of many color-pattern elements such as eyespots. It is believed that eyespot patterns are determined by a concentration gradient of a single morphogen species released by diffusion from the prospective eyespot focus in conjunction with multiple thresholds in signal-receiving cells. As alternatives to this single-morphogen model, more flexible multiple-morphogen model and induction model can be proposed. However, the relevance of these conceptual models to actual eyespots has not been examined systematically. Here, representative eyespots from nymphalid butterflies were analyzed morphologically to determine if they are consistent with these models. Measurement of ring widths of serial eyespots from a single wing surface showed that the proportion of each ring in an eyespot is quite different among homologous rings of serial eyespots of different sizes. In asymmetric eyespots, each ring is distorted to varying degrees. In extreme cases, only a portion of rings is expressed remotely from the focus. Similarly, there are many eyespots where only certain rings are deleted, added, or expanded. In an unusual case, the central area of an eyespot is composed of multiple "miniature eyespots," but the overall macroscopic eyespot structure is maintained. These results indicate that each eyespot ring has independence and flexibility to a certain degree, which is less consistent with the single-morphogen model. Considering a "periodic eyespot", which has repeats of a set of rings, damage-induced eyespots in mutants, and a scale-size distribution pattern in an eyespot, the induction model is the least incompatible with the actual eyespot diversity.

  8. Hodgkin's-like lymphoma in a ferret (Mustela putorius furo).

    PubMed

    Matsumoto, Isao; Uchida, Kazuyuki; Chambers, James Kenn; Nibe, Kazumi; Sato, Yu; Hamasu, Taku; Nakayama, Hiroyuki

    2017-10-07

    A 7-year-old castrated male ferret developed unilateral cervical lymphadenomegaly over a 1-month period. Histological examination revealed proliferation of tumor cells in a diffuse and partially nodular pattern. The tumor cells were predominantly Hodgkin cells and binucleated Reed-Sternberg cells, characterized by abundant, clear, vacuolated cytoplasm, pleomorphic, ovoid nuclei with thick nuclear membranes and distinct nucleoli. Multinucleated cells, resembling lymphocytic and histiocytic (L&H) cells, were also observed. Immunohistochemically, the tumor cells expressed Pax-5, BLA-36 and vimentin. A small population of the tumor cells expressed CD20. This case showed proliferation of Hodgkin/Reed-Sternberg cells in conjunction with L&H cells that were histologically analogous to feline Hodgkin's-like lymphoma. However, Pax-5 and BLA-36 expression along with rare CD20 expression were consistent with classical Hodgkin's lymphoma in humans.

  9. Concordant p53 and mdm-2 protein expression in vulvar squamous cell carcinoma and adjacent lichen sclerosus.

    PubMed

    Carlson, J A; Amin, S; Malfetano, J; Tien, A T; Selkin, B; Hou, J; Goncharuk, V; Wilson, V L; Rohwedder, A; Ambros, R; Ross, J S

    2001-06-01

    To determine if carcinogenic events in vulvar skin precede the onset of morphologic atypia, the authors investigated for derangements in DNA content, cell proliferation, and cell death in vulvar carcinomas and surrounding skin in 140 samples of tumor and surrounding skin collected from 35 consecutive vulvectomy specimen for squamous cell carcinoma (SCC) or vulvar intraepithelial neoplasia (VIN) 3. Vulvar non-cancer excisions were used as controls. Investigations consisted of histologic classification and measurement of 9 variables--epidermal thickness (acanthosis and rete ridge length), immunolabeling index (LI) for 3 proteins (p53 protein, Ki-67, and mdm-2), pattern of p53 expression (dispersed vs. compact), DNA content index, and presence of aneuploidy by image analysis and apoptotic rate by Apotag labeling. Significant positive correlations were found for all nine variables studied versus increasing histologic severity in two proposed histologic stepwise models of vulvar carcinogenesis (lichen sclerosus (LS) and VIN 3 undifferentiated associated SCC groups). High p53 LI (>25) and the compact pattern of p53 expression (suspected oncoprotein) significantly correlated with LS and its associated vulvar samples compared with samples not associated with LS (P < or = 0.001). Furthermore, p53 LI, mdm-2 LI, and pattern of p53 expression were concordant between patient matched samples of LS and SCC. In addition, mdm-2 LI significantly correlated with dispersed pattern p53 LI suggesting a response to wild-type p53 protein accumulation. These findings support the hypothesis that neoplastic transformation occurs in sequential steps and compromises proteins involved in the cell cycle control. Concordance of p53 and mdm-2 protein expression in LS and adjacent SCC provides evidence that LS can act as a precursor lesion in the absence of morphologic atypia. Overexpression of mdm-2 with stabilization and inactivation of p53 protein may provide an alternate pathway for vulvar carcinogenesis.

  10. Minimal evidence for consistent changes in maize DNA methylation patterns following environmental stress.

    PubMed

    Eichten, Steven R; Springer, Nathan M

    2015-01-01

    DNA methylation is a chromatin modification that is sometimes associated with epigenetic regulation of gene expression. As DNA methylation can be reversible at some loci, it is possible that methylation patterns may change within an organism that is subjected to environmental stress. In order to assess the effects of abiotic stress on DNA methylation patterns in maize (Zea mays), seeding plants were subjected to heat, cold, and UV stress treatments. Tissue was later collected from individual adult plants that had been subjected to stress or control treatments and used to perform DNA methylation profiling to determine whether there were consistent changes in DNA methylation triggered by specific stress treatments. DNA methylation profiling was performed by immunoprecipitation of methylated DNA followed by microarray hybridization to allow for quantitative estimates of DNA methylation abundance throughout the low-copy portion of the maize genome. By comparing the DNA methylation profiles of each individual plant to the average of the control plants it was possible to identify regions of the genome with variable DNA methylation. However, we did not find evidence of consistent DNA methylation changes resulting from the stress treatments used in this study. Instead, the data suggest that there is a low-rate of stochastic variation that is present in both control and stressed plants.

  11. Analysis of lamprey clustered Fox genes: insight into Fox gene evolution and expression in vertebrates.

    PubMed

    Wotton, Karl R; Shimeld, Sebastian M

    2011-12-01

    In the human genome, members of the FoxC, FoxF, FoxL1, and FoxQ1 gene families are found in two paralagous clusters. One cluster contains the genes FOXQ1, FOXF2, FOXC1 and the second consists of FOXF1, FOXC2, and FOXL1. In jawed vertebrates these genes are known to be expressed in different pharyngeal tissues and all, except FoxQ1, are involved in patterning the early embryonic mesoderm. We have previously traced the evolution of this cluster in the bony vertebrates, and the gene content is identical in the dogfish, a member of the most basally branching lineage of the jawed vertebrates. Here we extend these analyses to jawless vertebrates. Using genomic searches and molecular approaches we have identified homologues of these genes from lampreys. We identify two FoxC genes, two FoxF genes, two FoxQ1 genes and single FoxL1 gene. We examine the embryonic expression of one predominantly mesodermally expressed gene family, FoxC, and the endodermally expressed member of the cluster, FoxQ1. We identified FoxQ1 transcripts in the pharyngeal endoderm, while the two FoxC genes are differentially expressed in the pharyngeal mesenchyme and ectoderm. Furthermore we identify conserved expression of lamprey FoxC genes in the paraxial and intermediate mesoderms. We interpret our results through a chordate-wide comparison of expression patterns and discuss gene content in the context of theories on the evolution of the vertebrate genome. 2011 Elsevier B.V. All rights reserved.

  12. Estradiol stimulates an anti-translocation expression pattern of glucocorticoid co-regulators in a hippocampal cell model

    PubMed Central

    Malviya, Sanjana A.; Kelly, Sean D.; Greenlee, Megan M.; Eaton, Douglas C.; Duke, Billie Jeanne; Bourke, Chase H.; Neigh, Gretchen N.

    2013-01-01

    A consistent clinical finding in patients with major depressive disorder (MDD) is hyperactivity of the hypothalamic–pituitary–adrenal (HPA) axis, the system in the body that facilitates the response to stress. It has been suggested that alterations in glucocorticoid receptor (GR)-mediated feedback prolong activation of the HPA axis, leading to the dysfunction observed in MDD. Additionally, the risk for developing MDD is heightened by several risk factors, namely gender, genetics and early life stress. Previous studies have demonstrated that GR translocation is sexually dimorphic and this difference may be facilitated by differential expression of GR co-regulators. The purpose of this study was to determine the extent to which ovarian hormones alter expression of GR and its co-regulators, Fkbp5 and Ppid, in HT-22 hippocampal neurons. The impact of corticosterone (cort), estradiol (E2), and progesterone (P4) treatments on the expression of the genes Nr3c1, Ppid, and Fkbp5 was assessed in HT-22 hippocampal neurons. Treatment of cells with increasing doses of cort increased the expression of Fkbp5, an effect that was potentiated by E2. Exposure of HT-22 cells to E2 decreased the expression of Ppid and simultaneous exposure to E2 and P4 had combinatory effects on Ppid expression. The effects of E2 on Ppid extend previous work which demonstrated that serum E2 concentrations correlate with hippocampal Ppid expression in female rats. The results presented here illustrate that E2 generates an anti-translocation pattern of GR co-regulators in hippocampal cells. PMID:23541378

  13. A transversal approach to predict gene product networks from ontology-based similarity

    PubMed Central

    Chabalier, Julie; Mosser, Jean; Burgun, Anita

    2007-01-01

    Background Interpretation of transcriptomic data is usually made through a "standard" approach which consists in clustering the genes according to their expression patterns and exploiting Gene Ontology (GO) annotations within each expression cluster. This approach makes it difficult to underline functional relationships between gene products that belong to different expression clusters. To address this issue, we propose a transversal analysis that aims to predict functional networks based on a combination of GO processes and data expression. Results The transversal approach presented in this paper consists in computing the semantic similarity between gene products in a Vector Space Model. Through a weighting scheme over the annotations, we take into account the representativity of the terms that annotate a gene product. Comparing annotation vectors results in a matrix of gene product similarities. Combined with expression data, the matrix is displayed as a set of functional gene networks. The transversal approach was applied to 186 genes related to the enterocyte differentiation stages. This approach resulted in 18 functional networks proved to be biologically relevant. These results were compared with those obtained through a standard approach and with an approach based on information content similarity. Conclusion Complementary to the standard approach, the transversal approach offers new insight into the cellular mechanisms and reveals new research hypotheses by combining gene product networks based on semantic similarity, and data expression. PMID:17605807

  14. ASSESSING THE ROLE OF CASPASE ACTIVITY AND METACASPASE EXPRESSION ON VIRAL SUSCEPTIBILITY OF THE COCCOLITHOPHORE, EMILIANIA HUXLEYI (HAPTOPHYTA).

    PubMed

    Bidle, Kay D; Kwityn, Clifford J

    2012-10-01

    As part of their strategy to infect the globally important coccolithophore, Emiliania huxleyi (Lohmann) W.W. Hay & H.P. Mohler, Coccolithoviruses trigger and regulate the host's programmed cell death (PCD) machinery during lytic infection. The induction and recruitment of host metacaspases, specialized, ancestral death proteases that facilitate viral lysis, suggests they may be important subcellular determinants to infection. We examined the "basal" levels and patterns of caspase activity and metacaspase expression in exponentially growing resistant and sensitive E. huxleyi strains and linked them with susceptibility to E. huxleyi virus 1 (EhV1). Resistant E. huxleyi strains were consistently characterized by low caspase specific activity and a relatively simple metacaspase expression profile. In contrast, sensitive E. huxleyi strains had markedly elevated caspase specific activity and consistently expressed more diverse metacaspase proteins. Using pooled data sets from triplicate experiments, we observed statistically significant linear correlations between infectivity, caspase activity, and metacaspase expression, with each strain forming distinct clusters, within a gradient in viral susceptibility. At the same time, we observed positive correlations between the expression of a subset of metacaspase proteins and lower susceptibility, suggestive of potential protective roles. Our findings implicate the importance of subtle differences in the basal physiological regulation of the PCD machinery to viral resistance or sensitivity and cell fate. © 2012 Phycological Society of America.

  15. CFTR expression and organ damage in cystic fibrosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tizzano, E.; Chitayat, D.; Buchwald, M.

    1994-09-01

    To assist our understanding of the origin of organ damage caused by cystic fibrosis (CF) disease, we have analyzed the pattern of expression of the CF gene (CFTR). mRNA in situ hybridization analysis was carried out in human fetal, newborn, infant and adult tissues and the abundance of the mRNA was correlated with the known pathology at the various stages of human development. Analysis of the pattern of expression indicates a constitutive level of mRNA in gastrointestinal tissues starting during early development and maintained throughout life. Prenatal respiratory tissues show qualitative and quantitative major differences in comparison to postnatal lungmore » samples. Male reproductive tissues show high levels of expression in the head of the epididymis compared with the rest of the male ducts. Female reproductive tissues show a variable pattern of expression at different stages during fetal development and during puberty probably due to changes in hormonal levels. Gastrointestinal and male reproductive tissues have a consistent pathology at birth, whereas no lung abnormalities have been described in newborns affected by CF. Our results show that there is no exact correlations between organ damage present at birth and the degree of CFTR expression. To explain these observations, we hypothesize that the pathogenesis of organ damage in CF depend on at least three factors: the rate of CFTR-mediated fluid secretion, differences in genotype and environmental factors, such as the amount of macromolecules in the lumen of the ducts. This last element predicts that damage will occur in tissues with high protein loads and low flow rates (e.g. pancreas, epididymis), where the absence of CFTR function leads to obstruction and pathology. Organs that express CFTR but with no significant damage (e.g. prenatal lung, female reproductive tissues), will have a low protein load and a high flow rates.« less

  16. Reciprocal transcriptional regulation of metabolic and signaling pathways correlates with disease severity in heart failure.

    PubMed

    Barth, Andreas S; Kumordzie, Ami; Frangakis, Constantine; Margulies, Kenneth B; Cappola, Thomas P; Tomaselli, Gordon F

    2011-10-01

    Systolic heart failure (HF) is a complex systemic syndrome that can result from a wide variety of clinical conditions and gene mutations. Despite phenotypic similarities, characterized by ventricular dilatation and reduced contractility, the extent of common and divergent gene expression between different forms of HF remains a matter of intense debate. Using a meta-analysis of 28 experimental (mouse, rat, dog) and human HF microarray studies, we demonstrate that gene expression changes are characterized by a coordinated and reciprocal regulation of major metabolic and signaling pathways. In response to a wide variety of stressors in animal models of HF, including ischemia, pressure overload, tachypacing, chronic isoproterenol infusion, Chagas disease, and transgenic mouse models, major metabolic pathways are invariably downregulated, whereas cell signaling pathways are upregulated. In contrast to this uniform transcriptional pattern that recapitulates a fetal gene expression program in experimental animal models of HF, human HF microarray studies displayed a greater heterogeneity, with some studies even showing upregulation of metabolic and downregulation of signaling pathways in end-stage human hearts. These discrepant results between animal and human studies are due to a number of factors, prominently cardiac disease and variable exposure to cold cardioplegic solution in nonfailing human samples, which can downregulate transcripts involved in oxidative phosphorylation (OXPHOS), thus mimicking gene expression patterns observed in failing samples. Additionally, β-blockers and ACE inhibitor use in end-stage human HF was associated with higher levels of myocardial OXPHOS transcripts, thus partially reversing the fetal gene expression pattern. In human failing samples, downregulation of metabolism was associated with hemodynamic markers of disease severity. Irrespective of the etiology, gene expression in failing myocardium is characterized by downregulation of metabolic transcripts and concomitant upregulation of cell signaling pathways. Gene expression changes along this metabolic-signaling axis in mammalian myocardium are a consistent feature in the heterogeneous transcriptional response observed in phenotypically similar models of HF.

  17. PiiL: visualization of DNA methylation and gene expression data in gene pathways.

    PubMed

    Moghadam, Behrooz Torabi; Zamani, Neda; Komorowski, Jan; Grabherr, Manfred

    2017-08-02

    DNA methylation is a major mechanism involved in the epigenetic state of a cell. It has been observed that the methylation status of certain CpG sites close to or within a gene can directly affect its expression, either by silencing or, in some cases, up-regulating transcription. However, a vertebrate genome contains millions of CpG sites, all of which are potential targets for methylation, and the specific effects of most sites have not been characterized to date. To study the complex interplay between methylation status, cellular programs, and the resulting phenotypes, we present PiiL, an interactive gene expression pathway browser, facilitating analyses through an integrated view of methylation and expression on multiple levels. PiiL allows for specific hypothesis testing by quickly assessing pathways or gene networks, where the data is projected onto pathways that can be downloaded directly from the online KEGG database. PiiL provides a comprehensive set of analysis features that allow for quick and specific pattern searches. Individual CpG sites and their impact on host gene expression, as well as the impact on other genes present in the regulatory network, can be examined. To exemplify the power of this approach, we analyzed two types of brain tumors, Glioblastoma multiform and lower grade gliomas. At a glance, we could confirm earlier findings that the predominant methylation and expression patterns separate perfectly by mutations in the IDH genes, rather than by histology. We could also infer the IDH mutation status for samples for which the genotype was not known. By applying different filtering methods, we show that a subset of CpG sites exhibits consistent methylation patterns, and that the status of sites affect the expression of key regulator genes, as well as other genes located downstream in the same pathways. PiiL is implemented in Java with focus on a user-friendly graphical interface. The source code is available under the GPL license from https://github.com/behroozt/PiiL.git .

  18. Site-specific variation in gene expression from Symbiodinium spp. associated with offshore and inshore Porites astreoides in the lower Florida Keys is lost with bleaching and disease stress.

    PubMed

    Salas, Briana Hauff; Haslun, Joshua A; Strychar, Kevin B; Ostrom, Peggy H; Cervino, James M

    2017-01-01

    Scleractinian coral are experiencing unprecedented rates of mortality due to increases in sea surface temperatures in response to global climate change. Some coral species however, survive high temperature events due to a reduced susceptibility to bleaching. We investigated the relationship between bleaching susceptibility and expression of five metabolically related genes of Symbiodinium spp. from the coral Porites astreoides originating from an inshore and offshore reef in the Florida Keys. The acclimatization potential of Symbiodinium spp. to changing temperature regimes was also measured via a two-year reciprocal transplant between the sites. Offshore coral fragments displayed significantly higher expression in Symbiodinium spp. genes PCNA, SCP2, G3PDH, PCP and psaE than their inshore counterparts (p<0.05), a pattern consistent with increased bleaching susceptibility in offshore corals. Additionally, gene expression patterns in Symbiodinium spp. from site of origin were conserved throughout the two-year reciprocal transplant, indicating acclimatization did not occur within this multi-season time frame. Further, laboratory experiments were used to investigate the influence of acute high temperature (32°C for eight hours) and disease (lipopolysaccharide of Serratia marcescens) on the five metabolically related symbiont genes from the same offshore and inshore P. astreoides fragments. Gene expression did not differ between reef fragments, or as a consequence of acute exposure to heat or heat and disease, contrasting to results found in the field. Gene expression reported here indicates functional variation in populations of Symbiodinium spp. associated with P. astreoides in the Florida Keys, and is likely a result of localized adaptation. However, gene expression patterns observed in the lab imply that functional variation in zooxanthellae observed under conditions of chronic moderate stress is lost under the acute extreme conditions studied here.

  19. Site-specific variation in gene expression from Symbiodinium spp. associated with offshore and inshore Porites astreoides in the lower Florida Keys is lost with bleaching and disease stress

    PubMed Central

    Haslun, Joshua A.; Strychar, Kevin B.; Ostrom, Peggy H.; Cervino, James M.

    2017-01-01

    Scleractinian coral are experiencing unprecedented rates of mortality due to increases in sea surface temperatures in response to global climate change. Some coral species however, survive high temperature events due to a reduced susceptibility to bleaching. We investigated the relationship between bleaching susceptibility and expression of five metabolically related genes of Symbiodinium spp. from the coral Porites astreoides originating from an inshore and offshore reef in the Florida Keys. The acclimatization potential of Symbiodinium spp. to changing temperature regimes was also measured via a two-year reciprocal transplant between the sites. Offshore coral fragments displayed significantly higher expression in Symbiodinium spp. genes PCNA, SCP2, G3PDH, PCP and psaE than their inshore counterparts (p<0.05), a pattern consistent with increased bleaching susceptibility in offshore corals. Additionally, gene expression patterns in Symbiodinium spp. from site of origin were conserved throughout the two-year reciprocal transplant, indicating acclimatization did not occur within this multi-season time frame. Further, laboratory experiments were used to investigate the influence of acute high temperature (32°C for eight hours) and disease (lipopolysaccharide of Serratia marcescens) on the five metabolically related symbiont genes from the same offshore and inshore P. astreoides fragments. Gene expression did not differ between reef fragments, or as a consequence of acute exposure to heat or heat and disease, contrasting to results found in the field. Gene expression reported here indicates functional variation in populations of Symbiodinium spp. associated with P. astreoides in the Florida Keys, and is likely a result of localized adaptation. However, gene expression patterns observed in the lab imply that functional variation in zooxanthellae observed under conditions of chronic moderate stress is lost under the acute extreme conditions studied here. PMID:28355291

  20. Peptide vaccine immunotherapy biomarkers and response patterns in pediatric gliomas

    PubMed Central

    Müller, Sören; Agnihotri, Sameer; Shoger, Karsen E.; Myers, Max I.; Chaparala, Srilakshmi; Villanueva, Clarence R.; Chattopadhyay, Ansuman; Butterfield, Lisa H.; Okada, Hideho; Pollack, Ian F.

    2018-01-01

    Low-grade gliomas (LGGs) are the most common brain tumor affecting children. We recently reported an early phase clinical trial of a peptide-based vaccine, which elicited consistent antigen-specific T cell responses in pediatric LGG patients. Additionally, we observed radiologic responses of stable disease (SD), partial response (PR), and near-complete/complete response (CR) following therapy. To identify biomarkers of clinical response in peripheral blood, we performed RNA sequencing on PBMC samples collected at multiple time points. Patients who showed CR demonstrated elevated levels of T cell activation markers, accompanied by a cytotoxic T cell response shortly after treatment initiation. At week 34, patients with CR demonstrated both IFN signaling and Poly-IC:LC adjuvant response patterns. Patients with PR demonstrated a unique, late monocyte response signature. Interestingly, HLA-V expression, before or during therapy, and an early monocytic hematopoietic response were strongly associated with SD. Finally, low IDO1 and PD-L1 expression before treatment and early elevated levels of T cell activation markers were associated with prolonged progression-free survival. Overall, our data support the presence of unique peripheral immune patterns in LGG patients associated with different radiographic responses to our peptide vaccine immunotherapy. Future clinical trials, including our ongoing phase II LGG vaccine immunotherapy, should monitor these response patterns. PMID:29618666

  1. Immunohistochemical assessment of NY-ESO-1 expression in esophageal adenocarcinoma resection specimens.

    PubMed

    Hayes, Stephen J; Hng, Keng Ngee; Clark, Peter; Thistlethwaite, Fiona; Hawkins, Robert E; Ang, Yeng

    2014-04-14

    To assess NY-ESO-1 expression in a cohort of esophageal adenocarcinomas. A retrospective search of our tissue archive for esophageal resection specimens containing esophageal adenocarcinoma was performed, for cases which had previously been reported for diagnostic purposes, using the systematised nomenclature of human and veterinary medicine coding system. Original haematoxylin and eosin stained sections were reviewed, using light microscopy, to confirm classification and tumour differentiation. A total of 27 adenocarcinoma resection specimens were then assessed using immunohistochemistry for NY-ESO-1 expression: 4 well differentiated, 14 moderately differentiated, 4 moderate-poorly differentiated, and 5 poorly differentiated. Four out of a total of 27 cases of esophageal adenocarcinoma examined (15%) displayed diffuse cytoplasmic and nuclear expression for NY-ESO-1. They displayed a heterogeneous and mosaic-type pattern of diffuse staining. Diffuse cytoplasmic staining was not identified in any of these structures: stroma, normal squamous epithelium, normal submucosal gland and duct, Barrett's esophagus (goblet cell), Barrett's esophagus (non-goblet cell) and high grade glandular dysplasia. All adenocarcinomas showed an unexpected dot-type pattern of staining at nuclear, paranuclear and cytoplasmic locations. Similar dot-type staining, with varying frequency and size of dots, was observed on examination of Barrett's metaplasia, esophageal submucosal gland acini and the large bowel negative control, predominantly at the crypt base. Furthermore, a prominent pattern of apical (luminal) cytoplasmic dot-type staining was observed in some cases of Barrett's metaplasia and also adenocarcinoma. A further morphological finding of interest was noted on examination of haematoxylin and eosin stained sections, as aggregates of lymphocytes were consistently noted to surround submucosal glands. We have demonstrated for the first time NY-ESO-1 expression by esophageal adenocarcinomas, Barrett's metaplasia and normal tissues other than germ cells.

  2. Immunohistochemical assessment of NY-ESO-1 expression in esophageal adenocarcinoma resection specimens

    PubMed Central

    Hayes, Stephen J; Hng, Keng Ngee; Clark, Peter; Thistlethwaite, Fiona; Hawkins, Robert E; Ang, Yeng

    2014-01-01

    AIM: To assess NY-ESO-1 expression in a cohort of esophageal adenocarcinomas. METHODS: A retrospective search of our tissue archive for esophageal resection specimens containing esophageal adenocarcinoma was performed, for cases which had previously been reported for diagnostic purposes, using the systematised nomenclature of human and veterinary medicine coding system. Original haematoxylin and eosin stained sections were reviewed, using light microscopy, to confirm classification and tumour differentiation. A total of 27 adenocarcinoma resection specimens were then assessed using immunohistochemistry for NY-ESO-1 expression: 4 well differentiated, 14 moderately differentiated, 4 moderate-poorly differentiated, and 5 poorly differentiated. RESULTS: Four out of a total of 27 cases of esophageal adenocarcinoma examined (15%) displayed diffuse cytoplasmic and nuclear expression for NY-ESO-1. They displayed a heterogeneous and mosaic-type pattern of diffuse staining. Diffuse cytoplasmic staining was not identified in any of these structures: stroma, normal squamous epithelium, normal submucosal gland and duct, Barrett’s esophagus (goblet cell), Barrett’s esophagus (non-goblet cell) and high grade glandular dysplasia. All adenocarcinomas showed an unexpected dot-type pattern of staining at nuclear, paranuclear and cytoplasmic locations. Similar dot-type staining, with varying frequency and size of dots, was observed on examination of Barrett’s metaplasia, esophageal submucosal gland acini and the large bowel negative control, predominantly at the crypt base. Furthermore, a prominent pattern of apical (luminal) cytoplasmic dot-type staining was observed in some cases of Barrett’s metaplasia and also adenocarcinoma. A further morphological finding of interest was noted on examination of haematoxylin and eosin stained sections, as aggregates of lymphocytes were consistently noted to surround submucosal glands. CONCLUSION: We have demonstrated for the first time NY-ESO-1 expression by esophageal adenocarcinomas, Barrett’s metaplasia and normal tissues other than germ cells. PMID:24744590

  3. Effects of cultural characteristics on building an emotion classifier through facial expression analysis

    NASA Astrophysics Data System (ADS)

    da Silva, Flávio Altinier Maximiano; Pedrini, Helio

    2015-03-01

    Facial expressions are an important demonstration of humanity's humors and emotions. Algorithms capable of recognizing facial expressions and associating them with emotions were developed and employed to compare the expressions that different cultural groups use to show their emotions. Static pictures of predominantly occidental and oriental subjects from public datasets were used to train machine learning algorithms, whereas local binary patterns, histogram of oriented gradients (HOGs), and Gabor filters were employed to describe the facial expressions for six different basic emotions. The most consistent combination, formed by the association of HOG filter and support vector machines, was then used to classify the other cultural group: there was a strong drop in accuracy, meaning that the subtle differences of facial expressions of each culture affected the classifier performance. Finally, a classifier was trained with images from both occidental and oriental subjects and its accuracy was higher on multicultural data, evidencing the need of a multicultural training set to build an efficient classifier.

  4. Crepuscular Behavioral Variation and Profiling of Opsin Genes in Anopheles gambiae and Anopheles stephensi (Diptera: Culicidae)

    PubMed Central

    Jenkins, Adam M.; Muskavitch, Marc A. T.

    2015-01-01

    We understand little about photopreference and the molecular mechanisms governing vision-dependent behavior in vector mosquitoes. Investigations of the influence of photopreference on adult mosquito behaviors such as endophagy and exophagy and endophily and exophily will enhance our ability to develop and deploy vector-targeted interventions and monitoring techniques. Our laboratory-based analyses have revealed that crepuscular period photopreference differs between An. gambiae and An. stephensi. We employed qRT-PCR to assess crepuscular transcriptional expression patterns of long wavelength-, short wavelength-, and ultraviolet wavelength-sensing opsins (i.e., rhodopsin-class G-protein coupled receptors) in An. gambiae and in An. stephensi. Transcript levels do not exhibit consistent differences between species across diurnal cycles, indicating that differences in transcript abundances within this gene set are not correlated with these behavioral differences. Using developmentally staged and gender-specific RNAseq data sets in An. gambiae, we show that long wavelength-sensing opsins are expressed in two different patterns (one set expressed during larval stages, and one set expressed during adult stages), while short wavelength- and ultraviolet wavelength-sensing opsins exhibit increased expression during adult stages. Genomic organization of An. gambiae opsins suggests paralogous gene expansion of long wavelength-sensing opsins in comparison with An. stephensi. We speculate that this difference in gene number may contribute to variation between these species in photopreference behavior (e.g., visual sensitivity). PMID:26334802

  5. Self-reflection and positive schizotypy in the adolescent brain.

    PubMed

    Debbané, Martin; Vrtička, Pascal; Lazouret, Marine; Badoud, Deborah; Sander, David; Eliez, Stephan

    2014-01-01

    Clinical and phenomenological accounts of schizophrenia suggest that impairments in self-reflective processes significantly contribute to psychopathological expression. Recent imaging studies observe atypical cerebral activation patterns during self-reflection, especially around the cortical midline structures, both in psychosis-prone adults and individuals with schizophrenia. Given that self-reflection processes consolidate during adolescence, and that early transient expression of psychosis (positive schizotypy) also arises during this period, the present study sought to examine whether atypical cerebral activation during self-reflection task could be associated with early schizotypic expression during adolescence. Forty-two neurotypical adolescent participants (19 females) aged from 12 to 19 (15.92±1.9) underwent a self-reflection task using functional neuroimaging (fMRI), where they had to evaluate trait adjectives (1 to 4 ratings) about themselves or their same sex best friend. The Schizotypal Personality Questionnaire (SPQ) was employed to assess positive schizotypic expression. Results showed that positive schizotypy in adolescents significantly correlated with cortical midline activation patterns in the dorsomedial prefrontal cortex (dmPFC) and the posterior cingulate cortex (PCC), as well as the dorsolateral PFC and the lingual gyrus. The results are consistent with previous imaging literature on self-reflection and schizophrenia. They further highlight that the relationship between self-reflection processes and positive schizotypy operates at the trait level of expression and can be observed as early as adolescence. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. The tracking of active travel and its relationship with body composition in UK adolescents.

    PubMed

    Falconer, Catherine L; Leary, Sam D; Page, Angie S; Cooper, Ashley R

    2015-12-01

    To examine the tracking of active travel through adolescence, and its association with body mass index (BMI) and fat mass at age 17 in a UK cohort. We analysed data collected from the Avon Longitudinal Study of Parents and Children (ALSPAC). The analyses include all participants with self-reported travel mode to school at ages 12, 14 and 16 years, and measured height, weight and body composition at age 17 ( n =2,026). Tracking coefficients were calculated for individual travel behaviours (including walking and cycling) through adolescence using Generalised Estimating Equations. Linear regression analyses examined associations between travel pattern (consistently passive, consistently active, active at two time points or active at one time point), BMI, and DXA-measured fat mass (expressed as internally derived standard deviation scores) at 17 years. Analyses were adjusted for height (where appropriate), sex, age, parental social class, and maternal education with interaction terms to assess sex differences. There was substantial tracking in active travel through adolescence, with 38.5% of males and 32.3% of females consistently walking or cycling to school. In males, a consistently or predominantly active travel pattern was associated with a lower BMI SD score at age 17 (consistently active: adjusted β =-0.23; 95% CI -0.40, -0.06; active at two time points: adjusted β -0.30; 95% CI -0.50, -0.10) compared to those with a consistently passive pattern. No associations were seen in females. Maintenance of active travel behaviours throughout adolescence may help to protect against the development of excess BMI in males. In addition to encouraging the adoption of active travel to school, public health messages should aim to prevent drop out from active travel to promote good health in youth.

  7. HSV-1 Genome Subnuclear Positioning and Associations with Host-Cell PML-NBs and Centromeres Regulate LAT Locus Transcription during Latency in Neurons

    PubMed Central

    Catez, Frédéric; Picard, Christel; Held, Kathrin; Gross, Sylvain; Rousseau, Antoine; Theil, Diethilde; Sawtell, Nancy; Labetoulle, Marc; Lomonte, Patrick

    2012-01-01

    Major human pathologies are caused by nuclear replicative viruses establishing life-long latent infection in their host. During latency the genomes of these viruses are intimately interacting with the cell nucleus environment. A hallmark of herpes simplex virus type 1 (HSV-1) latency establishment is the shutdown of lytic genes expression and the concomitant induction of the latency associated (LAT) transcripts. Although the setting up and the maintenance of the latent genetic program is most likely dependent on a subtle interplay between viral and nuclear factors, this remains uninvestigated. Combining the use of in situ fluorescent-based approaches and high-resolution microscopic analysis, we show that HSV-1 genomes adopt specific nuclear patterns in sensory neurons of latently infected mice (28 days post-inoculation, d.p.i.). Latent HSV-1 genomes display two major patterns, called “Single” and “Multiple”, which associate with centromeres, and with promyelocytic leukemia nuclear bodies (PML-NBs) as viral DNA-containing PML-NBs (DCP-NBs). 3D-image reconstruction of DCP-NBs shows that PML forms a shell around viral genomes and associated Daxx and ATRX, two PML partners within PML-NBs. During latency establishment (6 d.p.i.), infected mouse TGs display, at the level of the whole TG and in individual cells, a substantial increase of PML amount consistent with the interferon-mediated antiviral role of PML. “Single” and “Multiple” patterns are reminiscent of low and high-viral genome copy-containing neurons. We show that LAT expression is significantly favored within the “Multiple” pattern, which underlines a heterogeneity of LAT expression dependent on the viral genome copy number, pattern acquisition, and association with nuclear domains. Infection of PML-knockout mice demonstrates that PML/PML-NBs are involved in virus nuclear pattern acquisition, and negatively regulate the expression of the LAT. This study demonstrates that nuclear domains including PML-NBs and centromeres are functionally involved in the control of HSV-1 latency, and represent a key level of host/virus interaction. PMID:22912575

  8. The disruption of a novel limb cis-regulatory element of SHH is associated with autosomal dominant preaxial polydactyly-hypertrichosis

    PubMed Central

    Petit, Florence; Jourdain, Anne-Sophie; Holder-Espinasse, Muriel; Keren, Boris; Andrieux, Joris; Duterque-Coquillaud, Martine; Porchet, Nicole; Manouvrier-Hanu, Sylvie; Escande, Fabienne

    2016-01-01

    The expression gradient of the morphogen Sonic Hedgehog (SHH) is crucial in establishing the number and the identity of the digits during anteroposterior patterning of the limb. Its anterior ectopic expression is responsible for preaxial polydactyly (PPD). Most of these malformations are due to the gain-of-function of the Zone of Polarizing Activity Regulatory Sequence, the only limb-specific enhancer of SHH known to date. We report a family affected with a novel condition associating PPD and hypertrichosis of the upper back, following an autosomal dominant mode of inheritance. This phenotype is consistent with deregulation of SHH expression during limb and follicle development. In affected members, we identified a 2 kb deletion located ~240 kb upstream from the SHH promoter. The deleted sequence is capable of repressing the transcriptional activity of the SHH promoter in vitro, consistent with a silencer activity. We hypothesize that the deletion of this silencer could be responsible for SHH deregulation during development, leading to a PPD-hypertrichosis phenotype. PMID:25782671

  9. Effects of tributyltin (TBT) on in vitro hormonal and biotransformation responses in Atlantic salmon (Salmo salar).

    PubMed

    Mortensen, Anne S; Arukwe, Augustine

    2009-01-01

    The mechanisms by which the biocide tributyltin (TBT) and its metabolites affect the hormonal and xenobiotic biotransformation pathways in aquatic species are not well understood. In this study hepatocytes isolated from salmon were used to evaluate the mechanistical effects of TBT on fish hormonal and xenobiotic biotransformation pathways. Cells were exposed to 0.01, 0.1, 1, or 5 microM TBT and samples were collected at 0, 12, 24, or 48 h following exposure. Gene expression patterns were evaluated using quantitative polymerase chain reaction (PCR), and cytochrome P-450 (CYP)-mediated enzyme activities were evaluated by ethoxyresorufin, benzyloxyresorufin, and pentoxyresorufin O-deethylase (EROD, BROD, and PROD, respectively) activity assays. Generally, exposure of hepatocytes to 1 microM (at 48 h) and 5 microM TBT (at 12, 24, and 48 h) consistently produced reductions in all mRNA species investigated. TBT produced significant decreases of vitellogen (Vtg) expression at 48 h and modified the expression patterns of estrogen receptors (ERalpha and ERbeta) and androgen receptor-beta (ARbeta) that were dependent on time and TBT concentration. In the xenobiotic biotransformation pathway, TBT produced differential expression patterns that were dependent on exposure time and concentration for all salmonid AhR2 isoforms (AhR2alpha, AhR2beta, AhR2delta, and AhR2gamma). For CYP1A1, CYP3A, AhRR, and Arnt mRNA, TBT produced exposure- and time-specific modulations. Catalytic CYP activities showed that BROD activity increased in an apparent concentration-specific manner in cells exposed to TBT for 12 h. Interestingly, EROD activity showed a TBT concentration-dependent increase at 24 h and PROD at 12 and 48 h of exposure. In general our data show that TBT differentially modulated hormonal and biotransformation responses in the salmon in vitro system. The apparent and consistent decrease of the studied responses with time in 1 and 5 microM exposed hepatocytes suggest a possible transcription inhibitory effect of TBT.

  10. Primate Short-Wavelength Cones Share Molecular Markers with Rods

    PubMed Central

    Craft, Cheryl M.; Huang, Jing; Possin, Daniel E.; Hendrickson, Anita

    2015-01-01

    Macaca, Callithrix jacchus marmoset monkey, Pan troglodytes chim- panzee and human retinas were examined to define if short wavelength (S) cones share molecular markers with L&M cone or rod photoreceptors. S cones showed consistent differences in their immunohistochemical staining and expression levels compared to L&M cones for “rod” Arrestin1 (S-Antigen), “cone” Arrestin4, cone alpha transducin, and Calbindin. Our data verify a similar pattern of expression in these primate retinas and provide clues to the structural divergence of rods and S cones versus L&M cones, suggesting S cone retinal function is “intermediate” between them. PMID:24664680

  11. Reconstructing the Evolutionary History of Paralogous APETALA1/FRUITFULL-Like Genes in Grasses (Poaceae)

    PubMed Central

    Preston, Jill C.; Kellogg, Elizabeth A.

    2006-01-01

    Gene duplication is an important mechanism for the generation of evolutionary novelty. Paralogous genes that are not silenced may evolve new functions (neofunctionalization) that will alter the developmental outcome of preexisting genetic pathways, partition ancestral functions (subfunctionalization) into divergent developmental modules, or function redundantly. Functional divergence can occur by changes in the spatio-temporal patterns of gene expression and/or by changes in the activities of their protein products. We reconstructed the evolutionary history of two paralogous monocot MADS-box transcription factors, FUL1 and FUL2, and determined the evolution of sequence and gene expression in grass AP1/FUL-like genes. Monocot AP1/FUL-like genes duplicated at the base of Poaceae and codon substitutions occurred under relaxed selection mostly along the branch leading to FUL2. Following the duplication, FUL1 was apparently lost from early diverging taxa, a pattern consistent with major changes in grass floral morphology. Overlapping gene expression patterns in leaves and spikelets indicate that FUL1 and FUL2 probably share some redundant functions, but that FUL2 may have become temporally restricted under partial subfunctionalization to particular stages of floret development. These data have allowed us to reconstruct the history of AP1/FUL-like genes in Poaceae and to hypothesize a role for this gene duplication in the evolution of the grass spikelet. PMID:16816429

  12. NRIP/DCAF6 stabilizes the androgen receptor protein by displacing DDB2 from the CUL4A-DDB1 E3 ligase complex in prostate cancer.

    PubMed

    Chen, Hsin-Hsiung; Fan, Ping; Chang, Szu-Wei; Tsao, Yeou-Ping; Huang, Hsiang-Po; Chen, Show-Li

    2017-03-28

    Both nuclear receptor interaction protein (NRIP) and DNA damage binding protein 2 (DDB2) belong to the Cullin 4 (CUL4)-DDB1 binding protein family and are androgen receptor (AR)-interacting proteins. Here, we investigated the expression patterns of the NRIP, DDB2 and AR proteins in human prostate cancer tissues and found that the expression levels of NRIP and AR were higher, but the DDB2 level was lower, in prostate cancer tissues than in non-neoplastic controls, suggesting NRIP as a candidate tumor promoter and DDB2 as a tumor suppressor in prostate cancer. Furthermore, both NRIP and DDB2 shared the same AR binding domain; they were competitors for the AR, but not for DDB1 binding, in the AR-DDB2-DDB1-CUL4A complex. Conclusively, NRIP stabilizes the AR protein by displacing DDB2 from the AR-DDB2 complex. Consistent with our hypothesis, a specific expression pattern with high levels of NRIP and AR, together with a low level of DDB2, was found more frequently in the human prostate cancer tissues with a cribriform pattern than in non-cribriform tumors, suggesting that disruption of the balance between NRIP and DDB2 may change AR protein homeostasis and contribute to pathogenesis in certain aggressive types of prostate cancer.

  13. NRIP/DCAF6 stabilizes the androgen receptor protein by displacing DDB2 from the CUL4A-DDB1 E3 ligase complex in prostate cancer

    PubMed Central

    Tsao, Yeou-Ping; Huang, Hsiang-Po; Chen, Show-Li

    2017-01-01

    Both nuclear receptor interaction protein (NRIP) and DNA damage binding protein 2 (DDB2) belong to the Cullin 4 (CUL4)-DDB1 binding protein family and are androgen receptor (AR)-interacting proteins. Here, we investigated the expression patterns of the NRIP, DDB2 and AR proteins in human prostate cancer tissues and found that the expression levels of NRIP and AR were higher, but the DDB2 level was lower, in prostate cancer tissues than in non-neoplastic controls, suggesting NRIP as a candidate tumor promoter and DDB2 as a tumor suppressor in prostate cancer. Furthermore, both NRIP and DDB2 shared the same AR binding domain; they were competitors for the AR, but not for DDB1 binding, in the AR-DDB2-DDB1-CUL4A complex. Conclusively, NRIP stabilizes the AR protein by displacing DDB2 from the AR-DDB2 complex. Consistent with our hypothesis, a specific expression pattern with high levels of NRIP and AR, together with a low level of DDB2, was found more frequently in the human prostate cancer tissues with a cribriform pattern than in non-cribriform tumors, suggesting that disruption of the balance between NRIP and DDB2 may change AR protein homeostasis and contribute to pathogenesis in certain aggressive types of prostate cancer. PMID:28212551

  14. Sinonasal hemangiopericytomas: a clinicopathologic and immunohistochemical study of seven cases.

    PubMed

    Catalano, P J; Brandwein, M; Shah, D K; Urken, M L; Lawson, W; Biller, H F

    1996-01-01

    Sinonasal hemangiopericytoma (SNHPC) is a rare lesion usually of low-grade malignant potential. Aggressive and metastatic cases are uncommon, and experience using adjuvant therapy on these cases has been limited. Tumor-induced osteomalacia has a very rare association with SNHPC. Further, the diagnosis of SNHPC remains one of histologic-pattern recognition. Traditionally, immunohistochemistry has aided in excluding other diagnoses; only vimentin has been consistently expressed by the tumor spindle cells of HPC. Recent studies have shown that Factor XIIIa is also expressed by HPC, (as well as tumors of fibrohistiocytic differentiation) and hence may be yet another helpful positive marker in establishing an immunohistochemical profile. We identified 7 patients at this institution with SNHPC from 1990 to 1994. Immunohistochemistry was performed on seven formalin-fixed paraffin-embedded tumors utilizing antibodies to factor XIIIa as well as antibodies to vimentin, factor VIII, muscle-specific antigen, cytokeratin, and S-100. All 7 patients were initially seen with nasal obstruction or epistaxis and underwent surgical resection. The period of follow-up was from 3 months to 14 years (mean 54 months) for 7 patients. Three patients had recurrent disease after 3, 5, and 10 years. The first 2 were known to have been originally treated by polypectomy. One patient required adjuvant radiotherapy for metastatic disease and local extension. One patient was initially seen with tumor-induced osteomalacia which dramatically improved following resection of the lesion. The immunohistochemical profile revealed strong expression of vimentin in 7/7 cases, and of factor XIIIa in 4/7 cases; tumor cells did not express the other markers studied. Adequate surgical resection with negative margins appears to be the appropriate therapy for SNHPC. Our 1 case associated with tumor-induced osteomalacia was reversible after surgical excision of the tumor. The immunohistochemical results suggest that the pattern of vimentin and factor XIIIa positivity, as well as lack of expression of other markers, is consistent with the diagnosis of HPC, which still remains in the domain of histopathology.

  15. Gene-expression signatures can distinguish gastric cancer grades and stages.

    PubMed

    Cui, Juan; Li, Fan; Wang, Guoqing; Fang, Xuedong; Puett, J David; Xu, Ying

    2011-03-18

    Microarray gene-expression data of 54 paired gastric cancer and adjacent noncancerous gastric tissues were analyzed, with the aim to establish gene signatures for cancer grades (well-, moderately-, poorly- or un-differentiated) and stages (I, II, III and IV), which have been determined by pathologists. Our statistical analysis led to the identification of a number of gene combinations whose expression patterns serve well as signatures of different grades and different stages of gastric cancer. A 19-gene signature was found to have discerning power between high- and low-grade gastric cancers in general, with overall classification accuracy at 79.6%. An expanded 198-gene panel allows the stratification of cancers into four grades and control, giving rise to an overall classification agreement of 74.2% between each grade designated by the pathologists and our prediction. Two signatures for cancer staging, consisting of 10 genes and 9 genes, respectively, provide high classification accuracies at 90.0% and 84.0%, among early-, advanced-stage cancer and control. Functional and pathway analyses on these signature genes reveal the significant relevance of the derived signatures to cancer grades and progression. To the best of our knowledge, this represents the first study on identification of genes whose expression patterns can serve as markers for cancer grades and stages.

  16. Stochastic and epigenetic changes of gene expression in Arabidopsis polyploids.

    PubMed

    Wang, Jianlin; Tian, Lu; Madlung, Andreas; Lee, Hyeon-Se; Chen, Meng; Lee, Jinsuk J; Watson, Brian; Kagochi, Trevor; Comai, Luca; Chen, Z Jeffrey

    2004-08-01

    Polyploidization is an abrupt speciation mechanism for eukaryotes and is especially common in plants. However, little is known about patterns and mechanisms of gene regulation during early stages of polyploid formation. Here we analyzed differential expression patterns of the progenitors' genes among successive selfing generations and independent lineages. The synthetic Arabidopsis allotetraploid lines were produced by a genetic cross between A. thaliana and A. arenosa autotetraploids. We found that some progenitors' genes are differentially expressed in early generations, whereas other genes are silenced in late generations or among different siblings within a selfing generation, suggesting that the silencing of progenitors' genes is rapidly and/or stochastically established. Moreover, a subset of genes is affected in autotetraploid and multiple independent allotetraploid lines and in A. suecica, a natural allotetraploid derived from A. thaliana and A. arenosa, indicating locus-specific susceptibility to ploidy-dependent gene regulation. The role of DNA methylation in silencing progenitors' genes is tested in DNA-hypomethylation transgenic lines of A. suecica using RNA interference (RNAi). Two silenced genes are reactivated in both ddm1- and met1-RNAi lines, consistent with the demethylation of centromeric repeats and gene-specific regions in the genome. A rapid and stochastic process of differential gene expression is reinforced by epigenetic regulation during polyploid formation and evolution. Copyright 2004 Genetics Society of America

  17. Molecular Cloning, Identification, and Expression Patterns of Myostatin Gene in Water Buffalo (Bubalus Bubalis).

    PubMed

    Zhu, Peng; Li, Haiyang; Huang, Guiting; Cui, Jiayu; Zhang, Ruimen; Cui, Kuiqing; Yang, Sufang; Shi, Deshun

    2018-01-02

    Myostatin (MSTN), also named growth differentiation factor 8 (GDF8), is a transforming growth factor-β (TGF-β) family member with a key role in the negative regulation of skeletal muscle growth. However, its role in ovarian folliculogenesis remains unclear. To provide us with a basis for understanding this role, we cloned MSTN and examined its expression patterns in water buffalo (Bubalus bubalis). The complete ORF of the water buffalo MSTN gene is 1,128 nucleotides, which encode a 375 amino acid protein and sharing 99% identity at the deducted amino acid level with that of Bos taurus. Protein sequence analysis showed that MSTN is a weakly acerbic extracellular protein, consisting of signal peptides at 18-19 sites, a TGF-β propeptide, and a TGF-β domain. RT-PCR analyses demonstrated that water buffalo MSTN was expressed in multiple tissues but not limited to muscle. Immunohistochemistry staining confirmed the presence of MSTN in oocytes and granulosal cells. To our knowledge, this is the first study to confirm the expression of MSTN in the water buffalo ovary, suggesting an additional role of MSTN in water buffalo folliculogenesis, along with its role in skeletal muscle growth regulation. Further study of the regulatory mechanism of MSTN in water buffalo reproduction is warranted. MSTN, myostatin; ORF, open reading frame.

  18. Turning publicly available gene expression data into discoveries using gene set context analysis.

    PubMed

    Ji, Zhicheng; Vokes, Steven A; Dang, Chi V; Ji, Hongkai

    2016-01-08

    Gene Set Context Analysis (GSCA) is an open source software package to help researchers use massive amounts of publicly available gene expression data (PED) to make discoveries. Users can interactively visualize and explore gene and gene set activities in 25,000+ consistently normalized human and mouse gene expression samples representing diverse biological contexts (e.g. different cells, tissues and disease types, etc.). By providing one or multiple genes or gene sets as input and specifying a gene set activity pattern of interest, users can query the expression compendium to systematically identify biological contexts associated with the specified gene set activity pattern. In this way, researchers with new gene sets from their own experiments may discover previously unknown contexts of gene set functions and hence increase the value of their experiments. GSCA has a graphical user interface (GUI). The GUI makes the analysis convenient and customizable. Analysis results can be conveniently exported as publication quality figures and tables. GSCA is available at https://github.com/zji90/GSCA. This software significantly lowers the bar for biomedical investigators to use PED in their daily research for generating and screening hypotheses, which was previously difficult because of the complexity, heterogeneity and size of the data. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  19. Amphioxus and lamprey AP-2 genes: implications for neural crest evolution and migration patterns

    NASA Technical Reports Server (NTRS)

    Meulemans, Daniel; Bronner-Fraser, Marianne

    2002-01-01

    The neural crest is a uniquely vertebrate cell type present in the most basal vertebrates, but not in cephalochordates. We have studied differences in regulation of the neural crest marker AP-2 across two evolutionary transitions: invertebrate to vertebrate, and agnathan to gnathostome. Isolation and comparison of amphioxus, lamprey and axolotl AP-2 reveals its extensive expansion in the vertebrate dorsal neural tube and pharyngeal arches, implying co-option of AP-2 genes by neural crest cells early in vertebrate evolution. Expression in non-neural ectoderm is a conserved feature in amphioxus and vertebrates, suggesting an ancient role for AP-2 genes in this tissue. There is also common expression in subsets of ventrolateral neurons in the anterior neural tube, consistent with a primitive role in brain development. Comparison of AP-2 expression in axolotl and lamprey suggests an elaboration of cranial neural crest patterning in gnathostomes. However, migration of AP-2-expressing neural crest cells medial to the pharyngeal arch mesoderm appears to be a primitive feature retained in all vertebrates. Because AP-2 has essential roles in cranial neural crest differentiation and proliferation, the co-option of AP-2 by neural crest cells in the vertebrate lineage was a potentially crucial event in vertebrate evolution.

  20. Characterization of the c-type lysozyme gene family in Anopheles gambiae.

    PubMed

    Li, Bin; Calvo, Eric; Marinotti, Osvaldo; James, Anthony A; Paskewitz, Susan M

    2005-11-07

    Seven new c-type lysozyme genes were found using the Anopheles gambiae genome sequence, increasing to eight the total number of genes in this family identified in this species. The eight lysozymes in An. gambiae have considerable variation in gene structure and expression patterns. Lys c-6 has the most unusual primary amino acid structure as the predicted protein consists of five lysozyme-like domains. Transcript abundance of each c-type lysozyme was determined by semiquantitative RT-PCR. Lys c-1, c-6 and c-7 are expressed constitutively in all developmental stages from egg to adult. Lys c-2 and c-4 also are found in all stages, but with relatively much higher levels in adults. Conversely, Lys c-3 and c-8 transcripts are highest in larvae. Lys c-1, c-6 and c-7 transcripts are found in nearly all the adult tissue samples examined while Lys c-2 and Lys c-4 are more restricted in their expression. Lys c-1 and c-2 transcripts are clearly immune responsive and are increased significantly 6-12 h post challenge with bacteria. The functional adaptive changes that may have evolved during the expansion of this gene family are briefly discussed in terms of the expression patterns, gene and protein structures.

  1. Concurrent hypothalamic gene expression under acute and chronic long days: Implications for initiation and maintenance of photoperiodic response in migratory songbirds.

    PubMed

    Mishra, Ila; Bhardwaj, Sanjay K; Malik, Shalie; Kumar, Vinod

    2017-01-05

    Hypothalamic expression of the thyroid hormone (TH) responsive gonadostimulatory (eya3, cga, tshβ, dio2, dio3, gnrh, gnih) and neurosteroid pathway genes (androgen receptor [ar], aromatase [cyp19], estrogen receptor [er] α and β) was examined in photosensitive redheaded buntings exposed to 2 (acute, experiment 1) or 12 (chronic, experiment 2) long days (16L:8D). Experiment 2 also included a photorefractory group. Acute long days caused a significant increase in eya3, cga, tshβ, dio2 and gnrh and decrease in dio3 mRNA levels. eya3, cga and tshβ expressions were unchanged after the chronic long days. We also found increased cyp19, erα and erβ mRNA levels after acute, and increased cyp19 and decreased erβ levels after the chronic long-day exposure. Photorefractory buntings showed expression patterns similar to that in the photosensitive state, except for high gnrh and gnih and low dio3 mRNA levels. Consistent with gene expression patterns, there were changes in fat deposition, body mass, testis size, and plasma levels of testosterone, tri-iodothyronine and thyroxine. These results show concurrent photostimulation of the TH-signalling and neurosteroid pathways, and extend the idea, based on differences in gene expression, that transitions in seasonal photoperiodic states are accomplished at the transcriptional levels in absolute photorefractory species. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Developmental and cell-specific expression of thyroid hormone transporters in the mouse cochlea.

    PubMed

    Sharlin, David S; Visser, Theo J; Forrest, Douglas

    2011-12-01

    Thyroid hormone is essential for the development of the cochlea and auditory function. Cochlear response tissues, which express thyroid hormone receptor β (encoded by Thrb), include the greater epithelial ridge and sensory epithelium residing inside the bony labyrinth. However, these response tissues lack direct blood flow, implying that mechanisms exist to shuttle hormone from the circulation to target tissues. Therefore, we investigated expression of candidate thyroid hormone transporters L-type amino acid transporter 1 (Lat1), monocarboxylate transporter (Mct)8, Mct10, and organic anion transporting polypeptide 1c1 (Oatp1c1) in mouse cochlear development by in situ hybridization and immunofluorescence analysis. L-type amino acid transporter 1 localized to cochlear blood vessels and transiently to sensory hair cells. Mct8 localized to the greater epithelial ridge, tympanic border cells underlying the sensory epithelium, spiral ligament fibrocytes, and spiral ganglion neurons, partly overlapping with the Thrb expression pattern. Mct10 was detected in a highly restricted pattern in the outer sulcus epithelium and weakly in tympanic border cells and hair cells. Organic anion transporting polypeptide 1c1 localized primarily to fibrocytes in vascularized tissues of the spiral limbus and spiral ligament and to tympanic border cells. Investigation of hypothyroid Tshr(-/-) mice showed that transporter expression was delayed consistent with retardation of cochlear tissue maturation but not with compensatory responses to hypothyroidism. The results demonstrate specific expression of thyroid hormone transporters in the cochlea and suggest that a network of thyroid hormone transport underlies cochlear development.

  3. Regulation of DM-20 mRNA expression and intracellular translocation of glutathione-S-transferase pi isoform during oligodendrocyte differentiation in the adult rat spinal cord.

    PubMed

    Kitada, Masaaki; Takeda, Kazuya; Dezawa, Mari

    2016-07-01

    We previously demonstrated that NG2-positive oligodendrocyte precursor cells (OPCs) do not express DM-20 mRNA and identified a distinct DM-20 mRNA-positive cell population expressing glutathione-S-transferase pi isoform (GST-pi) in the nucleus (GST-pi(Nuc)) of the adult rat spinal cord. As GST-pi intranuclear localization correlates with progenitor cell properties, we examined the differentiation status of this cell population under the intensive 5-bromo-2'-deoxyuridine (BrdU) administration method, consisting of intraperitoneal BrdU injections every 2 h for 48 h. We observed that a certain population of proliferating/proliferated cells expressed DM-20 mRNA, and sometimes two proliferating/proliferated cells were observed still attached to each other. We performed triple staining for BrdU, DM-20 mRNA, and NG2 and found pairs of neighboring BrdU-positive cells, which were considered to originate from the same progenitor cells and where both cells expressed DM-20 mRNA. Triple staining for BrdU, DM-20 mRNA, and GST-pi detected proliferating/proliferated cells exhibiting the GST-pi(Nuc)/DM-20 mRNA-positive expression pattern. These findings suggested the presence of a GST-pi(Nuc)/DM-20 mRNA-positive oligodendrocyte-lineage progenitor cell population in the adult rat spinal cord. However, we did not find any pair of neighboring BrdU-positive cells with this expression pattern. These observations collectively support the idea that GST-pi(Nuc)/DM-20 mRNA-expressing cells are the progeny of NG2-positive OPCs rather than a novel type of oligodendrocyte-lineage progenitor cells and that DM-20 mRNA expression is dynamically regulated during differentiation of OPCs into oligodendrocytes.

  4. Molecular stress response in the CNS of mice after systemic exposureto interferon-alpha, ionizing radiation and ketamine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lowe, Xiu R.; Marchetti, Francesco; Lu, Xiaochen

    2009-03-03

    We previously showed that the expression of troponin T1 (Tnnt 1) was induced in the central nervous system (CNS) of adultmice 30 min after treatment with ketamine, a glutamate N-methyl-D-aspartic acid (NMDA) receptor antagonist. We hypothesized that Tnnt 1 expression may be an early molecular biomarker of stress response in the CNS of mice. To further evaluate this hypothesis, we investigated the regional expression of Tnnt 1 in the mouse brain using RNA in situ hybridization 4 h after systemic exposure to interferon-a (IFN-a) and gamma ionizing radiation, both of which have be associated with wide ranges of neuropsychiatric complications.more » Adult B6C3F1 male mice were treated with either human IFN-a (a single i.p. injection at 1 x 105 IU/kg) or whole body gamma-radiation (10 cGy or 2 Gy). Patterns of Tnnt 1 transcript expression were compared in various CNS regions after IFN-a, radiation and ketamine treatments (previous study). Tnnt 1 expression was consistently induced in pyramidal neurons of cerebral cortex and hippocampus after all treatment regimens including 10 cGy of ionizing radiation. Regional expression of Tnnt 1 was induced in Purkinje cells of cerebellum after ionizing radiation and ketamine treatment; but not after IFN-a treatment. None of the three treatments induced Tnnt 1 expression in glial cells. The patterns of Tnnt 1 expression in pyramidal neurons of cerebral cortex andhippocampus, which are both known to play important roles in cognitive function, memory and emotion, suggest that the expression of Tnnt 1 may be an early molecular biomarker of induced CNS stress.« less

  5. Evidence for distinct roles of the SEPALLATA gene LEAFY HULL STERILE1 in Eleusine indica and Megathyrsus maximus (Poaceae).

    PubMed

    Reinheimer, Renata; Malcomber, Simon T; Kellogg, Elizabeth A

    2006-01-01

    LEAFY HULL STERILE1 (LHS1) is an MIKC-type MADS-box gene in the SEPALLATA class. Expression patterns of LHS1 homologs vary among species of grasses, and may be involved in determining palea and lemma morphology, specifying the terminal floret of the spikelet, and sex determination. Here we present LHS1 expression data from Eleusine indica (subfamily Chloridoideae) and Megathyrsus maximus (subfamily Panicoideae) to provide further insights into the hypothesized roles of the gene. E. indica has spikelets with three to eight florets that mature acropetally; E. indica LHS1 (EiLHS1) is expressed in the palea and lemma of all florets. In contrast, M. maximus has spikelets with two florets that mature basipetally; M. maximus LHS1 (MmLHS1) is expressed in the palea and lemma of the distal floret only. These data are consistent with the hypothesis that LHS1 plays a role in determining palea and lemma morphology and specifies the terminal floret of basipetally maturing grass spikelets. However, LHS1 expression does not correlate with floret sex expression; MmLHS1 is restricted to the bisexual distal floret, whereas EiLHS1 is expressed in both sterile and bisexual floret meristems. Phylogenetic analyses reconstruct a complex pattern of LHS1 expression evolution in grasses. LHS1 expression within the gynoecium has apparently been lost twice, once before diversification of a major clade within tribe Paniceae, and once in subfamily Chloridoideae. These data suggest that LHS1 has multiple roles during spikelet development and may have played a role in the diversification of spikelet morphology.

  6. Anatomical and histological profiling of orphan G-protein-coupled receptor expression in gastrointestinal tract of C57BL/6J mice.

    PubMed

    Ito, Junko; Ito, Masahiko; Nambu, Hirohide; Fujikawa, Toru; Tanaka, Kenichi; Iwaasa, Hisashi; Tokita, Shigeru

    2009-11-01

    G-protein-coupled receptors (GPCRs) constitute the largest family of transmembrane receptors and regulate a variety of physiological and disease processes. Although the roles of many non-odorant GPCRs have been identified in vivo, several GPCRs remain orphans (oGPCRs). The gastrointestinal (GI) tract is the largest endocrine organ and is a promising target for drug discovery. Given their close link to physiological function, the anatomical and histological expression profiles of benchmark GI-related GPCRs, such as the cholecystokinin-1 receptor and GPR120, and 106 oGPCRs were investigated in the mucosal and muscle-myenteric nerve layers in the GI tract of C57BL/6J mice by quantitative real-time polymerase chain reaction. The mRNA expression patterns of these benchmark molecules were consistent with previous in situ hybridization and immunohistochemical studies, validating the experimental protocols in this study. Of 96 oGPCRs with significant mRNA expression in the GI tract, several oGPCRs showed unique expression patterns. GPR85, GPR37, GPR37L1, brain-specific angiogenesis inhibitor (BAI) 1, BAI2, BAI3, and GPRC5B mRNAs were preferentially expressed in the muscle-myenteric nerve layer, similar to GPCRs that are expressed in both the central and enteric nerve systems and that play multiple regulatory roles throughout the gut-brain axis. In contrast, GPR112, trace amine-associated receptor (TAAR) 1, TAAR2, and GPRC5A mRNAs were preferentially expressed in the mucosal layer, suggesting their potential roles in the regulation of secretion, immunity, and epithelial homeostasis. These anatomical and histological mRNA expression profiles of oGPCRs provide useful clues about the physiological roles of oGPCRs in the GI tract.

  7. Characterization, expression patterns and functional analysis of the MAPK and MAPKK genes in watermelon (Citrullus lanatus).

    PubMed

    Song, Qiuming; Li, Dayong; Dai, Yi; Liu, Shixia; Huang, Lei; Hong, Yongbo; Zhang, Huijuan; Song, Fengming

    2015-12-23

    Mitogen-activated protein kinase (MAPK) cascades, which consist of three functionally associated protein kinases, namely MEKKs, MKKs and MPKs, are universal signaling modules in all eukaryotes and have been shown to play critical roles in many physiological and biochemical processes in plants. However, little or nothing is known about the MPK and MKK families in watermelon. In the present study, we performed a systematic characterization of the ClMPK and ClMKK families including the identification and nomenclature, chromosomal localization, phylogenetic relationships, ClMPK-ClMKK interactions, expression patterns in different tissues and in response to abiotic and biotic stress and transient expression-based functional analysis for their roles in disease resistance. Genome-wide survey identified fifteen ClMPK and six ClMKK genes in watermelon genome and phylogenetic analysis revealed that both of the ClMPK and ClMKK families can be classified into four distinct groups. Yeast two-hybrid assays demonstrated significant interactions between members of the ClMPK and ClMKK families, defining putative ClMKK2-1/ClMKK6-ClMPK4-1/ClMPK4-2/ClMPK13 and ClMKK5-ClMPK6 cascades. Most of the members in the ClMPK and ClMKK families showed differential expression patterns in different tissues and in response to abiotic (e.g. drought, salt, cold and heat treatments) and biotic (e.g. infection of Fusarium oxysporum f. sp. niveum) stresses. Transient expression of ClMPK1, ClMPK4-2 and ClMPK7 in Nicotiana benthamiana resulted in enhanced resistance to Botrytis cinerea and upregulated expression of defense genes while transient expression of ClMPK6 and ClMKK2-2 led to increased susceptibility to B. cinerea. Furthermore, transient expression of ClMPK7 also led to hypersensitive response (HR)-like cell death and significant accumulation of H2O2 in N. benthamiana. We identified fifteen ClMPK and six ClMKK genes from watermelon and analyzed their phylogenetic relationships, expression patterns and protein-protein interactions and functions in disease resistance. Our results demonstrate that ClMPK1, ClMPK4-2 and ClMPK7 positively but ClMPK6 and ClMKK2-2 negatively regulate the resistance to B. cinerea when transiently expressed in N. benthamiana and that ClMPK7 functions as a regulator of HR-like cell death through modulating the generation of H2O2.

  8. Anterior visceral endoderm SMAD4 signaling specifies anterior embryonic patterning and head induction in mice.

    PubMed

    Li, Cuiling; Li, Yi-Ping; Fu, Xin-Yuan; Deng, Chu-Xia

    2010-09-27

    SMAD4 serves as a common mediator for signaling of TGF-β superfamily. Previous studies illustrated that SMAD4-null mice die at embryonic day 6.5 (E6.5) due to failure of mesoderm induction and extraembryonic defects; however, functions of SMAD4 in each germ layer remain elusive. To investigate this, we disrupted SMAD4 in the visceral endoderm and epiblast, respectively, using a Cre-loxP mediated approach. We showed that mutant embryos lack of SMAD4 in the visceral endoderm (Smad4(Co/Co);TTR-Cre) died at E7.5-E9.5 without head-fold and anterior embryonic structures. We demonstrated that TGF-β regulates expression of several genes, such as Hex1, Cer1, and Lim1, in the anterior visceral endoderm (AVE), and the failure of anterior embryonic development in Smad4(Co/Co);TTR-Cre embryos is accompanied by diminished expression of these genes. Consistent with this finding, SMAD4-deficient embryoid bodies showed impaired responsiveness to TGF-β-induced gene expression and morphological changes. On the other hand, embryos carrying Cre-loxP mediated disruption of SMAD4 in the epiblasts exhibited relatively normal mesoderm and head-fold induction although they all displayed profound patterning defects in the later stages of gastrulation. Cumulatively, our data indicate that SMAD4 signaling in the epiblasts is dispensable for mesoderm induction although it remains critical for head patterning, which is significantly different from SMAD4 signaling in the AVE, where it specifies anterior embryonic patterning and head induction.

  9. Anterior Visceral Endoderm SMAD4 Signaling Specifies Anterior Embryonic Patterning and Head Induction in Mice

    PubMed Central

    Li, Cuiling; Li, Yi-Ping; Fu, Xin-Yuan; Deng, Chu-Xia

    2010-01-01

    SMAD4 serves as a common mediator for signaling of TGF-β superfamily. Previous studies illustrated that SMAD4-null mice die at embryonic day 6.5 (E6.5) due to failure of mesoderm induction and extraembryonic defects; however, functions of SMAD4 in each germ layer remain elusive. To investigate this, we disrupted SMAD4 in the visceral endoderm and epiblast, respectively, using a Cre-loxP mediated approach. We showed that mutant embryos lack of SMAD4 in the visceral endoderm (Smad4Co/Co;TTR-Cre) died at E7.5-E9.5 without head-fold and anterior embryonic structures. We demonstrated that TGF-β regulates expression of several genes, such as Hex1, Cer1, and Lim1, in the anterior visceral endoderm (AVE), and the failure of anterior embryonic development in Smad4Co/Co;TTR-Cre embryos is accompanied by diminished expression of these genes. Consistent with this finding, SMAD4-deficient embryoid bodies showed impaired responsiveness to TGF-β-induced gene expression and morphological changes. On the other hand, embryos carrying Cre-loxP mediated disruption of SMAD4 in the epiblasts exhibited relatively normal mesoderm and head-fold induction although they all displayed profound patterning defects in the later stages of gastrulation. Cumulatively, our data indicate that SMAD4 signaling in the epiblasts is dispensable for mesoderm induction although it remains critical for head patterning, which is significantly different from SMAD4 signaling in the AVE, where it specifies anterior embryonic patterning and head induction. PMID:20941375

  10. Positioning of the sensor cell on the sensing area using cell trapping pattern in incubation type planar patch clamp biosensor.

    PubMed

    Wang, Zhi-Hong; Takada, Noriko; Uno, Hidetaka; Ishizuka, Toru; Yawo, Hiromu; Urisu, Tsuneo

    2012-08-01

    Positioning the sensor cell on the micropore of the sensor chip and keeping it there during incubation are problematic tasks for incubation type planar patch clamp biosensors. To solve these problems, we formed on the Si sensor chip's surface a cell trapping pattern consisting of a lattice pattern with a round area 5 μm deep and with the micropore at the center of the round area. The surface of the sensor chip was coated with extra cellular matrix collagen IV, and HEK293 cells on which a chimera molecule of channel-rhodopsin-wide-receiver (ChR-WR) was expressed, were then seeded. We examined the effects of this cell trapping pattern on the biosensor's operation. In the case of a flat sensor chip without a cell trapping pattern, it took several days before the sensor cell covered the micropore and formed an almost confluent state. As a result, multi-cell layers easily formed and made channel current measurements impossible. On the other hand, the sensor chip with cell trapping pattern easily trapped cells in the round area, and formed the colony consisted of the cell monolayer covering the micropore. A laser (473 nm wavelength) induced channel current was observed from the whole cell arrangement formed using the nystatin perforation technique. The observed channel current characteristics matched measurements made by using a pipette patch clamp. Copyright © 2012 Elsevier B.V. All rights reserved.

  11. APOL1–Mediated Cell Injury Involves Disruption of Conserved Trafficking Processes

    PubMed Central

    Kruzel-Davila, Etty; Shemer, Revital; Ofir, Ayala; Bavli-Kertselli, Ira; Darlyuk-Saadon, Ilona; Oren-Giladi, Pazit; Wasser, Walter G.; Magen, Daniella; Zaknoun, Eid; Schuldiner, Maya; Salzberg, Adi; Kornitzer, Daniel; Marelja, Zvonimir; Simons, Matias

    2017-01-01

    APOL1 harbors C–terminal sequence variants (G1 and G2), which account for much of the increased risk for kidney disease in sub–Saharan African ancestry populations. Expression of the risk variants has also been shown to cause injury to podocytes and other cell types, but the underlying mechanisms are not understood. We used Drosophila melanogaster and Saccharomyces cerevisiae to help clarify these mechanisms. Ubiquitous expression of the human APOL1 G1 and G2 disease risk alleles caused near-complete lethality in D. melanogaster, with no effect of the G0 nonrisk APOL1 allele, corresponding to the pattern of human disease risk. We also observed a congruent pattern of cellular damage with tissue-specific expression of APOL1. In particular, expression of APOL1 risk variants in D. melanogaster nephrocytes caused cell-autonomous accumulation of the endocytic tracer atrial natriuretic factor-red fluorescent protein at early stages and nephrocyte loss at later stages. We also observed differential toxicity of the APOL1 risk variants compared with the APOL1 nonrisk variants in S. cerevisiae, including impairment of vacuole acidification. Yeast strains defective in endosomal trafficking or organelle acidification but not those defective in autophagy displayed augmented APOL1 toxicity with all isoforms. This pattern of differential injury by the APOL1 risk alleles compared with the nonrisk alleles across evolutionarily divergent species is consistent with an impairment of conserved core intracellular endosomal trafficking processes. This finding should facilitate the identification of cell injury pathways and corresponding therapeutic targets of interest in these amenable experimental platforms. PMID:27864431

  12. The invasive phenotype of placenta accreta extravillous trophoblasts associates with loss of E-cadherin.

    PubMed

    Duzyj, C M; Buhimschi, I A; Motawea, H; Laky, C A; Cozzini, G; Zhao, G; Funai, E F; Buhimschi, C S

    2015-06-01

    Epithelial-to-mesenchymal transition (EMT) is a process of molecular and phenotypic epithelial cell alteration promoting invasiveness. Loss of E-cadherin (E-CAD), a transmembrane protein involved in cell adhesion, is a marker of EMT. Proteolysis into N- and C-terminus fragments by ADAM10 and presenilin-1 (PSEN-1) generates soluble (sE-CAD) and transcriptionally active forms. We studied the protein expression patterns of E-CAD in the serum and placenta of women with histologically-confirmed over-invasive placentation. The patterns of expression and levels of sE-CAD were analyzed by Western blot, immunoassay, and immunoprecipitation. Tissue immunostaining for E-CAD, cytokeratin-7 (epithelial marker), vimentin (mesenchymal marker), ADAM10, PSEN-1 and β-catenin expression were investigated in parallel. N-terminus cleaved 80 kDa sE-CAD fragments were present in serum of pregnant women with gestational age regulation of the circulatory levels. Women with advanced trophoblast invasion did not display circulatory levels of sE-CAD different from those of women with normal placentation. Histologically, extravillous trophoblasts (EVT) closer to the placental-myometrial interface demonstrated less E-CAD staining than those found deeper in the myometrium. These cells expressed both vimentin and cytokeratin, an additional feature of EMT. EVT of placentas with advanced invasion displayed intracellular E-CAD C-terminus immunoreactivity predominating over that of the extracellular N-terminus, a pattern consistent with preferential PSEN-1 processing. Local processing of E-CAD may be an important molecular mechanism controlling the invasive phenotype of accreta EVT. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Gene expression links functional networks across cortex and striatum.

    PubMed

    Anderson, Kevin M; Krienen, Fenna M; Choi, Eun Young; Reinen, Jenna M; Yeo, B T Thomas; Holmes, Avram J

    2018-04-12

    The human brain is comprised of a complex web of functional networks that link anatomically distinct regions. However, the biological mechanisms supporting network organization remain elusive, particularly across cortical and subcortical territories with vastly divergent cellular and molecular properties. Here, using human and primate brain transcriptional atlases, we demonstrate that spatial patterns of gene expression show strong correspondence with limbic and somato/motor cortico-striatal functional networks. Network-associated expression is consistent across independent human datasets and evolutionarily conserved in non-human primates. Genes preferentially expressed within the limbic network (encompassing nucleus accumbens, orbital/ventromedial prefrontal cortex, and temporal pole) relate to risk for psychiatric illness, chloride channel complexes, and markers of somatostatin neurons. Somato/motor associated genes are enriched for oligodendrocytes and markers of parvalbumin neurons. These analyses indicate that parallel cortico-striatal processing channels possess dissociable genetic signatures that recapitulate distributed functional networks, and nominate molecular mechanisms supporting cortico-striatal circuitry in health and disease.

  14. Genetic variation in melatonin pathway enzymes in children with autism spectrum disorder and comorbid sleep onset delay.

    PubMed

    Veatch, Olivia J; Pendergast, Julie S; Allen, Melissa J; Leu, Roberta M; Johnson, Carl Hirschie; Elsea, Sarah H; Malow, Beth A

    2015-01-01

    Sleep disruption is common in individuals with autism spectrum disorder (ASD). Genes whose products regulate endogenous melatonin modify sleep patterns and have been implicated in ASD. Genetic factors likely contribute to comorbid expression of sleep disorders in ASD. We studied a clinically unique ASD subgroup, consisting solely of children with comorbid expression of sleep onset delay. We evaluated variation in two melatonin pathway genes, acetylserotonin O-methyltransferase (ASMT) and cytochrome P450 1A2 (CYP1A2). We observed higher frequencies than currently reported (p < 0.04) for variants evidenced to decrease ASMT expression and related to decreased CYP1A2 enzyme activity (p ≤ 0.0007). We detected a relationship between genotypes in ASMT and CYP1A2 (r(2) = 0.63). Our results indicate that expression of sleep onset delay relates to melatonin pathway genes.

  15. Developmental Progression in the Coral Acropora digitifera Is Controlled by Differential Expression of Distinct Regulatory Gene Networks

    PubMed Central

    Reyes-Bermudez, Alejandro; Villar-Briones, Alejandro; Ramirez-Portilla, Catalina; Hidaka, Michio; Mikheyev, Alexander S.

    2016-01-01

    Corals belong to the most basal class of the Phylum Cnidaria, which is considered the sister group of bilaterian animals, and thus have become an emerging model to study the evolution of developmental mechanisms. Although cell renewal, differentiation, and maintenance of pluripotency are cellular events shared by multicellular animals, the cellular basis of these fundamental biological processes are still poorly understood. To understand how changes in gene expression regulate morphogenetic transitions at the base of the eumetazoa, we performed quantitative RNA-seq analysis during Acropora digitifera’s development. We collected embryonic, larval, and adult samples to characterize stage-specific transcription profiles, as well as broad expression patterns. Transcription profiles reconstructed development revealing two main expression clusters. The first cluster grouped blastula and gastrula and the second grouped subsequent developmental time points. Consistently, we observed clear differences in gene expression between early and late developmental transitions, with higher numbers of differentially expressed genes and fold changes around gastrulation. Furthermore, we identified three coexpression clusters that represented discrete gene expression patterns. During early transitions, transcriptional networks seemed to regulate cellular fate and morphogenesis of the larval body. In late transitions, these networks seemed to play important roles preparing planulae for switch in lifestyle and regulation of adult processes. Although developmental progression in A. digitifera is regulated to some extent by differential coexpression of well-defined gene networks, stage-specific transcription profiles appear to be independent entities. While negative regulation of transcription is predominant in early development, cell differentiation was upregulated in larval and adult stages. PMID:26941230

  16. EGR-1 Expression in Catecholamine-synthesizing Neurons Reflects Auditory Learning and Correlates with Responses in Auditory Processing Areas.

    PubMed

    Dai, Jennifer B; Chen, Yining; Sakata, Jon T

    2018-05-21

    Distinguishing between familiar and unfamiliar individuals is an important task that shapes the expression of social behavior. As such, identifying the neural populations involved in processing and learning the sensory attributes of individuals is important for understanding mechanisms of behavior. Catecholamine-synthesizing neurons have been implicated in sensory processing, but relatively little is known about their contribution to auditory learning and processing across various vertebrate taxa. Here we investigated the extent to which immediate early gene expression in catecholaminergic circuitry reflects information about the familiarity of social signals and predicts immediate early gene expression in sensory processing areas in songbirds. We found that male zebra finches readily learned to differentiate between familiar and unfamiliar acoustic signals ('songs') and that playback of familiar songs led to fewer catecholaminergic neurons in the locus coeruleus (but not in the ventral tegmental area, substantia nigra, or periaqueductal gray) expressing the immediate early gene, EGR-1, than playback of unfamiliar songs. The pattern of EGR-1 expression in the locus coeruleus was similar to that observed in two auditory processing areas implicated in auditory learning and memory, namely the caudomedial nidopallium (NCM) and the caudal medial mesopallium (CMM), suggesting a contribution of catecholamines to sensory processing. Consistent with this, the pattern of catecholaminergic innervation onto auditory neurons co-varied with the degree to which song playback affected the relative intensity of EGR-1 expression. Together, our data support the contention that catecholamines like norepinephrine contribute to social recognition and the processing of social information. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

  17. Multivariate Pattern Classification of Facial Expressions Based on Large-Scale Functional Connectivity.

    PubMed

    Liang, Yin; Liu, Baolin; Li, Xianglin; Wang, Peiyuan

    2018-01-01

    It is an important question how human beings achieve efficient recognition of others' facial expressions in cognitive neuroscience, and it has been identified that specific cortical regions show preferential activation to facial expressions in previous studies. However, the potential contributions of the connectivity patterns in the processing of facial expressions remained unclear. The present functional magnetic resonance imaging (fMRI) study explored whether facial expressions could be decoded from the functional connectivity (FC) patterns using multivariate pattern analysis combined with machine learning algorithms (fcMVPA). We employed a block design experiment and collected neural activities while participants viewed facial expressions of six basic emotions (anger, disgust, fear, joy, sadness, and surprise). Both static and dynamic expression stimuli were included in our study. A behavioral experiment after scanning confirmed the validity of the facial stimuli presented during the fMRI experiment with classification accuracies and emotional intensities. We obtained whole-brain FC patterns for each facial expression and found that both static and dynamic facial expressions could be successfully decoded from the FC patterns. Moreover, we identified the expression-discriminative networks for the static and dynamic facial expressions, which span beyond the conventional face-selective areas. Overall, these results reveal that large-scale FC patterns may also contain rich expression information to accurately decode facial expressions, suggesting a novel mechanism, which includes general interactions between distributed brain regions, and that contributes to the human facial expression recognition.

  18. Multivariate Pattern Classification of Facial Expressions Based on Large-Scale Functional Connectivity

    PubMed Central

    Liang, Yin; Liu, Baolin; Li, Xianglin; Wang, Peiyuan

    2018-01-01

    It is an important question how human beings achieve efficient recognition of others’ facial expressions in cognitive neuroscience, and it has been identified that specific cortical regions show preferential activation to facial expressions in previous studies. However, the potential contributions of the connectivity patterns in the processing of facial expressions remained unclear. The present functional magnetic resonance imaging (fMRI) study explored whether facial expressions could be decoded from the functional connectivity (FC) patterns using multivariate pattern analysis combined with machine learning algorithms (fcMVPA). We employed a block design experiment and collected neural activities while participants viewed facial expressions of six basic emotions (anger, disgust, fear, joy, sadness, and surprise). Both static and dynamic expression stimuli were included in our study. A behavioral experiment after scanning confirmed the validity of the facial stimuli presented during the fMRI experiment with classification accuracies and emotional intensities. We obtained whole-brain FC patterns for each facial expression and found that both static and dynamic facial expressions could be successfully decoded from the FC patterns. Moreover, we identified the expression-discriminative networks for the static and dynamic facial expressions, which span beyond the conventional face-selective areas. Overall, these results reveal that large-scale FC patterns may also contain rich expression information to accurately decode facial expressions, suggesting a novel mechanism, which includes general interactions between distributed brain regions, and that contributes to the human facial expression recognition. PMID:29615882

  19. An optimized ERP brain-computer interface based on facial expression changes.

    PubMed

    Jin, Jing; Daly, Ian; Zhang, Yu; Wang, Xingyu; Cichocki, Andrzej

    2014-06-01

    Interferences from spatially adjacent non-target stimuli are known to evoke event-related potentials (ERPs) during non-target flashes and, therefore, lead to false positives. This phenomenon was commonly seen in visual attention-based brain-computer interfaces (BCIs) using conspicuous stimuli and is known to adversely affect the performance of BCI systems. Although users try to focus on the target stimulus, they cannot help but be affected by conspicuous changes of the stimuli (such as flashes or presenting images) which were adjacent to the target stimulus. Furthermore, subjects have reported that conspicuous stimuli made them tired and annoyed. In view of this, the aim of this study was to reduce adjacent interference, annoyance and fatigue using a new stimulus presentation pattern based upon facial expression changes. Our goal was not to design a new pattern which could evoke larger ERPs than the face pattern, but to design a new pattern which could reduce adjacent interference, annoyance and fatigue, and evoke ERPs as good as those observed during the face pattern. Positive facial expressions could be changed to negative facial expressions by minor changes to the original facial image. Although the changes are minor, the contrast is big enough to evoke strong ERPs. In this paper, a facial expression change pattern between positive and negative facial expressions was used to attempt to minimize interference effects. This was compared against two different conditions, a shuffled pattern containing the same shapes and colours as the facial expression change pattern, but without the semantic content associated with a change in expression, and a face versus no face pattern. Comparisons were made in terms of classification accuracy and information transfer rate as well as user supplied subjective measures. The results showed that interferences from adjacent stimuli, annoyance and the fatigue experienced by the subjects could be reduced significantly (p < 0.05) by using the facial expression change patterns in comparison with the face pattern. The offline results show that the classification accuracy of the facial expression change pattern was significantly better than that of the shuffled pattern (p < 0.05) and the face pattern (p < 0.05). The facial expression change pattern presented in this paper reduced interference from adjacent stimuli and decreased the fatigue and annoyance experienced by BCI users significantly (p < 0.05) compared to the face pattern.

  20. An optimized ERP brain-computer interface based on facial expression changes

    NASA Astrophysics Data System (ADS)

    Jin, Jing; Daly, Ian; Zhang, Yu; Wang, Xingyu; Cichocki, Andrzej

    2014-06-01

    Objective. Interferences from spatially adjacent non-target stimuli are known to evoke event-related potentials (ERPs) during non-target flashes and, therefore, lead to false positives. This phenomenon was commonly seen in visual attention-based brain-computer interfaces (BCIs) using conspicuous stimuli and is known to adversely affect the performance of BCI systems. Although users try to focus on the target stimulus, they cannot help but be affected by conspicuous changes of the stimuli (such as flashes or presenting images) which were adjacent to the target stimulus. Furthermore, subjects have reported that conspicuous stimuli made them tired and annoyed. In view of this, the aim of this study was to reduce adjacent interference, annoyance and fatigue using a new stimulus presentation pattern based upon facial expression changes. Our goal was not to design a new pattern which could evoke larger ERPs than the face pattern, but to design a new pattern which could reduce adjacent interference, annoyance and fatigue, and evoke ERPs as good as those observed during the face pattern. Approach. Positive facial expressions could be changed to negative facial expressions by minor changes to the original facial image. Although the changes are minor, the contrast is big enough to evoke strong ERPs. In this paper, a facial expression change pattern between positive and negative facial expressions was used to attempt to minimize interference effects. This was compared against two different conditions, a shuffled pattern containing the same shapes and colours as the facial expression change pattern, but without the semantic content associated with a change in expression, and a face versus no face pattern. Comparisons were made in terms of classification accuracy and information transfer rate as well as user supplied subjective measures. Main results. The results showed that interferences from adjacent stimuli, annoyance and the fatigue experienced by the subjects could be reduced significantly (p < 0.05) by using the facial expression change patterns in comparison with the face pattern. The offline results show that the classification accuracy of the facial expression change pattern was significantly better than that of the shuffled pattern (p < 0.05) and the face pattern (p < 0.05). Significance. The facial expression change pattern presented in this paper reduced interference from adjacent stimuli and decreased the fatigue and annoyance experienced by BCI users significantly (p < 0.05) compared to the face pattern.

  1. Extraordinary diversity of visual opsin genes in dragonflies

    PubMed Central

    Futahashi, Ryo; Kawahara-Miki, Ryouka; Kinoshita, Michiyo; Yoshitake, Kazutoshi; Yajima, Shunsuke; Arikawa, Kentaro; Fukatsu, Takema

    2015-01-01

    Dragonflies are colorful and large-eyed animals strongly dependent on color vision. Here we report an extraordinary large number of opsin genes in dragonflies and their characteristic spatiotemporal expression patterns. Exhaustive transcriptomic and genomic surveys of three dragonflies of the family Libellulidae consistently identified 20 opsin genes, consisting of 4 nonvisual opsin genes and 16 visual opsin genes of 1 UV, 5 short-wavelength (SW), and 10 long-wavelength (LW) type. Comprehensive transcriptomic survey of the other dragonflies representing an additional 10 families also identified as many as 15–33 opsin genes. Molecular phylogenetic analysis revealed dynamic multiplications and losses of the opsin genes in the course of evolution. In contrast to many SW and LW genes expressed in adults, only one SW gene and several LW genes were expressed in larvae, reflecting less visual dependence and LW-skewed light conditions for their lifestyle under water. In this context, notably, the sand-burrowing or pit-dwelling species tended to lack SW gene expression in larvae. In adult visual organs: (i) many SW genes and a few LW genes were expressed in the dorsal region of compound eyes, presumably for processing SW-skewed light from the sky; (ii) a few SW genes and many LW genes were expressed in the ventral region of compound eyes, probably for perceiving terrestrial objects; and (iii) expression of a specific LW gene was associated with ocelli. Our findings suggest that the stage- and region-specific expressions of the diverse opsin genes underlie the behavior, ecology, and adaptation of dragonflies. PMID:25713365

  2. Detection of Nuclear Weapons and Materials: Science, Technologies, Observations

    DTIC Science & Technology

    2010-06-04

    extensive use of photons, packets of energy with no rest mass and no electrical charge. Electromagnetic radiation consists of photons, and may be measured...bulk property, expressed as mass per unit volume. In general, the densest materials are those of high Z. These properties may be used to detect...SNM by detecting the time pattern of neutron generation. A subcritical mass of highly enriched uranium or weapons-grade plutonium can support a

  3. Transcriptome analysis of the painted lady butterfly, Vanessa cardui during wing color pattern development.

    PubMed

    Connahs, Heidi; Rhen, Turk; Simmons, Rebecca B

    2016-03-31

    Butterfly wing color patterns are an important model system for understanding the evolution and development of morphological diversity and animal pigmentation. Wing color patterns develop from a complex network composed of highly conserved patterning genes and pigmentation pathways. Patterning genes are involved in regulating pigment synthesis however the temporal expression dynamics of these interacting networks is poorly understood. Here, we employ next generation sequencing to examine expression patterns of the gene network underlying wing development in the nymphalid butterfly, Vanessa cardui. We identified 9, 376 differentially expressed transcripts during wing color pattern development, including genes involved in patterning, pigmentation and gene regulation. Differential expression of these genes was highest at the pre-ommochrome stage compared to early pupal and late melanin stages. Overall, an increasing number of genes were down-regulated during the progression of wing development. We observed dynamic expression patterns of a large number of pigment genes from the ommochrome, melanin and also pteridine pathways, including contrasting patterns of expression for paralogs of the yellow gene family. Surprisingly, many patterning genes previously associated with butterfly pattern elements were not significantly up-regulated at any time during pupation, although many other transcription factors were differentially expressed. Several genes involved in Notch signaling were significantly up-regulated during the pre-ommochrome stage including slow border cells, bunched and pebbles; the function of these genes in the development of butterfly wings is currently unknown. Many genes involved in ecdysone signaling were also significantly up-regulated during early pupal and late melanin stages and exhibited opposing patterns of expression relative to the ecdysone receptor. Finally, a comparison across four butterfly transcriptomes revealed 28 transcripts common to all four species that have no known homologs in other metazoans. This study provides a comprehensive list of differentially expressed transcripts during wing development, revealing potential candidate genes that may be involved in regulating butterfly wing patterns. Some differentially expressed genes have no known homologs possibly representing genes unique to butterflies. Results from this study also indicate that development of nymphalid wing patterns may arise not only from melanin and ommochrome pigments but also the pteridine pigment pathway.

  4. Spoiled child syndrome.

    PubMed

    McIntosh, B J

    1989-01-01

    People often speak of children as being "spoiled" and many parents worry about the possibility of spoiling their infants and children. Many pediatricians, however, are uncomfortable with this term because it is a poorly defined and derogatory expression. Some would even deny that infants and children can be spoiled. Avoiding the use of the expression spoiled can create difficulties in communicating with parents concerned about their children's behavior. In this article, the spoiled child syndrome will be defined and those patterns of behavior that characterize it will be distinguished from other patterns of difficult behavior which may be confused with it. The spoiled child syndrome is characterized by excessive self-centered and immature behavior, resulting from the failure of parents to enforce consistent, age-appropriate limits. Many of the problem behaviors that cause parental concern are unrelated to spoiling as properly understood. Such behaviors are often age-related normal behaviors, reactions to family stresses, or patterns of behavior determined by factors inherent in the child. Pediatricians can provide counseling and reassurance for such behaviors and, by helping parents understand the etiology of true spoiling, can encourage the use of behavior modification techniques for its prevention and treatment.

  5. Precision matters for position decoding in the early fly embryo

    NASA Astrophysics Data System (ADS)

    Petkova, Mariela D.; Tkacik, Gasper; Wieschaus, Eric F.; Bialek, William; Gregor, Thomas

    Genetic networks can determine cell fates in multicellular organisms with precision that often reaches the physical limits of the system. However, it is unclear how the organism uses this precision and whether it has biological content. Here we address this question in the developing fly embryo, in which a genetic network of patterning genes reaches 1% precision in positioning cells along the embryo axis. The network consists of three interconnected layers: an input layer of maternal gradients, a processing layer of gap genes, and an output layer of pair-rule genes with seven-striped patterns. From measurements of gap gene protein expression in hundreds of wild-type embryos we construct a ``decoder'', which is a look-up table that determines cellular positions from the concentration means, variances and co-variances. When we apply the decoder to measurements in mutant embryos lacking various combinations of the maternal inputs, we predict quantitative changes in the output layer such as missing, altered or displaced stripes. We confirm these predictions by measuring pair-rule expression in the mutant embryos. Our results thereby show that the precision of the patterning network is biologically meaningful and a necessary feature for decoding cell positions in the early fly embryo.

  6. A comparative view of early development in the corals Favia lizardensis, Ctenactis echinata, and Acropora millepora - morphology, transcriptome, and developmental gene expression.

    PubMed

    Okubo, Nami; Hayward, David C; Forêt, Sylvain; Ball, Eldon E

    2016-02-29

    Research into various aspects of coral biology has greatly increased in recent years due to anthropogenic threats to coral health including pollution, ocean warming and acidification. However, knowledge of coral early development has lagged. The present paper describes the embryonic development of two previously uncharacterized robust corals, Favia lizardensis (a massive brain coral) and Ctenactis echinata (a solitary coral) and compares it to that of the previously characterized complex coral, Acropora millepora, both morphologically and in terms of the expression of a set of key developmental genes. Illumina sequencing of mixed age embryos was carried out, resulting in embryonic transcriptomes consisting of 40605 contigs for C.echinata (N50 = 1080 bp) and 48536 contigs for F.lizardensis (N50 = 1496 bp). The transcriptomes have been annotated against Swiss-Prot and were sufficiently complete to enable the identification of orthologs of many key genes controlling development in bilaterians. Developmental series of images of whole mounts and sections reveal that the early stages of both species contain a blastocoel, consistent with their membership of the robust clade. In situ hybridization was used to examine the expression of the developmentally important genes brachyury, chordin and forkhead. The expression of brachyury and forkhead was consistent with that previously reported for Acropora and allowed us to confirm that the pseudo-blastopore sometimes seen in robust corals such as Favia spp. is not directly associated with gastrulation. C.echinata chordin expression, however, differed from that seen in the other two corals. Embryonic transcriptomes were assembled for the brain coral Favia lizardensis and the solitary coral Ctenactis echinata. Both species have a blastocoel in their early developmental stages, consistent with their phylogenetic position as members of the robust clade. Expression of the key developmental genes brachyury, chordin and forkhead was investigated, allowing comparison to that of their orthologs in Acropora, Nematostella and bilaterians and demonstrating that even within the Anthozoa there are significant differences in expression patterns.

  7. Cultural differences in gaze and emotion recognition: Americans contrast more than Chinese.

    PubMed

    Stanley, Jennifer Tehan; Zhang, Xin; Fung, Helene H; Isaacowitz, Derek M

    2013-02-01

    We investigated the influence of contextual expressions on emotion recognition accuracy and gaze patterns among American and Chinese participants. We expected Chinese participants would be more influenced by, and attend more to, contextual information than Americans. Consistent with our hypothesis, Americans were more accurate than Chinese participants at recognizing emotions embedded in the context of other emotional expressions. Eye-tracking data suggest that, for some emotions, Americans attended more to the target faces, and they made more gaze transitions to the target face than Chinese. For all emotions except anger and disgust, Americans appeared to use more of a contrasting strategy where each face was individually contrasted with the target face, compared with Chinese who used less of a contrasting strategy. Both cultures were influenced by contextual information, although the benefit of contextual information depended upon the perceptual dissimilarity of the contextual emotions to the target emotion and the gaze pattern employed during the recognition task. PsycINFO Database Record (c) 2013 APA, all rights reserved.

  8. Cultural Differences in Gaze and Emotion Recognition: Americans Contrast More than Chinese

    PubMed Central

    Tehan Stanley, Jennifer; Zhang, Xin; Fung, Helene H.; Isaacowitz, Derek M.

    2014-01-01

    We investigated the influence of contextual expressions on emotion recognition accuracy and gaze patterns among American and Chinese participants. We expected Chinese participants would be more influenced by, and attend more to, contextual information than Americans. Consistent with our hypothesis, Americans were more accurate than Chinese participants at recognizing emotions embedded in the context of other emotional expressions. Eye tracking data suggest that, for some emotions, Americans attended more to the target faces and made more gaze transitions to the target face than Chinese. For all emotions except anger and disgust, Americans appeared to use more of a contrasting strategy where each face was individually contrasted with the target face, compared with Chinese who used less of a contrasting strategy. Both cultures were influenced by contextual information, although the benefit of contextual information depended upon the perceptual dissimilarity of the contextual emotions to the target emotion and the gaze pattern employed during the recognition task. PMID:22889414

  9. Developmental disorders of the hypothalamus and pituitary gland associated with congenital hypopituitarism.

    PubMed

    Mehta, Ameeta; Dattani, Mehul T

    2008-02-01

    The pituitary gland is a complex organ secreting six hormones from five different cell types. It is the end product of a carefully orchestrated pattern of expression of signalling molecules and transcription factors. Naturally occurring and transgenic murine models have demonstrated a role for many of these molecules in the aetiology of congenital hypopituitarism. These include the transcription factors HESX1, PROP1, POU1F1, LHX3, LHX4, PITX1, PITX2, SOX2 and SOX3. The expression pattern of these transcription factors dictates the phenotype that results when the gene encoding the relevant transcription factor is mutated. The highly variable phenotype may consist of isolated hypopituitarism or more complex disorders such as septo-optic dysplasia and holoprosencephaly. However, the overall incidence of mutations in known transcription factors in patients with hypopituitarism is low, indicating that many genes remain to be identified; characterization of these will further elucidate the pathogenesis of this complex condition and also shed light on normal pituitary development and function.

  10. Differences in osmotolerance in freshwater and brackish water populations of Theodoxus fluviatilis (Gastropoda: Neritidae) are associated with differential protein expression.

    PubMed

    Symanowski, Frauke; Hildebrandt, Jan-Peter

    2010-03-01

    The euryhaline gastropod Theodoxus fluviatilis is found in northern Germany in freshwater or in brackish water habitats in the Baltic Sea. Previous studies have revealed that individuals from both habitats are not distinguishable by morphological characters or by sequence comparison of DNA encoding 16S RNA or cytochrome C. As reported in this study, animals collected in the two habitats differ substantially in their physiological ability to adapt to different salinities. Comparison of accumulation rates of ninhydrin-positive substances (NPS) in foot muscle upon transfer of animals to higher medium salinities revealed that brackish water animals were perfectly able to mobilize NPS, while freshwater animals had only limited ability to do so. In an attempt to explore whether this difference in physiology may be caused by genetic differentiation, we compared protein expression patterns of soluble foot muscle proteins using 2D gel electrophoresis and silver staining. Of the 40 consistently detected protein spots, 27 showed similar levels in protein expression in animals collected from freshwater or brackish water habitats, respectively. In 12 spots, however, protein concentration was higher in brackish water than in freshwater animals. In four of these spots, expression levels followed increases or decreases in medium salinities. In a different set of 4 of these 12 spots, protein levels were always higher in brackish water as compared to freshwater animals, regardless of their physiological situation (14 days in artificial pond water or in medium with a salinity of 16 per thousand). The remaining 4 of the 12 spots had complex expression patterns. Protein levels of the remaining single spot were generally higher in freshwater animals than in brackish water animals. These expression patterns may indicate that freshwater and brackish water animals of T. fluviatilis belong to different locally adapted populations with subtle genetic differentiation.

  11. Keratin pattern of acanthosis nigricans in syndromelike association with polythelia, polycystic kidneys, and syndactyly.

    PubMed

    Bonnekoh, B; Wevers, A; Spangenberger, H; Mahrle, G; Krieg, T

    1993-09-01

    Acanthosis nigricans (AN) comprises a broad spectrum of etiologic subtypes. The underlying pathomechanisms have not yet been completely clarified. We present a patient affected with a syndromelike AN subtype including disturbed epidermopoiesis as evidenced by immunohistologic findings and in situ hybridization. A 54-year-old white man contracted AN during childhood. There were connate malformations consisting of webbed toes II/III on the right side and a supernumerary left mammilla. As an adult he developed psoriasis vulgaris, obesity, and latent diabetes mellitus, polycystic kidney and liver disease. With regard to keratin 6 mRNA, and the protein expression of keratin 6/16, KI-67, and proliferating cell nuclear antigen, the AN lesion showed moderate hyperproliferation. A much higher degree of hyperproliferation was evident in psoriatic areas of the patient's skin. In contrast to psoriatic tissue, basal keratinocytes of the AN showed an unusually high expression of keratin 18 and 19 protein. The observation thus deals with a unique, syndromelike constellation of AN characterized by a particular epidermal pattern of moderate hyperproliferation. A further dysregulation of protein expression in the epidermis is indicated by the demonstration of the rare keratins 18 and 19 in basal keratinocytes of the AN lesion.

  12. Protein Poly(ADP-ribosyl)ation Regulates Arabidopsis Immune Gene Expression and Defense Responses

    PubMed Central

    Feng, Baomin; Liu, Chenglong; de Oliveira, Marcos V. V.; Intorne, Aline C.; Li, Bo; Babilonia, Kevin; de Souza Filho, Gonçalo A.; Shan, Libo; He, Ping

    2015-01-01

    Perception of microbe-associated molecular patterns (MAMPs) elicits transcriptional reprogramming in hosts and activates defense to pathogen attacks. The molecular mechanisms underlying plant pattern-triggered immunity remain elusive. A genetic screen identified Arabidopsis poly(ADP-ribose) glycohydrolase 1 (atparg1) mutant with elevated immune gene expression upon multiple MAMP and pathogen treatments. Poly(ADP-ribose) glycohydrolase (PARG) is predicted to remove poly(ADP-ribose) polymers on acceptor proteins modified by poly(ADP-ribose) polymerases (PARPs) with three PARPs and two PARGs in Arabidopsis genome. AtPARP1 and AtPARP2 possess poly(ADP-ribose) polymerase activity, and the activity of AtPARP2 was enhanced by MAMP treatment. AtPARG1, but not AtPARG2, carries glycohydrolase activity in vivo and in vitro. Importantly, mutation (G450R) in atparg1 blocks its activity and the corresponding residue is highly conserved and essential for human HsPARG activity. Consistently, mutant atparp1atparp2 plants exhibited compromised immune gene activation and enhanced susceptibility to pathogen infections. Our study indicates that protein poly(ADP-ribosyl)ation plays critical roles in plant immune gene expression and defense to pathogen attacks. PMID:25569773

  13. Characterization of Betula platyphylla gene transcripts associated with early development of male inflorescence.

    PubMed

    Xing, Lei; Liu, Xue-Mei

    2012-02-01

    Birch (Betula platyphylla), an eminent tree species in Northeast and Inner Mongolia of China, has been widely used in architecture, furniture, and paper making in recent years. In order to retrieve genes involved in early development of B. platyphylla male inflorescence, RNA populations extracted from early and late developmental stage were analyzed by cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) technique. Following amplification of 256 pairs of primer combinations, ~7000 fragments were generated, of which 350 transcripts expressing more in early stage than late. Of 350 specific transcripts, 198 clear and reproducible electrophoresis bands were retrieved and sequenced successfully, 74 of them (37%) showing significant homologies to known genes after GO annotation. Majority of the predicted gene products were involved in metabolism (24.56%), cellular process (27.19%), response to stimulus (11.4%) and cell growth (8.7%). Transcripts ME56, ME108, ME206 and ME310, representing metabolism, cellular process, response to stimulus and cell growth, respectively, were selected for further study to validate cDNA-AFLP expression patterns via RT-PCR and qRT-PCR analysis. RT-PCR and qRT-PCR expression pattern results were consistent with cDNA-AFLP analysis results.

  14. Pattern activation/recognition theory of mind

    PubMed Central

    du Castel, Bertrand

    2015-01-01

    In his 2012 book How to Create a Mind, Ray Kurzweil defines a “Pattern Recognition Theory of Mind” that states that the brain uses millions of pattern recognizers, plus modules to check, organize, and augment them. In this article, I further the theory to go beyond pattern recognition and include also pattern activation, thus encompassing both sensory and motor functions. In addition, I treat checking, organizing, and augmentation as patterns of patterns instead of separate modules, therefore handling them the same as patterns in general. Henceforth I put forward a unified theory I call “Pattern Activation/Recognition Theory of Mind.” While the original theory was based on hierarchical hidden Markov models, this evolution is based on their precursor: stochastic grammars. I demonstrate that a class of self-describing stochastic grammars allows for unifying pattern activation, recognition, organization, consistency checking, metaphor, and learning, into a single theory that expresses patterns throughout. I have implemented the model as a probabilistic programming language specialized in activation/recognition grammatical and neural operations. I use this prototype to compute and present diagrams for each stochastic grammar and corresponding neural circuit. I then discuss the theory as it relates to artificial network developments, common coding, neural reuse, and unity of mind, concluding by proposing potential paths to validation. PMID:26236228

  15. Pattern activation/recognition theory of mind.

    PubMed

    du Castel, Bertrand

    2015-01-01

    In his 2012 book How to Create a Mind, Ray Kurzweil defines a "Pattern Recognition Theory of Mind" that states that the brain uses millions of pattern recognizers, plus modules to check, organize, and augment them. In this article, I further the theory to go beyond pattern recognition and include also pattern activation, thus encompassing both sensory and motor functions. In addition, I treat checking, organizing, and augmentation as patterns of patterns instead of separate modules, therefore handling them the same as patterns in general. Henceforth I put forward a unified theory I call "Pattern Activation/Recognition Theory of Mind." While the original theory was based on hierarchical hidden Markov models, this evolution is based on their precursor: stochastic grammars. I demonstrate that a class of self-describing stochastic grammars allows for unifying pattern activation, recognition, organization, consistency checking, metaphor, and learning, into a single theory that expresses patterns throughout. I have implemented the model as a probabilistic programming language specialized in activation/recognition grammatical and neural operations. I use this prototype to compute and present diagrams for each stochastic grammar and corresponding neural circuit. I then discuss the theory as it relates to artificial network developments, common coding, neural reuse, and unity of mind, concluding by proposing potential paths to validation.

  16. AFLP-based transcript profiling for cassava genome-wide expression analysis in the onset of storage root formation.

    PubMed

    Sojikul, Punchapat; Kongsawadworakul, Panida; Viboonjun, Unchera; Thaiprasit, Jittrawan; Intawong, Burapat; Narangajavana, Jarunya; Svasti, Mom Rajawong Jisnuson

    2010-10-01

    Cassava (Manihot esculenta Crantz) is a root crop that accumulates large quantities of starch, and it is an important source of carbohydrate. Study on gene expressions during storage root development provides important information on storage root formation and starch accumulation as well as unlock new traits for improving of starch yield. cDNA-Amplified Fragment Length Polymorphism (AFLP) was used to compare gene expression profiles in fibrous and storage roots of cassava cultivar Kasetsart 50. Total of 155 differentially expressed transcript-derived fragments with undetectable or low expression in leaves were characterized and classified into 11 groups regarding to their functions. The four major groups were no similarity (20%), hypothetical or unknown proteins (17%), cellular metabolism and biosynthesis (17%) and cellular communication and signaling (14%). Interestingly, sulfite reductase (MeKD82), calcium-dependent protein kinase (CDPK) (MeKD83), ent-kaurene synthase (KS) (MeKD106) and hexose transporter (HT) (MeKD154) showed root-specific expression patterns. This finding is consistent with previously reported genes involved in the initiation of potato tuber. Semi-quantitative reverse transcription polymerase chain reaction of early-developed root samples confirmed that those four genes exhibited significant expression with similar pattern in the storage root initiation and early developmental stages. We proposed that KS and HT may involve in transient induction of CDPK expression, which may play an important role in the signaling pathway of storage root initiation. Sulfite reductase, on the other hand, may involve in storage root development by facilitating sulfur-containing protein biosynthesis or detoxifying the cyanogenic glucoside content through aspartate biosynthesis. Copyright © Physiologia Plantarum 2010.

  17. Differential Gene Expression at Coral Settlement and Metamorphosis - A Subtractive Hybridization Study

    PubMed Central

    Hayward, David C.; Hetherington, Suzannah; Behm, Carolyn A.; Grasso, Lauretta C.; Forêt, Sylvain; Miller, David J.; Ball, Eldon E.

    2011-01-01

    Background A successful metamorphosis from a planktonic larva to a settled polyp, which under favorable conditions will establish a future colony, is critical for the survival of corals. However, in contrast to the situation in other animals, e.g., frogs and insects, little is known about the molecular basis of coral metamorphosis. We have begun to redress this situation with previous microarray studies, but there is still a great deal to learn. In the present paper we have utilized a different technology, subtractive hybridization, to characterize genes differentially expressed across this developmental transition and to compare the success of this method to microarray. Methodology/Principal Findings Suppressive subtractive hybridization (SSH) was used to identify two pools of transcripts from the coral, Acropora millepora. One is enriched for transcripts expressed at higher levels at the pre-settlement stage, and the other for transcripts expressed at higher levels at the post-settlement stage. Virtual northern blots were used to demonstrate the efficacy of the subtractive hybridization technique. Both pools contain transcripts coding for proteins in various functional classes but transcriptional regulatory proteins were represented more frequently in the post-settlement pool. Approximately 18% of the transcripts showed no significant similarity to any other sequence on the public databases. Transcripts of particular interest were further characterized by in situ hybridization, which showed that many are regulated spatially as well as temporally. Notably, many transcripts exhibit axially restricted expression patterns that correlate with the pool from which they were isolated. Several transcripts are expressed in patterns consistent with a role in calcification. Conclusions We have characterized over 200 transcripts that are differentially expressed between the planula larva and post-settlement polyp of the coral, Acropora millepora. Sequence, putative function, and in some cases temporal and spatial expression are reported. PMID:22065994

  18. Mapping heterogeneity in patient-derived melanoma cultures by single-cell RNA-seq

    PubMed Central

    Loeffler-Wirth, Henry; Hopp, Lydia; Schadendorf, Dirk; Schartl, Manfred; Anderegg, Ulf; Camp, Gray; Treutlein, Barbara; Binder, Hans; Kunz, Manfred

    2017-01-01

    Recent technological advances in single-cell genomics make it possible to analyze cellular heterogeneity of tumor samples. Here, we applied single-cell RNA-seq to measure the transcriptomes of 307 single cells cultured from three biopsies of three different patients with a BRAF/NRAS wild type, BRAF mutant/NRAS wild type and BRAF wild type/NRAS mutant melanoma metastasis, respectively. Analysis based on self-organizing maps identified sub-populations defined by multiple gene expression modules involved in proliferation, oxidative phosphorylation, pigmentation and cellular stroma. Gene expression modules had prognostic relevance when compared with gene expression data from published melanoma samples and patient survival data. We surveyed kinome expression patterns across sub-populations of the BRAF/NRAS wild type sample and found that CDK4 and CDK2 were consistently highly expressed in the majority of cells, suggesting that these kinases might be involved in melanoma progression. Treatment of cells with the CDK4 inhibitor palbociclib restricted cell proliferation to a similar, and in some cases greater, extent than MAPK inhibitors. Finally, we identified a low abundant sub-population in this sample that highly expressed a module containing ABC transporter ABCB5, surface markers CD271 and CD133, and multiple aldehyde dehydrogenases (ALDHs). Patient-derived cultures of the BRAF mutant/NRAS wild type and BRAF wild type/NRAS mutant metastases showed more homogeneous single-cell gene expression patterns with gene expression modules for proliferation and ABC transporters. Taken together, our results describe an intertumor and intratumor heterogeneity in melanoma short-term cultures which might be relevant for patient survival, and suggest promising targets for new treatment approaches in melanoma therapy. PMID:27903987

  19. Differences in MYB expression and gene abnormalities further confirm that salivary cribriform basal cell tumors and adenoid cystic carcinoma are two distinct tumor entities.

    PubMed

    Tian, Zhen; Li, Lei; Zhang, Chun-Ye; Gu, Ting; Li, Jiang

    2016-10-01

    In practices, some cases of salivary basal cell tumors that consist mainly of cribriform growth pattern are difficult to differentiate from adenoid cystic carcinoma (AdCC). Identification of reliable molecular biomarkers for the differential diagnosis between them is required. Twenty-two cases of cribriform salivary basal cell tumors (at least 10% cribriform pattern present in each tumor) comprising 18 cases of basal cell adenoma (BCA) and four cases of basal cell adenocarcinoma (BcAC) were collected between 1985 and 2008. Twenty cases of cribriform AdCC were retrieved from our archives. MYB protein expression and gene abnormalities were detected in all cases by immunohistochemistry (IHC) and fluorescent in situ hybridization (FISH) analyses, respectively. Neither MYB protein nor split genes were detected in any of the cases of cribriform basal cell tumors, while 55% (11/20) of cases of cribriform AdCC had MYB protein expression. High MYB expression was detected in 81.8% (9/11) cases, while low expression was found in the remaining cases. FISH analysis indicated that nine AdCC tumors with high MYB protein expression were split gene-positive, while MYB gene splitting was not detected in the 11 cases with low or absent MYB protein expression. The molecular changes in AdCC differ from those associated with cribriform basal cell tumors, which further confirms that cribriform basal cell tumors and AdCC are two distinct tumor entities. Simultaneous detection of MYB protein expression and the associated molecular changes could be beneficial in differentiating salivary cribriform basal cell tumors from AdCC. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  20. Duplication and diversification of the LEAFY HULL STERILE1 and Oryza sativa MADS5 SEPALLATA lineages in graminoid Poales

    PubMed Central

    2012-01-01

    Background Gene duplication and the subsequent divergence in function of the resulting paralogs via subfunctionalization and/or neofunctionalization is hypothesized to have played a major role in the evolution of plant form. The LEAFY HULL STERILE1 (LHS1) SEPALLATA (SEP) genes have been linked with the origin and diversification of the grass spikelet, but it is uncertain 1) when the duplication event that produced the LHS1 clade and its paralogous lineage Oryza sativa MADS5 (OSM5) occurred, and 2) how changes in gene structure and/or expression might have contributed to subfunctionalization and/or neofunctionalization in the two lineages. Methods Phylogenetic relationships among 84 SEP genes were estimated using Bayesian methods. RNA expression patterns were inferred using in situ hybridization. The patterns of protein sequence and RNA expression evolution were reconstructed using maximum parsimony (MP) and maximum likelihood (ML) methods, respectively. Results Phylogenetic analyses mapped the LHS1/OSM5 duplication event to the base of the grass family. MP character reconstructions estimated a change from cytosine to thymine in the first codon position of the first amino acid after the Zea mays MADS3 (ZMM3) domain converted a glutamine to a stop codon in the OSM5 ancestor following the LHS1/OSM5 duplication event. RNA expression analyses of OSM5 co-orthologs in Avena sativa, Chasmanthium latifolium, Hordeum vulgare, Pennisetum glaucum, and Sorghum bicolor followed by ML reconstructions of these data and previously published analyses estimated a complex pattern of gain and loss of LHS1 and OSM5 expression in different floral organs and different flowers within the spikelet or inflorescence. Conclusions Previous authors have reported that rice OSM5 and LHS1 proteins have different interaction partners indicating that the truncation of OSM5 following the LHS1/OSM5 duplication event has resulted in both partitioned and potentially novel gene functions. The complex pattern of OSM5 and LHS1 expression evolution is not consistent with a simple subfunctionalization model following the gene duplication event, but there is evidence of recent partitioning of OSM5 and LHS1 expression within different floral organs of A. sativa, C. latifolium, P. glaucum and S. bicolor, and between the upper and lower florets of the two-flowered maize spikelet. PMID:22340849

  1. Expression of the glutamine metabolism-related proteins glutaminase 1 and glutamate dehydrogenase in canine mammary tumours.

    PubMed

    Ryu, J-E; Park, H-K; Choi, H-J; Lee, H-B; Lee, H-J; Lee, H; Yu, E-S; Son, W-C

    2018-06-01

    Glutamine metabolism is an important metabolic pathway for cancer cell survival, and there is a critical connection between tumour growth and glutamine metabolism. Because of their similarities, canine mammary carcinomas are useful for studying human breast cancer. Accordingly, we investigated the correlations between the expression of glutamine metabolism-related proteins and the pathological features of canine mammary tumours. We performed immunohistochemical and western blot analysis of 39 mammary tumour tissues. In immunohistochemical analysis, the expression of glutaminase 1 (GLS1) in the epithelial region increased according to the histological grade (P < .005). In the stromal region, complex-type tumours displayed significantly higher GLS1 intensity than simple-type tumours. However, glutamate dehydrogenase expression did not show the same tendencies as GLS1. The western blot results were consistent with the immunohistochemical findings. These results suggest that the expression of GLS1 is correlates with clinicopathological factors in canine mammary tumours and shows a similar pattern to human breast cancer. © 2017 John Wiley & Sons Ltd.

  2. Happy guys finish last: the impact of emotion expressions on sexual attraction.

    PubMed

    Tracy, Jessica L; Beall, Alec T

    2011-12-01

    This research examined the relative sexual attractiveness of individuals showing emotion expressions of happiness, pride, and shame compared with a neutral control. Across two studies using different images and samples ranging broadly in age (total N = 1041), a large gender difference emerged in the sexual attractiveness of happy displays: happiness was the most attractive female emotion expression, and one of the least attractive in males. In contrast, pride showed the reverse pattern; it was the most attractive male expression, and one of the least attractive in women. Shame displays were relatively attractive in both genders, and, among younger adult women viewers, male shame was more attractive than male happiness, and not substantially less than male pride. Effects were largely consistent with evolutionary and socio-cultural-norm accounts. Overall, this research provides the first evidence that distinct emotion expressions have divergent effects on sexual attractiveness, which vary by gender but largely hold across age. (c) 2011 APA, all rights reserved.

  3. Rax: Developmental and Daily Expression Patterns in the Rat Pineal Gland and Retina

    PubMed Central

    Rohde, Kristian; Klein, David C.; Møller, Morten; Rath, Martin F.

    2011-01-01

    Retina and anterior neural fold homeobox (Rax) gene encodes a transcription factor essential for vertebrate eye development. Recent microarray studies indicate that Rax is expressed in the adult rat pineal gland and retina. The present study reveals that Rax expression levels in the rat change significantly during retinal development with a peak occurring at embryonic day (E) 18, whereas Rax expression in the pineal is relatively delayed and not detectable until E20. In both tissues, Rax is expressed throughout postnatal development into adulthood. In the mature rat pineal gland, the abundance of Rax transcripts increases 2-fold during the light period with a peak occurring at dusk. These findings are consistent with the evidence that Rax is of functional importance in eye development and suggest a role of Rax in the developing pineal gland. In addition, it would appear possible that Rax contributes to phenotype maintenance in the mature retina and pineal gland and may facilitate 24-h changes in the pineal transcriptome. PMID:21749377

  4. BMP2 and BMP7 play antagonistic roles in feather induction

    PubMed Central

    Michon, Frédéric; Forest, Loïc; Collomb, Elodie; Demongeot, Jacques; Dhouailly, Danielle

    2008-01-01

    Summary During embryonic development, feathers first appear as primordia consisting of an epidermal placode associated with a dermal condensation. In most previous studies, the BMPs have been proposed to function as inhibitors of the formation of cutaneous appendages. We showed that the function of BMPs is quite nuanced: BMP-2 and BMP-7, which are expressed in both skin components, act antagonistically and yet are both involved in the dermal condensations formation. BMP-7, the first to be expressed, is implicated in chemotaxis which leads to cell recruitment to the condensation, whereas BMP-2, which is expressed later, leads to an arrest of cell migration, likely via its modulation of EIIIA Fibronectin domain and α4-Integrin expression. We also propose a mathematical model, a reaction-diffusion system, based on cell proliferation, chemotaxis and the timing of BMP-2 and BMP-7 expression, which simulates the endogenous situation and reproduces the negative effects of excess BMP-2 or BMP-7 on feather patterning. PMID:18635609

  5. Expression-Linked Patterns of Codon Usage, Amino Acid Frequency, and Protein Length in the Basally Branching Arthropod Parasteatoda tepidariorum

    PubMed Central

    Whittle, Carrie A.; Extavour, Cassandra G.

    2016-01-01

    Abstract Spiders belong to the Chelicerata, the most basally branching arthropod subphylum. The common house spider, Parasteatoda tepidariorum, is an emerging model and provides a valuable system to address key questions in molecular evolution in an arthropod system that is distinct from traditionally studied insects. Here, we provide evidence suggesting that codon usage, amino acid frequency, and protein lengths are each influenced by expression-mediated selection in P. tepidariorum. First, highly expressed genes exhibited preferential usage of T3 codons in this spider, suggestive of selection. Second, genes with elevated transcription favored amino acids with low or intermediate size/complexity (S/C) scores (glycine and alanine) and disfavored those with large S/C scores (such as cysteine), consistent with the minimization of biosynthesis costs of abundant proteins. Third, we observed a negative correlation between expression level and coding sequence length. Together, we conclude that protein-coding genes exhibit signals of expression-related selection in this emerging, noninsect, arthropod model. PMID:27017527

  6. Hepatic Leukemia Factor Promotes Resistance To Cell Death: Implications For Therapeutics and Chronotherapy

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Waters, Katrina M.; Sontag, Ryan L.; Weber, Thomas J.

    Physiological variation related to circadian rhythms and aberrant gene expression patterns are believed to modulate therapeutic efficacy, but the precise molecular determinants remain unclear. Here we examine the regulation of cell death by hepatic leukemia factor (HLF), which is an output regulator of circadian rhythms and is aberrantly expressed in human cancers, using an ectopic expression strategy in JB6 mouse epidermal cells and human keratinocytes. Ectopic HLF expression inhibited cell death in both JB6 cells and human keratinocytes, as induced by serum-starvation, tumor necrosis factor alpha and ionizing radiation. Microarray analysis indicates that HLF regulates a complex multi-gene transcriptional programmore » encompassing upregulation of anti-apoptotic genes, downregulation of pro-apoptotic genes, and many additional changes that are consistent with an anti-death program. Collectively, our results demonstrate that ectopic expression of HLF, an established transcription factor that cycles with circadian rhythms, can recapitulate many features associated with circadian-dependent physiological variation.« less

  7. Expression of the mRNAs encoding the limbic system-associated membrane protein (LAMP): II. Fetal rat brain.

    PubMed

    Pimenta, A F; Reinoso, B S; Levitt, P

    1996-11-11

    The limbic system-associated membrane protein (LAMP) is a 64-68 kDa neuronal surface glycoprotein expressed in cortical and subcortical regions of the limbic system of the adult and developing rat central nervous system (CNS). LAMP is a member of the immunoglobulin superfamily of cell adhesion molecules with three Ig domains and is highly conserved between rat and human. In this study, the temporal and spatial pattern of lamp gene expression during fetal rat development was analyzed by using Northern blot analysis and in situ hybridization. In Northern blot analysis, two lamp mRNA transcripts, 1.6 kb and 8.0 kb, identical in size to those present in the adult rat nervous system, were detected in developing neural tissue. In situ hybridization analysis showed close correlation, though not identity, between the expression of lamp mRNAs and the distribution of LAMP in limbic regions of the developing rat CNS, indicative of a more complex regulation of gene expression than was previously thought to be the case. The expression of lamp mRNAs is first detected on about embryonic day (E) 13. The hybridization signal is not seen in the proliferative ventricular zone at any level of the neuraxis, indicating that lamp is expressed in postmitotic neurons. In the cerebral cortex, lamp mRNAs are expressed in limbic cortical regions, such as the perirhinal cortex, prefrontal cortex, and cingulate cortex. In the hippocampus, the hybridization signal is observed in Ammon's horn by E18. The neostriatum, amygdaloid complex, and most hypothalamic areas express lamp mRNAs from early stages (E13-E14) in a pattern consistent with the onset of neurogenesis. The emerging patterns of lamp expression at the outset are similar to those seen in adult hypothalamus and dorsal thalamus. Although the hybridization signal is observed in some nonlimbic areas, including midbrain and hindbrain structures, intense labeling is evident in more classic limbic regions. The high levels of expression of lamp in limbic regions, beginning in early developmental stages, combined with the results of previous functional in vitro and in vivo studies, support a role for LAMP as a recognition molecule involved in the formation of limbic connections.

  8. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

    PubMed Central

    Pavasovic, Ana; Dammannagoda, Lalith K.; Mather, Peter B.; Prentis, Peter J.

    2017-01-01

    Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na+/K+-ATPase (NKA), H+-ATPase (HAT), Na+/K+/2Cl− cotransporter (NKCC), Na+/Cl−/HCO\\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}${}_{3}^{-}$\\end{document}3− cotransporter (NBC), Na+/H+ exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca+2-ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish, Cherax quadricarinatus, C. destructor and C. cainii, with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types. PMID:28852583

  9. Four not six: Revealing culturally common facial expressions of emotion.

    PubMed

    Jack, Rachael E; Sun, Wei; Delis, Ioannis; Garrod, Oliver G B; Schyns, Philippe G

    2016-06-01

    As a highly social species, humans generate complex facial expressions to communicate a diverse range of emotions. Since Darwin's work, identifying among these complex patterns which are common across cultures and which are culture-specific has remained a central question in psychology, anthropology, philosophy, and more recently machine vision and social robotics. Classic approaches to addressing this question typically tested the cross-cultural recognition of theoretically motivated facial expressions representing 6 emotions, and reported universality. Yet, variable recognition accuracy across cultures suggests a narrower cross-cultural communication supported by sets of simpler expressive patterns embedded in more complex facial expressions. We explore this hypothesis by modeling the facial expressions of over 60 emotions across 2 cultures, and segregating out the latent expressive patterns. Using a multidisciplinary approach, we first map the conceptual organization of a broad spectrum of emotion words by building semantic networks in 2 cultures. For each emotion word in each culture, we then model and validate its corresponding dynamic facial expression, producing over 60 culturally valid facial expression models. We then apply to the pooled models a multivariate data reduction technique, revealing 4 latent and culturally common facial expression patterns that each communicates specific combinations of valence, arousal, and dominance. We then reveal the face movements that accentuate each latent expressive pattern to create complex facial expressions. Our data questions the widely held view that 6 facial expression patterns are universal, instead suggesting 4 latent expressive patterns with direct implications for emotion communication, social psychology, cognitive neuroscience, and social robotics. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  10. Altered microRNA expression patterns during the initiation and promotion stages of neonatal diethylstilbestrol-induced dysplasia/neoplasia in the hamster (Mesocricetus auratus) uterus.

    PubMed

    Padmanabhan, Ramesh; Hendry, Isabel R; Knapp, Jennifer R; Shuai, Bin; Hendry, William J

    2017-10-01

    Treatment of Syrian hamsters on the day of birth with the prototypical endocrine disruptor and synthetic estrogen, diethylstilbestrol (DES), leads to 100% occurrence of uterine hyperplasia/dysplasia in adulthood, a large proportion of which progress to neoplasia (endometrial adenocarcinoma). Consistent with our prior gene expression analyses at the mRNA and protein levels, we now report (based on microarray, real-time polymerase chain reaction, and in situ hybridization analyses) that progression of the neonatal DES-induced dysplasia/neoplasia phenomenon in the hamster uterus also includes a spectrum of microRNA expression alterations (at both the whole-organ and cell-specific level) that differ during the initiation (upregulated miR-21, 200a, 200b, 200c, 29a, 29b, 429, 141; downregulated miR-181a) and promotion (downregulated miR-133a) stages of the phenomenon. The biological processes targeted by those differentially expressed miRNAs include pathways in cancer and adherens junction, plus regulation of the cell cycle, apoptosis, and miRNA functions, all of which are consistent with our model system phenotype. These findings underscore the need for continued efforts to identify and assess both the classical genetic and the more recently recognized epigenetic mechanisms that truly drive this and other endocrine disruption phenomena.

  11. Major cellular and physiological impacts of ocean acidification on a reef building coral.

    PubMed

    Kaniewska, Paulina; Campbell, Paul R; Kline, David I; Rodriguez-Lanetty, Mauricio; Miller, David J; Dove, Sophie; Hoegh-Guldberg, Ove

    2012-01-01

    As atmospheric levels of CO(2) increase, reef-building corals are under greater stress from both increased sea surface temperatures and declining sea water pH. To date, most studies have focused on either coral bleaching due to warming oceans or declining calcification due to decreasing oceanic carbonate ion concentrations. Here, through the use of physiology measurements and cDNA microarrays, we show that changes in pH and ocean chemistry consistent with two scenarios put forward by the Intergovernmental Panel on Climate Change (IPCC) drive major changes in gene expression, respiration, photosynthesis and symbiosis of the coral, Acropora millepora, before affects on biomineralisation are apparent at the phenotype level. Under high CO(2) conditions corals at the phenotype level lost over half their Symbiodinium populations, and had a decrease in both photosynthesis and respiration. Changes in gene expression were consistent with metabolic suppression, an increase in oxidative stress, apoptosis and symbiont loss. Other expression patterns demonstrate upregulation of membrane transporters, as well as the regulation of genes involved in membrane cytoskeletal interactions and cytoskeletal remodeling. These widespread changes in gene expression emphasize the need to expand future studies of ocean acidification to include a wider spectrum of cellular processes, many of which may occur before impacts on calcification.

  12. Major Cellular and Physiological Impacts of Ocean Acidification on a Reef Building Coral

    PubMed Central

    Kaniewska, Paulina; Campbell, Paul R.; Kline, David I.; Rodriguez-Lanetty, Mauricio; Miller, David J.

    2012-01-01

    As atmospheric levels of CO2 increase, reef-building corals are under greater stress from both increased sea surface temperatures and declining sea water pH. To date, most studies have focused on either coral bleaching due to warming oceans or declining calcification due to decreasing oceanic carbonate ion concentrations. Here, through the use of physiology measurements and cDNA microarrays, we show that changes in pH and ocean chemistry consistent with two scenarios put forward by the Intergovernmental Panel on Climate Change (IPCC) drive major changes in gene expression, respiration, photosynthesis and symbiosis of the coral, Acropora millepora, before affects on biomineralisation are apparent at the phenotype level. Under high CO2 conditions corals at the phenotype level lost over half their Symbiodinium populations, and had a decrease in both photosynthesis and respiration. Changes in gene expression were consistent with metabolic suppression, an increase in oxidative stress, apoptosis and symbiont loss. Other expression patterns demonstrate upregulation of membrane transporters, as well as the regulation of genes involved in membrane cytoskeletal interactions and cytoskeletal remodeling. These widespread changes in gene expression emphasize the need to expand future studies of ocean acidification to include a wider spectrum of cellular processes, many of which may occur before impacts on calcification. PMID:22509341

  13. Featured Article: Transcriptional landscape analysis identifies differently expressed genes involved in follicle-stimulating hormone induced postmenopausal osteoporosis.

    PubMed

    Maasalu, Katre; Laius, Ott; Zhytnik, Lidiia; Kõks, Sulev; Prans, Ele; Reimann, Ene; Märtson, Aare

    2017-01-01

    Osteoporosis is a disorder associated with bone tissue reorganization, bone mass, and mineral density. Osteoporosis can severely affect postmenopausal women, causing bone fragility and osteoporotic fractures. The aim of the current study was to compare blood mRNA profiles of postmenopausal women with and without osteoporosis, with the aim of finding different gene expressions and thus targets for future osteoporosis biomarker studies. Our study consisted of transcriptome analysis of whole blood serum from 12 elderly female osteoporotic patients and 12 non-osteoporotic elderly female controls. The transcriptome analysis was performed with RNA sequencing technology. For data analysis, the edgeR package of R Bioconductor was used. Two hundred and fourteen genes were expressed differently in osteoporotic compared with non-osteoporotic patients. Statistical analysis revealed 20 differently expressed genes with a false discovery rate of less than 1.47 × 10 -4 among osteoporotic patients. The expression of 10 genes were up-regulated and 10 down-regulated. Further statistical analysis identified a potential osteoporosis mRNA biomarker pattern consisting of six genes: CACNA1G, ALG13, SBK1, GGT7, MBNL3, and RIOK3. Functional ingenuity pathway analysis identified the strongest candidate genes with regard to potential involvement in a follicle-stimulating hormone activated network of increased osteoclast activity and hypogonadal bone loss. The differentially expressed genes identified in this study may contribute to future research of postmenopausal osteoporosis blood biomarkers.

  14. Transcriptome dynamics along axolotl regenerative development are consistent with an extensive reduction in gene expression heterogeneity in dedifferentiated cells

    PubMed Central

    2017-01-01

    Although in recent years the study of gene expression variation in the absence of genetic or environmental cues or gene expression heterogeneity has intensified considerably, many basic and applied biological fields still remain unaware of how useful the study of gene expression heterogeneity patterns might be for the characterization of biological systems and/or processes. Largely based on the modulator effect chromatin compaction has for gene expression heterogeneity and the extensive changes in chromatin compaction known to occur for specialized cells that are naturally or artificially induced to revert to less specialized states or dedifferentiate, I recently hypothesized that processes that concur with cell dedifferentiation would show an extensive reduction in gene expression heterogeneity. The confirmation of the existence of such trend could be of wide interest because of the biomedical and biotechnological relevance of cell dedifferentiation-based processes, i.e., regenerative development, cancer, human induced pluripotent stem cells, or plant somatic embryogenesis. Here, I report the first empirical evidence consistent with the existence of an extensive reduction in gene expression heterogeneity for processes that concur with cell dedifferentiation by analyzing transcriptome dynamics along forearm regenerative development in Ambystoma mexicanum or axolotl. Also, I briefly discuss on the utility of the study of gene expression heterogeneity dynamics might have for the characterization of cell dedifferentiation-based processes, and the engineering of tools that afforded better monitoring and modulating such processes. Finally, I reflect on how a transitional reduction in gene expression heterogeneity for dedifferentiated cells can promote a long-term increase in phenotypic heterogeneity following cell dedifferentiation with potential adverse effects for biomedical and biotechnological applications. PMID:29134148

  15. Differential Expression of Three α-Galactosidase Genes and a Single β-Galactosidase Gene from Aspergillus niger

    PubMed Central

    de Vries, Ronald P.; van den Broeck, Hetty C.; Dekkers, Ester; Manzanares, Paloma; de Graaff, Leo H.; Visser, Jaap

    1999-01-01

    A gene encoding a third α-galactosidase (AglB) from Aspergillus niger has been cloned and sequenced. The gene consists of an open reading frame of 1,750 bp containing six introns. The gene encodes a protein of 443 amino acids which contains a eukaryotic signal sequence of 16 amino acids and seven putative N-glycosylation sites. The mature protein has a calculated molecular mass of 48,835 Da and a predicted pI of 4.6. An alignment of the AglB amino acid sequence with those of other α-galactosidases revealed that it belongs to a subfamily of α-galactosidases that also includes A. niger AglA. A. niger AglC belongs to a different subfamily that consists mainly of prokaryotic α-galactosidases. The expression of aglA, aglB, aglC, and lacA, the latter of which encodes an A. niger β-galactosidase, has been studied by using a number of monomeric, oligomeric, and polymeric compounds as growth substrates. Expression of aglA is only detected on galactose and galactose-containing oligomers and polymers. The aglB gene is expressed on all of the carbon sources tested, including glucose. Elevated expression was observed on xylan, which could be assigned to regulation via XlnR, the xylanolytic transcriptional activator. Expression of aglC was only observed on glucose, fructose, and combinations of glucose with xylose and galactose. High expression of lacA was detected on arabinose, xylose, xylan, and pectin. Similar to aglB, the expression on xylose and xylan can be assigned to regulation via XlnR. All four genes have distinct expression patterns which seem to mirror the natural substrates of the encoded proteins. PMID:10347026

  16. LEF1 is preferentially expressed in the tubal-peritoneal junctions and is a reliable marker of tubal intraepithelial lesions

    PubMed Central

    Schmoeckel, Elisa; Odai-Afotey, Ashley A.; Schleiβheimer, Michael; Rottmann, Miriam; Flesken-Nikitin, Andrea; Ellenson, Lora H.; Kirchner, Thomas; Mayr, Doris; Nikitin, Alexander Yu.

    2017-01-01

    Recently it has been reported that serous tubal intraepithelial carcinoma (STIC), the likely precursor of ovarian/extra-uterine high-grade serous carcinoma, are frequently located in the vicinity of tubal-peritoneal junctions, consistent with the cancer-prone features of many epithelial transitional regions. To test if p53 (aka TP53)-signatures and secretory cell outgrowths (SCOUTs) also localize to tubal-peritoneal junctions, we examined these lesions in the fallopian tubes of patients undergoing salpingo-oophorectomy for sporadic high-grade serous carcinomas or as a prophylactic procedure for carriers of familial BRCA1 or 2 mutations. STICs were located closest to the tubal-peritoneal junctions with an average distance of 1.31 mm, while SCOUTs were not detected in the fimbriated end of the fallopian tube. Since many epithelial transitional regions contain stem cells, we also determined the expression of stem cell markers in the normal fallopian tube, tubal intraepithelial lesions and high-grade serous carcinomas. Of those, LEF1 was consistently expressed in the tubal-peritoneal junctions and all lesions, independent of p53 status. All SCOUTs demonstrated strong nuclear expression of β-catenin consistent with the LEF1 participation in the canonical WNT pathway. However, β-catenin was preferentially located in the cytoplasm of cells comprising STICs and p53 signatures, suggesting WNT-independent function of LEF1 in those lesions. Both frequency of LEF1 expression and β-catenin nuclear expression correlated with the worst 5 year patient survival, supporting important role of both proteins in high-grade serous carcinoma. Taken together, our findings suggest the existence of stem cell niche within the tubal-peritoneal junctions. Furthermore, they support the notion that the pathogenesis of SCOUTs is distinct from that of STICs and p53 signatures. The location and discrete patterns of LEF1 and β-catenin expression may serve as highly sensitive and reliable ancillary markers for the detection and differential diagnosis of tubal intraepithelial lesions. PMID:28664938

  17. Differential expression of three galaxin-related genes during settlement and metamorphosis in the scleractinian coral Acropora millepora

    PubMed Central

    Reyes-Bermudez, Alejandro; Lin, Zhiyi; Hayward, David C; Miller, David J; Ball, Eldon E

    2009-01-01

    Background The coral skeleton consists of CaCO3 deposited upon an organic matrix primarily as aragonite. Currently galaxin, from Galaxea fascicularis, is the only soluble protein component of the organic matrix that has been characterized from a coral. Three genes related to galaxin were identified in the coral Acropora millepora. Results One of the Acropora genes (Amgalaxin) encodes a clear galaxin ortholog, while the others (Amgalaxin-like 1 and Amgalaxin-like 2) encode larger and more divergent proteins. All three proteins are predicted to be extracellular and share common structural features, most notably the presence of repetitive motifs containing dicysteine residues. In situ hybridization reveals distinct, but partially overlapping, spatial expression of the genes in patterns consistent with distinct roles in calcification. Both of the Amgalaxin-like genes are expressed exclusively in the early stages of calcification, while Amgalaxin continues to be expressed in the adult, consistent with the situation in the coral Galaxea. Conclusion Comparisons with molluscs suggest functional convergence in the two groups; lustrin A/pearlin proteins may be the mollusc counterparts of galaxin, whereas the galaxin-like proteins combine characteristics of two distinct proteins involved in mollusc calcification. Database searches indicate that, although sequences with high similarity to the galaxins are restricted to the Scleractinia, more divergent members of this protein family are present in other cnidarians and some other metazoans. We suggest that ancestral galaxins may have been secondarily recruited to roles in calcification in the Triassic, when the Scleractinia first appeared. Understanding the evolution of the broader galaxin family will require wider sampling and expression analysis in a range of cnidarians and other animals. PMID:19638240

  18. Pbx proteins cooperate with Engrailed to pattern the midbrain-hindbrain and diencephalic-mesencephalic boundaries

    PubMed Central

    Erickson, Timothy; Scholpp, Steffen; Brand, Michael; Moens, Cecilia B.; Waskiewicz, Andrew Jan

    2007-01-01

    Pbx proteins are a family of TALE-class transcription factors that are well characterized as Hox co-factors acting to impart segmental identity to the hindbrain rhombomeres. However, no role for Pbx in establishing more anterior neural compartments has been demonstrated. Studies done in Drosophila show that Engrailed requires Exd (Pbx orthologue) for its biological activity. Here, we present evidence that zebrafish Pbx proteins cooperate with Engrailed to compartmentalize the midbrain by regulating the maintenance of the midbrain-hindbrain boundary (MHB) and the diencephalic-mesencephalic boundary (DMB). Embryos lacking Pbx function correctly initiate midbrain patterning, but fail to maintain eng2a, pax2a, fgf8, gbx2, and wnt1 expression at the MHB. Formation of the DMB is also defective as shown by a caudal expansion of diencephalic epha4a and pax6a expression into midbrain territory. These phenotypes are similar to the phenotype of an Engrailed loss-of-function embryo, supporting the hypothesis that Pbx and Engrailed act together on a common genetic pathway. Consistent with this model, we demonstrate that zebrafish Engrailed and Pbx interact in vitro, and that this interaction is required for both the eng2a overexpression phenotype and Engrailed’s role in patterning the MHB. Our data support a novel model of midbrain development in which Pbx and Engrailed proteins cooperatively pattern the mesencephalic region of the neural tube. PMID:16959235

  19. Pbx proteins cooperate with Engrailed to pattern the midbrain-hindbrain and diencephalic-mesencephalic boundaries.

    PubMed

    Erickson, Timothy; Scholpp, Steffen; Brand, Michael; Moens, Cecilia B; Waskiewicz, Andrew Jan

    2007-01-15

    Pbx proteins are a family of TALE-class transcription factors that are well characterized as Hox co-factors acting to impart segmental identity to the hindbrain rhombomeres. However, no role for Pbx in establishing more anterior neural compartments has been demonstrated. Studies done in Drosophila show that Engrailed requires Exd (Pbx orthologue) for its biological activity. Here, we present evidence that zebrafish Pbx proteins cooperate with Engrailed to compartmentalize the midbrain by regulating the maintenance of the midbrain-hindbrain boundary (MHB) and the diencephalic-mesencephalic boundary (DMB). Embryos lacking Pbx function correctly initiate midbrain patterning, but fail to maintain eng2a, pax2a, fgf8, gbx2, and wnt1 expression at the MHB. Formation of the DMB is also defective as shown by a caudal expansion of diencephalic epha4a and pax6a expression into midbrain territory. These phenotypes are similar to the phenotype of an Engrailed loss-of-function embryo, supporting the hypothesis that Pbx and Engrailed act together on a common genetic pathway. Consistent with this model, we demonstrate that zebrafish Engrailed and Pbx interact in vitro and that this interaction is required for both the eng2a overexpression phenotype and Engrailed's role in patterning the MHB. Our data support a novel model of midbrain development in which Pbx and Engrailed proteins cooperatively pattern the mesencephalic region of the neural tube.

  20. Overexpressing of OsAMT1-3, a High Affinity Ammonium Transporter Gene, Modifies Rice Growth and Carbon-Nitrogen Metabolic Status

    PubMed Central

    Bao, Aili; Liang, Zhijun; Zhao, Zhuqing; Cai, Hongmei

    2015-01-01

    AMT1-3 encodes the high affinity NH4+ transporter in rice roots and is predominantly expressed under nitrogen starvation. In order to evaluate the effect of AMT1-3 gene on rice growth, nitrogen absorption and metabolism, we generated AMT1-3-overexpressing plants and analyzed the growth phenotype, yield, carbon and nitrogen metabolic status, and gene expression profiles. Although AMT1-3 mRNA accumulated in transgenic plants, these plants displayed significant decreases in growth when compared to the wild-type plants. The nitrogen uptake assay using a 15N tracer revealed poor nitrogen uptake ability in AMT1-3-overexpressing plants. We found significant decreases in AMT1-3-overexpressing plant leaf carbon and nitrogen content accompanied with a higher leaf C/N ratio. Significant changes in soluble proteins and carbohydrates were also observed in AMT1-3-overexpressing plants. In addition, metabolite profile analysis demonstrated significant changes in individual sugars, organic acids and free amino acids. Gene expression analysis revealed distinct expression patterns of genes that participate in carbon and nitrogen metabolism. Additionally, the correlation between the metabolites and gene expression patterns was consistent in AMT1-3-overexpressing plants under both low and high nitrogen growth conditions. Therefore, we hypothesized that the carbon and nitrogen metabolic imbalance caused by AMT1-3 overexpressing attributed to the poor growth and yield of transgenic plants. PMID:25915023

  1. Promotion of Testa Rupture during Garden Cress Germination Involves Seed Compartment-Specific Expression and Activity of Pectin Methylesterases1[OPEN

    PubMed Central

    Scheler, Claudia; Weitbrecht, Karin; Pearce, Simon P.; Hampstead, Anthony; Büttner-Mainik, Annette; Lee, Kieran J.D.; Voegele, Antje; Oracz, Krystyna; Dekkers, Bas J.W.; Wang, Xiaofeng; Wood, Andrew T.A.; Bentsink, Leónie; King, John R.; Knox, J. Paul; Holdsworth, Michael J.; Müller, Kerstin; Leubner-Metzger, Gerhard

    2015-01-01

    Pectin methylesterase (PME) controls the methylesterification status of pectins and thereby determines the biophysical properties of plant cell walls, which are important for tissue growth and weakening processes. We demonstrate here that tissue-specific and spatiotemporal alterations in cell wall pectin methylesterification occur during the germination of garden cress (Lepidium sativum). These cell wall changes are associated with characteristic expression patterns of PME genes and resultant enzyme activities in the key seed compartments CAP (micropylar endosperm) and RAD (radicle plus lower hypocotyl). Transcriptome and quantitative real-time reverse transcription-polymerase chain reaction analysis as well as PME enzyme activity measurements of separated seed compartments, including CAP and RAD, revealed distinct phases during germination. These were associated with hormonal and compartment-specific regulation of PME group 1, PME group 2, and PME inhibitor transcript expression and total PME activity. The regulatory patterns indicated a role for PME activity in testa rupture (TR). Consistent with a role for cell wall pectin methylesterification in TR, treatment of seeds with PME resulted in enhanced testa permeability and promoted TR. Mathematical modeling of transcript expression changes in germinating garden cress and Arabidopsis (Arabidopsis thaliana) seeds suggested that group 2 PMEs make a major contribution to the overall PME activity rather than acting as PME inhibitors. It is concluded that regulated changes in the degree of pectin methylesterification through CAP- and RAD-specific PME and PME inhibitor expression play a crucial role during Brassicaceae seed germination. PMID:25429110

  2. Estimating replicate time shifts using Gaussian process regression

    PubMed Central

    Liu, Qiang; Andersen, Bogi; Smyth, Padhraic; Ihler, Alexander

    2010-01-01

    Motivation: Time-course gene expression datasets provide important insights into dynamic aspects of biological processes, such as circadian rhythms, cell cycle and organ development. In a typical microarray time-course experiment, measurements are obtained at each time point from multiple replicate samples. Accurately recovering the gene expression patterns from experimental observations is made challenging by both measurement noise and variation among replicates' rates of development. Prior work on this topic has focused on inference of expression patterns assuming that the replicate times are synchronized. We develop a statistical approach that simultaneously infers both (i) the underlying (hidden) expression profile for each gene, as well as (ii) the biological time for each individual replicate. Our approach is based on Gaussian process regression (GPR) combined with a probabilistic model that accounts for uncertainty about the biological development time of each replicate. Results: We apply GPR with uncertain measurement times to a microarray dataset of mRNA expression for the hair-growth cycle in mouse back skin, predicting both profile shapes and biological times for each replicate. The predicted time shifts show high consistency with independently obtained morphological estimates of relative development. We also show that the method systematically reduces prediction error on out-of-sample data, significantly reducing the mean squared error in a cross-validation study. Availability: Matlab code for GPR with uncertain time shifts is available at http://sli.ics.uci.edu/Code/GPRTimeshift/ Contact: ihler@ics.uci.edu PMID:20147305

  3. Conservation and divergence of plant LHP1 protein sequences and expression patterns in angiosperms and gymnosperms.

    PubMed

    Guan, Hexin; Zheng, Zhengui; Grey, Paris H; Li, Yuhua; Oppenheimer, David G

    2011-05-01

    Floral transition is a critical and strictly regulated developmental process in plants. Mutations in Arabidopsis LIKE HETEROCHROMATIN PROTEIN 1 (AtLHP1)/TERMINAL FLOWER 2 (TFL2) result in early and terminal flowers. Little is known about the gene expression, function and evolution of plant LHP1 homologs, except for Arabidopsis LHP1. In this study, the conservation and divergence of plant LHP1 protein sequences was analyzed by sequence alignments and phylogeny. LHP1 expression patterns were compared among taxa that occupy pivotal phylogenetic positions. Several relatively conserved new motifs/regions were identified among LHP1 homologs. Phylogeny of plant LHP1 proteins agreed with established angiosperm relationships. In situ hybridization unveiled conserved expression of plant LHP1 in the axillary bud/tiller, vascular bundles, developing stamens, and carpels. Unlike AtLHP1, cucumber CsLHP1-2, sugarcane SoLHP1 and maize ZmLHP1, rice OsLHP1 is not expressed in the shoot apical meristem (SAM) and the OsLHP1 transcript level is consistently low in shoots. "Unequal crossover" might have contributed to the divergence in the N-terminal and hinge region lengths of LHP1 homologs. We propose an "insertion-deletion" model for soybean (Glycine max L.) GmLHP1s evolution. Plant LHP1 homologs are more conserved than previously expected, and may favor vegetative meristem identity and primordia formation. OsLHP1 may not function in rice SAM during floral induction.

  4. Transcriptional Activity, Chromosomal Distribution and Expression Effects of Transposable Elements in Coffea Genomes

    PubMed Central

    da Silva, Carlos R. M.; Andrade, Alan C.; Marraccini, Pierre; Teixeira, João B.; Carazzolle, Marcelo F.; Pereira, Gonçalo A. G.; Pereira, Luiz Filipe P.; Vanzela, André L. L.; Wang, Lu; Jordan, I. King; Carareto, Claudia M. A.

    2013-01-01

    Plant genomes are massively invaded by transposable elements (TEs), many of which are located near host genes and can thus impact gene expression. In flowering plants, TE expression can be activated (de-repressed) under certain stressful conditions, both biotic and abiotic, as well as by genome stress caused by hybridization. In this study, we examined the effects of these stress agents on TE expression in two diploid species of coffee, Coffea canephora and C. eugenioides, and their allotetraploid hybrid C. arabica. We also explored the relationship of TE repression mechanisms to host gene regulation via the effects of exonized TE sequences. Similar to what has been seen for other plants, overall TE expression levels are low in Coffea plant cultivars, consistent with the existence of effective TE repression mechanisms. TE expression patterns are highly dynamic across the species and conditions assayed here are unrelated to their classification at the level of TE class or family. In contrast to previous results, cell culture conditions per se do not lead to the de-repression of TE expression in C. arabica. Results obtained here indicate that differing plant drought stress levels relate strongly to TE repression mechanisms. TEs tend to be expressed at significantly higher levels in non-irrigated samples for the drought tolerant cultivars but in drought sensitive cultivars the opposite pattern was shown with irrigated samples showing significantly higher TE expression. Thus, TE genome repression mechanisms may be finely tuned to the ideal growth and/or regulatory conditions of the specific plant cultivars in which they are active. Analysis of TE expression levels in cell culture conditions underscored the importance of nonsense-mediated mRNA decay (NMD) pathways in the repression of Coffea TEs. These same NMD mechanisms can also regulate plant host gene expression via the repression of genes that bear exonized TE sequences. PMID:24244387

  5. Finding consistent patterns: A nonparametric approach for identifying differential expression in RNA-Seq data

    PubMed Central

    Li, Jun; Tibshirani, Robert

    2015-01-01

    We discuss the identification of features that are associated with an outcome in RNA-Sequencing (RNA-Seq) and other sequencing-based comparative genomic experiments. RNA-Seq data takes the form of counts, so models based on the normal distribution are generally unsuitable. The problem is especially challenging because different sequencing experiments may generate quite different total numbers of reads, or ‘sequencing depths’. Existing methods for this problem are based on Poisson or negative binomial models: they are useful but can be heavily influenced by ‘outliers’ in the data. We introduce a simple, nonparametric method with resampling to account for the different sequencing depths. The new method is more robust than parametric methods. It can be applied to data with quantitative, survival, two-class or multiple-class outcomes. We compare our proposed method to Poisson and negative binomial-based methods in simulated and real data sets, and find that our method discovers more consistent patterns than competing methods. PMID:22127579

  6. Internal Characteristics of Phobos and Deimos from Spectral Properties and Density: Relationship to Landforms and Comparison with Asteroids

    NASA Technical Reports Server (NTRS)

    Murchie, S. L.; Fraeman, A. A.; Arvidson, R. E.; Rivkin, A. S.; Morris, R. V.

    2013-01-01

    Compositional interpretations of new spectral measurements of Phobos and Deimos from Mars Express/OMEGA and MRO/CRISM and density measurements from encounters by multiple spacecraft support refined estimates of the moons' porosity and internal structure. Phobos' estimated macroporosity of 12-20% is consistent with a fractured but coherent interior; Deimos' estimated macroporosity of 23-44% is more consistent with a loosely consolidated interior. These internal differences are reflected in differences in surface morphology: Phobos exhibits a globally coherent pattern of grooves, whereas Deimos has a surface dominated instead by fragmental debris. Comparison with other asteroids .110 km in diameter shows that this correspondence between landforms and inferred internal structure is part of a pervasive pattern: asteroids interpreted to have coherent interiors exhibit pervasive, organized ridge or groove systems, whereas loosely consolidated asteroids have landforms dominated by fragmental debris and/or retain craters >1.3 body radii in diameter suggesting a porous, compressible interior.

  7. Screening of Biochemical and Molecular Mechanisms of Secondary Injury and Repair in the Brain after Experimental Blast-Induced Traumatic Brain Injury in Rats

    DTIC Science & Technology

    2013-01-01

    Vimentin, complement component 1) with expression patterns bioinformatically consistent with those seen in Alzheimer’s disease and long-term...statistically significant associations with blast TBI at 2 h included Parkinson’s, Huntington’s, and Alzheimer’s disease , respectively suggesting...similarities in the early blast TBI response to those seen in important neurodegenerative diseases that have been linked to TBI.25 Comparison of 24 h

  8. Modification of carotenoid levels by abscission agents and expression of carotenoid biosynthetic genes in 'valencia' sweet orange.

    PubMed

    Alferez, Fernando; Pozo, Luis V; Rouseff, Russell R; Burns, Jacqueline K

    2013-03-27

    The effect of 5-chloro-3-methyl-4-nitro-1H-pyrazole (CMNP) and ethephon on peel color, flavedo carotenoid gene expression, and carotenoid accumulation was investigated in mature 'Valencia' orange ( Citrus sinensis L. Osbeck) fruit flavedo at three maturation stages. Abscission agent application altered peel color. CMNP was more effective than ethephon in promoting green-to-red (a) and blue-to-yellow (b) color at the middle and late maturation stages and total carotenoid changes at all maturation stages. Altered flow of carotenoid precursors during maturation due to abscission agents was suggested by changes in phytoene desaturase (Pds) and ζ-carotene desaturase (Zds) gene expression. However, each abscission agent affected downstream expression differentially. Ethephon application increased β-carotene hydroxilase (β-Chx) transcript accumulation 12-fold as maturation advanced from the early to middle and late stages. CMNP markedly increased β- and ε-lycopene cyclase (Lcy) transcript accumulation 45- and 15-fold, respectively, at midmaturation. Patterns of carotenoid accumulation in flavedo were supported in part by gene expression changes. CMNP caused greater accumulation of total flavedo carotenoids at all maturation stages when compared with ethephon or controls. In general, CMNP treatment increased total red carotenoids more than ethephon or the control but decreased total yellow carotenoids at each maturation stage. In control fruit flavedo, total red carotenoids increased and yellow carotenoids decreased as maturation progressed. Trends in total red carotenoids during maturation were consistent with measured a values. Changes in carotenoid accumulation and expression patterns in flavedo suggest that regulation of carotenoid accumulation is under transcriptional, translational, and post-translational control.

  9. Developmental and Cell-Specific Expression of Thyroid Hormone Transporters in the Mouse Cochlea

    PubMed Central

    Sharlin, David S.; Visser, Theo J.

    2011-01-01

    Thyroid hormone is essential for the development of the cochlea and auditory function. Cochlear response tissues, which express thyroid hormone receptor β (encoded by Thrb), include the greater epithelial ridge and sensory epithelium residing inside the bony labyrinth. However, these response tissues lack direct blood flow, implying that mechanisms exist to shuttle hormone from the circulation to target tissues. Therefore, we investigated expression of candidate thyroid hormone transporters L-type amino acid transporter 1 (Lat1), monocarboxylate transporter (Mct)8, Mct10, and organic anion transporting polypeptide 1c1 (Oatp1c1) in mouse cochlear development by in situ hybridization and immunofluorescence analysis. L-type amino acid transporter 1 localized to cochlear blood vessels and transiently to sensory hair cells. Mct8 localized to the greater epithelial ridge, tympanic border cells underlying the sensory epithelium, spiral ligament fibrocytes, and spiral ganglion neurons, partly overlapping with the Thrb expression pattern. Mct10 was detected in a highly restricted pattern in the outer sulcus epithelium and weakly in tympanic border cells and hair cells. Organic anion transporting polypeptide 1c1 localized primarily to fibrocytes in vascularized tissues of the spiral limbus and spiral ligament and to tympanic border cells. Investigation of hypothyroid Tshr−/− mice showed that transporter expression was delayed consistent with retardation of cochlear tissue maturation but not with compensatory responses to hypothyroidism. The results demonstrate specific expression of thyroid hormone transporters in the cochlea and suggest that a network of thyroid hormone transport underlies cochlear development. PMID:21878515

  10. Bioelectric signalling via potassium channels: a mechanism for craniofacial dysmorphogenesis in KCNJ2‐associated Andersen–Tawil Syndrome

    PubMed Central

    Adams, Dany Spencer; Uzel, Sebastien G. M.; Akagi, Jin; Wlodkowic, Donald; Andreeva, Viktoria; Yelick, Pamela Crotty; Devitt‐Lee, Adrian; Pare, Jean‐Francois; Levin, Michael

    2016-01-01

    Key points Xenopus laevis craniofacial development is a good system for the study of Andersen–Tawil Syndrome (ATS)‐associated craniofacial anomalies (CFAs) because (1) Kcnj2 is expressed in the nascent face; (2) molecular‐genetic and biophysical techniques are available for the study of ion‐dependent signalling during craniofacial morphogenesis; (3) as in humans, expression of variant Kcnj2 forms in embryos causes a muscle phenotype; and (4) variant forms of Kcnj2 found in human patients, when injected into frog embryos, cause CFAs in the same cell lineages.Forced expression of WT or variant Kcnj2 changes the normal pattern of V mem (resting potential) regionalization found in the ectoderm of neurulating embryos, and changes the normal pattern of expression of ten different genetic regulators of craniofacial development, including markers of cranial neural crest and of placodes.Expression of other potassium channels and two different light‐activated channels, all of which have an effect on V mem, causes CFAs like those induced by injection of Kcnj2 variants. In contrast, expression of Slc9A (NHE3), an electroneutral ion channel, and of GlyR, an inactive Cl− channel, do not cause CFAs, demonstrating that correct craniofacial development depends on a pattern of bioelectric states, not on ion‐ or channel‐specific signalling.Using optogenetics to control both the location and the timing of ion flux in developing embryos, we show that affecting V mem of the ectoderm and no other cell layers is sufficient to cause CFAs, but only during early neurula stages. Changes in V mem induced late in neurulation do not affect craniofacial development.We interpret these data as strong evidence, consistent with our hypothesis, that ATS‐associated CFAs are caused by the effect of variant Kcnj2 on the V mem of ectodermal cells of the developing face. We predict that the critical time is early during neurulation, and the critical cells are the ectodermal cranial neural crest and placode lineages. This points to the potential utility of extant, ion flux‐modifying drugs as treatments to prevent CFAs associated with channelopathies such as ATS. Abstract Variants in potassium channel KCNJ2 cause Andersen–Tawil Syndrome (ATS); the induced craniofacial anomalies (CFAs) are entirely unexplained. We show that KCNJ2 is expressed in Xenopus and mouse during the earliest stages of craniofacial development. Misexpression in Xenopus of KCNJ2 carrying ATS‐associated mutations causes CFAs in the same structures affected in humans, changes the normal pattern of membrane voltage potential regionalization in the developing face and disrupts expression of important craniofacial patterning genes, revealing the endogenous control of craniofacial patterning by bioelectric cell states. By altering cells’ resting potentials using other ion translocators, we show that a change in ectodermal voltage, not tied to a specific protein or ion, is sufficient to cause CFAs. By adapting optogenetics for use in non‐neural cells in embryos, we show that developmentally patterned K+ flux is required for correct regionalization of the resting potentials and for establishment of endogenous early gene expression domains in the anterior ectoderm, and that variants in KCNJ2 disrupt this regionalization, leading to the CFAs seen in ATS patients. PMID:26864374

  11. Species differences in brain gene expression profiles associated with adult behavioral maturation in honey bees.

    PubMed

    Sen Sarma, Moushumi; Whitfield, Charles W; Robinson, Gene E

    2007-06-29

    Honey bees are known for several striking social behaviors, including a complex pattern of behavioral maturation that gives rise to an age-related colony division of labor and a symbolic dance language, by which successful foragers communicate the location of attractive food sources to their nestmates. Our understanding of honey bees is mostly based on studies of the Western honey bee, Apis mellifera, even though there are 9-10 other members of genus Apis, showing interesting variations in social behavior relative to A. mellifera. To facilitate future in-depth genomic and molecular level comparisons of behavior across the genus, we performed a microarray analysis of brain gene expression for A. mellifera and three key species found in Asia, A. cerana, A. florea and A. dorsata. For each species we compared brain gene expression patterns between foragers and adult one-day-old bees on an A. mellifera cDNA microarray and calculated within-species gene expression ratios to facilitate cross-species analysis. The number of cDNA spots showing hybridization fluorescence intensities above the experimental threshold was reduced by an average of 16% in the Asian species compared to A. mellifera, but an average of 71% of genes on the microarray were available for analysis. Brain gene expression profiles between foragers and one-day-olds showed differences that are consistent with a previous study on A. mellifera and were comparable across species. Although 1772 genes showed significant differences in expression between foragers and one-day-olds, only 218 genes showed differences in forager/one-day-old expression between species (p < 0.001). Principal Components Analysis revealed dominant patterns of expression that clearly distinguished between the four species but did not reflect known differences in behavior and ecology. There were species differences in brain expression profiles for functionally related groups of genes. We conclude that the A. mellifera cDNA microarray can be used effectively for cross-species comparisons within the genus. Our results indicate that there is a widespread conservation of the molecular processes in the honey bee brain underlying behavioral maturation. Species differences in brain expression profiles for functionally related groups of genes provide possible clues to the basis of behavioral variation in the genus.

  12. Antagonizing the Spemann organizer: role of the homeobox gene Xvent-1.

    PubMed Central

    Gawantka, V; Delius, H; Hirschfeld, K; Blumenstock, C; Niehrs, C

    1995-01-01

    We have identified a novel homeobox gene, Xvent-1, that is differentially expressed in the ventral marginal zone of the early Xenopus gastrula. Evidence is presented from mRNA microinjection experiments for a role for this gene in dorsoventral patterning of mesoderm. First, Xvent-1 is induced by BMP-4, a gene known to be a key regulator of ventral mesoderm development. Second, Xvent-1 and the organizer-specific gene goosecoid are able to interact, directly or indirectly, in a cross-regulatory loop suppressing each other's expression, consistent with their mutually exclusive expression in the marginal zone. Third, microinjection of Xvent-1 mRNA ventralizes dorsal mesoderm. The results suggest that Xvent-1 functions in a ventral signaling pathway that maintains the ventral mesodermal state and antagonizes the Spemann organizer. Images PMID:8557046

  13. Isoform-level gene expression patterns in single-cell RNA-sequencing data.

    PubMed

    Vu, Trung Nghia; Wills, Quin F; Kalari, Krishna R; Niu, Nifang; Wang, Liewei; Pawitan, Yudi; Rantalainen, Mattias

    2018-02-27

    RNA sequencing of single cells enables characterization of transcriptional heterogeneity in seemingly homogeneous cell populations. Single-cell sequencing has been applied in a wide range of researches fields. However, few studies have focus on characterization of isoform-level expression patterns at the single-cell level. In this study we propose and apply a novel method, ISOform-Patterns (ISOP), based on mixture modeling, to characterize the expression patterns of isoform pairs from the same gene in single-cell isoform-level expression data. We define six principal patterns of isoform expression relationships and describe a method for differential-pattern analysis. We demonstrate ISOP through analysis of single-cell RNA-sequencing data from a breast cancer cell line, with replication in three independent datasets. We assigned the pattern types to each of 16,562 isoform-pairs from 4,929 genes. Among those, 26% of the discovered patterns were significant (p<0.05), while remaining patterns are possibly effects of transcriptional bursting, drop-out and stochastic biological heterogeneity. Furthermore, 32% of genes discovered through differential-pattern analysis were not detected by differential-expression analysis. The effect of drop-out events, mean expression level, and properties of the expression distribution on the performances of ISOP were also investigated through simulated datasets. To conclude, ISOP provides a novel approach for characterization of isoformlevel preference, commitment and heterogeneity in single-cell RNA-sequencing data. The ISOP method has been implemented as a R package and is available at https://github.com/nghiavtr/ISOP under a GPL-3 license. mattias.rantalainen@ki.se. Supplementary data are available at Bioinformatics online.

  14. FoxP2 expression in the cerebellum and inferior olive: development of the transverse stripe-shaped expression pattern in the mouse cerebellar cortex.

    PubMed

    Fujita, Hirofumi; Sugihara, Izumi

    2012-02-15

    Many molecules are expressed heterogeneously in subpopulations of cerebellar Purkinje cells (PCs) and inferior olive (IO) neurons during development or in adulthood. These expression patterns are often organized in longitudinal stripes in the cerebellar cortex, which may be related to functional compartmentalization. FoxP2, a transcription factor, is expressed in PCs and IO neurons, but the details of its expression pattern remain unclear. Here we examined FoxP2 expression patterns systematically by immunostaining serial sections of the hindbrain from embryonic day 14.5 to adulthood in mice. FoxP2 was highly expressed in virtually all PCs at and before postnatal day 6 (P6), except for those in the flocculus and small parts of the nodulus (vermal lobule X), where FoxP2 expression was moderate or absent. After P6, FoxP2 expression gradually diminished in PCs in some areas. In adults, FoxP2 was expressed, less intensely than in earlier stages, in subsets of PCs that were mostly arranged transversely along the folial apices. In contrast, FoxP2 was expressed intensely in most IO neurons during development and in adulthood. FoxP2 was also expressed in a small population of neurons in the cerebellar nuclei. FoxP2 expression in adult rats and chicks was generally comparable to that in adult mice, suggesting evolutionary conservation of the expression pattern. Thus, the FoxP2 expression pattern reflects new transverse compartmentalization in the adult cerebellar cortex, although its functional significance remains unclear. Copyright © 2011 Wiley-Liss, Inc.

  15. Dorsoventral patterning in hemichordates: insights into early chordate evolution.

    PubMed

    Lowe, Christopher J; Terasaki, Mark; Wu, Michael; Freeman, Robert M; Runft, Linda; Kwan, Kristen; Haigo, Saori; Aronowicz, Jochanan; Lander, Eric; Gruber, Chris; Smith, Mark; Kirschner, Marc; Gerhart, John

    2006-09-01

    We have compared the dorsoventral development of hemichordates and chordates to deduce the organization of their common ancestor, and hence to identify the evolutionary modifications of the chordate body axis after the lineages split. In the hemichordate embryo, genes encoding bone morphogenetic proteins (Bmp) 2/4 and 5/8, as well as several genes for modulators of Bmp activity, are expressed in a thin stripe of ectoderm on one midline, historically called "dorsal." On the opposite midline, the genes encoding Chordin and Anti-dorsalizing morphogenetic protein (Admp) are expressed. Thus, we find a Bmp-Chordin developmental axis preceding and underlying the anatomical dorsoventral axis of hemichordates, adding to the evidence from Drosophila and chordates that this axis may be at least as ancient as the first bilateral animals. Numerous genes encoding transcription factors and signaling ligands are expressed in the three germ layers of hemichordate embryos in distinct dorsoventral domains, such as pox neuro, pituitary homeobox, distalless, and tbx2/3 on the Bmp side and netrin, mnx, mox, and single-minded on the Chordin-Admp side. When we expose the embryo to excess Bmp protein, or when we deplete endogenous Bmp by small interfering RNA injections, these expression domains expand or contract, reflecting their activation or repression by Bmp, and the embryos develop as dorsalized or ventralized limit forms. Dorsoventral patterning is independent of anterior/posterior patterning, as in Drosophila but not chordates. Unlike both chordates and Drosophila, neural gene expression in hemichordates is not repressed by high Bmp levels, consistent with their development of a diffuse rather than centralized nervous system. We suggest that the common ancestor of hemichordates and chordates did not use its Bmp-Chordin axis to segregate epidermal and neural ectoderm but to pattern many other dorsoventral aspects of the germ layers, including neural cell fates within a diffuse nervous system. Accordingly, centralization was added in the chordate line by neural-epidermal segregation, mediated by the pre-existing Bmp-Chordin axis. Finally, since hemichordates develop the mouth on the non-Bmp side, like arthropods but opposite to chordates, the mouth and Bmp-Chordin axis may have rearranged in the chordate line, one relative to the other.

  16. Dorsoventral Patterning in Hemichordates: Insights into Early Chordate Evolution

    PubMed Central

    Lowe, Christopher J; Terasaki, Mark; Wu, Michael; Freeman, Robert M; Runft, Linda; Kwan, Kristen; Haigo, Saori; Aronowicz, Jochanan; Lander, Eric; Gruber, Chris; Smith, Mark; Kirschner, Marc; Gerhart, John

    2006-01-01

    We have compared the dorsoventral development of hemichordates and chordates to deduce the organization of their common ancestor, and hence to identify the evolutionary modifications of the chordate body axis after the lineages split. In the hemichordate embryo, genes encoding bone morphogenetic proteins (Bmp) 2/4 and 5/8, as well as several genes for modulators of Bmp activity, are expressed in a thin stripe of ectoderm on one midline, historically called “dorsal.” On the opposite midline, the genes encoding Chordin and Anti-dorsalizing morphogenetic protein (Admp) are expressed. Thus, we find a Bmp-Chordin developmental axis preceding and underlying the anatomical dorsoventral axis of hemichordates, adding to the evidence from Drosophila and chordates that this axis may be at least as ancient as the first bilateral animals. Numerous genes encoding transcription factors and signaling ligands are expressed in the three germ layers of hemichordate embryos in distinct dorsoventral domains, such as pox neuro, pituitary homeobox, distalless, and tbx2/3 on the Bmp side and netrin, mnx, mox, and single-minded on the Chordin-Admp side. When we expose the embryo to excess Bmp protein, or when we deplete endogenous Bmp by small interfering RNA injections, these expression domains expand or contract, reflecting their activation or repression by Bmp, and the embryos develop as dorsalized or ventralized limit forms. Dorsoventral patterning is independent of anterior/posterior patterning, as in Drosophila but not chordates. Unlike both chordates and Drosophila, neural gene expression in hemichordates is not repressed by high Bmp levels, consistent with their development of a diffuse rather than centralized nervous system. We suggest that the common ancestor of hemichordates and chordates did not use its Bmp-Chordin axis to segregate epidermal and neural ectoderm but to pattern many other dorsoventral aspects of the germ layers, including neural cell fates within a diffuse nervous system. Accordingly, centralization was added in the chordate line by neural-epidermal segregation, mediated by the pre-existing Bmp-Chordin axis. Finally, since hemichordates develop the mouth on the non-Bmp side, like arthropods but opposite to chordates, the mouth and Bmp-Chordin axis may have rearranged in the chordate line, one relative to the other. PMID:16933975

  17. Molecular cloning of a C-type lectin (LvLT) from the shrimp Litopenaeus vannamei: early gene down-regulation after WSSV infection.

    PubMed

    Ma, Tracy Hoi Tung; Tiu, Shirley Hiu Kwan; He, Jian-Guo; Chan, Siu-Ming

    2007-08-01

    C-type lectin is one of the pattern-recognition proteins of the non-self innate immune system in the invertebrates. In this study, a lectin-like cDNA (LvLT) of Litopenaeus vannamei was cloned and characterized. LvLT cDNA consists of 1035 nt encoding for a protein with 345 amino acid residues. The deduced LvLT consists of two putative carbohydrate-recognition domains (CRDs) as found in most C-type lectins. The first CRD consists of an amino acid motif (QPD) for the binding of galactose and the other CRDs consist of amino acid motifs (EPN) for the binding of mannose. Except for some conserved amino acid residues, the CRD of LvLT shared an overall low amino acid sequence identity with CRDs of other lectins. Unlike other shrimp lectins, LvLT is expressed only in the hepatopancreas but not in the hemocytes as revealed by RT-PCR. When juvenile shrimp were challenged with shrimp extracts containing white spot syndrome virus (WSSV), the expression levels of LvLT decreased initially in the first 2 h and then increased to a much higher level after 4 h. The results suggest that the initial reduction in LvLT transcript level may be related to the WSSV infection in shrimp.

  18. Culture Conditions Affect Expression of DUX4 in FSHD Myoblasts.

    PubMed

    Pandey, Sachchida Nand; Khawaja, Hunain; Chen, Yi-Wen

    2015-05-08

    Facioscapulohumeral muscular dystrophy (FSHD) is believed to be caused by aberrant expression of double homeobox 4 (DUX4) due to epigenetic changes of the D4Z4 region at chromosome 4q35. Detecting DUX4 is challenging due to its stochastic expression pattern and low transcription level. In this study, we examined different cDNA synthesis strategies and the sensitivity for DUX4 detection. In addition, we investigated the effects of dexamethasone and knockout serum replacement (KOSR) on DUX4 expression in culture. Our data showed that DUX4 was consistently detected in cDNA samples synthesized using Superscript III. The sensitivity of DUX4 detection was higher in the samples synthesized using oligo(dT) primers compared to random hexamers. Adding dexamethasone to the culture media significantly suppressed DUX4 expression in immortalized (1.3 fold, p < 0.01) and primary (4.7 fold, p < 0.01) FSHD myoblasts, respectively. Culture medium with KOSR increased DUX4 expression and the response is concentration dependent. The findings suggest that detection strategies and culture conditions should be carefully considered when studying DUX4 in cultured cells.

  19. Low-level image properties in facial expressions.

    PubMed

    Menzel, Claudia; Redies, Christoph; Hayn-Leichsenring, Gregor U

    2018-06-04

    We studied low-level image properties of face photographs and analyzed whether they change with different emotional expressions displayed by an individual. Differences in image properties were measured in three databases that depicted a total of 167 individuals. Face images were used either in their original form, cut to a standard format or superimposed with a mask. Image properties analyzed were: brightness, redness, yellowness, contrast, spectral slope, overall power and relative power in low, medium and high spatial frequencies. Results showed that image properties differed significantly between expressions within each individual image set. Further, specific facial expressions corresponded to patterns of image properties that were consistent across all three databases. In order to experimentally validate our findings, we equalized the luminance histograms and spectral slopes of three images from a given individual who showed two expressions. Participants were significantly slower in matching the expression in an equalized compared to an original image triad. Thus, existing differences in these image properties (i.e., spectral slope, brightness or contrast) facilitate emotion detection in particular sets of face images. Copyright © 2018. Published by Elsevier B.V.

  20. Insights into the Sesquiterpenoid Pathway by Metabolic Profiling and De novo Transcriptome Assembly of Stem-Chicory (Cichorium intybus Cultigroup “Catalogna”)

    PubMed Central

    Testone, Giulio; Mele, Giovanni; Di Giacomo, Elisabetta; Gonnella, Maria; Renna, Massimiliano; Tenore, Gian Carlo; Nicolodi, Chiara; Frugis, Giovanna; Iannelli, Maria Adelaide; Arnesi, Giuseppe; Schiappa, Alessandro; Giannino, Donato

    2016-01-01

    Stem-chicory of the “Catalogna” group is a vegetable consumed for bitter-flavored stems. Type and levels of bitter sesquiterpene lactones (STLs) participate in conferring bitterness in vegetables. The content of lactucin—and lactucopocrin-like STLs was higher in “Molfettese” than “Galatina” landrace stalks, regardless of the cultivation sites, consistently with bitterness scores and gustative differences. The “Galatina” transcriptome assembly resulted in 58,872 unigenes, 77% of which were annotated, paving the way to molecular investigation of the STL pathway. Comparative transcriptome analysis allowed the identification of 69,352 SNPs and of 1640 differentially expressed genes that maintained the pattern independently of the site. Enrichment analyses revealed that 4 out of 29 unigenes were up-regulated in “Molfettese” vs “Galatina” within the sesquiterpenoid pathway. The expression of two germacrene A -synthase (GAS) and one -oxidase (GAO) genes of the costunolide branch correlated positively with the contents of lactucin-like molecules, supporting that STL biosynthesis regulation occurs at the transcriptional level. Finally, 46 genes encoding transcription factors (TFs) maintained a differential expression pattern between the two varieties regardless of the growth site; correlation analyses among TFs, GAS, GAO gene expressions and STLs contents suggest that one MYB and one bHLH may act in the pathway. PMID:27877190

  1. Expression of Vitis amurensis VaERF20 in Arabidopsis thaliana Improves Resistance to Botrytis cinerea and Pseudomonas syringae pv. Tomato DC3000.

    PubMed

    Wang, Mengnan; Zhu, Yanxun; Han, Rui; Yin, Wuchen; Guo, Chunlei; Li, Zhi; Wang, Xiping

    2018-03-01

    Ethylene response factor (ERF) transcription factors play important roles in regulating immune responses in plants. In our study, we characterized a member of the ERF transcription factor family, VaERF20 , from the Chinese wild Vitis genotype, V. amurensis Rupr "Shuangyou". Phylogenetic analysis indicated that VaERF20 belongs to group IXc of the ERF family, in which many members are known to contribute to fighting pathogen infection. Consistent with this, expression of VaERF20 was induced by treatment with the necrotrophic fungal pathogen Botrytis cinerea (B. cinerea ) in "Shuangyou" and V. vinifera "Red Globe". Arabidopsis thaliana plants over-expressing VaERF20 displayed enhanced resistance to B. cinerea and the bacterium Pseudomonas syringae pv. tomato ( Pst ) DC3000. Patterns of pathogen-induced reactive oxygen species (ROS) accumulation were entirely distinct in B. cinerea and Pst DC3000 inoculated plants. Examples of both salicylic acid (SA) and jasmonic acid/ethylene (JA/ET) responsive defense genes were up-regulated after B. cinerea and Pst DC3000 inoculation of the VaERF20 -overexpressing transgenic A. thaliana plants. Evidence of pattern-triggered immunity (PTI), callose accumulation and stomatal defense, together with increased expression of PTI genes, was also greater in the transgenic lines. These data indicate that VaERF20 participates in various signal transduction pathways and acts as an inducer of immune responses.

  2. From cytoskeletal dynamics to organ asymmetry: a nonlinear, regulative pathway underlies left-right patterning.

    PubMed

    McDowell, Gary; Rajadurai, Suvithan; Levin, Michael

    2016-12-19

    Consistent left-right (LR) asymmetry is a fundamental aspect of the bodyplan across phyla, and errors of laterality form an important class of human birth defects. Its molecular underpinning was first discovered as a sequential pathway of left- and right-sided gene expression that controlled positioning of the heart and visceral organs. Recent data have revised this picture in two important ways. First, the physical origin of chirality has been identified; cytoskeletal dynamics underlie the asymmetry of single-cell behaviour and patterning of the LR axis. Second, the pathway is not linear: early disruptions that alter the normal sidedness of upstream asymmetric genes do not necessarily induce defects in the laterality of the downstream genes or in organ situs Thus, the LR pathway is a unique example of two fascinating aspects of biology: the interplay of physics and genetics in establishing large-scale anatomy, and regulative (shape-homeostatic) pathways that correct molecular and anatomical errors over time. Here, we review aspects of asymmetry from its intracellular, cytoplasmic origins to the recently uncovered ability of the LR control circuitry to achieve correct gene expression and morphology despite reversals of key 'determinant' genes. We provide novel functional data, in Xenopus laevis, on conserved elements of the cytoskeleton that drive asymmetry, and comparatively analyse it together with previously published results in the field. Our new observations and meta-analysis demonstrate that despite aberrant expression of upstream regulatory genes, embryos can progressively normalize transcriptional cascades and anatomical outcomes. LR patterning can thus serve as a paradigm of how subcellular physics and gene expression cooperate to achieve developmental robustness of a body axis.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Author(s).

  3. From cytoskeletal dynamics to organ asymmetry: a nonlinear, regulative pathway underlies left–right patterning

    PubMed Central

    Rajadurai, Suvithan

    2016-01-01

    Consistent left–right (LR) asymmetry is a fundamental aspect of the bodyplan across phyla, and errors of laterality form an important class of human birth defects. Its molecular underpinning was first discovered as a sequential pathway of left- and right-sided gene expression that controlled positioning of the heart and visceral organs. Recent data have revised this picture in two important ways. First, the physical origin of chirality has been identified; cytoskeletal dynamics underlie the asymmetry of single-cell behaviour and patterning of the LR axis. Second, the pathway is not linear: early disruptions that alter the normal sidedness of upstream asymmetric genes do not necessarily induce defects in the laterality of the downstream genes or in organ situs. Thus, the LR pathway is a unique example of two fascinating aspects of biology: the interplay of physics and genetics in establishing large-scale anatomy, and regulative (shape-homeostatic) pathways that correct molecular and anatomical errors over time. Here, we review aspects of asymmetry from its intracellular, cytoplasmic origins to the recently uncovered ability of the LR control circuitry to achieve correct gene expression and morphology despite reversals of key ‘determinant’ genes. We provide novel functional data, in Xenopus laevis, on conserved elements of the cytoskeleton that drive asymmetry, and comparatively analyse it together with previously published results in the field. Our new observations and meta-analysis demonstrate that despite aberrant expression of upstream regulatory genes, embryos can progressively normalize transcriptional cascades and anatomical outcomes. LR patterning can thus serve as a paradigm of how subcellular physics and gene expression cooperate to achieve developmental robustness of a body axis. This article is part of the themed issue ‘Provocative questions in left–right asymmetry’. PMID:27821521

  4. Artemisinin resistance in Plasmodium falciparum is associated with an altered temporal pattern of transcription

    PubMed Central

    2011-01-01

    Background Artemisinin resistance in Plasmodium falciparum malaria has emerged in Western Cambodia. This is a major threat to global plans to control and eliminate malaria as the artemisinins are a key component of antimalarial treatment throughout the world. To identify key features associated with the delayed parasite clearance phenotype, we employed DNA microarrays to profile the physiological gene expression pattern of the resistant isolates. Results In the ring and trophozoite stages, we observed reduced expression of many basic metabolic and cellular pathways which suggests a slower growth and maturation of these parasites during the first half of the asexual intraerythrocytic developmental cycle (IDC). In the schizont stage, there is an increased expression of essentially all functionalities associated with protein metabolism which indicates the prolonged and thus increased capacity of protein synthesis during the second half of the resistant parasite IDC. This modulation of the P. falciparum intraerythrocytic transcriptome may result from differential expression of regulatory proteins such as transcription factors or chromatin remodeling associated proteins. In addition, there is a unique and uniform copy number variation pattern in the Cambodian parasites which may represent an underlying genetic background that contributes to the resistance phenotype. Conclusions The decreased metabolic activities in the ring stages are consistent with previous suggestions of higher resilience of the early developmental stages to artemisinin. Moreover, the increased capacity of protein synthesis and protein turnover in the schizont stage may contribute to artemisinin resistance by counteracting the protein damage caused by the oxidative stress and/or protein alkylation effect of this drug. This study reports the first global transcriptional survey of artemisinin resistant parasites and provides insight to the complexities of the molecular basis of pathogens with drug resistance phenotypes in vivo. PMID:21810278

  5. Precipitation, temperature, and teleconnection signals across the combined North American, Monsoon Asia, and Old World Drought Atlases

    NASA Astrophysics Data System (ADS)

    Smerdon, J. E.; Baek, S. H.; Coats, S.; Williams, P.; Cook, B.; Cook, E. R.; Seager, R.

    2017-12-01

    The tree-ring-based North American Drought Atlas (NADA), Monsoon Asia Drought Atlas (MADA), and Old World Drought Atlas (OWDA) collectively yield a near-hemispheric gridded reconstruction of hydroclimate variability over the last millennium. To test the robustness of the large-scale representation of hydroclimate variability across the drought atlases, the joint expression of seasonal climate variability and teleconnections in the NADA, MADA, and OWDA are compared against two global, observation-based PDSI products. Predominantly positive (negative) correlations are determined between seasonal precipitation (surface air temperature) and collocated tree-ring-based PDSI, with average Pearson's correlation coefficients increasing in magnitude from boreal winter to summer. For precipitation, these correlations tend to be stronger in the boreal winter and summer when calculated for the observed PDSI record, while remaining similar for temperature. Notwithstanding these differences, the drought atlases robustly express teleconnection patterns associated with the El Niño-Southern Oscillation (ENSO), North Atlantic Oscillation (NAO), Pacific Decadal Oscillation (PDO), and Atlantic Multidecadal Oscillation (AMO). These expressions exist in the drought atlas estimates of boreal summer PDSI despite the fact that these modes of climate variability are dominant in boreal winter, with the exception of the Atlantic Multidecadal Oscillation. ENSO and NAO teleconnection patterns in the drought atlases are particularly consistent with their well-known dominant expressions in boreal winter and over the OWDA domain, respectively. Collectively, our findings confirm that the joint Northern Hemisphere drought atlases robustly reflect large-scale patterns of hydroclimate variability on seasonal to multidecadal timescales over the 20th century and are likely to provide similarly robust estimates of hydroclimate variability prior to the existence of widespread instrumental data.

  6. Whole blood transcriptional profiling comparison between different milk yield of Chinese Holstein cows using RNA-seq data.

    PubMed

    Bai, Xue; Zheng, Zhuqing; Liu, Bin; Ji, Xiaoyang; Bai, Yongsheng; Zhang, Wenguang

    2016-08-22

    The objective of this research was to investigate the variation of gene expression in the blood transcriptome profile of Chinese Holstein cows associated to the milk yield traits. We used RNA-seq to generate the bovine transcriptome from the blood of 23 lactating Chinese Holstein cows with extremely high and low milk yield. A total of 100 differentially expressed genes (DEGs) (p < 0.05, FDR < 0.05) were revealed between the high and low groups. Gene ontology (GO) analysis demonstrated that the 100 DEGs were enriched in specific biological processes with regard to defense response, immune response, inflammatory response, icosanoid metabolic process, and fatty acid metabolic process (p < 0.05). The KEGG pathway analysis with 100 DEGs revealed that the most statistically-significant metabolic pathway was related with Toll-like receptor signaling pathway (p < 0.05). The expression level of four selected DEGs was analyzed by qRT-PCR, and the results indicated that the expression patterns were consistent with the deep sequencing results by RNA-Seq. Furthermore, alternative splicing analysis of 100 DEGs demonstrated that there were different splicing pattern between high and low yielders. The alternative 3' splicing site was the major splicing pattern detected in high yielders. However, in low yielders the major type was exon skipping. This study provides a non-invasive method to identify the DEGs in cattle blood using RNA-seq for milk yield. The revealed 100 DEGs between Holstein cows with extremely high and low milk yield, and immunological pathway are likely involved in milk yield trait. Finally, this study allowed us to explore associations between immune traits and production traits related to milk production.

  7. Cryptochromes and Hormone Signal Transduction under Near-Zero Magnetic Fields: New Clues to Magnetic Field Effects in a Rice Planthopper.

    PubMed

    Wan, Gui-Jun; Wang, Wen-Jing; Xu, Jing-Jing; Yang, Quan-Feng; Dai, Ming-Jiang; Zhang, Feng-Jiao; Sword, Gregory A; Pan, Wei-Dong; Chen, Fa-Jun

    2015-01-01

    Although there are considerable reports of magnetic field effects (MFE) on organisms, very little is known so far about the MFE-related signal transduction pathways. Here we establish a manipulative near-zero magnetic field (NZMF) to investigate the potential signal transduction pathways involved in MFE. We show that exposure of migratory white-backed planthopper, Sogatella furcifera, to the NZMF results in delayed egg and nymphal development, increased frequency of brachypterous females, and reduced longevity of macropterous female adults. To understand the changes in gene expression underlying these phenotypes, we examined the temporal patterns of gene expression of (i) CRY1 and CRY2 as putative magnetosensors, (ii) JHAMT, FAMeT and JHEH in the juvenile hormone pathway, (iii) CYP307A1 in the ecdysone pathway, and (iv) reproduction-related Vitellogenin (Vg). The significantly altered gene expression of CRY1 and CRY2 under the NZMF suggest their developmental stage-specific patterns and potential upstream location in magnetic response. Gene expression patterns of JHAMT, JHEH and CYP307A1 were consistent with the NZMF-triggered delay in nymphal development, higher proportion of brachypterous female adults, and the shortened longevity of macropterous female adults, which show feasible links between hormone signal transduction and phenotypic MFE. By conducting manipulative NZMF experiments, our study suggests an important role of the geomagnetic field (GMF) in modulating development and physiology of insects, provides new insights into the complexity of MFE-magnetosensitivity interactions, and represents an initial but crucial step forward in understanding the molecular basis of cryptochromes and hormone signal transduction involved in MFE.

  8. Preferential Allele Expression Analysis Identifies Shared Germline and Somatic Driver Genes in Advanced Ovarian Cancer

    PubMed Central

    Halabi, Najeeb M.; Martinez, Alejandra; Al-Farsi, Halema; Mery, Eliane; Puydenus, Laurence; Pujol, Pascal; Khalak, Hanif G.; McLurcan, Cameron; Ferron, Gwenael; Querleu, Denis; Al-Azwani, Iman; Al-Dous, Eman; Mohamoud, Yasmin A.; Malek, Joel A.; Rafii, Arash

    2016-01-01

    Identifying genes where a variant allele is preferentially expressed in tumors could lead to a better understanding of cancer biology and optimization of targeted therapy. However, tumor sample heterogeneity complicates standard approaches for detecting preferential allele expression. We therefore developed a novel approach combining genome and transcriptome sequencing data from the same sample that corrects for sample heterogeneity and identifies significant preferentially expressed alleles. We applied this analysis to epithelial ovarian cancer samples consisting of matched primary ovary and peritoneum and lymph node metastasis. We find that preferentially expressed variant alleles include germline and somatic variants, are shared at a relatively high frequency between patients, and are in gene networks known to be involved in cancer processes. Analysis at a patient level identifies patient-specific preferentially expressed alleles in genes that are targets for known drugs. Analysis at a site level identifies patterns of site specific preferential allele expression with similar pathways being impacted in the primary and metastasis sites. We conclude that genes with preferentially expressed variant alleles can act as cancer drivers and that targeting those genes could lead to new therapeutic strategies. PMID:26735499

  9. Profiling and Quantifying Differential Gene Transcription Provide Insights into Ganoderic Acid Biosynthesis in Ganoderma lucidum in Response to Methyl Jasmonate

    PubMed Central

    Shi, Liang; Mu, Da-Shuai; Jiang, Ai-Liang; Han, Qin; Zhao, Ming-Wen

    2013-01-01

    Ganoderma lucidum is a mushroom with traditional medicinal properties that has been widely used in China and other countries in Eastern Asia. Ganoderic acids (GA) produced by G. lucidum exhibit important pharmacological activities. Previous studies have demonstrated that methyl jasmonate (MeJA) is a potent inducer of GA biosynthesis and the expression of genes involved in the GA biosynthesis pathway in G. lucidum. To further explore the mechanism of GA biosynthesis, cDNA-Amplified Fragment Length Polymorphism (cDNA-AFLP) was used to identify genes that are differentially expressed in response to MeJA. Using 64 primer combinations, over 3910 transcriptionally derived fragments (TDFs) were obtained. Reliable sequence data were obtained for 390 of 458 selected TDFs. Ninety of these TDFs were annotated with known functions through BLASTX searching the GenBank database, and 12 annotated TDFs were assigned into secondary metabolic pathways by searching the KEGGPATHWAY database. Twenty-five TDFs were selected for qRT-PCR analysis to confirm the expression patterns observed with cDNA-AFLP. The qRT-PCR results were consistent with the altered patterns of gene expression revealed by the cDNA-AFLP technique. Additionally, the transcript levels of 10 genes were measured at the mycelium, primordia, and fruiting body developmental stages of G. lucidum. The greatest expression levels were reached during primordia for all of the genes except cytochrome b2 reached its highest expression level in the mycelium stage. This study not only identifies new candidate genes involved in the regulation of GA biosynthesis but also provides further insight into MeJA-induced gene expression and secondary metabolic response in G. lucidum. PMID:23762280

  10. Nipbl and mediator cooperatively regulate gene expression to control limb development.

    PubMed

    Muto, Akihiko; Ikeda, Shingo; Lopez-Burks, Martha E; Kikuchi, Yutaka; Calof, Anne L; Lander, Arthur D; Schilling, Thomas F

    2014-09-01

    Haploinsufficiency for Nipbl, a cohesin loading protein, causes Cornelia de Lange Syndrome (CdLS), the most common "cohesinopathy". It has been proposed that the effects of Nipbl-haploinsufficiency result from disruption of long-range communication between DNA elements. Here we use zebrafish and mouse models of CdLS to examine how transcriptional changes caused by Nipbl deficiency give rise to limb defects, a common condition in individuals with CdLS. In the zebrafish pectoral fin (forelimb), knockdown of Nipbl expression led to size reductions and patterning defects that were preceded by dysregulated expression of key early limb development genes, including fgfs, shha, hand2 and multiple hox genes. In limb buds of Nipbl-haploinsufficient mice, transcriptome analysis revealed many similar gene expression changes, as well as altered expression of additional classes of genes that play roles in limb development. In both species, the pattern of dysregulation of hox-gene expression depended on genomic location within the Hox clusters. In view of studies suggesting that Nipbl colocalizes with the mediator complex, which facilitates enhancer-promoter communication, we also examined zebrafish deficient for the Med12 Mediator subunit, and found they resembled Nipbl-deficient fish in both morphology and gene expression. Moreover, combined partial reduction of both Nipbl and Med12 had a strongly synergistic effect, consistent with both molecules acting in a common pathway. In addition, three-dimensional fluorescent in situ hybridization revealed that Nipbl and Med12 are required to bring regions containing long-range enhancers into close proximity with the zebrafish hoxda cluster. These data demonstrate a crucial role for Nipbl in limb development, and support the view that its actions on multiple gene pathways result from its influence, together with Mediator, on regulation of long-range chromosomal interactions.

  11. Gene expression profiling reveals distinct molecular signatures associated with the rupture of intracranial aneurysm.

    PubMed

    Nakaoka, Hirofumi; Tajima, Atsushi; Yoneyama, Taku; Hosomichi, Kazuyoshi; Kasuya, Hidetoshi; Mizutani, Tohru; Inoue, Ituro

    2014-08-01

    The rupture of intracranial aneurysm (IA) causes subarachnoid hemorrhage associated with high morbidity and mortality. We compared gene expression profiles in aneurysmal domes between unruptured IAs and ruptured IAs (RIAs) to elucidate biological mechanisms predisposing to the rupture of IA. We determined gene expression levels of 8 RIAs, 5 unruptured IAs, and 10 superficial temporal arteries with the Agilent microarrays. To explore biological heterogeneity of IAs, we classified the samples into subgroups showing similar gene expression patterns, using clustering methods. The clustering analysis identified 4 groups: superficial temporal arteries and unruptured IAs were aggregated into their own clusters, whereas RIAs segregated into 2 distinct subgroups (early and late RIAs). Comparing gene expression levels between early RIAs and unruptured IAs, we identified 430 upregulated and 617 downregulated genes in early RIAs. The upregulated genes were associated with inflammatory and immune responses and phagocytosis including S100/calgranulin genes (S100A8, S100A9, and S100A12). The downregulated genes suggest mechanical weakness of aneurysm walls. The expressions of Krüppel-like family of transcription factors (KLF2, KLF12, and KLF15), which were anti-inflammatory regulators, and CDKN2A, which was located on chromosome 9p21 that was the most consistently replicated locus in genome-wide association studies of IA, were also downregulated. We demonstrate that gene expression patterns of RIAs were different according to the age of patients. The results suggest that macrophage-mediated inflammation is a key biological pathway for IA rupture. The identified genes can be good candidates for molecular markers of rupture-prone IAs and therapeutic targets. © 2014 American Heart Association, Inc.

  12. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants

    PubMed Central

    Hook, Sharon E.; Skillman, Ann D.; Small, Jack A.; Schultz, Irvin R.

    2008-01-01

    The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4′-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1–3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA’s. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as “expression signatures”. The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action. PMID:16488489

  13. Gene expression patterns in rainbow trout, Oncorhynchus mykiss, exposed to a suite of model toxicants.

    PubMed

    Hook, Sharon E; Skillman, Ann D; Small, Jack A; Schultz, Irvin R

    2006-05-25

    The increased availability and use of DNA microarrays has allowed the characterization of gene expression patterns associated with exposure to different toxicants. An important question is whether toxicant induced changes in gene expression in fish are sufficiently diverse to allow for identification of specific modes of action and/or specific contaminants. In theory, each class of toxicant may generate a gene expression profile unique to its mode of toxic action. In this study, isogenic (cloned) rainbow trout Oncorhynchus mykiss were exposed to sublethal levels of a series of model toxicants with varying modes of action, including ethynylestradiol (xeno-estrogen), 2,2,4,4'-tetrabromodiphenyl ether (BDE-47, thyroid active), diquat (oxidant stressor), chromium VI, and benzo[a]pyrene (BaP) for a period of 1-3 weeks. An additional experiment measured trenbolone (anabolic steroid; model androgen) induced gene expression changes in sexually mature female trout. Following exposure, fish were euthanized, livers removed and RNA extracted. Fluorescently labeled cDNA were generated and hybridized against a commercially available Atlantic Salmon/Trout array (GRASP project, University of Victoria) spotted with 16,000 cDNA's. The slides were scanned to measure abundance of a given transcript in each sample relative to controls. Data were analyzed via Genespring (Silicon Genetics) to identify a list of up- and downregulated genes, as well as to determine gene clustering patterns that can be used as "expression signatures". The results indicate each toxicant exposure caused between 64 and 222 genes to be significantly altered in expression. Most genes exhibiting altered expression responded to only one of the toxicants and relatively few were co-expressed in multiple treatments. For example, BaP and Diquat, both of which exert toxicity via oxidative stress, upregulated 28 of the same genes, of over 100 genes altered by either treatment. Other genes associated with steroidogenesis, p450 and estrogen responsive genes appear to be useful for selectively identifying toxicant mode of action in fish, suggesting a link between gene expression profile and mode of toxicity. Our array results showed good agreement with quantitative real time polymerase chain reaction (qRT PCR), which demonstrates that the arrays are an accurate measure of gene expression. The specificity of the gene expression profile in response to a model toxicant, the link between genes with altered expression and mode of toxic action, and the consistency between array and qRT PCR results all suggest that cDNA microarrays have the potential to screen environmental contaminants for biomarkers and mode of toxic action.

  14. Gene expression underlying adaptive variation in Heliconius wing patterns: non-modular regulation of overlapping cinnabar and vermilion prepatterns.

    PubMed

    Reed, Robert D; McMillan, W Owen; Nagy, Lisa M

    2008-01-07

    Geographical variation in the mimetic wing patterns of the butterfly Heliconius erato is a textbook example of adaptive polymorphism; however, little is known about how this variation is controlled developmentally. Using microarrays and qPCR, we identified and compared expression of candidate genes potentially involved with a red/yellow forewing band polymorphism in H. erato. We found that transcripts encoding the pigment synthesis enzymes cinnabar and vermilion showed pattern- and polymorphism-related expression patterns, respectively. cinnabar expression was associated with the forewing band regardless of pigment colour, providing the first gene expression pattern known to be correlated with a major Heliconius colour pattern. In contrast, vermilion expression changed spatially over time in red-banded butterflies, but was not expressed at detectable levels in yellow-banded butterflies, suggesting that regulation of this gene may be involved with the red/yellow polymorphism. Furthermore, we found that the yellow pigment, 3-hydroxykynurenine, is incorporated into wing scales from the haemolymph rather than being synthesized in situ. We propose that some aspects of Heliconius colour patterns are determined by spatio-temporal overlap of pigment gene transcription prepatterns and speculate that evolutionary changes in vermilion regulation may in part underlie an adaptive colour pattern polymorphism.

  15. Age and prior blood feeding of Anopheles gambiae influences their susceptibility and gene expression patterns to ivermectin-containing blood meals.

    PubMed

    Seaman, Jonathan A; Alout, Haoues; Meyers, Jacob I; Stenglein, Mark D; Dabiré, Roch K; Lozano-Fuentes, Saul; Burton, Timothy A; Kuklinski, Wojtek S; Black, William C; Foy, Brian D

    2015-10-15

    Ivermectin has been proposed as a novel malaria transmission control tool based on its insecticidal properties and unique route of acquisition through human blood. To maximize ivermectin's effect and identify potential resistance/tolerance mechanisms, it is important to understand its effect on mosquito physiology and potential to shift mosquito population age-structure. We therefore investigated ivermectin susceptibility and gene expression changes in several age groups of female Anopheles gambiae mosquitoes. The effect of aging on ivermectin susceptibility was analyzed in three age groups (2, 6, and 14-days) of colonized female Anopheles gambiaemosquitoes using standard survivorship assays. Gene expression patterns were then analyzed by transcriptome sequencing on an Illumina HiSeq 2500 platform. RT-qPCR was used to validate transcriptional changes and also to examine expression in a different, colonized strain and in wild mosquitoes, both of which blood fed naturally on an ivermectin-treated person. Mosquitoes of different ages and blood meal history died at different frequencies after ingesting ivermectin. Mortality was lowest in 2-day old mosquitoes exposed on their first blood meal and highest in 6-day old mosquitoes exposed on their second blood meal. Twenty-four hours following ivermectin ingestion, 101 and 187 genes were differentially-expressed relative to control blood-fed, in 2 and 6-day groups, respectively. Transcription patterns of select genes were similar in membrane-fed, colonized, and naturally-fed wild vectors. Transcripts from several unexpected functional classes were highly up-regulated, including Niemann-Pick Type C (NPC) genes, peritrophic matrix-associated genes, and immune-response genes, and these exhibited different transcription patterns between age groups, which may explain the observed susceptibility differences. Niemann-Pick Type 2 genes were the most highly up-regulated transcripts after ivermectin ingestion (up to 160 fold) and comparing phylogeny to transcriptional patterns revealed that NPCs have rapidly evolved and separate members respond to either blood meals or to ivermectin. We present evidence of increased ivermectin susceptibility in older An. gambiae mosquitoes that had previously bloodfed. Differential expression analysis suggests complex midgut interactions resulting from ivermectin ingestion that likely involve blood meal digestion physiological responses, midgut microflora, and innate immune responses. Thus, the transcription of certain gene families is consistently affected by ivermectin ingestion, and may provide important clues to ivermectin's broad effects on malaria vectors. These findings contribute to the growing understanding of ivermectin's potential as a transmission control tool.

  16. GEsture: an online hand-drawing tool for gene expression pattern search.

    PubMed

    Wang, Chunyan; Xu, Yiqing; Wang, Xuelin; Zhang, Li; Wei, Suyun; Ye, Qiaolin; Zhu, Youxiang; Yin, Hengfu; Nainwal, Manoj; Tanon-Reyes, Luis; Cheng, Feng; Yin, Tongming; Ye, Ning

    2018-01-01

    Gene expression profiling data provide useful information for the investigation of biological function and process. However, identifying a specific expression pattern from extensive time series gene expression data is not an easy task. Clustering, a popular method, is often used to classify similar expression genes, however, genes with a 'desirable' or 'user-defined' pattern cannot be efficiently detected by clustering methods. To address these limitations, we developed an online tool called GEsture. Users can draw, or graph a curve using a mouse instead of inputting abstract parameters of clustering methods. GEsture explores genes showing similar, opposite and time-delay expression patterns with a gene expression curve as input from time series datasets. We presented three examples that illustrate the capacity of GEsture in gene hunting while following users' requirements. GEsture also provides visualization tools (such as expression pattern figure, heat map and correlation network) to display the searching results. The result outputs may provide useful information for researchers to understand the targets, function and biological processes of the involved genes.

  17. The sleeping patterns of Head Start children and the influence on developmental outcomes.

    PubMed

    Schlieber, M; Han, J

    2018-05-01

    Sleep has a significant influence on children's development. The objective of this study was to investigate Head Start children's sleeping patterns and the impact on cognitive and behavioural outcomes. Using the 2009 cohort of the Head Start Family and Child Experiences Survey (N = 2,868), information on sleeping patterns was assessed through parent interviews. Cognitive outcomes were assessed using direct assessments (Peabody Picture Vocabulary Test-IV, the Expressive One-Word Picture Vocabulary Test, and Subtests of the Woodcock-Johnson III) in addition to teacher report. Behavioural outcomes were assessed through parent and teacher reports. A multiple regression analysis was performed for each outcome variable. Descriptive findings showed that 89% of children had a regular bedtime at least 4 days per week and that the average amount of sleep per night was 10.41 hr. White mothers were more likely than other racial groups to adhere to a consistent bedtime, and maternal employment predicted less hour of sleep per night. Multiple regression analyses revealed that disrupted sleep had a negative influence on cognitive outcomes, especially in areas of mathematical problem solving, receptive language, teacher-reported literacy behaviours, and approaches to learning. Disrupted sleep was associated with the risk of misbehaviour by increasing teacher and parent ratings on aggressive behaviours, hyperactivity, and withdrawing in addition to decreased scores on overall social skills. Having an inconsistent bedtime negatively predicted expressive vocabulary and teacher-reported literacy behaviours. The findings of this study support the influential role of sleep on children's development. Sleeping through the night and having a consistent bedtime were found to be predictive of many areas of cognitive and behavioural development. Head Start staff can provide the supports to increase parental knowledge on appropriate child sleep practices. © 2017 John Wiley & Sons Ltd.

  18. Expression and Activity of Breast Cancer Resistance Protein (BCRP/ABCG2) in Human Distal Lung Epithelial Cells In Vitro.

    PubMed

    Nickel, Sabrina; Selo, Mohammed Ali; Fallack, Juliane; Clerkin, Caoimhe G; Huwer, Hanno; Schneider-Daum, Nicole; Lehr, Claus-Michael; Ehrhardt, Carsten

    2017-12-01

    Breast cancer resistance protein (BCRP/ABCG2) has previously been identified with high expression levels in human lung. The subcellular localisation and functional activity of the transporter in lung epithelia, however, remains poorly investigated. The aim of this project was to study BCRP expression and activity in freshly isolated human alveolar epithelial type 2 (AT2) and type 1-like (AT1-like) cells in primary culture, and to compare these findings with data obtained from the NCI-H441 cell line. BCRP expression levels in AT2 and AT1-like cells and in different passages of NCI-H441 cells were determined using q-PCR and immunoblot. Transporter localisation was confirmed by confocal laser scanning microscopy. Efflux and transport studies using the BCRP substrate BODIPY FL prazosin and the inhibitor Ko143 were carried out to assess BCRP activity in the different cell models. BCRP expression decreased during transdifferentiation from AT2 to AT1-like phenotype. Culturing NCI-H441 cells at an air-liquid interface or submersed did not change BCRP abundance, however, BCRP levels increased with passage number. BCRP was localised to the apical membrane and cytosol in NCI-H441 cells. In primary cells, the protein was found predominantly in the nucleus. Functional studies were consistent with expression data. BCRP is differently expressed in AT2 and AT1-like cells with lower abundance and activity in the latter ones. Nuclear BCRP might play a transcriptional role in distal lung epithelium. In NCI-H441 cells, BCRP is expressed in apical cell membranes and its activity is consistent with the localisation pattern.

  19. Critical fault patterns determination in fault-tolerant computer systems

    NASA Technical Reports Server (NTRS)

    Mccluskey, E. J.; Losq, J.

    1978-01-01

    The method proposed tries to enumerate all the critical fault-patterns (successive occurrences of failures) without analyzing every single possible fault. The conditions for the system to be operating in a given mode can be expressed in terms of the static states. Thus, one can find all the system states that correspond to a given critical mode of operation. The next step consists in analyzing the fault-detection mechanisms, the diagnosis algorithm and the process of switch control. From them, one can find all the possible system configurations that can result from a failure occurrence. Thus, one can list all the characteristics, with respect to detection, diagnosis, and switch control, that failures must have to constitute critical fault-patterns. Such an enumeration of the critical fault-patterns can be directly used to evaluate the overall system tolerance to failures. Present research is focused on how to efficiently make use of these system-level characteristics to enumerate all the failures that verify these characteristics.

  20. Intra- and extracellular lipid composition and associated gene expression patterns during pollen development in Brassica napus.

    PubMed

    Piffanelli, P; Ross, J H; Murphy, D J

    1997-03-01

    Pollen development in angiosperms is regulated by the interaction of products contributed by both the gametophytic (haploid) and sporophytic (diploid) genomes. In entomophilous species, lipids are major products of both sporophytic and gametophytic metabolism during pollen development. Mature pollen grains of Brassica napus are shown to contain three major acyl lipid pools as follows: (i) the extracellular tryphine mainly consisting of medium-chain neutral esters; (ii) the intracellular membranes, particularly endoplasmic reticulum, mainly containing phospholipids; and (iii) the intracellular storage lipids, which are mostly triacylglycerols. This paper reports on the kinetics of accumulation of these lipid classes during pollen maturation and the expression patterns of several lipid biosynthetic genes and their protein products that are differentially regulated in developing microspores/ pollen grains (gametophyte) and tapetal cells (sporophyte) of B. napus. Detailed analysis of three members of the stearoyl-ACP desaturase (sad) gene family by Northern blotting, in situ hybridization and RT-PCR showed that the same individual genes were expressed both in gametophytic and sporophytic tissues, although under different temporal regulation. In the tapetum, maximal expression of two marker genes for lipid biosynthesis (sad and ear) occurred at a bud length of 2-3 mm, and the corresponding gene products SAD and EAR were detected by Western blotting in 3-4 mm buds, coinciding with the maximal rates of tapetal lipid accumulation. These lipids are released following tapetal cell disintegration and are relocated to form the major structural component of the extracellular tryphine layer that coats the mature pollen grain. In contrast, in developing microspores/pollen grains, maximal expression of the lipid marker genes sad, ear, acp and cyb5 was at the 3-5 mm bud stages, with the SAD and EAR gene products detected in 4-7 mm buds. This pattern of expression coincided with accumulation of the intracellular storage and membrane lipid components of pollen. These results suggest that, although the same genes may be expressed in the sporophytic tapetal cells and in gametophytic tissues, they are regulated differentially leading to the production of the various contrasting lipidic structures that are assembled together to give rise to a viable, fertile pollen grain.

  1. Sex Chromosome Dosage Compensation in Heliconius Butterflies: Global yet Still Incomplete?

    PubMed Central

    Walters, James R.; Hardcastle, Thomas J.; Jiggins, Chris D.

    2015-01-01

    The evolution of heterogametic sex chromosomes is often—but not always—accompanied by the evolution of dosage compensating mechanisms that mitigate the impact of sex-specific gene dosage on levels of gene expression. One emerging view of this process is that such mechanisms may only evolve in male-heterogametic (XY) species but not in female-heterogametic (ZW) species, which will consequently exhibit “incomplete” sex chromosome dosage compensation. However, recent results suggest that at least some Lepidoptera (moths and butterflies) may prove to be an exception to this prediction. Studies in bombycoid moths indicate the presence of a chromosome-wide epigenetic mechanism that effectively balances Z chromosome gene expression between the sexes by reducing Z-linked expression in males. In contrast, strong sex chromosome dosage effects without any reduction in male Z-linked expression were previously reported in a pyralid moth, suggesting a lack of any such dosage compensating mechanism. Here we report an analysis of sex chromosome dosage compensation in Heliconius butterflies, sampling multiple individuals for several different adult tissues (head, abdomen, leg, mouth, and antennae). Methodologically, we introduce a novel application of linear mixed-effects models to assess dosage compensation, offering a unified statistical framework that can estimate effects specific to chromosome, to sex, and their interactions (i.e., a dosage effect). Our results show substantially reduced Z-linked expression relative to autosomes in both sexes, as previously observed in bombycoid moths. This observation is consistent with an increasing body of evidence that some lepidopteran species possess an epigenetic dosage compensating mechanism that reduces Z chromosome expression in males to levels comparable with females. However, this mechanism appears to be imperfect in Heliconius, resulting in a modest dosage effect that produces an average 5–20% increase in male expression relative to females on the Z chromosome, depending on the tissue. Thus our results in Heliconius reflect a mixture of previous patterns reported for Lepidoptera. In Heliconius, a moderate pattern of incomplete dosage compensation persists apparently despite the presence of an epigenetic dosage compensating mechanism. The chromosomal distributions of sex-biased genes show an excess of male-biased and a dearth of female-biased genes on the Z chromosome relative to autosomes, consistent with predictions of sexually antagonistic evolution. PMID:26338190

  2. Differential Responses to Wnt and PCP Disruption Predict Expression and Developmental Function of Conserved and Novel Genes in a Cnidarian

    PubMed Central

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-01-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at “oral” and “aboral” poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes. PMID:25233086

  3. Differential responses to Wnt and PCP disruption predict expression and developmental function of conserved and novel genes in a cnidarian.

    PubMed

    Lapébie, Pascal; Ruggiero, Antonella; Barreau, Carine; Chevalier, Sandra; Chang, Patrick; Dru, Philippe; Houliston, Evelyn; Momose, Tsuyoshi

    2014-09-01

    We have used Digital Gene Expression analysis to identify, without bilaterian bias, regulators of cnidarian embryonic patterning. Transcriptome comparison between un-manipulated Clytia early gastrula embryos and ones in which the key polarity regulator Wnt3 was inhibited using morpholino antisense oligonucleotides (Wnt3-MO) identified a set of significantly over and under-expressed transcripts. These code for candidate Wnt signaling modulators, orthologs of other transcription factors, secreted and transmembrane proteins known as developmental regulators in bilaterian models or previously uncharacterized, and also many cnidarian-restricted proteins. Comparisons between embryos injected with morpholinos targeting Wnt3 and its receptor Fz1 defined four transcript classes showing remarkable correlation with spatiotemporal expression profiles. Class 1 and 3 transcripts tended to show sustained expression at "oral" and "aboral" poles respectively of the developing planula larva, class 2 transcripts in cells ingressing into the endodermal region during gastrulation, while class 4 gene expression was repressed at the early gastrula stage. The preferential effect of Fz1-MO on expression of class 2 and 4 transcripts can be attributed to Planar Cell Polarity (PCP) disruption, since it was closely matched by morpholino knockdown of the specific PCP protein Strabismus. We conclude that endoderm and post gastrula-specific gene expression is particularly sensitive to PCP disruption while Wnt-/β-catenin signaling dominates gene regulation along the oral-aboral axis. Phenotype analysis using morpholinos targeting a subset of transcripts indicated developmental roles consistent with expression profiles for both conserved and cnidarian-restricted genes. Overall our unbiased screen allowed systematic identification of regionally expressed genes and provided functional support for a shared eumetazoan developmental regulatory gene set with both predicted and previously unexplored members, but also demonstrated that fundamental developmental processes including axial patterning and endoderm formation in cnidarians can involve newly evolved (or highly diverged) genes.

  4. Bladder Cancer-associated Protein, a Potential Prognostic Biomarker in Human Bladder Cancer*

    PubMed Central

    Moreira, José M. A.; Ohlsson, Gita; Gromov, Pavel; Simon, Ronald; Sauter, Guido; Celis, Julio E.; Gromova, Irina

    2010-01-01

    It is becoming increasingly clear that no single marker will have the sensitivity and specificity necessary to be used on its own for diagnosis/prognosis of tumors. Interpatient and intratumor heterogeneity provides overwhelming odds against the existence of such an ideal marker. With this in mind, our laboratory has been applying a long term systematic approach to identify multiple biomarkers that can be used for clinical purposes. As a result of these studies, we have identified and reported several candidate biomarker proteins that are deregulated in bladder cancer. Following the conceptual biomarker development phases proposed by the Early Detection Research Network, we have taken some of the most promising candidate proteins into postdiscovery validation studies, and here we report on the characterization of one such biomarker, the bladder cancer-associated protein (BLCAP), formerly termed Bc10. To characterize BLCAP protein expression and cellular localization patterns in benign bladder urothelium and urothelial carcinomas (UCs), we used two independent sets of samples from different patient cohorts: a reference set consisting of 120 bladder specimens (formalin-fixed as well as frozen biopsies) and a validation set consisting of 2,108 retrospectively collected UCs with long term clinical follow-up. We could categorize the UCs examined into four groups based on levels of expression and subcellular localization of BLCAP protein and showed that loss of BLCAP expression is associated with tumor progression. The results indicated that increased expression of this protein confers an adverse patient outcome, suggesting that categorization of staining patterns for this protein may have prognostic value. Finally, we applied a combinatorial two-marker discriminator using BLCAP and adipocyte-type fatty acid-binding protein, another UC biomarker previously reported by us, and found that the combination of the two markers correlated more closely with grade and/or stage of disease than the individual markers. The implications of these results in biomarker discovery are discussed. PMID:19783793

  5. Divergent and nonuniform gene expression patterns in mouse brain

    PubMed Central

    Morris, John A.; Royall, Joshua J.; Bertagnolli, Darren; Boe, Andrew F.; Burnell, Josh J.; Byrnes, Emi J.; Copeland, Cathy; Desta, Tsega; Fischer, Shanna R.; Goldy, Jeff; Glattfelder, Katie J.; Kidney, Jolene M.; Lemon, Tracy; Orta, Geralyn J.; Parry, Sheana E.; Pathak, Sayan D.; Pearson, Owen C.; Reding, Melissa; Shapouri, Sheila; Smith, Kimberly A.; Soden, Chad; Solan, Beth M.; Weller, John; Takahashi, Joseph S.; Overly, Caroline C.; Lein, Ed S.; Hawrylycz, Michael J.; Hohmann, John G.; Jones, Allan R.

    2010-01-01

    Considerable progress has been made in understanding variations in gene sequence and expression level associated with phenotype, yet how genetic diversity translates into complex phenotypic differences remains poorly understood. Here, we examine the relationship between genetic background and spatial patterns of gene expression across seven strains of mice, providing the most extensive cellular-resolution comparative analysis of gene expression in the mammalian brain to date. Using comprehensive brainwide anatomic coverage (more than 200 brain regions), we applied in situ hybridization to analyze the spatial expression patterns of 49 genes encoding well-known pharmaceutical drug targets. Remarkably, over 50% of the genes examined showed interstrain expression variation. In addition, the variability was nonuniformly distributed across strain and neuroanatomic region, suggesting certain organizing principles. First, the degree of expression variance among strains mirrors genealogic relationships. Second, expression pattern differences were concentrated in higher-order brain regions such as the cortex and hippocampus. Divergence in gene expression patterns across the brain could contribute significantly to variations in behavior and responses to neuroactive drugs in laboratory mouse strains and may help to explain individual differences in human responsiveness to neuroactive drugs. PMID:20956311

  6. Binary Gene Expression Patterning of the Molt Cycle: The Case of Chitin Metabolism

    PubMed Central

    Abehsera, Shai; Glazer, Lilah; Tynyakov, Jenny; Plaschkes, Inbar; Chalifa-Caspi, Vered; Khalaila, Isam; Aflalo, Eliahu D.; Sagi, Amir

    2015-01-01

    In crustaceans, like all arthropods, growth is accompanied by a molting cycle. This cycle comprises major physiological events in which mineralized chitinous structures are built and degraded. These events are in turn governed by genes whose patterns of expression are presumably linked to the molting cycle. To study these genes we performed next generation sequencing and constructed a molt-related transcriptomic library from two exoskeletal-forming tissues of the crayfish Cherax quadricarinatus, namely the gastrolith and the mandible cuticle-forming epithelium. To simplify the study of such a complex process as molting, a novel approach, binary patterning of gene expression, was employed. This approach revealed that key genes involved in the synthesis and breakdown of chitin exhibit a molt-related pattern in the gastrolith-forming epithelium. On the other hand, the same genes in the mandible cuticle-forming epithelium showed a molt-independent pattern of expression. Genes related to the metabolism of glucosamine-6-phosphate, a chitin precursor synthesized from simple sugars, showed a molt-related pattern of expression in both tissues. The binary patterning approach unfolds typical patterns of gene expression during the molt cycle of a crustacean. The use of such a simplifying integrative tool for assessing gene patterning seems appropriate for the study of complex biological processes. PMID:25919476

  7. Learning multiple variable-speed sequences in striatum via cortical tutoring.

    PubMed

    Murray, James M; Escola, G Sean

    2017-05-08

    Sparse, sequential patterns of neural activity have been observed in numerous brain areas during timekeeping and motor sequence tasks. Inspired by such observations, we construct a model of the striatum, an all-inhibitory circuit where sequential activity patterns are prominent, addressing the following key challenges: (i) obtaining control over temporal rescaling of the sequence speed, with the ability to generalize to new speeds; (ii) facilitating flexible expression of distinct sequences via selective activation, concatenation, and recycling of specific subsequences; and (iii) enabling the biologically plausible learning of sequences, consistent with the decoupling of learning and execution suggested by lesion studies showing that cortical circuits are necessary for learning, but that subcortical circuits are sufficient to drive learned behaviors. The same mechanisms that we describe can also be applied to circuits with both excitatory and inhibitory populations, and hence may underlie general features of sequential neural activity pattern generation in the brain.

  8. The pattern of circumferential and radial eruptive fissures on the volcanoes of Fernandina and Isabela islands, Galapagos

    USGS Publications Warehouse

    Chadwick, W.W.; Howard, K.A.

    1991-01-01

    Maps of the eruptive vents on the active shield volcanoes of Fernandina and Isabela islands, Galapagos, made from aerial photographs, display a distinctive pattern that consists of circumferential eruptive fissures around the summit calderas and radial fissures lower on the flanks. On some volcano flanks either circumferential or radial eruptions have been dominant in recent time. The location of circumferential vents outside the calderas is independent of caldera-related normal faults. The eruptive fissures are the surface expression of dike emplacement, and the dike orientations are interpreted to be controlled by the state of stress in the volcano. Very few subaerial volcanoes display a pattern of fissures similar to that of the Galapagos volcanoes. Some seamounts and shield volcanoes on Mars morphologically resemble the Galapagos volcanoes, but more specific evidence is needed to determine if they also share common structure and eruptive style. ?? 1991 Springer-Verlag.

  9. Identification of polycomb and trithorax group responsive elements in the regulatory region of the Drosophila homeotic gene Sex combs reduced

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gindhart, J.G. Jr.; Kaufman, T.C.

    1995-02-01

    The Drosophilia homeotic gene Sex combs reduced (Scr) is necessary for the establishment and maintenance of the morphological identity of the labial and prothoracic segments. In the early embryo, its expression pattern is established through the activity of several gap and segmentation gene products, as well as other transcription factors. Once established, the Polycomb group (Pc-G) and trithorax group (trx-G) gene products maintain the spatial pattern of Scr expression for the remainder of development. We report the identification of DNA fragments in the Scr regulatory region that may be important for its regulation by Polycomb and trithorax group gene products.more » When DNA fragments containing these regulatory sequences are subcloned into P-element vectors containing a white minigene, transformants containing these constructs exhibit mosaic patterns of pigmentation in the adult eye, indicating that white minigene expression is repressed in a clonally heritable manner. The size of pigmented and nonpigmented clones in the adult eye suggests that the event determining whether a cell in the eye anlagen will express white occurs at least as early as the first larval instar. The amount of white minigene repression is reduced in some Polycomb group mutants, whereas repression is enhanced in flies mutant for a subset of trithorax group loci. The repressor activity of one fragment, normally located in Scr Intron 2, is increased when it is able to homologously pair, a property consistent with genetic data suggesting that Scr exhibits transvection. Another Scr regulatory fragment, normally located 40 kb upstream of the Scr promoter, silences ectopic expression of an Scr-lacZ fusion gene in the embryo and does so in a Polycomb-dependent manner. We propose that the regulatory sequences located within these DNA fragments may normally mediate the regulation of Scr by proteins encoded by members of Polycomb and trithorax group loci. 98 refs., 6 figs., 4 tabs.« less

  10. Meta-analyses of microarrays of Arabidopsis asymmetric leaves1 (as1), as2 and their modifying mutants reveal a critical role for the ETT pathway in stabilization of adaxial-abaxial patterning and cell division during leaf development.

    PubMed

    Takahashi, Hiro; Iwakawa, Hidekazu; Ishibashi, Nanako; Kojima, Shoko; Matsumura, Yoko; Prananingrum, Pratiwi; Iwasaki, Mayumi; Takahashi, Anna; Ikezaki, Masaya; Luo, Lilan; Kobayashi, Takeshi; Machida, Yasunori; Machida, Chiyoko

    2013-03-01

    It is necessary to use algorithms to analyze gene expression data from DNA microarrays, such as in clustering and machine learning. Previously, we developed the knowledge-based fuzzy adaptive resonance theory (KB-FuzzyART), a clustering algorithm suitable for analyzing gene expression data, to find clues for identifying gene networks. Leaf primordia form around the shoot apical meristem (SAM), which consists of indeterminate stem cells. Upon initiation of leaf development, adaxial-abaxial patterning is crucial for lateral expansion, via cellular proliferation, and the formation of flat symmetric leaves. Many regulatory genes that specify such patterning have been identified. Analysis by the KB-FuzzyART and subsequent molecular and genetic analyses previously showed that ASYMMETRIC LEAVES1 (AS1) and AS2 repress the expression of some abaxial-determinant genes, such as AUXIN RESPONSE FACTOR3 (ARF3)/ETTIN (ETT) and ARF4, which are responsible for defects in leaf adaxial-abaxial polarity in as1 and as2. In the present study, genetic analysis revealed that ARF3/ETT and ARF4 were regulated by modifier genes, BOBBER1 (BOB1) and ELONGATA3 (ELO3), together with AS1-AS2. We analyzed expression arrays with as2 elo3 and as2 bob1, and extracted genes downstream of ARF3/ETT by using KB-FuzzyART and molecular analyses. The results showed that expression of Kip-related protein (KRP) (for inhibitors of cyclin-dependent protein kinases) and Isopentenyltransferase (IPT) (for biosynthesis of cytokinin) genes were controlled by AS1-AS2 through ARF3/ETT and ARF4 functions, which suggests that the AS1-AS2-ETT pathway plays a critical role in controlling the cell division cycle and the biosynthesis of cytokinin around SAM to stabilize leaf development in Arabidopsis thaliana.

  11. Dominant inheritance of cerebral gigantism.

    PubMed

    Zonana, J; Sotos, J F; Romshe, C A; Fisher, D A; Elders, M J; Rimoin, D L

    1977-08-01

    Cerebral gigantism is a syndrome consisting of characteristic dysmorphic features, accelerated growth in early childhood, and variable degrees of mental retardation. Its etiology and pathogenesis have not been defined. Three families are presented with multiple affected members. The vertical transmission of the trait and equal expression in both sexes in these families indicates a genetic etiology with a dominant pattern of inheritance, probably autosomal. As in previously reported cases, extensive endocrine evaluation failed to define the pathogenesis of the accelerated growth present in this disorder.

  12. Histone modifications in the male germ line of Drosophila.

    PubMed

    Hennig, Wolfgang; Weyrich, Alexandra

    2013-02-22

    In the male germ line of Drosophila chromatin remains decondensed and highly transcribed during meiotic prophase until it is rapidly compacted. A large proportion of the cell cycle-regulated histone H3.1 is replaced by H3.3, a histone variant encoded outside the histone repeat cluster and not subject to cell cycle controlled expression. We investigated histone modification patterns in testes of D. melanogaster and D. hydei. In somatic cells of the testis envelope and in germ cells these modification patterns differ from those typically seen in eu- and heterochromatin of other somatic cells. During the meiotic prophase some modifications expected in active chromatin are not found or are found at low level. The absence of H4K16ac suggests that dosage compensation does not take place. Certain histone modifications correspond to either the cell cycle-regulated histone H3.1 or to the testis-specific variant H3.3. In spermatogonia we found H3K9 methylation in cytoplasmic histones, most likely corresponding to the H3.3 histone variant. Most histone modifications persist throughout the meiotic divisions. The majority of modifications persist until the early spermatid nuclei, and only a minority further persist until the final chromatin compaction stages before individualization of the spermatozoa. Histone modification patterns in the male germ line differ from expected patterns. They are consistent with an absence of dosage compensation of the X chromosome during the male meiotic prophase. The cell cycle-regulated histone variant H3.1 and H3.3, expressed throughout the cell cycle, also vary in their modification patterns. Postmeiotically, we observed a highly complex pattern of the histone modifications until late spermatid nuclear elongation stages. This may be in part due to postmeiotic transcription and in part to differential histone replacement during chromatin condensation.

  13. Pattern identification in time-course gene expression data with the CoGAPS matrix factorization.

    PubMed

    Fertig, Elana J; Stein-O'Brien, Genevieve; Jaffe, Andrew; Colantuoni, Carlo

    2014-01-01

    Patterns in time-course gene expression data can represent the biological processes that are active over the measured time period. However, the orthogonality constraint in standard pattern-finding algorithms, including notably principal components analysis (PCA), confounds expression changes resulting from simultaneous, non-orthogonal biological processes. Previously, we have shown that Markov chain Monte Carlo nonnegative matrix factorization algorithms are particularly adept at distinguishing such concurrent patterns. One such matrix factorization is implemented in the software package CoGAPS. We describe the application of this software and several technical considerations for identification of age-related patterns in a public, prefrontal cortex gene expression dataset.

  14. Altered feto-placental vascularization, feto-placental malperfusion and fetal growth restriction in mice with Egfl7 loss of function.

    PubMed

    Lacko, Lauretta A; Hurtado, Romulo; Hinds, Samantha; Poulos, Michael G; Butler, Jason M; Stuhlmann, Heidi

    2017-07-01

    EGFL7 is a secreted angiogenic factor produced by embryonic endothelial cells. To understand its role in placental development, we established a novel Egfl7 knockout mouse. The mutant mice have gross defects in chorioallantoic branching morphogenesis and placental vascular patterning. Microangiography and 3D imaging revealed patchy perfusion of Egfl7 -/- placentas marked by impeded blood conductance through sites of narrowed vessels. Consistent with poor feto-placental perfusion, Egfl7 knockout resulted in reduced placental weight and fetal growth restriction. The placentas also showed abnormal fetal vessel patterning and over 50% reduction in fetal blood space. In vitro , placental endothelial cells were deficient in migration, cord formation and sprouting. Expression of genes involved in branching morphogenesis, Gcm1 , Syna and Synb , and in patterning of the extracellular matrix, Mmrn1 , were temporally dysregulated in the placentas. Egfl7 knockout did not affect expression of the microRNA embedded within intron 7. Collectively, these data reveal that Egfl7 is crucial for placental vascularization and embryonic growth, and may provide insight into etiological factors underlying placental pathologies associated with intrauterine growth restriction, which is a significant cause of infant morbidity and mortality. © 2017. Published by The Company of Biologists Ltd.

  15. Differential Expression of HERV-K (HML-2) Proviruses in Cells and Virions of the Teratocarcinoma Cell Line Tera-1

    PubMed Central

    Bhardwaj, Neeru; Montesion, Meagan; Roy, Farrah; Coffin, John M.

    2015-01-01

    Human endogenous retrovirus (HERV-K (HML-2)) proviruses are among the few endogenous retroviral elements in the human genome that retain coding sequence. HML-2 expression has been widely associated with human disease states, including different types of cancers as well as with HIV-1 infection. Understanding of the potential impact of this expression requires that it be annotated at the proviral level. Here, we utilized the high throughput capabilities of next-generation sequencing to profile HML-2 expression at the level of individual proviruses and secreted virions in the teratocarcinoma cell line Tera-1. We identified well-defined expression patterns, with transcripts emanating primarily from two proviruses located on chromosome 22, only one of which was efficiently packaged. Interestingly, there was a preference for transcripts of recently integrated proviruses, over those from other highly expressed but older elements, to be packaged into virions. We also assessed the promoter competence of the 5’ long terminal repeats (LTRs) of expressed proviruses via a luciferase assay following transfection of Tera-1 cells. Consistent with the RNASeq results, we found that the activity of most LTRs corresponded to their transcript levels. PMID:25746218

  16. Parallels between Global Transcriptional Programs of Polarizing Caco-2 Intestinal Epithelial Cells In Vitro and Gene Expression Programs in Normal Colon and Colon Cancer

    PubMed Central

    Sääf, Annika M.; Halbleib, Jennifer M.; Chen, Xin; Yuen, Siu Tsan; Leung, Suet Yi

    2007-01-01

    Posttranslational mechanisms are implicated in the development of epithelial cell polarity, but little is known about the patterns of gene expression and transcriptional regulation during this process. We characterized temporal patterns of gene expression during cell–cell adhesion-initiated polarization of cultured human Caco-2 cells, which develop structural and functional polarity resembling enterocytes in vivo. A distinctive switch in gene expression patterns occurred upon formation of cell–cell contacts. Comparison to gene expression patterns in normal human colon and colon tumors revealed that the pattern in proliferating, nonpolarized Caco-2 cells paralleled patterns seen in human colon cancer in vivo, including expression of genes involved in cell proliferation. The pattern switched in polarized Caco-2 cells to one more closely resembling that in normal colon tissue, indicating that regulation of transcription underlying Caco-2 cell polarization is similar to that during enterocyte differentiation in vivo. Surprisingly, the temporal program of gene expression in polarizing Caco-2 cells involved changes in signaling pathways (e.g., Wnt, Hh, BMP, FGF) in patterns similar to those during migration and differentiation of intestinal epithelial cells in vivo, despite the absence of morphogen gradients and interactions with stromal cells characteristic of enterocyte differentiation in situ. The full data set is available at http://microarray-pubs.stanford.edu/CACO2. PMID:17699589

  17. Patterns of activity expressed by juvenile horseshoe crabs.

    PubMed

    Dubofsky, E A; Simpson, S D; Chabot, Christopher C; Watson, Winsor H

    2013-09-01

    Adult American horseshoe crabs, Limulus polyphemus, possess endogenous circadian and circatidal clocks controlling visual sensitivity and locomotion, respectively. The goal of this study was to determine the types of activity rhythms expressed by juvenile horseshoe crabs (n = 24) when exposed to a 14:10 light/dark cycle (LD) for 10 days, followed by 10 days of constant darkness (DD). Horseshoe crab activity was recorded with a digital time-lapse video system that used an infrared-sensitive camera so animals could be monitored at night. In LD, 15 animals expressed daily patterns of activity, 6 displayed a circatidal pattern, and the remaining 3 were arrhythmic. Of the 15 animals with daily patterns of locomotion, 7 had a significant preference (P < 0.05) for diurnal activity and 3 for nocturnal activity; the remainder did not express a significant preference for day or night activity. In DD, 13 horseshoe crabs expressed circatidal rhythms and 8 maintained a pattern of about 24 h. Although these results suggest the presence of a circadian clock influencing circatidal patterns of locomotion, these apparent circadian rhythms may actually represent the expression of just one of the two bouts of activity driven by the putative circalunidian clocks that control their tidal rhythms. Overall, these results indicate that, like adults, juvenile horseshoe crabs express both daily and tidal patterns of activity and that at least one, and maybe both, of these patterns is driven by endogenous clocks.

  18. MusTRD can regulate postnatal fiber-specific expression.

    PubMed

    Issa, Laura L; Palmer, Stephen J; Guven, Kim L; Santucci, Nicole; Hodgson, Vanessa R M; Popovic, Kata; Joya, Josephine E; Hardeman, Edna C

    2006-05-01

    Human MusTRD1alpha1 was isolated as a result of its ability to bind a critical element within the Troponin I slow upstream enhancer (TnIslow USE) and was predicted to be a regulator of slow fiber-specific genes. To test this hypothesis in vivo, we generated transgenic mice expressing hMusTRD1alpha1 in skeletal muscle. Adult transgenic mice show a complete loss of slow fibers and a concomitant replacement by fast IIA fibers, resulting in postural muscle weakness. However, developmental analysis demonstrates that transgene expression has no impact on embryonic patterning of slow fibers but causes a gradual postnatal slow to fast fiber conversion. This conversion was underpinned by a demonstrable repression of many slow fiber-specific genes, whereas fast fiber-specific gene expression was either unchanged or enhanced. These data are consistent with our initial predictions for hMusTRD1alpha1 and suggest that slow fiber genes contain a specific common regulatory element that can be targeted by MusTRD proteins.

  19. The endobacterium of an arbuscular mycorrhizal fungus modulates the expression of its toxin-antitoxin systems during the life cycle of its host.

    PubMed

    Salvioli di Fossalunga, Alessandra; Lipuma, Justine; Venice, Francesco; Dupont, Laurence; Bonfante, Paola

    2017-10-01

    Arbuscular mycorrhizal fungi (AMF) are widespread root symbionts that perform important ecological services, such as improving plant nutrient and water acquisition. Some AMF from the Gigasporaceae family host a population of endobacteria, Candidatus Glomeribacter gigasporarum (Cagg). The analysis of the Cagg genome identified six putative toxin-antitoxin modules (TAs), consisting of pairs of stable toxins and unstable antitoxins that affect diverse physiological functions. Sequence analysis suggested that these TA modules were acquired by horizontal transfer. Gene expression patterns of two TAs (yoeB/yefM and chpB/chpS) changed during the fungal life cycle, with the expression during the pre-symbiotic phase higher than during the symbiosis with the plant host. The heterologous expression in Escherichia coli demonstrated the functionality only for the YoeB-YefM pair. On the basis of these observations, we speculate that TA modules might help Cagg adapt to its intracellular habitat, coordinating its proliferation with the physiological state of the AMF host.

  20. Fractal Clustering and Knowledge-driven Validation Assessment for Gene Expression Profiling.

    PubMed

    Wang, Lu-Yong; Balasubramanian, Ammaiappan; Chakraborty, Amit; Comaniciu, Dorin

    2005-01-01

    DNA microarray experiments generate a substantial amount of information about the global gene expression. Gene expression profiles can be represented as points in multi-dimensional space. It is essential to identify relevant groups of genes in biomedical research. Clustering is helpful in pattern recognition in gene expression profiles. A number of clustering techniques have been introduced. However, these traditional methods mainly utilize shape-based assumption or some distance metric to cluster the points in multi-dimension linear Euclidean space. Their results shows poor consistence with the functional annotation of genes in previous validation study. From a novel different perspective, we propose fractal clustering method to cluster genes using intrinsic (fractal) dimension from modern geometry. This method clusters points in such a way that points in the same clusters are more self-affine among themselves than to the points in other clusters. We assess this method using annotation-based validation assessment for gene clusters. It shows that this method is superior in identifying functional related gene groups than other traditional methods.

  1. Non-canonical TAF complexes regulate active promoters in human embryonic stem cells.

    PubMed

    Maston, Glenn A; Zhu, Lihua Julie; Chamberlain, Lynn; Lin, Ling; Fang, Minggang; Green, Michael R

    2012-11-13

    The general transcription factor TFIID comprises the TATA-box-binding protein (TBP) and approximately 14 TBP-associated factors (TAFs). Here we find, unexpectedly, that undifferentiated human embryonic stem cells (hESCs) contain only six TAFs (TAFs 2, 3, 5, 6, 7 and 11), whereas following differentiation all TAFs are expressed. Directed and global chromatin immunoprecipitation analyses reveal an unprecedented promoter occupancy pattern: most active genes are bound by only TAFs 3 and 5 along with TBP, whereas the remaining active genes are bound by TBP and all six hESC TAFs. Consistent with these results, hESCs contain a previously undescribed complex comprising TAFs 2, 6, 7, 11 and TBP. Altering the composition of hESC TAFs, either by depleting TAFs that are present or ectopically expressing TAFs that are absent, results in misregulated expression of pluripotency genes and induction of differentiation. Thus, the selective expression and use of TAFs underlies the ability of hESCs to self-renew.DOI:http://dx.doi.org/10.7554/eLife.00068.001.

  2. AGL61 interacts with AGL80 and is required for central cell development in Arabidopsis.

    PubMed

    Steffen, Joshua G; Kang, Il-Ho; Portereiko, Michael F; Lloyd, Alan; Drews, Gary N

    2008-09-01

    The central cell of the female gametophyte plays a role in pollen tube guidance and in regulating the initiation of endosperm development. Following fertilization, the central cell gives rise to the seed's endosperm, which nourishes the developing embryo within the seed. The molecular mechanisms controlling specification and differentiation of the central cell are poorly understood. We identified AGL61 in a screen for transcription factor genes expressed in the female gametophyte. AGL61 encodes a Type I MADS domain protein, which likely functions as a transcription factor. Consistent with this, an AGL61-green fluorescent protein fusion protein is localized to the nucleus. In the context of the ovule and seed, AGL61 is expressed exclusively in the central cell and early endosperm. agl61 female gametophytes are affected in the central cell specifically. The morphological defects include an overall reduction in size of the central cell and a reduced or absent central cell vacuole. When fertilized with wild-type pollen, agl61 central cells fail to give rise to endosperm. In addition, synergid- and antipodal-expressed genes are ectopically expressed in agl61 central cells. The expression pattern and mutant phenotype of AGL61 are similar to those of AGL80, suggesting that AGL61 may function as a heterodimer with AGL80 within the central cell; consistent with this, AGL61 and AGL80 interact in yeast two-hybrid assays. Together, these data suggest that AGL61 functions as a transcription factor and controls the expression of downstream genes during central cell development.

  3. Characterization of Disease-Related Covariance Topographies with SSMPCA Toolbox: Effects of Spatial Normalization and PET Scanners

    PubMed Central

    Peng, Shichun; Ma, Yilong; Spetsieris, Phoebe G; Mattis, Paul; Feigin, Andrew; Dhawan, Vijay; Eidelberg, David

    2013-01-01

    In order to generate imaging biomarkers from disease-specific brain networks, we have implemented a general toolbox to rapidly perform scaled subprofile modeling (SSM) based on principal component analysis (PCA) on brain images of patients and normals. This SSMPCA toolbox can define spatial covariance patterns whose expression in individual subjects can discriminate patients from controls or predict behavioral measures. The technique may depend on differences in spatial normalization algorithms and brain imaging systems. We have evaluated the reproducibility of characteristic metabolic patterns generated by SSMPCA in patients with Parkinson's disease (PD). We used [18F]fluorodeoxyglucose PET scans from PD patients and normal controls. Motor-related (PDRP) and cognition-related (PDCP) metabolic patterns were derived from images spatially normalized using four versions of SPM software (spm99, spm2, spm5 and spm8). Differences between these patterns and subject scores were compared across multiple independent groups of patients and control subjects. These patterns and subject scores were highly reproducible with different normalization programs in terms of disease discrimination and cognitive correlation. Subject scores were also comparable in PD patients imaged across multiple PET scanners. Our findings confirm a very high degree of consistency among brain networks and their clinical correlates in PD using images normalized in four different SPM platforms. SSMPCA toolbox can be used reliably for generating disease-specific imaging biomarkers despite the continued evolution of image preprocessing software in the neuroimaging community. Network expressions can be quantified in individual patients independent of different physical characteristics of PET cameras. PMID:23671030

  4. Characterization of disease-related covariance topographies with SSMPCA toolbox: effects of spatial normalization and PET scanners.

    PubMed

    Peng, Shichun; Ma, Yilong; Spetsieris, Phoebe G; Mattis, Paul; Feigin, Andrew; Dhawan, Vijay; Eidelberg, David

    2014-05-01

    To generate imaging biomarkers from disease-specific brain networks, we have implemented a general toolbox to rapidly perform scaled subprofile modeling (SSM) based on principal component analysis (PCA) on brain images of patients and normals. This SSMPCA toolbox can define spatial covariance patterns whose expression in individual subjects can discriminate patients from controls or predict behavioral measures. The technique may depend on differences in spatial normalization algorithms and brain imaging systems. We have evaluated the reproducibility of characteristic metabolic patterns generated by SSMPCA in patients with Parkinson's disease (PD). We used [(18) F]fluorodeoxyglucose PET scans from patients with PD and normal controls. Motor-related (PDRP) and cognition-related (PDCP) metabolic patterns were derived from images spatially normalized using four versions of SPM software (spm99, spm2, spm5, and spm8). Differences between these patterns and subject scores were compared across multiple independent groups of patients and control subjects. These patterns and subject scores were highly reproducible with different normalization programs in terms of disease discrimination and cognitive correlation. Subject scores were also comparable in patients with PD imaged across multiple PET scanners. Our findings confirm a very high degree of consistency among brain networks and their clinical correlates in PD using images normalized in four different SPM platforms. SSMPCA toolbox can be used reliably for generating disease-specific imaging biomarkers despite the continued evolution of image preprocessing software in the neuroimaging community. Network expressions can be quantified in individual patients independent of different physical characteristics of PET cameras. Copyright © 2013 Wiley Periodicals, Inc.

  5. A framework for analyzing the relationship between gene expression and morphological, topological, and dynamical patterns in neuronal networks.

    PubMed

    de Arruda, Henrique Ferraz; Comin, Cesar Henrique; Miazaki, Mauro; Viana, Matheus Palhares; Costa, Luciano da Fontoura

    2015-04-30

    A key point in developmental biology is to understand how gene expression influences the morphological and dynamical patterns that are observed in living beings. In this work we propose a methodology capable of addressing this problem that is based on estimating the mutual information and Pearson correlation between the intensity of gene expression and measurements of several morphological properties of the cells. A similar approach is applied in order to identify effects of gene expression over the system dynamics. Neuronal networks were artificially grown over a lattice by considering a reference model used to generate artificial neurons. The input parameters of the artificial neurons were determined according to two distinct patterns of gene expression and the dynamical response was assessed by considering the integrate-and-fire model. As far as single gene dependence is concerned, we found that the interaction between the gene expression and the network topology, as well as between the former and the dynamics response, is strongly affected by the gene expression pattern. In addition, we observed a high correlation between the gene expression and some topological measurements of the neuronal network for particular patterns of gene expression. To our best understanding, there are no similar analyses to compare with. A proper understanding of gene expression influence requires jointly studying the morphology, topology, and dynamics of neurons. The proposed framework represents a first step towards predicting gene expression patterns from morphology and connectivity. Copyright © 2015. Published by Elsevier B.V.

  6. Involvement of glycosphingolipid-enriched lipid rafts in inflammatory responses.

    PubMed

    Iwabuchi, Kazuhisa

    2015-01-01

    Glycosphingolipids (GSLs) are membrane components consisting of hydrophobic ceramide and hydrophilic sugar moieties. GSLs cluster with cholesterol in cell membranes to form GSL-enriched lipid rafts. Biochemical analyses have demonstrated that GSL-enriched lipid rafts contain several kinds of transducer molecules, including Src family kinases. Among the GSLs, lactosylceramide (LacCer, CDw17) can bind to various microorganisms, is highly expressed on the plasma membranes of human phagocytes, and forms lipid rafts containing the Src family tyrosine kinase Lyn. LacCer-enriched lipid rafts mediate immunological and inflammatory reactions, including superoxide generation, chemotaxis, and non-opsonic phagocytosis. Therefore, LacCer-enriched membrane microdomains are thought to function as pattern recognition receptors (PRRs), which recognize pathogen-associated molecular patterns (PAMPs) expressed on microorganisms. LacCer also serves as a signal transduction molecule for functions mediated by CD11b/CD18-integrin (αM/β2-integrin, CR3, Mac-1), as well as being associated with several key cellular processes. LacCer recruits PCKα/ε and phospholipase A2 to stimulate PECAM-1 expression in human monocytes and their adhesion to endothelial cells, as well as regulating β1-integrin clustering and endocytosis on cell surfaces. This review describes the organizational and inflammation-related functions of LacCer-enriched lipid rafts.

  7. An Ancient Duplication of Apple MYB Transcription Factors Is Responsible for Novel Red Fruit-Flesh Phenotypes1[C][W

    PubMed Central

    Chagné, David; Lin-Wang, Kui; Espley, Richard V.; Volz, Richard K.; How, Natalie M.; Rouse, Simon; Brendolise, Cyril; Carlisle, Charmaine M.; Kumar, Satish; De Silva, Nihal; Micheletti, Diego; McGhie, Tony; Crowhurst, Ross N.; Storey, Roy D.; Velasco, Riccardo; Hellens, Roger P.; Gardiner, Susan E.; Allan, Andrew C.

    2013-01-01

    Anthocyanin accumulation is coordinated in plants by a number of conserved transcription factors. In apple (Malus × domestica), an R2R3 MYB transcription factor has been shown to control fruit flesh and foliage anthocyanin pigmentation (MYB10) and fruit skin color (MYB1). However, the pattern of expression and allelic variation at these loci does not explain all anthocyanin-related apple phenotypes. One such example is an open-pollinated seedling of cv Sangrado that has green foliage and develops red flesh in the fruit cortex late in maturity. We used methods that combine plant breeding, molecular biology, and genomics to identify duplicated MYB transcription factors that could control this phenotype. We then demonstrated that the red-flesh cortex phenotype is associated with enhanced expression of MYB110a, a paralog of MYB10. Functional characterization of MYB110a showed that it was able to up-regulate anthocyanin biosynthesis in tobacco (Nicotiana tabacum). The chromosomal location of MYB110a is consistent with a whole-genome duplication event that occurred during the evolution of apple within the Maloideae family. Both MYB10 and MYB110a have conserved function in some cultivars, but they differ in their expression pattern and response to fruit maturity. PMID:23096157

  8. Nkx2.5 regulates Endothelin Converting Enzyme-1 during pharyngeal arch patterning

    PubMed Central

    Iklé, Jennifer M.; Tavares, Andre L. P.; King, Marisol; Ding, Hailei; Colombo, Sophie; Firulli, Beth A.; Firulli, Anthony B.; Targoff, Kimara L.; Yelon, Deborah; Clouthier, David E.

    2017-01-01

    In gnathostomes, dorsoventral (D-V) patterning of neural crest cells (NCC) within the pharyngeal arches is crucial for the development of hinged jaws. One of the key signals that mediates this process is Endothelin-1 (EDN1). Loss of EDN1 binding to the Endothelin-A receptor (EDNRA) results in loss of EDNRA signaling and subsequent facial birth defects in humans, mice and zebrafish. A rate-limiting step in this crucial signaling pathway is the conversion of immature EDN1 into a mature active form by Endothelin converting enzyme-1 (ECE1). However, surprisingly little is known about how Ece1 transcription is induced or regulated. We show here that Nkx2.5 is required for proper craniofacial development in zebrafish and acts in part by upregulating ece1 expression. Disruption of nkx2.5 in zebrafish embryos results in defects in both ventral and dorsal pharyngeal arch-derived elements, with changes in ventral arch gene expression consistent with a disruption in Ednra signaling. ece1 mRNA rescues the nkx2.5 morphant phenotype, indicating that Nkx2.5 functions through modulating Ece1 expression or function. These studies illustrate a new function for Nkx2.5 in embryonic development and provide new avenues with which to pursue potential mechanisms underlying human facial disorders. PMID:28109039

  9. A new earthworm cellulase and its possible role in the innate immunity.

    PubMed

    Park, In Yong; Cha, Ju Roung; Ok, Suk-Mi; Shin, Chuog; Kim, Jin-Se; Kwak, Hee-Jin; Yu, Yun-Sang; Kim, Yu-Kyung; Medina, Brenda; Cho, Sung-Jin; Park, Soon Cheol

    2017-02-01

    A new endogenous cellulase (Ean-EG) from the earthworm, Eisenia andrei and its expression pattern are demonstrated. Based on a deduced amino acid sequence, the open reading frame (ORF) of Ean-EG consisted of 1368 bps corresponding to a polypeptide of 456 amino acid residues in which is contained the conserved region specific to GHF9 that has the essential amino acid residues for enzyme activity. In multiple alignments and phylogenetic analysis, the deduced amino acid sequence of Ean- EG showed the highest sequence similarity (about 79%) to that of an annelid (Pheretima hilgendorfi) and could be clustered together with other GHF9 cellulases, indicating that Ean-EG could be categorized as a member of the GHF9 to which most animal cellulases belong. The histological expression pattern of Ean-EG mRNA using in situ hybridization revealed that the most distinct expression was observed in epithelial cells with positive hybridization signal in epidermis, chloragogen tissue cells, coelomic cell-aggregate, and even blood vessel, which could strongly support the fact that at least in the earthworm, Eisenia andrei, cellulase function must not be limited to digestive process but be possibly extended to the innate immunity. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Functioning of Fluorescent Proteins in Aggregates in Anthozoa Species and in Recombinant Artificial Models

    PubMed Central

    Povarova, Natalia V.; Petri, Natalia D.; Blokhina, Anna E.; Bogdanov, Alexey M.; Lukyanov, Konstantin A.

    2017-01-01

    Despite great advances in practical applications of fluorescent proteins (FPs), their natural function is poorly understood. FPs display complex spatio-temporal expression patterns in living Anthozoa coral polyps. Here we applied confocal microscopy, specifically, the fluorescence recovery after photobleaching (FRAP) technique to analyze intracellular localization and mobility of endogenous FPs in live tissues. We observed three distinct types of protein distributions in living tissues. One type of distribution, characteristic for Anemonia, Discosoma and Zoanthus, is free, highly mobile cytoplasmic localization. Another pattern is seen in FPs localized to numerous intracellular vesicles, observed in Clavularia. The third most intriguing type of intracellular localization is with respect to the spindle-shaped aggregates and lozenge crystals several micrometers in size observed in Zoanthus samples. No protein mobility within those structures was detected by FRAP. This finding encouraged us to develop artificial aggregating FPs. We constructed “trio-FPs” consisting of three tandem copies of tetrameric FPs and demonstrated that they form multiple bright foci upon expression in mammalian cells. High brightness of the aggregates is advantageous for early detection of weak promoter activities. Simultaneously, larger aggregates can induce significant cytostatic and cytotoxic effects and thus such tags are not suitable for long-term and high-level expression. PMID:28704934

  11. Expression patterns, mutation detection and RNA interference of Rhopalosiphum padi voltage-gated sodium channel genes.

    PubMed

    Zuo, Yayun; Peng, Xiong; Wang, Kang; Lin, Fangfei; Li, Yuting; Chen, Maohua

    2016-07-21

    The voltage-gated sodium channel (VGSC) is the target of sodium-channel-blocking insecticides. Traditionally, animals were thought to have only one VGSC gene comprising a α-subunit with four homologous domains (DI-DIV). The present study showed that Rhopalosiphum padi, an economically important crop pest, owned a unique heterodimeric VGSC (H1 and H2 subunits) encoded by two genes (Rpvgsc1 and Rpvgsc2), which is unusual in insects and other animals. The open reading frame (ORF) of Rpvgsc1 consisted 1150 amino acids, and the ORF of Rpvgsc2 had 957 amino acids. Rpvgsc1 showed 64.1% amino acid identity to DI-DII of Drosophila melanogaster VGSC and Rpvgsc2 showed 64.0% amino acid identity to DIII-DIV of D. melanogaster VGSC. A M918L mutation previously reported in pyrethroids-resistant strains of other insects was found in the IIS4-S6 region of R. padi field sample. The two R. padi VGSC genes were expressed at all developmental stages and showed similar expression patterns after treatment with beta-cypermethrin. Knockdown of Rpvgsc1 or Rpvgsc2 caused significant reduction in mortality rate of R. padi after exposure to beta-cypermethrin. These findings suggest that the two R. padi VGSC genes are both functional genes.

  12. Expression patterns, mutation detection and RNA interference of Rhopalosiphum padi voltage-gated sodium channel genes

    NASA Astrophysics Data System (ADS)

    Zuo, Yayun; Peng, Xiong; Wang, Kang; Lin, Fangfei; Li, Yuting; Chen, Maohua

    2016-07-01

    The voltage-gated sodium channel (VGSC) is the target of sodium-channel-blocking insecticides. Traditionally, animals were thought to have only one VGSC gene comprising a α-subunit with four homologous domains (DI-DIV). The present study showed that Rhopalosiphum padi, an economically important crop pest, owned a unique heterodimeric VGSC (H1 and H2 subunits) encoded by two genes (Rpvgsc1 and Rpvgsc2), which is unusual in insects and other animals. The open reading frame (ORF) of Rpvgsc1 consisted 1150 amino acids, and the ORF of Rpvgsc2 had 957 amino acids. Rpvgsc1 showed 64.1% amino acid identity to DI-DII of Drosophila melanogaster VGSC and Rpvgsc2 showed 64.0% amino acid identity to DIII-DIV of D. melanogaster VGSC. A M918L mutation previously reported in pyrethroids-resistant strains of other insects was found in the IIS4-S6 region of R. padi field sample. The two R. padi VGSC genes were expressed at all developmental stages and showed similar expression patterns after treatment with beta-cypermethrin. Knockdown of Rpvgsc1 or Rpvgsc2 caused significant reduction in mortality rate of R. padi after exposure to beta-cypermethrin. These findings suggest that the two R. padi VGSC genes are both functional genes.

  13. Rapid increase in pertactin-deficient Bordetella pertussis isolates, Australia.

    PubMed

    Lam, Connie; Octavia, Sophie; Ricafort, Lawrence; Sintchenko, Vitali; Gilbert, Gwendolyn L; Wood, Nicholas; McIntyre, Peter; Marshall, Helen; Guiso, Nicole; Keil, Anthony D; Lawrence, Andrew; Robson, Jenny; Hogg, Geoff; Lan, Ruiting

    2014-04-01

    Acellular vaccines against Bordetella pertussis were introduced in Australia in 1997. By 2000, these vaccines had replaced whole-cell vaccines. During 2008-2012, a large outbreak of pertussis occurred. During this period, 30% (96/320) of B. pertussis isolates did not express the vaccine antigen pertactin (Prn). Multiple mechanisms of Prn inactivation were documented, including IS481 and IS1002 disruptions, a variation within a homopolymeric tract, and deletion of the prn gene. The mechanism of lack of expression of Prn in 16 (17%) isolates could not be determined at the sequence level. These findings suggest that B. pertussis not expressing Prn arose independently multiple times since 2008, rather than by expansion of a single Prn-negative clone. All but 1 isolate had ptxA1, prn2, and ptxP3, the alleles representative of currently circulating strains in Australia. This pattern is consistent with continuing evolution of B. pertussis in response to vaccine selection pressure.

  14. Long-range evolutionary constraints reveal cis-regulatory interactions on the human X chromosome

    PubMed Central

    Naville, Magali; Ishibashi, Minaka; Ferg, Marco; Bengani, Hemant; Rinkwitz, Silke; Krecsmarik, Monika; Hawkins, Thomas A.; Wilson, Stephen W.; Manning, Elizabeth; Chilamakuri, Chandra S. R.; Wilson, David I.; Louis, Alexandra; Lucy Raymond, F.; Rastegar, Sepand; Strähle, Uwe; Lenhard, Boris; Bally-Cuif, Laure; van Heyningen, Veronica; FitzPatrick, David R.; Becker, Thomas S.; Roest Crollius, Hugues

    2015-01-01

    Enhancers can regulate the transcription of genes over long genomic distances. This is thought to lead to selection against genomic rearrangements within such regions that may disrupt this functional linkage. Here we test this concept experimentally using the human X chromosome. We describe a scoring method to identify evolutionary maintenance of linkage between conserved noncoding elements and neighbouring genes. Chromatin marks associated with enhancer function are strongly correlated with this linkage score. We test >1,000 putative enhancers by transgenesis assays in zebrafish to ascertain the identity of the target gene. The majority of active enhancers drive a transgenic expression in a pattern consistent with the known expression of a linked gene. These results show that evolutionary maintenance of linkage is a reliable predictor of an enhancer's function, and provide new information to discover the genetic basis of diseases caused by the mis-regulation of gene expression. PMID:25908307

  15. Fear, anger, and risk.

    PubMed

    Lerner, J S; Keltner, D

    2001-07-01

    Drawing on an appraisal-tendency framework (J. S. Lerner & D. Keltner, 2000), the authors predicted and found that fear and anger have opposite effects on risk perception. Whereas fearful people expressed pessimistic risk estimates and risk-averse choices, angry people expressed optimistic risk estimates and risk-seeking choices. These opposing patterns emerged for naturally occurring and experimentally induced fear and anger. Moreover, estimates of angry people more closely resembled those of happy people than those of fearful people. Consistent with predictions, appraisal tendencies accounted for these effects: Appraisals of certainty and control moderated and (in the case of control) mediated the emotion effects. As a complement to studies that link affective valence to judgment outcomes, the present studies highlight multiple benefits of studying specific emotions.

  16. Identification of an osteoclast transcription factor that binds to the human T cell leukemia virus type I-long terminal repeat enhancer element.

    PubMed

    Inoue, D; Santiago, P; Horne, W C; Baron, R

    1997-10-03

    Transgenic mice expressing human T cell leukemia virus type I (HTLV-I)-tax under the control of HTLV-I-long terminal repeat (LTR) promoter develop skeletal abnormalities with high bone turnover and myelofibrosis. In these animals, Tax is highly expressed in bone with a pattern of expression restricted to osteoclasts and spindle-shaped cells within the endosteal myelofibrosis. To test the hypothesis that lineage-specific transcription factors promote transgene expression from the HTLV-I-LTR in osteoclasts, we first examined tax expression in transgenic bone marrow cultures. Expression was dependent on 1alpha,25-dihydroxycholecalciferol and coincided with tartrate-resistant acid phosphatase (TRAP) expression, a marker of osteoclast differentiation. Furthermore, Tax was expressed in vitronectin receptor-positive mononuclear precursors as well as in mature osteoclast-like cells (OCLs). Consistent with our hypothesis, electrophoretic mobility shift assays revealed the presence of an OCL nuclear factor (NFOC-1) that binds to the LTR 21-base pair direct repeat, a region critical for the promoter activity. This binding is further enhanced by Tax. Since NFOC-1 is absent in macrophages and conserved in osteoclasts among species including human, such a factor may play a role in lineage determination and/or in expression of the differentiated osteoclast phenotype.

  17. Expression profile of the sex determination gene doublesex in a gynandromorph of bumblebee, Bombus ignitus

    NASA Astrophysics Data System (ADS)

    Ugajin, Atsushi; Matsuo, Koshiro; Kubo, Ryohei; Sasaki, Tetsuhiko; Ono, Masato

    2016-04-01

    Gynandromorphy that has both male and female features is known in many insect orders, including Hymenoptera. In most cases, however, only external morphology and behavioral aspects have been studied. We found a gynandromorph of bumblebee, Bombus ignitus, that showed almost bilateral distribution of external sexual traits, with male characters observed on the left side and female characters on the right side. This individual never exhibited sexual behavior toward new queens. The dissection of the head part showed that it had bilaterally dimorphic labial glands, only the left of which was well developed and synthesized male-specific pheromone components. In contrast, the gynandromorph possessed an ovipositor and a pair of ovaries in the abdominal part, suggesting that it had a uniformly female reproductive system. Furthermore, we characterized several internal organs of the gynandromorph by a molecular biological approach. The expression analyses of a sex determination gene, doublesex, in the brain, the fat bodies, the hindgut, and the ovaries of the gynandromorph revealed a male-type expression pattern exclusively in the left brain hemisphere and consistent female-type expression in other tissues. These findings clearly indicate the sexual discordance between external traits and internal organs in the gynandromorph. The results of genetic analyses using microsatellite markers suggested that this individual consisted of both genetically male- and female-type tissues.

  18. A gene expression biomarker accurately predicts estrogen ...

    EPA Pesticide Factsheets

    The EPA’s vision for the Endocrine Disruptor Screening Program (EDSP) in the 21st Century (EDSP21) includes utilization of high-throughput screening (HTS) assays coupled with computational modeling to prioritize chemicals with the goal of eventually replacing current Tier 1 screening tests. The ToxCast program currently includes 18 HTS in vitro assays that evaluate the ability of chemicals to modulate estrogen receptor α (ERα), an important endocrine target. We propose microarray-based gene expression profiling as a complementary approach to predict ERα modulation and have developed computational methods to identify ERα modulators in an existing database of whole-genome microarray data. The ERα biomarker consisted of 46 ERα-regulated genes with consistent expression patterns across 7 known ER agonists and 3 known ER antagonists. The biomarker was evaluated as a predictive tool using the fold-change rank-based Running Fisher algorithm by comparison to annotated gene expression data sets from experiments in MCF-7 cells. Using 141 comparisons from chemical- and hormone-treated cells, the biomarker gave a balanced accuracy for prediction of ERα activation or suppression of 94% or 93%, respectively. The biomarker was able to correctly classify 18 out of 21 (86%) OECD ER reference chemicals including “very weak” agonists and replicated predictions based on 18 in vitro ER-associated HTS assays. For 114 chemicals present in both the HTS data and the MCF-7 c

  19. Quantitative expression analysis of selected transcription factors in pavement, basal and trichome cells of mature leaves from Arabidopsis thaliana

    PubMed Central

    Schliep, Martin; Ebert, Berit; Simon-Rosin, Ulrike; Zoeller, Daniela

    2010-01-01

    Gene expression levels of several transcription factors from Arabidopsis thaliana that were described previously to be involved in leaf development and trichome formation were analysed in trichome, basal and pavement cells of mature leaves. Single cell samples of these three cells types were collected by glass micro-capillaries. Real-time reverse transcription (RT)-PCR was used to analyse expression patterns of the following transcription factors: MYB23, MYB55, AtHB1, FILAMENTOUS FLOWER (FIL)/YABBY1 (YAB1), TRIPTYCHON (TRY) and CAPRICE (CPC). A difference in the expression patterns of TRY and CPC was revealed. Contrary to the CPC expression pattern, no transcripts of TRY could be detected in pavement cells. FIL/YAB1 was exclusively expressed in trichome cells. AtHB1 was highly expressed throughout all three cell types. MYB55 was higher expressed in basal cells than in trichome and pavement cells. MYB23 showed a pattern of low expression in pavement cells, medium in basal cells and high expression in trichomes. Expression patterns obtained by single cell sampling and real-time RT-PCR were compared to promoter GUS fusions of the selected transcription factors. Therefore, we regenerated two transgenic Arabidopsis lines that expressed the GUS reporter gene under control of the promoters of MYB55 and YAB1. In conclusion, despite their function in leaf morphogenesis, all six transcription factors were detected in mature leaves. Furthermore, single cell sampling and promoter GUS staining patterns demonstrated the predominant presence of MYB55 in basal cells as compared to pavement cells and trichomes. PMID:20101514

  20. Quantitative expression analysis of selected transcription factors in pavement, basal and trichome cells of mature leaves from Arabidopsis thaliana.

    PubMed

    Schliep, Martin; Ebert, Berit; Simon-Rosin, Ulrike; Zoeller, Daniela; Fisahn, Joachim

    2010-05-01

    Gene expression levels of several transcription factors from Arabidopsis thaliana that were described previously to be involved in leaf development and trichome formation were analysed in trichome, basal and pavement cells of mature leaves. Single cell samples of these three cells types were collected by glass micro-capillaries. Real-time reverse transcription (RT)-PCR was used to analyse expression patterns of the following transcription factors: MYB23, MYB55, AtHB1, FILAMENTOUS FLOWER (FIL)/YABBY1 (YAB1), TRIPTYCHON (TRY) and CAPRICE (CPC). A difference in the expression patterns of TRY and CPC was revealed. Contrary to the CPC expression pattern, no transcripts of TRY could be detected in pavement cells. FIL/YAB1 was exclusively expressed in trichome cells. AtHB1 was highly expressed throughout all three cell types. MYB55 was higher expressed in basal cells than in trichome and pavement cells. MYB23 showed a pattern of low expression in pavement cells, medium in basal cells and high expression in trichomes. Expression patterns obtained by single cell sampling and real-time RT-PCR were compared to promoter GUS fusions of the selected transcription factors. Therefore, we regenerated two transgenic Arabidopsis lines that expressed the GUS reporter gene under control of the promoters of MYB55 and YAB1. In conclusion, despite their function in leaf morphogenesis, all six transcription factors were detected in mature leaves. Furthermore, single cell sampling and promoter GUS staining patterns demonstrated the predominant presence of MYB55 in basal cells as compared to pavement cells and trichomes.

  1. Regulatory role of AINTEGUMENTA in organ initiation and growth

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Krizek, Beth Allyn; Lebioda, Lukasz

    2005-03-01

    Although several members of the plant-specific AP2/ERF family of transcription factors are important developmental regulators, many genes in this large protein family remain uncharacterized. Here, we present a phylogenetic analysis of the18 genes that make up the AP2 subgroup of this family. We report expression analyses of seven Arabidopsis genes most closely related to the floral development gene AINTEGUMENTA and show that all AINTEGUMENTA-like (AIL) genes are transcribed in multiple tissues during development. They are expressed primarily in young actively dividing tissues of a plant and not in mature leaves or stems. The spatial distribution of AIL5, AIL6, and AIL7more » mRNA in inflorescences was characterized by in situ hybridization. Each of these genes is expressed in a spatially and temporally distinct pattern within inflorescence meristems and flowers. Ectopic expression of AIL5 resulted in a larger floral organ phenotype, similar to that resulting from ectopic expression of ANT. Our results are consistent with AIL genes having roles in specification of meristematic or division-competent states.« less

  2. Rax : developmental and daily expression patterns in the rat pineal gland and retina.

    PubMed

    Rohde, Kristian; Klein, David C; Møller, Morten; Rath, Martin F

    2011-09-01

    Retina and anterior neural fold homeobox (Rax) gene encodes a transcription factor essential for vertebrate eye development. Recent microarray studies indicate that Rax is expressed in the adult rat pineal gland and retina. The present study reveals that Rax expression levels in the rat change significantly during retinal development with a peak occurring at embryonic day 18, whereas Rax expression in the pineal is relatively delayed and not detectable until embryonic day 20. In both tissues, Rax is expressed throughout postnatal development into adulthood. In the mature rat pineal gland, the abundance of Rax transcripts increases 2-fold during the light period with a peak occurring at dusk. These findings are consistent with the evidence that Rax is of functional importance in eye development and suggest a role of Rax in the developing pineal gland. In addition, it would appear possible that Rax contributes to phenotype maintenance in the mature retina and pineal gland and may facilitate 24-h changes in the pineal transcriptome. © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

  3. Function does not follow form in gene regulatory circuits.

    PubMed

    Payne, Joshua L; Wagner, Andreas

    2015-08-20

    Gene regulatory circuits are to the cell what arithmetic logic units are to the chip: fundamental components of information processing that map an input onto an output. Gene regulatory circuits come in many different forms, distinct structural configurations that determine who regulates whom. Studies that have focused on the gene expression patterns (functions) of circuits with a given structure (form) have examined just a few structures or gene expression patterns. Here, we use a computational model to exhaustively characterize the gene expression patterns of nearly 17 million three-gene circuits in order to systematically explore the relationship between circuit form and function. Three main conclusions emerge. First, function does not follow form. A circuit of any one structure can have between twelve and nearly thirty thousand distinct gene expression patterns. Second, and conversely, form does not follow function. Most gene expression patterns can be realized by more than one circuit structure. And third, multifunctionality severely constrains circuit form. The number of circuit structures able to drive multiple gene expression patterns decreases rapidly with the number of these patterns. These results indicate that it is generally not possible to infer circuit function from circuit form, or vice versa.

  4. Discovering high-resolution patterns of differential DNA methylation that correlate with gene expression changes

    PubMed Central

    VanderKraats, Nathan D.; Hiken, Jeffrey F.; Decker, Keith F.; Edwards, John R.

    2013-01-01

    Methylation of the CpG-rich region (CpG island) overlapping a gene’s promoter is a generally accepted mechanism for silencing expression. While recent technological advances have enabled measurement of DNA methylation and expression changes genome-wide, only modest correlations between differential methylation at gene promoters and expression have been found. We hypothesize that stronger associations are not observed because existing analysis methods oversimplify their representation of the data and do not capture the diversity of existing methylation patterns. Recently, other patterns such as CpG island shore methylation and long partially hypomethylated domains have also been linked with gene silencing. Here, we detail a new approach for discovering differential methylation patterns associated with expression change using genome-wide high-resolution methylation data: we represent differential methylation as an interpolated curve, or signature, and then identify groups of genes with similarly shaped signatures and corresponding expression changes. Our technique uncovers a diverse set of patterns that are conserved across embryonic stem cell and cancer data sets. Overall, we find strong associations between these methylation patterns and expression. We further show that an extension of our method also outperforms other approaches by generating a longer list of genes with higher quality associations between differential methylation and expression. PMID:23748561

  5. Cell differentiation in cardiac myxomas: confocal microscopy and gene expression analysis after laser capture microdissection.

    PubMed

    Pucci, Angela; Mattioli, Claudia; Matteucci, Marco; Lorenzini, Daniele; Panvini, Francesca; Pacini, Simone; Ippolito, Chiara; Celiento, Michele; De Martino, Andrea; Dolfi, Amelio; Belgio, Beatrice; Bortolotti, Uberto; Basolo, Fulvio; Bartoloni, Giovanni

    2018-05-22

    Cardiac myxomas are rare tumors with a heterogeneous cell population including properly neoplastic (lepidic), endothelial and smooth muscle cells. The assessment of neoplastic (lepidic) cell differentiation pattern is rather difficult using conventional light microscopy immunohistochemistry and/or whole tissue extracts for mRNA analyses. In a preliminary study, we investigated 20 formalin-fixed and paraffin-embedded cardiac myxomas by means of conventional immunohistochemistry; in 10/20 cases, cell differentiation was also analyzed by real-time RT-PCR after laser capture microdissection of the neoplastic cells, whereas calretinin and endothelial antigen CD31 immunoreactivity was localized in 4/10 cases by double immunofluorescence confocal microscopy. Gene expression analyses of α-smooth muscle actin, endothelial CD31 antigen, alpha-cardiac actin, matrix metalloprotease-2 (MMP2) and tissue inhibitor of matrix metalloprotease-1 (TIMP1) was performed on cDNA obtained from either microdissected neoplastic cells or whole tumor sections. We found very little or absent CD31 and α-Smooth Muscle Actin expression in the microdissected cells as compared to the whole tumors, whereas TIMP1 and MMP2 genes were highly expressed in both ones, greater levels being found in patients with embolic phenomena. α-Cardiac Actin was not detected. Confocal microscopy disclosed two different signals corresponding to calretinin-positive myxoma cells and to endothelial CD31-positive cells, respectively. In conclusion, the neoplastic (lepidic) cells showed a distinct gene expression pattern and no consistent overlapping with endothelial and smooth muscle cells or cardiac myocytes; the expression of TIMP1 and MMP2 might be related to clinical presentation; larger series studies using also systematic transcriptome analysis might be useful to confirm the present results.

  6. Temporal and Embryonic Lineage-Dependent Regulation of Human Vascular SMC Development by NOTCH3

    PubMed Central

    Granata, Alessandra; Bernard, William G.; Zhao, Ning; Mccafferty, John; Lilly, Brenda

    2015-01-01

    Vascular smooth muscle cells (SMCs), which arise from multiple embryonic progenitors, have unique lineage-specific properties and this diversity may contribute to spatial patterns of vascular diseases. We developed in vitro methods to generate distinct vascular SMC subtypes from human pluripotent stem cells, allowing us to explore their intrinsic differences and the mechanisms involved in SMC development. Since Notch signaling is thought to be one of the several key regulators of SMC differentiation and function, we profiled the expression of Notch receptors, ligands, and downstream elements during the development of origin-specific SMC subtypes. NOTCH3 expression in our in vitro model varied in a lineage- and developmental stage-specific manner so that the highest expression in mature SMCs was in those derived from paraxial mesoderm (PM). This pattern was consistent with the high expression level of NOTCH3 observed in the 8–9 week human fetal descending aorta, which is populated by SMCs of PM origin. Silencing NOTCH3 in mature SMCs in vitro reduced SMC markers in cells of PM origin preferentially. Conversely, during early development, NOTCH3 was highly expressed in vitro in SMCs of neuroectoderm (NE) origin. Inhibition of NOTCH3 in early development resulted in a significant downregulation of specific SMC markers exclusively in the NE lineage. Corresponding to this prediction, the Notch3-null mouse showed reduced expression of Acta2 in the neural crest-derived SMCs of the aortic arch. Thus, Notch3 signaling emerges as one of the key regulators of vascular SMC differentiation and maturation in vitro and in vivo in a lineage- and temporal-dependent manner. PMID:25539150

  7. Potential Novel Mechanism for Axenfeld-Rieger Syndrome: Deletion of a Distant Region Containing Regulatory Elements of PITX2

    PubMed Central

    Volkmann, Bethany A.; Zinkevich, Natalya S.; Mustonen, Aki; Schilter, Kala F.; Bosenko, Dmitry V.; Reis, Linda M.; Broeckel, Ulrich; Link, Brian A.

    2011-01-01

    Purpose. Mutations in PITX2 are associated with Axenfeld-Rieger syndrome (ARS), which involves ocular, dental, and umbilical abnormalities. Identification of cis-regulatory elements of PITX2 is important to better understand the mechanisms of disease. Methods. Conserved noncoding elements surrounding PITX2/pitx2 were identified and examined through transgenic analysis in zebrafish; expression pattern was studied by in situ hybridization. Patient samples were screened for deletion/duplication of the PITX2 upstream region using arrays and probes. Results. Zebrafish pitx2 demonstrates conserved expression during ocular and craniofacial development. Thirteen conserved noncoding sequences positioned within a gene desert as far as 1.1 Mb upstream of the human PITX2 gene were identified; 11 have enhancer activities consistent with pitx2 expression. Ten elements mediated expression in the developing brain, four regions were active during eye formation, and two sequences were associated with craniofacial expression. One region, CE4, located approximately 111 kb upstream of PITX2, directed a complex pattern including expression in the developing eye and craniofacial region, the classic sites affected in ARS. Screening of ARS patients identified an approximately 7600-kb deletion that began 106 to 108 kb upstream of the PITX2 gene, leaving PITX2 intact while removing regulatory elements CE4 to CE13. Conclusions. These data suggest the presence of a complex distant regulatory matrix within the gene desert located upstream of PITX2 with an essential role in its activity and provides a possible mechanism for the previous reports of ARS in patients with balanced translocations involving the 4q25 region upstream of PITX2 and the current patient with an upstream deletion. PMID:20881290

  8. A distal modular enhancer complex acts to control pituitary- and nervous system-specific expression of the LHX3 regulatory gene.

    PubMed

    Mullen, Rachel D; Park, Soyoung; Rhodes, Simon J

    2012-02-01

    Lin-11, Isl-1, and Mec-3 (LIM)-homeodomain (HD)-class transcription factors are critical for many aspects of mammalian organogenesis. Of these, LHX3 is essential for pituitary gland and nervous system development. Pediatric patients with mutations in coding regions of the LHX3 gene have complex syndromes, including combined pituitary hormone deficiency and nervous system defects resulting in symptoms such as dwarfism, thyroid insufficiency, infertility, and developmental delay. The pathways underlying early pituitary development are poorly understood, and the mechanisms by which the LHX3 gene is regulated in vivo are not known. Using bioinformatic and transgenic mouse approaches, we show that multiple conserved enhancers downstream of the human LHX3 gene direct expression to the developing pituitary and spinal cord in a pattern consistent with endogenous LHX3 expression. Several transferable cis elements can individually guide nervous system expression. However, a single 180-bp minimal enhancer is sufficient to confer specific expression in the developing pituitary. Within this sequence, tandem binding sites recognized by the islet-1 (ISL1) LIM-HD protein are essential for enhancer activity in the pituitary and spine, and a pituitary homeobox 1 (PITX1) bicoid class HD element is required for spatial patterning in the developing pituitary. This study establishes ISL1 as a novel transcriptional regulator of LHX3 and describes a potential mechanism for regulation by PITX1. Moreover, these studies suggest models for analyses of the transcriptional pathways coordinating the expression of other LIM-HD genes and provide tools for the molecular analysis and genetic counseling of pediatric patients with combined pituitary hormone deficiency.

  9. A Distal Modular Enhancer Complex Acts to Control Pituitary- and Nervous System-Specific Expression of the LHX3 Regulatory Gene

    PubMed Central

    Mullen, Rachel D.; Park, Soyoung

    2012-01-01

    Lin-11, Isl-1, and Mec-3 (LIM)-homeodomain (HD)-class transcription factors are critical for many aspects of mammalian organogenesis. Of these, LHX3 is essential for pituitary gland and nervous system development. Pediatric patients with mutations in coding regions of the LHX3 gene have complex syndromes, including combined pituitary hormone deficiency and nervous system defects resulting in symptoms such as dwarfism, thyroid insufficiency, infertility, and developmental delay. The pathways underlying early pituitary development are poorly understood, and the mechanisms by which the LHX3 gene is regulated in vivo are not known. Using bioinformatic and transgenic mouse approaches, we show that multiple conserved enhancers downstream of the human LHX3 gene direct expression to the developing pituitary and spinal cord in a pattern consistent with endogenous LHX3 expression. Several transferable cis elements can individually guide nervous system expression. However, a single 180-bp minimal enhancer is sufficient to confer specific expression in the developing pituitary. Within this sequence, tandem binding sites recognized by the islet-1 (ISL1) LIM-HD protein are essential for enhancer activity in the pituitary and spine, and a pituitary homeobox 1 (PITX1) bicoid class HD element is required for spatial patterning in the developing pituitary. This study establishes ISL1 as a novel transcriptional regulator of LHX3 and describes a potential mechanism for regulation by PITX1. Moreover, these studies suggest models for analyses of the transcriptional pathways coordinating the expression of other LIM-HD genes and provide tools for the molecular analysis and genetic counseling of pediatric patients with combined pituitary hormone deficiency. PMID:22194342

  10. Platinum sensitivity and DNA repair in a recently established panel of patient-derived ovarian carcinoma xenografts

    PubMed Central

    Guffanti, Federica; Fratelli, Maddalena; Ganzinelli, Monica; Bolis, Marco; Ricci, Francesca; Bizzaro, Francesca; Chilà, Rosaria; Sina, Federica Paola; Fruscio, Robert; Lupia, Michela; Cavallaro, Ugo; Cappelletti, Maria Rosa; Generali, Daniele; Giavazzi, Raffaella; Damia, Giovanna

    2018-01-01

    A xenobank of patient-derived (PDX) ovarian tumor samples has been established consisting of tumors with different sensitivity to cisplatin (DDP), from very responsive to resistant. As the DNA repair pathway is an important driver in tumor response to DDP, we analyzed the mRNA expression of 20 genes involved in the nucleotide excision repair, fanconi anemia, homologous recombination, base excision repair, mismatch repair and translesion repair pathways and the methylation patterns of some of these genes. We also investigated the correlation with the response to platinum-based therapy. The mRNA levels of the selected genes were evaluated by Real Time-PCR (RT-PCR) with ad hoc validated primers and gene promoter methylation by pyrosequencing. All the DNA repair genes were variably expressed in all 42 PDX samples analyzed, with no particular histotype-specific pattern of expression. In high-grade serous/endometrioid PDXs, the CDK12 mRNA expression levels positively correlated with the expression of TP53BP1, PALB2, XPF and POLB. High-grade serous/endometrioid PDXs with TP53 mutations had significantly higher levels of POLQ, FANCD2, RAD51 and POLB than high-grade TP53 wild type PDXs. The mRNA levels of CDK12, PALB2 and XPF inversely associated with the in vivo DDP antitumor activity; higher CDK12 mRNA levels were associated with a higher recurrence rate in ovarian patients with low residual tumor. These data support the important role of CDK12 in the response to a platinum based therapy in ovarian patients. PMID:29872499

  11. A clip domain serine protease involved in moulting in the silkworm, Bombyx mori: cloning, characterization, expression patterns and functional analysis.

    PubMed

    Liu, H-W; Wang, L-L; Meng, Z; Tang, X; Li, Y-S; Xia, Q-Y; Zhao, P

    2017-10-01

    Clip domain serine proteases (CLIPs), characterized by one or more conserved clip domains, are essential components of extracellular signalling cascades in various biological processes, especially in innate immunity and the embryonic development of insects. Additionally, CLIPs may have additional non-immune functions in insect development. In the present study, the clip domain serine protease gene Bombyx mori serine protease 95 (BmSP95), which encodes a 527-residue protein, was cloned from the integument of B. mori. Bioinformatics analysis indicated that BmSP95 is a typical CLIP of the subfamily D and possesses a clip domain at the N terminus, a trypsin-like serine protease (tryp_spc) domain at the C terminus and a conserved proline-rich motif between these two domains. At the transcriptional level, BmSP95 is expressed in the integument during moulting and metamorphosis, and the expression pattern is consistent with the fluctuating 20-hydroxyecdysone (20E) titre in B. mori. At the translational level, BmSP95 protein is synthesized in the epidermal cells, secreted as a zymogen and activated in the moulting fluid. Immunofluorescence revealed that BmSP95 is distributed into the old endocuticle in the moulting stage. The expression of BmSP95 was upregulated by 20E. Moreover, expression of BmSP95 was downregulated by pathogen infection. RNA interference-mediated silencing of BmSP95 led to delayed moulting from pupa to moth. These results suggest that BmSP95 is involved in integument remodelling during moulting and metamorphosis. © 2017 The Royal Entomological Society.

  12. Unsupervised Extraction of Stable Expression Signatures from Public Compendia with an Ensemble of Neural Networks.

    PubMed

    Tan, Jie; Doing, Georgia; Lewis, Kimberley A; Price, Courtney E; Chen, Kathleen M; Cady, Kyle C; Perchuk, Barret; Laub, Michael T; Hogan, Deborah A; Greene, Casey S

    2017-07-26

    Cross-experiment comparisons in public data compendia are challenged by unmatched conditions and technical noise. The ADAGE method, which performs unsupervised integration with denoising autoencoder neural networks, can identify biological patterns, but because ADAGE models, like many neural networks, are over-parameterized, different ADAGE models perform equally well. To enhance model robustness and better build signatures consistent with biological pathways, we developed an ensemble ADAGE (eADAGE) that integrated stable signatures across models. We applied eADAGE to a compendium of Pseudomonas aeruginosa gene expression profiling experiments performed in 78 media. eADAGE revealed a phosphate starvation response controlled by PhoB in media with moderate phosphate and predicted that a second stimulus provided by the sensor kinase, KinB, is required for this PhoB activation. We validated this relationship using both targeted and unbiased genetic approaches. eADAGE, which captures stable biological patterns, enables cross-experiment comparisons that can highlight measured but undiscovered relationships. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

  13. Control of retinoic acid synthesis and FGF expression in the nasal pit is required to pattern the craniofacial skeleton.

    PubMed

    Song, Y; Hui, J N; Fu, K K; Richman, J M

    2004-12-15

    Endogenous retinoids are important for patterning many aspects of the embryo including the branchial arches and frontonasal region of the embryonic face. The nasal placodes express retinaldehyde dehydrogenase-3 (RALDH3) and thus retinoids from the placode are a potential patterning influence on the developing face. We have carried out experiments that have used Citral, a RALDH antagonist, to address the function of retinoid signaling from the nasal pit in a whole embryo model. When Citral-soaked beads were implanted into the nasal pit of stage 20 chicken embryos, the result was a specific loss of derivatives from the lateral nasal prominences. Providing exogenous retinoic acid residue development of the beak demonstrating that most Citral-induced defects were produced by the specific blocking of RA synthesis. The mechanism of Citral effects was a specific increase in programmed cell death on the lateral (lateral nasal prominence) but not the medial side (frontonasal mass) of the nasal pit. Gene expression studies were focused on the Bone Morphogenetic Protein (BMP) pathway, which has a well-established role in programmed cell death. Unexpectedly, blocking RA synthesis decreased rather than increased Msx1, Msx2, and Bmp4 expression. We also examined cell survival genes, the most relevant of which was Fgf8, which is expressed around the nasal pit and in the frontonasal mass. We found that Fgf8 was not initially expressed along the lateral side of the nasal pit at the start of our experiments, whereas it was expressed on the medial side. Citral prevented upregulation of Fgf8 along the lateral edge and this may have contributed to the specific increase in programmed cell death in the lateral nasal prominence. Consistent with this idea, exogenous FGF8 was able to prevent cell death, rescue most of the morphological defects and was able to prevent a decrease in retinoic acid receptorbeta (Rarbeta) expression caused by Citral. Together, our results demonstrate that endogenous retinoids act upstream of FGF8 and the balance of these two factors is critical for regulating programmed cell death and morphogenesis in the face. In addition, our data suggest a novel role for endogenous retinoids from the nasal pit in controlling the precise downregulation of FGF in the center of the frontonasal mass observed during normal vertebrate development.

  14. Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia

    PubMed Central

    Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J. V.; Schulz, Marcel H.; Simon, Martin

    2015-01-01

    Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. PMID:26231545

  15. Genetic Architecture and Molecular Networks Underlying Leaf Thickness in Desert-Adapted Tomato Solanum pennellii1[OPEN

    PubMed Central

    Frank, Margaret H.; Balaguer, Maria A. de Luis; Li, Mao

    2017-01-01

    Thicker leaves allow plants to grow in water-limited conditions. However, our understanding of the genetic underpinnings of this highly functional leaf shape trait is poor. We used a custom-built confocal profilometer to directly measure leaf thickness in a set of introgression lines (ILs) derived from the desert tomato Solanum pennellii and identified quantitative trait loci. We report evidence of a complex genetic architecture of this trait and roles for both genetic and environmental factors. Several ILs with thick leaves have dramatically elongated palisade mesophyll cells and, in some cases, increased leaf ploidy. We characterized the thick IL2-5 and IL4-3 in detail and found increased mesophyll cell size and leaf ploidy levels, suggesting that endoreduplication underpins leaf thickness in tomato. Next, we queried the transcriptomes and inferred dynamic Bayesian networks of gene expression across early leaf ontogeny in these lines to compare the molecular networks that pattern leaf thickness. We show that thick ILs share S. pennellii-like expression profiles for putative regulators of cell shape and meristem determinacy as well as a general signature of cell cycle-related gene expression. However, our network data suggest that leaf thickness in these two lines is patterned at least partially by distinct mechanisms. Consistent with this hypothesis, double homozygote lines combining introgression segments from these two ILs show additive phenotypes, including thick leaves, higher ploidy levels, and larger palisade mesophyll cells. Collectively, these data establish a framework of genetic, anatomical, and molecular mechanisms that pattern leaf thickness in desert-adapted tomato. PMID:28794258

  16. Transcriptome Sequencing Reveals Large-Scale Changes in Axenic Aedes aegypti Larvae

    PubMed Central

    Vogel, Kevin J.; Valzania, Luca; Coon, Kerri L.; Brown, Mark R.; Strand, Michael R.

    2017-01-01

    Mosquitoes host communities of microbes in their digestive tract that consist primarily of bacteria. We previously reported that Aedes aegypti larvae colonized by a native community of bacteria and gnotobiotic larvae colonized by only Escherichia coli develop very similarly into adults, whereas axenic larvae never molt and die as first instars. In this study, we extended these findings by first comparing the growth and abundance of bacteria in conventional, gnotobiotic, and axenic larvae during the first instar. Results showed that conventional and gnotobiotic larvae exhibited no differences in growth, timing of molting, or number of bacteria in their digestive tract. Axenic larvae in contrast grew minimally and never achieved the critical size associated with molting by conventional and gnotobiotic larvae. In the second part of the study we compared patterns of gene expression in conventional, gnotobiotic and axenic larvae by conducting an RNAseq analysis of gut and nongut tissues (carcass) at 22 h post-hatching. Approximately 12% of Ae. aegypti transcripts were differentially expressed in axenic versus conventional or gnotobiotic larvae. However, this profile consisted primarily of transcripts in seven categories that included the down-regulation of select peptidases in the gut and up-regulation of several genes in the gut and carcass with roles in amino acid transport, hormonal signaling, and metabolism. Overall, our results indicate that axenic larvae exhibit alterations in gene expression consistent with defects in acquisition and assimilation of nutrients required for growth. PMID:28060822

  17. Glucocorticoids Affect 24 h Clock Genes Expression in Human Adipose Tissue Explant Cultures

    PubMed Central

    Gómez-Abellán, Purificación; Díez-Noguera, Antoni; Madrid, Juan A.; Luján, Juan A.; Ordovás, José M.; Garaulet, Marta

    2012-01-01

    Aims to examine firstly whether CLOCK exhibits a circadian expression in human visceral (V) and subcutaneous (S) adipose tissue (AT) in vitro as compared with BMAL1 and PER2, and secondly to investigate the possible effect of the glucocorticoid analogue dexamethasone (DEX) on positive and negative clock genes expression. Subjects and Methods VAT and SAT biopsies were obtained from morbid obese women (body mass index≥40 kg/m2) (n = 6). In order to investigate rhythmic expression pattern of clock genes and the effect of DEX on CLOCK, PER2 and BMAL1 expression, control AT (without DEX) and AT explants treated with DEX (2 hours) were cultured during 24 h and gene expression was analyzed at the following times: 10:00 h, 14:00 h, 18:00 h, 22:00 h, 02:00 h and 06:00 h, using qRT-PCR. Results CLOCK, BMAL1 and PER2 expression exhibited circadian patterns in both VAT and SAT explants that were adjusted to a typical 24 h sinusoidal curve. PER2 expression (negative element) was in antiphase with respect to CLOCK and in phase with BMAL1 expression (both positive elements) in the SAT (situation not present in VAT). A marked effect of DEX exposure on both positive and negative clock genes expression patterns was observed. Indeed, DEX treatment modified the rhythmicity pattern towards altered patterns with a period lower than 24 hours in all genes and in both tissues. Conclusions 24 h patterns in CLOCK and BMAL1 (positive clock elements) and PER2 (negative element) mRNA levels were observed in human adipose explants. These patterns were altered by dexamethasone exposure. PMID:23251369

  18. Arsenic exposure disrupts epigenetic regulation of SIRT1 in human keratinocytes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herbert, Katharine J.; Holloway, Adele; Cook, Anthony L.

    2014-11-15

    Arsenic is an environmental toxin which increases skin cancer risk for exposed populations worldwide; however the underlying biomolecular mechanism for arsenic-induced carcinogenesis is complex and poorly defined. Recent investigations show that histone deacetylase and DNA methyltransferase activity is impaired, and epigenetic patterns of gene regulation are consistently altered in cancers associated with arsenic exposure. Expression of the histone deacetylase SIRT1 is altered in solid tumours and haematological malignancies; however its role in arsenic-induced pathology is unknown. In this study we investigated the effect of arsenic on epigenetic regulation of SIRT1 and its targeting microRNA, miR-34a in primary human keratinocytes. Acetylationmore » of histone H4 at lysine 16 (H4K16) increased in keratinocytes exposed to 0.5 μM arsenite [As(III)]; and this was associated with chromatin remodelling at the miR-34a promoter. Moreover, although SIRT1 protein initially increased in these As(III)-exposed cells, after 24 days expression was not significantly different from untreated controls. Extended exposure to low-dose As(III) (0.5 μM; > 5 weeks) compromised the pattern of CpG methylation at SIRT1 and miR-34a gene promoters, and this was associated with altered expression for both genes. We have found that arsenic alters epigenetic regulation of SIRT1 expression via structural reorganisation of chromatin at the miR-34a gene promoter in the initial 24 h of exposure; and over time, through shifts in miR-34a and SIRT1 gene methylation. Taken together, this investigation demonstrates that arsenic produces cumulative disruptions to epigenetic regulation of miR-34a expression, and this is associated with impaired coordination of SIRT1 functional activity. - Highlights: • Submicromolar arsenic concentrations disrupt SIRT1 activity and expression in human keratinocytes. • Arsenic-induced chromatin remodelling at the miR-34a gene promoter is associated with hyperacetylation of histone H4 (Lys 16). • Continual extended exposure to arsenic reorganises the pattern of SIRT1 and miR-34a promoter methylation.« less

  19. Histone acetylation is associated with differential gene expression in the rapid and robust memory CD8+ T-cell response

    PubMed Central

    Fann, Monchou; Godlove, Jason M.; Catalfamo, Marta; Wood, William H.; Chrest, Francis J.; Chun, Nicholas; Granger, Larry; Wersto, Robert; Madara, Karen; Becker, Kevin; Henkart, Pierre A.; Weng, Nan-ping

    2006-01-01

    To understand the molecular basis for the rapid and robust memory T-cell responses, we examined gene expression and chromatin modification by histone H3 lysine 9 (H3K9) acetylation in resting and activated human naive and memory CD8+ T cells. We found that, although overall gene expression patterns were similar, a number of genes are differentially expressed in either memory or naive cells in their resting and activated states. To further elucidate the basis for differential gene expression, we assessed the role of histone H3K9 acetylation in differential gene expression. Strikingly, higher H3K9 acetylation levels were detected in resting memory cells, prior to their activation, for those genes that were differentially expressed following activation, indicating that hyperacetylation of histone H3K9 may play a role in selective and rapid gene expression of memory CD8+ T cells. Consistent with this model, we showed that inducing high levels of H3K9 acetylation resulted in an increased expression in naive cells of those genes that are normally expressed differentially in memory cells. Together, these findings suggest that differential gene expression mediated at least in part by histone H3K9 hyperacetylation may be responsible for the rapid and robust memory CD8+ T-cell response. PMID:16868257

  20. Fox (forkhead) genes are involved in the dorso-ventral patterning of the Xenopus mesoderm.

    PubMed

    El-Hodiri, H; Bhatia-Dey, N; Kenyon, K; Ault, K; Dirksen, M; Jamrich, M

    2001-01-01

    Fox (forkhead/winged helix) genes encode a family of transcription factors that are involved in embryonic pattern formation, regulation of tissue specific gene expression and tumorigenesis. Several of them are transcribed during Xenopus embryogenesis and are important for the patterning of ectoderm, mesoderm and endoderm. We have isolated three forkhead genes that are activated during gastrulation and play an important role in the dorso-ventral patterning of the mesoderm. XFKH1 (FoxA4b), the first vertebrate forkhead gene to be implicated in embryonic pattern formation, is expressed in the Spemann-Mangold organizer region and later in the embryonic notochord. XFKH7, the Xenopus orthologue of the murine Mfh1(Foxc2), is expressed in the presomitic mesoderm, but not in the notochord or lateral plate mesoderm. Finally, XFD-13'(FoxF1b)1 is expressed in the lateral plate mesoderm, but not in the notochord or presomitic mesoderm. Expression pattern and functional experiments indicate that these three forkhead genes are involved in the dorso-ventral patterning of the mesoderm.

  1. A dynamic Shh expression pattern, regulated by SHH and BMP signaling, coordinates fusion of primordia in the amniote face

    PubMed Central

    Hu, Diane; Young, Nathan M.; Li, Xin; Xu, Yanhua; Hallgrímsson, Benedikt; Marcucio, Ralph S.

    2015-01-01

    The mechanisms of morphogenesis are not well understood, yet shaping structures during development is essential for establishing correct organismal form and function. Here, we examine mechanisms that help to shape the developing face during the crucial period of facial primordia fusion. This period of development is a time when the faces of amniote embryos exhibit the greatest degree of similarity, and it probably results from the necessity for fusion to occur to establish the primary palate. Our results show that hierarchical induction mechanisms, consisting of iterative signaling by Sonic hedgehog (SHH) followed by Bone morphogenetic proteins (BMPs), regulate a dynamic expression pattern of Shh in the ectoderm covering the frontonasal (FNP) and maxillary (MxP) processes. Furthermore, this Shh expression domain contributes to the morphogenetic processes that drive the directional growth of the globular process of the FNP toward the lateral nasal process and MxP, in part by regulating cell proliferation in the facial mesenchyme. The nature of the induction mechanism that we discovered suggests that the process of fusion of the facial primordia is intrinsically buffered against producing maladaptive morphologies, such as clefts of the primary palate, because there appears to be little opportunity for variation to occur during expansion of the Shh expression domain in the ectoderm of the facial primordia. Ultimately, these results might explain why this period of development constitutes a phylotypic stage of facial development among amniotes. PMID:25605783

  2. Timing Is Everything: Highly Specific and Transient Expression of a MAP Kinase Determines Auxin-Induced Leaf Venation Patterns in Arabidopsis

    PubMed Central

    Stanko, Vera; Giuliani, Concetta; Retzer, Katarzyna; Djamei, Armin; Wahl, Vanessa; Wurzinger, Bernhard; Wilson, Cathal; Heberle-Bors, Erwin; Teige, Markus; Kragler, Friedrich

    2014-01-01

    Mitogen-activated protein kinase (MAPK) cascades are universal signal transduction modules present in all eukaryotes. In plants, MAPK cascades were shown to regulate cell division, developmental processes, stress responses, and hormone pathways. The subgroup A of Arabidopsis MAPKs consists of AtMPK3, AtMPK6, and AtMPK10. AtMPK3 and AtMPK6 are activated by their upstream MAP kinase kinases (MKKs) AtMKK4 and AtMKK5 in response to biotic and abiotic stress. In addition, they were identified as key regulators of stomatal development and patterning. AtMPK10 has long been considered as a pseudo-gene, derived from a gene duplication of AtMPK6. Here we show that AtMPK10 is expressed highly but very transiently in seedlings and at sites of local auxin maxima leaves. MPK10 encodes a functional kinase and interacts with the upstream MAP kinase kinase (MAPKK) AtMKK2. mpk10 mutants are delayed in flowering in long-day conditions and in continuous light. Moreover, cotyledons of mpk10 and mkk2 mutants have reduced vein complexity, which can be reversed by inhibiting polar auxin transport (PAT). Auxin does not affect AtMPK10 expression while treatment with the PAT inhibitor HFCA extends the expression in leaves and reverses the mpk10 mutant phenotype. These results suggest that the AtMKK2–AtMPK10 MAPK module regulates venation complexity by altering PAT efficiency. PMID:25064848

  3. Expression of Vitis amurensis VaERF20 in Arabidopsis thaliana Improves Resistance to Botrytis cinerea and Pseudomonas syringae pv. Tomato DC3000

    PubMed Central

    Wang, Mengnan; Zhu, Yanxun; Han, Rui; Yin, Wuchen; Guo, Chunlei; Li, Zhi; Wang, Xiping

    2018-01-01

    Ethylene response factor (ERF) transcription factors play important roles in regulating immune responses in plants. In our study, we characterized a member of the ERF transcription factor family, VaERF20, from the Chinese wild Vitis genotype, V. amurensis Rupr “Shuangyou”. Phylogenetic analysis indicated that VaERF20 belongs to group IXc of the ERF family, in which many members are known to contribute to fighting pathogen infection. Consistent with this, expression of VaERF20 was induced by treatment with the necrotrophic fungal pathogen Botrytis cinerea (B. cinerea) in “Shuangyou” and V. vinifera “Red Globe”. Arabidopsis thaliana plants over-expressing VaERF20 displayed enhanced resistance to B. cinerea and the bacterium Pseudomonas syringae pv. tomato (Pst) DC3000. Patterns of pathogen-induced reactive oxygen species (ROS) accumulation were entirely distinct in B. cinerea and PstDC3000 inoculated plants. Examples of both salicylic acid (SA) and jasmonic acid/ethylene (JA/ET) responsive defense genes were up-regulated after B. cinerea and PstDC3000 inoculation of the VaERF20-overexpressing transgenic A. thaliana plants. Evidence of pattern-triggered immunity (PTI), callose accumulation and stomatal defense, together with increased expression of PTI genes, was also greater in the transgenic lines. These data indicate that VaERF20 participates in various signal transduction pathways and acts as an inducer of immune responses. PMID:29494485

  4. Maintained expression of the planar cell polarity molecule Vangl2 and reformation of hair cell orientation in the regenerating inner ear.

    PubMed

    Warchol, Mark E; Montcouquiol, Mireille

    2010-09-01

    The avian inner ear possesses a remarkable ability to regenerate sensory hair cells after ototoxic injury. Regenerated hair cells possess phenotypes and innervation that are similar to those found in the undamaged ear, but little is known about the signaling pathways that guide hair cell differentiation during the regenerative process. The aim of the present study was to examine the factors that specify the orientation of hair cell stereocilia bundles during regeneration. Using organ cultures of the chick utricle, we show that hair cells are properly oriented after having regenerated entirely in vitro and that orientation is not affected by surgical removal of the striolar reversal zone. These results suggest that the orientation of regenerating stereocilia is not guided by the release of a diffusible morphogen from the striolar reversal zone but is specified locally within the regenerating sensory organ. In order to determine the nature of the reorientation cues, we examined the expression patterns of the core planar cell polarity molecule Vangl2 in the normal and regenerating utricle. We found that Vangl2 is asymmetrically expressed on cells within the sensory epithelium and that this expression pattern is maintained after ototoxic injury and throughout regeneration. Notably, treatment with a small molecule inhibitor of c-Jun-N-terminal kinase disrupted the orientation of regenerated hair cells. Both of these results are consistent with the hypothesis that noncanonical Wnt signaling guides hair cell orientation during regeneration.

  5. Patterns of gene expression reveal a temporally orchestrated wound healing response in the injured spinal cord.

    PubMed

    Velardo, Margaret J; Burger, Corinna; Williams, Philip R; Baker, Henry V; López, M Cecilia; Mareci, Thomas H; White, Todd E; Muzyczka, Nicholas; Reier, Paul J

    2004-09-29

    Spinal cord injury (SCI) induces a progressive pathophysiology affecting cell survival and neurological integrity via complex and evolving molecular cascades whose interrelationships are not fully understood. The present experiments were designed to: (1) determine potential functional interactions within transcriptional expression profiles obtained after a clinically relevant SCI and (2) test the consistency of transcript expression after SCI in two genetically and immunologically diverse rat strains characterized by differences in T cell competence and associated inflammatory responses. By interrogating Affymetrix U34A rat genome GeneChip microarrays, we defined the transcriptional expression patterns in midcervical contusion lesion sites between 1 and 90 d postinjury of athymic nude (AN) and Sprague Dawley (SD) strains. Stringent statistical analyses detected significant changes in 3638 probe sets, with 80 genes differing between the AN and SD groups. Subsequent detailed functional categorization of these transcripts unveiled an overall tissue remodeling response that was common to both strains. The functionally organized gene profiles were temporally distinct and correlated with repair indices observed microscopically and by magnetic resonance microimaging. Our molecular and anatomical observations have identified a novel, longitudinal perspective of the post-SCI response, namely, that of a highly orchestrated tissue repair and remodeling repertoire with a prominent cutaneous wound healing signature that is conserved between two widely differing rat strains. These results have significant bearing on the continuing development of cellular and pharmacological therapeutics directed at tissue rescue and neuronal regeneration in the injured spinal cord.

  6. Altered levels of the Taraxacum kok-saghyz (Russian dandelion) small rubber particle protein, TkSRPP3, result in qualitative and quantitative changes in rubber metabolism.

    PubMed

    Collins-Silva, Jillian; Nural, Aise Taban; Skaggs, Amanda; Scott, Deborah; Hathwaik, Upul; Woolsey, Rebekah; Schegg, Kathleen; McMahan, Colleen; Whalen, Maureen; Cornish, Katrina; Shintani, David

    2012-07-01

    Several proteins have been identified and implicated in natural rubber biosynthesis, one of which, the small rubber particle protein (SRPP), was originally identified in Hevea brasiliensis as an abundant protein associated with cytosolic vesicles known as rubber particles. While previous in vitro studies suggest that SRPP plays a role in rubber biosynthesis, in vivo evidence is lacking to support this hypothesis. To address this issue, a transgene approach was taken in Taraxacum kok-saghyz (Russian dandelion or Tk) to determine if altered SRPP levels would influence rubber biosynthesis. Three dandelion SRPPs were found to be highly abundant on dandelion rubber particles. The most abundant particle associated SRPP, TkSRPP3, showed temporal and spatial patterns of expression consistent with patterns of natural rubber accumulation in dandelion. To confirm its role in rubber biosynthesis, TkSRPP3 expression was altered in Russian dandelion using over-expression and RNAi methods. While TkSRPP3 over-expressing lines had slightly higher levels of rubber in their roots, relative to the control, TkSRPP3 RNAi lines showed significant decreases in root rubber content and produced dramatically lower molecular weight rubber than the control line. Not only do results here provide in vivo evidence of TkSRPP proteins affecting the amount of rubber in dandelion root, but they also suggest a function in regulating the molecular weight of the cis-1, 4-polyisoprene polymer. Copyright © 2012 Elsevier Ltd. All rights reserved.

  7. Clustering change patterns using Fourier transformation with time-course gene expression data.

    PubMed

    Kim, Jaehee

    2011-01-01

    To understand the behavior of genes, it is important to explore how the patterns of gene expression change over a period of time because biologically related gene groups can share the same change patterns. In this study, the problem of finding similar change patterns is induced to clustering with the derivative Fourier coefficients. This work is aimed at discovering gene groups with similar change patterns which share similar biological properties. We developed a statistical model using derivative Fourier coefficients to identify similar change patterns of gene expression. We used a model-based method to cluster the Fourier series estimation of derivatives. We applied our model to cluster change patterns of yeast cell cycle microarray expression data with alpha-factor synchronization. It showed that, as the method clusters with the probability-neighboring data, the model-based clustering with our proposed model yielded biologically interpretable results. We expect that our proposed Fourier analysis with suitably chosen smoothing parameters could serve as a useful tool in classifying genes and interpreting possible biological change patterns.

  8. BnDGAT1s Function Similarly in Oil Deposition and Are Expressed with Uniform Patterns in Tissues of Brassica napus.

    PubMed

    Zhao, Cuizhu; Li, Huan; Zhang, Wenxue; Wang, Hailan; Xu, Aixia; Tian, Jianhua; Zou, Jitao; Taylor, David C; Zhang, Meng

    2017-01-01

    As an allotetraploid oilcrop, Brassica napus contains four duplicated Acyl-CoA:diacylglycerol acyltransferase 1 ( DGAT1 ) genes, which catalyze one of the rate-limiting steps in triacylglycerol (TAG) biosynthesis in plants. While all four BnDGAT1 s have been expressed functionally in yeast, their expression patterns in different germplasms and tissues and also consequent contribution to seed oil accumulation in planta remain to be elucidated. In this study, the coding regions of the four BnDGAT1s were expressed in an Arabidopsis dgat1 mutant. All four BnDGAT1s showed similar effects on oil content and fatty acid composition, a result which is different from that observed in previous studies of their expression in yeast. Expression patterns of BnDGAT1s were analyzed in developing seeds of 34 B. napus inbred lines and in different tissues of 14 lines. Different expression patterns were observed for the four BnDGAT1 s, which suggests that they express independently or randomly in different germplasm sources. Higher expression of BnDGAT1s was correlated with higher seed oil content lines. Tissue-specific analyses showed that the BnDGAT1 s were expressed in a uniform pattern in different tissues. Our results suggest that it is important to maintain expression of the four BnDGAT1s for maximum return on oil content.

  9. Evidence for a role of the oxytocin system, indexed by genetic variation in CD38, in the social bonding effects of expressed gratitude

    PubMed Central

    2014-01-01

    Oxytocin is thought to play a central role in promoting close social bonds via influence on social interactions. The current investigation targeted interactions involving expressed gratitude between members of romantic relationships because recent evidence suggests gratitude and its expression provides behavioral and psychological ‘glue’ to bind individuals closer together. Specifically, we took a genetic approach to test the hypothesis that social interactions involving expressed gratitude would be associated with variation in a gene, CD38, which has been shown to affect oxytocin secretion. A polymorphism (rs6449182) that affects CD38 expression was significantly associated with global relationship satisfaction, perceived partner responsiveness and positive emotions (particularly love) after lab-based interactions, observed behavioral expression of gratitude toward a romantic partner in the lab, and frequency of expressed gratitude in daily life. A separate polymorphism in CD38 (rs3796863) previously associated with plasma oxytocin levels and social engagement was also associated with perceived responsiveness in the benefactor after an expression of gratitude. The combined influence of the two polymorphisms was associated with a broad range of gratitude-related behaviors and feelings. The consistent pattern of findings suggests that the oxytocin system is associated with solidifying the glue that binds adults into meaningful and important relationships. PMID:24396004

  10. Embryonic stem cell-like features of testicular carcinoma in situ revealed by genome-wide gene expression profiling.

    PubMed

    Almstrup, Kristian; Hoei-Hansen, Christina E; Wirkner, Ute; Blake, Jonathon; Schwager, Christian; Ansorge, Wilhelm; Nielsen, John E; Skakkebaek, Niels E; Rajpert-De Meyts, Ewa; Leffers, Henrik

    2004-07-15

    Carcinoma in situ (CIS) is the common precursor of histologically heterogeneous testicular germ cell tumors (TGCTs), which in recent decades have markedly increased and now are the most common malignancy of young men. Using genome-wide gene expression profiling, we identified >200 genes highly expressed in testicular CIS, including many never reported in testicular neoplasms. Expression was further verified by semiquantitative reverse transcription-PCR and in situ hybridization. Among the highest expressed genes were NANOG and POU5F1, and reverse transcription-PCR revealed possible changes in their stoichiometry on progression into embryonic carcinoma. We compared the CIS expression profile with patterns reported in embryonic stem cells (ESCs), which revealed a substantial overlap that may be as high as 50%. We also demonstrated an over-representation of expressed genes in regions of 17q and 12, reported as unstable in cultured ESCs. The close similarity between CIS and ESCs explains the pluripotency of CIS. Moreover, the findings are consistent with an early prenatal origin of TGCTs and thus suggest that etiologic factors operating in utero are of primary importance for the incidence trends of TGCTs. Finally, some of the highly expressed genes identified in this study are promising candidates for new diagnostic markers for CIS and/or TGCTs.

  11. A Subset of Mouse Colonic Goblet Cells Expresses the Bitter Taste Receptor Tas2r131

    PubMed Central

    Prandi, Simone; Bromke, Marta; Hübner, Sandra; Voigt, Anja; Boehm, Ulrich; Meyerhof, Wolfgang; Behrens, Maik

    2013-01-01

    The concept that gut nutrient sensing involves taste receptors has been fueled by recent reports associating the expression of taste receptors and taste-associated signaling molecules in the gut and in gut-derived cell lines with physiological responses induced by known taste stimuli. However, for bitter taste receptors (Tas2rs), direct evidence for their functional role in gut physiology is scarce and their cellular expression pattern remained unknown. We therefore investigated Tas2r expression in mice. RT-PCR experiments assessed the presence of mRNA for Tas2rs and taste signaling molecules in the gut. A gene-targeted mouse strain was established to visualize and identify cell types expressing the bitter receptor Tas2r131. Messenger RNA for various Tas2rs and taste signaling molecules were detected by RT-PCR in the gut. Using our knock-in mouse strain we demonstrate that a subset of colonic goblet cells express Tas2r131. Cells that express this receptor are absent in the upper gut and do not correspond to enteroendocrine and brush cells. Expression in colonic goblet cells is consistent with a role of Tas2rs in defense mechanisms against potentially harmful xenobiotics. PMID:24367558

  12. Validation of housekeeping genes as an internal control for gene expression studies in Giardia lamblia using quantitative real-time PCR.

    PubMed

    Marcial-Quino, Jaime; Fierro, Francisco; De la Mora-De la Mora, Ignacio; Enríquez-Flores, Sergio; Gómez-Manzo, Saúl; Vanoye-Carlo, America; Garcia-Torres, Itzhel; Sierra-Palacios, Edgar; Reyes-Vivas, Horacio

    2016-04-25

    The analysis of transcript levels of specific genes is important for understanding transcriptional regulation and for the characterization of gene function. Real-time quantitative reverse transcriptase PCR (RT-qPCR) has become a powerful tool to quantify gene expression. The objective of this study was to identify reliable housekeeping genes in Giardia lamblia. Twelve genes were selected for this purpose, and their expression was analyzed in the wild type WB strain and in two strains with resistance to nitazoxanide (NTZ) and metronidazole (MTZ), respectively. RefFinder software analysis showed that the expression of the genes is different in the three strains. The integrated data from the four analyses showed that the NADH oxidase (NADH) and aldolase (ALD) genes were the most steadily expressed genes, whereas the glyceraldehyde-3-phosphate dehydrogenase gene was the most unstable. Additionally, the relative expression of seven genes were quantified in the NTZ- and MTZ-resistant strains by RT-qPCR, using the aldolase gene as the internal control, and the results showed a consistent differential pattern of expression in both strains. The housekeeping genes found in this work will facilitate the analysis of mRNA expression levels of other genes of interest in G. lamblia. Copyright © 2016 Elsevier B.V. All rights reserved.

  13. Plain faces are more expressive: comparative study of facial colour, mobility and musculature in primates

    PubMed Central

    Santana, Sharlene E.; Dobson, Seth D.; Diogo, Rui

    2014-01-01

    Facial colour patterns and facial expressions are among the most important phenotypic traits that primates use during social interactions. While colour patterns provide information about the sender's identity, expressions can communicate its behavioural intentions. Extrinsic factors, including social group size, have shaped the evolution of facial coloration and mobility, but intrinsic relationships and trade-offs likely operate in their evolution as well. We hypothesize that complex facial colour patterning could reduce how salient facial expressions appear to a receiver, and thus species with highly expressive faces would have evolved uniformly coloured faces. We test this hypothesis through a phylogenetic comparative study, and explore the underlying morphological factors of facial mobility. Supporting our hypothesis, we find that species with highly expressive faces have plain facial colour patterns. The number of facial muscles does not predict facial mobility; instead, species that are larger and have a larger facial nucleus have more expressive faces. This highlights a potential trade-off between facial mobility and colour patterning in primates and reveals complex relationships between facial features during primate evolution. PMID:24850898

  14. The androgen receptor controls expression of the cancer-associated sTn antigen and cell adhesion through induction of ST6GalNAc1 in prostate cancer

    PubMed Central

    Munkley, Jennifer; Oltean, Sebastian; Vodák, Daniel; Wilson, Brian T.; Livermore, Karen E.; Zhou, Yan; Star, Eleanor; Floros, Vasileios I.; Johannessen, Bjarne; Knight, Bridget; McCullagh, Paul; McGrath, John; Crundwell, Malcolm; Skotheim, Rolf I.; Robson, Craig N.; Leung, Hing Y.; Harries, Lorna W.; Rajan, Prabhakar; Mills, Ian G.; Elliott, David J.

    2015-01-01

    Patterns of glycosylation are important in cancer, but the molecular mechanisms that drive changes are often poorly understood. The androgen receptor drives prostate cancer (PCa) development and progression to lethal metastatic castration-resistant disease. Here we used RNA-Seq coupled with bioinformatic analyses of androgen-receptor (AR) binding sites and clinical PCa expression array data to identify ST6GalNAc1 as a direct and rapidly activated target gene of the AR in PCa cells. ST6GalNAc1 encodes a sialytransferase that catalyses formation of the cancer-associated sialyl-Tn antigen (sTn), which we find is also induced by androgen exposure. Androgens induce expression of a novel splice variant of the ST6GalNAc1 protein in PCa cells. This splice variant encodes a shorter protein isoform that is still fully functional as a sialyltransferase and able to induce expression of the sTn-antigen. Surprisingly, given its high expression in tumours, stable expression of ST6GalNAc1 in PCa cells reduced formation of stable tumours in mice, reduced cell adhesion and induced a switch towards a more mesenchymal-like cell phenotype in vitro. ST6GalNAc1 has a dynamic expression pattern in clinical datasets, being significantly up-regulated in primary prostate carcinoma but relatively down-regulated in established metastatic tissue. ST6GalNAc1 is frequently upregulated concurrently with another important glycosylation enzyme GCNT1 previously associated with prostate cancer progression and implicated in Sialyl Lewis X antigen synthesis. Together our data establishes an androgen-dependent mechanism for sTn antigen expression in PCa, and are consistent with a general role for the androgen receptor in driving important coordinate changes to the glycoproteome during PCa progression. PMID:26452038

  15. Mechanisms controlling neurite outgrowth in a pheochromocytoma cell line: The role of TRPC channels

    PubMed Central

    Kumar, Sanjay; Chakraborty, Saikat; Barbosa, Cindy; Brustovetsky, Tatiana; Brustovetsky, Nickolay; Obukhov, Alexander G.

    2014-01-01

    Transient Receptor Potential Canonical (TRPC) channels are implicated in modulating neurite outgrowth. The expression pattern of TRPC changes significantly during brain development, suggesting that fine-tuning TRPC expression may be important for orchestrating neuritogenesis. To study how alterations in the TRPC expression pattern affect neurite outgrowth, we used nerve growth factor (NGF)-differentiated rat pheochromocytoma 12 (PC12) cells, a model system for neuritogenesis. In PC12 cells, NGF markedly up-regulated TRPC1 and TRPC6 expression, but down-regulated TRPC5 expression while promoting neurite outgrowth. Overexpression of TRPC1 augmented, whereas TRPC5 overexpression decelerated NGF-induced neurite outgrowth. Conversely, shRNA-mediated knockdown of TRPC1 decreased, whereas shRNA-mediated knockdown of TRPC5 increased NGF-induced neurite extension. Endogenous TRPC1 attenuated the anti-neuritogenic effect of overexpressed TRPC5 in part by forming the heteromeric TRPC1–TRPC5 channels. Previous reports suggested that TRPC6 may facilitate neurite outgrowth. However, we found that TRPC6 overexpression slowed down neuritogenesis, whereas dominant negative TRPC6 (DN-TRPC6) facilitated neurite outgrowth in NGF-differentiated PC12 cells. Consistent with these findings, hyperforin, a neurite outgrowth promoting factor, decreased TRPC6 expression in NGF-differentiated PC12 cells. Using pharmacological and molecular biological approaches, we determined that NGF up-regulated TRPC1 and TRPC6 expression via a p75NTR-IKK2-dependent pathway that did not involve TrkA receptor signaling in PC12 cells. Similarly, NGF up-regulated TRPC1 and TRPC6 via an IKK2 dependent pathway in primary cultured hippocampal neurons. Thus, our data suggest that a balance of TRPC1, TRPC5, and TRPC6 expression determines neurite extension rate in neural cells, with TRPC6 emerging as an NGF-dependent “molecular damper” maintaining a submaximal velocity of neurite extension. PMID:21618530

  16. Analysis of AtGUS1 and AtGUS2 in Arabidopsis root apex by a highly sensitive TSA-MISH method.

    PubMed

    Bruno, Leonardo; Ronchini, Matteo; Gagliardi, Olimpia; Corinti, Tamara; Chiappetta, Adriana; Gerola, Paolo; Bitonti, Maria B

    2015-01-01

    A new highly sensitive whole-mount in situ hybridization method, based on tyramide signal amplification (TSA-MISH) was developed and a combined GFP detection and TSA-MISH procedure was applied for the first time in plants, to precisely define the spatial pattern of AtGUS1 and AtGUS2 expression in the root apex. β-glucuronidases (GUSs) belonging to the glycosyl hydrolases (GHs) 79 family, are widely distributed in plants, but their functional role has not yet been fully investigated. In the model system Arabidopsis Thaliana, three different AtGUS genes have been identified which encode proteins with putative different fates. Endogenous GUS expression has been detected in different organs and tissues, but the cyto-histological domains of gene expression remain unclear. The results here reported show co-expression of AtGUS1 and AtGUS2 in different functional zones of the root apex (the cap central zone, the root cap meristem, the staminal cell niche and the cortical cell layers of the proximal meristem), while AtGUS2 is exclusively expressed in the cap peripheral layer and in the epidermis in the elongation zone. Interestingly, both genes are not expressed in the stelar portion of the proximal meristem. A spatial (cortex vs. stele) and temporal (proximal meristem vs. transition zone) regulation of AtGUS1 and AtGUS2 expression is therefore active in the root apex. This expression pattern, although globally consistent with the involvement of GUS activity in both cell proliferation and elongation, clearly indicates that AtGUS1 and AtGUS2 could control distinct downstream process depending on the developmental context and the interaction with other players of root growth control. In the future, the newly developed approaches may well be very useful to dissect such interactions.

  17. Cell-specific expression of tryptophan decarboxylase and 10-hydroxygeraniol oxidoreductase, key genes involved in camptothecin biosynthesis in Camptotheca acuminata Decne (Nyssaceae)

    PubMed Central

    2010-01-01

    Background Camptotheca acuminata is a major natural source of the terpenoid indole alkaloid camptothecin (CPT). At present, little is known about the cellular distribution of the biosynthesis of CPT, which would be useful knowledge for developing new strategies and technologies for improving alkaloid production. Results The pattern of CPT accumulation was compared with the expression pattern of some genes involved in CPT biosynthesis in C. acuminata [i.e., Ca-TDC1 and Ca-TDC2 (encoding for tryptophan decarboxylase) and Ca-HGO (encoding for 10-hydroxygeraniol oxidoreductase)]. Both CPT accumulation and gene expression were investigated in plants at different degrees of development and in plantlets subjected to drought-stress. In all organs, CPT accumulation was detected in epidermal idioblasts, in some glandular trichomes, and in groups of idioblast cells localized in parenchyma tissues. Drought-stress caused an increase in CPT accumulation and in the number of glandular trichomes containing CPT, whereas no increase in epidermal or parenchymatous idioblasts was observed. In the leaf, Ca-TDC1 expression was detected in some epidermal cells and in groups of mesophyll cells but not in glandular trichomes; in the stem, it was observed in parenchyma cells of the vascular tissue; in the root, no expression was detected. Ca-TDC2 expression was observed exclusively in leaves of plantlets subjected to drought-stress, in the same sites described for Ca-TDC1. In the leaf, Ca-HGO was detected in all chlorenchyma cells; in the stem, it was observed in the same sites described for Ca-TDC1; in the root, no expression was detected. Conclusions The finding that the sites of CPT accumulation are not consistently the same as those in which the studied genes are expressed demonstrates an organ-to-organ and cell-to-cell translocation of CPT or its precursors. PMID:20403175

  18. Cell-specific expression of tryptophan decarboxylase and 10-hydroxygeraniol oxidoreductase, key genes involved in camptothecin biosynthesis in Camptotheca acuminata Decne (Nyssaceae).

    PubMed

    Valletta, Alessio; Trainotti, Livio; Santamaria, Anna Rita; Pasqua, Gabriella

    2010-04-19

    Camptotheca acuminata is a major natural source of the terpenoid indole alkaloid camptothecin (CPT). At present, little is known about the cellular distribution of the biosynthesis of CPT, which would be useful knowledge for developing new strategies and technologies for improving alkaloid production. The pattern of CPT accumulation was compared with the expression pattern of some genes involved in CPT biosynthesis in C. acuminata [i.e., Ca-TDC1 and Ca-TDC2 (encoding for tryptophan decarboxylase) and Ca-HGO (encoding for 10-hydroxygeraniol oxidoreductase)]. Both CPT accumulation and gene expression were investigated in plants at different degrees of development and in plantlets subjected to drought-stress. In all organs, CPT accumulation was detected in epidermal idioblasts, in some glandular trichomes, and in groups of idioblast cells localized in parenchyma tissues. Drought-stress caused an increase in CPT accumulation and in the number of glandular trichomes containing CPT, whereas no increase in epidermal or parenchymatous idioblasts was observed. In the leaf, Ca-TDC1 expression was detected in some epidermal cells and in groups of mesophyll cells but not in glandular trichomes; in the stem, it was observed in parenchyma cells of the vascular tissue; in the root, no expression was detected. Ca-TDC2 expression was observed exclusively in leaves of plantlets subjected to drought-stress, in the same sites described for Ca-TDC1. In the leaf, Ca-HGO was detected in all chlorenchyma cells; in the stem, it was observed in the same sites described for Ca-TDC1; in the root, no expression was detected. The finding that the sites of CPT accumulation are not consistently the same as those in which the studied genes are expressed demonstrates an organ-to-organ and cell-to-cell translocation of CPT or its precursors.

  19. Characterization of basal gene expression trends over a diurnal cycle in Xiphophorus maculatus skin, brain and liver.

    PubMed

    Lu, Yuan; Reyes, Jose; Walter, Sean; Gonzalez, Trevor; Medrano, Geraldo; Boswell, Mikki; Boswell, William; Savage, Markita; Walter, Ronald

    2018-06-01

    Evolutionarily conserved diurnal circadian mechanisms maintain oscillating patterns of gene expression based on the day-night cycle. Xiphophorus fish have been used to evaluate transcriptional responses after exposure to various light sources and it was determined that each source incites distinct genetic responses in skin tissue. However, basal expression levels of genes that show oscillating expression patterns in day-night cycle, may affect the outcomes of such experiments, since basal gene expression levels at each point in the circadian path may influence the profile of identified light responsive genes. Lack of knowledge regarding diurnal fluctuations in basal gene expression patterns may confound the understanding of genetic responses to external stimuli (e.g., light) since the dynamic nature of gene expression implies animals subjected to stimuli at different times may be at very different stages within the continuum of genetic homeostasis. We assessed basal gene expression changes over a 24-hour period in 200 select Xiphophorus gene targets known to transcriptionally respond to various types of light exposure. We identified 22 genes in skin, 36 genes in brain and 28 genes in liver that exhibit basal oscillation of expression patterns. These genes, including known circadian regulators, produced the expected expression patterns over a 24-hour cycle when compared to circadian regulatory genes identified in other species, especially human and other vertebrate animal models. Our results suggest the regulatory network governing diurnal oscillating gene expression is similar between Xiphophorus and other vertebrates for the three Xiphophorus organs tested. In addition, we were able to categorize light responsive gene sets in Xiphophorus that do, and do not, exhibit circadian based oscillating expression patterns. Copyright © 2017 Elsevier Inc. All rights reserved.

  20. Neural responses to facial expressions support the role of the amygdala in processing threat

    PubMed Central

    Sormaz, Mladen; Flack, Tessa; Asghar, Aziz U. R.; Fan, Siyan; Frey, Julia; Manssuer, Luis; Usten, Deniz; Young, Andrew W.; Andrews, Timothy J.

    2014-01-01

    The amygdala is known to play an important role in the response to facial expressions that convey fear. However, it remains unclear whether the amygdala’s response to fear reflects its role in the interpretation of danger and threat, or whether it is to some extent activated by all facial expressions of emotion. Previous attempts to address this issue using neuroimaging have been confounded by differences in the use of control stimuli across studies. Here, we address this issue using a block design functional magnetic resonance imaging paradigm, in which we compared the response to face images posing expressions of fear, anger, happiness, disgust and sadness with a range of control conditions. The responses in the amygdala to different facial expressions were compared with the responses to a non-face condition (buildings), to mildly happy faces and to neutral faces. Results showed that only fear and anger elicited significantly greater responses compared with the control conditions involving faces. Overall, these findings are consistent with the role of the amygdala in processing threat, rather than in the processing of all facial expressions of emotion, and demonstrate the critical importance of the choice of comparison condition to the pattern of results. PMID:24097376

  1. Alternative dominance of the parental genomes in hybrid cells generated through the fusion of mouse embryonic stem cells with fibroblasts.

    PubMed

    Matveeva, Natalia M; Fishman, Veniamin S; Zakharova, Irina S; Shevchenko, Alexander I; Pristyazhnyuk, Inna E; Menzorov, Aleksei G; Serov, Oleg L

    2017-12-22

    For the first time, two types of hybrid cells with embryonic stem (ES) cell-like and fibroblast-like phenotypes were produced through the fusion of mouse ES cells with fibroblasts. Transcriptome analysis of 2,848 genes differentially expressed in the parental cells demonstrated that 34-43% of these genes are expressed in hybrid cells, consistent with their phenotypes; 25-29% of these genes display intermediate levels of expression, and 12-16% of these genes maintained expression at the parental cell level, inconsistent with the phenotype of the hybrid cell. Approximately 20% of the analyzed genes displayed unexpected expression patterns that differ from both parents. An unusual phenomenon was observed, namely, the illegitimate activation of Xist expression and the inactivation of one of two X-chromosomes in the near-tetraploid fibroblast-like hybrid cells, whereas both Xs were active before and after in vitro differentiation of the ES cell-like hybrid cells. These results and previous data obtained on heterokaryons suggest that the appearance of hybrid cells with a fibroblast-like phenotype reflects the reprogramming, rather than the induced differentiation, of the ES cell genome under the influence of a somatic partner.

  2. Regional expression patterns of taste receptors and gustducin in the mouse tongue.

    PubMed

    Kim, Mi-Ryung; Kusakabe, Yuko; Miura, Hirohito; Shindo, Yoichiro; Ninomiya, Yuzo; Hino, Akihiro

    2003-12-12

    In order to understand differences in taste sensitivities of taste bud cells between the anterior and posterior part of tongue, it is important to analyze the regional expression patterns of genes related to taste signal transduction on the tongue. Here we examined the expression pattern of a taste receptor family, the T1r family, and gustducin in circumvallate and fungiform papillae of the mouse tongue using double-labeled in situ hybridization. Each member of the T1r family was expressed in both circumvallate and fungiform papillae with some differences in their expression patterns. The most striking difference between fungiform and circumvallate papillae was observed in their co-expression patterns of T1r2, T1r3, and gustducin. T1r2-positive cells in fungiform papillae co-expressed T1r3 and gustducin, whereas T1r2 and T1r3 double-positive cells in circumvallate papillae merely expressed gustducin. These results suggested that in fungiform papillae, gustducin might play a role in the sweet taste signal transduction cascade mediated by a sweet receptor based on the T1r2 and T1r3 combination, in fungiform papillae.

  3. Identification of Human HK Genes and Gene Expression Regulation Study in Cancer from Transcriptomics Data Analysis

    PubMed Central

    Zhang, Zhang; Liu, Jingxing; Wu, Jiayan; Yu, Jun

    2013-01-01

    The regulation of gene expression is essential for eukaryotes, as it drives the processes of cellular differentiation and morphogenesis, leading to the creation of different cell types in multicellular organisms. RNA-Sequencing (RNA-Seq) provides researchers with a powerful toolbox for characterization and quantification of transcriptome. Many different human tissue/cell transcriptome datasets coming from RNA-Seq technology are available on public data resource. The fundamental issue here is how to develop an effective analysis method to estimate expression pattern similarities between different tumor tissues and their corresponding normal tissues. We define the gene expression pattern from three directions: 1) expression breadth, which reflects gene expression on/off status, and mainly concerns ubiquitously expressed genes; 2) low/high or constant/variable expression genes, based on gene expression level and variation; and 3) the regulation of gene expression at the gene structure level. The cluster analysis indicates that gene expression pattern is higher related to physiological condition rather than tissue spatial distance. Two sets of human housekeeping (HK) genes are defined according to cell/tissue types, respectively. To characterize the gene expression pattern in gene expression level and variation, we firstly apply improved K-means algorithm and a gene expression variance model. We find that cancer-associated HK genes (a HK gene is specific in cancer group, while not in normal group) are expressed higher and more variable in cancer condition than in normal condition. Cancer-associated HK genes prefer to AT-rich genes, and they are enriched in cell cycle regulation related functions and constitute some cancer signatures. The expression of large genes is also avoided in cancer group. These studies will help us understand which cell type-specific patterns of gene expression differ among different cell types, and particularly for cancer. PMID:23382867

  4. Two-Stage, In Silico Deconvolution of the Lymphocyte Compartment of the Peripheral Whole Blood Transcriptome in the Context of Acute Kidney Allograft Rejection

    PubMed Central

    Shannon, Casey P.; Balshaw, Robert; Ng, Raymond T.; Wilson-McManus, Janet E.; Keown, Paul; McMaster, Robert; McManus, Bruce M.; Landsberg, David; Isbel, Nicole M.; Knoll, Greg; Tebbutt, Scott J.

    2014-01-01

    Acute rejection is a major complication of solid organ transplantation that prevents the long-term assimilation of the allograft. Various populations of lymphocytes are principal mediators of this process, infiltrating graft tissues and driving cell-mediated cytotoxicity. Understanding the lymphocyte-specific biology associated with rejection is therefore critical. Measuring genome-wide changes in transcript abundance in peripheral whole blood cells can deliver a comprehensive view of the status of the immune system. The heterogeneous nature of the tissue significantly affects the sensitivity and interpretability of traditional analyses, however. Experimental separation of cell types is an obvious solution, but is often impractical and, more worrying, may affect expression, leading to spurious results. Statistical deconvolution of the cell type-specific signal is an attractive alternative, but existing approaches still present some challenges, particularly in a clinical research setting. Obtaining time-matched sample composition to biologically interesting, phenotypically homogeneous cell sub-populations is costly and adds significant complexity to study design. We used a two-stage, in silico deconvolution approach that first predicts sample composition to biologically meaningful and homogeneous leukocyte sub-populations, and then performs cell type-specific differential expression analysis in these same sub-populations, from peripheral whole blood expression data. We applied this approach to a peripheral whole blood expression study of kidney allograft rejection. The patterns of differential composition uncovered are consistent with previous studies carried out using flow cytometry and provide a relevant biological context when interpreting cell type-specific differential expression results. We identified cell type-specific differential expression in a variety of leukocyte sub-populations at the time of rejection. The tissue-specificity of these differentially expressed probe-set lists is consistent with the originating tissue and their functional enrichment consistent with allograft rejection. Finally, we demonstrate that the strategy described here can be used to derive useful hypotheses by validating a cell type-specific ratio in an independent cohort using the nanoString nCounter assay. PMID:24733377

  5. CD64-Neutrophil expression and stress metabolic patterns in early sepsis and severe traumatic brain injury in children.

    PubMed

    Fitrolaki, Diana-Michaela; Dimitriou, Helen; Kalmanti, Maria; Briassoulis, George

    2013-03-01

    Critical illness constitutes a serious derangement of metabolism. The aim of our study was to compare acute phase metabolic patterns in children with sepsis (S) or severe sepsis/septic shock (SS) to those with severe traumatic brain injury (TBI) and healthy controls (C) and to evaluate their relations to neutrophil, lymphocyte and monocyte expressions of CD64 and CD11b. Sixty children were enrolled in the study. Forty-five children with systemic inflammatory response syndrome (SIRS) were classified into three groups: TBI (n = 15), S (n = 15), and SS (n = 15). C consisted of 15 non- SIRS patients undergoing screening tests for minor elective surgery. Blood samples were collected within 6 hours after admission for flow cytometry of neutrophil, lymphocyte and monocyte expression of CD64 and CD11b (n = 60). Procalcitonin (PCT), C-reactive protein (CRP), glucose, triglycerides (TG), total cholesterol (TC), high (HDL) or low-density-lipoproteins (LDL) were also determined in all groups, and repeated on day 2 and 3 in the 3 SIRS groups (n = 150). CRP, PCT and TG (p < 0.01) were significantly increased in S and SS compared to TBI and C; glucose did not differ among critically ill groups. Significantly lower were the levels of TC, LDL, and HDL in septic groups compared to C and to moderate changes in TBI (p < 0.0001) but only LDL differed between S and SS (p < 0.02). Among septic patients, PCT levels declined significantly (p < 0.02) with time, followed by parallel decrease of HDL (p < 0.03) and increase of TG (p < 0.02) in the SS group. Neutrophil CD64 (nCD64) expression was higher in patients with SS (81.2%) and S (78.8%) as compared to those with TBI (5.5%) or C (0.9%, p < 0.0001). nCD64 was positively related with CRP, PCT, glucose, and TG (p < 0.01) and negatively with TC, LDL, and HDL (p < 0.0001), but not with severity of illness, hematologic indices, length of stay or mechanical ventilation duration. In sepsis, the early stress-metabolic pattern is characterized by a high (nCD64, glucose, TG) - low (TC, HDL, LDL) combination in contrast to the moderate pattern of TBI in which only glucose increases combined with a moderate cholesterol - lipoprotein decrease. These early metabolic patterns persist the first 3 days of acute illness and are associated with the acute phase CD64 expression on neutrophils.

  6. Expression of Eag1 K+ channel and ErbBs in human pituitary adenomas: cytoskeleton arrangement patterns in cultured cells.

    PubMed

    del Pliego, Margarita González; Aguirre-Benítez, Elsa; Paisano-Cerón, Karina; Valdovinos-Ramírez, Irene; Rangel-Morales, Carlos; Rodríguez-Mata, Verónica; Solano-Agama, Carmen; Martín-Tapia, Dolores; de la Vega, María Teresa; Saldoval-Balanzario, Miguel; Camacho, Javier; Mendoza-Garrido, María Eugenia

    2013-01-01

    Pituitary adenomas can invade surrounded tissue, but the mechanism remains elusive. Ether à go-go-1 (Eag1) potassium channel and epidermal growth factor receptors (ErbB1 and ErbB2) have been associated to invasive phenotypes or poor prognosis in cancer patients. However, cells arrange their cytoskeleton in order to acquire a successful migration pattern. We have studied ErbBs and Eag1 expression, and cytoskeleton arrangements in 11 human pituitary adenomas. Eag1, ErbB1 and ErbB2 expression were studied by immunochemistry in tissue and cultured cells. The cytoskeleton arrangement was analyzed in cultured cells by immunofluorescence. Normal pituitary tissue showed ErbB2 expression and Eag1 only in few cells. However, Eag1 and ErbB2 were expressed in all the tumors analyzed. ErbB1 expression was observed variable and did not show specificity for a tumor characteristic. Cultured cells from micro- and macro-adenomas clinically functional organize their cytoskeleton suggesting a mesenchymal pattern, and a round leucocyte/amoeboid pattern from invasive clinically silent adenoma. Pituitary tumors over-express EGF receptors and the ErbB2 repeated expression suggests is a characteristic of adenomas. Eag 1 was express, in different extent, and could be a therapeutic target. The cytoskeleton arrangements observed suggest that pituitary tumor cells acquire different patterns: mesenchymal, and leucocyte/amoeboid, the last observed in the invasive adenomas. Amoeboid migration pattern has been associated with high invasion capacity.

  7. Transcriptional profile of breast muscle in heat stressed layers is similar to that of broiler chickens at control temperature.

    PubMed

    Zahoor, Imran; de Koning, Dirk-Jan; Hocking, Paul M

    2017-09-20

    In recent years, the commercial importance of changes in muscle function of broiler chickens and of the corresponding effects on meat quality has increased. Furthermore, broilers are more sensitive to heat stress during transport and at high ambient temperatures than smaller egg-laying chickens. We hypothesised that heat stress would amplify muscle damage and expression of genes that are involved in such changes and, thus, lead to the identification of pathways and networks associated with broiler muscle and meat quality traits. Broiler and layer chickens were exposed to control or high ambient temperatures to characterise differences in gene expression between the two genotypes and the two environments. Whole-genome expression studies in breast muscles of broiler and layer chickens were conducted before and after heat stress; 2213 differentially-expressed genes were detected based on a significant (P < 0.05) genotype × treatment interaction. This gene set was analysed with the BioLayout Express 3D and Ingenuity Pathway Analysis software and relevant biological pathways and networks were identified. Genes involved in functions related to inflammatory reactions, cell death, oxidative stress and tissue damage were upregulated in control broilers compared with control and heat-stressed layers. Expression of these genes was further increased in heat-stressed broilers. Differences in gene expression between broiler and layer chickens under control and heat stress conditions suggest that damage of breast muscles in broilers at normal ambient temperatures is similar to that in heat-stressed layers and is amplified when broilers are exposed to heat stress. The patterns of gene expression of the two genotypes under heat stress were almost the polar opposite of each other, which is consistent with the conclusion that broiler chickens were not able to cope with heat stress by dissipating their body heat. The differentially expressed gene networks and pathways were consistent with the pathological changes that are observed in the breast muscle of heat-stressed broilers.

  8. Annotation of gene function in citrus using gene expression information and co-expression networks

    PubMed Central

    2014-01-01

    Background The genus Citrus encompasses major cultivated plants such as sweet orange, mandarin, lemon and grapefruit, among the world’s most economically important fruit crops. With increasing volumes of transcriptomics data available for these species, Gene Co-expression Network (GCN) analysis is a viable option for predicting gene function at a genome-wide scale. GCN analysis is based on a “guilt-by-association” principle whereby genes encoding proteins involved in similar and/or related biological processes may exhibit similar expression patterns across diverse sets of experimental conditions. While bioinformatics resources such as GCN analysis are widely available for efficient gene function prediction in model plant species including Arabidopsis, soybean and rice, in citrus these tools are not yet developed. Results We have constructed a comprehensive GCN for citrus inferred from 297 publicly available Affymetrix Genechip Citrus Genome microarray datasets, providing gene co-expression relationships at a genome-wide scale (33,000 transcripts). The comprehensive citrus GCN consists of a global GCN (condition-independent) and four condition-dependent GCNs that survey the sweet orange species only, all citrus fruit tissues, all citrus leaf tissues, or stress-exposed plants. All of these GCNs are clustered using genome-wide, gene-centric (guide) and graph clustering algorithms for flexibility of gene function prediction. For each putative cluster, gene ontology (GO) enrichment and gene expression specificity analyses were performed to enhance gene function, expression and regulation pattern prediction. The guide-gene approach was used to infer novel roles of genes involved in disease susceptibility and vitamin C metabolism, and graph-clustering approaches were used to investigate isoprenoid/phenylpropanoid metabolism in citrus peel, and citric acid catabolism via the GABA shunt in citrus fruit. Conclusions Integration of citrus gene co-expression networks, functional enrichment analysis and gene expression information provide opportunities to infer gene function in citrus. We present a publicly accessible tool, Network Inference for Citrus Co-Expression (NICCE, http://citrus.adelaide.edu.au/nicce/home.aspx), for the gene co-expression analysis in citrus. PMID:25023870

  9. Shapes and features of the primordial bispectrum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gong, Jinn-Ouk; Palma, Gonzalo A.; Sypsas, Spyros, E-mail: jinn-ouk.gong@apctp.org, E-mail: gpalmaquilod@ing.uchile.cl, E-mail: s.sypsas@gmail.com

    If time-dependent disruptions from slow-roll occur during inflation, the correlation functions of the primordial curvature perturbation should have scale-dependent features, a case which is marginally supported from the cosmic microwave background (CMB) data. We offer a new approach to analyze the appearance of such features in the primordial bispectrum that yields new consistency relations and justifies the search of oscillating patterns modulated by orthogonal and local templates. Under the assumption of sharp features, we find that the cubic couplings of the curvature perturbation can be expressed in terms of the bispectrum in two specific momentum configurations, for example local andmore » equilateral. This allows us to derive consistency relations among different bispectrum shapes, which in principle could be tested in future CMB surveys. Furthermore, based on the form of the consistency relations, we construct new two-parameter templates for features that include all the known shapes.« less

  10. Photosynthetic behavior of woody species under high ozone exposure probed with the JIP-test: a review.

    PubMed

    Bussotti, Filippo; Strasser, Reto J; Schaub, Marcus

    2007-06-01

    Visible ozone symptoms on leaves are expressions of physiological mechanisms to cope with oxidative stresses. Often, the symptoms consist of stippling, which corresponds to localized cell death (hypersensitive response, HR), separated from healthy cells by a layer of callose. The HR strategy tends to protect the healthy cells and in most cases the efficiency of chlorophyll to trap energy is not affected. In other cases, the efficiency of leaves to produce biomass declines and the plant loses its photosynthetic apparatus replacing it with a new, more efficient one. Another strategy consists of the production of pigments (anthocyanins), and leaves become reddish. In these cases, the most significant physiological manifestation consists of the enhanced dissipation of energy. These different behavior patterns are reflected in the initial events of photosynthetic activity, and can be monitored with techniques based on the direct fluorescence of chlorophyll a in photosystem II, applying the JIP-test.

  11. Genomic Expression Patterns in Menstrually-Related Migraine in Adolescents

    PubMed Central

    Hershey, Andrew; Horn, Paul; Kabbouche, Marielle; O'Brien, Hope; Powers, Scott

    2011-01-01

    Background Exacerbation of migraine with menses is common in adolescent girls and women with migraine, occurring in up to 60% of females with migraine. These migraines are oftentimes longer and more disabling and may be related to estrogen levels and hormonal fluctuations. Objective This study identifies the unique genomic expression pattern of menstrually-related migraine (MRM) in comparison to migraine occurring outside the menstrual period and headache free controls. Methods Whole blood samples were obtained from female subjects having an acute migraine during their menstrual period (MRM) or outside of their menstrual period (nonMRM) and controls (C) – females having a menstrual period without any history of headache. The mRNA was isolated from these samples and genomic profile was assessed. Affymetrix Human Exon ST 1.0 arrays were used to examine the genomic expression pattern differences between these three groups. Results Blood genomic expression patterns were obtained on 56 subjects (MRM = 18, nonMRM = 18 and C = 20). Unique genomic expression patterns were observed for both MRM and nonMRM. For MRM, 77 genes were identified that were unique to MRM, while 61 genes were commonly expressed for MRM and nonMRM and 127 genes appeared to have a unique expression pattern for nonMRM. In addition, there were 279 genes that differentially expressed for MRM compared to nonMRM that were not differentially expressed for nonMRM. Gene ontology of these samples indicated many of these groups of genes were functionally related and included categories of immunomodulation/inflammation, mitochondrial function and DNA homeostasis. Conclusions Blood genomic patterns can accurately differentiate MRM from nonMRM. These results indicate that MRM involves a unique molecular biology pathway that can be identified with a specific biomarker and suggest that individuals with MRM have a different underlying genetic etiology. PMID:22220971

  12. LAT region factors mediating differential neuronal tropism of HSV-1 and HSV-2 do not act in trans.

    PubMed

    Bertke, Andrea S; Apakupakul, Kathleen; Ma, AyeAye; Imai, Yumi; Gussow, Anne M; Wang, Kening; Cohen, Jeffrey I; Bloom, David C; Margolis, Todd P

    2012-01-01

    After HSV infection, some trigeminal ganglion neurons support productive cycle gene expression, while in other neurons the virus establishes a latent infection. We previously demonstrated that HSV-1 and HSV-2 preferentially establish latent infection in A5+ and KH10+ sensory neurons, respectively, and that exchanging the latency-associated transcript (LAT) between HSV-1 and HSV-2 also exchanges the neuronal preference. Since many viral genes besides the LAT are functionally interchangeable between HSV-1 and HSV-2, we co-infected HSV-1 and HSV-2, both in vivo and in vitro, to determine if trans-acting viral factors regulate whether HSV infection follows a productive or latent pattern of gene expression in sensory neurons. The pattern of HSV-1 and HSV-2 latent infection in trigeminal neurons was no different following co-infection than with either virus alone, consistent with the hypothesis that a trans-acting viral factor is not responsible for the different patterns of latent infection of HSV-1 and HSV-2 in A5+ and KH10+ neurons. Since exchanging the LAT regions between the viruses also exchanges neuronal preferences, we infected transgenic mice that constitutively express 2.8 kb of the LAT region with the heterologous viral serotype. Endogenous expression of LAT did not alter the pattern of latent infection after inoculation with the heterologous serotype virus, demonstrating that the LAT region does not act in trans to direct preferential establishment of latency of HSV-1 and HSV-2. Using HSV1-RFP and HSV2-GFP in adult trigeminal ganglion neurons in vitro, we determined that HSV-1 and HSV-2 do not exert trans-acting effects during acute infection to regulate neuron specificity. Although some neurons were productively infected with both HSV-1 and HSV-2, no A5+ or KH10+ neurons were productively infected with both viruses. Thus, trans-acting viral factors do not regulate preferential permissiveness of A5+ and KH10+ neurons for productive HSV infection and preferential establishment of latent infection.

  13. LAT Region Factors Mediating Differential Neuronal Tropism of HSV-1 and HSV-2 Do Not Act in Trans

    PubMed Central

    Bertke, Andrea S.; Apakupakul, Kathleen; Ma, AyeAye; Imai, Yumi; Gussow, Anne M.; Wang, Kening; Cohen, Jeffrey I.; Bloom, David C.; Margolis, Todd P.

    2012-01-01

    After HSV infection, some trigeminal ganglion neurons support productive cycle gene expression, while in other neurons the virus establishes a latent infection. We previously demonstrated that HSV-1 and HSV-2 preferentially establish latent infection in A5+ and KH10+ sensory neurons, respectively, and that exchanging the latency-associated transcript (LAT) between HSV-1 and HSV-2 also exchanges the neuronal preference. Since many viral genes besides the LAT are functionally interchangeable between HSV-1 and HSV-2, we co-infected HSV-1 and HSV-2, both in vivo and in vitro, to determine if trans-acting viral factors regulate whether HSV infection follows a productive or latent pattern of gene expression in sensory neurons. The pattern of HSV-1 and HSV-2 latent infection in trigeminal neurons was no different following co-infection than with either virus alone, consistent with the hypothesis that a trans-acting viral factor is not responsible for the different patterns of latent infection of HSV-1 and HSV-2 in A5+ and KH10+ neurons. Since exchanging the LAT regions between the viruses also exchanges neuronal preferences, we infected transgenic mice that constitutively express 2.8 kb of the LAT region with the heterologous viral serotype. Endogenous expression of LAT did not alter the pattern of latent infection after inoculation with the heterologous serotype virus, demonstrating that the LAT region does not act in trans to direct preferential establishment of latency of HSV-1 and HSV-2. Using HSV1-RFP and HSV2-GFP in adult trigeminal ganglion neurons in vitro, we determined that HSV-1 and HSV-2 do not exert trans-acting effects during acute infection to regulate neuron specificity. Although some neurons were productively infected with both HSV-1 and HSV-2, no A5+ or KH10+ neurons were productively infected with both viruses. Thus, trans-acting viral factors do not regulate preferential permissiveness of A5+ and KH10+ neurons for productive HSV infection and preferential establishment of latent infection. PMID:23300908

  14. Regulatory analysis of the mouse Hoxb3 gene: multiple elements work in concert to direct temporal and spatial patterns of expression.

    PubMed

    Kwan, C T; Tsang, S L; Krumlauf, R; Sham, M H

    2001-04-01

    The expression pattern of the mouse Hoxb3 gene is exceptionally complex and dynamic compared with that of other members of the Hoxb cluster. There are multiple types of transcripts for Hoxb3 gene, and the anterior boundaries of its expression vary at different stages of development. Two enhancers flanking Hoxb3 on the 3' and 5' sides regulate Hoxb2 and Hoxb4, respectively, and these control regions define the two ends of a 28-kb interval in and around the Hoxb3 locus. To assay the regulatory potential of DNA fragments in this interval we have used transgenic analysis with a lacZ reporter gene to locate cis-elements for directing the dynamic patterns of Hoxb3 expression. Our detailed analysis has identified four new and widely spaced cis-acting regulatory regions that can together account for major aspects of the Hoxb3 expression pattern. Elements Ib, IIIa, and IVb control gene expression in neural and mesodermal tissues; element Va controls mesoderm-specific gene expression. The most anterior neural expression domain of Hoxb3 is controlled by an r5 enhancer (element IVa); element IIIa directs reporter expression in the anterior spinal cord and hindbrain up to r6, and the region A enhancer (in element I) mediates posterior neural expression. Hence, the regulation of segmental expression of Hoxb3 in the hindbrain is different from that of Hoxa3, as two separate enhancer elements contribute to expression in r5 and r6. The mesoderm-specific element (Va) directs reporter expression to prevertebra C1 at 12.5 dpc, which is the anterior limit of paraxial mesoderm expression for Hoxb3. When tested in combinations, these cis-elements appear to work as modules in an additive manner to recapitulate the major endogenous expression patterns of Hoxb3 during embryogenesis. Together our study shows that multiple control elements direct reporter gene expression in diverse tissue-, temporal-, and spatially restricted subset of the endogenous Hoxb3 expression domains and work in concert to control the neural and mesodermal patterns of expression. Copyright 2001 Academic Press.

  15. Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia.

    PubMed

    Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J V; Schulz, Marcel H; Simon, Martin

    2015-08-01

    Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. © The Author 2015. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  16. BMPs regulate msx gene expression in the dorsal neuroectoderm of Drosophila and vertebrates by distinct mechanisms.

    PubMed

    Esteves, Francisco F; Springhorn, Alexander; Kague, Erika; Taylor, Erika; Pyrowolakis, George; Fisher, Shannon; Bier, Ethan

    2014-09-01

    In a broad variety of bilaterian species the trunk central nervous system (CNS) derives from three primary rows of neuroblasts. The fates of these neural progenitor cells are determined in part by three conserved transcription factors: vnd/nkx2.2, ind/gsh and msh/msx in Drosophila melanogaster/vertebrates, which are expressed in corresponding non-overlapping patterns along the dorsal-ventral axis. While this conserved suite of "neural identity" gene expression strongly suggests a common ancestral origin for the patterning systems, it is unclear whether the original regulatory mechanisms establishing these patterns have been similarly conserved during evolution. In Drosophila, genetic evidence suggests that Bone Morphogenetic Proteins (BMPs) act in a dosage-dependent fashion to repress expression of neural identity genes. BMPs also play a dose-dependent role in patterning the dorsal and lateral regions of the vertebrate CNS, however, the mechanism by which they achieve such patterning has not yet been clearly established. In this report, we examine the mechanisms by which BMPs act on cis-regulatory modules (CRMs) that control localized expression of the Drosophila msh and zebrafish (Danio rerio) msxB in the dorsal central nervous system (CNS). Our analysis suggests that BMPs act differently in these organisms to regulate similar patterns of gene expression in the neuroectoderm: repressing msh expression in Drosophila, while activating msxB expression in the zebrafish. These findings suggest that the mechanisms by which the BMP gradient patterns the dorsal neuroectoderm have reversed since the divergence of these two ancient lineages.

  17. BMPs Regulate msx Gene Expression in the Dorsal Neuroectoderm of Drosophila and Vertebrates by Distinct Mechanisms

    PubMed Central

    Esteves, Francisco F.; Taylor, Erika; Pyrowolakis, George; Fisher, Shannon; Bier, Ethan

    2014-01-01

    In a broad variety of bilaterian species the trunk central nervous system (CNS) derives from three primary rows of neuroblasts. The fates of these neural progenitor cells are determined in part by three conserved transcription factors: vnd/nkx2.2, ind/gsh and msh/msx in Drosophila melanogaster/vertebrates, which are expressed in corresponding non-overlapping patterns along the dorsal-ventral axis. While this conserved suite of “neural identity” gene expression strongly suggests a common ancestral origin for the patterning systems, it is unclear whether the original regulatory mechanisms establishing these patterns have been similarly conserved during evolution. In Drosophila, genetic evidence suggests that Bone Morphogenetic Proteins (BMPs) act in a dosage-dependent fashion to repress expression of neural identity genes. BMPs also play a dose-dependent role in patterning the dorsal and lateral regions of the vertebrate CNS, however, the mechanism by which they achieve such patterning has not yet been clearly established. In this report, we examine the mechanisms by which BMPs act on cis-regulatory modules (CRMs) that control localized expression of the Drosophila msh and zebrafish (Danio rerio) msxB in the dorsal central nervous system (CNS). Our analysis suggests that BMPs act differently in these organisms to regulate similar patterns of gene expression in the neuroectoderm: repressing msh expression in Drosophila, while activating msxB expression in the zebrafish. These findings suggest that the mechanisms by which the BMP gradient patterns the dorsal neuroectoderm have reversed since the divergence of these two ancient lineages. PMID:25210771

  18. Expression patterns of protein C inhibitor in mouse development.

    PubMed

    Wagenaar, Gerry T M; Uhrin, Pavel; Weipoltshammer, Klara; Almeder, Marlene; Hiemstra, Pieter S; Geiger, Margarethe; Meijers, Joost C M; Schöfer, Christian

    2010-02-01

    Proteolysis of extracellular matrix is an important requirement for embryonic development and is instrumental in processes such as morphogenesis, angiogenesis, and cell migration. Efficient remodeling requires controlled spatio-temporal expression of both the proteases and their inhibitors. Protein C inhibitor (PCI) effectively blocks a range of serine proteases, and recently has been suggested to play a role in cell differentiation and angiogenesis. In this study, we mapped the expression pattern of PCI throughout mouse development using in situ hybridization and immunohistochemistry. We detected a wide-spread, yet distinct expression pattern with prominent PCI levels in skin including vibrissae, and in fore- and hindgut. Further sites of PCI expression were choroid plexus of brain ventricles, heart, skeletal muscles, urogenital tract, and cartilages. A strong and stage-dependent PCI expression was observed in the developing lung. In the pseudoglandular stage, PCI expression was present in distal branching tubules whereas proximal tubules did not express PCI. Later in development, in the saccular stage, PCI expression was restricted to distal bronchioli whereas sacculi did not express PCI. PCI expression declined in postnatal stages and was not detected in adult lungs. In general, embryonic PCI expression indicates multifunctional roles of PCI during mouse development. The expression pattern of PCI during lung development suggests its possible involvement in lung morphogenesis and angiogenesis.

  19. Origin of heterogeneous spiking patterns from continuously distributed ion channel densities: a computational study in spinal dorsal horn neurons.

    PubMed

    Balachandar, Arjun; Prescott, Steven A

    2018-05-01

    Distinct spiking patterns may arise from qualitative differences in ion channel expression (i.e. when different neurons express distinct ion channels) and/or when quantitative differences in expression levels qualitatively alter the spike generation process. We hypothesized that spiking patterns in neurons of the superficial dorsal horn (SDH) of spinal cord reflect both mechanisms. We reproduced SDH neuron spiking patterns by varying densities of K V 1- and A-type potassium conductances. Plotting the spiking patterns that emerge from different density combinations revealed spiking-pattern regions separated by boundaries (bifurcations). This map suggests that certain spiking pattern combinations occur when the distribution of potassium channel densities straddle boundaries, whereas other spiking patterns reflect distinct patterns of ion channel expression. The former mechanism may explain why certain spiking patterns co-occur in genetically identified neuron types. We also present algorithms to predict spiking pattern proportions from ion channel density distributions, and vice versa. Neurons are often classified by spiking pattern. Yet, some neurons exhibit distinct patterns under subtly different test conditions, which suggests that they operate near an abrupt transition, or bifurcation. A set of such neurons may exhibit heterogeneous spiking patterns not because of qualitative differences in which ion channels they express, but rather because quantitative differences in expression levels cause neurons to operate on opposite sides of a bifurcation. Neurons in the spinal dorsal horn, for example, respond to somatic current injection with patterns that include tonic, single, gap, delayed and reluctant spiking. It is unclear whether these patterns reflect five cell populations (defined by distinct ion channel expression patterns), heterogeneity within a single population, or some combination thereof. We reproduced all five spiking patterns in a computational model by varying the densities of a low-threshold (K V 1-type) potassium conductance and an inactivating (A-type) potassium conductance and found that single, gap, delayed and reluctant spiking arise when the joint probability distribution of those channel densities spans two intersecting bifurcations that divide the parameter space into quadrants, each associated with a different spiking pattern. Tonic spiking likely arises from a separate distribution of potassium channel densities. These results argue in favour of two cell populations, one characterized by tonic spiking and the other by heterogeneous spiking patterns. We present algorithms to predict spiking pattern proportions based on ion channel density distributions and, conversely, to estimate ion channel density distributions based on spiking pattern proportions. The implications for classifying cells based on spiking pattern are discussed. © 2018 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

  20. The isolation of spatial patterning modes in a mathematical model of juxtacrine cell signalling.

    PubMed

    O'Dea, R D; King, J R

    2013-06-01

    Juxtacrine signalling mechanisms are known to be crucial in tissue and organ development, leading to spatial patterns in gene expression. We investigate the patterning behaviour of a discrete model of juxtacrine cell signalling due to Owen & Sherratt (1998, Mathematical modelling of juxtacrine cell signalling. Math. Biosci., 153, 125-150) in which ligand molecules, unoccupied receptors and bound ligand-receptor complexes are modelled. Feedback between the ligand and receptor production and the level of bound receptors is incorporated. By isolating two parameters associated with the feedback strength and employing numerical simulation, linear stability and bifurcation analysis, the pattern-forming behaviour of the model is analysed under regimes corresponding to lateral inhibition and induction. Linear analysis of this model fails to capture the patterning behaviour exhibited in numerical simulations. Via bifurcation analysis, we show that since the majority of periodic patterns fold subcritically from the homogeneous steady state, a wide variety of stable patterns exists at a given parameter set, providing an explanation for this failure. The dominant pattern is isolated via numerical simulation. Additionally, by sampling patterns of non-integer wavelength on a discrete mesh, we highlight a disparity between the continuous and discrete representations of signalling mechanisms: in the continuous case, patterns of arbitrary wavelength are possible, while sampling such patterns on a discrete mesh leads to longer wavelength harmonics being selected where the wavelength is rational; in the irrational case, the resulting aperiodic patterns exhibit 'local periodicity', being constructed from distorted stable shorter wavelength patterns. This feature is consistent with experimentally observed patterns, which typically display approximate short-range periodicity with defects.

  1. Nonparametric Hierarchical Bayesian Model for Functional Brain Parcellation

    PubMed Central

    Lashkari, Danial; Sridharan, Ramesh; Vul, Edward; Hsieh, Po-Jang; Kanwisher, Nancy; Golland, Polina

    2011-01-01

    We develop a method for unsupervised analysis of functional brain images that learns group-level patterns of functional response. Our algorithm is based on a generative model that comprises two main layers. At the lower level, we express the functional brain response to each stimulus as a binary activation variable. At the next level, we define a prior over the sets of activation variables in all subjects. We use a Hierarchical Dirichlet Process as the prior in order to simultaneously learn the patterns of response that are shared across the group, and to estimate the number of these patterns supported by data. Inference based on this model enables automatic discovery and characterization of salient and consistent patterns in functional signals. We apply our method to data from a study that explores the response of the visual cortex to a collection of images. The discovered profiles of activation correspond to selectivity to a number of image categories such as faces, bodies, and scenes. More generally, our results appear superior to the results of alternative data-driven methods in capturing the category structure in the space of stimuli. PMID:21841977

  2. Codon usage bias in prokaryotic pyrimidine-ending codons is associated with the degeneracy of the encoded amino acids

    PubMed Central

    Wald, Naama; Alroy, Maya; Botzman, Maya; Margalit, Hanah

    2012-01-01

    Synonymous codons are unevenly distributed among genes, a phenomenon termed codon usage bias. Understanding the patterns of codon bias and the forces shaping them is a major step towards elucidating the adaptive advantage codon choice can confer at the level of individual genes and organisms. Here, we perform a large-scale analysis to assess codon usage bias pattern of pyrimidine-ending codons in highly expressed genes in prokaryotes. We find a bias pattern linked to the degeneracy of the encoded amino acid. Specifically, we show that codon-pairs that encode two- and three-fold degenerate amino acids are biased towards the C-ending codon while codons encoding four-fold degenerate amino acids are biased towards the U-ending codon. This codon usage pattern is widespread in prokaryotes, and its strength is correlated with translational selection both within and between organisms. We show that this bias is associated with an improved correspondence with the tRNA pool, avoidance of mis-incorporation errors during translation and moderate stability of codon–anticodon interaction, all consistent with more efficient translation. PMID:22581775

  3. Identification of a rice metal tolerance protein OsMTP11 as a manganese transporter

    PubMed Central

    Zhang, Mei; Liu, Baoxiu

    2017-01-01

    Metal tolerance proteins (MTPs) are a gene family of cation efflux transporters that occur widely in plants and might serve an essential role in metal homeostasis and tolerance. Our research describes the identification, characterization, and localization of OsMTP11, a member of the MTP family from rice. OsMTP11 was expressed constitutively and universally in different tissues in rice plant. Heterologous expression in yeast showed that OsMTP11 complemented the hypersensitivity of mutant strains to Mn, and also complemented yeast mutants to other metals, including Co and Ni. Real time RT-PCR analysis demonstrated OsMTP11 expression was substantially enhanced following 4 h under Cd, Zn, Ni, and Mn treatments, suggesting possible roles of OsMTP11 involvement in heavy metal stress responses. Promoter analysis by transgenic assays with GUS as a reporter gene and mRNA in situ hybridization experiments showed that OsMTP11 was expressed specifically in conducting tissues in rice. DNA methylation assays of genomic DNA in rice treated with Cd, Zn, Ni, and Mn revealed that decreased DNA methylation levels were present in the OsMTP11 promoter region, which was consistent with OsMTP11 induced-expression patterns resulting from heavy metal stress. This result suggested that DNA methylation is one of major factors regulating expression of OsMTP11 through epigenetic mechanisms. OsMTP11 fused to green fluorescent protein (GFP) localized to the entire onion epidermal cell cytoplasm, while vacuolar membrane exhibited increased GFP signals, consistent with an OsMTP11 function in cation sequestration. Our results indicated that OsMTP11 might play vital roles in Mn and other heavy metal transportation in rice. PMID:28394944

  4. Expression and regulation of human endogenous retrovirus W elements.

    PubMed

    Li, Fang; Karlsson, Håkan

    2016-01-01

    Human endogenous retroviruses (HERV) comprise 8% of the human genome and can be classified into at least 31 families. A typical HERV provirus consists of internal gag, pol and env genes, flanked by two long terminal repeats (LTRs). No single provirus is capable of engendering infectious particles. HERV are by nature repetitive and have with few notable exceptions lost their protein-coding capacity. Therefore, HERV have consistently been excluded from array-based expression studies and hence little is known of their expression, regulation, and potential functional significance. An increasing number of studies have, however, observed expression of the W family of HERV in various human tissues and cells, predominantly in placenta. HERV-W LTRs act as promoters in directing transcription of HERV-W members, contribute to their tissue-specific and highly diversified expression pattern. Furthermore, leaky transcription originating from adjacent genes plays a role in the transcription initiation of HERV-W psudoelements. It has been reported that HERV-W elements, including ERVWE1 (the so far only known HERV-W locus harboring a gene (env) functionally adopted by the human host to critically participate in placenta biogenesis), can become transactivated in a range of human non-placental cell-lines during exogenous virus infections. Aberrant expression of HERV-W has been associated with human diseases, such as cancer, multiple sclerosis, and schizophrenia. Based on published reports, transcriptional activities of HERV-W appear to be influenced by several mechanisms; binding of transcription factors to LTR promoters and enhancers outside of LTRs, genetic variation and alteration in DNA methylation and histone modification. Emerging mechanistic studies support the notion that HERV-W represents a potential marker or mediator of environmental exposures (e.g., virus infection) in the development of chronic complex diseases. © 2016 APMIS. Published by John Wiley & Sons Ltd.

  5. Identification and Expression Profiles of Six Transcripts Encoding Carboxylesterase Protein in Vitis flexuosa Infected with Pathogens.

    PubMed

    Islam, Md Zaherul; Yun, Hae Keun

    2016-08-01

    Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585), VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132) showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674) were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi) after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines.

  6. Identification and Expression Profiles of Six Transcripts Encoding Carboxylesterase Protein in Vitis flexuosa Infected with Pathogens

    PubMed Central

    Islam, Md. Zaherul; Yun, Hae Keun

    2016-01-01

    Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585), VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132) showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674) were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi) after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines. PMID:27493610

  7. The Arabidopsis translatome cell-specific mRNA atlas: Mining suberin and cutin lipid monomer biosynthesis genes as an example for data application.

    PubMed

    Mustroph, Angelika; Bailey-Serres, Julia

    2010-03-01

    Plants consist of distinct cell types distinguished by position, morphological features and metabolic activities. We recently developed a method to extract cell-type specific mRNA populations by immunopurification of ribosome-associated mRNAs. Microarray profiles of 21 cell-specific mRNA populations from seedling roots and shoots comprise the Arabidopsis Translatome dataset. This gene expression atlas provides a new tool for the study of cell-specific processes. Here we provide an example of how genes involved in a pathway limited to one or few cell-types can be further characterized and new candidate genes can be predicted. Cells of the root endodermis produce suberin as an inner barrier between the cortex and stele, whereas the shoot epidermal cells form cutin as a barrier to the external environment. Both polymers consist of fatty acid derivates, and share biosynthetic origins. We use the Arabidopsis Translatome dataset to demonstrate the significant cell-specific expression patterns of genes involved in those biosynthetic processes and suggest new candidate genes in the biosynthesis of suberin and cutin.

  8. Rhabdom evolution in butterflies: insights from the uniquely tiered and heterogeneous ommatidia of the Glacial Apollo butterfly, Parnassius glacialis.

    PubMed

    Matsushita, Atsuko; Awata, Hiroko; Wakakuwa, Motohiro; Takemura, Shin-ya; Arikawa, Kentaro

    2012-09-07

    The eye of the Glacial Apollo butterfly, Parnassius glacialis, a 'living fossil' species of the family Papilionidae, contains three types of spectrally heterogeneous ommatidia. Electron microscopy reveals that the Apollo rhabdom is tiered. The distal tier is composed exclusively of photoreceptors expressing opsins of ultraviolet or blue-absorbing visual pigments, and the proximal tier consists of photoreceptors expressing opsins of green or red-absorbing visual pigments. This organization is unique because the distal tier of other known butterflies contains two green-sensitive photoreceptors, which probably function in improving spatial and/or motion vision. Interspecific comparison suggests that the Apollo rhabdom retains an ancestral tiered pattern with some modification to enhance its colour vision towards the long-wavelength region of the spectrum.

  9. BnDGAT1s Function Similarly in Oil Deposition and Are Expressed with Uniform Patterns in Tissues of Brassica napus

    PubMed Central

    Zhao, Cuizhu; Li, Huan; Zhang, Wenxue; Wang, Hailan; Xu, Aixia; Tian, Jianhua; Zou, Jitao; Taylor, David C.; Zhang, Meng

    2017-01-01

    As an allotetraploid oilcrop, Brassica napus contains four duplicated Acyl-CoA:diacylglycerol acyltransferase 1 (DGAT1) genes, which catalyze one of the rate-limiting steps in triacylglycerol (TAG) biosynthesis in plants. While all four BnDGAT1s have been expressed functionally in yeast, their expression patterns in different germplasms and tissues and also consequent contribution to seed oil accumulation in planta remain to be elucidated. In this study, the coding regions of the four BnDGAT1s were expressed in an Arabidopsis dgat1 mutant. All four BnDGAT1s showed similar effects on oil content and fatty acid composition, a result which is different from that observed in previous studies of their expression in yeast. Expression patterns of BnDGAT1s were analyzed in developing seeds of 34 B. napus inbred lines and in different tissues of 14 lines. Different expression patterns were observed for the four BnDGAT1s, which suggests that they express independently or randomly in different germplasm sources. Higher expression of BnDGAT1s was correlated with higher seed oil content lines. Tissue-specific analyses showed that the BnDGAT1s were expressed in a uniform pattern in different tissues. Our results suggest that it is important to maintain expression of the four BnDGAT1s for maximum return on oil content. PMID:29312429

  10. Mutually exclusive expression of human red and green visual pigment-reporter transgenes occurs at high frequency in murine cone photoreceptors.

    PubMed

    Wang, Y; Smallwood, P M; Cowan, M; Blesh, D; Lawler, A; Nathans, J

    1999-04-27

    This study examines the mechanism of mutually exclusive expression of the human X-linked red and green visual pigment genes in their respective cone photoreceptors by asking whether this expression pattern can be produced in a mammal that normally carries only a single X-linked visual pigment gene. To address this question, we generated transgenic mice that carry a single copy of a minimal human X chromosome visual pigment gene array in which the red and green pigment gene transcription units were replaced, respectively, by alkaline phosphatase and beta-galactosidase reporters. As determined by histochemical staining, the reporters are expressed exclusively in cone photoreceptor cells. In 20 transgenic mice carrying any one of three independent transgene insertion events, an average of 63% of expressing cones have alkaline phosphatase activity, 10% have beta-galactosidase activity, and 27% have activity for both reporters. Thus, mutually exclusive expression of red and green pigment transgenes can be achieved in a large fraction of cones in a dichromat mammal, suggesting a facile evolutionary path for the development of trichromacy after visual pigment gene duplication. These observations are consistent with a model of visual pigment expression in which stochastic pairing occurs between a locus control region and either the red or the green pigment gene promotor.

  11. Complex interactions between cis-regulatory modules in native conformation are critical for Drosophila snail expression

    PubMed Central

    Dunipace, Leslie; Ozdemir, Anil; Stathopoulos, Angelike

    2011-01-01

    It has been shown in several organisms that multiple cis-regulatory modules (CRMs) of a gene locus can be active concurrently to support similar spatiotemporal expression. To understand the functional importance of such seemingly redundant CRMs, we examined two CRMs from the Drosophila snail gene locus, which are both active in the ventral region of pre-gastrulation embryos. By performing a deletion series in a ∼25 kb DNA rescue construct using BAC recombineering and site-directed transgenesis, we demonstrate that the two CRMs are not redundant. The distal CRM is absolutely required for viability, whereas the proximal CRM is required only under extreme conditions such as high temperature. Consistent with their distinct requirements, the CRMs support distinct expression patterns: the proximal CRM exhibits an expanded expression domain relative to endogenous snail, whereas the distal CRM exhibits almost complete overlap with snail except at the anterior-most pole. We further show that the distal CRM normally limits the increased expression domain of the proximal CRM and that the proximal CRM serves as a `damper' for the expression levels driven by the distal CRM. Thus, the two CRMs interact in cis in a non-additive fashion and these interactions may be important for fine-tuning the domains and levels of gene expression. PMID:21813571

  12. Utility of GATA3 in the differential diagnosis of pheochromocytoma.

    PubMed

    Perrino, Carmen M; Ho, Alex; Dall, Christopher P; Zynger, Debra L

    2017-09-01

    GATA3 is a relatively new immunohistochemical marker which shows consistent nuclear expression in a variety of tumours, including breast and urothelial carcinoma. The staining pattern of GATA3 in adrenal lesions is not well established. We aim to describe the expression of GATA3 in adrenal tumours and determine if there is differential staining between pheochromocytoma and adrenal cortical carcinoma. A retrospective search was performed to identify 74 adrenal lesions which were tested immunohistochemically for GATA3 expression. GATA3 was negative in 90% of adrenal cortical carcinoma. In contrast, pheochromocytomas were frequently positive (71%), including benign pheochromocytoma, pheochromocytoma with features concerning for malignancy, malignant (metastatic) pheochromocytoma and composite pheochromocytoma with ganglioneuroma. Metastatic lung adenocarcinoma in the adrenal gland had occasional (36%) expression, while metastatic clear cell renal cell carcinoma in the adrenal gland did not express GATA3. As the most common pitfall in diagnosing adrenal cortical carcinoma is mistaking it for pheochromocytoma or vice versa, GATA3 may be useful in narrowing the differential diagnosis as a part of a panel of immunohistochemical markers. However, occasional GATA3 expression in the most common source of metastases within the adrenal gland, metastatic pulmonary adenocarcinoma, may confound the diagnosis due to the overlapping expression with pheochromocytoma and other carcinomas. © 2017 John Wiley & Sons Ltd.

  13. Modulation of microRNA expression in human lung cancer cells by the G9a histone methyltransferase inhibitor BIX01294

    PubMed Central

    PANG, ALAN LAP-YIN; TITLE, ALEXANDRA C.; RENNERT, OWEN M.

    2014-01-01

    MicroRNAs (miRNAs) are small non-coding RNAs that regulate the expression of their target genes at the post-transcriptional level. In cancer cells, miRNAs, depending on the biological functions of their target genes, may have a tumor-promoting or -suppressing effect. Treatment of cancer cells with inhibitors of DNA methylation and/or histone deacetylation modulates the expression level of miRNAs, which provides evidence for epigenetic regulation of miRNA expression. The consequences of inhibition of histone methyltransferase on miRNA expression, however, have not been thoroughly investigated. The present study examined the expression pattern of miRNAs in the non-small cell lung cancer cell line, H1299 with or without treatment of BIX01294, a potent chemical inhibitor of G9a methyltransferase that catalyzes the mono-and di-methylation of the lysine 9 residue of histone H3. By coupling microarray analysis with quantitative real-time polymerase chain reaction analysis, two miRNAs were identified that showed consistent downregulation following BIX01294 treatment. The results indicate that histone H3 methylation regulates miRNA expression in lung cancer cells, which may provide additional insight for future chemical treatment of lung cancer. PMID:24932239

  14. Clinical investigations of receptive and expressive musical functions after stroke

    PubMed Central

    Rosslau, Ken; Steinwede, Daniel; Schröder, C.; Herholz, Sibylle C.; Lappe, Claudia; Dobel, Christian; Altenmüller, Eckart

    2015-01-01

    There is a long tradition of investigating various disorders of musical abilities after stroke. These impairments, associated with acquired amusia, can be highly selective, affecting only music perception (i.e., receptive abilities/functions) or expression (music production abilities), and some patients report that these may dramatically influence their emotional state. The aim of this study was to systematically test both the melodic and rhythmic domains of music perception and expression in left- and right-sided stroke patients compared to healthy subjects. Music perception was assessed using rhythmic and melodic discrimination tasks, while tests of expressive function involved the vocal or instrumental reproduction of rhythms and melodies. Our approach revealed deficits in receptive and expressive functions in stroke patients, mediated by musical expertise. Those patients who had experienced a short period of musical training in childhood and adolescence performed better in the receptive and expressive subtests compared to those without any previous musical training. While discrimination of specific musical patterns was unimpaired after a left-sided stroke, patients with a right-sided stroke had worse results for fine melodic and rhythmic analysis. In terms of expressive testing, the most consistent results were obtained from a test that required patients to reproduce sung melodies. This implies that the means of investigating production abilities can impact the identification of deficits. PMID:26124731

  15. Clinical investigations of receptive and expressive musical functions after stroke.

    PubMed

    Rosslau, Ken; Steinwede, Daniel; Schröder, C; Herholz, Sibylle C; Lappe, Claudia; Dobel, Christian; Altenmüller, Eckart

    2015-01-01

    There is a long tradition of investigating various disorders of musical abilities after stroke. These impairments, associated with acquired amusia, can be highly selective, affecting only music perception (i.e., receptive abilities/functions) or expression (music production abilities), and some patients report that these may dramatically influence their emotional state. The aim of this study was to systematically test both the melodic and rhythmic domains of music perception and expression in left- and right-sided stroke patients compared to healthy subjects. Music perception was assessed using rhythmic and melodic discrimination tasks, while tests of expressive function involved the vocal or instrumental reproduction of rhythms and melodies. Our approach revealed deficits in receptive and expressive functions in stroke patients, mediated by musical expertise. Those patients who had experienced a short period of musical training in childhood and adolescence performed better in the receptive and expressive subtests compared to those without any previous musical training. While discrimination of specific musical patterns was unimpaired after a left-sided stroke, patients with a right-sided stroke had worse results for fine melodic and rhythmic analysis. In terms of expressive testing, the most consistent results were obtained from a test that required patients to reproduce sung melodies. This implies that the means of investigating production abilities can impact the identification of deficits.

  16. Perineurial-like Cells and EMA Expression in the Suprachoroidal Region of the Human Eye.

    PubMed

    Gilbert, Andrea R; Chévez-Barrios, Patricia; Cykowski, Matthew D

    2018-05-01

    The suprachoroidal region of the eye comprises vascular channels, melanocytes, and thin fibroblasts with elongated cytoplasm that are positioned directly adjacent to the densely collagenous sclera. Morphological similarities between these suprachoroidal fibroblasts and arachnoid cells and perineurial cells have been recognized, but whether these fibroblasts have a perineurial cell-like immunophenotype is not known. To further examine the relationship of these three cell types, we investigated the comparative expression of epithelial membrane antigen (EMA), the tight junction protein claudin-1, glucose transporter-1 (Glut-1), and CD34 in suprachoroidal fibroblasts, arachnoid of the optic nerve sheath, and perineurium of ciliary nerves in eight human eye specimens. Granular, diffuse, and cytoplasmic EMA expression was seen in suprachoroidal fibroblasts, but this was not contiguous with the similar pattern of EMA expression in adjacent perineurium and arachnoid. CD34 expression in suprachoroidal fibroblasts was also seen, similar to arachnoid and perineurium. Claudin-1 and Glut-1 were not consistently expressed in suprachoroidal fibroblasts, distinguishing them from perineurial cells in particular and suggesting that these fibroblasts do not arise directly from adjacent arachnoid or perineurium. Nonetheless, the overlapping morphology and protein expression suggest phenotypic similarities in these cells that protect and support adjacent retina, optic nerve, and peripheral nerve.

  17. Expression pattern of circadian genes and steroidogenesis-related genes after testosterone stimulation in the human ovary.

    PubMed

    Chen, Minghui; Xu, Yanwen; Miao, Benyu; Zhao, Hui; Luo, Lu; Shi, Huijuan; Zhou, Canquan

    2016-09-10

    Previous studies have shown that circadian genes might be involved in the development of polycystic ovarian syndrome (PCOS). Hyperandrogenism is a hallmark feature of PCOS. However, the effect of hyperandrogenism on circadian gene expression in human granulosa cells is unknown, and the general expression pattern of circadian genes in the human ovary is unclear. Expression of the circadian proteins CLOCK and PER2 in human ovaries was observed by immunohistochemistry. The mRNA expression patterns of the circadian genes CLOCK, PER2, and BMAL1, and the steroidogenesis-related genes STAR, CYP11A1, HSD3B2, and CYP19A1 in cultured human luteinized granulosa cells were analyzed over the course of 48 h after testosterone treatment by quantitative polymerase chain reaction. Immunostaining of CLOCK and PER2 protein was detected in the granulosa cells of dominant antral follicles but was absent in the primordial, primary, or preantral follicles of human ovaries. After testosterone stimulation, expression of PER2 showed an oscillating pattern, with two peaks occurring at the 24th and 44th hours; expression of CLOCK increased significantly to the peak at the 24th hour, whereas expression of BMAL1 did not change significantly over time in human luteinized granulosa cells. Among the four steroidogenesis-related genes evaluated, only STAR displayed an oscillating expression pattern with two peaks occurring at the 24th and 40th hours after testosterone stimulation. Circadian genes are expressed in the dominant antral follicles of the human ovary. Oscillating expression of the circadian gene PER2 can be induced by testosterone in human granulosa cells in vitro. Expression of STAR also displayed an oscillating pattern after testosterone stimulation. Our results indicate a potential relationship between the circadian clock and steroidogenesis in the human ovary, and demonstrate the effect of testosterone on circadian gene expression in granulosa cells.

  18. Evolutionary modification of T-brain (tbr) expression patterns in sand dollar.

    PubMed

    Minemura, Keiko; Yamaguchi, Masaaki; Minokawa, Takuya

    2009-10-01

    The sand dollars are a group of irregular echinoids that diverged from other regular sea urchins approximately 200 million years ago. We isolated two orthologs of T-brain (tbr), Smtbr and Pjtbr, from the indirect developing sand dollar Scaphechinus mirabilis and the direct developing sand dollar Peronella japonica, respectively. The expression patterns of Smtbr and Pjtbr during early development were examined by whole mount in situ hybridization. The expression of Smtbr was first detected in micromere descendants in early blastula stage, similar to tbr expression in regular sea urchins. However, unlike in regular sea urchin, Smtbr expression in middle blastula stage was detected in micromere-descendent cells and a subset of macromere-descendant cells. At gastrula stage, expression of Smtbr was detected in part of the archenteron as well as primary mesenchyme cells. A similar pattern of tbr expression was observed in early Peronella embryos. A comparison of tbr expression patterns between sand dollars and other echinoderm species suggested that broader expression in the endomesoderm is an ancestral character of echinoderms. In addition to the endomesoderm, Pjtbr expression was detected in the apical organ, the animal-most part of the ectoderm.

  19. Dynamic CRM occupancy reflects a temporal map of developmental progression.

    PubMed

    Wilczyński, Bartek; Furlong, Eileen E M

    2010-06-22

    Development is driven by tightly coordinated spatio-temporal patterns of gene expression, which are initiated through the action of transcription factors (TFs) binding to cis-regulatory modules (CRMs). Although many studies have investigated how spatial patterns arise, precise temporal control of gene expression is less well understood. Here, we show that dynamic changes in the timing of CRM occupancy is a prevalent feature common to all TFs examined in a developmental ChIP time course to date. CRMs exhibit complex binding patterns that cannot be explained by the sequence motifs or expression of the TFs themselves. The temporal changes in TF binding are highly correlated with dynamic patterns of target gene expression, which in turn reflect transitions in cellular function during different stages of development. Thus, it is not only the timing of a TF's expression, but also its temporal occupancy in refined time windows, which determines temporal gene expression. Systematic measurement of dynamic CRM occupancy may therefore serve as a powerful method to decode dynamic changes in gene expression driving developmental progression.

  20. Intraspecific Arabidopsis hybrids show different patterns of heterosis despite the close relatedness of the parental genomes.

    PubMed

    Groszmann, Michael; Gonzalez-Bayon, Rebeca; Greaves, Ian K; Wang, Li; Huen, Amanda K; Peacock, W James; Dennis, Elizabeth S

    2014-09-01

    Heterosis is important for agriculture; however, little is known about the mechanisms driving hybrid vigor. Ultimately, heterosis depends on the interactions of specific alleles and epialleles provided by the parents, which is why hybrids can exhibit different levels of heterosis, even within the same species. We characterize the development of several intraspecific Arabidopsis (Arabidopsis thaliana) F1 hybrids that show different levels of heterosis at maturity. We identify several phases of heterosis beginning during embryogenesis and culminating in a final phase of vegetative maturity and seed production. During each phase, the hybrids show different levels and patterns of growth, despite the close relatedness of the parents. For instance, during the vegetative phases, the hybrids develop larger leaves than the parents to varied extents, and they do so by exploiting increases in cell size and cell numbers in different ratios. Consistent with this finding, we observed changes in the expression of genes known to regulate leaf size in developing rosettes of the hybrids, with the patterns of altered expression differing between combinations. The data show that heterosis is dependent on changes in development throughout the growth cycle of the hybrid, with the traits of mature vegetative biomass and reproductive yield as cumulative outcomes of heterosis at different levels, tissues, and times of development. © 2014 American Society of Plant Biologists. All Rights Reserved.

Top