Sample records for expression patterns observed

  1. Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain

    PubMed Central

    Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

    2013-01-01

    An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain. PMID:23440889

  2. Neuron-Enriched Gene Expression Patterns are Regionally Anti-Correlated with Oligodendrocyte-Enriched Patterns in the Adult Mouse and Human Brain.

    PubMed

    Tan, Powell Patrick Cheng; French, Leon; Pavlidis, Paul

    2013-01-01

    An important goal in neuroscience is to understand gene expression patterns in the brain. The recent availability of comprehensive and detailed expression atlases for mouse and human creates opportunities to discover global patterns and perform cross-species comparisons. Recently we reported that the major source of variation in gene transcript expression in the adult normal mouse brain can be parsimoniously explained as reflecting regional variation in glia to neuron ratios, and is correlated with degree of connectivity and location in the brain along the anterior-posterior axis. Here we extend this investigation to two gene expression assays of adult normal human brains that consisted of over 300 brain region samples, and perform comparative analyses of brain-wide expression patterns to the mouse. We performed principal components analysis (PCA) on the regional gene expression of the adult human brain to identify the expression pattern that has the largest variance. As in the mouse, we observed that the first principal component is composed of two anti-correlated patterns enriched in oligodendrocyte and neuron markers respectively. However, we also observed interesting discordant patterns between the two species. For example, a few mouse neuron markers show expression patterns that are more correlated with the human oligodendrocyte-enriched pattern and vice-versa. In conclusion, our work provides insights into human brain function and evolution by probing global relationships between regional cell type marker expression patterns in the human and mouse brain.

  3. Expression of Eag1 K+ channel and ErbBs in human pituitary adenomas: cytoskeleton arrangement patterns in cultured cells.

    PubMed

    del Pliego, Margarita González; Aguirre-Benítez, Elsa; Paisano-Cerón, Karina; Valdovinos-Ramírez, Irene; Rangel-Morales, Carlos; Rodríguez-Mata, Verónica; Solano-Agama, Carmen; Martín-Tapia, Dolores; de la Vega, María Teresa; Saldoval-Balanzario, Miguel; Camacho, Javier; Mendoza-Garrido, María Eugenia

    2013-01-01

    Pituitary adenomas can invade surrounded tissue, but the mechanism remains elusive. Ether à go-go-1 (Eag1) potassium channel and epidermal growth factor receptors (ErbB1 and ErbB2) have been associated to invasive phenotypes or poor prognosis in cancer patients. However, cells arrange their cytoskeleton in order to acquire a successful migration pattern. We have studied ErbBs and Eag1 expression, and cytoskeleton arrangements in 11 human pituitary adenomas. Eag1, ErbB1 and ErbB2 expression were studied by immunochemistry in tissue and cultured cells. The cytoskeleton arrangement was analyzed in cultured cells by immunofluorescence. Normal pituitary tissue showed ErbB2 expression and Eag1 only in few cells. However, Eag1 and ErbB2 were expressed in all the tumors analyzed. ErbB1 expression was observed variable and did not show specificity for a tumor characteristic. Cultured cells from micro- and macro-adenomas clinically functional organize their cytoskeleton suggesting a mesenchymal pattern, and a round leucocyte/amoeboid pattern from invasive clinically silent adenoma. Pituitary tumors over-express EGF receptors and the ErbB2 repeated expression suggests is a characteristic of adenomas. Eag 1 was express, in different extent, and could be a therapeutic target. The cytoskeleton arrangements observed suggest that pituitary tumor cells acquire different patterns: mesenchymal, and leucocyte/amoeboid, the last observed in the invasive adenomas. Amoeboid migration pattern has been associated with high invasion capacity.

  4. Immunohistochemical Analysis on Cortex-to-Cortex Healing After Mandibular Vertical Ramus Osteotomy: A Preliminary Study.

    PubMed

    Jung, Hwi-Dong; Kim, Sang Yoon; Jung, Han-Sung; Park, Hyung-Sik; Jung, Young-Soo

    2018-02-01

    The present study analyzed the expression of specific cytokines in the transforming growth factor (TGF)-β superfamily postoperatively after mandibular vertical ramus osteotomy (VRO). Four beagle dogs were enrolled and euthanized at 1, 2, 4, and 8 weeks postoperatively for immunohistochemical analysis using 6 specific antibodies (bone morphogenetic protein [BMP]-2/4, BMP-7, TGF-β2, TGF-β3, matrix metalloproteinase-3, and vascular endothelial growth factor [VEGF]). The results from the surgical site and control (adjacent area) were compared. Generalized upregulation of BMP-2/4 was observed in all healing periods, and the strongest expression of BMP-7 was observed at 1 week postoperatively. The strongest expression of TGF-β2 was observed at 8 weeks with increasing pattern. The strong expression of TGF-β3 was observed at 1 and 4 weeks, with the strongest expression of VEGF at 1 week, with a decreasing pattern. No notable uptake was detected with the 6 specific antibodies in the adjacent bone (control). The absence of internal fixation after VRO led to dynamic healing with a specific expression pattern of BMP-7 and TGF-β2. The anatomic factors, including sufficient preexisting vascularity, led to the earlier expression pattern of VEGF. Copyright © 2017 American Association of Oral and Maxillofacial Surgeons. Published by Elsevier Inc. All rights reserved.

  5. A framework for analyzing the relationship between gene expression and morphological, topological, and dynamical patterns in neuronal networks.

    PubMed

    de Arruda, Henrique Ferraz; Comin, Cesar Henrique; Miazaki, Mauro; Viana, Matheus Palhares; Costa, Luciano da Fontoura

    2015-04-30

    A key point in developmental biology is to understand how gene expression influences the morphological and dynamical patterns that are observed in living beings. In this work we propose a methodology capable of addressing this problem that is based on estimating the mutual information and Pearson correlation between the intensity of gene expression and measurements of several morphological properties of the cells. A similar approach is applied in order to identify effects of gene expression over the system dynamics. Neuronal networks were artificially grown over a lattice by considering a reference model used to generate artificial neurons. The input parameters of the artificial neurons were determined according to two distinct patterns of gene expression and the dynamical response was assessed by considering the integrate-and-fire model. As far as single gene dependence is concerned, we found that the interaction between the gene expression and the network topology, as well as between the former and the dynamics response, is strongly affected by the gene expression pattern. In addition, we observed a high correlation between the gene expression and some topological measurements of the neuronal network for particular patterns of gene expression. To our best understanding, there are no similar analyses to compare with. A proper understanding of gene expression influence requires jointly studying the morphology, topology, and dynamics of neurons. The proposed framework represents a first step towards predicting gene expression patterns from morphology and connectivity. Copyright © 2015. Published by Elsevier B.V.

  6. BnDGAT1s Function Similarly in Oil Deposition and Are Expressed with Uniform Patterns in Tissues of Brassica napus.

    PubMed

    Zhao, Cuizhu; Li, Huan; Zhang, Wenxue; Wang, Hailan; Xu, Aixia; Tian, Jianhua; Zou, Jitao; Taylor, David C; Zhang, Meng

    2017-01-01

    As an allotetraploid oilcrop, Brassica napus contains four duplicated Acyl-CoA:diacylglycerol acyltransferase 1 ( DGAT1 ) genes, which catalyze one of the rate-limiting steps in triacylglycerol (TAG) biosynthesis in plants. While all four BnDGAT1 s have been expressed functionally in yeast, their expression patterns in different germplasms and tissues and also consequent contribution to seed oil accumulation in planta remain to be elucidated. In this study, the coding regions of the four BnDGAT1s were expressed in an Arabidopsis dgat1 mutant. All four BnDGAT1s showed similar effects on oil content and fatty acid composition, a result which is different from that observed in previous studies of their expression in yeast. Expression patterns of BnDGAT1s were analyzed in developing seeds of 34 B. napus inbred lines and in different tissues of 14 lines. Different expression patterns were observed for the four BnDGAT1 s, which suggests that they express independently or randomly in different germplasm sources. Higher expression of BnDGAT1s was correlated with higher seed oil content lines. Tissue-specific analyses showed that the BnDGAT1 s were expressed in a uniform pattern in different tissues. Our results suggest that it is important to maintain expression of the four BnDGAT1s for maximum return on oil content.

  7. Circadian Clock Gene Expression in the Coral Favia fragum over Diel and Lunar Reproductive Cycles

    PubMed Central

    Hoadley, Kenneth D.; Szmant, Alina M.; Pyott, Sonja J.

    2011-01-01

    Natural light cycles synchronize behavioral and physiological cycles over varying time periods in both plants and animals. Many scleractinian corals exhibit diel cycles of polyp expansion and contraction entrained by diel sunlight patterns, and monthly cycles of spawning or planulation that correspond to lunar moonlight cycles. The molecular mechanisms for regulating such cycles are poorly understood. In this study, we identified four molecular clock genes (cry1, cry2, clock and cycle) in the scleractinian coral, Favia fragum, and investigated patterns of gene expression hypothesized to be involved in the corals' diel polyp behavior and lunar reproductive cycles. Using quantitative PCR, we measured fluctuations in expression of these clock genes over both diel and monthly spawning timeframes. Additionally, we assayed gene expression and polyp expansion-contraction behavior in experimental corals in normal light:dark (control) or constant dark treatments. Well-defined and reproducible diel patterns in cry1, cry2, and clock expression were observed in both field-collected and the experimental colonies maintained under control light:dark conditions, but no pattern was observed for cycle. Colonies in the control light:dark treatment also displayed diel rhythms of tentacle expansion and contraction. Experimental colonies in the constant dark treatment lost diel patterns in cry1, cry2, and clock expression and displayed a diminished and less synchronous pattern of tentacle expansion and contraction. We observed no pattern in cry1, cry2, clock, or cycle expression correlated with monthly spawning events suggesting these genes are not involved in the entrainment of reproductive cycles to lunar light cycles in F. fragum. Our results suggest a molecular clock mechanism, potentially similar to that in described in fruit flies, exists within F. fragum. PMID:21573070

  8. Adult mouse brain gene expression patterns bear an embryologic imprint

    PubMed Central

    Zapala, Matthew A.; Hovatta, Iiris; Ellison, Julie A.; Wodicka, Lisa; Del Rio, Jo A.; Tennant, Richard; Tynan, Wendy; Broide, Ron S.; Helton, Rob; Stoveken, Barbara S.; Winrow, Christopher; Lockhart, Daniel J.; Reilly, John F.; Young, Warren G.; Bloom, Floyd E.; Lockhart, David J.; Barlow, Carrolee

    2005-01-01

    The current model to explain the organization of the mammalian nervous system is based on studies of anatomy, embryology, and evolution. To further investigate the molecular organization of the adult mammalian brain, we have built a gene expression-based brain map. We measured gene expression patterns for 24 neural tissues covering the mouse central nervous system and found, surprisingly, that the adult brain bears a transcriptional “imprint” consistent with both embryological origins and classic evolutionary relationships. Embryonic cellular position along the anterior–posterior axis of the neural tube was shown to be closely associated with, and possibly a determinant of, the gene expression patterns in adult structures. We also observed a significant number of embryonic patterning and homeobox genes with region-specific expression in the adult nervous system. The relationships between global expression patterns for different anatomical regions and the nature of the observed region-specific genes suggest that the adult brain retains a degree of overall gene expression established during embryogenesis that is important for regional specificity and the functional relationships between regions in the adult. The complete collection of extensively annotated gene expression data along with data mining and visualization tools have been made available on a publicly accessible web site (www.barlow-lockhart-brainmapnimhgrant.org). PMID:16002470

  9. Coordinate expression of cytokeratins 7 and 14, vimentin, and Bcl-2 in canine cutaneous epithelial tumors and cysts.

    PubMed

    Pieper, Jason B; Stern, Adam W; LeClerc, Suzette M; Campbell, Karen L

    2015-07-01

    Forty-seven canine cutaneous epithelial tumors and cysts were examined to determine coordinate expression of cytokeratins 7 (CK7) and 14 (CK14), vimentin, and Bcl-2 using commercially available antibodies. Within non-affected normal skin adjacent to tumors or cysts, CK7 expression was observed in luminal cells in apocrine glands; CK14 expression was observed in the stratum basale, stratum spinosum, stratum granulosum, basal layer of outer root sheath, sebaceous glands, and myoepithelial cells of apocrine glands; vimentin expression was observed in dermal papilla and scattered non-epithelial cells within the epidermis; and Bcl-2 expression was observed in scattered non-epithelial cells in the epidermis and some apocrine glands. The pattern of expression of CK7 and CK14 in cases of adenocarcinoma of the apocrine gland of the anal sac (CK7+/CK14-) and hepatoid gland tumors (CK7-/CK14+) may prove useful for diagnostic purposes. Loss of expression of CK14 and vimentin, identifying myoepithelial cells, was observed in apocrine and ceruminous adenocarcinomas. Differences in patterns of expression of Bcl-2 were observed between infundibular keratinizing acanthomas compared to trichoepitheliomas. © 2015 The Author(s).

  10. Preservation affinity in consensus modules among stages of HIV-1 progression.

    PubMed

    Mosaddek Hossain, Sk Md; Ray, Sumanta; Mukhopadhyay, Anirban

    2017-03-20

    Analysis of gene expression data provides valuable insights into disease mechanism. Investigating relationship among co-expression modules of different stages is a meaningful tool to understand the way in which a disease progresses. Identifying topological preservation of modular structure also contributes to that understanding. HIV-1 disease provides a well-documented progression pattern through three stages of infection: acute, chronic and non-progressor. In this article, we have developed a novel framework to describe the relationship among the consensus (or shared) co-expression modules for each pair of HIV-1 infection stages. The consensus modules are identified to assess the preservation of network properties. We have investigated the preservation patterns of co-expression networks during HIV-1 disease progression through an eigengene-based approach. We discovered that the expression patterns of consensus modules have a strong preservation during the transitions of three infection stages. In particular, it is noticed that between acute and non-progressor stages the preservation is slightly more than the other pair of stages. Moreover, we have constructed eigengene networks for the identified consensus modules and observed the preservation structure among them. Some consensus modules are marked as preserved in two pairs of stages and are analyzed further to form a higher order meta-network consisting of a group of preserved modules. Additionally, we observed that module membership (MM) values of genes within a module are consistent with the preservation characteristics. The MM values of genes within a pair of preserved modules show strong correlation patterns across two infection stages. We have performed an extensive analysis to discover preservation pattern of co-expression network constructed from microarray gene expression data of three different HIV-1 progression stages. The preservation pattern is investigated through identification of consensus modules in each pair of infection stages. It is observed that the preservation of the expression pattern of consensus modules remains more prominent during the transition of infection from acute stage to non-progressor stage. Additionally, we observed that the module membership values of genes are coherent with preserved modules across the HIV-1 progression stages.

  11. Glucocorticoids Affect 24 h Clock Genes Expression in Human Adipose Tissue Explant Cultures

    PubMed Central

    Gómez-Abellán, Purificación; Díez-Noguera, Antoni; Madrid, Juan A.; Luján, Juan A.; Ordovás, José M.; Garaulet, Marta

    2012-01-01

    Aims to examine firstly whether CLOCK exhibits a circadian expression in human visceral (V) and subcutaneous (S) adipose tissue (AT) in vitro as compared with BMAL1 and PER2, and secondly to investigate the possible effect of the glucocorticoid analogue dexamethasone (DEX) on positive and negative clock genes expression. Subjects and Methods VAT and SAT biopsies were obtained from morbid obese women (body mass index≥40 kg/m2) (n = 6). In order to investigate rhythmic expression pattern of clock genes and the effect of DEX on CLOCK, PER2 and BMAL1 expression, control AT (without DEX) and AT explants treated with DEX (2 hours) were cultured during 24 h and gene expression was analyzed at the following times: 10:00 h, 14:00 h, 18:00 h, 22:00 h, 02:00 h and 06:00 h, using qRT-PCR. Results CLOCK, BMAL1 and PER2 expression exhibited circadian patterns in both VAT and SAT explants that were adjusted to a typical 24 h sinusoidal curve. PER2 expression (negative element) was in antiphase with respect to CLOCK and in phase with BMAL1 expression (both positive elements) in the SAT (situation not present in VAT). A marked effect of DEX exposure on both positive and negative clock genes expression patterns was observed. Indeed, DEX treatment modified the rhythmicity pattern towards altered patterns with a period lower than 24 hours in all genes and in both tissues. Conclusions 24 h patterns in CLOCK and BMAL1 (positive clock elements) and PER2 (negative element) mRNA levels were observed in human adipose explants. These patterns were altered by dexamethasone exposure. PMID:23251369

  12. BnDGAT1s Function Similarly in Oil Deposition and Are Expressed with Uniform Patterns in Tissues of Brassica napus

    PubMed Central

    Zhao, Cuizhu; Li, Huan; Zhang, Wenxue; Wang, Hailan; Xu, Aixia; Tian, Jianhua; Zou, Jitao; Taylor, David C.; Zhang, Meng

    2017-01-01

    As an allotetraploid oilcrop, Brassica napus contains four duplicated Acyl-CoA:diacylglycerol acyltransferase 1 (DGAT1) genes, which catalyze one of the rate-limiting steps in triacylglycerol (TAG) biosynthesis in plants. While all four BnDGAT1s have been expressed functionally in yeast, their expression patterns in different germplasms and tissues and also consequent contribution to seed oil accumulation in planta remain to be elucidated. In this study, the coding regions of the four BnDGAT1s were expressed in an Arabidopsis dgat1 mutant. All four BnDGAT1s showed similar effects on oil content and fatty acid composition, a result which is different from that observed in previous studies of their expression in yeast. Expression patterns of BnDGAT1s were analyzed in developing seeds of 34 B. napus inbred lines and in different tissues of 14 lines. Different expression patterns were observed for the four BnDGAT1s, which suggests that they express independently or randomly in different germplasm sources. Higher expression of BnDGAT1s was correlated with higher seed oil content lines. Tissue-specific analyses showed that the BnDGAT1s were expressed in a uniform pattern in different tissues. Our results suggest that it is important to maintain expression of the four BnDGAT1s for maximum return on oil content. PMID:29312429

  13. Interpretation of biological and mechanical variations between the Lowry versus Bradford method for protein quantification.

    PubMed

    Lu, Tzong-Shi; Yiao, Szu-Yu; Lim, Kenneth; Jensen, Roderick V; Hsiao, Li-Li

    2010-07-01

    The identification of differences in protein expression resulting from methodical variations is an essential component to the interpretation of true, biologically significant results. We used the Lowry and Bradford methods- two most commonly used methods for protein quantification, to assess whether differential protein expressions are a result of true biological or methodical variations. MATERIAL #ENTITYSTARTX00026; Differential protein expression patterns was assessed by western blot following protein quantification by the Lowry and Bradford methods. We have observed significant variations in protein concentrations following assessment with the Lowry versus Bradford methods, using identical samples. Greater variations in protein concentration readings were observed over time and in samples with higher concentrations, with the Bradford method. Identical samples quantified using both methods yielded significantly different expression patterns on Western blot. We show for the first time that methodical variations observed in these protein assay techniques, can potentially translate into differential protein expression patterns, that can be falsely taken to be biologically significant. Our study therefore highlights the pivotal need to carefully consider methodical approaches to protein quantification in techniques that report quantitative differences.

  14. Expression and distribution of voltage-gated ion channels in ferret sinoatrial node.

    PubMed

    Brahmajothi, Mulugu V; Morales, Michael J; Campbell, Donald L; Steenbergen, Charles; Strauss, Harold C

    2010-10-01

    Spontaneous diastolic depolarization in the sinoatrial (SA) node enables it to serve as pacemaker of the heart. The variable cell morphology within the SA node predicts that ion channel expression would be heterogeneous and different from that in the atrium. To evaluate ion channel heterogeneity within the SA node, we used fluorescent in situ hybridization to examine ion channel expression in the ferret SA node region and atrial appendage. SA nodal cells were distinguished from surrounding cardiac myocytes by expression of the slow (SA node) and cardiac (surrounding tissue) forms of troponin I. Nerve cells in the sections were identified by detection of GAP-43 and cytoskeletal middle neurofilament. Transcript expression was characterized for the 4 hyperpolarization-activated cation channels, 6 voltage-gated Na(+) channels, 3 voltage-gated Ca(2+) channels, 24 voltage-gated K(+) channel α-subunits, and 3 ancillary subunits. To ensure that transcript expression was representative of protein expression, immunofluorescence was used to verify localization patterns of voltage-dependent K(+) channels. Colocalizations were performed to observe any preferential patterns. Some overlapping and nonoverlapping binding patterns were observed. Measurement of different cation channel transcripts showed heterogeneous expression with many different patterns of expression, attesting to the complexity of electrical activity in the SA node. This study provides insight into the possible role ion channel heterogeneity plays in SA node pacemaker activity.

  15. Erasure and reestablishment of random allelic expression imbalance after epigenetic reprogramming

    PubMed Central

    Jeffries, Aaron Richard; Uwanogho, Dafe Aghogho; Cocks, Graham; Perfect, Leo William; Dempster, Emma; Mill, Jonathan; Price, Jack

    2016-01-01

    Clonal level random allelic expression imbalance and random monoallelic expression provides cellular heterogeneity within tissues by modulating allelic dosage. Although such expression patterns have been observed in multiple cell types, little is known about when in development these stochastic allelic choices are made. We examine allelic expression patterns in human neural progenitor cells before and after epigenetic reprogramming to induced pluripotency, observing that loci previously characterized by random allelic expression imbalance (0.63% of expressed genes) are generally reset to a biallelic state in induced pluripotent stem cells (iPSCs). We subsequently neuralized the iPSCs and profiled isolated clonal neural stem cells, observing that significant random allelic expression imbalance is reestablished at 0.65% of expressed genes, including novel loci not found to show allelic expression imbalance in the original parental neural progenitor cells. Allelic expression imbalance was associated with altered DNA methylation across promoter regulatory regions, with clones characterized by skewed allelic expression being hypermethylated compared to their biallelic sister clones. Our results suggest that random allelic expression imbalance is established during lineage commitment and is associated with increased DNA methylation at the gene promoter. PMID:27539784

  16. Erasure and reestablishment of random allelic expression imbalance after epigenetic reprogramming.

    PubMed

    Jeffries, Aaron Richard; Uwanogho, Dafe Aghogho; Cocks, Graham; Perfect, Leo William; Dempster, Emma; Mill, Jonathan; Price, Jack

    2016-10-01

    Clonal level random allelic expression imbalance and random monoallelic expression provides cellular heterogeneity within tissues by modulating allelic dosage. Although such expression patterns have been observed in multiple cell types, little is known about when in development these stochastic allelic choices are made. We examine allelic expression patterns in human neural progenitor cells before and after epigenetic reprogramming to induced pluripotency, observing that loci previously characterized by random allelic expression imbalance (0.63% of expressed genes) are generally reset to a biallelic state in induced pluripotent stem cells (iPSCs). We subsequently neuralized the iPSCs and profiled isolated clonal neural stem cells, observing that significant random allelic expression imbalance is reestablished at 0.65% of expressed genes, including novel loci not found to show allelic expression imbalance in the original parental neural progenitor cells. Allelic expression imbalance was associated with altered DNA methylation across promoter regulatory regions, with clones characterized by skewed allelic expression being hypermethylated compared to their biallelic sister clones. Our results suggest that random allelic expression imbalance is established during lineage commitment and is associated with increased DNA methylation at the gene promoter. © 2016 Jeffries et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  17. Expression of myosin heavy chain isoforms mRNA transcripts in the temporalis muscle of common chimpanzees (Pan troglodytes).

    PubMed

    Ciurana, Neus; Artells, Rosa; Muñoz, Carmen; Arias-Martorell, Júlia; Bello-Hellegouarch, Gaëlle; Casado, Aroa; Cuesta, Elisabeth; Pérez-Pérez, Alejandro; Pastor, Juan Francisco; Potau, Josep Maria

    2017-11-01

    The common chimpanzee (Pan troglodytes) is the primate that is phylogenetically most closely related to humans (Homo sapiens). In order to shed light on the anatomy and function of the temporalis muscle in the chimpanzee, we have analyzed the expression patterns of the mRNA transcripts of the myosin heavy chain (MyHC) isoforms in different parts of the muscle. We dissected the superficial, deep and sphenomandibularis portions of the temporalis muscle in five adult P. troglodytes and quantified the expression of the mRNA transcripts of the MyHC isoforms in each portion using real-time quantitative polymerase chain reaction. We observed significant differences in the patterns of expression of the mRNA transcripts of the MyHC-IIM isoform between the sphenomandibularis portion and the anterior superficial temporalis (33.6% vs 47.0%; P=0.032) and between the sphenomandibularis portion and the anterior deep temporalis (33.6% vs 43.0; P=0.016). We also observed non-significant differences between the patterns of expression in the anterior and posterior superficial temporalis. The differential expression patterns of the mRNA transcripts of the MyHC isoforms in the temporalis muscle in P. troglodytes may be related to the functional differences that have been observed in electromyographic studies in other species of primates. Our findings can be applicable to the fields of comparative anatomy, evolutionary anatomy, and anthropology. Copyright © 2017 Elsevier GmbH. All rights reserved.

  18. Signaling by Bone Morphogenetic Proteins directs formation of an ectodermal signaling center that regulates craniofacial development

    PubMed Central

    Foppiano, Silvia; Hu, Diane; Marcucio, Ralph S.

    2008-01-01

    We previously described a signaling center, the Frontonasal Ectodermal Zone (FEZ) that regulates growth and patterning of the frontonasal process (FNP). The FEZ is comprised of FNP ectoderm flanking a boundary between Sonic hedgehog (Shh) and Fibroblast growth factor 8 (Fgf8) expression domains. Our objective was to examine BMP signaling during formation of the FEZ. We blocked BMP signaling throughout the FNP prior to FEZ formation by infecting chick embryos at stage 10 (HH10) with a replication competent avian retrovirus encoding the BMP antagonist Noggin. We assessed gene expression patterns in the FNP 72 hours after infection (~HH22) and observed that Shh expression was reduced or absent. In the mesenchyme we observed that Bmp2 transcripts were absent while the Bmp4 expression domain was expanded proximally. In addition to the molecular changes, infected embryos also exhibited facial malformations at 72 and 96 hours after infection suggesting that the FEZ did not form. Our data indicate that reduced cell proliferation, but not apoptosis, in the mesenchyme contributed to the phenotype that we observed. Additionally, adding exogenous SHH into the mesenchyme of RCAS-Noggin infected embryos did not restore Bmp2 and Bmp4 to a normal pattern of expression. These data indicate that BMP signaling mediates interactions between tissues in the FNP that regulate FEZ formation; and that the correct pattern of Bmp2 and Bmp4, but not Bmp7, expression in the FNP mesenchyme requires signaling by the BMP pathway. PMID:18028903

  19. Pervasive Effects of Aging on Gene Expression in Wild Wolves

    PubMed Central

    Charruau, Pauline; Johnston, Rachel A.; Stahler, Daniel R.; Lea, Amanda; Snyder-Mackler, Noah; Smith, Douglas W.; vonHoldt, Bridgett M.; Cole, Steven W.; Tung, Jenny; Wayne, Robert K.

    2016-01-01

    Abstract Gene expression levels change as an individual ages and responds to environmental conditions. With the exception of humans, such patterns have principally been studied under controlled conditions, overlooking the array of developmental and environmental influences that organisms encounter under conditions in which natural selection operates. We used high-throughput RNA sequencing (RNA-Seq) of whole blood to assess the relative impacts of social status, age, disease, and sex on gene expression levels in a natural population of gray wolves (Canis lupus). Our findings suggest that age is broadly associated with gene expression levels, whereas other examined factors have minimal effects on gene expression patterns. Further, our results reveal evolutionarily conserved signatures of senescence, such as immunosenescence and metabolic aging, between wolves and humans despite major differences in life history and environment. The effects of aging on gene expression levels in wolves exhibit conservation with humans, but the more rapid expression differences observed in aging wolves is evolutionarily appropriate given the species’ high level of extrinsic mortality due to intraspecific aggression. Some expression changes that occur with age can facilitate physical age-related changes that may enhance fitness in older wolves. However, the expression of these ancestral patterns of aging in descendant modern dogs living in highly modified domestic environments may be maladaptive and cause disease. This work provides evolutionary insight into aging patterns observed in domestic dogs and demonstrates the applicability of studying natural populations to investigate the mechanisms of aging. PMID:27189566

  20. Discovering high-resolution patterns of differential DNA methylation that correlate with gene expression changes

    PubMed Central

    VanderKraats, Nathan D.; Hiken, Jeffrey F.; Decker, Keith F.; Edwards, John R.

    2013-01-01

    Methylation of the CpG-rich region (CpG island) overlapping a gene’s promoter is a generally accepted mechanism for silencing expression. While recent technological advances have enabled measurement of DNA methylation and expression changes genome-wide, only modest correlations between differential methylation at gene promoters and expression have been found. We hypothesize that stronger associations are not observed because existing analysis methods oversimplify their representation of the data and do not capture the diversity of existing methylation patterns. Recently, other patterns such as CpG island shore methylation and long partially hypomethylated domains have also been linked with gene silencing. Here, we detail a new approach for discovering differential methylation patterns associated with expression change using genome-wide high-resolution methylation data: we represent differential methylation as an interpolated curve, or signature, and then identify groups of genes with similarly shaped signatures and corresponding expression changes. Our technique uncovers a diverse set of patterns that are conserved across embryonic stem cell and cancer data sets. Overall, we find strong associations between these methylation patterns and expression. We further show that an extension of our method also outperforms other approaches by generating a longer list of genes with higher quality associations between differential methylation and expression. PMID:23748561

  1. Regional expression patterns of taste receptors and gustducin in the mouse tongue.

    PubMed

    Kim, Mi-Ryung; Kusakabe, Yuko; Miura, Hirohito; Shindo, Yoichiro; Ninomiya, Yuzo; Hino, Akihiro

    2003-12-12

    In order to understand differences in taste sensitivities of taste bud cells between the anterior and posterior part of tongue, it is important to analyze the regional expression patterns of genes related to taste signal transduction on the tongue. Here we examined the expression pattern of a taste receptor family, the T1r family, and gustducin in circumvallate and fungiform papillae of the mouse tongue using double-labeled in situ hybridization. Each member of the T1r family was expressed in both circumvallate and fungiform papillae with some differences in their expression patterns. The most striking difference between fungiform and circumvallate papillae was observed in their co-expression patterns of T1r2, T1r3, and gustducin. T1r2-positive cells in fungiform papillae co-expressed T1r3 and gustducin, whereas T1r2 and T1r3 double-positive cells in circumvallate papillae merely expressed gustducin. These results suggested that in fungiform papillae, gustducin might play a role in the sweet taste signal transduction cascade mediated by a sweet receptor based on the T1r2 and T1r3 combination, in fungiform papillae.

  2. Expression profiles of the Gα subunits during Xenopus tropicalis embryonic development.

    PubMed

    Fuentealba, Jaime; Toro-Tapia, Gabriela; Rodriguez, Marion; Arriagada, Cecilia; Maureira, Alejandro; Beyer, Andrea; Villaseca, Soraya; Leal, Juan I; Hinrichs, Maria V; Olate, Juan; Caprile, Teresa; Torrejón, Marcela

    2016-09-01

    Heterotrimeric G protein signaling plays major roles during different cellular events. However, there is a limited understanding of the molecular mechanisms underlying G protein control during embryogenesis. G proteins are highly conserved and can be grouped into four subfamilies according to sequence homology and function. To further studies on G protein function during embryogenesis, the present analysis identified four Gα subunits representative of the different subfamilies and determined their spatiotemporal expression patterns during Xenopus tropicalis embryogenesis. Each of the Gα subunit transcripts was maternally and zygotically expressed, and, as development progressed, dynamic expression patterns were observed. In the early developmental stages, the Gα subunits were expressed in the animal hemisphere and dorsal marginal zone. While expression was observed at the somite boundaries, in vascular structures, in the eye, and in the otic vesicle during the later stages, expression was mainly found in neural tissues, such as the neural tube and, especially, in the cephalic vesicles, neural crest region, and neural crest-derived structures. Together, these results support the pleiotropism and complexity of G protein subfamily functions in different cellular events. The present study constitutes the most comprehensive description to date of the spatiotemporal expression patterns of Gα subunits during vertebrate development. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Transcriptome analysis of the painted lady butterfly, Vanessa cardui during wing color pattern development.

    PubMed

    Connahs, Heidi; Rhen, Turk; Simmons, Rebecca B

    2016-03-31

    Butterfly wing color patterns are an important model system for understanding the evolution and development of morphological diversity and animal pigmentation. Wing color patterns develop from a complex network composed of highly conserved patterning genes and pigmentation pathways. Patterning genes are involved in regulating pigment synthesis however the temporal expression dynamics of these interacting networks is poorly understood. Here, we employ next generation sequencing to examine expression patterns of the gene network underlying wing development in the nymphalid butterfly, Vanessa cardui. We identified 9, 376 differentially expressed transcripts during wing color pattern development, including genes involved in patterning, pigmentation and gene regulation. Differential expression of these genes was highest at the pre-ommochrome stage compared to early pupal and late melanin stages. Overall, an increasing number of genes were down-regulated during the progression of wing development. We observed dynamic expression patterns of a large number of pigment genes from the ommochrome, melanin and also pteridine pathways, including contrasting patterns of expression for paralogs of the yellow gene family. Surprisingly, many patterning genes previously associated with butterfly pattern elements were not significantly up-regulated at any time during pupation, although many other transcription factors were differentially expressed. Several genes involved in Notch signaling were significantly up-regulated during the pre-ommochrome stage including slow border cells, bunched and pebbles; the function of these genes in the development of butterfly wings is currently unknown. Many genes involved in ecdysone signaling were also significantly up-regulated during early pupal and late melanin stages and exhibited opposing patterns of expression relative to the ecdysone receptor. Finally, a comparison across four butterfly transcriptomes revealed 28 transcripts common to all four species that have no known homologs in other metazoans. This study provides a comprehensive list of differentially expressed transcripts during wing development, revealing potential candidate genes that may be involved in regulating butterfly wing patterns. Some differentially expressed genes have no known homologs possibly representing genes unique to butterflies. Results from this study also indicate that development of nymphalid wing patterns may arise not only from melanin and ommochrome pigments but also the pteridine pigment pathway.

  4. Keratinocyte growth factor expression in human gingival fibroblasts and stimulation of in vitro gene expression by retinoic acid.

    PubMed

    Mackenzie, I C; Gao, Z

    2001-04-01

    Keratinocyte growth factor (KGF) is a stromally derived growth factor of the fibroblast growth factor (FGF) family with paracrine effects targeted to influence the growth and differentiation of epithelia. Regional and temporal changes in KGF expression play important roles in the development and maintenance of epithelial structures and in epithelial wound healing. Differing patterns of expression of KGF by fibroblasts in the gingival region could therefore be related to the observed regional variation in the differentiation and behavior of gingival epithelia. The in vitro and in vivo patterns of expression of KGF mRNA in human gingival and periodontal fibroblasts were examined using reverse transcription polymerase chain reactions (RT-PCR) and in situ hybridization with digoxigenin-labeled riboprobes. The patterns observed for human gingiva were compared with those for human skin and for murine tissues. Gingival and periodontal fibroblasts showed expression of KGF transcripts in vitro, and the degree of expression was markedly influenced by the presence of retinoic acid, an agent known to influence patterns of epithelial differentiation. Sections of human and murine gingiva and skin showed regionally variable expression of transcripts with the cells expressing KGF in the subepithelial, rather than the deeper, connective tissues and periodontium. The results point to a role of KGF in the maintenance of normal growth and differentiation of gingival epithelia. A lack of KGF expression by periodontal fibroblasts in vivo is expected to hinder apical epithelial migration and thus stabilize the epithelial attachment. The effects of retinoic acid (RA) on KGF expression in vitro provide an indirect mechanism by which RA may regulate the growth and differentiation of gingival epithelia.

  5. The spatial and temporal expression of Ch-en, the engrailed gene in the polychaete Chaetopterus, does not support a role in body axis segmentation

    NASA Technical Reports Server (NTRS)

    Seaver, E. C.; Paulson, D. A.; Irvine, S. Q.; Martindale, M. Q.

    2001-01-01

    We are interested in understanding whether the annelids and arthropods shared a common segmented ancestor and have approached this question by characterizing the expression pattern of the segment polarity gene engrailed (en) in a basal annelid, the polychaete Chaetopterus. We have isolated an en gene, Ch-en, from a Chaetopterus cDNA library. Genomic Southern blotting suggests that this is the only en class gene in this animal. The predicted protein sequence of the 1.2-kb cDNA clone contains all five domains characteristic of en proteins in other taxa, including the en class homeobox. Whole-mount in situ hybridization reveals that Ch-en is expressed throughout larval life in a complex spatial and temporal pattern. The Ch-en transcript is initially detected in a small number of neurons associated with the apical organ and in the posterior portion of the prototrochophore. At later stages, Ch-en is expressed in distinct patterns in the three segmented body regions (A, B, and C) of Chaetopterus. In all segments, Ch-en is expressed in a small set of segmentally iterated cells in the CNS. In the A region, Ch-en is also expressed in a small group of mesodermal cells at the base of the chaetal sacs. In the B region, Ch-en is initially expressed broadly in the mesoderm that then resolves into one band/segment coincident with morphological segmentation. The mesodermal expression in the B region is located in the anterior region of each segment, as defined by the position of ganglia in the ventral nerve cord, and is involved in the morphogenesis of segment-specific feeding structures late in larval life. We observe banded mesodermal and ectodermal staining in an anterior-posterior sequence in the C region. We do not observe a segment polarity pattern of expression of Ch-en in the ectoderm, as is observed in arthropods. Copyright 2001 Academic Press.

  6. Multiple HOM-C gene interactions specify cell fates in the nematode central nervous system.

    PubMed

    Salser, S J; Loer, C M; Kenyon, C

    1993-09-01

    Intricate patterns of overlapping HOM-C gene expression along the A/P axis have been observed in many organisms; however, the significance of these patterns in establishing the ultimate fates of individual cells is not well understood. We have examined the expression of the Caenorhabditis elegans Antennapedia homolog mab-5 and its role in specifying cell fates in the posterior of the ventral nerve cord. We find that the pattern of fates specified by mab-5 not only depends on mab-5 expression but also on post-translational interactions with the neighboring HOM-C gene lin-39 and a second, inferred gene activity. Where mab-5 expression overlaps with lin-39 activity, they can interact in two different ways depending on the cell type: They can either effectively neutralize one another where they are both expressed or lin-39 can predominate over mab-5. As observed for Antennapedia in Drosophila, expression of mab-5 itself is repressed by the next most posterior HOM-C gene, egl-5. Thus, a surprising diversity in HOM-C regulatory mechanisms exists within a small set of cells even in a simple organism.

  7. Evolutionary modification of T-brain (tbr) expression patterns in sand dollar.

    PubMed

    Minemura, Keiko; Yamaguchi, Masaaki; Minokawa, Takuya

    2009-10-01

    The sand dollars are a group of irregular echinoids that diverged from other regular sea urchins approximately 200 million years ago. We isolated two orthologs of T-brain (tbr), Smtbr and Pjtbr, from the indirect developing sand dollar Scaphechinus mirabilis and the direct developing sand dollar Peronella japonica, respectively. The expression patterns of Smtbr and Pjtbr during early development were examined by whole mount in situ hybridization. The expression of Smtbr was first detected in micromere descendants in early blastula stage, similar to tbr expression in regular sea urchins. However, unlike in regular sea urchin, Smtbr expression in middle blastula stage was detected in micromere-descendent cells and a subset of macromere-descendant cells. At gastrula stage, expression of Smtbr was detected in part of the archenteron as well as primary mesenchyme cells. A similar pattern of tbr expression was observed in early Peronella embryos. A comparison of tbr expression patterns between sand dollars and other echinoderm species suggested that broader expression in the endomesoderm is an ancestral character of echinoderms. In addition to the endomesoderm, Pjtbr expression was detected in the apical organ, the animal-most part of the ectoderm.

  8. Segmentation gene expression patterns in Bactrocera dorsalis and related insects: regulation and shape of blastoderm and larval cuticle.

    PubMed

    Suksuwan, Worramin; Cai, Xiaoli; Ngernsiri, Lertluk; Baumgartner, Stefan

    2017-01-01

    The oriental fruit fly, Bactrocera dorsalis, is regarded as a severe pest of fruit production in Asia. Despite its economic importance, only limited information regarding the molecular and developmental biology of this insect is known to date. We provide a detailed analysis of B. dorsalis embryology, as well as the expression patterns of a number of segmentation genes known to act during patterning of Drosophila and compare these to the patterns of other insect families. An anterior shift of the expression of gap genes was detected when compared to Drosophila. This shift was largely restored during the step where the gap genes control expression of the pair-rule genes. We analyzed and compared the shapes of the embryos of insects of different families, B. dorsalis and the blow fly Lucilia sericata with that of the well-characterized Drosophila melanogaster. We found distinct shapes as well as differences in the ratios of the length of the anterior-posterior axis and the dorsal-ventral axis. These features were integrated into a profile of how the expression patterns of the gap gene Krüppel and the pair-rule gene even-skipped were observed along the A-P axis in three insects families. Since significant differences were observed, we discuss how Krüppel controls the even-skipped stripes. Furthermore, we discuss how the position and angles of the segmentation gene stripes differed from other insects. Finally, we analyzed the outcome of the expression patterns of the late acting segment polarity genes in relation to the anlagen of the naked-cuticle and denticle belt area of the B. dorsalis larva.

  9. Expression patterns of protein C inhibitor in mouse development.

    PubMed

    Wagenaar, Gerry T M; Uhrin, Pavel; Weipoltshammer, Klara; Almeder, Marlene; Hiemstra, Pieter S; Geiger, Margarethe; Meijers, Joost C M; Schöfer, Christian

    2010-02-01

    Proteolysis of extracellular matrix is an important requirement for embryonic development and is instrumental in processes such as morphogenesis, angiogenesis, and cell migration. Efficient remodeling requires controlled spatio-temporal expression of both the proteases and their inhibitors. Protein C inhibitor (PCI) effectively blocks a range of serine proteases, and recently has been suggested to play a role in cell differentiation and angiogenesis. In this study, we mapped the expression pattern of PCI throughout mouse development using in situ hybridization and immunohistochemistry. We detected a wide-spread, yet distinct expression pattern with prominent PCI levels in skin including vibrissae, and in fore- and hindgut. Further sites of PCI expression were choroid plexus of brain ventricles, heart, skeletal muscles, urogenital tract, and cartilages. A strong and stage-dependent PCI expression was observed in the developing lung. In the pseudoglandular stage, PCI expression was present in distal branching tubules whereas proximal tubules did not express PCI. Later in development, in the saccular stage, PCI expression was restricted to distal bronchioli whereas sacculi did not express PCI. PCI expression declined in postnatal stages and was not detected in adult lungs. In general, embryonic PCI expression indicates multifunctional roles of PCI during mouse development. The expression pattern of PCI during lung development suggests its possible involvement in lung morphogenesis and angiogenesis.

  10. An optimized ERP brain-computer interface based on facial expression changes.

    PubMed

    Jin, Jing; Daly, Ian; Zhang, Yu; Wang, Xingyu; Cichocki, Andrzej

    2014-06-01

    Interferences from spatially adjacent non-target stimuli are known to evoke event-related potentials (ERPs) during non-target flashes and, therefore, lead to false positives. This phenomenon was commonly seen in visual attention-based brain-computer interfaces (BCIs) using conspicuous stimuli and is known to adversely affect the performance of BCI systems. Although users try to focus on the target stimulus, they cannot help but be affected by conspicuous changes of the stimuli (such as flashes or presenting images) which were adjacent to the target stimulus. Furthermore, subjects have reported that conspicuous stimuli made them tired and annoyed. In view of this, the aim of this study was to reduce adjacent interference, annoyance and fatigue using a new stimulus presentation pattern based upon facial expression changes. Our goal was not to design a new pattern which could evoke larger ERPs than the face pattern, but to design a new pattern which could reduce adjacent interference, annoyance and fatigue, and evoke ERPs as good as those observed during the face pattern. Positive facial expressions could be changed to negative facial expressions by minor changes to the original facial image. Although the changes are minor, the contrast is big enough to evoke strong ERPs. In this paper, a facial expression change pattern between positive and negative facial expressions was used to attempt to minimize interference effects. This was compared against two different conditions, a shuffled pattern containing the same shapes and colours as the facial expression change pattern, but without the semantic content associated with a change in expression, and a face versus no face pattern. Comparisons were made in terms of classification accuracy and information transfer rate as well as user supplied subjective measures. The results showed that interferences from adjacent stimuli, annoyance and the fatigue experienced by the subjects could be reduced significantly (p < 0.05) by using the facial expression change patterns in comparison with the face pattern. The offline results show that the classification accuracy of the facial expression change pattern was significantly better than that of the shuffled pattern (p < 0.05) and the face pattern (p < 0.05). The facial expression change pattern presented in this paper reduced interference from adjacent stimuli and decreased the fatigue and annoyance experienced by BCI users significantly (p < 0.05) compared to the face pattern.

  11. An optimized ERP brain-computer interface based on facial expression changes

    NASA Astrophysics Data System (ADS)

    Jin, Jing; Daly, Ian; Zhang, Yu; Wang, Xingyu; Cichocki, Andrzej

    2014-06-01

    Objective. Interferences from spatially adjacent non-target stimuli are known to evoke event-related potentials (ERPs) during non-target flashes and, therefore, lead to false positives. This phenomenon was commonly seen in visual attention-based brain-computer interfaces (BCIs) using conspicuous stimuli and is known to adversely affect the performance of BCI systems. Although users try to focus on the target stimulus, they cannot help but be affected by conspicuous changes of the stimuli (such as flashes or presenting images) which were adjacent to the target stimulus. Furthermore, subjects have reported that conspicuous stimuli made them tired and annoyed. In view of this, the aim of this study was to reduce adjacent interference, annoyance and fatigue using a new stimulus presentation pattern based upon facial expression changes. Our goal was not to design a new pattern which could evoke larger ERPs than the face pattern, but to design a new pattern which could reduce adjacent interference, annoyance and fatigue, and evoke ERPs as good as those observed during the face pattern. Approach. Positive facial expressions could be changed to negative facial expressions by minor changes to the original facial image. Although the changes are minor, the contrast is big enough to evoke strong ERPs. In this paper, a facial expression change pattern between positive and negative facial expressions was used to attempt to minimize interference effects. This was compared against two different conditions, a shuffled pattern containing the same shapes and colours as the facial expression change pattern, but without the semantic content associated with a change in expression, and a face versus no face pattern. Comparisons were made in terms of classification accuracy and information transfer rate as well as user supplied subjective measures. Main results. The results showed that interferences from adjacent stimuli, annoyance and the fatigue experienced by the subjects could be reduced significantly (p < 0.05) by using the facial expression change patterns in comparison with the face pattern. The offline results show that the classification accuracy of the facial expression change pattern was significantly better than that of the shuffled pattern (p < 0.05) and the face pattern (p < 0.05). Significance. The facial expression change pattern presented in this paper reduced interference from adjacent stimuli and decreased the fatigue and annoyance experienced by BCI users significantly (p < 0.05) compared to the face pattern.

  12. The fitness cost of mis-splicing is the main determinant of alternative splicing patterns.

    PubMed

    Saudemont, Baptiste; Popa, Alexandra; Parmley, Joanna L; Rocher, Vincent; Blugeon, Corinne; Necsulea, Anamaria; Meyer, Eric; Duret, Laurent

    2017-10-30

    Most eukaryotic genes are subject to alternative splicing (AS), which may contribute to the production of protein variants or to the regulation of gene expression via nonsense-mediated messenger RNA (mRNA) decay (NMD). However, a fraction of splice variants might correspond to spurious transcripts and the question of the relative proportion of splicing errors to functional splice variants remains highly debated. We propose a test to quantify the fraction of AS events corresponding to errors. This test is based on the fact that the fitness cost of splicing errors increases with the number of introns in a gene and with expression level. We analyzed the transcriptome of the intron-rich eukaryote Paramecium tetraurelia. We show that in both normal and in NMD-deficient cells, AS rates strongly decrease with increasing expression level and with increasing number of introns. This relationship is observed for AS events that are detectable by NMD as well as for those that are not, which invalidates the hypothesis of a link with the regulation of gene expression. Our results show that in genes with a median expression level, 92-98% of observed splice variants correspond to errors. We observed the same patterns in human transcriptomes and we further show that AS rates correlate with the fitness cost of splicing errors. These observations indicate that genes under weaker selective pressure accumulate more maladaptive substitutions and are more prone to splicing errors. Thus, to a large extent, patterns of gene expression variants simply reflect the balance between selection, mutation, and drift.

  13. Differential expression of decorin and biglycan genes during mouse tooth development

    NASA Technical Reports Server (NTRS)

    Matsuura, T.; Duarte, W. R.; Cheng, H.; Uzawa, K.; Yamauchi, M.

    2001-01-01

    Small leucine-rich proteoglycans (SLRPs) have a number of biological functions and some of them are thought to regulate collagen mineralizaton in bone and tooth. We have previously identified and immunolocalized two members of the SLRPs family, decorin and biglycan, in bovine tooth/periodontium. To investigate their potential roles in tooth development, we examined the mRNA expression patterns of decorin, biglycan and type I collagen in newborn (day 19) mice tooth germs by in situ hybridization. At this developmental stage, the first maxillary and mandibular molars include stages before and after secretion of the predentin matrix, respectively. The expression of decorin mRNA coincided with that of type I collagen mRNA and was mostly observed in secretory odontoblasts, while the biglycan mRNA was expressed throughout the tooth germ, including pre-secretory odontoblasts/ameloblasts, dental papilla and stellate reticulum. However, its signal in secretory odontoblasts was not as evident as that of decorin. In mandibular incisors, where a significant amount of predentin matrix and a small amount of enamel matrix were already secreted, a similar differential expression pattern was observed. In secretory ameloblasts the biglycan mRNA expression was apparent, while that of decorin was not. These differential expression patterns suggest the distinct roles of biglycan and decorin in the process of tooth development.

  14. Gene expression of antioxidant enzymes and coffee seed quality during pre- and post-physiological maturity.

    PubMed

    Santos, F C; Caixeta, F; Clemente, A C S; Pinho, E V; Rosa, S D V F

    2014-12-19

    Seeds collected at different maturation stages vary in physiological quality and patterns of protective antioxidant systems against deterioration. In this study we investigated the expression of genes that codify catalase (CAT), dismutase superoxide (SOD), and polyphenol oxidase (PPO) during the pre- and post-physiological maturation phases in whole seeds and in endosperms and embryos extracted from the seeds. Coffea arabica L. berries were collected at the green, yellowish-green, cherry, over-ripe, and dry stages, and the seeds were examined physiologically. The transcription levels of the genes were quantified by quantitative real-time polymerase chain reaction using coffee-specific primers. The highest level of SOD expression was observed in the endosperm at the cherry and over-ripe stages; in addition, these seeds presented the greatest physiological quality (assessed via germination test). The highest CAT3 transcript expression was observed at the green stage in whole seeds, and at the green and over-ripe stages in the embryos and endosperms. High expression of the PPO transcript was observed at the green and yellowish-green stages in whole seeds. In embryos and endosperms, peak expression of the PPO transcript was observed at the green stage; subsequently, peaks at the cherry and over-ripe stages were observed. We concluded that the expression patterns of the SOD and CAT3 transcripts were similar at the more advanced maturation stages, which corresponded to enhanced physiological seed quality. High expression of the PPO transcript at the over-ripe stage, also observed in the embryos and endosperms at the cherry stage, coincided with the highest physiological seed quality.

  15. Pervasive Effects of Aging on Gene Expression in Wild Wolves.

    PubMed

    Charruau, Pauline; Johnston, Rachel A; Stahler, Daniel R; Lea, Amanda; Snyder-Mackler, Noah; Smith, Douglas W; vonHoldt, Bridgett M; Cole, Steven W; Tung, Jenny; Wayne, Robert K

    2016-08-01

    Gene expression levels change as an individual ages and responds to environmental conditions. With the exception of humans, such patterns have principally been studied under controlled conditions, overlooking the array of developmental and environmental influences that organisms encounter under conditions in which natural selection operates. We used high-throughput RNA sequencing (RNA-Seq) of whole blood to assess the relative impacts of social status, age, disease, and sex on gene expression levels in a natural population of gray wolves (Canis lupus). Our findings suggest that age is broadly associated with gene expression levels, whereas other examined factors have minimal effects on gene expression patterns. Further, our results reveal evolutionarily conserved signatures of senescence, such as immunosenescence and metabolic aging, between wolves and humans despite major differences in life history and environment. The effects of aging on gene expression levels in wolves exhibit conservation with humans, but the more rapid expression differences observed in aging wolves is evolutionarily appropriate given the species' high level of extrinsic mortality due to intraspecific aggression. Some expression changes that occur with age can facilitate physical age-related changes that may enhance fitness in older wolves. However, the expression of these ancestral patterns of aging in descendant modern dogs living in highly modified domestic environments may be maladaptive and cause disease. This work provides evolutionary insight into aging patterns observed in domestic dogs and demonstrates the applicability of studying natural populations to investigate the mechanisms of aging. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  16. Diversity of Histologic Patterns and Expression of Cytoskeletal Proteins in Canine Skeletal Osteosarcoma.

    PubMed

    Nagamine, E; Hirayama, K; Matsuda, K; Okamoto, M; Ohmachi, T; Kadosawa, T; Taniyama, H

    2015-09-01

    Osteosarcoma (OS), the most common bone tumor, includes OS of the head (OSH) and appendicular OS (OSA). In dogs, it is classified into 6 histologic subtypes: osteoblastic, chondroblastic, fibroblastic, telangiectatic, giant cell, and poorly differentiated. This study investigated the significance of the histologic classification relevant to clinical outcome and the histologic and immunohistochemical relationships between pleomorphism and expression of cytoskeletal proteins in 60 cases each of OSH and OSA. Most neoplasms exhibited histologic diversity, and 64% of OS contained multiple subtypes. In addition to the above 6 subtypes, myxoid, round cell, and epithelioid subtypes were observed. Although the epithelioid subtypes were observed in only OSH, no significant difference in the frequency of other subtypes was observed. Also, no significant relevance was observed between the clinical outcome and histologic subtypes. Cytokeratin (CK) was expressed in both epithelioid and sarcomatoid tumor cells in various subtypes, and all CK-positive tumor cells also expressed vimentin. Vimentin and α-smooth muscle actin (SMA) were expressed in all subtypes. A few SMA-positive spindle-shaped tumor cells exhibited desmin expression. Glial fibrillary acidic protein-positive tumor cells were observed in many subtypes, and some of these cells showed neurofilament expression. Although OSH exhibited significantly stronger immunoreactivity for SMA than OSA, no significant difference in other cytoskeletal proteins was observed. Some tumor cells had cytoskeletal protein expression compatible with the corresponding histologic subtypes, such as CK in the epithelioid subtype and SMA in the fibroblastic subtype. Thus, canine skeletal OS is composed of pleomorphic and heterogenous tumor cells as is reflected in the diversity of histologic patterns and expression of cytoskeletal proteins. © The Author(s) 2015.

  17. ROKU: a novel method for identification of tissue-specific genes.

    PubMed

    Kadota, Koji; Ye, Jiazhen; Nakai, Yuji; Terada, Tohru; Shimizu, Kentaro

    2006-06-12

    One of the important goals of microarray research is the identification of genes whose expression is considerably higher or lower in some tissues than in others. We would like to have ways of identifying such tissue-specific genes. We describe a method, ROKU, which selects tissue-specific patterns from gene expression data for many tissues and thousands of genes. ROKU ranks genes according to their overall tissue specificity using Shannon entropy and detects tissues specific to each gene if any exist using an outlier detection method. We evaluated the capacity for the detection of various specific expression patterns using synthetic and real data. We observed that ROKU was superior to a conventional entropy-based method in its ability to rank genes according to overall tissue specificity and to detect genes whose expression pattern are specific only to objective tissues. ROKU is useful for the detection of various tissue-specific expression patterns. The framework is also directly applicable to the selection of diagnostic markers for molecular classification of multiple classes.

  18. A gene expression resource generated by genome-wide lacZ profiling in the mouse

    PubMed Central

    Tuck, Elizabeth; Estabel, Jeanne; Oellrich, Anika; Maguire, Anna Karin; Adissu, Hibret A.; Souter, Luke; Siragher, Emma; Lillistone, Charlotte; Green, Angela L.; Wardle-Jones, Hannah; Carragher, Damian M.; Karp, Natasha A.; Smedley, Damian; Adams, Niels C.; Bussell, James N.; Adams, David J.; Ramírez-Solis, Ramiro; Steel, Karen P.; Galli, Antonella; White, Jacqueline K.

    2015-01-01

    ABSTRACT Knowledge of the expression profile of a gene is a critical piece of information required to build an understanding of the normal and essential functions of that gene and any role it may play in the development or progression of disease. High-throughput, large-scale efforts are on-going internationally to characterise reporter-tagged knockout mouse lines. As part of that effort, we report an open access adult mouse expression resource, in which the expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter gene. Many specific and informative expression patterns were noted. Expression was most commonly observed in the testis and brain and was most restricted in white adipose tissue and mammary gland. Over half of the assessed genes presented with an absent or localised expression pattern (categorised as 0-10 positive structures). A link between complexity of expression profile and viability of homozygous null animals was observed; inactivation of genes expressed in ≥21 structures was more likely to result in reduced viability by postnatal day 14 compared with more restricted expression profiles. For validation purposes, this mouse expression resource was compared with Bgee, a federated composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Furthermore, there were 1207 observations of expression of a particular gene in an anatomical structure where Bgee had no data, indicating a large amount of novelty in our data set. Examples of expression data corroborating and extending genotype-phenotype associations and supporting disease gene candidacy are presented to demonstrate the potential of this powerful resource. PMID:26398943

  19. Role of heat shock protein Hsp25 in the response of the orofacial nuclei motor system to physiological stress

    NASA Technical Reports Server (NTRS)

    Murashov, A. K.; Talebian, S.; Wolgemuth, D. J.

    1998-01-01

    Although expression of the small heat shock protein family member Hsp25 has been previously observed in the central nervous system (CNS), both constitutively and upon induction, its function in the CNS remains far from clear. In the present study we have characterized the spatial pattern of expression of Hsp25 in the normal adult mouse brain as well as the changes in expression patterns induced by subjecting mice to experimental hyperthermia or hypoxia. Immunohistochemical analysis revealed a surprisingly restricted pattern of constitutive expression of Hsp25 in the brain, limited to the facial, trigeminal, ambiguus, hypoglossal and vagal motor nuclei of the brainstem. After hyperthermia or hypoxia treatment, significant increases in the levels of Hsp25 were observed in these same areas and also in fibers of the facial and trigeminal nerve tracts. Immunoblot analysis of protein lysates from brainstem also showed the same pattern of induction of Hsp25. Surprisingly, no other area in the brain showed expression of Hsp25, in either control or stressed animals. The highly restricted expression of Hsp25 implies that this protein may have a specific physiological role in the orofacial motor nuclei, which govern precise coordination between muscles of mastication and the pharynx, larynx, and face. Its rapid induction after stress further suggests that Hsp25 may serve as a specific molecular chaperone in the lower cholinergic motor neurons and along their fibers under conditions of stress or injury. Copyright 1998 Elsevier Science B.V.

  20. Circadian expression of clock and putative clock-controlled genes in skeletal muscle of the zebrafish.

    PubMed

    Amaral, Ian P G; Johnston, Ian A

    2012-01-01

    To identify circadian patterns of gene expression in skeletal muscle, adult male zebrafish were acclimated for 2 wk to a 12:12-h light-dark photoperiod and then exposed to continuous darkness for 86 h with ad libitum feeding. The increase in gut food content associated with the subjective light period was much diminished by the third cycle, enabling feeding and circadian rhythms to be distinguished. Expression of zebrafish paralogs of mammalian transcriptional activators of the circadian mechanism (bmal1, clock1, and rora) followed a rhythmic pattern with a ∼24-h periodicity. Peak expression of rora paralogs occurred at the beginning of the subjective light period [Zeitgeber time (ZT)07 and ZT02 for roraa and rorab], whereas the highest expression of bmal1 and clock paralogs occurred 12 h later (ZT13-15 and ZT16 for bmal and clock paralogs). Expression of the transcriptional repressors cry1a, per1a/1b, per2, per3, nr1d2a/2b, and nr1d1 also followed a circadian pattern with peak expression at ZT0-02. Expression of the two paralogs of cry2 occurred in phase with clock1a/1b. Duplicated genes had a high correlation of expression except for paralogs of clock1, nr1d2, and per1, with cry1b showing no circadian pattern. The highest expression difference was 9.2-fold for the activator bmal1b and 51.7-fold for the repressor per1a. Out of 32 candidate clock-controlled genes, only myf6, igfbp3, igfbp5b, and hsf2 showed circadian expression patterns. Igfbp3, igfbp5b, and myf6 were expressed in phase with clock1a/1b and had an average of twofold change in expression from peak to trough, whereas hsf2 transcripts were expressed in phase with cry1a and had a 7.2-fold-change in expression. The changes in expression of clock and clock-controlled genes observed during continuous darkness were also observed at similar ZTs in fish exposed to a normal photoperiod in a separate control experiment. The role of circadian clocks in regulating muscle maintenance and growth are discussed.

  1. Robust patterning of gene expression based on internal coordinate system of cells.

    PubMed

    Ogawa, Ken-ichiro; Miyake, Yoshihiro

    2015-06-01

    Cell-to-cell communication in multicellular organisms is established through the transmission of various kinds of chemical substances such as proteins. It is well known that gene expression triggered by a chemical substance in individuals has stable spatial patterns despite the individual differences in concentration patterns of the chemical substance. This fact reveals an important property of multicellular organisms called "robustness", which allows the organisms to generate their forms while maintaining proportion. Robustness has been conventionally accounted for by the stability of solutions of dynamical equations that represent a specific interaction network of chemical substances. However, any biological system is composed of autonomous elements. In general, an autonomous element does not merely accept information on the chemical substance from the environment; instead, it accepts the information based on its own criteria for reaction. Therefore, this phenomenon needs to be considered from the viewpoint of cells. Such a viewpoint is expected to allow the consideration of the autonomy of cells in multicellular organisms. This study aims to explain theoretically the robust patterning of gene expression from the viewpoint of cells. For this purpose, we introduced a new operator for transforming a state variable of a chemical substance from an external coordinate system to an internal coordinate system of each cell, which describes the observation of the chemical substance by cells. We then applied this operator to the simplest reaction-diffusion model of the chemical substance to investigate observation effects by cells. Our mathematical analysis of this extended model indicates that the robust patterning of gene expression against individual differences in concentration pattern of the chemical substance can be explained from the viewpoint of cells if there is a regulation field that compensates for the difference between cells seen in the observation results. This result provides a new insight into the investigation of the mechanism of robust patterning in biological systems composed of individual elements. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  2. Genes@Work: an efficient algorithm for pattern discovery and multivariate feature selection in gene expression data.

    PubMed

    Lepre, Jorge; Rice, J Jeremy; Tu, Yuhai; Stolovitzky, Gustavo

    2004-05-01

    Despite the growing literature devoted to finding differentially expressed genes in assays probing different tissues types, little attention has been paid to the combinatorial nature of feature selection inherent to large, high-dimensional gene expression datasets. New flexible data analysis approaches capable of searching relevant subgroups of genes and experiments are needed to understand multivariate associations of gene expression patterns with observed phenotypes. We present in detail a deterministic algorithm to discover patterns of multivariate gene associations in gene expression data. The patterns discovered are differential with respect to a control dataset. The algorithm is exhaustive and efficient, reporting all existent patterns that fit a given input parameter set while avoiding enumeration of the entire pattern space. The value of the pattern discovery approach is demonstrated by finding a set of genes that differentiate between two types of lymphoma. Moreover, these genes are found to behave consistently in an independent dataset produced in a different laboratory using different arrays, thus validating the genes selected using our algorithm. We show that the genes deemed significant in terms of their multivariate statistics will be missed using other methods. Our set of pattern discovery algorithms including a user interface is distributed as a package called Genes@Work. This package is freely available to non-commercial users and can be downloaded from our website (http://www.research.ibm.com/FunGen).

  3. Genomic Expression Patterns in Menstrually-Related Migraine in Adolescents

    PubMed Central

    Hershey, Andrew; Horn, Paul; Kabbouche, Marielle; O'Brien, Hope; Powers, Scott

    2011-01-01

    Background Exacerbation of migraine with menses is common in adolescent girls and women with migraine, occurring in up to 60% of females with migraine. These migraines are oftentimes longer and more disabling and may be related to estrogen levels and hormonal fluctuations. Objective This study identifies the unique genomic expression pattern of menstrually-related migraine (MRM) in comparison to migraine occurring outside the menstrual period and headache free controls. Methods Whole blood samples were obtained from female subjects having an acute migraine during their menstrual period (MRM) or outside of their menstrual period (nonMRM) and controls (C) – females having a menstrual period without any history of headache. The mRNA was isolated from these samples and genomic profile was assessed. Affymetrix Human Exon ST 1.0 arrays were used to examine the genomic expression pattern differences between these three groups. Results Blood genomic expression patterns were obtained on 56 subjects (MRM = 18, nonMRM = 18 and C = 20). Unique genomic expression patterns were observed for both MRM and nonMRM. For MRM, 77 genes were identified that were unique to MRM, while 61 genes were commonly expressed for MRM and nonMRM and 127 genes appeared to have a unique expression pattern for nonMRM. In addition, there were 279 genes that differentially expressed for MRM compared to nonMRM that were not differentially expressed for nonMRM. Gene ontology of these samples indicated many of these groups of genes were functionally related and included categories of immunomodulation/inflammation, mitochondrial function and DNA homeostasis. Conclusions Blood genomic patterns can accurately differentiate MRM from nonMRM. These results indicate that MRM involves a unique molecular biology pathway that can be identified with a specific biomarker and suggest that individuals with MRM have a different underlying genetic etiology. PMID:22220971

  4. Arabidopsis thaliana gonidialess A/Zuotin related factors (GlsA/ZRF) are essential for maintenance of meristem integrity.

    PubMed

    Guzmán-López, José Alfredo; Abraham-Juárez, María Jazmín; Lozano-Sotomayor, Paulina; de Folter, Stefan; Simpson, June

    2016-05-01

    Observation of a differential expression pattern, including strong expression in meristematic tissue of an Agave tequilana GlsA/ZRF ortholog suggested an important role for this gene during bulbil formation and developmental changes in this species. In order to better understand this role, the two GlsA/ZFR orthologs present in the genome of Arabidopsis thaliana were functionally characterized by analyzing expression patterns, double mutant phenotypes, promoter-GUS fusions and expression of hormone related or meristem marker genes. Patterns of expression for A. thaliana show that GlsA/ZFR genes are strongly expressed in SAMs and RAMs in mature plants and developing embryos and double mutants showed multiple changes in morphology related to both SAM and RAM tissues. Typical double mutants showed stunted growth of aerial and root tissue, formation of multiple ectopic meristems and effects on cotyledons, leaves and flowers. The KNOX genes STM and BP were overexpressed in double mutants whereas CLV3, WUSCHEL and AS1 were repressed and lack of AtGlsA expression was also associated with changes in localization of auxin and cytokinin. These results suggest that GlsA/ZFR is an essential component of the machinery that maintains the integrity of SAM and RAM tissue and underline the potential to identify new genes or gene functions based on observations in non-model plants.

  5. MORPHOLOGIC ANALYSIS CORRELATES WITH GENE EXPRESSION CHANGES IN CULTURED F344 RAT MESOTHELIAL CELLS

    EPA Science Inventory

    The gene expression pattern of mesothelial cells in vitro was determined after 4 or 12 h exposure to the rat mesothelial, kidney and thyroid carcinogen, and oxidative stressor potassium bromate (KBr03). Gene expression changes observed using cDNA arrays indicated oxidative stres...

  6. Prepatterning and patterning of the thalamus along embryonic development of Xenopus laevis

    PubMed Central

    Bandín, Sandra; Morona, Ruth; González, Agustín

    2015-01-01

    Previous developmental studies of the thalamus (alar part of the diencephalic prosomere p2) have defined the molecular basis for the acquisition of the thalamic competence (preparttening), the subsequent formation of the secondary organizer in the zona limitans intrathalamica, and the early specification of two anteroposterior domains (rostral and caudal progenitor domains) in response to inducing activities and that are shared in birds and mammals. In the present study we have analyzed the embryonic development of the thalamus in the anuran Xenopus laevis to determine conserved or specific features in the amphibian diencephalon. From early embryonic stages to the beginning of the larval period, the expression patterns of 22 markers were analyzed by means of combined In situ hybridization (ISH) and immunohistochemical techniques. The early genoarchitecture observed in the diencephalon allowed us to discern the boundaries of the thalamus with the prethalamus, pretectum, and epithalamus. Common molecular features were observed in the thalamic prepatterning among vertebrates in which Wnt3a, Fez, Pax6 and Xiro1 expression were of particular importance in Xenopus. The formation of the zona limitans intrathalamica was observed, as in other vertebrates, by the progressive expression of Shh. The largely conserved expressions of Nkx2.2 in the rostral thalamic domain vs. Gbx2 and Ngn2 (among others) in the caudal domain strongly suggest the role of Shh as morphogen in the amphibian thalamus. All these data showed that the molecular characteristics observed during preparttening and patterning in the thalamus of the anuran Xenopus (anamniote) share many features with those described during thalamic development in amniotes (common patterns in tetrapods) but also with zebrafish, strengthening the idea of a basic organization of this diencephalic region across vertebrates. PMID:26321920

  7. Separable roles of UFO during floral development revealed by conditional restoration of gene function.

    PubMed

    Laufs, Patrick; Coen, Enrico; Kronenberger, Jocelyne; Traas, Jan; Doonan, John

    2003-02-01

    The UNUSUAL FLORAL ORGANS (UFO) gene is required for several aspects of floral development in Arabidopsis including specification of organ identity in the second and third whorls and the proper pattern of primordium initiation in the inner three whorls. UFO is expressed in a dynamic pattern during the early phases of flower development. Here we dissect the role of UFO by ubiquitously expressing it in ufo loss-of-function flowers at different developmental stages and for various durations using an ethanol-inducible expression system. The previously known functions of UFO could be separated and related to its expression at specific stages of development. We show that a 24- to 48-hour period of UFO expression from floral stage 2, before any floral organs are visible, is sufficient to restore normal petal and stamen development. The earliest requirement for UFO is during stage 2, when the endogenous UFO gene is transiently expressed in the centre of the wild-type flower and is required to specify the initiation patterns of petal, stamen and carpel primordia. Petal and stamen identity is determined during stages 2 or 3, when UFO is normally expressed in the presumptive second and third whorl. Although endogenous UFO expression is absent from the stamen whorl from stage 4 onwards, stamen identity can be restored by UFO activation up to stage 6. We also observed floral phenotypes not observed in loss-of-function or constitutive gain-of-function backgrounds, revealing additional roles of UFO in outgrowth of petal primordia.

  8. Expression patterns of the aquaporin gene family during renal development: influence of genetic variability.

    PubMed

    Parreira, Kleber S; Debaix, Huguette; Cnops, Yvette; Geffers, Lars; Devuyst, Olivier

    2009-08-01

    High-throughput analyses have shown that aquaporins (AQPs) belong to a cluster of genes that are differentially expressed during kidney organogenesis. However, the spatiotemporal expression patterns of the AQP gene family during tubular maturation and the potential influence of genetic variation on these patterns and on water handling remain unknown. We investigated the expression patterns of all AQP isoforms in fetal (E13.5 to E18.5), postnatal (P1 to P28), and adult (9 weeks) kidneys of inbred (C57BL/6J) and outbred (CD-1) mice. Using quantitative polymerase chain reaction (PCR), we evidenced two mRNA patterns during tubular maturation in C57 mice. The AQPs 1-7-11 showed an early (from E14.5) and progressive increase to adult levels, similar to the mRNA pattern observed for proximal tubule markers (Megalin, NaPi-IIa, OAT1) and reflecting the continuous increase in renal cortical structures during development. By contrast, AQPs 2-3-4 showed a later (E15.5) and more abrupt increase, with transient postnatal overexpression. Most AQP genes were expressed earlier and/or stronger in maturing CD-1 kidneys. Furthermore, adult CD-1 kidneys expressed more AQP2 in the collecting ducts, which was reflected by a significant delay in excreting a water load. The expression patterns of proximal vs. distal AQPs and the earlier expression in the CD-1 strain were confirmed by immunoblotting and immunostaining. These data (1) substantiate the clustering of important genes during tubular maturation and (2) demonstrate that genetic variability influences the regulation of the AQP gene family during tubular maturation and water handling by the mature kidney.

  9. ROKU: a novel method for identification of tissue-specific genes

    PubMed Central

    Kadota, Koji; Ye, Jiazhen; Nakai, Yuji; Terada, Tohru; Shimizu, Kentaro

    2006-01-01

    Background One of the important goals of microarray research is the identification of genes whose expression is considerably higher or lower in some tissues than in others. We would like to have ways of identifying such tissue-specific genes. Results We describe a method, ROKU, which selects tissue-specific patterns from gene expression data for many tissues and thousands of genes. ROKU ranks genes according to their overall tissue specificity using Shannon entropy and detects tissues specific to each gene if any exist using an outlier detection method. We evaluated the capacity for the detection of various specific expression patterns using synthetic and real data. We observed that ROKU was superior to a conventional entropy-based method in its ability to rank genes according to overall tissue specificity and to detect genes whose expression pattern are specific only to objective tissues. Conclusion ROKU is useful for the detection of various tissue-specific expression patterns. The framework is also directly applicable to the selection of diagnostic markers for molecular classification of multiple classes. PMID:16764735

  10. The relations of mothers' negative expressivity to children's experience and expression of negative emotion.

    PubMed

    Valiente, Carlos; Eisenberg, Nancy; Shepard, Stephanie A; Fabes, Richard A; Cumberland, Amanda J; Losoya, Sandra H; Spinrad, Tracy L

    2004-03-01

    Guided by the heuristic model proposed by Eisenberg et al. [Psychol. Inq. 9 (1998) 241], we examined the relations of mothers' reported and observed negative expressivity to children's (N = 159; 74 girls; M age = 7.67 years) experience and expression of emotion. Children's experience and/or expression of emotion in response to a distressing film were measured with facial, heart rate, and self-report measures. Children's heart rate and facial distress were modestly positively related. Children's facial distress was significantly positively related to mothers' reports of negative (dominant and submissive) expressivity; the positive relation between children's facial distress and mothers' observed negative expressivity approached the conventional level of significance. Moreover, mothers' observed negative expressivity was significantly negatively related to children's heart rate reactivity during the conflict film. The positive relation between children's reported distress and mothers' observed negative expressivity approached the conventional level of significance. Several possible explanations for the pattern of findings are discussed.

  11. The relations of mothers’ negative expressivity to children’s experience and expression of negative emotion

    PubMed Central

    Valiente, Carlos; Eisenberg, Nancy; Shepard, Stephanie A.; Fabes, Richard A.; Cumberland, Amanda J.; Losoya, Sandra H.; Spinrad, Tracy L.

    2010-01-01

    Guided by the heuristic model proposed by Eisenberg et al. [Psychol. Inq. 9 (1998) 241], we examined the relations of mothers’ reported and observed negative expressivity to children’s (N = 159; 74 girls; M age = 7.67 years) experience and expression of emotion. Children’s experience and/or expression of emotion in response to a distressing film were measured with facial, heart rate, and self-report measures. Children’s heart rate and facial distress were modestly positively related. Children’s facial distress was significantly positively related to mothers’ reports of negative (dominant and submissive) expressivity; the positive relation between children’s facial distress and mothers’ observed negative expressivity approached the conventional level of significance. Moreover, mothers’ observed negative expressivity was significantly negatively related to children’s heart rate reactivity during the conflict film. The positive relation between children’s reported distress and mothers’ observed negative expressivity approached the conventional level of significance. Several possible explanations for the pattern of findings are discussed. PMID:20617103

  12. Patterning of anteroposterior body axis displayed in the expression of Hox genes in sea cucumber Apostichopus japonicus.

    PubMed

    Kikuchi, Mani; Omori, Akihito; Kurokawa, Daisuke; Akasaka, Koji

    2015-09-01

    The presence of an anteroposterior body axis is a fundamental feature of bilateria. Within this group, echinoderms have secondarily evolved pentameral symmetric body plans. Although all echinoderms present bilaterally symmetric larval stages, they dramatically rearrange their body axis and develop a pentaradial body plan during metamorphosis. Therefore, the location of their anteroposterior body axis in adult forms remains a contentious issue. Unlike other echinoderms, sea cucumbers present an obvious anteroposterior axis not rearranged during metamorphosis, thus representing an interesting group to study their anteroposterior axis patterning. Hox genes are known to play a broadly conserved role in anteroposterior axis patterning in deuterostomes. Here, we report the expression patterns of Hox genes from early development to pentactula stage in sea cucumber. In early larval stages, five Hox genes (AjHox1, AjHox7, AjHox8, AjHox11/13a, and AjHox11/13b) were expressed sequentially along the archenteron, suggesting that the role of anteroposterior patterning of the Hox genes is conserved in bilateral larvae of echinoderms. In doliolaria and pentactula stages, eight Hox genes (AjHox1, AjHox5, AjHox7, AjHox8, AjHox9/10, AjHox11/13a, AjHox11/13b, and AjHox11/13c) were expressed sequentially along the digestive tract, following a similar expression pattern to that found in the visceral mesoderm of other bilateria. Unlike other echinoderms, pentameral expression patterns of AjHox genes were not observed in sea cucumber. Altogether, we concluded that AjHox genes are involved in the patterning of the digestive tract in both larvae and metamorphosis of sea cucumbers. In addition, the anteroposterior axis in sea cucumbers might be patterned like that of other bilateria.

  13. Expression pattern of circadian genes and steroidogenesis-related genes after testosterone stimulation in the human ovary.

    PubMed

    Chen, Minghui; Xu, Yanwen; Miao, Benyu; Zhao, Hui; Luo, Lu; Shi, Huijuan; Zhou, Canquan

    2016-09-10

    Previous studies have shown that circadian genes might be involved in the development of polycystic ovarian syndrome (PCOS). Hyperandrogenism is a hallmark feature of PCOS. However, the effect of hyperandrogenism on circadian gene expression in human granulosa cells is unknown, and the general expression pattern of circadian genes in the human ovary is unclear. Expression of the circadian proteins CLOCK and PER2 in human ovaries was observed by immunohistochemistry. The mRNA expression patterns of the circadian genes CLOCK, PER2, and BMAL1, and the steroidogenesis-related genes STAR, CYP11A1, HSD3B2, and CYP19A1 in cultured human luteinized granulosa cells were analyzed over the course of 48 h after testosterone treatment by quantitative polymerase chain reaction. Immunostaining of CLOCK and PER2 protein was detected in the granulosa cells of dominant antral follicles but was absent in the primordial, primary, or preantral follicles of human ovaries. After testosterone stimulation, expression of PER2 showed an oscillating pattern, with two peaks occurring at the 24th and 44th hours; expression of CLOCK increased significantly to the peak at the 24th hour, whereas expression of BMAL1 did not change significantly over time in human luteinized granulosa cells. Among the four steroidogenesis-related genes evaluated, only STAR displayed an oscillating expression pattern with two peaks occurring at the 24th and 40th hours after testosterone stimulation. Circadian genes are expressed in the dominant antral follicles of the human ovary. Oscillating expression of the circadian gene PER2 can be induced by testosterone in human granulosa cells in vitro. Expression of STAR also displayed an oscillating pattern after testosterone stimulation. Our results indicate a potential relationship between the circadian clock and steroidogenesis in the human ovary, and demonstrate the effect of testosterone on circadian gene expression in granulosa cells.

  14. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine.

    PubMed

    Bradford, Emily M; Vairamani, Kanimozhi; Shull, Gary E

    2016-02-15

    To investigate the intestinal functions of the NKCC1 Na(+)-K(+)-2Cl cotransporter (SLC12a2 gene), differential mRNA expression changes in NKCC1-null intestine were analyzed. Microarray analysis of mRNA from intestines of adult wild-type mice and gene-targeted NKCC1-null mice (n = 6 of each genotype) was performed to identify patterns of differential gene expression changes. Differential expression patterns were further examined by Gene Ontology analysis using the online Gorilla program, and expression changes of selected genes were verified using northern blot analysis and quantitative real time-polymerase chain reaction. Histological staining and immunofluorescence were performed to identify cell types in which upregulated pancreatic digestive enzymes were expressed. Genes typically associated with pancreatic function were upregulated. These included lipase, amylase, elastase, and serine proteases indicative of pancreatic exocrine function, as well as insulin and regenerating islet genes, representative of endocrine function. Northern blot analysis and immunohistochemistry showed that differential expression of exocrine pancreas mRNAs was specific to the duodenum and localized to a subset of goblet cells. In addition, a major pattern of changes involving differential expression of olfactory receptors that function in chemical sensing, as well as other chemosensing G-protein coupled receptors, was observed. These changes in chemosensory receptor expression may be related to the failure of intestinal function and dependency on parenteral nutrition observed in humans with SLC12a2 mutations. The results suggest that loss of NKCC1 affects not only secretion, but also goblet cell function and chemosensing of intestinal contents via G-protein coupled chemosensory receptors.

  15. Cdx1 and cdx2 expression during intestinal development.

    PubMed

    Silberg, D G; Swain, G P; Suh, E R; Traber, P G

    2000-10-01

    The intestine-specific transcription factors Cdx1 and Cdx2 are candidate genes for directing intestinal development, differentiation, and maintenance of the intestinal phenotype. This study focused on the complex patterns of expression of Cdx1 and Cdx2 during mouse gastrointestinal development. Embryonic and postnatal mouse tissues were analyzed by immunohistochemistry to determine protein expression of Cdx1 and Cdx2 in the developing intestinal tract. Cdx2 protein expression was observed at 9. 5 postcoitum (pc), whereas weak expression of Cdx1 protein was first seen at 12.5 pc in the distal developing intestine (hindgut). Expression of Cdx1 increased from 13.5 to 14.5 pc during the endoderm/epithelial transition with predominately distal expression. In contrast to Cdx1, there was intense expression of Cdx2 in all but the distal portions of the developing intestine. Cdx2 expression remained low in the distal colon throughout postnatal development. A gradient of expression formed in the crypt-villus axis, with Cdx1 primarily in the crypt and Cdx2 primarily in the villus. Direct comparison of the patterns of Cdx1 and Cdx2 protein expression during development as performed in this study provides new insights into their potential functional roles. The relative expression of Cdx1 to Cdx2 protein may be important in the anterior to posterior patterning of the intestinal epithelium and in defining patterns of proliferation and differentiation along the crypt-villus axis.

  16. Spatial and temporal expression patterns of auxin response transcription factors in the syncytium induced by the beet cyst nematode Heterodera schachtii in Arabidopsis.

    PubMed

    Hewezi, Tarek; Piya, Sarbottam; Richard, Geoffrey; Rice, J Hollis

    2014-09-01

    Plant-parasitic cyst nematodes induce the formation of a multinucleated feeding site in the infected root, termed the syncytium. Recent studies point to key roles of the phytohormone auxin in the regulation of gene expression and establishment of the syncytium. Nevertheless, information about the spatiotemporal expression patterns of the transcription factors that mediate auxin transcriptional responses during syncytium formation is limited. Here, we provide a gene expression map of 22 auxin response factors (ARFs) during the initiation, formation and maintenance stages of the syncytium induced by the cyst nematode Heterodera schachtii in Arabidopsis. We observed distinct and overlapping expression patterns of ARFs throughout syncytium development phases. We identified a set of ARFs whose expression is predominantly located inside the developing syncytium, whereas others are expressed in the neighbouring cells, presumably to initiate specific transcriptional programmes required for their incorporation within the developing syncytium. Our analyses also point to a role of certain ARFs in determining the maximum size of the syncytium. In addition, several ARFs were found to be highly expressed in fully developed syncytia, suggesting a role in maintaining the functional phenotype of mature syncytia. The dynamic distribution and overlapping expression patterns of various ARFs seem to be essential characteristics of ARF activity during syncytium development. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  17. Receptor for Advanced Glycation End Products (RAGE) is Expressed Predominantly in Medium Spiny Neurons of tgHD Rat Striatum.

    PubMed

    Shi, Dian; Chang, Joshua W; Choi, Jaimin; Connor, Bronwen; O'Carroll, Simon J; Nicholson, Louise F B; Kim, Joo Hyun

    2018-06-01

    Receptor for advanced glycation end products (RAGE) is a multi-ligand receptor involved in the pathology of several progressive neurodegenerative disorders including Huntington's disease (HD). We previously showed that the expression of RAGE and its colocalization with ligands were increased in the striatum of HD patients, increasing with grade severity, and that the pattern of RAGE expression coincided with the medio-lateral pattern of neurodegeneration. However, the exact role of RAGE in HD remains elusive. In order to address the necessity for a direct functional study, we aimed to characterize the pattern of RAGE expression in the transgenic rat model of HD (tgHD rats). Our results showed that RAGE expression was expanded laterally in tgHD rat caudate-putamen (CPu) compared to wildtype littermates, but the expression was unchanged by disease severity. The rostro-caudal location did not affect RAGE expression. RAGE was predominantly expressed in the medium spiny neurons (MSN) where it colocalized most extensively with N-carboxymethyllysine (CML), which largely contradicts with observations from human HD brains. Overall, the tgHD rat model only partially recapitulated the pattern in striatal RAGE expression in human brains, raising a question about its reliability as an animal model for future functional studies. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

  18. Regulation of mouse hepatic CYP2D9 mRNA expression by growth and adrenal hormones.

    PubMed

    Jarukamjorn, Kanokwan; Sakuma, Tsutomu; Jaruchotikamol, Atika; Oguro, Miki; Nemoto, Nobuo

    2006-02-01

    The constitutive expression of CYP2D9 is sexually dimorphic, namely, strong in males, but diminutive in females. Repetition of mimic growth hormone (GH) secretion pattern impressively returned the mRNA expression level to that in intact mice: the GH secretion pattern's regulation of CYP2D9 mRNA expression has been predominantly disrupted by exogenous GH-administration. The extensive decline of CYP2D9 mRNA expression becoming a sexually non-specific P450 in 9-week-old male mice exposed as neonates to monosodium L-glutamate (MSG) suggested that the male GH secretion pattern is a key to the regulation of male-specific CYP2D9 mRNA expression in adult mice. Dexamethasone (Dex) showed possibility to induce CYP2D9 mRNA expression in adult MSG-neonatally treated mice of either sex. However, the antagonism was observed by co-administration of Dex and GH in the males. Dex-administration in adrenalectomized mice significantly elevated CYP2D9 mRNA expression levels. These findings suggest that an adrenal hormone participates in the regulatory mechanism of CYP2D9 mRNA expression in association with GH.

  19. An integrated genomics analysis of epigenetic subtypes in human breast tumors links DNA methylation patterns to chromatin states in normal mammary cells.

    PubMed

    Holm, Karolina; Staaf, Johan; Lauss, Martin; Aine, Mattias; Lindgren, David; Bendahl, Pär-Ola; Vallon-Christersson, Johan; Barkardottir, Rosa Bjork; Höglund, Mattias; Borg, Åke; Jönsson, Göran; Ringnér, Markus

    2016-02-29

    Aberrant DNA methylation is frequently observed in breast cancer. However, the relationship between methylation patterns and the heterogeneity of breast cancer has not been comprehensively characterized. Whole-genome DNA methylation analysis using Illumina Infinium HumanMethylation450 BeadChip arrays was performed on 188 human breast tumors. Unsupervised bootstrap consensus clustering was performed to identify DNA methylation epigenetic subgroups (epitypes). The Cancer Genome Atlas data, including methylation profiles of 669 human breast tumors, was used for validation. The identified epitypes were characterized by integration with publicly available genome-wide data, including gene expression levels, DNA copy numbers, whole-exome sequencing data, and chromatin states. We identified seven breast cancer epitypes. One epitype was distinctly associated with basal-like tumors and with BRCA1 mutations, one epitype contained a subset of ERBB2-amplified tumors characterized by multiple additional amplifications and the most complex genomes, and one epitype displayed a methylation profile similar to normal epithelial cells. Luminal tumors were stratified into the remaining four epitypes, with differences in promoter hypermethylation, global hypomethylation, proliferative rates, and genomic instability. Specific hyper- and hypomethylation across the basal-like epitype was rare. However, we observed that the candidate genomic instability drivers BRCA1 and HORMAD1 displayed aberrant methylation linked to gene expression levels in some basal-like tumors. Hypomethylation in luminal tumors was associated with DNA repeats and subtelomeric regions. We observed two dominant patterns of aberrant methylation in breast cancer. One pattern, constitutively methylated in both basal-like and luminal breast cancer, was linked to genes with promoters in a Polycomb-repressed state in normal epithelial cells and displayed no correlation with gene expression levels. The second pattern correlated with gene expression levels and was associated with methylation in luminal tumors and genes with active promoters in normal epithelial cells. Our results suggest that hypermethylation patterns across basal-like breast cancer may have limited influence on tumor progression and instead reflect the repressed chromatin state of the tissue of origin. On the contrary, hypermethylation patterns specific to luminal breast cancer influence gene expression, may contribute to tumor progression, and may present an actionable epigenetic alteration in a subset of luminal breast cancers.

  20. A gene expression profile indicative of early stage HER2 targeted therapy response.

    PubMed

    O'Neill, Fiona; Madden, Stephen F; Clynes, Martin; Crown, John; Doolan, Padraig; Aherne, Sinéad T; O'Connor, Robert

    2013-07-01

    Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor.Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents.

  1. A gene expression profile indicative of early stage HER2 targeted therapy response

    PubMed Central

    2013-01-01

    Background Efficacious application of HER2-targetting agents requires the identification of novel predictive biomarkers. Lapatinib, afatinib and neratinib are tyrosine kinase inhibitors (TKIs) of HER2 and EGFR growth factor receptors. A panel of breast cancer cell lines was treated with these agents, trastuzumab, gefitinib and cytotoxic therapies and the expression pattern of a specific panel of genes using RT-PCR was investigated as a potential marker of early drug response to HER2-targeting therapies. Results Treatment of HER2 TKI-sensitive SKBR3 and BT474 cell lines with lapatinib, afatinib and neratinib induced an increase in the expression of RB1CC1, ERBB3, FOXO3a and NR3C1. The response directly correlated with the degree of sensitivity. This expression pattern switched from up-regulated to down-regulated in the HER2 expressing, HER2-TKI insensitive cell line MDAMB453. Expression of the CCND1 gene demonstrated an inversely proportional response to drug exposure. A similar expression pattern was observed following the treatment with both neratinib and afatinib. These patterns were retained following exposure to traztuzumab and lapatinib plus capecitabine. In contrast, gefitinib, dasatinib and epirubicin treatment resulted in a completely different expression pattern change. Conclusions In these HER2-expressing cell line models, lapatinib, neratinib, afatinib and trastuzumab treatment generated a characteristic and specific gene expression response, proportionate to the sensitivity of the cell lines to the HER2 inhibitor. Characterisation of the induced changes in expression levels of these genes may therefore give a valuable, very early predictor of the likely extent and specificity of tumour HER2 inhibitor response in patients, potentially guiding more specific use of these agents. PMID:23816254

  2. Expression and localization of the vascular endothelial growth factor and changes of microvessel density during hair follicle development of Liaoning cashmere goats.

    PubMed

    Zhang, Q L; Li, J P; Li, Y M; Chang, Q; Chen, Y; Jiang, H Z; Zhao, Z H; Guo, D

    2013-12-10

    Vascular endothelial growth factors (VEGFs) play important roles in neovascularization, tissue development, and angiogenesis. In this study, changes in VEGF expression patterns and microvessel density (MVD), and their correlations, were investigated during hair follicle development in epidermal appendages of Liaoning cashmere goats. Polyclonal antibodies to VEGF and microvessels were used for monthly immunohistochemical examinations of normal skin specimens from adult female goats for one year. VEGF was expressed in the hair bulb of primary and secondary hair follicles, the outer and inner root sheaths, sebaceous glands (ductal and secretory portions), eccrine sweat glands (ductal and secretory portions), and the epidermis. Abundant expression of VEGF was observed in the follicular basement membrane zone surrounding the bulb matrix and in ductal and secretory portions of eccrine sweat glands. The change in VEGFs in primary hair follicles showed a bimodal pattern, with the first peak observed from March to May, and the second in August. Maximal expression in secondary hair follicles occurred in May and August. Therefore, VEGF expression in primary and secondary hair follicles is synchronized throughout the year, and is correlated to hair development. In the later telogen and anagen phases, VEGF expression was higher in the secondary, compared to the primary, hair follicle. Changes in MVD also showed a bimodal pattern with peaks in May and August. VEGF expression and MVD showed moderate and strongly positive correlation in the primary and secondary hair follicles, respectively. Therefore, MVD and VEGF are closely related to the processes involved in hair cycle regulation.

  3. Role of Gender, Sex Role Identity, and Type A Behavior in Anger Expression and Mental Health Functioning.

    ERIC Educational Resources Information Center

    Kopper, Beverly A.

    1993-01-01

    Investigated relationship of gender, sex role identity, Type A behavior to multiple dimensions of anger expression and mental health functioning among 407 female and 222 male college students. Found significant multivariate effects for sex role and behavior pattern type for anger expression. Significant gender differences were not observed.…

  4. Too much data, but little inter-changeability: a lesson learned from mining public data on tissue specificity of gene expression.

    PubMed

    Li, Shuyu; Li, Yiqun Helen; Wei, Tao; Su, Eric Wen; Duffin, Kevin; Liao, Birong

    2006-10-25

    The tissue expression pattern of a gene often provides an important clue to its potential role in a biological process. A vast amount of gene expression data have been and are being accumulated in public repository through different technology platforms. However, exploitations of these rich data sources remain limited in part due to issues of technology standardization. Our objective is to test the data comparability between SAGE and microarray technologies, through examining the expression pattern of genes under normal physiological states across variety of tissues. There are 42-54% of genes showing significant correlations in tissue expression patterns between SAGE and GeneChip, with 30-40% of genes whose expression patterns are positively correlated and 10-15% of genes whose expression patterns are negatively correlated at a statistically significant level (p = 0.05). Our analysis suggests that the discrepancy on the expression patterns derived from technology platforms is not likely from the heterogeneity of tissues used in these technologies, or other spurious correlations resulting from microarray probe design, abundance of genes, or gene function. The discrepancy can be partially explained by errors in the original assignment of SAGE tags to genes due to the evolution of sequence databases. In addition, sequence analysis has indicated that many SAGE tags and Affymetrix array probe sets are mapped to different splice variants or different sequence regions although they represent the same gene, which also contributes to the observed discrepancies between SAGE and array expression data. To our knowledge, this is the first report attempting to mine gene expression patterns across tissues using public data from different technology platforms. Unlike previous similar studies that only demonstrated the discrepancies between the two gene expression platforms, we carried out in-depth analysis to further investigate the cause for such discrepancies. Our study shows that the exploitation of rich public expression resource requires extensive knowledge about the technologies, and experiment. Informatic methodologies for better interoperability among platforms still remain a gap. One of the areas that can be improved practically is the accurate sequence mapping of SAGE tags and array probes to full-length genes.

  5. Tools for neuroanatomy and neurogenetics in Drosophila

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Pfeiffer, Barret D.; Jenett, Arnim; Hammonds, Ann S.

    2008-08-11

    We demonstrate the feasibility of generating thousands of transgenic Drosophila melanogaster lines in which the expression of an exogenous gene is reproducibly directed to distinct small subsets of cells in the adult brain. We expect the expression patterns produced by the collection of 5,000 lines that we are currently generating to encompass all neurons in the brain in a variety of intersecting patterns. Overlapping 3-kb DNA fragments from the flanking noncoding and intronic regions of genes thought to have patterned expression in the adult brain were inserted into a defined genomic location by site-specific recombination. These fragments were then assayedmore » for their ability to function as transcriptional enhancers in conjunction with a synthetic core promoter designed to work with a wide variety of enhancer types. An analysis of 44 fragments from four genes found that >80% drive expression patterns in the brain; the observed patterns were, on average, comprised of <100 cells. Our results suggest that the D. melanogaster genome contains >50,000 enhancers and that multiple enhancers drive distinct subsets of expression of a gene in each tissue and developmental stage. We expect that these lines will be valuable tools for neuroanatomy as well as for the elucidation of neuronal circuits and information flow in the fly brain.« less

  6. G-protein coupled receptor expression patterns delineate medulloblastoma subgroups

    PubMed Central

    2013-01-01

    Background Medulloblastoma is the most common malignant brain tumor in children. Genetic profiling has identified four principle tumor subgroups; each subgroup is characterized by different initiating mutations, genetic and clinical profiles, and prognoses. The two most well-defined subgroups are caused by overactive signaling in the WNT and SHH mitogenic pathways; less is understood about Groups 3 and 4 medulloblastoma. Identification of tumor subgroup using molecular classification is set to become an important component of medulloblastoma diagnosis and staging, and will likely guide therapeutic options. However, thus far, few druggable targets have emerged. G-protein coupled receptors (GPCRs) possess characteristics that make them ideal targets for molecular imaging and therapeutics; drugs targeting GPCRs account for 30-40% of all current pharmaceuticals. While expression patterns of many proteins in human medulloblastoma subgroups have been discerned, the expression pattern of GPCRs in medulloblastoma has not been investigated. We hypothesized that analysis of GPCR expression would identify clear subsets of medulloblastoma and suggest distinct GPCRs that might serve as molecular targets for both imaging and therapy. Results Our study found that medulloblastoma tumors fall into distinct clusters based solely on GPCR expression patterns. Normal cerebellum clustered separately from the tumor samples. Further, two of the tumor clusters correspond with high fidelity to the WNT and SHH subgroups of medulloblastoma. Distinct over-expressed GPCRs emerge; for example, LGR5 and GPR64 are significantly and uniquely over-expressed in the WNT subgroup of tumors, while PTGER4 is over-expressed in the SHH subgroup. Uniquely under-expressed GPCRs were also observed. Our key findings were independently validated using a large international dataset. Conclusions Our results identify GPCRs with potential to act as imaging and therapeutic targets. Elucidating tumorigenic pathways is a secondary benefit to identifying differential GPCR expression patterns in medulloblastoma tumors. PMID:24252460

  7. Investigating circular patterns in linear polarization observations of Venus

    NASA Astrophysics Data System (ADS)

    Mahapatra, Gourav; Stam, Daphne; Rossi, Loic; Rodenhuis, Michiel; Snik, Frans

    2017-04-01

    ESA's Venus Express mission has revealed our neighbouring planet to be a highly dynamic world, with ever-changing cloud properties and structures, wind speeds that increase in time, and variable concentrations of atmospheric trace gases such as SO2. The SPICAV-IR instrument on Venus Express has provided us with close-up linear polarization data of sunlight reflected by Venus's clouds and hazes, that allows a characterisation of their composition and particle sizes. Here, we analyse linear polarization data of the planet at a distance, obtained with the Extreme Polarimeter (ExPo) on the William Herschel Telescope on La Palma. These spatially resolved, high-accuracy polarization observations of Venus show faint circular patterns centered on the sub-solar point that are absent in the flux observations. So far, careful analyses have ruled out instrumental effects which leaves us to wonder about atmospheric properties as the cause of the circular patterns. Using numerical simulations of the flux and polarization of sunlight that is reflected by Venus, we have investigated the relation between the observed patterns and several atmospheric properties, such as variations in particle sizes, composition, density and altitude. We discuss the plausibility of the possible causes in the view of the current knowledge of the composition and dynamical processes in Venus's atmosphere.

  8. Off-line monitoring of bacterial stress response during recombinant protein production using an optical biosensor.

    PubMed

    Vostiar, Igor; Tkac, Jan; Mandenius, Carl-Fredrik

    2004-07-15

    A surface plasmon resonance (SPR) biosensor was used to monitor the profiles of the heat-shock protein (DnaK) and the expression of a heterologous protein to map the dynamics of the cellular stress response in Escherichia coli. As expression system was used an E. coli strain overproducing human recombinant superoxide dismutase (rhSOD). Expression of DnaK showed complex patterns differing with strength of induction. The strong up-regulation of DnaK expression was observed in all cultivations which over-produced of rhSOD. Similar patterns were not observed in non-induced reference cultures. Differences in DnaK concentration profiles were correlated with induction strength. Presented data, carried out in shake flask and glucose limited fed-batch cultivation, show a good consistency with previously published transcriptional profiling results and provide complementary information to understand stress response related to overproduction of recombinant protein. The study also demonstrates the feasibility of using the SPR as a two channel protein array for monitoring of intracellular components.

  9. Identification of rice genes associated with cosmic-ray response via co-expression gene network analysis.

    PubMed

    Hwang, Sun-Goo; Kim, Dong Sub; Hwang, Jung Eun; Han, A-Reum; Jang, Cheol Seong

    2014-05-15

    In order to better understand the biological systems that are affected in response to cosmic ray (CR), we conducted weighted gene co-expression network analysis using the module detection method. By using the Pearson's correlation coefficient (PCC) value, we evaluated complex gene-gene functional interactions between 680 CR-responsive probes from integrated microarray data sets, which included large-scale transcriptional profiling of 1000 microarray samples. These probes were divided into 6 distinct modules that contained 20 enriched gene ontology (GO) functions, such as oxidoreductase activity, hydrolase activity, and response to stimulus and stress. In particular, modules 1 and 2 commonly showed enriched annotation categories such as oxidoreductase activity, including enriched cis-regulatory elements known as ROS-specific regulators. These results suggest that the ROS-mediated irradiation response pathway is affected by CR in modules 1 and 2. We found 243 ionizing radiation (IR)-responsive probes that exhibited similarities in expression patterns in various irradiation microarray data sets. The expression patterns of 6 randomly selected IR-responsive genes were evaluated by quantitative reverse transcription polymerase chain reaction following treatment with CR, gamma rays (GR), and ion beam (IB); similar patterns were observed among these genes under these 3 treatments. Moreover, we constructed subnetworks of IR-responsive genes and evaluated the expression levels of their neighboring genes following GR treatment; similar patterns were observed among them. These results of network-based analyses might provide a clue to understanding the complex biological system related to the CR response in plants. Copyright © 2014 Elsevier B.V. All rights reserved.

  10. Differential expression of pancreatic protein and chemosensing receptor mRNAs in NKCC1-null intestine

    PubMed Central

    Bradford, Emily M; Vairamani, Kanimozhi; Shull, Gary E

    2016-01-01

    AIM: To investigate the intestinal functions of the NKCC1 Na+-K+-2Cl cotransporter (SLC12a2 gene), differential mRNA expression changes in NKCC1-null intestine were analyzed. METHODS: Microarray analysis of mRNA from intestines of adult wild-type mice and gene-targeted NKCC1-null mice (n = 6 of each genotype) was performed to identify patterns of differential gene expression changes. Differential expression patterns were further examined by Gene Ontology analysis using the online Gorilla program, and expression changes of selected genes were verified using northern blot analysis and quantitative real time-polymerase chain reaction. Histological staining and immunofluorescence were performed to identify cell types in which upregulated pancreatic digestive enzymes were expressed. RESULTS: Genes typically associated with pancreatic function were upregulated. These included lipase, amylase, elastase, and serine proteases indicative of pancreatic exocrine function, as well as insulin and regenerating islet genes, representative of endocrine function. Northern blot analysis and immunohistochemistry showed that differential expression of exocrine pancreas mRNAs was specific to the duodenum and localized to a subset of goblet cells. In addition, a major pattern of changes involving differential expression of olfactory receptors that function in chemical sensing, as well as other chemosensing G-protein coupled receptors, was observed. These changes in chemosensory receptor expression may be related to the failure of intestinal function and dependency on parenteral nutrition observed in humans with SLC12a2 mutations. CONCLUSION: The results suggest that loss of NKCC1 affects not only secretion, but also goblet cell function and chemosensing of intestinal contents via G-protein coupled chemosensory receptors. PMID:26909237

  11. Kinetics of lipogenic genes expression in milk purified mammary epithelial cells (MEC) across lactation and their correlation with milk and fat yield in buffalo.

    PubMed

    Yadav, Poonam; Kumar, Parveen; Mukesh, Manishi; Kataria, R S; Yadav, Anita; Mohanty, A K; Mishra, B P

    2015-04-01

    Expression patterns of lipogenic genes (LPL, ABCG2, ACSS2, ACACA, SCD, BDH, LIPIN1, SREBF1, PPARα and PPARγ) were studied in milk purified MEC across different stages of lactation (15, 30, 45, 60, 90, 120 and 240 days relative to parturition) in buffalo. PPARα was the most abundant gene while ABCG2 and ACSS2 had moderate level of expression; whereas expression of SREBF and PPARγ was very low. The expression patterns of some genes (BDH1, ACSS2, and LIPIN1) across lactation were positively correlated with milk yield while negatively correlated with fat yield. SCD also showed weak correlation with milk yield (p, 0.53) and fat yield (p, -0.47). On the other hand, expression pattern of ACACA was negatively correlated with milk yield (p, -0.88) and positively correlated with fat yield (p, 0.62). Strong correlation was observed between genes involved in de novo milk fat synthesis (BDH1, ACSS2, LIPIN2 and SCD) and milk yield. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Activation patterns in superficial layers of neocortex change between experiences independent of behavior, environment, or the hippocampus.

    PubMed

    Takehara-Nishiuchi, Kaori; Insel, Nathan; Hoang, Lan T; Wagner, Zachary; Olson, Kathy; Chawla, Monica K; Burke, Sara N; Barnes, Carol A

    2013-09-01

    Previous work suggests that activation patterns of neurons in superficial layers of the neocortex are more sensitive to spatial context than activation patterns in deep cortical layers. A possible source of this laminar difference is the distribution of contextual information to the superficial cortical layers carried by hippocampal efferents that travel through the entorhinal cortex and subiculum. To evaluate the role that the hippocampus plays in determining context sensitivity in superficial cortical layers, behavior-induced expression of the immediate early gene Arc was examined in hippocampus-lesioned and control rats after exposing them to 2 distinct contexts. Contrary to expectations, hippocampal lesions had no observable effect on Arc expression in any neocortical layer relative to controls. Furthermore, another group of intact animals was exposed to the same environment twice, to determine the reliability of Arc-expression patterns across identical contextual and behavioral episodes. Although this condition included no difference in external input between 2 epochs, the significant layer differences in Arc expression still remained. Thus, laminar differences in activation or plasticity patterns are not likely to arise from hippocampal sources or differences in external inputs, but are more likely to be an intrinsic property of the neocortex.

  13. Correct Patterning of the Primitive Streak Requires the Anterior Visceral Endoderm

    PubMed Central

    Stuckey, Daniel W.; Di Gregorio, Aida; Clements, Melanie; Rodriguez, Tristan A.

    2011-01-01

    Anterior-posterior axis specification in the mouse requires signalling from a specialised extra-embryonic tissue called the anterior visceral endoderm (AVE). AVE precursors are induced at the distal tip of the embryo and move to the prospective anterior. Embryological and genetic analysis has demonstrated that the AVE is required for anterior patterning and for correctly positioning the site of primitive streak formation by inhibiting Nodal activity. We have carried out a genetic ablation of the Hex-expressing cells of the AVE (Hex-AVE) by knocking the Diphtheria toxin subunit A into the Hex locus in an inducible manner. Using this model we have identified that, in addition to its requirement in the anterior of the embryo, the Hex-AVE sub-population has a novel role between 5.5 and 6.5dpc in patterning the primitive streak. Embryos lacking the Hex-AVE display delayed initiation of primitive streak formation and miss-patterning of the anterior primitive streak. We demonstrate that in the absence of the Hex-AVE the restriction of Bmp2 expression to the proximal visceral endoderm is also defective and expression of Wnt3 and Nodal is not correctly restricted to the posterior epiblast. These results, coupled with the observation that reducing Nodal signalling in Hex-AVE ablated embryos increases the frequency of phenotypes observed, suggests that these primitive streak patterning defects are due to defective Nodal signalling. Together, our experiments demonstrate that the AVE is not only required for anterior patterning, but also that specific sub-populations of this tissue are required to pattern the posterior of the embryo. PMID:21445260

  14. SOX2 and nestin expression in human melanoma: an immunohistochemical and experimental study

    PubMed Central

    Laga, Alvaro C.; Zhan, Qian; Weishaupt, Carsten; Ma, Jie; Frank, Markus H.; Murphy, George F.

    2012-01-01

    SOX2 is an embryonic neural crest stem-cell transcription factor recently shown to be expressed in human melanoma and to correlate with experimental tumor growth. SOX2 binds to an enhancer region of the gene that encodes for nestin, also a neural progenitor cell biomarker. To define further the potential relationship between SOX2 and nestin, we examined co-expression patterns in 135 melanomas and 37 melanocytic nevi. Immunohistochemical staining in 27 melanoma tissue sections showed an association between SOX2 positivity, spindle cell shape and a peripheral nestin distribution pattern. In contrast, SOX2-negative cells were predominantly epithelioid, and exhibited a cytoplasmic pattern for nestin. In tissue microarrays, co-expression correlated with tumor progression, with only 11% of nevi co-expressing SOX2 and nestin in contrast to 65% of metastatic melanomas, and preliminarily, with clinical outcome. Human melanoma lines that differentially expressed constitutive SOX2 revealed a positive correlation between SOX2 and nestin expression. Experimental melanomas grown from these respective cell lines in murine subcutis and dermis of xenografted human skin maintained the association between SOX2-positivity, spindle cell shape, and peripheral nestin distribution. Moreover, the cytoplasmic pattern of nestin distribution was observed in xenografts generated from SOX2-knockdown A2058 melanoma cells, in contrast to the periperhal nestin pattern seen in tumors grown from A2058 control cells transfected with non-target shRNA. In aggregate, these data further support a biologically significant linkage between SOX2 and nestin expression in human melanoma. PMID:21410764

  15. Klf8 regulates left-right asymmetric patterning through modulation of Kupffer's vesicle morphogenesis and spaw expression.

    PubMed

    Lin, Che-Yi; Tsai, Ming-Yuan; Liu, Yu-Hsiu; Lu, Yu-Fen; Chen, Yi-Chung; Lai, Yun-Ren; Liao, Hsin-Chi; Lien, Huang-Wei; Yang, Chung-Hsiang; Huang, Chang-Jen; Hwang, Sheng-Ping L

    2017-07-17

    Although vertebrates are bilaterally symmetric organisms, their internal organs are distributed asymmetrically along a left-right axis. Disruption of left-right axis asymmetric patterning often occurs in human genetic disorders. In zebrafish embryos, Kupffer's vesicle, like the mouse node, breaks symmetry by inducing asymmetric expression of the Nodal-related gene, spaw, in the left lateral plate mesoderm (LPM). Spaw then stimulates transcription of itself and downstream genes, including lft1, lft2, and pitx2, specifically in the left side of the diencephalon, heart and LPM. This developmental step is essential to establish subsequent asymmetric organ positioning. In this study, we evaluated the role of krüppel-like factor 8 (klf8) in regulating left-right asymmetric patterning in zebrafish embryos. Zebrafish klf8 expression was disrupted by both morpholino antisense oligomer-mediated knockdown and a CRISPR-Cas9 system. Whole-mount in situ hybridization was conducted to evaluate gene expression patterns of Nodal signalling components and the positions of heart and visceral organs. Dorsal forerunner cell number was evaluated in Tg(sox17:gfp) embryos and the length and number of cilia in Kupffer's vesicle were analyzed by immunocytochemistry using an acetylated tubulin antibody. Heart jogging, looping and visceral organ positioning were all defective in zebrafish klf8 morphants. At the 18-22 s stages, klf8 morphants showed reduced expression of genes encoding Nodal signalling components (spaw, lft1, lft2, and pitx2) in the left LPM, diencephalon, and heart. Co-injection of klf8 mRNA with klf8 morpholino partially rescued spaw expression. Furthermore, klf8 but not klf8△zf overexpressing embryos showed dysregulated bilateral expression of Nodal signalling components at late somite stages. At the 10s stage, klf8 morphants exhibited reductions in length and number of cilia in Kupffer's vesicle, while at 75% epiboly, fewer dorsal forerunner cells were observed. Interestingly, klf8 mutant embryos, generated by a CRISPR-Cas9 system, showed bilateral spaw expression in the LPM at late somite stages. This observation may be partly attributed to compensatory upregulation of klf12b, because klf12b knockdown reduced the percentage of klf8 mutants exhibiting bilateral spaw expression. Our results demonstrate that zebrafish Klf8 regulates left-right asymmetric patterning by modulating both Kupffer's vesicle morphogenesis and spaw expression in the left LPM.

  16. Diametrical clustering for identifying anti-correlated gene clusters.

    PubMed

    Dhillon, Inderjit S; Marcotte, Edward M; Roshan, Usman

    2003-09-01

    Clustering genes based upon their expression patterns allows us to predict gene function. Most existing clustering algorithms cluster genes together when their expression patterns show high positive correlation. However, it has been observed that genes whose expression patterns are strongly anti-correlated can also be functionally similar. Biologically, this is not unintuitive-genes responding to the same stimuli, regardless of the nature of the response, are more likely to operate in the same pathways. We present a new diametrical clustering algorithm that explicitly identifies anti-correlated clusters of genes. Our algorithm proceeds by iteratively (i). re-partitioning the genes and (ii). computing the dominant singular vector of each gene cluster; each singular vector serving as the prototype of a 'diametric' cluster. We empirically show the effectiveness of the algorithm in identifying diametrical or anti-correlated clusters. Testing the algorithm on yeast cell cycle data, fibroblast gene expression data, and DNA microarray data from yeast mutants reveals that opposed cellular pathways can be discovered with this method. We present systems whose mRNA expression patterns, and likely their functions, oppose the yeast ribosome and proteosome, along with evidence for the inverse transcriptional regulation of a number of cellular systems.

  17. Prospective Associations From Family-of-Origin Interactions to Adult Marital Interactions and Relationship Adjustment

    PubMed Central

    Whitton, Sarah W.; Waldinger, Robert J.; Schulz, Marc S.; Allen, Joseph P.; Crowell, Judith A.; Hauser, Stuart T.

    2011-01-01

    To test the social learning–based hypothesis that marital conflict resolution patterns are learned in the family of origin, longitudinal, observational data were used to assess prospective associations between family conflict interaction patterns during adolescence and offspring’s later marital conflict interaction patterns. At age 14 years, 47 participants completed an observed family conflict resolution task with their parents. In a subsequent assessment 17 years later, the participants completed measures of marital adjustment and an observed marital conflict interaction task with their spouse. As predicted, levels of hostility and positive engagement expressed by parents and adolescents during family interactions were prospectively linked with levels of hostility and positive engagement expressed by offspring and their spouses during marital interactions. Family-of-origin hostility was a particularly robust predictor of marital interaction behaviors; it predicted later marital hostility and negatively predicted positive engagement, controlling for psychopathology and family-of-origin positive engagement. For men, family-of-origin hostility also predicted poorer marital adjustment, an effect that was mediated through hostility in marital interactions. These findings suggest a long-lasting influence of family communication patterns, particularly hostility, on offspring’s intimate communication and relationship functioning. PMID:18410214

  18. The G protein-coupled estrogen receptor (GPER) is expressed in two different subcellular localizations reflecting distinct tumor properties in breast cancer.

    PubMed

    Samartzis, Eleftherios P; Noske, Aurelia; Meisel, Alexander; Varga, Zsuzsanna; Fink, Daniel; Imesch, Patrick

    2014-01-01

    The G protein-coupled estrogen receptor (GPER) is a novel estrogen receptor that mediates proliferative effects induced by estrogen but also by tamoxifen. The aim of our study was to analyze the frequency of GPER in a large collective of primary invasive breast carcinomas, with special emphasis on the subcellular expression and to evaluate the association with clinicopathological parameters and patient overall survival. The tissue microarrays from formalin-fixed, paraffin embedded samples of primary invasive breast carcinomas (n = 981) were analyzed for GPER expression using immunohistochemistry. Expression data were compared to the clinicopathological parameters and overall survival. GPER localization was also analyzed in two immortalized breast cancer cell lines T47D and MCF7 by confocal immunofluorescence microscopy. A predominantly cytoplasmic GPER expression was found in 189 carcinomas (19.3%), whereas a predominantly nuclear expression was observed in 529 cases (53.9%). A simultaneous comparable positive expression of both patterns was found in 32 of 981 cases (3.2%), and negative staining was detected in 295 cases (30%). Confocal microscopy confirmed the occurrence of cytoplasmic and nuclear GPER expression in T47D and MCF7. Cytoplasmic GPER expression was significantly associated with non-ductal histologic subtypes, low tumor stage, better histologic differentiation, as well as Luminal A and B subtypes. In contrast, nuclear GPER expression was significantly associated with poorly differentiated carcinomas and the triple-negative subtype. In univariate analysis, cytoplasmic GPER expression was associated with better overall survival (p = 0.012). Our data suggest that predominantly cytoplasmic and/or nuclear GPER expression are two distinct immunohistochemical patterns in breast carcinomas and may reflect different biological features, reason why these patterns should be clearly distinguished in histological evaluations. Prospective studies will be needed to assess whether the expression status of GPER in breast carcinomas should be routinely observed by clinicians, for instance, before implementing endocrine breast cancer treatment.

  19. The G Protein-Coupled Estrogen Receptor (GPER) Is Expressed in Two Different Subcellular Localizations Reflecting Distinct Tumor Properties in Breast Cancer

    PubMed Central

    Samartzis, Eleftherios P.; Noske, Aurelia; Meisel, Alexander; Varga, Zsuzsanna; Fink, Daniel; Imesch, Patrick

    2014-01-01

    Introduction The G protein-coupled estrogen receptor (GPER) is a novel estrogen receptor that mediates proliferative effects induced by estrogen but also by tamoxifen. The aim of our study was to analyze the frequency of GPER in a large collective of primary invasive breast carcinomas, with special emphasis on the subcellular expression and to evaluate the association with clinicopathological parameters and patient overall survival. Methods The tissue microarrays from formalin-fixed, paraffin embedded samples of primary invasive breast carcinomas (n = 981) were analyzed for GPER expression using immunohistochemistry. Expression data were compared to the clinicopathological parameters and overall survival. GPER localization was also analyzed in two immortalized breast cancer cell lines T47D and MCF7 by confocal immunofluorescence microscopy. Results A predominantly cytoplasmic GPER expression was found in 189 carcinomas (19.3%), whereas a predominantly nuclear expression was observed in 529 cases (53.9%). A simultaneous comparable positive expression of both patterns was found in 32 of 981 cases (3.2%), and negative staining was detected in 295 cases (30%). Confocal microscopy confirmed the occurrence of cytoplasmic and nuclear GPER expression in T47D and MCF7. Cytoplasmic GPER expression was significantly associated with non-ductal histologic subtypes, low tumor stage, better histologic differentiation, as well as Luminal A and B subtypes. In contrast, nuclear GPER expression was significantly associated with poorly differentiated carcinomas and the triple-negative subtype. In univariate analysis, cytoplasmic GPER expression was associated with better overall survival (p = 0.012). Conclusion Our data suggest that predominantly cytoplasmic and/or nuclear GPER expression are two distinct immunohistochemical patterns in breast carcinomas and may reflect different biological features, reason why these patterns should be clearly distinguished in histological evaluations. Prospective studies will be needed to assess whether the expression status of GPER in breast carcinomas should be routinely observed by clinicians, for instance, before implementing endocrine breast cancer treatment. PMID:24421881

  20. Expression of genes involved in energy mobilization and osmoprotectant synthesis during thermal and dehydration stress in the Antarctic midge, Belgica antarctica.

    PubMed

    Teets, Nicholas M; Kawarasaki, Yuta; Lee, Richard E; Denlinger, David L

    2013-02-01

    The Antarctic midge, Belgica antarctica, experiences sub-zero temperatures and desiccating conditions for much of the year, and in response to these environmental insults, larvae undergo rapid shifts in metabolism, mobilizing carbohydrate energy reserves to promote synthesis of low-molecular-mass osmoprotectants. In this study, we measured the expression of 11 metabolic genes in response to thermal and dehydration stress. During both heat and cold stress, we observed upregulation of phosphoenolpyruvate carboxykinase (pepck) and glycogen phosphorylase (gp) to support rapid glucose mobilization. In contrast, there was a general downregulation of pathways related to polyol, trehalose, and proline synthesis during both high- and low-temperature stress. Pepck was likewise upregulated in response to different types of dehydration stress; however, for many of the other genes, expression patterns depended on the nature of dehydration stress. Following fast dehydration, expression patterns were similar to those observed during thermal stress, i.e., upregulation of gp accompanied by downregulation of trehalose and proline synthetic genes. In contrast, gradual, prolonged dehydration (both at a constant temperature and in conjunction with chilling) promoted marked upregulation of genes responsible for trehalose and proline synthesis. On the whole, our data agree with known metabolic adaptations to stress in B. antarctica, although a few discrepancies between gene expression patterns and downstream metabolite contents point to fluxes that are not controlled at the level of transcription.

  1. Predictive computation of genomic logic processing functions in embryonic development

    PubMed Central

    Peter, Isabelle S.; Faure, Emmanuel; Davidson, Eric H.

    2012-01-01

    Gene regulatory networks (GRNs) control the dynamic spatial patterns of regulatory gene expression in development. Thus, in principle, GRN models may provide system-level, causal explanations of developmental process. To test this assertion, we have transformed a relatively well-established GRN model into a predictive, dynamic Boolean computational model. This Boolean model computes spatial and temporal gene expression according to the regulatory logic and gene interactions specified in a GRN model for embryonic development in the sea urchin. Additional information input into the model included the progressive embryonic geometry and gene expression kinetics. The resulting model predicted gene expression patterns for a large number of individual regulatory genes each hour up to gastrulation (30 h) in four different spatial domains of the embryo. Direct comparison with experimental observations showed that the model predictively computed these patterns with remarkable spatial and temporal accuracy. In addition, we used this model to carry out in silico perturbations of regulatory functions and of embryonic spatial organization. The model computationally reproduced the altered developmental functions observed experimentally. Two major conclusions are that the starting GRN model contains sufficiently complete regulatory information to permit explanation of a complex developmental process of gene expression solely in terms of genomic regulatory code, and that the Boolean model provides a tool with which to test in silico regulatory circuitry and developmental perturbations. PMID:22927416

  2. Cultural immersion alters emotion perception: Neurophysiological evidence from Chinese immigrants to Canada.

    PubMed

    Liu, Pan; Rigoulot, Simon; Pell, Marc D

    2017-12-01

    To explore how cultural immersion modulates emotion processing, this study examined how Chinese immigrants to Canada process multisensory emotional expressions, which were compared to existing data from two groups, Chinese and North Americans. Stroop and Oddball paradigms were employed to examine different stages of emotion processing. The Stroop task presented face-voice pairs expressing congruent/incongruent emotions and participants actively judged the emotion of one modality while ignoring the other. A significant effect of cultural immersion was observed in the immigrants' behavioral performance, which showed greater interference from to-be-ignored faces, comparable with what was observed in North Americans. However, this effect was absent in their N400 data, which retained the same pattern as the Chinese. In the Oddball task, where immigrants passively viewed facial expressions with/without simultaneous vocal emotions, they exhibited a larger visual MMN for faces accompanied by voices, again mirroring patterns observed in Chinese. Correlation analyses indicated that the immigrants' living duration in Canada was associated with neural patterns (N400 and visual mismatch negativity) more closely resembling North Americans. Our data suggest that in multisensory emotion processing, adopting to a new culture first leads to behavioral accommodation followed by alterations in brain activities, providing new evidence on human's neurocognitive plasticity in communication.

  3. Comparative analysis of cadherin expression and connectivity patterns in the cerebellar system of ferret and mouse.

    PubMed

    Neudert, Franziska; Nuernberger, Krishna-K Monique; Redies, Christoph

    2008-12-20

    The cerebellum shows remarkable variations in the relative size of its divisions among vertebrate species. In the present study, we compare the cerebella of two mammals (ferret and mouse) by mapping the expression of three cadherins (cadherin-8, protocadherin-7, and protocadherin-10) at similar postnatal stages. The three cadherins are expressed differentially in parasagittal stripes in the cerebellar cortex, in the portions of the deep cerebellar nuclei, in the divisions of the inferior olivary nucleus, and in the lateral vestibular nucleus. The expression profiles suggest that the cadherin-positive structures are interconnected. The expression patterns resemble each other in ferret and mouse, although some differences can be observed. The general resemblance indicates that cerebellar organization is based on a common set of embryonic divisions in the two species. Consequently, the large differences in cerebellar morphology between the two species are more likely caused by differential growth of these embryonic divisions than by differences in early embryonic patterning. Based on the cadherin expression patterns, a model of corticonuclear projection territories in ferret and mouse is proposed. In summary, our results indicate that the cerebellar systems of rodents and carnivores display a relatively large degree of similarity in their molecular and functional organization.

  4. The in vitro maintenance of clock genes expression within the rat pineal gland under standard and norepinephrine-synchronized stimulation.

    PubMed

    Andrade-Silva, Jéssica; Cipolla-Neto, José; Peliciari-Garcia, Rodrigo A

    2014-01-01

    Although the norepinephrine (NE) synchronization protocol was proved to be an important procedure for further modulating in vitro pineal melatonin synthesis, the maintenance of clock genes under the same conditions remained to be investigated. The aim of this study was to investigate the maintenance of the clock genes expression in pineal gland cultures under standard and NE-synchronized stimulation. The glands were separated into three experimental groups: Control, Standard (acute NE-stimulation), and NE-synchronized. The expression of Bmal1, Per2, Cry2, Rev-erbα, the clock controlled gene Dbp and Arylalkylamine-N-acetyltransferase were investigated, as well as melatonin content. No oscillations were observed in the expression of the investigated genes from the control group. Under Standard NE stimulation, the clock genes did not exhibit a rhythmic pattern of expression. However, in the NE-synchronized condition, a rhythmic expression pattern was observed in all cases. An enhancement in pineal gland responsiveness to NE stimulation, reflected in an advanced synthesis of melatonin was also observed. Our results reinforce our previous hypothesis that NE synchronization of pineal gland culture mimics the natural rhythmic release of NE in the gland, increasing melatonin synthesis and keeping the pineal circadian clock synchronized, ensuring the fine adjustments that are relied in the clockwork machinery. Copyright © 2014 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.

  5. Stress-induced activation of the immediate early gene Arc (activity-regulated cytoskeleton-associated protein) is restricted to telencephalic areas in the rat brain: relationship to c-fos mRNA.

    PubMed

    Ons, Sheila; Martí, Octavi; Armario, Antonio

    2004-06-01

    Arc is an effector immediate early gene whose expression is induced in situations of increased neuronal activity. However, there is no report on the influence of stress on Arc expression. Here, we compared the induction of both c-fos and Arc mRNAs in the brain of rats exposed to one of three different stressful situations: novel environment, forced swimming and immobilization. An absent or weak c-fos mRNA signal was observed in control rats, whereas those exposed to one of three stressors showed enhanced c-fos expression in a wide range of brain areas. Constitutive Arc expression was observed in some areas such as cortex, striatum, hippocampus, reticular thalamic nucleus and cerebellar cortex. In response to stressors, a strong induction of Arc was observed, but the pattern was different from that of c-fos. For instance, activation of Arc but not c-fos was observed in the nucleus accumbens after immobilization and in the hippocampus after novel environment. No Arc induction was observed in diencephalic and brainstem areas. The present data show that Arc has a neuroanatomically restricted pattern of induction in the brain after emotional stress. Telencephalic activation suggests that a more intense induction of synaptic plasticity is occurring in this area after exposure to emotional stressors.

  6. Continuum theory of gene expression waves during vertebrate segmentation.

    PubMed

    Jörg, David J; Morelli, Luis G; Soroldoni, Daniele; Oates, Andrew C; Jülicher, Frank

    2015-09-01

    The segmentation of the vertebrate body plan during embryonic development is a rhythmic and sequential process governed by genetic oscillations. These genetic oscillations give rise to traveling waves of gene expression in the segmenting tissue. Here we present a minimal continuum theory of vertebrate segmentation that captures the key principles governing the dynamic patterns of gene expression including the effects of shortening of the oscillating tissue. We show that our theory can quantitatively account for the key features of segmentation observed in zebrafish, in particular the shape of the wave patterns, the period of segmentation and the segment length as a function of time.

  7. Continuum theory of gene expression waves during vertebrate segmentation

    PubMed Central

    Jörg, David J; Morelli, Luis G; Soroldoni, Daniele; Oates, Andrew C; Jülicher, Frank

    2015-01-01

    Abstract The segmentation of the vertebrate body plan during embryonic development is a rhythmic and sequential process governed by genetic oscillations. These genetic oscillations give rise to traveling waves of gene expression in the segmenting tissue. Here we present a minimal continuum theory of vertebrate segmentation that captures the key principles governing the dynamic patterns of gene expression including the effects of shortening of the oscillating tissue. We show that our theory can quantitatively account for the key features of segmentation observed in zebrafish, in particular the shape of the wave patterns, the period of segmentation and the segment length as a function of time. PMID:28725158

  8. Defining global neuroendocrine gene expression patterns associated with reproductive seasonality in fish.

    PubMed

    Zhang, Dapeng; Xiong, Huiling; Mennigen, Jan A; Popesku, Jason T; Marlatt, Vicki L; Martyniuk, Christopher J; Crump, Kate; Cossins, Andrew R; Xia, Xuhua; Trudeau, Vance L

    2009-06-05

    Many vertebrates, including the goldfish, exhibit seasonal reproductive rhythms, which are a result of interactions between external environmental stimuli and internal endocrine systems in the hypothalamo-pituitary-gonadal axis. While it is long believed that differential expression of neuroendocrine genes contributes to establishing seasonal reproductive rhythms, no systems-level investigation has yet been conducted. In the present study, by analyzing multiple female goldfish brain microarray datasets, we have characterized global gene expression patterns for a seasonal cycle. A core set of genes (873 genes) in the hypothalamus were identified to be differentially expressed between May, August and December, which correspond to physiologically distinct stages that are sexually mature (prespawning), sexual regression, and early gonadal redevelopment, respectively. Expression changes of these genes are also shared by another brain region, the telencephalon, as revealed by multivariate analysis. More importantly, by examining one dataset obtained from fish in October who were kept under long-daylength photoperiod (16 h) typical of the springtime breeding season (May), we observed that the expression of identified genes appears regulated by photoperiod, a major factor controlling vertebrate reproductive cyclicity. Gene ontology analysis revealed that hormone genes and genes functionally involved in G-protein coupled receptor signaling pathway and transmission of nerve impulses are significantly enriched in an expression pattern, whose transition is located between prespawning and sexually regressed stages. The existence of seasonal expression patterns was verified for several genes including isotocin, ependymin II, GABA(A) gamma2 receptor, calmodulin, and aromatase b by independent samplings of goldfish brains from six seasonal time points and real-time PCR assays. Using both theoretical and experimental strategies, we report for the first time global gene expression patterns throughout a breeding season which may account for dynamic neuroendocrine regulation of seasonal reproductive development.

  9. Defining Global Neuroendocrine Gene Expression Patterns Associated with Reproductive Seasonality in Fish

    PubMed Central

    Mennigen, Jan A.; Popesku, Jason T.; Marlatt, Vicki L.; Martyniuk, Christopher J.; Crump, Kate; Cossins, Andrew R.; Xia, Xuhua; Trudeau, Vance L.

    2009-01-01

    Background Many vertebrates, including the goldfish, exhibit seasonal reproductive rhythms, which are a result of interactions between external environmental stimuli and internal endocrine systems in the hypothalamo-pituitary-gonadal axis. While it is long believed that differential expression of neuroendocrine genes contributes to establishing seasonal reproductive rhythms, no systems-level investigation has yet been conducted. Methodology/Principal Findings In the present study, by analyzing multiple female goldfish brain microarray datasets, we have characterized global gene expression patterns for a seasonal cycle. A core set of genes (873 genes) in the hypothalamus were identified to be differentially expressed between May, August and December, which correspond to physiologically distinct stages that are sexually mature (prespawning), sexual regression, and early gonadal redevelopment, respectively. Expression changes of these genes are also shared by another brain region, the telencephalon, as revealed by multivariate analysis. More importantly, by examining one dataset obtained from fish in October who were kept under long-daylength photoperiod (16 h) typical of the springtime breeding season (May), we observed that the expression of identified genes appears regulated by photoperiod, a major factor controlling vertebrate reproductive cyclicity. Gene ontology analysis revealed that hormone genes and genes functionally involved in G-protein coupled receptor signaling pathway and transmission of nerve impulses are significantly enriched in an expression pattern, whose transition is located between prespawning and sexually regressed stages. The existence of seasonal expression patterns was verified for several genes including isotocin, ependymin II, GABAA gamma2 receptor, calmodulin, and aromatase b by independent samplings of goldfish brains from six seasonal time points and real-time PCR assays. Conclusions/Significance Using both theoretical and experimental strategies, we report for the first time global gene expression patterns throughout a breeding season which may account for dynamic neuroendocrine regulation of seasonal reproductive development. PMID:19503831

  10. Behavioral Values and Family Structure in American Society.

    ERIC Educational Resources Information Center

    Schwerin, Karl H.

    Looking at holiday observances and patterns of contact and interaction among kinsmen, this paper examines the values middle class people hold about both close and distant kinsmen and investigates how consistent their actual behavioral patterns are to these expressed values. A questionaire was constructed and administered to a class of…

  11. Tissue-specific regulation of malic enzyme by thyroid hormone in the neonatal rat.

    PubMed

    Sood, A; Schwartz, H L; Oppenheimer, J H

    1996-05-15

    Two recent studies have claimed that thyroid hormone administration accelerates malic enzyme gene expression in the neonatal brain in contrast to the well-documented lack of effect of triiodothyronine on malic enzyme gene expression in the adult brain. Since these observations conflict with earlier observations in our laboratory, we reinvestigated the effect of thyroid hormone status on the ontogeny of malic enzyme gene expression in the neonatal rat. Neither hypothyroidism nor hyperthyroidism influenced the ontogenesis of malic enzyme activity in neonatal brain whereas the patterns of gene expression and enzyme activity in liver were markedly affected. Our results suggest that tissue-specific factors in brain block thyroid hormone-induced gene expression by thyroid hormone.

  12. The herpes simplex virus-induced demise of keratinocytes is associated with a dysregulated pattern of p63 expression.

    PubMed

    Megyeri, Klára; Orosz, László; Kormos, Bernadett; Pásztor, Katalin; Seprényi, György; Ocsovszki, Imre; Mándi, Yvette; Bata-Csörgo, Zsuzsanna; Kemény, Lajos

    2009-01-01

    p63 plays a pivotal role in the development and maintenance of stratified epithelial tissues. In an effort to gain insight into the pathogenic mechanisms of skin infections caused by HSV-1 and HSV-2, we determined the patterns of p63 expression in primary keratinocytes and in the HaCaT cell line. The levels of DeltaNp63alpha and a 50kDa p73 isoform were decreased, Bax-alpha remained unaffected, while the expressions of the Bax-beta, TAp63gamma and a 44.5kDa p73 isoform were highly increased in both HSV-1-infected HaCaT cells and primary keratinocytes. In contrast, in response to HSV-2 infection the levels of DeltaNp63alpha, a 50kDa p73 isoform and a 44.5kDa p73 protein were decreased, Bax-alpha and TAp63gamma remained unaffected, while the expression of Bax-beta was slightly increased. The knockdown of TAp63 expression enhanced the viability of HSV-1-infected cells. Thus, HSV-1 and HSV-2 modulate the patterns of p63 and Bax expression in a serotype-specific manner. The dysregulated pattern of p63 expression observed in HSV-infected keratinocytes may comprise part of a mechanism by which these viruses perturb the functions of keratinocytes and lead to their demise.

  13. Epigenetic dysregulation of the dopamine system in diet-induced obesity.

    PubMed

    Vucetic, Zivjena; Carlin, Jesse Lea; Totoki, Kathy; Reyes, Teresa M

    2012-03-01

    Chronic intake of high-fat (HF) diet is known to alter brain neurotransmitter systems that participate in the central regulation of food intake. Dopamine (DA) system changes in response to HF diet have been observed in the hypothalamus, important in the homeostatic control of food intake, as well as within the central reward circuitry [ventral tegmental area (VTA), nucleus accumbens (NAc), and pre-frontal cortex (PFC)], critical for coding the rewarding properties of palatable food and important in hedonically driven feeding behavior. Using a mouse model of diet-induced obesity (DIO), significant alterations in the expression of DA-related genes were documented in adult animals, and the general pattern of gene expression changes was opposite within the hypothalamus versus the reward circuitry (increased vs. decreased, respectively). Differential DNA methylation was identified within the promoter regions of tyrosine hydroxylase (TH) and dopamine transporter (DAT), and the pattern of this response was consistent with the pattern of gene expression. Behaviors consistent with increased hypothalamic DA and decreased reward circuitry DA were observed. These data identify differential DNA methylation as an epigenetic mechanism linking the chronic intake of HF diet with altered DA-related gene expression, and this response varies by brain region and DNA sequence. © 2012 The Authors. Journal of Neurochemistry © 2012 International Society for Neurochemistry.

  14. Expression of the Fanconi anemia group A gene (Fanca) during mouse embryogenesis.

    PubMed

    Abu-Issa, R; Eichele, G; Youssoufian, H

    1999-07-15

    About 80% of all cases of Fanconi anemia (FA) can be accounted for by complementation groups A and C. To understand the relationship between these groups, we analyzed the expression pattern of the mouse FA group-A gene (Fanca) during embryogenesis and compared it with the known pattern of the group-C gene (Fancc). Northern analysis of RNA from mouse embryos at embryonic days 7, 11, 15, and 17 showed a predominant 4.5 kb band in all stages. By in situ hybridization, Fanca transcripts were found in the whisker follicles, teeth, brain, retina, kidney, liver, and limbs. There was also stage-specific variation in Fanca expression, particularly within the developing whiskers and the brain. Some tissues known to express Fancc (eg, gut) failed to show Fanca expression. These observations show that (1) Fanca is under both tissue- and stage-specific regulation in several tissues; (2) the expression pattern of Fanca is consistent with the phenotype of the human disease; and (3) Fanca expression is not necessarily coupled to that of Fancc. The presence of distinct tissue targets for FA genes suggests that some of the variability in the clinical phenotype can be attributed to the complementation group assignment.

  15. HLA-C expression pattern is spatially different between psoriasis and eczema skin lesions.

    PubMed

    Carlén, Lina; Sakuraba, Kazuko; Ståhle, Mona; Sánchez, Fabio

    2007-02-01

    Interactions between genetic and environmental factors underlie the immune dysregulation and keratinocyte abnormalities that characterize psoriasis. Among known psoriasis susceptibility loci (PSORS), PSORS1 on chromosome 6 has the strongest association to disease. Altered expression of some PSORS1 candidate genes has been reported but little is known about HLA-C expression in psoriasis. This study compared expression of major histocompatibility complex class Ia and HLA-C in psoriasis, allergic contact eczema, and normal skin. Although HLA-C was abundant in protein extracts from both eczema and psoriasis, a consistent and intriguing difference in the expression pattern was observed; strong immunoreactivity in the basal cell layer, polarized towards the basement membrane in psoriasis, whereas in eczema lesions HLA-C immunostaining was present mostly in suprabasal cells. Inflammatory cells in the dermis were strongly stained in both diseases. Normal skin epithelium showed less intense but similar HLA-C staining as eczema lesions. HLA class Ia expression overall resembled that of HLA-C in all samples. The distinct HLA-C expression patterns in psoriasis and eczema suggest a functional role in the specific psoriasis immune response and not only a general feature of inflammation.

  16. Variations in the sales and sales patterns of veterinary antimicrobial agents in 25 European countries.

    PubMed

    Grave, Kari; Torren-Edo, Jordi; Muller, Arno; Greko, Christina; Moulin, Gerard; Mackay, David

    2014-08-01

    To describe sales and sales patterns of veterinary antimicrobial agents in 25 European Union (EU)/European Economic Area (EEA) countries for 2011. Data on the sales of veterinary antimicrobial agents from 25 EU member states and EEA countries for 2011 were collected at package level (name, formulation, strength, pack size, number of packages sold) according to a standardized protocol and template and presented in a harmonized manner. These data were calculated to express amounts sold, in metric tonnes, of active ingredient of each package. A population correction unit (PCU) was applied as a proxy for the animal biomass potentially treated with antimicrobial agents. The indicator used to express sales was milligrams of active substance per PCU. Substantial variations in the sales patterns and in the magnitude of sales of veterinary antimicrobial agents, expressed as mg/PCU, between the countries were observed. The proportion of sales, in mg/PCU, of products applicable for treatment of groups or herds of animals (premixes, oral powders and oral solution) varied considerably between the countries. Some countries reported much lower sales of veterinary antimicrobial agents than others, when expressed as mg/PCU. Sales patterns varied between countries, particularly with respect to pharmaceutical forms. Further studies are needed to understand the factors that explain the observed differences. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  17. Metameric pattern of intervertebral disc/vertebral body is generated independently of Mesp2/Ripply-mediated rostro-caudal patterning of somites in the mouse embryo.

    PubMed

    Takahashi, Yu; Yasuhiko, Yukuto; Takahashi, Jun; Takada, Shinji; Johnson, Randy L; Saga, Yumiko; Kanno, Jun

    2013-08-15

    The vertebrae are derived from the sclerotome of somites. Formation of the vertebral body involves a process called resegmentation, by which the caudal half of a sclerotome is combined with the rostral half of the next sclerotome. To elucidate the relationship between resegmentation and rostro-caudal patterning of somite, we used the Uncx4.1-LacZ transgene to characterize the resegmentation process. Our observations suggested that in the thoracic and lumbar vertebrae, the Uncx4.1-expressing caudal sclerotome gave rise to the intervertebral disc (IVD) and rostral portion of the vertebral body (VB). In the cervical vertebrae, the Uncx4.1-expressing caudal sclerotome appeared to contribute to the IVD and both caudal and rostral ends of the VB. This finding suggests that the rostro-caudal gene expression boundary does not necessarily coincide with the resegmentation boundary. This conclusion was supported by analyses of Mesp2 KO and Ripply1/2 double KO embryos lacking rostral and caudal properties, respectively. Resegmentation was not observed in Mesp2 KO embryos, but both the IVD and whole VB were formed from the caudalized sclerotome. Expression analysis of IVD marker genes including Pax1 in the wild-type, Mesp2 KO, and Ripply1/2 DKO embryos also supported the idea that a metameric pattern of IVD/VB is generated independently of Mesp2/Ripply-mediated rostro-caudal patterning of somite. However, in the lumbar region, IVD differentiation appeared to be stimulated by the caudal property and suppressed by the rostral property. Therefore, we propose that rostro-caudal patterning of somites is not a prerequisite for metameric patterning of the IVD and VB, but instead required to stimulate IVD differentiation in the caudal half of the sclerotome. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. [Application and analysis of abdominal aortic branch malperfusion pattern in thoracic endovascular aortic repair for Stanford B aortic dissection].

    PubMed

    Han, X F; Guo, X; Li, T Z; Liu, G R; Huang, L J

    2017-12-18

    To evaluate the efficiency of thoracic endovascular aortic repair (TEVAR) in dealing with abdominal aortic branch malperfusion based on the analysis of aortic computed tomography angiography (CTA) images in pre- and post-TEVAR. Retrospective analysis from September 2015 to March 2016 in single institution to 32 patients, diagnosed as Stanford B aortic dissection with abdominal aortic branch malperfusion, CTA images in pre- and post-TEVAR were collected. Based on the aortic branch malperfusion pattern redefined by Nagamine, we identified and characterized branch malperfusion pattern for four abdominal aortic branches (celiac trunk, superior mesenteric artery, bilateral renal artery) in statistical analysis. In the four abdominal aortic branches (total 128 branches), 86 branches (67.2%) expressed with Class I patterns, in which subtype I-b presented with 0.8%, subtype I-c with 5.5%; 14 branches (10.9%) expressed with Class II patterns, in which subtype II-b-1 with 3.9%, subtype II-b-2 with 3.1%; 16 branches (12.5%) expressed with Class III patterns, all with subtype III-a, no subtype III-b and III-c presented. The remaining 12 branches were normal. The 100% successful rate of TEVAR obtained in 32 patients performed. The mean following-up was 4 months. Aortic CTA showed that among the 14 "high-risk" abdominal aortic branch malperfusion, 13 (92.9%) with obvious branch malperfusion in post-TEVAR were observed to improve, and the remaining one branch malperfusion (7.1%) was observed to change from subtype I-b to I-c. Few ratios in abdominal aortic branches suffered with obvious malperfusion complicated by Stanford B aortic dissection. For branches with "high-risk" malperfusion pattern, optimal changes were observed in abdominal aortic branch without revascularization in post-TEVAR, as well other branches with non-"high-risk" pattern perfusion were mostly stable in post-TEVAR. It could be of profound benefit to extend branch malperfusion patterns redefined by Nagamine in clinical practice to assess aortic dissection and in further guide for revascularization or not.

  19. Fatty acid binding proteins (FABPs) in prostate, bladder and kidney cancer cell lines and the use of IL-FABP as survival predictor in patients with renal cell carcinoma

    PubMed Central

    2011-01-01

    Background Fatty acid binding proteins (FABP) play an important role in carcinogenesis. Modified FABP expression patterns were described for prostate, bladder and for renal cell carcinoma. Studies on metabolic relationships and interactions in permanent cell lines allow a deeper insight into molecular processes. The aim of this study is therefore a systematic overview on mRNA and protein expressions of seven FABPs in frequently used urological cell lines. Methods Nine cell lines of renal carcinomas, seven of urinary bladder carcinomas, and five of prostate carcinomas were investigated. Quantitative RT-qPCR and western blotting were used to determine different FABPs. In addition, 46 paired cancerous and noncancerous tissue samples from nephrectomy specimen with renal cell carcinomas were investigated regarding the ileum FABP mRNA expression level and associated with survival outcome. Results General characteristics of all urological carcinoma cell lines were the expression of E-and IL-FABP on mRNA and protein level, while the expressions differed between the cell lines. The protein expression was not always congruent with the mRNA expression. Renal cell carcinoma cell lines showed expressions of L-, H- and B-FABP mRNA in addition to the general FABP expression in five out of the eight investigated cell lines. In bladder cancer cell lines, we additionally found the expression of A-FABP mRNA in six cell lines, while H-FABP was present only in three cell lines. In prostate cancer cell lines, a strong reduction of A- and E- FABP mRNA was observed. The expression of B-FABP mRNA and protein was observed only in the 22 RV-1 cells. IL-FABP mRNA was over-expressed in renal tumour tissue. The IL-FABP ratio was identified as an independent indicator of survival outcome. Conclusions Distinctly different FABP expression patterns were observed not only between the cell lines derived from the three cancer types, but also between the cell lines from the same cancer. The FABP patterns in the cell lines do not always reflect the real situation in the tumours. These facts have to be considered in functional studies concerning the different FABPs. PMID:21767383

  20. Genome-Wide Gene Expression in relation to Age in Large Laboratory Cohorts of Drosophila melanogaster

    PubMed Central

    Carlson, Kimberly A.; Gardner, Kylee; Pashaj, Anjeza; Carlson, Darby J.; Yu, Fang; Eudy, James D.; Zhang, Chi; Harshman, Lawrence G.

    2015-01-01

    Aging is a complex process characterized by a steady decline in an organism's ability to perform life-sustaining tasks. In the present study, two cages of approximately 12,000 mated Drosophila melanogaster females were used as a source of RNA from individuals sampled frequently as a function of age. A linear model for microarray data method was used for the microarray analysis to adjust for the box effect; it identified 1,581 candidate aging genes. Cluster analyses using a self-organizing map algorithm on the 1,581 significant genes identified gene expression patterns across different ages. Genes involved in immune system function and regulation, chorion assembly and function, and metabolism were all significantly differentially expressed as a function of age. The temporal pattern of data indicated that gene expression related to aging is affected relatively early in life span. In addition, the temporal variance in gene expression in immune function genes was compared to a random set of genes. There was an increase in the variance of gene expression within each cohort, which was not observed in the set of random genes. This observation is compatible with the hypothesis that D. melanogaster immune function genes lose control of gene expression as flies age. PMID:26090231

  1. Functional conservation between rodents and chicken of regulatory sequences driving skeletal muscle gene expression in transgenic chickens

    PubMed Central

    2010-01-01

    Background Regulatory elements that control expression of specific genes during development have been shown in many cases to contain functionally-conserved modules that can be transferred between species and direct gene expression in a comparable developmental pattern. An example of such a module has been identified at the rat myosin light chain (MLC) 1/3 locus, which has been well characterised in transgenic mouse studies. This locus contains two promoters encoding two alternatively spliced isoforms of alkali myosin light chain. These promoters are differentially regulated during development through the activity of two enhancer elements. The MLC3 promoter alone has been shown to confer expression of a reporter gene in skeletal and cardiac muscle in transgenic mice and the addition of the downstream MLC enhancer increased expression levels in skeletal muscle. We asked whether this regulatory module, sufficient for striated muscle gene expression in the mouse, would drive expression in similar domains in the chicken. Results We have observed that a conserved downstream MLC enhancer is present in the chicken MLC locus. We found that the rat MLC1/3 regulatory elements were transcriptionally active in chick skeletal muscle primary cultures. We observed that a single copy lentiviral insert containing this regulatory cassette was able to drive expression of a lacZ reporter gene in the fast-fibres of skeletal muscle in chicken in three independent transgenic chicken lines in a pattern similar to the endogenous MLC locus. Reporter gene expression in cardiac muscle tissues was not observed for any of these lines. Conclusions From these results we conclude that skeletal expression from this regulatory module is conserved in a genomic context between rodents and chickens. This transgenic module will be useful in future investigations of muscle development in avian species. PMID:20184756

  2. Sox genes in the coral Acropora millepora: divergent expression patterns reflect differences in developmental mechanisms within the Anthozoa

    PubMed Central

    2008-01-01

    Background Sox genes encode transcription factors that function in a wide range of developmental processes across the animal kingdom. To better understand both the evolution of the Sox family and the roles of these genes in cnidarians, we are studying the Sox gene complement of the coral, Acropora millepora (Class Anthozoa). Results Based on overall domain structures and HMG box sequences, the Acropora Sox genes considered here clearly fall into four of the five major Sox classes. AmSoxC is expressed in the ectoderm during development, in cells whose morphology is consistent with their assignment as sensory neurons. The expression pattern of the Nematostella ortholog of this gene is broadly similar to that of AmSoxC, but there are subtle differences – for example, expression begins significantly earlier in Acropora than in Nematostella. During gastrulation, AmSoxBb and AmSoxB1 transcripts are detected only in the presumptive ectoderm while AmSoxE1 transcription is restricted to the presumptive endoderm, suggesting that these Sox genes might play roles in germ layer specification. A third type B Sox gene, AmSoxBa, and a Sox F gene AmSoxF also have complex and specific expression patterns during early development. Each of these genes has a clear Nematostella ortholog, but in several cases the expression pattern observed in Acropora differs significantly from that reported in Nematostella. Conclusion These differences in expression patterns between Acropora and Nematostella largely reflect fundamental differences in developmental processes, underscoring the diversity of mechanisms within the anthozoan Sub-Class Hexacorallia (Zoantharia). PMID:19014479

  3. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants.

    PubMed

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira

    2016-10-13

    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  4. Liver but not adipose tissue is responsive to the pattern of enteral feeding

    PubMed Central

    Otero, Yolanda F.; Lundblad, Tammy M.; Ford, Eric A.; House, Lawrence M.; McGuinness, Owen P.

    2014-01-01

    Abstract Nutritional support is an important aspect of medical care, providing calories to patients with compromised nutrient intake. Metabolism has a diurnal pattern, responding to the light cycle and food intake, which in turn can drive changes in liver and adipose tissue metabolism. In this study, we assessed the response of liver and white adipose tissue (WAT) to different feeding patterns under nutritional support (total enteral nutrition or TEN). Mice received continuous isocaloric TEN for 10 days or equal calories of chow once a day (Ch). TEN was given either at a constant (CN, same infusion rate during 24 h) or variable rate (VN, 80% of calories fed at night, 20% at day). Hepatic lipogenesis and carbohydrate‐responsive element‐binding protein (ChREBP) expression increased in parallel with the diurnal feeding pattern. Relative to Ch, both patterns of enteral feeding increased adiposity. This increase was not associated with enhanced lipogenic gene expression in WAT; moreover, lipogenesis was unaffected by the feeding pattern. Surprisingly, leptin and adiponectin expression increased. Moreover, nutritional support markedly increased hepatic and adipose FGF21 expression in CN and VN, despite being considered a fasting hormone. In summary, liver but not WAT, respond to the pattern of feeding. While hepatic lipid metabolism adapts to the pattern of nutrient availability, WAT does not. Moreover, sustained delivery of nutrients in an isocaloric diet can cause adiposity without the proinflammatory state observed in hypercaloric feeding. Thus, the liver but not adipose tissue is responsive to the pattern of feeding behavior. PMID:24744913

  5. Posterior Hox gene reduction in an arthropod: Ultrabithorax and Abdominal-B are expressed in a single segment in the mite Archegozetes longisetosus

    PubMed Central

    2013-01-01

    Background Hox genes encode transcription factors that have an ancestral role in all bilaterian animals in specifying regions along the antero-posterior axis. In arthropods (insects, crustaceans, myriapods and chelicerates), Hox genes function to specify segmental identity, and changes in Hox gene expression domains in different segments have been causal to the evolution of novel arthropod morphologies. Despite this, the roles of Hox genes in arthropods that have secondarily lost or reduced their segmental composition have been relatively unexplored. Recent data suggest that acariform mites have a reduced segmental component of their posterior body tagma, the opisthosoma, in that only two segments are patterned during embryogenesis. This is in contrast to the observation that in many extinct and extant chelicerates (that is, horseshoe crabs, scorpions, spiders and harvestmen) the opisthosoma is comprised of ten or more segments. To explore the role of Hox genes in this reduced body region, we followed the expression of the posterior-patterning Hox genes Ultrabithorax (Ubx) and Abdominal-B (Abd-B), as well as the segment polarity genes patched (ptc) and engrailed (en), in the oribatid mite Archegozetes longisetosus. Results We find that the expression patterns of ptc are in agreement with previous reports of a reduced mite opisthosoma. In comparison to the ptc and en expression patterns, we find that Ubx and Abd-B are expressed in a single segment in A. longisetosus, the second opisthosomal segment. Abd-B is initially expressed more posteriorly than Ubx, that is, into the unsegmented telson; however, this domain clears in subsequent stages where it remains in the second opisthosomal segment. Conclusions Our findings suggest that Ubx and Abd-B are expressed in a single segment in the opisthosoma. This is a novel observation, in that these genes are expressed in several segments in all studied arthropods. These data imply that a reduction in opisthosomal segmentation may be tied to a dramatically reduced Hox gene input in the opisthosoma. PMID:23991696

  6. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori)

    PubMed Central

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-01-01

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family. PMID:27706106

  7. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    PubMed

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  8. Tooth Morphogenesis and FGF4 Expression During Development of Molar Tooth in Three Muroid Rodents: Calomyscus elburzensis (Calomyscidae), Mesocricetus auratus (Cricetidae) and Mus musculus (Muridae).

    PubMed

    Hamidi, Kordiyeh; Darvish, Jamshid; Matin, Maryam M; Javanmard, Athar Sadat; Kilpatrick, C William

    2017-12-01

    To date, no studies have examined the tooth formation during developmental stages of brush-tailed mice (Calomyscidae) and true hamsters (Cricetidae). Herein, we compared the timing of tooth morphogenesis and FGF4 expression pattern during development of the first lower molar in Goodwin's brush-tailed mouse, Calomyscus elburzensis with two other muroid rodents; the house mouse, Mus musculus (Muridae), model organism for tooth morphogenesis, and the golden hamster, Mesocricetus auratus which shares great similarities in cusp pattern with brush-tailed mice. All three species were bred in captivity and developing embryos were isolated at different embryonic days (E). Histological evaluation of lower molars was performed and spatiotemporal pattern of FGF4 expression was determined by immunohistochemistry. Results indicated that morphogenesis of the tooth cusps starts at the beginning of the cap stage of the first lower molar (E14 in house mouse, about E11.5 in golden hamster and E22 in Goodwin's brush-tailed mouse). During the cap to bell stage (E15 in house mouse, E12 in golden hamster and at about E24 in Goodwin's brush-tailed mouse), a decrease in the expression of FGF4 was observed in the mesenchyme, except for the cusp tips. According to our observations, the developmental process of the first lower molar formation in Goodwin's brush-tailed mouse began much later as compared with the other two species. Despite the differences in the temporal pattern of molar development between these three members of the same superfamily (Muroidea), the correlation in the expression of FGF4 with specific stages of tooth morphogenesis supported its regulatory function. Anat Rec, 300:2138-2149, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  9. Complex genomic rearrangement in CCS-LacZ transgenic mice.

    PubMed

    Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

    2007-02-01

    The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

  10. Characterization of GPR101 transcript structure and expression patterns

    PubMed Central

    Trivellin, Giampaolo; Bjelobaba, Ivana; Daly, Adrian F.; Larco, Darwin O.; Palmeira, Leonor; Faucz, Fabio R.; Thiry, Albert; Leal, Letícia F.; Rostomyan, Liliya; Quezado, Martha; Schernthaner-Reiter, Marie Helene; Janjic, Marija M.; Villa, Chiara; Wu, T. John; Stojilkovic, Stanko S.; Beckers, Albert; Feldman, Benjamin; Stratakis, Constantine A.

    2016-01-01

    We recently showed that Xq26.3 microduplications cause X-linked acrogigantism (X-LAG). X-LAG patients mainly present with growth hormone and prolactin-secreting adenomas and share a minimal duplicated region containing at least four genes. GPR101 was the only gene highly expressed in their pituitary lesions, but little is known about its expression patterns. GPR101 transcripts were characterized in human tissues by 5’-RACE and RNAseq, while the putative promoter was bioinformatically predicted. We investigated GPR101 mRNA and protein expression by RT-qPCR, whole-mount in situ hybridization, and immunostaining, in human, rhesus monkey, rat, and zebrafish. We identified four GPR101 isoforms characterized by different 5’ untranslated regions (UTRs) and a common 6.1 kb-long 3’UTR. GPR101 expression was very low or absent in almost all adult human tissues examined, except for specific brain regions. Strong GPR101 staining was observed in human fetal pituitary and during adolescence, whereas very weak/absent expression was detected during childhood and adult life. In contrast to humans, adult pituitaries of monkey and rat expressed GPR101, but in different cell types. Gpr101 is expressed in the brain and pituitary during rat and zebrafish development; in rat pituitary Gpr101 is expressed only after birth and showed sexual dimorphism. This study shows that different GPR101 transcripts exist and that the brain is the major site of GPR101 expression across different species, although divergent species- and temporal-specific expression patterns are evident. These findings suggest an important role for GPR101 in brain and pituitary development and likely reflect the very different growth, development and maturation patterns among species. PMID:27282544

  11. Polymorphism and Expression Profile of Cholecystokinin Type A Receptor in Relation to Gallstone Disease Susceptibility.

    PubMed

    Kazmi, Hasan Raza; Chandra, Abhijit; Nigam, Jaya; Baghel, Kavita; Srivastava, Meenu; Maurya, Shailendra S; Parmar, Devendra

    2016-10-01

    In the present study, we investigated expression pattern of Cholecystokinin type A receptor (CCKAR) in relation to its commonly studied polymorphism (rs1800857, T/C) in gallstone disease (GSD) patients and controls. A total of 502 subjects (272 GSD and 230 controls) were enrolled, and genotyping was performed by evaluating restriction fragments of PstI digested DNA. For analyzing expression pattern of CCKAR in relation to polymorphism, gallbladder tissue samples from 80 subjects (GSD-55; control-25) were studied. Expression of CCKAR mRNA was evaluated by reverse transcriptase-PCR and confirmed using real-time PCR. Protein expression was evaluated by enzyme-linked immunosorbent assay. We observed significantly (p < 0.0001) lower expression of CCKAR mRNA and protein in GSD tissues as compared with control. Significantly higher frequency of A1/A1 genotype (C/T transition) (p = 0.0005) was observed for GSD as compared with control. Expression of CCKAR protein was found to be significantly lower (p < 0.0001) in A1/A1 genotype as compared with other genotypes for GSD patients. Perhaps, this is the first report providing evidence of alteration in CCKAR expression in relation to its polymorphism elucidating the molecular pathway of the disease. Additional investigations with lager sample size are needed to confirm these findings.

  12. Regulation of DM-20 mRNA expression and intracellular translocation of glutathione-S-transferase pi isoform during oligodendrocyte differentiation in the adult rat spinal cord.

    PubMed

    Kitada, Masaaki; Takeda, Kazuya; Dezawa, Mari

    2016-07-01

    We previously demonstrated that NG2-positive oligodendrocyte precursor cells (OPCs) do not express DM-20 mRNA and identified a distinct DM-20 mRNA-positive cell population expressing glutathione-S-transferase pi isoform (GST-pi) in the nucleus (GST-pi(Nuc)) of the adult rat spinal cord. As GST-pi intranuclear localization correlates with progenitor cell properties, we examined the differentiation status of this cell population under the intensive 5-bromo-2'-deoxyuridine (BrdU) administration method, consisting of intraperitoneal BrdU injections every 2 h for 48 h. We observed that a certain population of proliferating/proliferated cells expressed DM-20 mRNA, and sometimes two proliferating/proliferated cells were observed still attached to each other. We performed triple staining for BrdU, DM-20 mRNA, and NG2 and found pairs of neighboring BrdU-positive cells, which were considered to originate from the same progenitor cells and where both cells expressed DM-20 mRNA. Triple staining for BrdU, DM-20 mRNA, and GST-pi detected proliferating/proliferated cells exhibiting the GST-pi(Nuc)/DM-20 mRNA-positive expression pattern. These findings suggested the presence of a GST-pi(Nuc)/DM-20 mRNA-positive oligodendrocyte-lineage progenitor cell population in the adult rat spinal cord. However, we did not find any pair of neighboring BrdU-positive cells with this expression pattern. These observations collectively support the idea that GST-pi(Nuc)/DM-20 mRNA-expressing cells are the progeny of NG2-positive OPCs rather than a novel type of oligodendrocyte-lineage progenitor cells and that DM-20 mRNA expression is dynamically regulated during differentiation of OPCs into oligodendrocytes.

  13. FoxP2 protein levels regulate cell morphology changes and migration patterns in the vertebrate developing telencephalon.

    PubMed

    Garcia-Calero, Elena; Botella-Lopez, Arancha; Bahamonde, Olga; Perez-Balaguer, Ariadna; Martinez, Salvador

    2016-07-01

    In the mammalian telencephalon, part of the progenitor cells transition from multipolar to bipolar morphology as they invade the mantle zone. This associates with changing patterns of radial migration. However, the molecules implicated in these morphology transitions are not well known. In the present work, we analyzed the function of FoxP2 protein in this process during telencephalic development in vertebrates. We analyzed the expression of FoxP2 protein and its relation with cell morphology and migratory patterns in mouse and chicken developing striatum. We observed FoxP2 protein expressed in a gradient from the subventricular zone to the mantle layer in mice embryos. In the FoxP2 low domain cells showed multipolar migration. In the striatal mantle layer where FoxP2 protein expression is higher, cells showed locomoting migration and bipolar morphology. In contrast, FoxP2 showed a high and homogenous expression pattern in chicken striatum, thus bipolar morphology predominated. Elevation of FoxP2 in the striatal subventricular zone by in utero electroporation promoted bipolar morphology and impaired multipolar radial migration. In mouse cerebral cortex we obtained similar results. FoxP2 promotes transition from multipolar to bipolar morphology by means of gradiental expression in mouse striatum and cortex. Together these results indicate a role of FoxP2 differential expression in cell morphology control of the vertebrate telencephalon.

  14. Transcriptomic variation of eyestalk reveals the genes and biological processes associated with molting in Portunus trituberculatus

    PubMed Central

    Zhang, Longtao; Liu, Ping; Li, Jian

    2017-01-01

    Background Molting is an essential biological process throughout the life history of crustaceans, which is regulated by many neuropeptide hormones expressed in the eyestalk. To better understand the molting mechanism in Portunus trituberculatus, we used digital gene expression (DGE) to analyze single eyestalk samples during the molting cycle by high-throughput sequencing. Results We obtained 14,387,942, 12,631,508 and 13,060,062 clean sequence reads from inter-molt (InM), pre-molt (PrM) and post-molt (PoM) cDNA libraries, respectively. A total of 1,394 molt-related differentially expressed genes (DEGs) were identified. GO and KEGG enrichment analysis identified some important processes and pathways with key roles in molting regulation, such as chitin metabolism, peptidase inhibitor activity, and the ribosome. We first observed a pattern associated with the neuromodulator-related pathways during the molting cycle, which were up-regulated in PrM and down-regulated in PoM. Four categories of important molting-related transcripts were clustered and most of them had similar expression patterns, which suggests that there is a connection between these genes throughout the molt cycle. Conclusion Our work is the first molt-related investigation of P. trituberculatus focusing on the eyestalk at the whole transcriptome level. Together, our results, including DEGs, identification of molting-related biological processes and pathways, and observed expression patterns of important genes, provide a novel insight into the function of the eyestalk in molting regulation. PMID:28394948

  15. Quantitative RT-PCR Comparison of the Urea and Nitric Oxide Cycle Gene Transcripts in Adult Human Tissues

    PubMed Central

    Neill, Meaghan Anne; Aschner, Judy; Barr, Frederick; Summar, Marshall L.

    2009-01-01

    The urea cycle and nitric oxide cycle play significant roles in complex biochemical and physiologic reactions. These cycles have distinct biochemical goals including the clearance of waste nitrogen; the production of the intermediates ornithine, citrulline, and arginine for the urea cycle; and the production of nitric oxide for the nitric oxide pathway. Despite their disparate functions, the two pathways share two enzymes, argininosuccinic acid synthase and argininosuccinic acid lyase, and a transporter, citrin. Studying the gene expression of these enzymes is paramount in understanding these complex biochemical pathways. Here, we examine the expression of genes involved in the urea cycle and the nitric oxide cycle in a panel of eleven different tissue samples obtained from individual adults without known inborn errors of metabolism. In this study, the pattern of co-expressed enzymes provides a global view of the metabolic activity of the urea and nitric oxide cycles in human tissues. Our results show that these transcripts are differentially expressed in different tissues. The pattern of co-expressed enzymes provides a global view of the metabolic activity of the urea and nitric oxide cycles in human tissues. Using the co-expression profiles, we discovered that the combination of expression of enzyme transcripts as detected in our study, might serve to fulfill specific physiologic function(s) in tissue including urea production/nitrogen removal, arginine/citrulline production, nitric oxide production, and ornithine production. Our study reveals the importance of studying not only the expression profile of an enzyme of interest, but also studying the expression profiles of the other enzymes involved in a particular pathway so as to better understand the context of expression. The tissue patterns we observed highlight the variety of important functions they conduct and provide insight into many of the clinical observations from their disruption. PMID:19345634

  16. Characterization of NvLWamide-like neurons reveals stereotypy in Nematostella nerve net development.

    PubMed

    Havrilak, Jamie A; Faltine-Gonzalez, Dylan; Wen, Yiling; Fodera, Daniella; Simpson, Ayanna C; Magie, Craig R; Layden, Michael J

    2017-11-15

    The organization of cnidarian nerve nets is traditionally described as diffuse with randomly arranged neurites that show minimal reproducibility between animals. However, most observations of nerve nets are conducted using cross-reactive antibodies that broadly label neurons, which potentially masks stereotyped patterns produced by individual neuronal subtypes. Additionally, many cnidarians species have overt structures such as a nerve ring, suggesting higher levels of organization and stereotypy exist, but mechanisms that generated that stereotypy are unknown. We previously demonstrated that NvLWamide-like is expressed in a small subset of the Nematostella nerve net and speculated that observing a few neurons within the developing nerve net would provide a better indication of potential stereotypy. Here we document NvLWamide-like expression more systematically. NvLWamide-like is initially expressed in the typical neurogenic salt and pepper pattern within the ectoderm at the gastrula stage, and expression expands to include endodermal salt and pepper expression at the planula larval stage. Expression persists in both ectoderm and endoderm in adults. We characterized our NvLWamide-like::mCherry transgenic reporter line to visualize neural architecture and found that NvLWamide-like is expressed in six neural subtypes identifiable by neural morphology and location. Upon completing development the numbers of neurons in each neural subtype are minimally variable between animals and the projection patterns of each subtype are consistent. Furthermore, between the juvenile polyp and adult stages the number of neurons for each subtype increases. We conclude that development of the Nematostella nerve net is stereotyped between individuals. Our data also imply that one aspect of generating adult cnidarian nervous systems is to modify the basic structural architecture generated in the juvenile by increasing neural number proportionally with size. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  17. The relative expression levels of insulin-like growth factor 1 and myostatin mRNA in the asynchronous development of skeletal muscle in ducks during early development.

    PubMed

    Hu, Yan; Liu, Hongxiang; Shan, Yanju; Ji, Gaige; Xu, Wenjuan; Shu, Jingting; Li, Huifang

    2015-08-10

    Genetic selection is a powerful tool for modifying poultry muscle yield. Insulin-like growth factor I (IGF-I) and myostatin (MSTN) are important regulators of muscle growth, especially in the myogenesis stage. This study compared the developmental pattern of the pectoralis major (PM) and lateral gastrocnemius (LM) muscles, mRNA expression characterization of IGF-I and MSTN-A and their correlation between 14 days in ovo and 1 week post-hatch in two Chinese local duck breeds. During early development, the growth of duck PM and LM followed an asynchronous pattern. Variations in PM growth rate observed with development followed the relative variations of MSTN and IGF-I expression; however, the same behavior was not observed in LM. Moreover, the profile of IGF-I expression in duck skeletal muscles indicated that genetic selection for high meat-yield poultry has altered the temporal expression of IGF-I and affected cellular characteristics and mass by hatch in a PM-specific manner. The MSTN-A expression profile showed synchronization with the growth of skeletal muscle and peaks of myofiber proliferation. The expression patterns of IGF-I and MSTN suggest that duck pectoralis fibers are prioritized for proliferation in embryogenesis. The IGF-1/MSTN-A mRNA ratios in PM and LM presented very similar trends in the changes of myofiber characteristics, and differences in the IGF-1/MSTN-A mRNA ratio in PM between the two breeds corresponded to the timing of differences in PM mass between the varieties. Our results support the hypothesis that relative levels of IGF-I and MSTN mRNA may participate in ordering muscle growth rates with selected development. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Ectopic Six3 expression in the dragon eye goldfish.

    PubMed

    Ma, Dong-Mei; Zhu, Hua-Ping; Gui, Jian-Fang

    2008-02-01

    For goldfish (Carassius auratus), there are many varieties with different eye phenotypes due to artificial selection and adaptive evolution. Dragon eye is a variant eye characterized by a large-size eyeball protruding out of the socket similar to the eye of dragon in Chinese legends. In this study, anatomical structure of the goldfish dragon eye was compared with that of the common eye, and a stretching of the retina was observed in the enlarged dragon eye. Moreover, the homeobox-containing transcription factor Six3 cDNAs were cloned from the two types of goldfish, and the expression patterns were analyzed in both normal eye and dragon eye goldfish. No amino acid sequence differences were observed between the two deduced peptides, and the expression pattern of Six3 protein in dragon eye is quite similar to common eye during embryogenesis, but from 2 days after hatching, ectopic Six3 expression began to occur in the dragon eye, especially in the outer nuclear layer cells. With eye development, more predominant Six3 distribution was detected in the outer nuclear layer cells of dragon eye than that of normal eye, and fewer cell-layers in outer nuclear layer were observed in dragon eye retina than in normal eye retina. The highlight of this study is that higher Six3 expression occurs in dragon eye goldfish than in normal eye goldfish during retinal development of larvae.

  19. Gene expression analysis of parthenogenetic embryonic development of the pea aphid, Acyrthosiphon pisum, suggests that aphid parthenogenesis evolved from meiotic oogenesis.

    PubMed

    Srinivasan, Dayalan G; Abdelhady, Ahmed; Stern, David L

    2014-01-01

    Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity.

  20. Gene Expression Analysis of Parthenogenetic Embryonic Development of the Pea Aphid, Acyrthosiphon pisum, Suggests That Aphid Parthenogenesis Evolved from Meiotic Oogenesis

    PubMed Central

    Srinivasan, Dayalan G.; Abdelhady, Ahmed; Stern, David L.

    2014-01-01

    Aphids exhibit a form of phenotypic plasticity, called polyphenism, in which genetically identical females reproduce sexually during one part of the life cycle and asexually (via parthenogenesis) during the remainder of the life cycle. The molecular basis for aphid parthenogenesis is unknown. Cytological observations of aphid parthenogenesis suggest that asexual oogenesis evolved either through a modification of meiosis or from a mitotic process. As a test of these alternatives, we assessed the expression levels and expression patterns of canonical meiotic recombination and germline genes in the sexual and asexual ovaries of the pea aphid, Acyrthosiphon pisum. We observed expression of all meiosis genes in similar patterns in asexual and sexual ovaries, with the exception that some genes encoding Argonaute-family members were not expressed in sexual ovaries. In addition, we observed that asexual aphid tissues accumulated unspliced transcripts of Spo11, whereas sexual aphid tissues accumulated primarily spliced transcripts. In situ hybridization revealed Spo11 transcript in sexual germ cells and undetectable levels of Spo11 transcript in asexual germ cells. We also found that an obligately asexual strain of pea aphid produced little spliced Spo11 transcript. Together, these results suggest that parthenogenetic oogenesis evolved from a meiosis-like, and not a mitosis-like, process and that the aphid reproductive polyphenism may involve a modification of Spo11 gene activity. PMID:25501006

  1. Dual targeting to mitochondria and plastids of AtBT1 and ZmBT1, two members of the mitochondrial carrier family.

    PubMed

    Bahaji, Abdellatif; Ovecka, Miroslav; Bárány, Ivett; Risueño, María Carmen; Muñoz, Francisco José; Baroja-Fernández, Edurne; Montero, Manuel; Li, Jun; Hidalgo, Maite; Sesma, María Teresa; Ezquer, Ignacio; Testillano, Pilar S; Pozueta-Romero, Javier

    2011-04-01

    Zea mays and Arabidopsis thaliana Brittle 1 (ZmBT1 and AtBT1, respectively) are members of the mitochondrial carrier family. Although they are presumed to be exclusively localized in the envelope membranes of plastids, confocal fluorescence microscopy analyses of potato, Arabidopsis and maize plants stably expressing green fluorescent protein (GFP) fusions of ZmBT1 and AtBT1 revealed that the two proteins have dual localization to plastids and mitochondria. The patterns of GFP fluorescence distribution observed in plants stably expressing GFP fusions of ZmBT1 and AtBT1 N-terminal extensions were fully congruent with that of plants expressing a plastidial marker fused to GFP. Furthermore, the patterns of GFP fluorescence distribution and motility observed in plants expressing the mature proteins fused to GFP were identical to those observed in plants expressing a mitochondrial marker fused to GFP. Electron microscopic immunocytochemical analyses of maize endosperms using anti-ZmBT1 antibodies further confirmed that ZmBT1 occurs in both plastids and mitochondria. The overall data showed that (i) ZmBT1 and AtBT1 are dually targeted to mitochondria and plastids; (ii) AtBT1 and ZmBT1 N-terminal extensions comprise targeting sequences exclusively recognized by the plastidial compartment; and (iii) targeting sequences to mitochondria are localized within the mature part of the BT1 proteins.

  2. Gender-Specific Gene Expression in Post-Mortem Human Brain: Localization to Sex Chromosomes

    PubMed Central

    Vawter, Marquis P; Evans, Simon; Choudary, Prabhakara; Tomita, Hiroaki; Meador-Woodruff, Jim; Molnar, Margherita; Li, Jun; Lopez, Juan F; Myers, Rick; Cox, David; Watson, Stanley J; Akil, Huda; Jones, Edward G; Bunney, William E

    2011-01-01

    Gender differences in brain development and in the prevalence of neuropsychiatric disorders such as depression have been reported. Gender differences in human brain might be related to patterns of gene expression. Microarray technology is one useful method for investigation of gene expression in brain. We investigated gene expression, cell types, and regional expression patterns of differentially expressed sex chromosome genes in brain. We profiled gene expression in male and female dorsolateral prefrontal cortex, anterior cingulate cortex, and cerebellum using the Affymetrix oligonucleotide microarray platform. Differentially expressed genes between males and females on the Y chromosome (DBY, SMCY, UTY, RPS4Y, and USP9Y) and X chromosome (XIST) were confirmed using real-time PCR measurements. In situ hybridization confirmed the differential expression of gender-specific genes and neuronal expression of XIST, RPS4Y, SMCY, and UTY in three brain regions examined. The XIST gene, which silences gene expression on regions of the X chromosome, is expressed in a subset of neurons. Since a subset of neurons express gender-specific genes, neural subpopulations may exhibit a subtle sexual dimorphism at the level of differences in gene regulation and function. The distinctive pattern of neuronal expression of XIST, RPS4Y, SMCY, and UTY and other sex chromosome genes in neuronal subpopulations may possibly contribute to gender differences in prevalence noted for some neuropsychiatric disorders. Studies of the protein expression of these sex- chromosome-linked genes in brain tissue are required to address the functional consequences of the observed gene expression differences. PMID:14583743

  3. Transcription factor-dependent chromatin remodeling of Il18r1 during Th1 and Th2 differentiation 1

    PubMed Central

    Yu, Qing; Chang, Hua-Chen; Ahyi, Ayele-Nati N.; Kaplan, Mark H.

    2008-01-01

    The IL-18Rα chain is expressed on Th1 but not Th2 cells. We have recently shown that Stat4 is an important component of programming the Il18r1 locus (encoding IL-18Rα) for maximal expression in Th1 cells. Il18r1 is reciprocally repressed during Th2 development. In this report we demonstrate that the establishment of DNase hypersensitivity patterns that are distinct among undifferentiated CD4 T cells, Th1 and Th2 cells. Stat6 is required for the repression of Il18r1 expression and in Stat6-deficient Th2 cultures, mRNA levels, histone acetylation and H3K4 methylation levels are intermediate between levels observed in Th1 and Th2 cells. Despite the repressive effects of IL-4 during Th2 differentiation, we observed only modest binding of Stat6 to the Il18r1 locus. In contrast, we observed robust GATA-3 binding to a central region of the locus where DNase hypersensitivity sites overlapped with conserved non-coding sequences in Il18r1 introns. Ectopic expression of GATA-3 in differentiated Th1 cells repressed Il18r1 mRNA and surface expression of IL-18Rα. These data provide further mechanistic insight into transcription factor dependent establishment of Th subset-specific patterns of gene expression. PMID:18714006

  4. Expression of the Maize Dof1 Transcription Factor in Wheat and Sorghum

    PubMed Central

    Peña, Pamela A.; Quach, Truyen; Sato, Shirley; Ge, Zhengxiang; Nersesian, Natalya; Changa, Taity; Dweikat, Ismail; Soundararajan, Madhavan; Clemente, Tom E.

    2017-01-01

    Nitrogen is essential for plant growth and development. Improving the ability of plants to acquire and assimilate nitrogen more efficiently is a key agronomic parameter that will augment sustainability in agriculture. A transcription factor approach was pursued to address improvement of nitrogen use efficiency in two major commodity crops. To this end, the Zea mays Dof1 (ZmDof1) transcription factor was expressed in both wheat (Triticum aestivum) and sorghum (Sorghum bicolor) either constitutively, UBI4 promoter from sugarcane, or in a tissue specific fashion via the maize rbcS1 promoter. The primary transcription activation target of ZmDof1, phosphoenolpyruvate carboxylase (PEPC), is observed in transgenic wheat events. Expression ZmDof1 under control of the rbcs1 promoter translates to increase in biomass and yield components in wheat. However, constitutive expression of ZmDof1 led to the down-regulation of genes involved in photosynthesis and the functional apparatus of chloroplasts, and an outcome that negatively impacts photosynthesis, height, and biomass in wheat. Similar patterns were also observed in sorghum transgenic events harboring the constitutive expression cassette of ZmDof1. These results indicate that transcription factor strategies to boost agronomic phenotypic outcomes in crops need to consider expression patterns of the genetic elements to be introduced. PMID:28424717

  5. Long-range activation of Sox9 in Odd Sex (Ods) mice.

    PubMed

    Qin, Yangjun; Kong, Ling-kun; Poirier, Christophe; Truong, Cavatina; Overbeek, Paul A; Bishop, Colin E

    2004-06-15

    The Odd Sex mouse mutation arose in a transgenic line of mice carrying a tyrosinase minigene driven by the dopachrome tautomerase (Dct) promoter region. The minigene integrated 0.98 Mb upstream of Sox9 and was accompanied by a deletion of 134 kb. This mutation causes female to male sex reversal in XX Ods/+ mice, and a characteristic eye phenotype of microphthalmia with cataracts in all mice carrying the transgene. Ods causes sex reversal in the absence of Sry by upregulating Sox9 expression and maintaining a male pattern of Sox9 expression in XX Ods/+ embryonic gonads. This expression, which begins at E11.5, triggers downstream events leading to the formation of a testis. We report here that the 134 kb deletion, in itself, is insufficient to cause sex reversal. We demonstrate that in Ods, the Dct promoter is capable of acting over a distance of 1 Mb to induce inappropriate expression of Sox9 in the retinal pigmented epithelium of the eye, causing the observed microphthalmia. In addition, it induces Sox9 expression in the melanocytes where it causes pigmentation defects. We propose that Ods sex reversal is due to the Dct promoter element interacting with gonad-specific enhancer elements to produce the observed male pattern expression of Sox9 in the embryonic gonads.

  6. Coordinated transcriptional regulation patterns associated with infertility phenotypes in men

    PubMed Central

    Ellis, Peter J I; Furlong, Robert A; Conner, Sarah J; Kirkman‐Brown, Jackson; Afnan, Masoud; Barratt, Christopher; Griffin, Darren K; Affara, Nabeel A

    2007-01-01

    Introduction Microarray gene‐expression profiling is a powerful tool for global analysis of the transcriptional consequences of disease phenotypes. Understanding the genetic correlates of particular pathological states is important for more accurate diagnosis and screening of patients, and thus for suggesting appropriate avenues of treatment. As yet, there has been little research describing gene‐expression profiling of infertile and subfertile men, and thus the underlying transcriptional events involved in loss of spermatogenesis remain unclear. Here we present the results of an initial screen of 33 patients with differing spermatogenic phenotypes. Methods Oligonucleotide array expression profiling was performed on testis biopsies for 33 patients presenting for testicular sperm extraction. Significantly regulated genes were selected using a mixed model analysis of variance. Principle components analysis and hierarchical clustering were used to interpret the resulting dataset with reference to the patient history, clinical findings and histological composition of the biopsies. Results Striking patterns of coordinated gene expression were found. The most significant contains multiple germ cell‐specific genes and corresponds to the degree of successful spermatogenesis in each patient, whereas a second pattern corresponds to inflammatory activity within the testis. Smaller‐scale patterns were also observed, relating to unique features of the individual biopsies. PMID:17496197

  7. A Comparative Analysis of Cytokeratin 18 and 19 Expressions in Odontogenic Keratocyst, Dentigerous Cyst and Radicular Cyst with a Review of Literature

    PubMed Central

    Shah, Vandana Sandip; Ghanchi, Mohsin Jiva; Gosavi, Sandesh Sachchidanand; Srivastava, Himanshu Mahesh; Pachore, Nivedita Javahir

    2016-01-01

    Introduction Odontogenic cysts viz Odontogenic Keratocyst (OKC), Dentigerous Cyst (DC) and Radicular Cyst (RC) occur commonly in the oral and maxillofacial region. Cytokeratin (CK) expression studies have been done to evaluate diagnostic accuracy, role in pathogenesis, elucidate behaviour and role in treatment protocols. However, variations have been reported in the expression of CK patterns in these odontogenic cysts, which could be due to the lack of standardization of laboratory techniques. The present study has tried to shed light on CK 18 and 19 expression in odontogenic cysts and offer the brief review of previous studies on these CK. Aim The aim of the present study was to evaluate the intensity and expression patterns of CK 18 and 19 in OKCs, DCs and RCs. Materials and Methods A total of 60 cases, 20 each of OKC, DC and RC were confirmed histologically and evaluated for immunohistochemical expression pattern and intensity of CK 18 and 19. Results A focal and variable expression of CK 18 was observed in 25% of OKCs, 15% of DCs and 10% of RCs. CK 19 was expressed in 75% of OKCs and 100% in DCs as well as RCs. Conclusion The intensity and expression of Cytokeratin 19 was more in all three cysts compared to Cytokeratin 18. PMID:27630961

  8. Differential expression of virulence genes in Legionella pneumophila growing in Acanthamoeba and human monocytes.

    PubMed

    Mou, Qianqian; Leung, Polly H M

    2018-01-01

    Legionella pneumophila, the causative agent of Legionnaires' disease, is widely distributed throughout natural and artificial water systems and can replicate in macrophages and amoebae. Amoebae are the natural hosts of L. pneumophila, whereas macrophages are incidentally infected. The life cycle of L. pneumophila comprises a replicative phase within the Legionella-containing vacuole (LCV) and a transmissive phase during which bacterial cells become motile and are released via killing of the host. Although the host death mechanisms induced by L. pneumophila have been studied, the expression patterns of related L. pneumophila genes have not been reported. The present study compared the expression patterns of host cell death-associated genes in L. pneumophila grown in the human monocytic cell line THP-1 and Acanthamoeba castellanii. Notably, when L. pneumophila was grown in THP-1, expression of the gene flaA, which is involved in the induction of pyroptosis, was downregulated during the course of infection. In contrast, sdhA associated indirectly with host death, was upregulated. Expression of the genes vipD and sidF, which are involved in the induction and suppression of apoptosis, changed by less than 2-fold. Notably, a lower percentage of pyroptotic cells was observed among infected THP-1 cells relative to uninfected cells, and the latter exhibited stronger expression of caspase-1. A different pattern was observed when L. pneumophila was grown in A. castellanii: flaA and vipD were activated, whereas sdhA and sidF were downregulated during the later stage of replication. The percentage of non-viable (annexin-V + PI + or annexin-V + PI - ) A. castellanii organisms increased with Legionella infection, and the expression of metacaspase-1, which is involved in encystation was up-regulated at late infection time. In summary, L. pneumophila can multiply intracellularly in both amoebae and macrophages to induce cell death and secondary infection, and this characteristic is essential for its survival in water and the lungs. The gene expression profiles observed in this study indicated the increased cytotoxicity of L. pneumophila in A. castellanii, suggesting an increased adaptation of Legionella to this host.

  9. BAC Recombineering of the Agouti Loci from Spotted Gar and Zebrafish Reveals the Evolutionary Ancestry of Dorsal-Ventral Pigment Asymmetry in Fish.

    PubMed

    Cal, Laura; MegÍas, Manuel; Cerdá-Reverter, José Miguel; Postlethwait, John H; Braasch, Ingo; Rotllant, Josep

    2017-11-01

    Dorsoventral pigment patterning, characterized by a light ventrum and a dark dorsum, is one of the most widespread chromatic adaptations in vertebrate body coloration. In mammals, this countershading depends on differential expression of agouti-signaling protein (ASIP), which drives a switch of synthesis of one type of melanin to another within melanocytes. Teleost fish share countershading, but the pattern results from a differential distribution of multiple types of chromatophores, with black-brown melanophores most abundant in the dorsal body and reflective iridophores most abundant in the ventral body. We previously showed that Asip1 (a fish ortholog of mammalian ASIP) plays a role in patterning melanophores. This observation leads to the surprising hypothesis that agouti may control an evolutionarily conserved pigment pattern by regulating different mechanisms in mammals and fish. To test this hypothesis, we compared two ray-finned fishes: the teleost zebrafish and the nonteleost spotted gar (Lepisosteus oculatus). By examining the endogenous pattern of asip1 expression in gar, we demonstrate a dorsoventral-graded distribution of asip1 expression that is highest ventrally, similar to teleosts. Additionally, in the first reported experiments to generate zebrafish transgenic lines carrying a bacterial artificial chromosome (BAC) from spotted gar, we show that both transgenic zebrafish lines embryos replicate the endogenous asip1 expression pattern in adult zebrafish, showing that BAC transgenes from both species contain all of the regulatory elements required for regular asip1 expression within adult ray-finned fishes. These experiments provide evidence that the mechanism leading to an environmentally important pigment pattern was likely in place before the origin of teleosts. © 2017 Wiley Periodicals, Inc.

  10. Role of Apoptosis in the Development of Uterine Leiomyoma: Analysis of Expression Patterns of Bcl-2 and Bax in Human Leiomyoma Tissue With Clinical Correlations.

    PubMed

    Csatlós, Éva; Máté, Szabolcs; Laky, Marcella; Rigó, János; Joó, József Gábor

    2015-07-01

    To describe gene expression patterns of the apoptotic regulatory genes Bcl and Bax in human uterine leiomyoma tissue. To investigate the relationship between alterations of gene expression patterns and several relevant clinical parameters. We obtained samples from 101 cases undergoing surgery for uterine leiomyoma for gene expression analysis of the Bcl-2 and Bax genes. Gene expression was quantified using RT-PCR technique. In the leiomyoma group, the Bcl-2 gene was significantly overexpressed compared with the control group although there was no such difference in the gene expression of Bax. Gene activity of Bcl-2 positively correlated with the tumor number in individual uterine leiomyoma cases. Although there was no significant correlation between the length of the cumulative lactation period before the development of uterine leiomyoma and Bcl-2 gene expression in the leiomyoma tissue, we observed a trend for a shorter cumulative lactation period to be associated with overexpression of the Bcl-2 gene. Overexpression of the antiapoptotic Bcl-2 gene appeared to be a factor in the development of uterine leiomyoma, whereas gene activity of the proapoptotic Bax gene did not seem to play a role in the process.

  11. Quantitative developmental transcriptomes of the Mediterranean sea urchin Paracentrotus lividus.

    PubMed

    Gildor, Tsvia; Malik, Assaf; Sher, Noa; Avraham, Linor; Ben-Tabou de-Leon, Smadar

    2016-02-01

    Embryonic development progresses through the timely activation of thousands of differentially activated genes. Quantitative developmental transcriptomes provide the means to relate global patterns of differentially expressed genes to the emerging body plans they generate. The sea urchin is one of the classic model systems for embryogenesis and the models of its developmental gene regulatory networks are of the most comprehensive of their kind. Thus, the sea urchin embryo is an excellent system for studies of its global developmental transcriptional profiles. Here we produced quantitative developmental transcriptomes of the sea urchin Paracentrotus lividus (P. lividus) at seven developmental stages from the fertilized egg to prism stage. We generated de-novo reference transcriptome and identified 29,817 genes that are expressed at this time period. We annotated and quantified gene expression at the different developmental stages and confirmed the reliability of the expression profiles by QPCR measurement of a subset of genes. The progression of embryo development is reflected in the observed global expression patterns and in our principle component analysis. Our study illuminates the rich patterns of gene expression that participate in sea urchin embryogenesis and provide an essential resource for further studies of the dynamic expression of P. lividus genes. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. X-linked gene expression in the Virginia opossum: differences between the paternally derived Gpd and Pgk-A loci

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Samollow, P.B.; Ford, A.L.; VandeBerg, J.L.

    1987-01-01

    Expression of X-linked glucose-6-phosphate dehydrogenase (G6PD) and phosphoglycerate kinase-A (PGK-A) in the Virginia opossum (Didelphis virginiana) was studied electrophoretically in animals from natural populations and those produced through controlled laboratory crosses. Blood from most of the wild animals exhibited a common single-banded phenotype for both enzymes. Rare variant animals, regardless of sex, exhibited single-banded phenotypes different in mobility from the common mobility class of the respective enzyme. The laboratory crosses confirmed the allelic basis for the common and rare phenotypes. Transmission of PGK-A phenotypes followed the pattern of determinate (nonrandom) inactivation of the paternally derived Pgk-A allele, and transmission ofmore » G6PD also was consistent with this pattern. A survey of tissue-specific expression of G6PD phenotypes of heterozygous females revealed, in almost all tissues, three-banded patterns skewed in favor of the allele that was expressed in blood cells. Three-banded patterns were never observed in males or in putatively homozygous females. These patterns suggest simultaneous, but unequal, expression of the maternally and paternally derived Gpd alleles within individual cells. The absence of such partial expression was noted in a parallel survey of females heterozygous at the Pgd-A locus. Thus, it appears that Gpd and Pgk-A are X-linked in D. virginiana and subject to preferential paternal allele inactivation, but that dosage compensation may not be complete for all paternally derived X-linked genes.« less

  13. Spatial expression of Hox cluster genes in the ontogeny of a sea urchin

    NASA Technical Reports Server (NTRS)

    Arenas-Mena, C.; Cameron, A. R.; Davidson, E. H.

    2000-01-01

    The Hox cluster of the sea urchin Strongylocentrous purpuratus contains ten genes in a 500 kb span of the genome. Only two of these genes are expressed during embryogenesis, while all of eight genes tested are expressed during development of the adult body plan in the larval stage. We report the spatial expression during larval development of the five 'posterior' genes of the cluster: SpHox7, SpHox8, SpHox9/10, SpHox11/13a and SpHox11/13b. The five genes exhibit a dynamic, largely mesodermal program of expression. Only SpHox7 displays extensive expression within the pentameral rudiment itself. A spatially sequential and colinear arrangement of expression domains is found in the somatocoels, the paired posterior mesodermal structures that will become the adult perivisceral coeloms. No such sequential expression pattern is observed in endodermal, epidermal or neural tissues of either the larva or the presumptive juvenile sea urchin. The spatial expression patterns of the Hox genes illuminate the evolutionary process by which the pentameral echinoderm body plan emerged from a bilateral ancestor.

  14. Serotype-dependent transduction efficiencies of recombinant adeno-associated viral vectors in monkey neocortex

    PubMed Central

    Gerits, Annelies; Vancraeyenest, Pascaline; Vreysen, Samme; Laramée, Marie-Eve; Michiels, Annelies; Gijsbers, Rik; Van den Haute, Chris; Moons, Lieve; Debyser, Zeger; Baekelandt, Veerle; Arckens, Lutgarde; Vanduffel, Wim

    2015-01-01

    Abstract. Viral vector-mediated expression of genes (e.g., coding for opsins and designer receptors) has grown increasingly popular. Cell-type specific expression is achieved by altering viral vector tropism through crosspackaging or by cell-specific promoters driving gene expression. Detailed information about transduction properties of most recombinant adeno-associated viral vector (rAAV) serotypes in macaque cortex is gradually becoming available. Here, we compare transduction efficiencies and expression patterns of reporter genes in two macaque neocortical areas employing different rAAV serotypes and promoters. A short version of the calmodulin-kinase-II (CaMKIIα0.4) promoter resulted in reporter gene expression in cortical neurons for all tested rAAVs, albeit with different efficiencies for spread: rAAV2/5>>rAAV2/7>rAAV2/8>rAAV2/9>>rAAV2/1 and proportion of transduced cells: rAAV2/1>rAAV2/5>rAAV2/7=rAAV2/9>rAAV2/8. In contrast to rodent studies, the cytomegalovirus (CMV) promoter appeared least efficient in macaque cortex. The human synapsin-1 promoter preceded by the CMV enhancer (enhSyn1) produced homogeneous reporter gene expression across all layers, while two variants of the CaMKIIα promoter resulted in different laminar transduction patterns and cell specificities. Finally, differences in expression patterns were observed when the same viral vector was injected in two neocortical areas. Our results corroborate previous findings that reporter-gene expression patterns and efficiency of rAAV transduction depend on serotype, promoter, cortical layer, and area. PMID:26839901

  15. Effects of natural mineral-rich water consumption on the expression of sirtuin 1 and angiogenic factors in the erectile tissue of rats with fructose-induced metabolic syndrome

    PubMed Central

    Pereira, Cidália D; Severo, Milton; Rafael, Luísa; Martins, Maria João; Neves, Delminda

    2014-01-01

    Consuming a high-fructose diet induces metabolic syndrome (MS)-like features, including endothelial dysfunction. Erectile dysfunction is an early manifestation of endothelial dysfunction and systemic vascular disease. Because mineral deficiency intensifies the deleterious effects of fructose consumption and mineral ingestion is protective against MS, we aimed to characterize the effects of 8 weeks of natural mineral-rich water consumption on the structural organization and expression of vascular growth factors and receptors on the corpus cavernosum (CC) in 10% fructose-fed Sprague-Dawley rats (FRUCT). Differences were not observed in the organization of the CC either on the expression of vascular endothelial growth factor (VEGF) or the components of the angiopoietins/Tie2 system. However, opposing expression patterns were observed for VEGF receptors (an increase and a decrease for VEGFR1 and VEGFR2, respectively) in FRUCT animals, with these patterns being strengthened by mineral-rich water ingestion. Mineral-rich water ingestion (FRUCTMIN) increased the proportion of smooth muscle cells compared with FRUCT rats and induced an upregulatory tendency of sirtuin 1 expression compared with the control and FRUCT groups. Western blot results were consistent with the dual immunofluorescence evaluation. Plasma oxidized low-density lipoprotein and plasma testosterone levels were similar among the experimental groups, although a tendency for an increase in the former was observed in the FRUCTMIN group. The mineral-rich water-treated rats presented changes similar to those observed in rats treated with MS-protective polyphenol-rich beverages or subjected to energy restriction, which led us to hypothesize that the effects of mineral-rich water consumption may be more vast than those directly observed in this study. PMID:24625878

  16. Expression Profile of Cytokines and Enzymes mRNA in Blood Leukocytes of Dogs with Leptospirosis and Its Associated Pulmonary Hemorrhage Syndrome.

    PubMed

    Maissen-Villiger, Carla A; Schweighauser, Ariane; van Dorland, H Anette; Morel, Claudine; Bruckmaier, Rupert M; Zurbriggen, Andreas; Francey, Thierry

    2016-01-01

    Dogs with leptospirosis show similar organ manifestations and disease course as human patients, including acute kidney injury and pulmonary hemorrhage, making this naturally-occurring infection a good animal model for human leptospirosis. Expression patterns of cytokines and enzymes have been correlated with disease manifestations and clinical outcome in humans and animals. The aim of this study was to describe mRNA expression of pro- and anti-inflammatory mediators in canine leptospirosis and to compare it with other renal diseases to identify patterns characterizing the disease and especially its pulmonary form. The mRNA abundance of cytokines (IL-1α, IL-1β, IL-8, IL-10, TNF-α, TGF-β) and enzymes (5-LO, iNOS) was measured prospectively in blood leukocytes from 34 dogs with severe leptospirosis and acute kidney injury, including 22 dogs with leptospirosis-associated pulmonary hemorrhages. Dogs with leptospirosis were compared to 14 dogs with acute kidney injury of other origin than leptospirosis, 8 dogs with chronic kidney disease, and 10 healthy control dogs. Canine leptospirosis was characterized by high 5-LO and low TNF-α expression compared to other causes of acute kidney injury, although the decreased TNF-α expression was also seen in chronic kidney disease. Leptospirosis-associated pulmonary hemorrhage was not characterized by a specific pattern, with only mild changes noted, including increased IL-10 and decreased 5-LO expression on some days in affected dogs. Fatal outcome from pulmonary hemorrhages was associated with low TNF-α, high IL-1β, and high iNOS expression, a pattern possibly expressed also in dogs with other forms of acute kidney injury. The patterns of cytokine and enzyme expression observed in the present study indicate a complex pro- and anti-inflammatory response to the infection with leptospires. The recognition of these signatures may be of diagnostic and prognostic relevance for affected individuals and they may indicate options for newer therapies targeting the identified pathways.

  17. Morphological diversity of the avian foot is related with the pattern of msx gene expression in the developing autopod.

    PubMed

    Gañan, Y; Macias, D; Basco, R D; Merino, R; Hurle, J M

    1998-04-01

    The formation of the digits in amniota embryos is accompanied by apoptotic cell death of the interdigital mesoderm triggered through BMP signaling. Differences in the intensity of this apoptotic process account for the establishment of the different morphological types of feet observed in amniota (i.e., free-digits, webbed digits, lobulated digits). The molecular basis accounting for the differential pattern of interdigital cell death remains uncertain since the reduction of cell death in species with webbed digits is not accompanied by a parallel reduction in the pattern of expression of bmp genes in the interdigital regions. In this study we show that the duck interdigital web mesoderm exhibits an attenuated response to both BMP-induced apoptosis and TGFbeta-induced chondrogenesis in comparison with species with free digits. The attenuated response to these signals is accompanied by a reduced pattern of expression of msx-1 and msx-2 genes. Local application of FGF in the duck interdigit expands the domain of msx-2 expression but not the domain of msx-1 expression. This change in the expression of msx-2 is followed by a parallel increase in spontaneous and exogenous BMP-induced interdigital cell death, while the chondrogenic response to TGFbetas is unchanged. The regression of AER, as deduced by the pattern of extinction of fgf-8 expression, takes place in a similar fashion in the chick and duck regardless of the differences in interdigital cell death and msx gene expression. Implantation of BMP-beads in the distal limb mesoderm induces AER regression in both the chick and duck. This finding suggests an additional role for BMPs in the physiological regression of the AER. It is proposed that the formation of webbed vs free-digit feet in amniota results from a premature differentiation of the interdigital mesoderm into connective tissue caused by a reduced expression of msx genes in the developing autopod. Copyright 1998 Academic Press.

  18. Cell-specific expression of tryptophan decarboxylase and 10-hydroxygeraniol oxidoreductase, key genes involved in camptothecin biosynthesis in Camptotheca acuminata Decne (Nyssaceae)

    PubMed Central

    2010-01-01

    Background Camptotheca acuminata is a major natural source of the terpenoid indole alkaloid camptothecin (CPT). At present, little is known about the cellular distribution of the biosynthesis of CPT, which would be useful knowledge for developing new strategies and technologies for improving alkaloid production. Results The pattern of CPT accumulation was compared with the expression pattern of some genes involved in CPT biosynthesis in C. acuminata [i.e., Ca-TDC1 and Ca-TDC2 (encoding for tryptophan decarboxylase) and Ca-HGO (encoding for 10-hydroxygeraniol oxidoreductase)]. Both CPT accumulation and gene expression were investigated in plants at different degrees of development and in plantlets subjected to drought-stress. In all organs, CPT accumulation was detected in epidermal idioblasts, in some glandular trichomes, and in groups of idioblast cells localized in parenchyma tissues. Drought-stress caused an increase in CPT accumulation and in the number of glandular trichomes containing CPT, whereas no increase in epidermal or parenchymatous idioblasts was observed. In the leaf, Ca-TDC1 expression was detected in some epidermal cells and in groups of mesophyll cells but not in glandular trichomes; in the stem, it was observed in parenchyma cells of the vascular tissue; in the root, no expression was detected. Ca-TDC2 expression was observed exclusively in leaves of plantlets subjected to drought-stress, in the same sites described for Ca-TDC1. In the leaf, Ca-HGO was detected in all chlorenchyma cells; in the stem, it was observed in the same sites described for Ca-TDC1; in the root, no expression was detected. Conclusions The finding that the sites of CPT accumulation are not consistently the same as those in which the studied genes are expressed demonstrates an organ-to-organ and cell-to-cell translocation of CPT or its precursors. PMID:20403175

  19. Cell-specific expression of tryptophan decarboxylase and 10-hydroxygeraniol oxidoreductase, key genes involved in camptothecin biosynthesis in Camptotheca acuminata Decne (Nyssaceae).

    PubMed

    Valletta, Alessio; Trainotti, Livio; Santamaria, Anna Rita; Pasqua, Gabriella

    2010-04-19

    Camptotheca acuminata is a major natural source of the terpenoid indole alkaloid camptothecin (CPT). At present, little is known about the cellular distribution of the biosynthesis of CPT, which would be useful knowledge for developing new strategies and technologies for improving alkaloid production. The pattern of CPT accumulation was compared with the expression pattern of some genes involved in CPT biosynthesis in C. acuminata [i.e., Ca-TDC1 and Ca-TDC2 (encoding for tryptophan decarboxylase) and Ca-HGO (encoding for 10-hydroxygeraniol oxidoreductase)]. Both CPT accumulation and gene expression were investigated in plants at different degrees of development and in plantlets subjected to drought-stress. In all organs, CPT accumulation was detected in epidermal idioblasts, in some glandular trichomes, and in groups of idioblast cells localized in parenchyma tissues. Drought-stress caused an increase in CPT accumulation and in the number of glandular trichomes containing CPT, whereas no increase in epidermal or parenchymatous idioblasts was observed. In the leaf, Ca-TDC1 expression was detected in some epidermal cells and in groups of mesophyll cells but not in glandular trichomes; in the stem, it was observed in parenchyma cells of the vascular tissue; in the root, no expression was detected. Ca-TDC2 expression was observed exclusively in leaves of plantlets subjected to drought-stress, in the same sites described for Ca-TDC1. In the leaf, Ca-HGO was detected in all chlorenchyma cells; in the stem, it was observed in the same sites described for Ca-TDC1; in the root, no expression was detected. The finding that the sites of CPT accumulation are not consistently the same as those in which the studied genes are expressed demonstrates an organ-to-organ and cell-to-cell translocation of CPT or its precursors.

  20. Hippocampus and Medial Prefrontal Cortex Contributions to Trace and Contextual Fear Memory Expression over Time

    ERIC Educational Resources Information Center

    Beeman, Christopher L.; Bauer, Philip S.; Pierson, Jamie L.; Quinn, Jennifer J.

    2013-01-01

    Previous work has shown that damage to the dorsal hippocampus (DH) occurring at recent, but not remote, timepoints following acquisition produces a deficit in trace conditioned fear memory expression. The opposite pattern has been observed with lesions to the medial prefrontal cortex (mPFC). The present studies address: (1) whether these lesion…

  1. DNA-Demethylase Regulated Genes Show Methylation-Independent Spatiotemporal Expression Patterns

    PubMed Central

    Schumann, Ulrike; Lee, Joanne; Kazan, Kemal; Ayliffe, Michael; Wang, Ming-Bo

    2017-01-01

    Recent research has indicated that a subset of defense-related genes is downregulated in the Arabidopsis DNA demethylase triple mutant rdd (ros1 dml2 dml3) resulting in increased susceptibility to the fungal pathogen Fusarium oxysporum. In rdd plants these downregulated genes contain hypermethylated transposable element sequences (TE) in their promoters, suggesting that this methylation represses gene expression in the mutant and that these sequences are actively demethylated in wild-type plants to maintain gene expression. In this study, the tissue-specific and pathogen-inducible expression patterns of rdd-downregulated genes were investigated and the individual role of ROS1, DML2, and DML3 demethylases in these spatiotemporal regulation patterns was determined. Large differences in defense gene expression were observed between pathogen-infected and uninfected tissues and between root and shoot tissues in both WT and rdd plants, however, only subtle changes in promoter TE methylation patterns occurred. Therefore, while TE hypermethylation caused decreased gene expression in rdd plants it did not dramatically effect spatiotemporal gene regulation, suggesting that this latter regulation is largely methylation independent. Analysis of ros1-3, dml2-1, and dml3-1 single gene mutant lines showed that promoter TE hypermethylation and defense-related gene repression was predominantly, but not exclusively, due to loss of ROS1 activity. These data demonstrate that DNA demethylation of TE sequences, largely by ROS1, promotes defense-related gene expression but does not control spatiotemporal expression in Arabidopsis. Summary: Ros1-mediated DNA demethylation of promoter transposable elements is essential for activation of defense-related gene expression in response to fungal infection in Arabidopsis thaliana. PMID:28894455

  2. Patterns of expression of position-dependent integrated transgenes in mouse embryo.

    PubMed Central

    Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F

    1990-01-01

    The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727

  3. Profile of new green fluorescent protein transgenic Jinhua pigs as an imaging source

    NASA Astrophysics Data System (ADS)

    Kawarasaki, Tatsuo; Uchiyama, Kazuhiko; Hirao, Atsushi; Azuma, Sadahiro; Otake, Masayoshi; Shibata, Masatoshi; Tsuchiya, Seiko; Enosawa, Shin; Takeuchi, Koichi; Konno, Kenjiro; Hakamata, Yoji; Yoshino, Hiroyuki; Wakai, Takuya; Ookawara, Shigeo; Tanaka, Hozumi; Kobayashi, Eiji; Murakami, Takashi

    2009-09-01

    Animal imaging sources have become an indispensable material for biological sciences. Specifically, gene-encoded biological probes serve as stable and high-performance tools to visualize cellular fate in living animals. We use a somatic cell cloning technique to create new green fluorescent protein (GFP)-expressing Jinhua pigs with a miniature body size, and characterized the expression profile in various tissues/organs and ex vivo culture conditions. The born GFP-transgenic pig demonstrate an organ/tissue-dependent expression pattern. Strong GFP expression is observed in the skeletal muscle, pancreas, heart, and kidney. Regarding cellular levels, bone-marrow-derived mesenchymal stromal cells, hepatocytes, and islet cells of the pancreas also show sufficient expression with the unique pattern. Moreover, the cloned pigs demonstrate normal growth and fertility, and the introduced GFP gene is stably transmitted to pigs in subsequent generations. The new GFP-expressing Jinhua pigs may be used as new cellular/tissue light resources for biological imaging in preclinical research fields such as tissue engineering, experimental regenerative medicine, and transplantation.

  4. The pivotal role of aristaless in development and evolution of diverse antennal morphologies in moths and butterflies.

    PubMed

    Ando, Toshiya; Fujiwara, Haruhiko; Kojima, Tetsuya

    2018-01-25

    Antennae are multi-segmented appendages and main odor-sensing organs in insects. In Lepidoptera (moths and butterflies), antennal morphologies have diversified according to their ecological requirements. While diurnal butterflies have simple, rod-shaped antennae, nocturnal moths have antennae with protrusions or lateral branches on each antennal segment for high-sensitive pheromone detection. A previous study on the Bombyx mori (silk moth) antenna, forming two lateral branches per segment, during metamorphosis has revealed the dramatic change in expression of antennal patterning genes to segmentally reiterated, branch-associated pattern and abundant proliferation of cells contributing almost all the dorsal half of the lateral branch. Thus, localized cell proliferation possibly controlled by the branch-associated expression of antennal patterning genes is implicated in lateral branch formation. Yet, actual gene function in lateral branch formation in Bombyx mori and evolutionary mechanism of various antennal morphologies in Lepidoptera remain elusive. We investigated the function of several genes and signaling specifically in lateral branch formation in Bombyx mori by the electroporation-mediated incorporation of siRNAs or morpholino oligomers. Knock down of aristaless, a homeobox gene expressed specifically in the region of abundant cell proliferation within each antennal segment, during metamorphosis resulted in missing or substantial shortening of lateral branches, indicating its importance for lateral branch formation. aristaless expression during metamorphosis was lost by knock down of Distal-less and WNT signaling but derepressed by knock down of Notch signaling, suggesting the strict determination of the aristaless expression domain within each antennal segment by the combinatorial action of them. In addition, analyses of pupal aristaless expression in antennae with various morphologies of several lepidopteran species revealed that the aristaless expression pattern has a striking correlation with antennal shapes, whereas the segmentally reiterated expression pattern was observed irrespective of antennal morphologies. Our results presented here indicate the significance of aristaless function in lateral branch formation in B. mori and imply that the diversification in the aristaless expression pattern within each antennal segment during metamorphosis is one of the significant determinants of antennal morphologies. According to these findings, we propose a mechanism underlying development and evolution of lepidopteran antennae with various morphologies.

  5. Introduction of the human AVPR1A gene substantially alters brain receptor expression patterns and enhances aspects of social behavior in transgenic mice

    PubMed Central

    Charles, Rhonda; Sakurai, Takeshi; Takahashi, Nagahide; Elder, Gregory A.; Gama Sosa, Miguel A.; Young, Larry J.; Buxbaum, Joseph D.

    2014-01-01

    Central arginine vasopressin receptor 1A (AVPR1A) modulates a wide range of behaviors, including stress management and territorial aggression, as well as social bonding and recognition. Inter- and intra-species variations in the expression pattern of AVPR1A in the brain and downstream differential behavioral phenotypes have been attributed to differences in the non-coding regions of the AVPR1A gene, including polymorphic elements within upstream regulatory areas. Gene association studies have suggested a link between AVPR1A polymorphisms and autism, and AVPR1A has emerged as a potential pharmacological target for treatment of social cognitive impairments and mood and anxiety disorders. To further investigate the genetic mechanism giving rise to species differences in AVPR1A expression patterns and associated social behaviors, and to create a preclinical mouse model useful for screening drugs targeting AVPR1A, we engineered and extensively characterized bacterial artificial chromosome (BAC) transgenic mice harboring the entire human AVPR1A locus with the surrounding regulatory elements. Compared with wild-type animals, the humanized mice displayed a more widely distributed ligand-AVPR1A binding pattern, which overlapped with that of primates. Furthermore, humanized AVPR1A mice displayed increased reciprocal social interactions compared with wild-type animals, but no differences in social approach and preference for social novelty were observed. Aspects of learning and memory, specifically novel object recognition and spatial relocation recognition, were unaffected. The biological alterations in humanized AVPR1A mice resulted in the rescue of the prepulse inhibition impairments that were observed in knockout mice, indicating conserved functionality. Although further behavioral paradigms and additional cohorts need to be examined in humanized AVPR1A mice, the results demonstrate that species-specific variations in the genomic content of regulatory regions surrounding the AVPR1A locus are responsible for differential receptor protein expression patterns across species and that they are likely to contribute to species-specific behavioral variation. The humanized AVPR1A mouse is a potential preclinical model for further understanding the regulation of receptor gene expression and the impact of variation in receptor expression on behaviors, and should be useful for screening drugs targeting human AVPR1A, taking advantage of the expression of human AVPR1A in human-relevant brain regions. PMID:24924430

  6. Altered temporal patterns of anxiety in aged and amyloid precursor protein (APP) transgenic mice.

    PubMed

    Bedrosian, Tracy A; Herring, Kamillya L; Weil, Zachary M; Nelson, Randy J

    2011-07-12

    Both normal aging and dementia are associated with dysregulation of the biological clock, which contributes to disrupted circadian organization of physiology and behavior. Diminished circadian organization in conjunction with the loss of cholinergic input to the cortex likely contributes to impaired cognition and behavior. One especially notable and relatively common circadian disturbance among the aged is "sundowning syndrome," which is characterized by exacerbated anxiety, agitation, locomotor activity, and delirium during the hours before bedtime. Sundowning has been reported in both dementia patients and cognitively intact elderly individuals living in institutions; however, little is known about temporal patterns in anxiety and agitation, and the neurobiological basis of these rhythms remains unspecified. In the present study, we explored the diurnal pattern of anxiety-like behavior in aged and amyloid precursor protein (APP) transgenic mice. We then attempted to treat the observed behavioral disturbances in the aged mice using chronic nightly melatonin treatment. Finally, we tested the hypothesis that time-of-day differences in acetylcholinesterase and choline acetyltransferase expression and general neuronal activation (i.e., c-Fos expression) coincide with the behavioral symptoms. Our results show a temporal pattern of anxiety-like behavior that emerges in elderly mice. This behavioral pattern coincides with elevated locomotor activity relative to adult mice near the end of the dark phase, and with time-dependent changes in basal forebrain acetylcholinesterase expression. Transgenic APP mice show a similar behavioral phenomenon that is not observed among age-matched wild-type mice. These results may have useful applications to the study and treatment of age- and dementia-related circadian behavioral disturbances, namely, sundowning syndrome.

  7. Divergence between motoneurons: gene expression profiling provides a molecular characterization of functionally discrete somatic and autonomic motoneurons

    PubMed Central

    Cui, Dapeng; Dougherty, Kimberly J.; Machacek, David W.; Sawchuk, Michael; Hochman, Shawn; Baro, Deborah J.

    2009-01-01

    Studies in the developing spinal cord suggest that different motoneuron (MN) cell types express very different genetic programs, but the degree to which adult programs differ is unknown. To compare genetic programs between adult MN columnar cell types, we used laser capture micro-dissection (LCM) and Affymetrix microarrays to create expression profiles for three columnar cell types: lateral and medial MNs from lumbar segments and sympathetic preganglionic motoneurons located in the thoracic intermediolateral nucleus. A comparison of the three expression profiles indicated that ~7% (813/11,552) of the genes showed significant differences in their expression levels. The largest differences were observed between sympathetic preganglionic MNs and the lateral motor column, with 6% (706/11,552) of the genes being differentially expressed. Significant differences in expression were observed for 1.8% (207/11,552) of the genes when comparing sympathetic preganglionic MNs with the medial motor column. Lateral and medial MNs showed the least divergence, with 1.3% (150/11,552) of the genes being differentially expressed. These data indicate that the amount of divergence in expression profiles between identified columnar MNs does not strictly correlate with divergence of function as defined by innervation patterns (somatic/muscle vs. autonomic/viscera). Classification of the differentially expressed genes with regard to function showed that they underpin all fundamental cell systems and processes, although most differentially expressed genes encode proteins involved in signal transduction. Mining the expression profiles to examine transcription factors essential for MN development suggested that many of the same transcription factors participatein combinatorial codes in embryonic and adult neurons, but patterns of expression change significantly. PMID:16317082

  8. Immunohistochemical analysis of tenascin expression in different grades of oral submucous fibrosis.

    PubMed

    Tak, Jalaj; Rao, Nirmala N; Chandra, Akhilesh; Gupta, Neha

    2015-01-01

    Tenascin, a glycoprotein, is one of the major constituents of extracellular matrix, which may function in organizing the stroma in normal and pathological conditions. The study aimed to correlate the structural organization of tenascin with the pathological progression of disease from early, moderate and advanced changes in oral submucous fibrosis (OSMF). A retrospective cross-sectional immunohistochemical (IHC) analysis of OSMF cases was performed. Total 70 slide samples were prepared for the study from 35 formalin-fixed paraffin-embedded tissue blocks with 10 each from histologically proven and graded as early, moderate and advanced OSMF and 5 of normal oral mucosa. The IHC sections were analyzed for the intensity and pattern of tenascin expression at the junction of epithelium and connective tissue (ECJ) and deeper connective tissue (CT), as well as presence or absence of staining around inflammatory cells, fibroblast and endothelial cells using anti-human tenascin. Most of the OSMF cases showed retention of antigen at ECJ and in deeper CT. Its expression varied in different grades as well as around inflammatory cells, fibroblast and endothelial cells in same tissue section. Highly significant P values of 0.001 and 0.003 were obtained for tenascin intensity and pattern, respectively, at ECJ in different OSMF grades. In addition, for the expression of tenascin pattern in deeper CT among different OSMF grades, a significant P value of 0.018 was obtained. A differential expression of tenascin was observed with the progression of disease. The expression of tenascin as bright and continuous deposition at ECJ in early and moderate stages of OSMF signifies either proliferative organization within the overlying epithelium or an epithelial-mesenchymal interaction. However, a weak immunoreactivity of tenascin at ECJ was observed in advanced stage of OSMF.

  9. Immunohistochemical analysis of tenascin expression in different grades of oral submucous fibrosis

    PubMed Central

    Tak, Jalaj; Rao, Nirmala N; Chandra, Akhilesh; Gupta, Neha

    2015-01-01

    Aim: Tenascin, a glycoprotein, is one of the major constituents of extracellular matrix, which may function in organizing the stroma in normal and pathological conditions. The study aimed to correlate the structural organization of tenascin with the pathological progression of disease from early, moderate and advanced changes in oral submucous fibrosis (OSMF). Study Design: A retrospective cross-sectional immunohistochemical (IHC) analysis of OSMF cases was performed. Total 70 slide samples were prepared for the study from 35 formalin-fixed paraffin-embedded tissue blocks with 10 each from histologically proven and graded as early, moderate and advanced OSMF and 5 of normal oral mucosa. The IHC sections were analyzed for the intensity and pattern of tenascin expression at the junction of epithelium and connective tissue (ECJ) and deeper connective tissue (CT), as well as presence or absence of staining around inflammatory cells, fibroblast and endothelial cells using anti-human tenascin. Result: Most of the OSMF cases showed retention of antigen at ECJ and in deeper CT. Its expression varied in different grades as well as around inflammatory cells, fibroblast and endothelial cells in same tissue section. Highly significant P values of 0.001 and 0.003 were obtained for tenascin intensity and pattern, respectively, at ECJ in different OSMF grades. In addition, for the expression of tenascin pattern in deeper CT among different OSMF grades, a significant P value of 0.018 was obtained. Conclusion: A differential expression of tenascin was observed with the progression of disease. The expression of tenascin as bright and continuous deposition at ECJ in early and moderate stages of OSMF signifies either proliferative organization within the overlying epithelium or an epithelial-mesenchymal interaction. However, a weak immunoreactivity of tenascin at ECJ was observed in advanced stage of OSMF. PMID:26980955

  10. The impact of IL28B genotype on the gene expression profile of patients with chronic hepatitis C treated with pegylated interferon alpha and ribavirin

    PubMed Central

    2012-01-01

    Background Recent studies of CH-C patients have demonstrated a strong association between IL28B CC genotype and sustained virologic response (SVR) after PEG-IFN/RBV treatment. We aimed to assess whether IL28B alleles rs12979860 genotype influences gene expression in response to PEG-IFN/RBV in CH-C patients. Methods Clinical data and gene expression data were available for 56 patients treated with PEG-IFN/RBV. Whole blood was used to determine IL28B genotypes. Differential expression of 153 human genes was assessed for each treatment time point (Days: 0, 1, 7, 28, 56) and was correlated with IL28B genotype (IL28B C/C or non-C/C) over the course of the PEG-IFN/RBV treatment. Genes with statistically significant changes in their expression at each time point were used as an input for pathway analysis using KEGG Pathway Painter (KPP). Pathways were ranked based on number of gene involved separately per each study cohort. Results The most striking difference between the response patterns of patients with IL28B C/C and T* genotypes during treatment, across all pathways, is a sustained pattern of treatment-induced gene expression in patients carrying IL28B C/C. In the case of IL28B T* genotype, pre-activation of genes, the lack of sustained pattern of gene expression or a combination of both were observed. This observation could potentially provide an explanation for the lower rate of SVR observed in these patients. Additionally, when the lists of IL28B genotype-specific genes which were differentially expressed in patients without SVR were compared at their baseline, IRF2 and SOCS1 genes were down-regulated regardless of patients' IL28B genotype. Furthermore, our data suggest that CH-C patients who do not have the SOCS1 gene silenced have a better chance of achieving SVR. Our observations suggest that the action of SOCS1 is independent of IL28B genotype. Conclusions IL28B CC genotype patients with CH-C show a sustained treatment-induced gene expression profile which is not seen in non-CC genotype patients. Silencing of SOCS1 is a negative and independent predictor of SVR. These data may provide some mechanistic explanation for higher rate of SVR in IL28B CC patients who are treated with PEG-IFN/RBV. PMID:22313623

  11. The impact of IL28B genotype on the gene expression profile of patients with chronic hepatitis C treated with pegylated interferon alpha and ribavirin.

    PubMed

    Younossi, Zobair M; Birerdinc, Aybike; Estep, Mike; Stepanova, Maria; Afendy, Arian; Baranova, Ancha

    2012-02-07

    Recent studies of CH-C patients have demonstrated a strong association between IL28B CC genotype and sustained virologic response (SVR) after PEG-IFN/RBV treatment. We aimed to assess whether IL28B alleles rs12979860 genotype influences gene expression in response to PEG-IFN/RBV in CH-C patients. Clinical data and gene expression data were available for 56 patients treated with PEG-IFN/RBV. Whole blood was used to determine IL28B genotypes. Differential expression of 153 human genes was assessed for each treatment time point (Days: 0, 1, 7, 28, 56) and was correlated with IL28B genotype (IL28B C/C or non-C/C) over the course of the PEG-IFN/RBV treatment. Genes with statistically significant changes in their expression at each time point were used as an input for pathway analysis using KEGG Pathway Painter (KPP). Pathways were ranked based on number of gene involved separately per each study cohort. The most striking difference between the response patterns of patients with IL28B C/C and T* genotypes during treatment, across all pathways, is a sustained pattern of treatment-induced gene expression in patients carrying IL28B C/C. In the case of IL28B T* genotype, pre-activation of genes, the lack of sustained pattern of gene expression or a combination of both were observed. This observation could potentially provide an explanation for the lower rate of SVR observed in these patients. Additionally, when the lists of IL28B genotype-specific genes which were differentially expressed in patients without SVR were compared at their baseline, IRF2 and SOCS1 genes were down-regulated regardless of patients' IL28B genotype. Furthermore, our data suggest that CH-C patients who do not have the SOCS1 gene silenced have a better chance of achieving SVR. Our observations suggest that the action of SOCS1 is independent of IL28B genotype. IL28B CC genotype patients with CH-C show a sustained treatment-induced gene expression profile which is not seen in non-CC genotype patients. Silencing of SOCS1 is a negative and independent predictor of SVR. These data may provide some mechanistic explanation for higher rate of SVR in IL28B CC patients who are treated with PEG-IFN/RBV.

  12. KIT gene mutations and patterns of protein expression in mucosal and acral melanoma.

    PubMed

    Abu-Abed, Suzan; Pennell, Nancy; Petrella, Teresa; Wright, Frances; Seth, Arun; Hanna, Wedad

    2012-01-01

    Recently characterized KIT (CD117) gene mutations have revealed new pathways involved in melanoma pathogenesis. In particular, certain subtypes harbor mutations similar to those observed in gastrointestinal stromal tumors, which are sensitive to treatment with tyrosine kinase inhibitors. The purpose of this study was to characterize KIT gene mutations and patterns of protein expression in mucosal and acral melanoma. Formalin-fixed, paraffin-embedded tissues were retrieved from our archives. Histologic assessment included routine hematoxylin-eosin stains and immunohistochemical staining for KIT. Genomic DNA was used for polymerase chain reaction-based amplification of exons 11 and 13. We identified 59 acral and mucosal melanoma cases, of which 78% showed variable levels of KIT expression. Sequencing of exons 11 and 13 was completed on all cases, and 4 (6.8%) mutant cases were isolated. We successfully optimized conditions for the detection of KIT mutations and showed that 8.6% of mucosal and 4.2% of acral melanoma cases at our institution harbor KIT mutations; all mutant cases showed strong, diffuse KIT protein expression. Our case series represents the first Canadian study to characterize KIT gene mutations and patterns of protein expression in acral and mucosal melanoma.

  13. The conservation of Javanese-cultured city through visual expression study on the architecture of Keraton Yogyakarta

    NASA Astrophysics Data System (ADS)

    Tohar, Ibrahim; Hardiman, Gagoek; Ratih Sari, Suzanna

    2017-12-01

    Keraton Yogyakarta as a summit of Javanese culture has been renowned as a heritage building. As object of study, Keraton Yogyakarta is ornamented with a collection of architectural artifacts. The acculturation and merging of these different styles create a unique impression within the palace complex. This study aims to identify the pattern of acculturation of these two styles and to interpret their meaning and expression. A descriptive-qualitative method is employed in this research, which contains visual observation, documentation collection, interviews with informants, and relevant literature review. As results of study, the expression of Tratag Pagelaran, Tratag Sitihinggil, Bangsal Ponconiti, and Gedong Jene tends to widen, while the expression of Gedong Purwaretna tends to uprise. Every building has its own point of interest and ornamentation which its place and content are different.. In visual observations, there are two categories of buildings in Keraton Yogyakarta,which accommodate two styles, namely Javanese Traditional style and Dutch Colonial style. Buildings of Javanese traditional style, which hold a special concept of shading, were built without buttresses and embody a ‘light’ expression, while buildings of Dutch Colonial style, which hold a concept of protection, were built with massive enclosure and produce a “heavy” expression. Although visually split into two distinct styles, the acculturation process in Keraton Yogyakarta produced a unity in its overall expression. The expression pattern of Keraton Yogyakarta can be used as conservation guidance of Javanese-cultured city.

  14. Regulatory Divergence between Parental Alleles Determines Gene Expression Patterns in Hybrids

    PubMed Central

    Combes, Marie-Christine; Hueber, Yann; Dereeper, Alexis; Rialle, Stéphanie; Herrera, Juan-Carlos; Lashermes, Philippe

    2015-01-01

    Both hybridization and allopolyploidization generate novel phenotypes by conciliating divergent genomes and regulatory networks in the same cellular context. To understand the rewiring of gene expression in hybrids, the total expression of 21,025 genes and the allele-specific expression of over 11,000 genes were quantified in interspecific hybrids and their parental species, Coffea canephora and Coffea eugenioides using RNA-seq technology. Between parental species, cis- and trans-regulatory divergences affected around 32% and 35% of analyzed genes, respectively, with nearly 17% of them showing both. The relative importance of trans-regulatory divergences between both species could be related to their low genetic divergence and perennial habit. In hybrids, among divergently expressed genes between parental species and hybrids, 77% was expressed like one parent (expression level dominance), including 65% like C. eugenioides. Gene expression was shown to result from the expression of both alleles affected by intertwined parental trans-regulatory factors. A strong impact of C. eugenioides trans-regulatory factors on the upregulation of C. canephora alleles was revealed. The gene expression patterns appeared determined by complex combinations of cis- and trans-regulatory divergences. In particular, the observed biased expression level dominance seemed to be derived from the asymmetric effects of trans-regulatory parental factors on regulation of alleles. More generally, this study illustrates the effects of divergent trans-regulatory parental factors on the gene expression pattern in hybrids. The characteristics of the transcriptional response to hybridization appear to be determined by the compatibility of gene regulatory networks and therefore depend on genetic divergences between the parental species and their evolutionary history. PMID:25819221

  15. Cloning and pattern of expression of the shiro-uo vasa gene during embryogenesis and its roles in PGC development.

    PubMed

    Miyake, Akimitsu; Saito, Taiju; Kashiwagi, Noboru; Ando, Daisuke; Yamamoto, Akitsugu; Suzuki, Tohru; Nakatsuji, Norio; Nakatsuji, Takako

    2006-01-01

    The vasa genes are expressed in the germ cell lineage in many organisms, but their expression patterns show large variations. Recent studies suggest that vasa transcripts are involved in germ cell lineage development. In this paper, we isolated the vasa cDNA clone from a teleost, shiro-uo, Leucopsarion petersii and examined its expression pattern during embryogenesis. Then, we examined the functional significance of vasa mRNA during the formation of primordial germ cells (PGCs). The amino acid sequence of shiro-uo VASA is 61.1% identical to that of zebrafish. In whole-mount in situ hybridization, vasa transcripts appeared at the 4- and 8-cell stages as four spots at both ends of two cleavage planes between the lower tier of blastomeres and the yolk cell mass. At the 16-cell stage, eight spots were observed. After the blastula stage, shiro-uo vasa transcripts showed similar localization as in the zebrafish. Ultrastructural analysis of 4-cell stage embryos revealed the presence of a subcellular organelle that resembled 'nuage' in the germ cell lineage observed in the embryos of various organisms. We carried out micromanipulation of 4- or 8-cell stage embryos to remove the vasa mRNA-containing spots and then measured the number of the vasa-expressing PGCs in the genital ridge of the manipulated embryos. The numbers decreased when all of the four spots were removed, indicating that the vasa-containing spots at early cleavage stages have important functions in the development of PGCs.

  16. Evidence for the temporal regulation of insect segmentation by a conserved sequence of transcription factors

    PubMed Central

    2018-01-01

    ABSTRACT Long-germ insects, such as the fruit fly Drosophila melanogaster, pattern their segments simultaneously, whereas short-germ insects, such as the beetle Tribolium castaneum, pattern their segments sequentially, from anterior to posterior. Although the two modes of segmentation at first appear quite distinct, much of this difference might simply reflect developmental heterochrony. We now show here that, in both Drosophila and Tribolium, segment patterning occurs within a common framework of sequential Caudal, Dichaete and Odd-paired expression. In Drosophila, these transcription factors are expressed like simple timers within the blastoderm, whereas in Tribolium they form wavefronts that sweep from anterior to posterior across the germband. In Drosophila, all three are known to regulate pair-rule gene expression and influence the temporal progression of segmentation. We propose that these regulatory roles are conserved in short-germ embryos, and that therefore the changing expression profiles of these genes across insects provide a mechanistic explanation for observed differences in the timing of segmentation. In support of this hypothesis, we demonstrate that Odd-paired is essential for segmentation in Tribolium, contrary to previous reports. PMID:29724758

  17. Analysis of expression patterns of IGF-1, caspase-3 and HSP-70 in developing human tooth germs.

    PubMed

    Kero, Darko; Kalibovic Govorko, Danijela; Medvedec Mikic, Ivana; Vukojevic, Katarina; Cigic, Livia; Saraga-Babic, Mirna

    2015-10-01

    To analyze expression patterns of IGF-1, caspase-3 and HSP-70 in human incisor and canine tooth germs during the late bud, cap and bell stages of odontogenesis. Head areas or parts of jaw containing teeth from 10 human fetuses aged between 9th and 20th developmental weeks were immunohistochemically analyzed using IGF-1, active caspase-3 and HSP-70 markers. Semi-quantitative analysis of each marker's expression pattern was also performed. During the analyzed period, IGF-1 and HSP-70 were mostly expressed in enamel organ. As development progressed, expression of IGF-1 and HSP-70 became more confined to differentiating tissues in the future cusp tip area, as well as in highly proliferating cervical loops. Few apoptotic bodies highly positive to active caspase-3 were observed in enamel organ and dental papilla from the cap stage onward. However, both enamel epithelia moderately expressed active caspase-3 throughout the investigated period. Expression patterns of IGF-1, active caspase-3 and HSP-70 imply importance of these factors for early human tooth development. IGF-1 and HSP-70 have versatile functions in control of proliferation, differentiation and anti-apoptotic protection of epithelial parts of human enamel organ. Active caspase-3 is partially involved in formation and apoptotic removal of primary enamel knot, although present findings might reflect its ability to perform other non-death functions such as differentiation of hard dental tissues secreting cells and guidance of ingrowth of proliferating cervical loops. Copyright © 2015 Elsevier Ltd. All rights reserved.

  18. Expression of the beta-catenin gene in the skin of embryonic geese during feather bud development.

    PubMed

    Wu, W; Xu, R F; Xiao, L; Xu, H; Gao, G

    2008-01-01

    beta-Catenin signaling has been reported to initiate feather bud development. In the present study, beta-catenin gene was isolated and identified from a cDNA library constructed using embryonic goose skin. Expression patterns of beta-catenin gene in the dorsal skin of goose embryos were investigated using the methods of semi-quantitative reverse transcription PCR, Northern blot analysis, and in situ hybridization. The sequence of beta-catenin was found highly conserved at the amino acid level, sharing 100, 99, and 99% identity with chicken, Chinese soft-shell turtle, and human sequences, respectively. Relatively high levels (62.51 +/- 7.11% to 101.74 +/- 7.29%) of beta-catenin mRNA were detected in the dorsal skin samples. The levels of beta-catenin expression were most prominent at the early stage from embryo day (E)10 to E20 and then significantly declined with the embryonic development. In situ hybridization demonstrated that at E10, beta-catenin expression was mainly observed at the surface periderm cells and the localized region of the epidermal layer. Because feather bud forms with an anterior-posterior orientation, strong staining was observed in the periderm layer and in the ectoderm and epidermis with a diffuse distribution within the internal area of the buds. The stronger staining was seen in the barb ridges than in the center pulp of the feather follicles at E18 and E20. In this study, expression of Shh as a marker gene for the bud development was examined paralleling with expression patterns of beta-catenin. It was found that the expression pattern of beta-catenin was almost similar spatially and temporally to that of Shh mRNA at the later stages of bud development. The differential beta-catenin mRNA expression in the goose dorsal skin may be essential for promoting the normal development of embryonic feather bud.

  19. Immunohistochemical characterization of neuroendocrine differentiation of canine anal sac glandular tumours.

    PubMed

    Suzuki, K; Morita, R; Hojo, Y; Nomura, K; Shibutani, M; Mitsumori, K

    2013-01-01

    Histological features and expression of neuroendocrine markers were examined in 69 samples of canine anal sac glandular carcinomas (ASGCs). The tumours were classified into solid, rosette and tubular types and mixtures of these types. Tumour-associated death in dogs with solid tumours and mixed tumours with solid components was higher than in dogs with rosette and tubular type tumours. Chromogranin A immunoreactivity was observed in 28 of 69 samples (40.6%) irrespective of histological type and was localized to the marginal areas of the tumour nest and the basal areas of the tubular and rosette structures. Neuron-specific enolase immunoreactivity in neoplastic epithelial cells was observed in 32 cases (46.4%) and was less frequently observed in the tubular type (14.3%). Synaptophysin expression was present in 15.9% of cases and was least frequent in the tubular type. Twenty-one of the 69 samples expressed more than two neuroendocrine markers and were classified as carcinomas with neuroendocrine differentiation. There was no relationship between neuroendocrine differentiation and clinical outcome. These results suggest that some ASGCs have neuroendocrine differentiation regardless of histological pattern, but clinical outcome is more related to the histological pattern than to neuroendocrine differentiation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Differential Accumulation of Sunflower Tetraubiquitin mRNAs during Zygotic Embryogenesis and Developmental Regulation of Their Heat-Shock Response.

    PubMed Central

    Almoguera, C.; Coca, M. A.; Jordano, J.

    1995-01-01

    We have isolated and sequenced Ha UbiS, a cDNA for a dry-seed-stored mRNA that encodes tetraubiquitin. We have observed differential accumulation of tetraubiquitin mRNAs during sunflower (Helianthus annuus L.) zygotic embryogenesis. These mRNAs were up-regulated during late embryogenesis and reached higher prevalence in the dry seed, where they were found to be associated mainly with provascular tissue. UbiS mRNA, as confirmed by Rnase A protection experiments, accumulated also in response to heat shock, but only in leaves and later during postgerminative development. These novel observations demonstrate expression during seed maturation of specific plant polyubiquitin transcripts and developmental regulation of their heat-shock response. Using ubiquitin antibodies we also detected discrete, seed-specific proteins with distinct temporal expression patterns during zygotic embryogenesis. Some of these patterns were concurrent with UbiS mRNA accumulation in seeds. The most abundant ubiquitin-reacting proteins found in mature seeds were small (16-22 kD) and acidic (isoelectric points of 6.1-7.4). Possible functional implications for UbiS expression elicited from these observations are discussed. PMID:12228401

  1. Self-reported empathy and neural activity during action imitation and observation in schizophrenia

    PubMed Central

    Horan, William P.; Iacoboni, Marco; Cross, Katy A.; Korb, Alex; Lee, Junghee; Nori, Poorang; Quintana, Javier; Wynn, Jonathan K.; Green, Michael F.

    2014-01-01

    Introduction Although social cognitive impairments are key determinants of functional outcome in schizophrenia their neural bases are poorly understood. This study investigated neural activity during imitation and observation of finger movements and facial expressions in schizophrenia, and their correlates with self-reported empathy. Methods 23 schizophrenia outpatients and 23 healthy controls were studied with functional magnetic resonance imaging (fMRI) while they imitated, executed, or simply observed finger movements and facial emotional expressions. Between-group activation differences, as well as relationships between activation and self-reported empathy, were evaluated. Results Both patients and controls similarly activated neural systems previously associated with these tasks. We found no significant between-group differences in task-related activations. There were, however, between-group differences in the correlation between self-reported empathy and right inferior frontal (pars opercularis) activity during observation of facial emotional expressions. As in previous studies, controls demonstrated a positive association between brain activity and empathy scores. In contrast, the pattern in the patient group reflected a negative association between brain activity and empathy. Conclusions Although patients with schizophrenia demonstrated largely normal patterns of neural activation across the finger movement and facial expression tasks, they reported decreased self perceived empathy and failed to show the typical relationship between neural activity and self-reported empathy seen in controls. These findings suggest that patients show a disjunction between automatic neural responses to low level social cues and higher level, integrative social cognitive processes involved in self-perceived empathy. PMID:25009771

  2. Self-reported empathy and neural activity during action imitation and observation in schizophrenia.

    PubMed

    Horan, William P; Iacoboni, Marco; Cross, Katy A; Korb, Alex; Lee, Junghee; Nori, Poorang; Quintana, Javier; Wynn, Jonathan K; Green, Michael F

    2014-01-01

    Although social cognitive impairments are key determinants of functional outcome in schizophrenia their neural bases are poorly understood. This study investigated neural activity during imitation and observation of finger movements and facial expressions in schizophrenia, and their correlates with self-reported empathy. 23 schizophrenia outpatients and 23 healthy controls were studied with functional magnetic resonance imaging (fMRI) while they imitated, executed, or simply observed finger movements and facial emotional expressions. Between-group activation differences, as well as relationships between activation and self-reported empathy, were evaluated. Both patients and controls similarly activated neural systems previously associated with these tasks. We found no significant between-group differences in task-related activations. There were, however, between-group differences in the correlation between self-reported empathy and right inferior frontal (pars opercularis) activity during observation of facial emotional expressions. As in previous studies, controls demonstrated a positive association between brain activity and empathy scores. In contrast, the pattern in the patient group reflected a negative association between brain activity and empathy. Although patients with schizophrenia demonstrated largely normal patterns of neural activation across the finger movement and facial expression tasks, they reported decreased self perceived empathy and failed to show the typical relationship between neural activity and self-reported empathy seen in controls. These findings suggest that patients show a disjunction between automatic neural responses to low level social cues and higher level, integrative social cognitive processes involved in self-perceived empathy.

  3. Methylation and expression patterns of tropomyosin-related kinase genes in different grades of glioma.

    PubMed

    Palani, Mahalakshmi; Arunkumar, R; Vanisree, Arrambakam Janardhanam

    2014-09-01

    Tropomyosin-related kinase family (NTRK1, NTRK2 and NTRK3) is well known to play an important role in the pathogenesis of brain tumour, which exhibit heterogeneity in its biological and clinical behaviour. However, the mechanism that regulates NTRKs in glioma is not well understood. The present study investigates the epigenetic status (methylation) of NTRKs and their expression in different grades of glioma. Promoter methylation and structural relationship of NTRKs was assessed using methylation-specific PCR followed by chromatin immunoprecipitation in brain tissue samples from 220 subjects with different grades of glioma. Control brain samples were also assessed similarly. Reverse transcriptase PCR was performed to analyse the expressions of NTRK mRNAs in the grades of glioma. In addition, the expression level of p75(NTR) protein was analysed using immunofluorescent technique in all of the samples. The overall percentage of NTRK3 gene methylation frequency with subsequent loss of mRNA expression was significantly higher in glioma compared with control samples (p < 0.05). No such significance was observed in other NTRK1 and NTRK2 genes. Further, mRNA expression pattern of NTRK1 and NTRK2 genes was found to be significantly higher in low grades as compared with high grades (HG) and control samples (p < 0.05). Survival rate of HG patients with negative expressions of NTRK1 and NTRK2 was poor than those with the positive expressions of both NTRK1 and NTRK2. Further, a significant correlation was observed with reduced expression of p75(NTR) and the expression pattern of NTRK family in glioma as compared with the control samples (p < 0.05). There exists a correlation between the expression of NTRK family and different grades of glioma with a significant suggestion that the promoter methylation does not play role in the regulation of these genes in glioma. Further, poor survival could be associated with NTRK mRNAs 1 and 2. Hence, NTRKs are potential probes for assessing the behaviour of different grades of glioma, which could also function as significant prognostic factors and thus deserve wider attention for an effective management of the grades.

  4. Expression patterns of tight junction components induced by CD24 in an oral epithelial cell-culture model correlated to affected periodontal tissues.

    PubMed

    Ye, P; Yu, H; Simonian, M; Hunter, N

    2014-04-01

    Previously we demonstrated uniformly strong expression of CD24 in the epithelial attachment to the tooth and in the migrating epithelium of the periodontitis lesion. Titers of serum antibodies autoreactive with CD24 peptide correlated with reduced severity of periodontal disease. Ligation of CD24 expressed by oral epithelial cells induced formation of tight junctions that limited paracellular diffusion. In this study, we aimed to reveal that the lack of uniform expression of tight junction components in the pocket epithelium of periodontitis lesions is likely to contribute to increased paracellular permeability to bacterial products. This is proposed as a potential driver of the immunopathology of periodontitis. An epithelial culture model with close correspondence for expression patterns for tight junction components in periodontal epithelia was used. Immunohistochemical staining and confocal laser scanning microscopy were used to analyse patterns of expression of gingival epithelial tight junction components. The minimally inflamed gingival attachment was characterized by uniformly strong staining at cell contacts for the tight junction components zona occludens-1, zona occludens-2, occludin, junction adhesion molecule-A, claudin-4 and claudin-15. In contrast, the pocket epithelium of the periodontal lesion showed scattered, uneven staining for these components. This pattern correlated closely with that of unstimulated oral epithelial cells in culture. Following ligation of CD24 expressed by these cells, the pattern of tight junction component expression of the minimally inflamed gingival attachment developed rapidly. There was evidence for non-uniform and focal expression only of tight junction components in the pocket epithelium. In the cell-culture model, ligation of CD24 induced a tight junction expression profile equivalent to that observed for the minimally inflamed gingival attachment. Ligation of CD24 expressed by gingival epithelial cells by lectin-like receptors of commensal oral streptococci could mediate the phenotype of health, whereas pathogenic organisms associated with periodontal disease might not signal effectively through CD24. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Influence of cloning by chromatin transfer on placental gene expression at Day 45 of pregnancy in cattle.

    PubMed

    Mesquita, Fernando S; Machado, Sergio A; Drnevich, Jenny; Borowicz, Pawel; Wang, Zhongde; Nowak, Romana A

    2013-01-30

    Poor success rates in somatic cell cloning are often attributed to abnormal early embryonic development as well as late abnormal fetal growth and placental development. Although promising results have been reported following chromatin transfer (CT), a novel cloning method that includes the remodeling of the donor nuclei in vitro prior to their transfer into enucleated oocytes, animals cloned by CT show placental abnormalities similar to those observed following conventional nuclear transfer. We hypothesized that the placental gene expression pattern from cloned fetuses was ontologically related to the frequently observed placental phenotype. The aim of the present study was to compare global gene expression by microarray analysis of Day 44-47 cattle placentas derived from CT cloned fetuses with those derived from in vitro fertilization (i.e. control), and confirm the altered mRNA and protein expression of selected molecules by qRT-PCR and immunohistochemistry, respectively. The differentially expressed genes identified in the present study are known to be involved in a range of activities associated with cell adhesion, cell cycle control, intracellular transport and proteolysis. Specifically, an imprinted gene, involved with cell proliferation and placentomegaly in humans (CDKN1C) and a peptidase that serves as a marker for non-invasive trophoblast cells in human placentas (DPP4), had mRNA and protein altered in CT placentas. It was concluded that the altered pattern of gene expression observed in CT samples may contribute to the abnormal placental development phenotypes commonly identified in cloned offspring, and that expression of imprinted as well as trophoblast invasiveness-related genes is altered in cattle cloned by CT. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. Expression and evolution of Tiki1 and Tiki2 genes in vertebrates

    PubMed Central

    FEISTEL, KERSTIN; BRITO, JOSE M.; AMADO, NATHALIA G.; XU, CHIWEI; ABREU, JOSE G.; HE, XI

    2015-01-01

    Tiki1 is a Wnt protease and antagonist specifically expressed in the Spemann-Mangold Organizer and is required for head formation in Xenopus embryos. Here we report neighbor-joining phylogenetic analysis of vertebrate Tiki genes and their mRNA expression patterns in chick, mouse, and rabbit embryos. Tiki1 and Tiki2 orthologues are highly conserved, and exhibit similar but also different developmental expression patterns among the vertebrate/mammalian species analyzed. The Tiki1 gene is noticeably absent in the rodent lineage, but is present in lagomorphs and all other vertebrate/mammalian species examined. Expression in Hensen’s node, the equivalent of the Xenopus Organizer, was observed for Chick Tiki2 and Rabbit Tiki1 and Tiki2. Mouse Tiki2 was detected at low levels at gastrulation and head fold stages, but not in the node. Mouse Tiki2 and chick Tiki1 display similar expression in the dorsal spinal cord. Chick Tiki1 expression was also detected in the surface ectoderm and maxillary bud, while chick Tiki2 was found in the anterior intestinal portal, head mensenchyme and primitive atrium. Our expression analyses provide evidence that Tiki1 and Tiki2 are evolutionary conserved among vertebrate species and their expression in the Organizer and other regions suggests contributions of these Wnt inhibitors to embryonic patterning as well as organogenesis. Our analyses further reveal mis-regulation of TIKI1 and TIKI2 in human cancer and diseases. PMID:25354456

  7. RT-PCR detection of Candida albicans ALS gene expression in the reconstituted human epithelium (RHE) model of oral candidiasis and in model biofilms.

    PubMed

    Green, Clayton B; Cheng, Georgina; Chandra, Jyotsna; Mukherjee, Pranab; Ghannoum, Mahmoud A; Hoyer, Lois L

    2004-02-01

    An RT-PCR assay was developed to analyse expression patterns of genes in the Candida albicans ALS (agglutinin-like sequence) family. Inoculation of a reconstituted human buccal epithelium (RHE) model of mucocutaneous candidiasis with strain SC5314 showed destruction of the epithelial layer by C. albicans and also formation of an upper fungal layer that had characteristics similar to a biofilm. RT-PCR analysis of total RNA samples extracted from C. albicans-inoculated buccal RHE showed that ALS1, ALS2, ALS3, ALS4, ALS5 and ALS9 were consistently detected over time as destruction of the RHE progressed. Detection of transcripts from ALS7, and particularly from ALS6, was more sporadic, but not associated with a strictly temporal pattern. The expression pattern of ALS genes in C. albicans cultures used to inoculate the RHE was similar to that observed in the RHE model, suggesting that contact of C. albicans with buccal RHE does little to alter ALS gene expression. RT-PCR analysis of RNA samples extracted from model denture and catheter biofilms showed similar gene expression patterns to the buccal RHE specimens. Results from the RT-PCR analysis of biofilm RNA specimens were consistent between various C. albicans strains during biofilm development and were comparable to gene expression patterns in planktonic cells. The RT-PCR assay described here will be useful for analysis of human clinical specimens and samples from other disease models. The method will provide further insight into the role of ALS genes and their encoded proteins in the diverse interactions between C. albicans and its host.

  8. Chromosome Transfer Induced Aneuploidy Results in Complex Dysregulation of the Cellular Transcriptome in Immortalized and Cancer Cells

    PubMed Central

    Upender, Madhvi B.; Habermann, Jens K.; McShane, Lisa M.; Korn, Edward L.; Barrett, J. Carl; Difilippantonio, Michael J.; Ried, Thomas

    2016-01-01

    Chromosomal aneuploidies are observed in essentially all sporadic carcinomas. These aneuploidies result in tumor-specific patterns of genomic imbalances that are acquired early during tumorigenesis, continuously selected for and faithfully maintained in cancer cells. Although the paradigm of translocation induced oncogene activation in hematologic malignancies is firmly established, it is not known how genomic imbalances affect chromosome-specific gene expression patterns in particular and how chromosomal aneuploidy dysregulates the genetic equilibrium of cells in general. To model specific chromosomal aneuploidies in cancer cells and dissect the immediate consequences of genomic imbalances on the transcriptome, we generated artificial trisomies in a karyotypically stable diploid yet mismatch repair-deficient, colorectal cancer cell line and in telomerase immortalized, cytogenetically normal human breast epithelial cells using microcell-mediated chromosome transfer. The global consequences on gene expression levels were analyzed using cDNA arrays. Our results show that regardless of chromosome or cell type, chromosomal trisomies result in a significant increase in the average transcriptional activity of the trisomic chromosome. This increase affects the expression of numerous genes on other chromosomes as well. We therefore postulate that the genomic imbalances observed in cancer cells exert their effect through a complex pattern of transcriptional dysregulation. PMID:15466185

  9. Population-Level Transcriptomic Responses of the Southern Ocean Salp Salpa thompsoni to Environment Variability of the Western Antarctic Peninsula Region

    NASA Astrophysics Data System (ADS)

    Bucklin, A. C.; Batta Lona, P. G.; Maas, A. E.; O'Neill, R. J.; Wiebe, P. H.

    2015-12-01

    In response to the changing Antarctic climate, the Southern Ocean salp Salpa thompsoni has shown altered patterns of distribution and abundance that are anticipated to have profound impacts on pelagic food webs and ecosystem dynamics. The physiological and molecular processes that underlay ecological function and biogeographical distribution are key to understanding present-day dynamics and predicting future trajectories. This study examined transcriptome-wide patterns of gene expression in relation to biological and physical oceanographic conditions in coastal, shelf and offshore waters of the Western Antarctic Peninsula (WAP) region during austral spring and summer 2011. Based on field observations and collections, seasonal changes in the distribution and abundance of salps of different life stages were associated with differences in water mass structure of the WAP. Our observations are consistent with previous suggestions that bathymetry and currents in Bransfield Strait could generate a retentive cell for an overwintering population of S. thompsoni, which may generate the characteristic salp blooms found throughout the region later in summer. The statistical analysis of transcriptome-wide patterns of gene expression revealed differences among salps collected in different seasons and from different habitats (i.e., coastal versus offshore) in the WAP. Gene expression patterns also clustered by station in austral spring - but not summer - collections, suggesting stronger heterogeneity of environmental conditions. During the summer, differentially expressed genes covered a wider range of functions, including those associated with stress responses. Future research using novel molecular transcriptomic / genomic characterization of S. thompsoni will allow more complete understanding of individual-, population-, and species-level responses to environmental variability and prediction of future dynamics of Southern Ocean food webs and ecosystems.

  10. Heat shock protein Hsp90-2 expression in the Arabidopsis thaliana seedlings under clinorotation

    NASA Astrophysics Data System (ADS)

    Kozeko, Liudmyla

    Heat shock proteins 90 kDa (Hsp90) are abundant under normal conditions and induced by stress. This family is distinguished from other chaperones in that most of its substrates are signal transduction proteins. Previously, we determined some time-dependent increase in the Hsp90 level in pea seedlings in response to simulated microgravity that indicated a stress-reaction. However, expression of the individual members of the Hsp90 family have specific pattern. The purpose of this study was to investigate possible alterations in the gene expression pattern of cytosolic Hsp90-2 in Arabidopsis thaliana seedlings under 2D-clinorotation. To obtain detailed expression pattern of the HSP90-2 genes we used seeds that provides a resource of loss-of-function mutations gene expression patterns via translational fusions with the reporter gene, GUS (a line N 166718, NASC). There were two variants of the experiment: 1) seedlings grew under clinorotation for 10, 12, 14 d; 2) seedlings grew in the stationary conditions for 10 d followed by clinorotation for 3 h -at 22o C and 16h light cycle. The seedlings grown in the stationary conditions were used as a control. GUS staining showed that HSP90-2 expression was regulated during seedling development and affected by clinorotation in the heterozygous mutant plants. In the homozygous for the mutation plants, HSP90-2 expression was stable during seedling development and not affected by clinorotation. GUS staining was observed in cotyledons, leaves and hypocotyls of the seedlings (especially intense in vascular bundles), indicating intensive cellular processes with participation of this chaperone. Possible pathways of influence of clinorotation on HSP90-2 expression are discussed.

  11. Structure and Function of the Splice Variants of TMPRSS2-ERG, a Prevalent Genomic Alteration in Prostate Cancer

    DTIC Science & Technology

    2011-09-01

    the ETS family of transcription factors showing diverse expression patterns in human tissues (Turner and Watson, 2008). ERG, similar to other...and adult mouse tissues . Most striking of these observations was highly selective and abundant expression of erg protein in endothelial cells of...mouse tissues . We for the first time clarified that endogenous ERG was not expressed in normal mouse prostate epithelium (Mohamed et al., 2010

  12. Expression patterns of epiplakin1 in pancreas, pancreatic cancer and regenerating pancreas.

    PubMed

    Yoshida, Tetsu; Shiraki, Nobuaki; Baba, Hideo; Goto, Mizuki; Fujiwara, Sakuhei; Kume, Kazuhiko; Kume, Shoen

    2008-07-01

    Epiplakin1 (Eppk1) is a plakin family gene with its function remains largely unknown, although the plakin genes are known to function in interconnecting cytoskeletal filaments and anchoring them at plasma membrane-associated adhesive junction. Here we analyzed the expression patterns of Eppk1 in the developing and adult pancreas in the mice. In the embryonic pancreas, Eppk1+/Pdx1+ and Eppk1+/Sox9+ pancreatic progenitor cells were observed in early pancreatic epithelium. Since Pdx1 expression overlapped with that of Sox9 at this stage, these multipotent progenitor cells are Eppk1+/Pdx1+/Sox9+ cells. Then Eppk1 expression becomes confined to Ngn3+ or Sox9+ endocrine progenitor cells, and p48+ exocrine progenitor cells, and then restricted to the duct cells and a cells at birth. In the adult pancreas, Eppk1 is expressed in centroacinar cells (CACs) and in duct cells. Eppk1 is observed in pancreatic intraepithelial neoplasia (PanIN), previously identified as pancreatic ductal adenocarcinoma (PDAC) precursor lesions. In addition, the expansion of Eppk1-positive cells occurs in a caerulein-induced acute pancreatitis, an acinar cell regeneration model. Furthermore, in the partial pancreatectomy (Px) regeneration model using mice, Eppk1 is expressed in "ducts in foci", a tubular structure transiently induced. These results suggest that Eppk1 serves as a useful marker for detecting pancreatic progenitor cells in developing and regenerating pancreas.

  13. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis.

    PubMed

    Paul, A L; Daugherty, C J; Bihn, E A; Chapman, D K; Norwood, K L; Ferl, R J

    2001-06-01

    The use of plants as integral components of life support systems remains a cornerstone of strategies for long-term human habitation of space and extraterrestrial colonization. Spaceflight experiments over the past few decades have refined the hardware required to grow plants in low-earth orbit and have illuminated fundamental issues regarding spaceflight effects on plant growth and development. Potential incipient hypoxia, resulting from the lack of convection-driven gas movement, has emerged as a possible major impact of microgravity. We developed transgenic Arabidopsis containing the alcohol dehydrogenase (Adh) gene promoter linked to the beta-glucuronidase (GUS) reporter gene to address specifically the possibility that spaceflight induces the plant hypoxia response and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. The staining patterns resulting from a 5-d mission on the orbiter Columbia during mission STS-93 indicate that the Adh/GUS reporter gene was activated in roots during the flight. However, the patterns of expression were not identical to terrestrial control inductions. Moreover, although terrestrial hypoxia induces Adh/GUS expression in the shoot apex, no apex staining was observed in the spaceflight plants. This indicates that either the normal hypoxia response signaling is impaired in spaceflight or that spaceflight inappropriately induces Adh/GUS activity for reasons other than hypoxia.

  14. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis

    NASA Technical Reports Server (NTRS)

    Paul, A. L.; Daugherty, C. J.; Bihn, E. A.; Chapman, D. K.; Norwood, K. L.; Ferl, R. J.

    2001-01-01

    The use of plants as integral components of life support systems remains a cornerstone of strategies for long-term human habitation of space and extraterrestrial colonization. Spaceflight experiments over the past few decades have refined the hardware required to grow plants in low-earth orbit and have illuminated fundamental issues regarding spaceflight effects on plant growth and development. Potential incipient hypoxia, resulting from the lack of convection-driven gas movement, has emerged as a possible major impact of microgravity. We developed transgenic Arabidopsis containing the alcohol dehydrogenase (Adh) gene promoter linked to the beta-glucuronidase (GUS) reporter gene to address specifically the possibility that spaceflight induces the plant hypoxia response and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. The staining patterns resulting from a 5-d mission on the orbiter Columbia during mission STS-93 indicate that the Adh/GUS reporter gene was activated in roots during the flight. However, the patterns of expression were not identical to terrestrial control inductions. Moreover, although terrestrial hypoxia induces Adh/GUS expression in the shoot apex, no apex staining was observed in the spaceflight plants. This indicates that either the normal hypoxia response signaling is impaired in spaceflight or that spaceflight inappropriately induces Adh/GUS activity for reasons other than hypoxia.

  15. Developmental expression of Hsp90, Hsp70 and HSF during morphogenesis in the vetigastropod Haliotis asinina.

    PubMed

    Gunter, Helen M; Degnan, Bernard M

    2007-08-01

    Heat shock proteins (Hsps) have dual functions, participating in both the stress response and a broad range of developmental processes. At physiological temperatures, it has been demonstrated in deuterostomes (vertebrates) and ecdysozoans (insects) that Hsps are expressed in tissues that are undergoing differentiation and morphogenesis. Here we investigate the developmental expression of Hsp70, Hsp90 and their regulatory transcription factor heat shock transcription factor (HSF) in the marine gastropod Haliotis asinina, a representative of the 3rd major lineage of bilaterian animals, the Lophotrochozoa. HasHsp70, HasHsp90 and HasHSF are maternally expressed in H. asinina and are progressively restricted to the micromere lineage during cleavage. During larval morphogenesis, they are expressed in unique and overlapping patterns in the prototroch, foot, and mantle. Hsp expression peaked in these tissues during periods of cell differentiation and morphogenesis, returning to lower levels after morphogenesis was complete. These patterns of Hsp and HSF expression in H. asinina are akin to those observed in ecdysozoans and deuterostomes, with Hsps being activated in cells and tissues undergoing morphogenesis.

  16. Loss of CDH1 (E-cadherin) expression is associated with infiltrative tumour growth and lymph node metastasis.

    PubMed

    Kim, Sun A; Inamura, Kentaro; Yamauchi, Mai; Nishihara, Reiko; Mima, Kosuke; Sukawa, Yasutaka; Li, Tingting; Yasunari, Mika; Morikawa, Teppei; Fitzgerald, Kathryn C; Fuchs, Charles S; Wu, Kana; Chan, Andrew T; Zhang, Xuehong; Ogino, Shuji; Qian, Zhi Rong

    2016-01-19

    Loss of CDH1 (E-cadherin) expression in cancer cells may promote cell migration and invasion. Therefore, we hypothesised that loss of CDH1 expression in colorectal carcinoma might be associated with aggressive features and clinical outcome. Utilising molecular pathological epidemiology database of 689 rectal and colon cancer cases in the Nurses' Health Study and the Health Professionals Follow-up Study, we assessed tumour CDH1 expression by immunohistochemistry. Multivariate logistic regression analysis was conducted to assess association of CDH1 loss with tumour growth pattern (expansile-intermediate vs infiltrative) and lymph node metastasis and distant metastasis, controlling for potential confounders including microsatellite instability, CpG island methylator phenotype, LINE-1 methylation, and PIK3CA, BRAF and KRAS mutations. Mortality according to CDH1 status was assessed using Cox proportional hazards model. Loss of tumour CDH1 expression was observed in 356 cases (52%), and associated with infiltrative tumour growth pattern (odds ratio (OR), 2.02; 95% confidence interval (CI), 1.23-3.34; P=0.006) and higher pN stage (OR, 1.73; 95% CI, 1.23-2.43; P=0.001). Tumour CDH1 expression was not significantly associated with distant metastasis or prognosis. Loss of CDH1 expression in colorectal cancer is associated with infiltrative tumour growth pattern and lymph node metastasis.

  17. ImpulseDE: detection of differentially expressed genes in time series data using impulse models.

    PubMed

    Sander, Jil; Schultze, Joachim L; Yosef, Nir

    2017-03-01

    Perturbations in the environment lead to distinctive gene expression changes within a cell. Observed over time, those variations can be characterized by single impulse-like progression patterns. ImpulseDE is an R package suited to capture these patterns in high throughput time series datasets. By fitting a representative impulse model to each gene, it reports differentially expressed genes across time points from a single or between two time courses from two experiments. To optimize running time, the code uses clustering and multi-threading. By applying ImpulseDE , we demonstrate its power to represent underlying biology of gene expression in microarray and RNA-Seq data. ImpulseDE is available on Bioconductor ( https://bioconductor.org/packages/ImpulseDE/ ). niryosef@berkeley.edu. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

  18. Translational initiation in Leishmania tarentolae and Phytomonas serpens (Kinetoplastida) is strongly influenced by pre-ATG triplet and its 5' sequence context.

    PubMed

    Lukes, Julius; Paris, Zdenek; Regmi, Sandesh; Breitling, Reinhard; Mureev, Sergey; Kushnir, Susanna; Pyatkov, Konstantin; Jirků, Milan; Alexandrov, Kirill A

    2006-08-01

    To investigate the influence of sequence context of translation initiation codon on translation efficiency in Kinetoplastida, we constructed a library of expression plasmids randomized in the three nucleotides prefacing ATG of a reporter gene encoding enhanced green fluorescent protein (EGFP). All 64 possible combinations of pre-ATG triplets were individually stably integrated into the rDNA locus of Leishmania tarentolae and the resulting cell lines were assessed for EGFP expression. The expression levels were quantified directly by measuring the fluorescence of EGFP protein in living cells and confirmed by Western blotting. We observed a strong influence of the pre-ATG triplet on the level of protein expression over a 20-fold range. To understand the degree of evolutionary conservation of the observed effect, we transformed Phytomonas serpens, a trypanosomatid parasite of plants, with a subset of the constructs. The pattern of translational efficiency mediated by individual pre-ATG triplets in this species was similar to that observed in L. tarentolae. However, the pattern of translational efficiency of two other proteins (red fluorescent protein and tetracycline repressor) containing selected pre-ATG triplets did not correlate with either EGFP or each other. Thus, we conclude that a conserved mechanism of translation initiation site selection exists in kinetoplastids that is strongly influenced not only by the pre-ATG sequences but also by the coding region of the gene.

  19. Candidate ionotropic taste receptors in the Drosophila larva.

    PubMed

    Stewart, Shannon; Koh, Tong-Wey; Ghosh, Arpan C; Carlson, John R

    2015-04-07

    We examine in Drosophila a group of ∼35 ionotropic receptors (IRs), the IR20a clade, about which remarkably little is known. Of 28 genes analyzed, GAL4 drivers representing 11 showed expression in the larva. Eight drivers labeled neurons of the pharynx, a taste organ, and three labeled neurons of the body wall that may be chemosensory. Expression was not observed in neurons of one taste organ, the terminal organ, although these neurons express many drivers of the Gr (Gustatory receptor) family. For most drivers of the IR20a clade, we observed expression in a single pair of cells in the animal, with limited coexpression, and only a fraction of pharyngeal neurons are labeled. The organization of IR20a clade expression thus appears different from the organization of the Gr family or the Odor receptor (Or) family in the larva. A remarkable feature of the larval pharynx is that some of its organs are incorporated into the adult pharynx, and several drivers of this clade are expressed in the pharynx of both larvae and adults. Different IR drivers show different developmental dynamics across the larval stages, either increasing or decreasing. Among neurons expressing drivers in the pharynx, two projection patterns can be distinguished in the CNS. Neurons exhibiting these two kinds of projection patterns may activate different circuits, possibly signaling the presence of cues with different valence. Taken together, the simplest interpretation of our results is that the IR20a clade encodes a class of larval taste receptors.

  20. A Hybrid One-Way ANOVA Approach for the Robust and Efficient Estimation of Differential Gene Expression with Multiple Patterns

    PubMed Central

    Mollah, Mohammad Manir Hossain; Jamal, Rahman; Mokhtar, Norfilza Mohd; Harun, Roslan; Mollah, Md. Nurul Haque

    2015-01-01

    Background Identifying genes that are differentially expressed (DE) between two or more conditions with multiple patterns of expression is one of the primary objectives of gene expression data analysis. Several statistical approaches, including one-way analysis of variance (ANOVA), are used to identify DE genes. However, most of these methods provide misleading results for two or more conditions with multiple patterns of expression in the presence of outlying genes. In this paper, an attempt is made to develop a hybrid one-way ANOVA approach that unifies the robustness and efficiency of estimation using the minimum β-divergence method to overcome some problems that arise in the existing robust methods for both small- and large-sample cases with multiple patterns of expression. Results The proposed method relies on a β-weight function, which produces values between 0 and 1. The β-weight function with β = 0.2 is used as a measure of outlier detection. It assigns smaller weights (≥ 0) to outlying expressions and larger weights (≤ 1) to typical expressions. The distribution of the β-weights is used to calculate the cut-off point, which is compared to the observed β-weight of an expression to determine whether that gene expression is an outlier. This weight function plays a key role in unifying the robustness and efficiency of estimation in one-way ANOVA. Conclusion Analyses of simulated gene expression profiles revealed that all eight methods (ANOVA, SAM, LIMMA, EBarrays, eLNN, KW, robust BetaEB and proposed) perform almost identically for m = 2 conditions in the absence of outliers. However, the robust BetaEB method and the proposed method exhibited considerably better performance than the other six methods in the presence of outliers. In this case, the BetaEB method exhibited slightly better performance than the proposed method for the small-sample cases, but the the proposed method exhibited much better performance than the BetaEB method for both the small- and large-sample cases in the presence of more than 50% outlying genes. The proposed method also exhibited better performance than the other methods for m > 2 conditions with multiple patterns of expression, where the BetaEB was not extended for this condition. Therefore, the proposed approach would be more suitable and reliable on average for the identification of DE genes between two or more conditions with multiple patterns of expression. PMID:26413858

  1. Complex Expression of the Cellulolytic Transcriptome of Saccharophagus degradans † ▿

    PubMed Central

    Zhang, Haitao; Hutcheson, Steven W.

    2011-01-01

    Saccharophagus degradans is an aerobic marine bacterium that can degrade cellulose by the induced expression of an unusual cellulolytic system composed of multiple endoglucanases and glucosidases. To understand the regulation of the cellulolytic system, transcript levels for the genes predicted to contribute to the cellulolytic system were monitored by quantitative real-time PCR (qRT-PCR) during the transition to growth on cellulose. Four glucanases of the cellulolytic system exhibited basal expression during growth on glucose. All but one of the predicted cellulolytic system genes were induced strongly during growth on Avicel, with three patterns of expression observed. One group showed increased expression (up to 6-fold) within 4 h of the nutritional shift, with the relative expression remaining constant over the next 22 h. A second group of genes was strongly induced between 4 and 10 h after nutritional transfer, with relative expression declining thereafter. The third group of genes was slowly induced and was expressed maximally after 24 h. Cellodextrins and cellobiose, products of the predicted basally expressed endoglucanases, stimulated expression of representative cellulase genes. A model is proposed by which the activity of basally expressed endoglucanases releases cellodextrins from Avicel that are then perceived and transduced to initiate transcription of each of the regulated cellulolytic system genes forming an expression pattern. PMID:21705539

  2. Expression patterns of wnt8 orthologs in two sand dollar species with different developmental modes.

    PubMed

    Nakata, Hidewo; Minokawa, Takuya

    2009-03-01

    Two wnt8 orthologs, Smwnt8 and Pjwnt8, were isolated from an indirect developing sand dollar, Scaphechinus mirabilis, and a direct developing sand dollar, Peronella japonica, respectively. The expression patterns of two genes during early development were examined by whole mount in situ hybridization. The expression of Smwnt8 was initiated in the micromeres at the late 16-cell stage and expanded at the 64-cell stage to the whole vegetal hemisphere, including the presumptive endomesodermal regions. The timing of the initiation of Pjwnt8 transcription in the presumptive endomesoderm region was delayed by 2-3 cell cycles compared to that of Smwnt8. The delay, or molecular heterochrony, of Pjwnt8 transcription strongly suggests the existence of a substantial evolutionary change in the early endomesodermal specification of P. japonica. In addition to the endomesodermal expression during early embryogenesis, bilateral expressions were observed commonly in the ectoderm of two sand dollar species during larval stages.

  3. Humans and Mice Display Opposing Patterns of "Browning" Gene Expression in Visceral and Subcutaneous White Adipose Tissue Depots.

    PubMed

    Zuriaga, Maria A; Fuster, Jose J; Gokce, Noyan; Walsh, Kenneth

    2017-01-01

    Visceral adiposity is much more strongly associated with cardiometabolic disease in humans than subcutaneous adiposity. Browning, the appearance of brown-like adipocytes in the white adipose tissue (WAT), has been shown to protect mice against metabolic dysfunction, suggesting the possibility of new therapeutic approaches to treat obesity and type 2 diabetes. In mice, subcutaneous WAT depots express higher levels of browning genes when compared with visceral WAT, further suggesting that differences in WAT browning could contribute to the differences in the pathogenicity of the two depots. However, the expression of browning genes in different WAT depots of human has not been characterized. Here, it is shown that the expression of browning genes is higher in visceral than in subcutaneous WAT in humans, a pattern that is opposite to what is observed in mice. These results suggest that caution should be applied in extrapolating the results of murine browning gene expression studies to human pathophysiology.

  4. Distinct cell-specific expression of homospermidine synthase involved in pyrrolizidine alkaloid biosynthesis in three species of the boraginales.

    PubMed

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-07-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant's chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature.

  5. Evolutionary divergence of vertebrate Hoxb2 expression patterns and transcriptional regulatory loci.

    PubMed

    Scemama, Jean-Luc; Hunter, Michael; McCallum, Jeff; Prince, Victoria; Stellwag, Edmund

    2002-10-15

    Hox gene expression is regulated by a complex array of cis-acting elements that control spatial and temporal gene expression in developing embryos. Here, we report the isolation of the striped bass Hoxb2a gene, comparison of its expression to the orthologous gene from zebrafish, and comparative genomic analysis of the upstream regulatory region to that of other vertebrates. Comparison of the Hoxb2a gene expression patterns from striped bass to zebrafish revealed similar expression patterns within rhombomeres 3, 4, and 5 of the hindbrain but a notable absence of expression in neural crest tissues of striped bass while neural crest expression is observed in zebrafish and common to other vertebrates. Comparative genomic analysis of the striped bass Hoxb2a-b3a intergenic region to those from zebrafish, pufferfish, human, and mouse demonstrated the presence of common Meis, Hox/Pbx, Krox-20, and Box 1 elements, which are necessary for rhombomere 3, 4, and 5 expression. Despite their common occurrence, the location and orientation of these transcription elements differed among the five species analyzed, such that Krox-20 and Box 1 elements are located 3' to the Meis, Hox/Pbx elements in striped bass, pufferfish, and human while they are located 5' of this r4 enhancer in zebrafish and mouse. Our results suggest that the plasticity exhibited in the organization of key regulatory elements responsible for rhombomere-specific Hoxb2a expression may reflect the effects of stabilizing selection in the evolution cis-acting elements. Copyright 2002 Wiley-Liss, Inc.

  6. Distinct Cell-Specific Expression of Homospermidine Synthase Involved in Pyrrolizidine Alkaloid Biosynthesis in Three Species of the Boraginales1[C][W][OA

    PubMed Central

    Niemüller, Daniel; Reimann, Andreas; Ober, Dietrich

    2012-01-01

    Homospermidine synthase (HSS) is the first specific enzyme in pyrrolizidine alkaloid (PA) biosynthesis, a pathway involved in the plant’s chemical defense. HSS has been shown to be recruited repeatedly by duplication of a gene involved in primary metabolism. Within the lineage of the Boraginales, only one gene duplication event gave rise to HSS. Here, we demonstrate that the tissue-specific expression of HSS in three boraginaceous species, Heliotropium indicum, Symphytum officinale, and Cynoglossum officinale, is unique with respect to plant organ, tissue, and cell type. Within H. indicum, HSS is expressed exclusively in nonspecialized cells of the lower epidermis of young leaves and shoots. In S. officinale, HSS expression has been detected in the cells of the root endodermis and in leaves directly underneath developing inflorescences. In young roots of C. officinale, HSS is detected only in cells of the endodermis, but in a later developmental stage, additionally in the pericycle. The individual expression patterns are compared with those within the Senecioneae lineage (Asteraceae), where HSS expression is reproducibly found in specific cells of the endodermis and the adjacent cortex parenchyma of the roots. The individual expression patterns within the Boraginales species are discussed as being a requirement for the successful recruitment of HSS after gene duplication. The diversity of HSS expression within this lineage adds a further facet to the already diverse patterns of expression that have been observed for HSS in other PA-producing plant lineages, making this PA-specific enzyme one of the most diverse expressed proteins described in the literature. PMID:22566491

  7. The miR172 target TOE3 represses AGAMOUS expression during Arabidopsis floral patterning.

    PubMed

    Jung, Jae-Hoon; Lee, Sangmin; Yun, Ju; Lee, Minyoung; Park, Chung-Mo

    2014-02-01

    microRNA172 (miR172) regulates phase transition and floral patterning in Arabidopsis by repressing targets that encode the APETALA2 (AP2) and AP2-like transcription factors. The miR172-mediated repression of the AP2 gene restricts AGAMOUS (AG) expression. In addition, most miR172 targets, including AP2, redundantly act as floral repressors, and the overexpression of the target genes causes delayed flowering. However, how miR172 targets other than AP2 regulate both of the developmental processes remains unclear. Here, we demonstrate that miR172-mediated repression of the TARGET OF EAT 3 (TOE3) gene is critical for floral patterning in Arabidopsis. Transgenic plants that overexpress a miR172-resistant TOE3 gene (rTOE3-ox) exhibit indeterminate flowers with numerous stamens and carpelloid organs, which is consistent with previous observations in transgenic plants that overexpress a miR172-resistant AP2 gene. TOE3 binds to the second intron of the AG gene. Accordingly, AG expression is significantly reduced in rTOE3-ox plants. TOE3 also interacts with AP2 in the nucleus. Given the major role of AP2 in floral patterning, miR172 likely regulates TOE3 in floral patterning, at least in part via AP2. In addition, a miR156 target SQUAMOSA PROMOTER BINDING PROTEIN-LIKE 3 directly activates TOE3 expression, revealing a novel signaling interaction between miR156 and miR172 in floral patterning. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  8. Initiation of olfactory placode development and neurogenesis is blocked in mice lacking both Six1 and Six4.

    PubMed

    Chen, Binglai; Kim, Eun-Hee; Xu, Pin-Xian

    2009-02-01

    Mouse olfactory epithelium (OE) originates from ectodermally derived placode, the olfactory placode that arises at the anterior end of the neural plate. Tissue grafting and recombination experiments suggest that the placode is derived from a common preplacodal domain around the neural plate and its development is directed by signals arising from the underlying mesoderm and adjacent neuroectoderm. In mice, loss of Six1 affects OE morphogenesis but not placode formation. We show here that embryos lacking both Six1 and Six4 failed to form the olfactory placode but the preplacodal region appeared to be specified as judged by the expression of Eya2, which marks the common preplacodal domain, suggesting a synergistic requirement of Six1 and Six4 in patterning the preplacodal ectoderm to a morphologic placode. Our results show that Six1 and Six4 are coexpressed in the preplacodal ectoderm from E8.0. In the olfactory pit, Six4 expression was observed in the peripheral precursors that overlap with Mash1-expressing cells, the early committed neuronal lineage. In contrast, Six1 is highly distributed in the peripheral regions where stem cells reside at E10.5 and it overlaps with Sox2 expression. Both genes are expressed in the basal and apical neuronal progenitors in the OE. Analyses of Six1;Six4 double mutant embryos demonstrated that the slightly thickened epithelium observed in the mutant was not induced for neuronal development. In contrast, in Six1(-/-) embryos, all neuronal lineage markers were initially expressed but the pattern of their expression was altered. Although very few, the pioneer neurons were initially present in the Six1 mutant OE. However, neurogenesis ceased by E12.5 due to markedly increased cell apoptosis and reduced proliferation, thus defining the cellular defects occurring in Six1(-/-) OE that have not been previously observed. Our findings demonstrate that Six1/4 function at the top of early events controlling olfactory placode formation and neuronal development. Our analyses show that the threshold of Six1/4 may be crucial for the expression of olfactory specific genes and that Six1 and Six4 may act synergistically to mediate olfactory placode specification and patterning through Fgf and Bmp signaling pathways.

  9. Glucose Transporter Expression in an Avian Nectarivore: The Ruby-Throated Hummingbird (Archilochus colubris)

    PubMed Central

    Welch, Kenneth C.; Allalou, Amina; Sehgal, Prateek; Cheng, Jason; Ashok, Aarthi

    2013-01-01

    Glucose transporter (GLUT) proteins play a key role in the transport of monosaccharides across cellular membranes, and thus, blood sugar regulation and tissue metabolism. Patterns of GLUT expression, including the insulin-responsive GLUT4, have been well characterized in mammals. However, relatively little is known about patterns of GLUT expression in birds with existing data limited to the granivorous or herbivorous chicken, duck and sparrow. The smallest avian taxa, hummingbirds, exhibit some of the highest fasted and fed blood glucose levels and display an unusual ability to switch rapidly and completely between endogenous fat and exogenous sugar to fuel energetically expensive hovering flight. Despite this, nothing is known about the GLUT transporters that enable observed rapid rates of carbohydrate flux. We examined GLUT (GLUT1, 2, 3, & 4) expression in pectoralis, leg muscle, heart, liver, kidney, intestine and brain from both zebra finches (Taeniopygia guttata) and ruby-throated hummingbirds (Archilochus colubris). mRNA expression of all four transporters was probed using reverse-transcription PCR (RT-PCR). In addition, GLUT1 and 4 protein expression were assayed by western blot and immunostaining. Patterns of RNA and protein expression of GLUT1-3 in both species agree closely with published reports from other birds and mammals. As in other birds, and unlike in mammals, we did not detect GLUT4. A lack of GLUT4 correlates with hyperglycemia and an uncoupling of exercise intensity and relative oxidation of carbohydrates in hummingbirds. The function of GLUTs present in hummingbird muscle tissue (e.g. GLUT1 and 3) remain undescribed. Thus, further work is necessary to determine if high capillary density, and thus surface area across which cellular-mediated transport of sugars into active tissues (e.g. muscle) occurs, rather than taxon-specific differences in GLUT density or kinetics, can account for observed rapid rates of sugar flux into these tissues. PMID:24155916

  10. Reciprocal transcriptional regulation of metabolic and signaling pathways correlates with disease severity in heart failure.

    PubMed

    Barth, Andreas S; Kumordzie, Ami; Frangakis, Constantine; Margulies, Kenneth B; Cappola, Thomas P; Tomaselli, Gordon F

    2011-10-01

    Systolic heart failure (HF) is a complex systemic syndrome that can result from a wide variety of clinical conditions and gene mutations. Despite phenotypic similarities, characterized by ventricular dilatation and reduced contractility, the extent of common and divergent gene expression between different forms of HF remains a matter of intense debate. Using a meta-analysis of 28 experimental (mouse, rat, dog) and human HF microarray studies, we demonstrate that gene expression changes are characterized by a coordinated and reciprocal regulation of major metabolic and signaling pathways. In response to a wide variety of stressors in animal models of HF, including ischemia, pressure overload, tachypacing, chronic isoproterenol infusion, Chagas disease, and transgenic mouse models, major metabolic pathways are invariably downregulated, whereas cell signaling pathways are upregulated. In contrast to this uniform transcriptional pattern that recapitulates a fetal gene expression program in experimental animal models of HF, human HF microarray studies displayed a greater heterogeneity, with some studies even showing upregulation of metabolic and downregulation of signaling pathways in end-stage human hearts. These discrepant results between animal and human studies are due to a number of factors, prominently cardiac disease and variable exposure to cold cardioplegic solution in nonfailing human samples, which can downregulate transcripts involved in oxidative phosphorylation (OXPHOS), thus mimicking gene expression patterns observed in failing samples. Additionally, β-blockers and ACE inhibitor use in end-stage human HF was associated with higher levels of myocardial OXPHOS transcripts, thus partially reversing the fetal gene expression pattern. In human failing samples, downregulation of metabolism was associated with hemodynamic markers of disease severity. Irrespective of the etiology, gene expression in failing myocardium is characterized by downregulation of metabolic transcripts and concomitant upregulation of cell signaling pathways. Gene expression changes along this metabolic-signaling axis in mammalian myocardium are a consistent feature in the heterogeneous transcriptional response observed in phenotypically similar models of HF.

  11. Site-specific variation in gene expression from Symbiodinium spp. associated with offshore and inshore Porites astreoides in the lower Florida Keys is lost with bleaching and disease stress.

    PubMed

    Salas, Briana Hauff; Haslun, Joshua A; Strychar, Kevin B; Ostrom, Peggy H; Cervino, James M

    2017-01-01

    Scleractinian coral are experiencing unprecedented rates of mortality due to increases in sea surface temperatures in response to global climate change. Some coral species however, survive high temperature events due to a reduced susceptibility to bleaching. We investigated the relationship between bleaching susceptibility and expression of five metabolically related genes of Symbiodinium spp. from the coral Porites astreoides originating from an inshore and offshore reef in the Florida Keys. The acclimatization potential of Symbiodinium spp. to changing temperature regimes was also measured via a two-year reciprocal transplant between the sites. Offshore coral fragments displayed significantly higher expression in Symbiodinium spp. genes PCNA, SCP2, G3PDH, PCP and psaE than their inshore counterparts (p<0.05), a pattern consistent with increased bleaching susceptibility in offshore corals. Additionally, gene expression patterns in Symbiodinium spp. from site of origin were conserved throughout the two-year reciprocal transplant, indicating acclimatization did not occur within this multi-season time frame. Further, laboratory experiments were used to investigate the influence of acute high temperature (32°C for eight hours) and disease (lipopolysaccharide of Serratia marcescens) on the five metabolically related symbiont genes from the same offshore and inshore P. astreoides fragments. Gene expression did not differ between reef fragments, or as a consequence of acute exposure to heat or heat and disease, contrasting to results found in the field. Gene expression reported here indicates functional variation in populations of Symbiodinium spp. associated with P. astreoides in the Florida Keys, and is likely a result of localized adaptation. However, gene expression patterns observed in the lab imply that functional variation in zooxanthellae observed under conditions of chronic moderate stress is lost under the acute extreme conditions studied here.

  12. Site-specific variation in gene expression from Symbiodinium spp. associated with offshore and inshore Porites astreoides in the lower Florida Keys is lost with bleaching and disease stress

    PubMed Central

    Haslun, Joshua A.; Strychar, Kevin B.; Ostrom, Peggy H.; Cervino, James M.

    2017-01-01

    Scleractinian coral are experiencing unprecedented rates of mortality due to increases in sea surface temperatures in response to global climate change. Some coral species however, survive high temperature events due to a reduced susceptibility to bleaching. We investigated the relationship between bleaching susceptibility and expression of five metabolically related genes of Symbiodinium spp. from the coral Porites astreoides originating from an inshore and offshore reef in the Florida Keys. The acclimatization potential of Symbiodinium spp. to changing temperature regimes was also measured via a two-year reciprocal transplant between the sites. Offshore coral fragments displayed significantly higher expression in Symbiodinium spp. genes PCNA, SCP2, G3PDH, PCP and psaE than their inshore counterparts (p<0.05), a pattern consistent with increased bleaching susceptibility in offshore corals. Additionally, gene expression patterns in Symbiodinium spp. from site of origin were conserved throughout the two-year reciprocal transplant, indicating acclimatization did not occur within this multi-season time frame. Further, laboratory experiments were used to investigate the influence of acute high temperature (32°C for eight hours) and disease (lipopolysaccharide of Serratia marcescens) on the five metabolically related symbiont genes from the same offshore and inshore P. astreoides fragments. Gene expression did not differ between reef fragments, or as a consequence of acute exposure to heat or heat and disease, contrasting to results found in the field. Gene expression reported here indicates functional variation in populations of Symbiodinium spp. associated with P. astreoides in the Florida Keys, and is likely a result of localized adaptation. However, gene expression patterns observed in the lab imply that functional variation in zooxanthellae observed under conditions of chronic moderate stress is lost under the acute extreme conditions studied here. PMID:28355291

  13. Cytokeratin 19 Expression Patterns of Dentigerous Cysts and Odontogenic Keratocysts

    PubMed Central

    Kamath, KP; Vidya, M

    2015-01-01

    Background: Although numerous investigators have studied the pattern of keratin expression in different odontogenic cysts, the results have been variable. Aim: The present study was conducted to determine the pattern of expression of cytokeratin 19 (CK 19) in the epithelial lining of odontogenic keratocysts and dentigerous cysts. Materials and Methods: The epithelial layers showing expression of the epithelial marker CK 19 was determined by immunohistochemical methods in 15 tissue specimens each of histopathologically confirmed cases of dentigerous cysts and odontogenic keratocysts. Statistical analysis was done to compare the CK 19 expression between dentigerous cyst and odontogenic keratocyst using the Chi-square test. P < 0.05 was considered to be statistically significant. Results: All specimens of dentigerous cysts were positive for CK 19 with 20% (3/15) of the specimens showing expression only in a single layer of the epithelium, 40% (6/15) of the specimens showing expression in more than one layer but not the entire thickness of the epithelium, and the remaining 40% (6/15) showing expression throughout the entire thickness of the epithelium. In the case of odontogenic keratocysts, 40% (6/15) of the specimens were negative for CK 19, 40% (6/15) of the specimens showed expression only in a single layer of the epithelium, and 20% (3/15) of the specimens showed expression in more than one layer, but not the entire thickness of the epithelium. The observed differences in CK 19 expression by the two lesions were statistically significant (P < 0.01). Conclusion: The differences in CK 19 expression by these cysts may be utilized as a diagnostic tool in differentiating between these two lesions. PMID:25861531

  14. Regulatory divergence between parental alleles determines gene expression patterns in hybrids.

    PubMed

    Combes, Marie-Christine; Hueber, Yann; Dereeper, Alexis; Rialle, Stéphanie; Herrera, Juan-Carlos; Lashermes, Philippe

    2015-03-29

    Both hybridization and allopolyploidization generate novel phenotypes by conciliating divergent genomes and regulatory networks in the same cellular context. To understand the rewiring of gene expression in hybrids, the total expression of 21,025 genes and the allele-specific expression of over 11,000 genes were quantified in interspecific hybrids and their parental species, Coffea canephora and Coffea eugenioides using RNA-seq technology. Between parental species, cis- and trans-regulatory divergences affected around 32% and 35% of analyzed genes, respectively, with nearly 17% of them showing both. The relative importance of trans-regulatory divergences between both species could be related to their low genetic divergence and perennial habit. In hybrids, among divergently expressed genes between parental species and hybrids, 77% was expressed like one parent (expression level dominance), including 65% like C. eugenioides. Gene expression was shown to result from the expression of both alleles affected by intertwined parental trans-regulatory factors. A strong impact of C. eugenioides trans-regulatory factors on the upregulation of C. canephora alleles was revealed. The gene expression patterns appeared determined by complex combinations of cis- and trans-regulatory divergences. In particular, the observed biased expression level dominance seemed to be derived from the asymmetric effects of trans-regulatory parental factors on regulation of alleles. More generally, this study illustrates the effects of divergent trans-regulatory parental factors on the gene expression pattern in hybrids. The characteristics of the transcriptional response to hybridization appear to be determined by the compatibility of gene regulatory networks and therefore depend on genetic divergences between the parental species and their evolutionary history. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Seasonal Changes in Bacterial and Archaeal Gene Expression Patterns across Salinity Gradients in the Columbia River Coastal Margin

    PubMed Central

    Smith, Maria W.; Herfort, Lydie; Tyrol, Kaitlin; Suciu, Dominic; Campbell, Victoria; Crump, Byron C.; Peterson, Tawnya D.; Zuber, Peter; Baptista, Antonio M.; Simon, Holly M.

    2010-01-01

    Through their metabolic activities, microbial populations mediate the impact of high gradient regions on ecological function and productivity of the highly dynamic Columbia River coastal margin (CRCM). A 2226-probe oligonucleotide DNA microarray was developed to investigate expression patterns for microbial genes involved in nitrogen and carbon metabolism in the CRCM. Initial experiments with the environmental microarrays were directed toward validation of the platform and yielded high reproducibility in multiple tests. Bioinformatic and experimental validation also indicated that >85% of the microarray probes were specific for their corresponding target genes and for a few homologs within the same microbial family. The validated probe set was used to query gene expression responses by microbial assemblages to environmental variability. Sixty-four samples from the river, estuary, plume, and adjacent ocean were collected in different seasons and analyzed to correlate the measured variability in chemical, physical and biological water parameters to differences in global gene expression profiles. The method produced robust seasonal profiles corresponding to pre-freshet spring (April) and late summer (August). Overall relative gene expression was high in both seasons and was consistent with high microbial abundance measured by total RNA, heterotrophic bacterial production, and chlorophyll a. Both seasonal patterns involved large numbers of genes that were highly expressed relative to background, yet each produced very different gene expression profiles. April patterns revealed high differential gene expression in the coastal margin samples (estuary, plume and adjacent ocean) relative to freshwater, while little differential gene expression was observed along the river-to-ocean transition in August. Microbial gene expression profiles appeared to relate, in part, to seasonal differences in nutrient availability and potential resource competition. Furthermore, our results suggest that highly-active particle-attached microbiota in the Columbia River water column may perform dissimilatory nitrate reduction (both dentrification and DNRA) within anoxic particle microniches. PMID:20967204

  16. Comparison of Five Major Trichome Regulatory Genes in Brassica villosa with Orthologues within the Brassicaceae

    PubMed Central

    Nayidu, Naghabushana K.; Kagale, Sateesh; Taheri, Ali; Withana-Gamage, Thushan S.; Parkin, Isobel A. P.; Sharpe, Andrew G.; Gruber, Margaret Y.

    2014-01-01

    Coding sequences for major trichome regulatory genes, including the positive regulators GLABRA 1(GL1), GLABRA 2 (GL2), ENHANCER OF GLABRA 3 (EGL3), and TRANSPARENT TESTA GLABRA 1 (TTG1) and the negative regulator TRIPTYCHON (TRY), were cloned from wild Brassica villosa, which is characterized by dense trichome coverage over most of the plant. Transcript (FPKM) levels from RNA sequencing indicated much higher expression of the GL2 and TTG1 regulatory genes in B. villosa leaves compared with expression levels of GL1 and EGL3 genes in either B. villosa or the reference genome species, glabrous B. oleracea; however, cotyledon TTG1 expression was high in both species. RNA sequencing and Q-PCR also revealed an unusual expression pattern for the negative regulators TRY and CPC, which were much more highly expressed in trichome-rich B. villosa leaves than in glabrous B. oleracea leaves and in glabrous cotyledons from both species. The B. villosa TRY expression pattern also contrasted with TRY expression patterns in two diploid Brassica species, and with the Arabidopsis model for expression of negative regulators of trichome development. Further unique sequence polymorphisms, protein characteristics, and gene evolution studies highlighted specific amino acids in GL1 and GL2 coding sequences that distinguished glabrous species from hairy species and several variants that were specific for each B. villosa gene. Positive selection was observed for GL1 between hairy and non-hairy plants, and as expected the origin of the four expressed positive trichome regulatory genes in B. villosa was predicted to be from B. oleracea. In particular the unpredicted expression patterns for TRY and CPC in B. villosa suggest additional characterization is needed to determine the function of the expanded families of trichome regulatory genes in more complex polyploid species within the Brassicaceae. PMID:24755905

  17. Tissue distribution and early developmental expression patterns of aldolase A, B, and C in grass carp Ctenopharyngodon idellus.

    PubMed

    Fan, J J; Bai, J J; Ma, D M; Yu, L Y; Jiang, P

    2017-09-27

    Aldolase is a key enzyme involved in glycolysis, gluconeogenesis, and the pentose phosphate pathway. To establish the expression patterns of all three aldolase isozyme genes in different tissues and during early embryogenesis in lower vertebrates, as well as to explore the functional differences between these three isozymes, the grass carp was selected as a model owing to its relatively high glucose-metabolizing capability. Based on the cDNA sequences of the aldolase A, B, and C genes, the expression patterns of these three isozymes were analyzed in different tissues and during early embryogenesis using quantitative real-time polymerase chain reaction (qRT-PCR). Sequence analysis of cDNAs indicated that aldolase A, B, and C (GenBank accession numbers: KM192250, KM192251, and KM192252) consist of 364, 364, and 363 amino acids, respectively. The qRT-PCR results showed that the expression levels of aldolase A, B, and C were highest in the muscle, liver, and brain, respectively. Aldolase A and C exhibited similar expression patterns during embryogenesis, with high levels observed in unfertilized and fertilized eggs and at the blastocyst stage, followed by a decline and then increase after organogenesis. In contrast, aldolase B transcript was not detected during the unfertilized egg stage, and appeared only from gastrulation; the expression increased markedly during the feeding period (72 h after hatching), at which point the level was higher than those of aldolase A and C. These data suggest that the glucose content of grass carp starter feed should be adjusted according to the metabolic activity of aldolase B.

  18. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures

    PubMed Central

    Liu, Juan; Franks, Robert G.; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin;  (Jenny) Xiang, Qiu-Yun

    2013-01-01

    Background and Aims LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Methods Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT–PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. Key Results cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. Conclusions The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories. PMID:24052556

  19. Characterization of the sequence and expression pattern of LFY homologues from dogwood species (Cornus) with divergent inflorescence architectures.

    PubMed

    Liu, Juan; Franks, Robert G; Feng, Chun-Miao; Liu, Xiang; Fu, Cheng-Xin; Jenny Xiang, Qiu-Yun

    2013-11-01

    LFY homologues encode transcription factors that regulate the transition from vegetative to reproductive growth in flowering plants and have been shown to control inflorescence patterning in model species. This study investigated the expression patterns of LFY homologues within the diverse inflorescence types (head-like, umbel-like and inflorescences with elongated internodes) in closely related lineages in the dogwood genus (Cornus s.l.). The study sought to determine whether LFY homologues in Cornus species are expressed during floral and inflorescence development and if the pattern of expression is consistent with a function in regulating floral development and inflorescence architectures in the genus. Total RNAs were extracted using the CTAB method and the first-strand cDNA was synthesized using the SuperScript III first-strand synthesis system kit (Invitrogen). Expression of CorLFY was investigated by RT-PCR and RNA in situ hybridization. Phylogenetic analyses were conducted using the maximum likelihood methods implemented in RAxML-HPC v7.2.8. cDNA clones of LFY homologues (designated CorLFY) were isolated from six Cornus species bearing different types of inflorescence. CorLFY cDNAs were predicted to encode proteins of approximately 375 amino acids. The detection of CorLFY expression patterns using in situ RNA hybridization demonstrated the expression of CorLFY within the inflorescence meristems, inflorescence branch meristems, floral meristems and developing floral organ primordia. PCR analyses for cDNA libraries derived from reverse transcription of total RNAs showed that CorLFY was also expressed during the late-stage development of flowers and inflorescences, as well as in bracts and developing leaves. Consistent differences in the CorLFY expression patterns were not detected among the distinct inflorescence types. The results suggest a role for CorLFY genes during floral and inflorescence development in dogwoods. However, the failure to detect expression differences between the inflorescence types in the Cornus species analysed suggests that the evolutionary shift between major inflorescence types in the genus is not controlled by dramatic alterations in the levels of CorLFY gene transcript accumulation. However, due to spatial, temporal and quantitative limitations of the expression data, it cannot be ruled out that subtle differences in the level or location of CorLFY transcripts may underlie the different inflorescence architectures that are observed across these species. Alternatively, differences in CorLFY protein function or the expression or function of other regulators (e.g. TFL1 and UFO homologues) may support the divergent developmental trajectories.

  20. The Smad4/PTEN Expression Pattern Predicts Clinical Outcomes in Colorectal Adenocarcinoma.

    PubMed

    Chung, Yumin; Wi, Young Chan; Kim, Yeseul; Bang, Seong Sik; Yang, Jung-Ho; Jang, Kiseok; Min, Kyueng-Whan; Paik, Seung Sam

    2018-01-01

    Smad4 and PTEN are prognostic indicators for various tumor types. Smad4 regulates tumor suppression, whereas PTEN inhibits cell proliferation. We analyzed and compared the performance of Smad4 and PTEN for predicting the prognosis of patients with colorectal adenocarcinoma. Combined expression patterns based on Smad4+/- and PTEN+/- status were evaluated by immunostaining using a tissue microarray of colorectal adenocarcinoma. The relationships between the protein expression and clinicopathological variables were analyzed. Smad4-/PTEN- status was most frequently observed in metastatic adenocarcinoma, followed by primary adenocarcinoma and tubular adenoma (p<.001). When Smad4-/PTEN- and Smad4+/PTEN+ groups were compared, Smad4-/PTEN- status was associated with high N stage (p=.018) and defective mismatch repair proteins (p=.006). Significant differences in diseasefree survival and overall survival were observed among the three groups (Smad4+/PTEN+, Smad4-/PTEN+ or Smad4+/PTEN-, and Smad4-/PTEN-) (all p<.05). Concurrent loss of Smad4 and PTEN may lead to more aggressive disease and poor prognosis in patients with colorectal adenocarcinoma compared to the loss of Smad4 or PTEN alone.

  1. Immunohistochemical assessment of NY-ESO-1 expression in esophageal adenocarcinoma resection specimens.

    PubMed

    Hayes, Stephen J; Hng, Keng Ngee; Clark, Peter; Thistlethwaite, Fiona; Hawkins, Robert E; Ang, Yeng

    2014-04-14

    To assess NY-ESO-1 expression in a cohort of esophageal adenocarcinomas. A retrospective search of our tissue archive for esophageal resection specimens containing esophageal adenocarcinoma was performed, for cases which had previously been reported for diagnostic purposes, using the systematised nomenclature of human and veterinary medicine coding system. Original haematoxylin and eosin stained sections were reviewed, using light microscopy, to confirm classification and tumour differentiation. A total of 27 adenocarcinoma resection specimens were then assessed using immunohistochemistry for NY-ESO-1 expression: 4 well differentiated, 14 moderately differentiated, 4 moderate-poorly differentiated, and 5 poorly differentiated. Four out of a total of 27 cases of esophageal adenocarcinoma examined (15%) displayed diffuse cytoplasmic and nuclear expression for NY-ESO-1. They displayed a heterogeneous and mosaic-type pattern of diffuse staining. Diffuse cytoplasmic staining was not identified in any of these structures: stroma, normal squamous epithelium, normal submucosal gland and duct, Barrett's esophagus (goblet cell), Barrett's esophagus (non-goblet cell) and high grade glandular dysplasia. All adenocarcinomas showed an unexpected dot-type pattern of staining at nuclear, paranuclear and cytoplasmic locations. Similar dot-type staining, with varying frequency and size of dots, was observed on examination of Barrett's metaplasia, esophageal submucosal gland acini and the large bowel negative control, predominantly at the crypt base. Furthermore, a prominent pattern of apical (luminal) cytoplasmic dot-type staining was observed in some cases of Barrett's metaplasia and also adenocarcinoma. A further morphological finding of interest was noted on examination of haematoxylin and eosin stained sections, as aggregates of lymphocytes were consistently noted to surround submucosal glands. We have demonstrated for the first time NY-ESO-1 expression by esophageal adenocarcinomas, Barrett's metaplasia and normal tissues other than germ cells.

  2. Immunohistochemical assessment of NY-ESO-1 expression in esophageal adenocarcinoma resection specimens

    PubMed Central

    Hayes, Stephen J; Hng, Keng Ngee; Clark, Peter; Thistlethwaite, Fiona; Hawkins, Robert E; Ang, Yeng

    2014-01-01

    AIM: To assess NY-ESO-1 expression in a cohort of esophageal adenocarcinomas. METHODS: A retrospective search of our tissue archive for esophageal resection specimens containing esophageal adenocarcinoma was performed, for cases which had previously been reported for diagnostic purposes, using the systematised nomenclature of human and veterinary medicine coding system. Original haematoxylin and eosin stained sections were reviewed, using light microscopy, to confirm classification and tumour differentiation. A total of 27 adenocarcinoma resection specimens were then assessed using immunohistochemistry for NY-ESO-1 expression: 4 well differentiated, 14 moderately differentiated, 4 moderate-poorly differentiated, and 5 poorly differentiated. RESULTS: Four out of a total of 27 cases of esophageal adenocarcinoma examined (15%) displayed diffuse cytoplasmic and nuclear expression for NY-ESO-1. They displayed a heterogeneous and mosaic-type pattern of diffuse staining. Diffuse cytoplasmic staining was not identified in any of these structures: stroma, normal squamous epithelium, normal submucosal gland and duct, Barrett’s esophagus (goblet cell), Barrett’s esophagus (non-goblet cell) and high grade glandular dysplasia. All adenocarcinomas showed an unexpected dot-type pattern of staining at nuclear, paranuclear and cytoplasmic locations. Similar dot-type staining, with varying frequency and size of dots, was observed on examination of Barrett’s metaplasia, esophageal submucosal gland acini and the large bowel negative control, predominantly at the crypt base. Furthermore, a prominent pattern of apical (luminal) cytoplasmic dot-type staining was observed in some cases of Barrett’s metaplasia and also adenocarcinoma. A further morphological finding of interest was noted on examination of haematoxylin and eosin stained sections, as aggregates of lymphocytes were consistently noted to surround submucosal glands. CONCLUSION: We have demonstrated for the first time NY-ESO-1 expression by esophageal adenocarcinomas, Barrett’s metaplasia and normal tissues other than germ cells. PMID:24744590

  3. Regional patterns of earthquake-triggered landslides and their relation to ground motion

    NASA Astrophysics Data System (ADS)

    Meunier, Patrick; Hovius, Niels; Haines, A. John

    2007-10-01

    We have documented patterns of landsliding associated with large earthquakes on three thrust faults: the Northridge earthquake in California, Chi-Chi earthquake in Taiwan, and two earthquakes on the Ramu-Markham fault bounding the Finisterre Mountains of Papua New Guinea. In each case, landslide densities are shown to be greatest in the area of strongest ground acceleration and to decay with distance from the epicenter. In California and Taiwan, the density of co-seismic landslides is linearly and highly correlated with both the vertical and horizontal components of measured peak ground acceleration. Based on this observation, we derive an expression for the spatial variation of landslide density analogous with regional seismic attenuation laws. In its general form, this expression applies to our three examples, and we determine best fit values for individual cases. Our findings open a window on the construction of shake maps from geomorphic observations for earthquakes in non-instrumented regions.

  4. DNA methylation modulates H19 and IGF2 expression in porcine female eye

    PubMed Central

    Wang, Dongxu; Wang, Guodong; Yang, Hao; Liu, Haibo; Li, Cuie; Li, Xiaolan; Lin, Chao; Song, Yuning; Li, Zhanjun; Liu, Dianfeng

    2017-01-01

    Abstract The sexually dimorphic expression of H19/IGF2 is evolutionarily conserved. To investigate whether the expression of H19/IGF2 in the female porcine eye is sex-dependent, gene expression and methylation status were evaluated using quantitative real-time PCR (qPCR) and bisulfite sequencing PCR (BSP). We hypothesized that H19/IGF2 might exhibit a different DNA methylation status in the female eye. In order to evaluate our hypothesis, parthenogenetic (PA) cells were used for analysis by qPCR and BSP. Our results showed that H19 and IGF2 were over-expressed in the female eye compared with the male eye (3-fold and 2-fold, respectively). We observed a normal monoallelic methylation pattern for H19 differentially methylated regions (DMRs). Compared with H19 DMRs, IGF2 DMRs showed a different methylation pattern in the eye. Taken together, these results suggest that elevated expression of H19/IGF2 is caused by a specific chromatin structure that is regulated by the DNA methylation status of IGF2 DMRs in the female eye. PMID:28266684

  5. Effects of intrinsic stochasticity on delayed reaction-diffusion patterning systems.

    PubMed

    Woolley, Thomas E; Baker, Ruth E; Gaffney, Eamonn A; Maini, Philip K; Seirin-Lee, Sungrim

    2012-05-01

    Cellular gene expression is a complex process involving many steps, including the transcription of DNA and translation of mRNA; hence the synthesis of proteins requires a considerable amount of time, from ten minutes to several hours. Since diffusion-driven instability has been observed to be sensitive to perturbations in kinetic delays, the application of Turing patterning mechanisms to the problem of producing spatially heterogeneous differential gene expression has been questioned. In deterministic systems a small delay in the reactions can cause a large increase in the time it takes a system to pattern. Recently, it has been observed that in undelayed systems intrinsic stochasticity can cause pattern initiation to occur earlier than in the analogous deterministic simulations. Here we are interested in adding both stochasticity and delays to Turing systems in order to assess whether stochasticity can reduce the patterning time scale in delayed Turing systems. As analytical insights to this problem are difficult to attain and often limited in their use, we focus on stochastically simulating delayed systems. We consider four different Turing systems and two different forms of delay. Our results are mixed and lead to the conclusion that, although the sensitivity to delays in the Turing mechanism is not completely removed by the addition of intrinsic noise, the effects of the delays are clearly ameliorated in certain specific cases.

  6. Diurnal lighting patterns and habitat alter opsin expression and colour preferences in a killifish

    PubMed Central

    Johnson, Ashley M.; Stanis, Shannon; Fuller, Rebecca C.

    2013-01-01

    Spatial variation in lighting environments frequently leads to population variation in colour patterns, colour preferences and visual systems. Yet lighting conditions also vary diurnally, and many aspects of visual systems and behaviour vary over this time scale. Here, we use the bluefin killifish (Lucania goodei) to compare how diurnal variation and habitat variation (clear versus tannin-stained water) affect opsin expression and the preference to peck at different-coloured objects. Opsin expression was generally lowest at midnight and dawn, and highest at midday and dusk, and this diurnal variation was many times greater than variation between habitats. Pecking preference was affected by both diurnal and habitat variation but did not correlate with opsin expression. Rather, pecking preference matched lighting conditions, with higher preferences for blue at noon and for red at dawn/dusk, when these wavelengths are comparatively scarce. Similarly, blue pecking preference was higher in tannin-stained water where blue wavelengths are reduced. In conclusion, L. goodei exhibits strong diurnal cycles of opsin expression, but these are not tightly correlated with light intensity or colour. Temporally variable pecking preferences probably result from lighting environment rather than from opsin production. These results may have implications for the colour pattern diversity observed in these fish. PMID:23698009

  7. The value of molecular expression of KIT and KIT ligand analysed using real-time polymerase chain reaction and immunohistochemistry as a prognostic indicator for canine cutaneous mast cell tumours.

    PubMed

    Costa Casagrande, T A; de Oliveira Barros, L M; Fukumasu, H; Cogliati, B; Chaible, L M; Dagli, M L Z; Matera, J M

    2015-03-01

    This study investigated the correlation between KIT gene expression determined by immunohistochemistry and real-time polymerase chain reaction (RT-PCR) and the rate of tumour recurrence and tumour-related deaths in dogs affected with mast cell tumour (MCT). Kaplan-Meier curves were constructed to compare tumour recurrence and tumour-related death between patients. The log-rank test was used to check for significant differences between curves. KIT-I, KIT-II and KIT-III staining patterns were observed in 9 (11.11%), 50 (61.73%) and 22 (27.16%) tumours, respectively. Tumour recurrence rates and tumour-related deaths were not associated with KIT staining patterns (P = 0278, P > 0.05), KIT (P = 0.289, P > 0.05) or KIT ligand (P = 0.106, P > 0.05) gene expression. Despite the lack of association between KIT staining pattern and patient survival time, the results suggest a correlation between aberrant KIT localization and increased proliferative activity of MCTs. RT-PCR seems to be a sensible method for quantitative detection of KIT gene expression in canine MCT, although expressions levels are not correlated with prognosis. © 2013 Blackwell Publishing Ltd.

  8. Cell Fusion Reprogramming Leads to a Specific Hepatic Expression Pattern during Mouse Bone Marrow Derived Hepatocyte Formation In Vivo

    PubMed Central

    Arza, Elvira; Alvarez-Barrientos, Alberto; Fabregat, Isabel; Garcia-Bravo, Maria; Meza, Nestor W.; Segovia, Jose C.

    2012-01-01

    The fusion of bone marrow (BM) hematopoietic cells with hepatocytes to generate BM derived hepatocytes (BMDH) is a natural process, which is enhanced in damaged tissues. However, the reprogramming needed to generate BMDH and the identity of the resultant cells is essentially unknown. In a mouse model of chronic liver damage, here we identify a modification in the chromatin structure of the hematopoietic nucleus during BMDH formation, accompanied by the loss of the key hematopoietic transcription factor PU.1/Sfpi1 (SFFV proviral integration 1) and gain of the key hepatic transcriptional regulator HNF-1A homeobox A (HNF-1A/Hnf1a). Through genome-wide expression analysis of laser captured BMDH, a differential gene expression pattern was detected and the chromatin changes observed were confirmed at the level of chromatin regulator genes. Similarly, Tranforming Growth Factor-β1 (TGF-β1) and neurotransmitter (e.g. Prostaglandin E Receptor 4 [Ptger4]) pathway genes were over-expressed. In summary, in vivo BMDH generation is a process in which the hematopoietic cell nucleus changes its identity and acquires hepatic features. These BMDHs have their own cell identity characterized by an expression pattern different from hematopoietic cells or hepatocytes. The role of these BMDHs in the liver requires further investigation. PMID:22457803

  9. Dissociation of sensitivities to tumor promotion and progression in outbred and inbred SENCAR mice.

    PubMed

    Gimenez-Conti, I B; Bianchi, A B; Fischer, S M; Reiners, J J; Conti, C J; Slaga, T J

    1992-06-15

    The sensitivity of outbred SENCAR mice and inbred SENCAR (SSIN) mice to multistage carcinogenesis was studied. Tumors were induced using either 7,12-dimethylbenz[a]anthracene or N-methyl-N'-nitro-N-nitrosoguanidine as initiators and 12-O-tetradecanoylphorbol-13-acetate or benzoyl peroxide as promoting agents. Although the number of papillomas per mouse was higher in SSIN than in outbred SENCAR mice, the number of carcinomas observed in the SSIN strain was significantly lower regardless of the initiator or promoter used. It was also observed that the expression of markers of premalignant progression (i.e., dysplasia, expression of keratin K13, and loss of keratin K1 expression) was markedly suppressed in SSIN papillomas. After 50 wk of promotion with 12-O-tetradecanoylphorbol-13-acetate, the pattern of expression of K13 and K1 in SSIN mice was comparable to the pattern observed in outbred SENCAR mice after 10 to 20 wk of promotion with 12-O-tetradecanoylphorbol-13-acetate. It was also observed that 67% of the tumors induced in SSIN mice by initiation with 7,12-dimethylbenz[a]anthracene exhibited a mutation in codon 61 of the Ha-ras-1 gene. This latter finding suggests that the differences observed in tumor progression between the inbred strain and the outbred stock are not related to a genetic alteration in the Ha-ras-1 gene but rather to an independent event that we have postulated to involve a putative suppressor gene. The data reported here suggest that the putative gene(s) that confers susceptibility to tumor promotion was segregated from the gene(s) involved in tumor progression during selection and inbreeding of the SENCAR mouse stock.

  10. Successful pod infections by Moniliophthora roreri result in differential Theobroma cacao gene expression depending on the clone's level of tolerance.

    PubMed

    Ali, Shahin S; Melnick, Rachel L; Crozier, Jayne; Phillips-Mora, Wilberth; Strem, Mary D; Shao, Jonathan; Zhang, Dapeng; Sicher, Richard; Meinhardt, Lyndel; Bailey, Bryan A

    2014-09-01

    An understanding of the tolerance mechanisms of Theobroma cacao used against Moniliophthora roreri, the causal agent of frosty pod rot, is important for the generation of stable disease-tolerant clones. A comparative view was obtained of transcript populations of infected pods from two susceptible and two tolerant clones using RNA sequence (RNA-Seq) analysis. A total of 3009 transcripts showed differential expression among clones. KEGG (Kyoto Encyclopedia of Genes and Genomes) pathway analysis of differentially expressed genes indicated shifts in 152 different metabolic pathways between the tolerant and susceptible clones. Real-time quantitative reverse transcription polymerase chain reaction (real-time qRT-PCR) analyses of 36 genes verified the differential expression. Regression analysis validated a uniform progression in gene expression in association with infection levels and fungal loads in the susceptible clones. Expression patterns observed in the susceptible clones diverged in tolerant clones, with many genes showing higher expression at a low level of infection and fungal load. Principal coordinate analyses of real-time qRT-PCR data separated the gene expression patterns between susceptible and tolerant clones for pods showing malformation. Although some genes were constitutively differentially expressed between clones, most results suggested that defence responses were induced at low fungal load in the tolerant clones. Several elicitor-responsive genes were highly expressed in tolerant clones, suggesting rapid recognition of the pathogen and induction of defence genes. Expression patterns suggested that the jasmonic acid-ethylene- and/or salicylic acid-mediated defence pathways were activated in the tolerant clones, being enhanced by reduced brassinosteroid (BR) biosynthesis and catabolic inactivation of both BR and abscisic acids. Finally, several genes associated with hypersensitive response-like cell death were also induced in tolerant clones. © 2014 BSPP AND JOHN WILEY & SONS LTD.

  11. Subdivision of arthropod cap-n-collar expression domains is restricted to Mandibulata

    PubMed Central

    2014-01-01

    Background The monophyly of Mandibulata - the division of arthropods uniting pancrustaceans and myriapods - is consistent with several morphological characters, such as the presence of sensory appendages called antennae and the eponymous biting appendage, the mandible. Functional studies have demonstrated that the patterning of the mandible requires the activity of the Hox gene Deformed and the transcription factor cap-n-collar (cnc) in at least two holometabolous insects: the fruit fly Drosophila melanogaster and the beetle Tribolium castaneum. Expression patterns of cnc from two non-holometabolous insects and a millipede have suggested conservation of the labral and mandibular domains within Mandibulata. However, the activity of cnc is unknown in crustaceans and chelicerates, precluding understanding of a complete scenario for the evolution of patterning of this appendage within arthropods. To redress these lacunae, here we investigate the gene expression of the ortholog of cnc in Parhyale hawaiensis, a malacostracan crustacean, and two chelicerates: the harvestman Phalangium opilio, and the scorpion Centruroides sculpturatus. Results In the crustacean P. hawaiensis, the segmental expression of Ph-cnc is the same as that reported previously in hexapods and myriapods, with two distinct head domains in the labrum and the mandibular segment. In contrast, Po-cnc and Cs-cnc expression is not enriched in the labrum of either chelicerate, but instead is expressed at comparable levels in all appendages. In further contrast to mandibulate orthologs, the expression domain of Po-cnc posterior to the labrum is not confined within the expression domain of Po-Dfd. Conclusions Expression data from two chelicerate outgroup taxa suggest that the signature two-domain head expression pattern of cnc evolved at the base of Mandibulata. The observation of the archetypal labral and mandibular segment domains in a crustacean exemplar supports the synapomorphic nature of mandibulate cnc expression. The broader expression of Po-cnc with respect to Po-Dfd in chelicerates further suggests that the regulation of cnc by Dfd was also acquired at the base of Mandibulata. To test this hypothesis, future studies examining panarthropod cnc evolution should investigate expression of the cnc ortholog in arthropod outgroups, such as Onychophora and Tardigrada. PMID:24405788

  12. Expression of pathogenicity-related genes of Xylella fastidiosa in vitro and in planta.

    PubMed

    de Souza, Alessandra A; Takita, Marco A; Pereira, Eridan O; Coletta-Filho, Helvécio D; Machado, Marcos A

    2005-04-01

    Xylella fastidiosa is responsible for several economically important plant diseases. It is currently assumed that the symptoms are caused by vascular occlusion due to biofilm formation. Microarray technology was previously used to examine the global gene expression profile of X. fastidiosa freshly isolated from symptomatic plants or after several passages by axenic culture medium, and different pathogenicity profiles have been obtained. In the present study the expression of some pathogenicity-related genes was evaluated in vitro and in planta by RT-PCR. The results suggest that adhesion is important at the beginning of biofilm formation, while the genes related to adaptation are essential for the organism's maintenance in planta. Similar results were observed in vitro mainly for the adhesion genes. The pattern of expression observed suggests that adhesion modulates biofilm formation whereas the expression of some adaptation genes may be related to the environment in which the organism is living.

  13. Introduction of the human AVPR1A gene substantially alters brain receptor expression patterns and enhances aspects of social behavior in transgenic mice.

    PubMed

    Charles, Rhonda; Sakurai, Takeshi; Takahashi, Nagahide; Elder, Gregory A; Gama Sosa, Miguel A; Young, Larry J; Buxbaum, Joseph D

    2014-08-01

    Central arginine vasopressin receptor 1A (AVPR1A) modulates a wide range of behaviors, including stress management and territorial aggression, as well as social bonding and recognition. Inter- and intra-species variations in the expression pattern of AVPR1A in the brain and downstream differential behavioral phenotypes have been attributed to differences in the non-coding regions of the AVPR1A gene, including polymorphic elements within upstream regulatory areas. Gene association studies have suggested a link between AVPR1A polymorphisms and autism, and AVPR1A has emerged as a potential pharmacological target for treatment of social cognitive impairments and mood and anxiety disorders. To further investigate the genetic mechanism giving rise to species differences in AVPR1A expression patterns and associated social behaviors, and to create a preclinical mouse model useful for screening drugs targeting AVPR1A, we engineered and extensively characterized bacterial artificial chromosome (BAC) transgenic mice harboring the entire human AVPR1A locus with the surrounding regulatory elements. Compared with wild-type animals, the humanized mice displayed a more widely distributed ligand-AVPR1A binding pattern, which overlapped with that of primates. Furthermore, humanized AVPR1A mice displayed increased reciprocal social interactions compared with wild-type animals, but no differences in social approach and preference for social novelty were observed. Aspects of learning and memory, specifically novel object recognition and spatial relocation recognition, were unaffected. The biological alterations in humanized AVPR1A mice resulted in the rescue of the prepulse inhibition impairments that were observed in knockout mice, indicating conserved functionality. Although further behavioral paradigms and additional cohorts need to be examined in humanized AVPR1A mice, the results demonstrate that species-specific variations in the genomic content of regulatory regions surrounding the AVPR1A locus are responsible for differential receptor protein expression patterns across species and that they are likely to contribute to species-specific behavioral variation. The humanized AVPR1A mouse is a potential preclinical model for further understanding the regulation of receptor gene expression and the impact of variation in receptor expression on behaviors, and should be useful for screening drugs targeting human AVPR1A, taking advantage of the expression of human AVPR1A in human-relevant brain regions. © 2014. Published by The Company of Biologists Ltd.

  14. A face versus non-face context influences amygdala responses to masked fearful eye whites.

    PubMed

    Kim, M Justin; Solomon, Kimberly M; Neta, Maital; Davis, F Caroline; Oler, Jonathan A; Mazzulla, Emily C; Whalen, Paul J

    2016-12-01

    The structure of the mask stimulus is crucial in backward masking studies and we recently demonstrated such an effect when masking faces. Specifically, we showed that activity of the amygdala is increased to fearful facial expressions masked with neutral faces and decreased to fearful expressions masked with a pattern mask-but critically both masked conditions discriminated fearful expressions from happy expressions. Given this finding, we sought to test whether masked fearful eye whites would produce a similar profile of amygdala response in a face vs non-face context. During functional magnetic resonance imaging scanning sessions, 30 participants viewed fearful or happy eye whites masked with either neutral faces or pattern images. Results indicated amygdala activity was increased to fearful vs happy eye whites in the face mask condition, but decreased to fearful vs happy eye whites in the pattern mask condition-effectively replicating and expanding our previous report. Our data support the idea that the amygdala is responsive to fearful eye whites, but that the nature of this activity observed in a backward masking design depends on the mask stimulus. © The Author (2016). Published by Oxford University Press.

  15. Faster embryonic segmentation through elevated Delta-Notch signalling

    PubMed Central

    Liao, Bo-Kai; Jörg, David J.; Oates, Andrew C.

    2016-01-01

    An important step in understanding biological rhythms is the control of period. A multicellular, rhythmic patterning system termed the segmentation clock is thought to govern the sequential production of the vertebrate embryo's body segments, the somites. Several genetic loss-of-function conditions, including the Delta-Notch intercellular signalling mutants, result in slower segmentation. Here, we generate DeltaD transgenic zebrafish lines with a range of copy numbers and correspondingly increased signalling levels, and observe faster segmentation. The highest-expressing line shows an altered oscillating gene expression wave pattern and shortened segmentation period, producing embryos with more, shorter body segments. Our results reveal surprising differences in how Notch signalling strength is quantitatively interpreted in different organ systems, and suggest a role for intercellular communication in regulating the output period of the segmentation clock by altering its spatial pattern. PMID:27302627

  16. TRMM-TMI Satellite Observed Soil Moisture and Vegetation Density (1998-2005) Show Strong Connection with El Nino in Eastern Australia

    NASA Technical Reports Server (NTRS)

    Liu, Yi; van Dijk, Albert I.J.M.; Owe, Manfred

    2007-01-01

    Spatiotemporal patterns in soil moisture and vegetation water content across mainland Australia were investigated from 1998 through 2005, using TRMMITMI passive microwave observations. The Empirical Orthogonal Function technique was used to extract dominant spatial and temporal patterns in retrieved estimates of moisture content for the top 1-cm of soil (theta) and vegetation moisture content (via optical depth tau). The dominant temporal theta and tau patterns were strongly correlated to El Nino/Southern Oscillation (ENSO) in spring (3 = 0.90), and to a progressively lesser extent autumn, summer and winter. The Indian Ocean Dipole (IOD) index also explained part of the variation in spring 8 and z. Cluster analysis suggested that the regions most affected by ENS0 are mainly located in eastern Australia. The results suggest that the drought conditions experienced in eastern Australia since 2000 an clearly expressed in these satellite observations have a strong connection with ENSO patterns.

  17. Functioning of Fluorescent Proteins in Aggregates in Anthozoa Species and in Recombinant Artificial Models

    PubMed Central

    Povarova, Natalia V.; Petri, Natalia D.; Blokhina, Anna E.; Bogdanov, Alexey M.; Lukyanov, Konstantin A.

    2017-01-01

    Despite great advances in practical applications of fluorescent proteins (FPs), their natural function is poorly understood. FPs display complex spatio-temporal expression patterns in living Anthozoa coral polyps. Here we applied confocal microscopy, specifically, the fluorescence recovery after photobleaching (FRAP) technique to analyze intracellular localization and mobility of endogenous FPs in live tissues. We observed three distinct types of protein distributions in living tissues. One type of distribution, characteristic for Anemonia, Discosoma and Zoanthus, is free, highly mobile cytoplasmic localization. Another pattern is seen in FPs localized to numerous intracellular vesicles, observed in Clavularia. The third most intriguing type of intracellular localization is with respect to the spindle-shaped aggregates and lozenge crystals several micrometers in size observed in Zoanthus samples. No protein mobility within those structures was detected by FRAP. This finding encouraged us to develop artificial aggregating FPs. We constructed “trio-FPs” consisting of three tandem copies of tetrameric FPs and demonstrated that they form multiple bright foci upon expression in mammalian cells. High brightness of the aggregates is advantageous for early detection of weak promoter activities. Simultaneously, larger aggregates can induce significant cytostatic and cytotoxic effects and thus such tags are not suitable for long-term and high-level expression. PMID:28704934

  18. The activation pattern of macrophages in giant cell (temporal) arteritis and primary angiitis of the central nervous system.

    PubMed

    Mihm, Bernhard; Bergmann, Markus; Brück, Wolfgang; Probst-Cousin, Stefan

    2014-06-01

    To determine if the pattern of macrophage activation reflects differences in the pathogenesis and clinical presentation of giant cell arteritis and primary angiitis of the central nervous system, specimens of 10 patients with giant cell arteritis and five with primary angiitis of the central nervous system were immunohistochemically studied and the expression of the macrophage activation markers 27E10, MRP14, MRP8 and 25F9 was determined in the vasculitic infiltrates. Thus, a partly different expression pattern of macrophage activation markers in giant cell arteritis and primary angiitis of the central nervous system was observed. The group comparison revealed that giant cell arteritis cases had significantly higher numbers of acute activated MRP14-positive macrophages, whereas primary angiitis of the central nervous system is characterized by a tendency toward more MRP8-positive intermediate/late activated macrophages. Furthermore, in giant cell arteritis comparably fewer CD8-positive lymphocytes were observed. These observations suggest, that despite their histopathological similarities, giant cell arteritis and primary angiitis of the central nervous system appear to represent either distinct entities within the spectrum of granulomatous vasculitides or different stages of similar disease processes. Their discrete clinical presentation is reflected by different activation patterns of macrophages, which may characterize giant cell arteritis as a more acute process and primary angiitis of the central nervous system as a more advanced inflammatory process. © 2013 Japanese Society of Neuropathology.

  19. Predicting human genetic interactions from cancer genome evolution.

    PubMed

    Lu, Xiaowen; Megchelenbrink, Wout; Notebaart, Richard A; Huynen, Martijn A

    2015-01-01

    Synthetic Lethal (SL) genetic interactions play a key role in various types of biological research, ranging from understanding genotype-phenotype relationships to identifying drug-targets against cancer. Despite recent advances in empirical measuring SL interactions in human cells, the human genetic interaction map is far from complete. Here, we present a novel approach to predict this map by exploiting patterns in cancer genome evolution. First, we show that empirically determined SL interactions are reflected in various gene presence, absence, and duplication patterns in hundreds of cancer genomes. The most evident pattern that we discovered is that when one member of an SL interaction gene pair is lost, the other gene tends not to be lost, i.e. the absence of co-loss. This observation is in line with expectation, because the loss of an SL interacting pair will be lethal to the cancer cell. SL interactions are also reflected in gene expression profiles, such as an under representation of cases where the genes in an SL pair are both under expressed, and an over representation of cases where one gene of an SL pair is under expressed, while the other one is over expressed. We integrated the various previously unknown cancer genome patterns and the gene expression patterns into a computational model to identify SL pairs. This simple, genome-wide model achieves a high prediction power (AUC = 0.75) for known genetic interactions. It allows us to present for the first time a comprehensive genome-wide list of SL interactions with a high estimated prediction precision, covering up to 591,000 gene pairs. This unique list can potentially be used in various application areas ranging from biotechnology to medical genetics.

  20. Differential Lectin Binding Patterns Identify Distinct Heart Regions in Giant Danio (Devario aequipinnatus) and Zebrafish (Danio rerio) Hearts

    PubMed Central

    Manalo, Trina; May, Adam; Quinn, Joshua; Lafontant, Dominique S.; Shifatu, Olubusola; He, Wei; Gonzalez-Rosa, Juan M.; Burns, Geoffrey C.; Burns, Caroline E.; Burns, Alan R.; Lafontant, Pascal J.

    2016-01-01

    Lectins are carbohydrate-binding proteins commonly used as biochemical and histochemical tools to study glycoconjugate (glycoproteins, glycolipids) expression patterns in cells, tissues, including mammalian hearts. However, lectins have received little attention in zebrafish (Danio rerio) and giant danio (Devario aequipinnatus) heart studies. Here, we sought to determine the binding patterns of six commonly used lectins—wheat germ agglutinin (WGA), Ulex europaeus agglutinin, Bandeiraea simplicifolia lectin (BS lectin), concanavalin A (Con A), Ricinus communis agglutinin I (RCA I), and Lycopersicon esculentum agglutinin (tomato lectin)—in these hearts. Con A showed broad staining in the myocardium. WGA stained cardiac myocyte borders, with binding markedly stronger in the compact heart and bulbus. BS lectin, which stained giant danio coronaries, was used to measure vascular reconstruction during regeneration. However, BS lectin reacted poorly in zebrafish. RCA I stained the compact heart of both fish. Tomato lectin stained the giant danio, and while low reactivity was seen in the zebrafish ventricle, staining was observed in their transitional cardiac myocytes. In addition, we observed unique staining patterns in the developing zebrafish heart. Lectins’ ability to reveal differential glycoconjugate expression in giant danio and zebrafish hearts suggests they can serve as simple but important tools in studies of developing, adult, and regenerating fish hearts. PMID:27680670

  1. Self-reflection and positive schizotypy in the adolescent brain.

    PubMed

    Debbané, Martin; Vrtička, Pascal; Lazouret, Marine; Badoud, Deborah; Sander, David; Eliez, Stephan

    2014-01-01

    Clinical and phenomenological accounts of schizophrenia suggest that impairments in self-reflective processes significantly contribute to psychopathological expression. Recent imaging studies observe atypical cerebral activation patterns during self-reflection, especially around the cortical midline structures, both in psychosis-prone adults and individuals with schizophrenia. Given that self-reflection processes consolidate during adolescence, and that early transient expression of psychosis (positive schizotypy) also arises during this period, the present study sought to examine whether atypical cerebral activation during self-reflection task could be associated with early schizotypic expression during adolescence. Forty-two neurotypical adolescent participants (19 females) aged from 12 to 19 (15.92±1.9) underwent a self-reflection task using functional neuroimaging (fMRI), where they had to evaluate trait adjectives (1 to 4 ratings) about themselves or their same sex best friend. The Schizotypal Personality Questionnaire (SPQ) was employed to assess positive schizotypic expression. Results showed that positive schizotypy in adolescents significantly correlated with cortical midline activation patterns in the dorsomedial prefrontal cortex (dmPFC) and the posterior cingulate cortex (PCC), as well as the dorsolateral PFC and the lingual gyrus. The results are consistent with previous imaging literature on self-reflection and schizophrenia. They further highlight that the relationship between self-reflection processes and positive schizotypy operates at the trait level of expression and can be observed as early as adolescence. Copyright © 2013 Elsevier B.V. All rights reserved.

  2. Mapping MRI/MRS Parameters with Genetic Over-expression Profiles In Human Prostate Cancer: Demonstrating the Potential

    PubMed Central

    Lenkinski, Robert E.; Bloch, B. Nicholas; Liu, Fangbing; Frangioni, John V.; Perner, Sven; Rubin, Mark A.; Genega, Elizabeth; Rofsky, Neil M.; Gaston, Sandra M.

    2009-01-01

    Magnetic resonance imaging (MRI) and MR spectroscopy can probe a variety of physiological (e.g. blood vessel permeability) and metabolic characteristics of prostate cancer. However, little is known about the changes in gene expression that underlie the spectral and imaging features observed in prostate cancer. Tumor induced changes in vascular permeability and angiogenesis are thought to contribute to patterns of dynamic contrast enhanced (DCE) MRI images of prostate cancer even though the genetic basis of tumor vasculogenesis is complex and the specific mechanisms underlying these DCEMRI features have not yet been determined. In order to identify the changes in gene expression that correspond to MRS and DCEMRI patterns in human prostate cancers, we have utilized tissue print micropeel techniques to generate “whole mount” molecular maps of radical prostatectomy specimens that correspond to pre-surgical MRI/MRS studies. These molecular maps include RNA expression profiles from both Affymetrix GeneChip microarrays and quantitative reverse transcriptase PCR (qrt-PCR) analysis, as well as immunohistochemical studies. Using these methods on patients with prostate cancer, we found robust over-expression of choline kinase a in the majority of primary tumors. We also observed overexpression of neuropeptide Y (NPY), a newly identified angiogenic factor, in a subset of DCEMRI positive prostate cancers. These studies set the stage for establishing MRI/MRS parameters as validated biomarkers for human prostate cancer. PMID:18752015

  3. Architectural patterns of p16 immunohistochemical expression associated with cancer immunity and prognosis of head and neck squamous cell carcinoma.

    PubMed

    Ryu, Hyang Joo; Kim, Eun Kyung; Heo, Su Jin; Cho, Byoung Chul; Kim, Hye Ryun; Yoon, Sun Och

    2017-11-01

    We evaluated the expression patterns of p16, which is used as a surrogate marker of HPV infection in head and neck squamous cell carcinoma (HNSCC), in regard to their biological and prognostic implications. p16 expression patterns and infiltrated immune cells were analyzed through immunohistochemistry of p16, CD3, CD8, PD-1, FOXP3, and CD163 on surgically resected HNSCCs (n = 393). Patterns of p16 immunoexpression were defined as STRONG (strong, diffuse expression in cytoplasm, and nucleus in >70% of tumor cells), MARGINAL (expression restricted to tumor margins), MOSAIC (ragged, discontinued expression), NUCLEAR (expression in nuclei only), and ABSENT (no expression). The STRONG pattern was more frequent in the oropharynx, and the MARGINAL pattern was noted only in the oral cavity. MOSAIC and NUCLEAR patterns were noted at variable sites. No two patterns of p16 expression showed the same immune cell composition of CD3+ T cells, CD8+ cytotoxic T cells, PD-1+ T cells, FOXP3+ regulatory T cells, and CD163+ macrophages. In overall and disease-free survival analyses, the STRONG pattern showed the most favorable prognosis, while the NUCLEAR pattern had the worst prognosis. HNSCC anatomical sites, tumor-related immune cell components, and patient outcomes were associated with p16 expression patterns. Each architectural pattern of p16 expression may be related to different biological and prognostic phenotypes. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  4. Expression and Enzyme Activity of Catalase in Chilo suppressalis (Lepidoptera: Crambidae) Is Responsive to Environmental Stresses.

    PubMed

    Lu, Yanhui; Bai, Qi; Zheng, Xusong; Lu, Zhongxian

    2017-08-01

    Catalase (CAT) is an important antioxidant enzyme that protects organisms against oxidative stresses by eliminating hydrogen peroxide. In this study, we cloned and characterized a full-length cDNA of CAT from Chilo suppressalis (CsCAT) and examined the influence of environmental stresses on CsCAT expression and enzyme activity. The cDNA contains a 1659-bp open reading frame encoding a polypeptide of 553 amino acids most closely related (90.14%) to Papilio polytes catalases. The CsCAT was expressed in all developmental stages with the highest expression in the fat body, and the CsCAT enzyme activity closely mirrored its observed mRNA expression patterns. The CsCAT mRNA was up-regulated when the larvae were exposed to high temperature (≥30 °C), insecticides (abamectin and chlorantraniliprole), chemicals (H2O2, CHP, CdCl2, and CuSO4), and a dead-end trap plant (vetiver grass), and the CsCAT enzyme activity again mirrored the observed CsCAT expression patterns. These results suggest that up-regulation of CsCAT may enhance the defense response of C. suppressalis by weakening the effects of environmental stresses, and provide insight into the role of CsCAT during development of C. suppressalis. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  5. MicroRNA profiling of the murine hematopoietic system

    PubMed Central

    Monticelli, Silvia; Ansel, K Mark; Xiao, Changchun; Socci, Nicholas D; Krichevsky, Anna M; Thai, To-Ha; Rajewsky, Nikolaus; Marks, Debora S; Sander, Chris; Rajewsky, Klaus; Rao, Anjana; Kosik, Kenneth S

    2005-01-01

    Background MicroRNAs (miRNAs) are a class of recently discovered noncoding RNA genes that post-transcriptionally regulate gene expression. It is becoming clear that miRNAs play an important role in the regulation of gene expression during development. However, in mammals, expression data are principally based on whole tissue analysis and are still very incomplete. Results We used oligonucleotide arrays to analyze miRNA expression in the murine hematopoietic system. Complementary oligonucleotides capable of hybridizing to 181 miRNAs were immobilized on a membrane and probed with radiolabeled RNA derived from low molecular weight fractions of total RNA from several different hematopoietic and neuronal cells. This method allowed us to analyze cell type-specific patterns of miRNA expression and to identify miRNAs that might be important for cell lineage specification and/or cell effector functions. Conclusion This is the first report of systematic miRNA gene profiling in cells of the hematopoietic system. As expected, miRNA expression patterns were very different between hematopoietic and non-hematopoietic cells, with further subtle differences observed within the hematopoietic group. Interestingly, the most pronounced similarities were observed among fully differentiated effector cells (Th1 and Th2 lymphocytes and mast cells) and precursors at comparable stages of differentiation (double negative thymocytes and pro-B cells), suggesting that in addition to regulating the process of commitment to particular cellular lineages, miRNAs might have an important general role in the mechanism of cell differentiation and maintenance of cell identity. PMID:16086853

  6. Transgene Expression Patterns Indicate That Spaceflight Affects Stress Signal Perception and Transduction in Arabidopsis1

    PubMed Central

    Paul, Anna-Lisa; Daugherty, Christine J.; Bihn, Elizabeth A.; Chapman, David K.; Norwood, Kelly L.L.; Ferl, Robert J.

    2001-01-01

    The use of plants as integral components of life support systems remains a cornerstone of strategies for long-term human habitation of space and extraterrestrial colonization. Spaceflight experiments over the past few decades have refined the hardware required to grow plants in low-earth orbit and have illuminated fundamental issues regarding spaceflight effects on plant growth and development. Potential incipient hypoxia, resulting from the lack of convection-driven gas movement, has emerged as a possible major impact of microgravity. We developed transgenic Arabidopsis containing the alcohol dehydrogenase (Adh) gene promoter linked to the β-glucuronidase (GUS) reporter gene to address specifically the possibility that spaceflight induces the plant hypoxia response and to assess whether any spaceflight response was similar to control terrestrial hypoxia-induced gene expression patterns. The staining patterns resulting from a 5-d mission on the orbiter Columbia during mission STS-93 indicate that the Adh/GUS reporter gene was activated in roots during the flight. However, the patterns of expression were not identical to terrestrial control inductions. Moreover, although terrestrial hypoxia induces Adh/GUS expression in the shoot apex, no apex staining was observed in the spaceflight plants. This indicates that either the normal hypoxia response signaling is impaired in spaceflight or that spaceflight inappropriately induces Adh/GUS activity for reasons other than hypoxia. PMID:11402191

  7. Following the time course of face gender and expression processing: a task-dependent ERP study.

    PubMed

    Valdés-Conroy, Berenice; Aguado, Luis; Fernández-Cahill, María; Romero-Ferreiro, Verónica; Diéguez-Risco, Teresa

    2014-05-01

    The effects of task demands and the interaction between gender and expression in face perception were studied using event-related potentials (ERPs). Participants performed three different tasks with male and female faces that were emotionally inexpressive or that showed happy or angry expressions. In two of the tasks (gender and expression categorization) facial properties were task-relevant while in a third task (symbol discrimination) facial information was irrelevant. Effects of expression were observed on the visual P100 component under all task conditions, suggesting the operation of an automatic process that is not influenced by task demands. The earliest interaction between expression and gender was observed later in the face-sensitive N170 component. This component showed differential modulations by specific combinations of gender and expression (e.g., angry male vs. angry female faces). Main effects of expression and task were observed in a later occipito-temporal component peaking around 230 ms post-stimulus onset (EPN or early posterior negativity). Less positive amplitudes in the presence of angry faces and during performance of the gender and expression tasks were observed. Finally, task demands also modulated a positive component peaking around 400 ms (LPC, or late positive complex) that showed enhanced amplitude for the gender task. The pattern of results obtained here adds new evidence about the sequence of operations involved in face processing and the interaction of facial properties (gender and expression) in response to different task demands. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Developmental exposure to 2,3,7,8-tetrachlorodibenzo-p-dioxin alters DNA methyltransferase (dnmt) expression in zebrafish (Danio rerio)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Aluru, Neelakanteswar, E-mail: naluru@whoi.edu; Kuo, Elaine; Stanford University, 450 Serra Mall, Stanford, CA 94305

    2015-04-15

    DNA methylation is one of the most important epigenetic modifications involved in the regulation of gene expression. The DNA methylation reaction is catalyzed by DNA methyltransferases (DNMTs). Recent studies have demonstrated that toxicants can affect normal development by altering DNA methylation patterns, but the mechanisms of action are poorly understood. Hence, we tested the hypothesis that developmental exposure to TCDD affects dnmt gene expression patterns. Zebrafish embryos were exposed to 5 nM TCDD for 1 h from 4 to 5 h post-fertilization (hpf) and sampled at 12, 24, 48, 72, and 96 hpf to determine dnmt gene expression and DNAmore » methylation patterns. We performed a detailed analysis of zebrafish dnmt gene expression during development and in adult tissues. Our results demonstrate that dnmt3b genes are highly expressed in early stages of development, and dnmt3a genes are more abundant in later stages. TCDD exposure upregulated dnmt1 and dnmt3b2 expression, whereas dnmt3a1, 3b1, and 3b4 are downregulated following exposure. We did not observe any TCDD-induced differences in global methylation or hydroxymethylation levels, but the promoter methylation of aryl hydrocarbon receptor (AHR) target genes was altered. In TCDD-exposed embryos, AHR repressor a (ahrra) and c-fos promoters were differentially methylated. To characterize the TCDD effects on DNMTs, we cloned the dnmt promoters with xenobiotic response elements and conducted AHR transactivation assays using a luciferase reporter system. Our results suggest that ahr2 can regulate dnmt3a1, dnmt3a2, and dnmt3b2 expression. Overall, we demonstrate that developmental exposure to TCDD alters dnmt expression and DNA methylation patterns. - Highlights: • TCDD altered the dnmt expression in a gene and developmental time-specific manner. • TCDD hypermethylated ahrra and hypomethylated c-fos proximal promoter regions. • Functional analysis suggests that ahr2 can regulate dnmt3a1, 3a2, and 3b2 expression. • Dnmt3b genes are expressed early whereas dnmt3a are abundant later in development.« less

  9. APOL1–Mediated Cell Injury Involves Disruption of Conserved Trafficking Processes

    PubMed Central

    Kruzel-Davila, Etty; Shemer, Revital; Ofir, Ayala; Bavli-Kertselli, Ira; Darlyuk-Saadon, Ilona; Oren-Giladi, Pazit; Wasser, Walter G.; Magen, Daniella; Zaknoun, Eid; Schuldiner, Maya; Salzberg, Adi; Kornitzer, Daniel; Marelja, Zvonimir; Simons, Matias

    2017-01-01

    APOL1 harbors C–terminal sequence variants (G1 and G2), which account for much of the increased risk for kidney disease in sub–Saharan African ancestry populations. Expression of the risk variants has also been shown to cause injury to podocytes and other cell types, but the underlying mechanisms are not understood. We used Drosophila melanogaster and Saccharomyces cerevisiae to help clarify these mechanisms. Ubiquitous expression of the human APOL1 G1 and G2 disease risk alleles caused near-complete lethality in D. melanogaster, with no effect of the G0 nonrisk APOL1 allele, corresponding to the pattern of human disease risk. We also observed a congruent pattern of cellular damage with tissue-specific expression of APOL1. In particular, expression of APOL1 risk variants in D. melanogaster nephrocytes caused cell-autonomous accumulation of the endocytic tracer atrial natriuretic factor-red fluorescent protein at early stages and nephrocyte loss at later stages. We also observed differential toxicity of the APOL1 risk variants compared with the APOL1 nonrisk variants in S. cerevisiae, including impairment of vacuole acidification. Yeast strains defective in endosomal trafficking or organelle acidification but not those defective in autophagy displayed augmented APOL1 toxicity with all isoforms. This pattern of differential injury by the APOL1 risk alleles compared with the nonrisk alleles across evolutionarily divergent species is consistent with an impairment of conserved core intracellular endosomal trafficking processes. This finding should facilitate the identification of cell injury pathways and corresponding therapeutic targets of interest in these amenable experimental platforms. PMID:27864431

  10. Distinct neuronal activation patterns are associated with PCP-induced social withdrawal and its reversal by the endocannabinoid-enhancing drug URB597.

    PubMed

    Matricon, Julien; Seillier, Alexandre; Giuffrida, Andrea

    2016-09-01

    The fatty acid amide hydrolase inhibitor, URB597, an endocannabinoid enhancing drug, reverses social withdrawal in the sub-chronic PCP rat model of schizophrenia, but reduces social interaction (SI) in controls. To identify the anatomical substrates associated with PCP-induced social withdrawal and the contrasting effects of URB597 on SI in PCP- versus saline-treated rats, we analyzed SI-induced c-Fos expression in 28 brain areas relevant to schizophrenia and/or social behavior following vehicle or URB597 administration. In saline-treated rats, SI was accompanied by changes in c-Fos expression in the infralimbic and orbitofrontal cortices, dorsomedial caudate putamen, ventrolateral nucleus of the septum, dorsolateral periaqueductal gray (dlPAG) and central amygdala. Except for the dlPAG, these changes were not observed in PCP-treated rats or in saline-treated rats receiving URB597. In the dorsomedial part of the bed nucleus of the stria terminalis (dmBNST), SI-induced c-Fos expression was observed only in PCP-treated rats. Interestingly, URB597 in PCP-treated rats restored a similar c-Fos expression pattern as observed in saline-treated rats: activation of the orbitofrontal cortex, inhibition of the central amygdala and suppression of activation of the dmBNST. These data suggest that orbitofrontal cortex, central amygdala and dmBNST play a critical role in the reversal of PCP-induced social withdrawal by URB597. Copyright © 2016 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.

  11. Immunohistochemical expression of epithelial cell adhesion molecule (EpCAM) in mucoepidermoid carcinoma compared to normal salivary gland tissues.

    PubMed

    Kamal, Noura M; Salem, Hend M; Dahmoush, Heba M

    2017-07-01

    Mucoepidermoid carcinoma (MEC) is the most common malignant salivary gland tumor which displays biological, histological and clinical diversity thus representing a challenge for its diagnosis and management. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein identified as a tumor specific antigen due to its frequent overexpression in the majority of epithelial carcinomas and its correlation with prognosis. It is considered to be a promising biomarker used as a therapeutic target already in ongoing clinical trials. The purpose of this study was to investigate the pattern, cellular characterization and level of EpCAM expression in MEC and demonstrate its correlation with histologic grading which may benefit future clinical trials using EpCAM targeted therapy. 48 specimens (12 normal salivary gland tissue and 36 MEC) were collected and EpCAM membranous expression was evaluated by immunohistochemistry. Total immunoscore (TIS) was evaluated, the term 'EpCAM overexpression' was given for tissues showing a total immunoscore >4. A highly significant difference was observed between TIS percent values in control and different grades of MEC (p<0.001). High grade MEC (HG-MEC) was the highest EpCAM expressor. In addition, EpCAM expression pattern differed among the different grades. EpCAM expression was detected in MEC, and its overexpression correlated with increasing the histological grade. The diffuse membranous expression in HG-MEC could be of diagnostic value in relation to the patchy expression observed in both low grade and intermediate grade MEC. Copyright © 2017 Elsevier Ltd. All rights reserved.

  12. Expression of the mRNAs encoding the limbic system-associated membrane protein (LAMP): II. Fetal rat brain.

    PubMed

    Pimenta, A F; Reinoso, B S; Levitt, P

    1996-11-11

    The limbic system-associated membrane protein (LAMP) is a 64-68 kDa neuronal surface glycoprotein expressed in cortical and subcortical regions of the limbic system of the adult and developing rat central nervous system (CNS). LAMP is a member of the immunoglobulin superfamily of cell adhesion molecules with three Ig domains and is highly conserved between rat and human. In this study, the temporal and spatial pattern of lamp gene expression during fetal rat development was analyzed by using Northern blot analysis and in situ hybridization. In Northern blot analysis, two lamp mRNA transcripts, 1.6 kb and 8.0 kb, identical in size to those present in the adult rat nervous system, were detected in developing neural tissue. In situ hybridization analysis showed close correlation, though not identity, between the expression of lamp mRNAs and the distribution of LAMP in limbic regions of the developing rat CNS, indicative of a more complex regulation of gene expression than was previously thought to be the case. The expression of lamp mRNAs is first detected on about embryonic day (E) 13. The hybridization signal is not seen in the proliferative ventricular zone at any level of the neuraxis, indicating that lamp is expressed in postmitotic neurons. In the cerebral cortex, lamp mRNAs are expressed in limbic cortical regions, such as the perirhinal cortex, prefrontal cortex, and cingulate cortex. In the hippocampus, the hybridization signal is observed in Ammon's horn by E18. The neostriatum, amygdaloid complex, and most hypothalamic areas express lamp mRNAs from early stages (E13-E14) in a pattern consistent with the onset of neurogenesis. The emerging patterns of lamp expression at the outset are similar to those seen in adult hypothalamus and dorsal thalamus. Although the hybridization signal is observed in some nonlimbic areas, including midbrain and hindbrain structures, intense labeling is evident in more classic limbic regions. The high levels of expression of lamp in limbic regions, beginning in early developmental stages, combined with the results of previous functional in vitro and in vivo studies, support a role for LAMP as a recognition molecule involved in the formation of limbic connections.

  13. Adolescent binge-pattern alcohol exposure alters genome-wide DNA methylation patterns in the hypothalamus of alcohol-naïve male offspring.

    PubMed

    Asimes, AnnaDorothea; Torcaso, Audrey; Pinceti, Elena; Kim, Chun K; Zeleznik-Le, Nancy J; Pak, Toni R

    2017-05-01

    Teenage binge drinking is a major health concern in the United States, with 21% of teenagers reporting binge-pattern drinking behavior in the previous 30 days. Recently, our lab showed that alcohol-naïve offspring of rats exposed to alcohol during adolescence exhibited altered gene expression profiles in the hypothalamus, a brain region involved in stress regulation. We employed Enhanced Reduced Representation Bisulfite Sequencing as an unbiased approach to test the hypothesis that parental exposure to binge-pattern alcohol during adolescence alters DNA methylation profiles in their alcohol-naïve offspring. Wistar rats were administered a repeated binge-ethanol exposure paradigm during early (postnatal day (PND) 37-44) and late (PND 67-74) adolescent development. Animals were mated 24 h after the last ethanol dose and subsequent offspring were produced. Analysis of male PND7 offspring revealed that offspring of alcohol-exposed parents exhibited differential DNA methylation patterns in the hypothalamus. The differentially methylated cytosines (DMCs) were distinct between offspring depending on which parent was exposed to ethanol. Moreover, novel DMCs were observed when both parents were exposed to ethanol and many DMCs from single parent ethanol exposure were not recapitulated with dual parent exposure. We also measured mRNA expression of several differentially methylated genes and some, but not all, showed correlative changes in expression. Importantly, methylation was not a direct predictor of expression levels, underscoring the complexity of transcriptional regulation. Overall, we demonstrate that adolescent binge ethanol exposure causes altered genome-wide DNA methylation patterns in the hypothalamus of alcohol-naïve offspring. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Adolescent binge-pattern alcohol exposure alters genome-wide DNA methylation patterns in the hypothalamus of alcohol-naïve male offspring

    PubMed Central

    Asimes, AnnaDorothea; Torcaso, Audrey; Pinceti, Elena; Kim, Chun K; Zeleznik-Le, Nancy J.; Pak, Toni R.

    2016-01-01

    Teenage binge drinking is a major health concern in the United States, with 21% of teenagers reporting binge-pattern drinking behavior in the last 30 days. Recently, our lab showed that alcohol-naïve offspring of rats exposed to alcohol during adolescence exhibited altered gene expression profiles in the hypothalamus, a brain region involved in stress regulation. We employed Enhanced Reduced Representation Bisulfite Sequencing as an unbiased approach to test the hypothesis that parental exposure to binge-pattern alcohol during adolescence alters DNA methylation profiles in their alcohol-naïve offspring. Wistar rats were administered a repeated binge-ethanol exposure paradigm during early (postnatal day (PND) 37-44) and late (PND 67-74) adolescent development. Animals were mated 24h after the last ethanol dose and subsequent offspring were produced. Analysis of male PND7 offspring revealed that offspring of alcohol-exposed parents exhibited differential DNA methylation patterns in the hypothalamus. The differentially methylated cytosines (DMCs) were distinct between offspring depending on which parent was exposed to ethanol. Moreover, novel DMCs were observed when both parents were exposed to ethanol and many DMCs from single parent ethanol exposure were not recapitulated with dual parent exposure. We also measured mRNA expression of several differentially methylated genes and some, but not all, showed correlative changes in expression. Importantly, methylation was not a direct predictor of expression levels, underscoring the complexity of transcriptional regulation. Overall, we demonstrate that adolescent binge ethanol exposure causes altered genome-wide DNA methylation patterns in the hypothalamus of alcohol-naïve offspring. PMID:27817987

  15. Comparison of tight junction protein expression in the ciliary epithelia of mouse, rabbit, cat and human eyes.

    PubMed

    Karim, M J; Biswas, S; Bhattacherjee, P; Paterson, C A

    2011-06-01

    Tight junctions in the nonpigmented epithelium (NPE) of the ciliary processes and the iris vascular endothelium form the ocular blood aqueous barrier that prevents leakage of proteins, immune cells and non-immune cells of blood into the anterior chamber. We attempted to determine whether ultrastructural differences in tight junctions reported in earlier studies are reflected in the expression pattern of tight junction proteins (TJP) and whether the TJP in mice, rabbits and cats resemble those of humans. For immunohistochemistry, 10 μm thick cryosections were rehydrated in PBS and fixed in 50 mM ammonium chloride at room temperature. After rinses in PBS, the sections were incubated twice in 0.1% Triton X-100, 10% goat serum, specific primary antibody or in PBS. After rinses in PBS, the sections were incubated in FITC-conjugated secondary antibody. After rinses in PBS, the sections were mounted with Vectashield mounting medium with propidium iodide, examined and photographed using a confocal microscope. The expression patterns of TJP in ocular ciliary epithelium of human, rabbit, cat and mouse were similar. Occludin immunoreactivity was observed as a sharp line along the junction between pigmented epithelium (PE) and NPE, and along the apico-lateral surfaces of NPE. Very light staining of the ciliary stroma was observed in cat and mouse. Claudin-1 was expressed along the entire boundaries of NPE and was more distinct between PE and NPE in rabbit. The ciliary stroma showed faint staining in cat and mouse. ZO-1 showed staining between PE and NPE, and at the adjacent membrane. Moderate staining was seen in PE in cat and mouse, which suggests that claudin-1, occludin and ZO-1 are expressed along the junction between PE and NPE, and the apico-lateral border of NPE. Lack of major difference in the expression patterns among the different species is important for validating the use of rabbit, mouse and cat in studies of intraocular inflammation in humans.

  16. Changing clothes easily: connexin41.8 regulates skin pattern variation.

    PubMed

    Watanabe, Masakatsu; Kondo, Shigeru

    2012-05-01

    The skin patterns of animals are very important for their survival, yet the mechanisms involved in skin pattern formation remain unresolved. Turing's reaction-diffusion model presents a well-known mathematical explanation of how animal skin patterns are formed, and this model can predict various animal patterns that are observed in nature. In this study, we used transgenic zebrafish to generate various artificial skin patterns including a narrow stripe with a wide interstripe, a narrow stripe with a narrow interstripe, a labyrinth, and a 'leopard' pattern (or donut-like ring pattern). In this process, connexin41.8 (or its mutant form) was ectopically expressed using the mitfa promoter. Specifically, the leopard pattern was generated as predicted by Turing's model. Our results demonstrate that the pigment cells in animal skin have the potential and plasticity to establish various patterns and that the reaction-diffusion principle can predict skin patterns of animals. © 2012 John Wiley & Sons A/S.

  17. Differential GFP expression patterns induced by different heavy metals in Tg(hsp70:gfp) transgenic medaka (Oryzias latipes).

    PubMed

    Ng, Grace Hwee Boon; Xu, Hongyan; Pi, Na; Kelly, Barry C; Gong, Zhiyuan

    2015-06-01

    Heat shock protein 70 (Hsp70) is one of the most widely used biomarker for monitoring environment perturbations in biological systems. To facilitate the analysis of hsp70 expression as a biomarker, we generated a Tg(hsp70:gfp) transgenic medaka line in which green fluorescence protein (GFP) reporter gene was driven by the medaka hsp70 promoter. Here, we characterized Tg(hsp70:gfp) medaka for inducible GFP expression by seven environment-relevant heavy metals, including mercury, arsenic, lead, cadmium, copper, chromium, and zinc. We found that four of them (mercury, arsenic, lead, and cadmium) induced GFP expression in multiple and different organs. In general, the liver, kidney, gut, and skin are among the most frequent organs to show induced GFP expression. In contrast, no detectable GFP induction was observed to copper, chromium, or zinc, indicating that the transgenic line was not responsive to all heavy metals. RT-qPCR determination of hsp70 mRNA showed similar induction and non-induction by these metals, which also correlated with the levels of metal uptake in medaka exposed to these metals. Our observations suggested that these heavy metals have different mechanisms of toxicity and/or differential bioaccumulation in various organs; different patterns of GFP expression induced by different metals may be used to determine or exclude metals in water samples tested. Furthermore, we also tested several non-metal toxicants such as bisphenol A, 2,3,7,8-tetrachlorodibenzo-p-dioxin, 4-introphenol, and lindane; none of them induced significant GFP expression in Tg(hsp70:gfp) medaka, further suggesting that the inducibility of Tg(hsp70:gfp) for GFP expression is specific to a subset of heavy metals.

  18. Construction of a Lotus japonicus late nodulin expressed sequence tag library and identification of novel nodule-specific genes.

    PubMed Central

    Szczyglowski, K; Hamburger, D; Kapranov, P; de Bruijn, F J

    1997-01-01

    A range of novel expressed sequence tags (ESTs) associated with late developmental events during nodule organogenesis in the legume Lotus japonicus were identified using mRNA differential display; 110 differentially displayed polymerase chain reaction products were cloned and analyzed. Of 88 unique cDNAs obtained, 22 shared significant homology to DNA/protein sequences in the respective databases. This group comprises, among others, a nodule-specific homolog of protein phosphatase 2C, a peptide transporter protein, and a nodule-specific form of cytochrome P450. RNA gel-blot analysis of 16 differentially displayed ESTs confirmed their nodule-specific expression pattern. The kinetics of mRNA accumulation of the majority of the ESTs analyzed were found to resemble the expression pattern observed for the L. japonicus leghemoglobin gene. These results indicate that the newly isolated molecular markers correspond to genes induced during late developmental stages of L. japonicus nodule organogenesis and provide important, novel tools for the study of nodulation. PMID:9276951

  19. Immunohistochemical expression of basement membrane proteins of verrucous carcinoma of the oral mucosa.

    PubMed

    Arduino, Paolo G; Carrozzo, Marco; Pagano, Marco; Broccoletti, Roberto; Scully, Crispian; Gandolfo, Sergio

    2010-06-01

    Squamous cell carcinoma (SCC) of the oral cavity is an extremely invasive tumour of stratified squamous epithelium that spreads throughout degradation of the basement membrane (BM) and extra-cellular matrix. Oral verrucous carcinoma (VC) is a rare low-grade variant of oral SCC that penetrates into the subepithelial connective tissue. It also has a different clinical behaviour from classical oral SCC. We investigated the immunohistochemical expression of laminin, laminin-5, collagen IV and fibronectin in VC, severe epithelial dysplasia (SED) and SCC in order to analyse if the pattern of these molecules expression contributes to the differences in the biological behaviour of these diseases. The staining pattern of laminin was less intensive in SCC compared with SED and VC, and collagen IV expression was increased in VC compared with SED. Discontinuities of laminin, collagen IV and fibronectin were more evident in SED than in VC. This study indicates that VC has a biological behaviour different from SED or SCC, observable by immunohistochemistry in the BM zone.

  20. Expression of a gymnosperm PIN homologous gene correlates with auxin immunolocalization pattern at cotyledon formation and in demarcation of the procambium during Picea abies somatic embryo development and in seedling tissues.

    PubMed

    Palovaara, Joakim; Hallberg, Henrik; Stasolla, Claudio; Luit, Bert; Hakman, Inger

    2010-04-01

    In seed plants, the body organization is established during embryogenesis and is uniform across gymnosperms and angiosperms, despite differences during early embryogeny. Evidence from angiosperms implicates the plant hormone auxin and its polar transport, mainly established by the PIN family of auxin efflux transporters, in the patterning of embryos. Here, PaPIN1 from Norway spruce (Picea abies [L.] Karst.), a gene widely expressed in conifer tissues and organs, was characterized and its expression and localization patterns were determined with reverse transcription polymerase chain reaction and in situ hybridization during somatic embryo development and in seedlings. PaPIN1 shares the predicted structure of other PIN proteins, but its central hydrophilic loop is longer than most PINs. In phylogenetic analyses, PaPIN1 clusters with Arabidopsis thaliana (L.) Heynh. PIN3, PIN4 and PIN7, but its expression pattern also suggests similarity to PIN1. The PaPIN1 expression signal was high in the protoderm of pre-cotyledonary embryos, but not if embryos were pre-treated with the auxin transport inhibitor N-1-naphthylphthalamic acid (NPA). This, together with a high auxin immunolocalization signal in this cell layer, suggests a role of PaPIN1 during cotyledon formation. At later stages, high PaPIN1 expression was observed in differentiating procambium, running from the tip of incipient cotyledons down through the embryo axis and to the root apical meristem (RAM), although the mode of RAM specification in conifer embryos differs from that of most angiosperms. Also, the PaPIN1 in situ signal was high in seedling root tips including root cap columella cells. The results thus suggest that PaPIN1 provides an ancient function associated with auxin transport and embryo pattern formation prior to the separation of angiosperms and gymnosperms, in spite of some morphological differences.

  1. Baculovirus-mediated gene transfer in butterfly wings in vivo: an efficient expression system with an anti-gp64 antibody.

    PubMed

    Dhungel, Bidur; Ohno, Yoshikazu; Matayoshi, Rie; Otaki, Joji M

    2013-03-25

    Candidate genes for color pattern formation in butterfly wings have been known based on gene expression patterns since the 1990s, but their functions remain elusive due to a lack of a functional assay. Several methods of transferring and expressing a foreign gene in butterfly wings have been reported, but they have suffered from low success rates or low expression levels. Here, we developed a simple, practical method to efficiently deliver and express a foreign gene using baculovirus-mediated gene transfer in butterfly wings in vivo. A recombinant baculovirus containing a gene for green fluorescent protein (GFP) was injected into pupae of the blue pansy butterfly Junonia orithya (Nymphalidae). GFP fluorescence was detected in the pupal wings and other body parts of the injected individuals three to five days post-injection at various degrees of fluorescence. We obtained a high GFP expression rate at relatively high virus titers, but it was associated with pupal death before color pattern formation in wings. To reduce the high mortality rate caused by the baculovirus treatment, we administered an anti-gp64 antibody, which was raised against baculovirus coat protein gp64, to infected pupae after the baculovirus injection. This treatment greatly reduced the mortality rate of the infected pupae. GFP fluorescence was observed in pupal and adult wings and other body parts of the antibody-treated individuals at various degrees of fluorescence. Importantly, we obtained completely developed wings with a normal color pattern, in which fluorescent signals originated directly from scales or the basal membrane after the removal of scales. GFP fluorescence in wing tissues spatially coincided with anti-GFP antibody staining, confirming that the fluorescent signals originated from the expressed GFP molecules. Our baculovirus-mediated gene transfer system with an anti-gp64 antibody is reasonably efficient, and it can be an invaluable tool to transfer, express, and functionally examine foreign genes in butterfly wings and also in other non-model insect systems.

  2. [Interactive patterns detection in family communication with adolescents].

    PubMed

    Gimeno Collado, Adelina; Anguera Argilaga, M Teresa; Berzosa Sanz, Amparo; Ramírez Ramírez, Luis

    2006-11-01

    Interactive patterns detection in family communication with adolescents. Nondistant communication is a relevant indicator for family functionality valuation. The goal of this study is to analyze this communication in order to identify specific kinds of leadership, interaction patterns and the relation between verbal and nonverbal elements in communication. The observational design exposed is an idiographic one, punctual and multidimensional, which uses field format as observation instrument. Participants were seven standardized families made up of both ancestors and an adolescent son or daughter. According to the family models analyzed, results show a predominantly democratic communication style in adults with recurrent support expressions. The sequential analysis incorporates only categories from the emitter point of view, and detects relevant sequences which show symmetric interaction between all three family members. Verbal and nonverbal channels provide complementary information. Depending on adolescents' gender different patterns in behaviour can be identified as well.

  3. Expression of hLAMP-1-Positive Particles During Early Heart Development in the Chick.

    PubMed

    Abd-Elhamid, T H; Conway, M L; Sinning, A R

    2017-10-01

    Heart development requires coordinated activity of various factors, the disturbance of which can lead to congenital heart defects. Heart lectin-associated matrix protein-1 (hLAMP-1) is a matrix protein expressed within Hensen's node at Hamburger-Hamilton (HH) stage 4, in the lateral mesoderm by HH stages 5-6 and enhanced within the left pre-cardiac field at HH stage 7. At HH stages 15-16, hLAMP-1 expression is observed in the atrioventricular canal and the outflow tract. Also, the role of hLAMP-1 in induction of mesenchyme formation in chick heart has been well documented. To further elucidate the role of this molecule in heart development, we examined its expression patterns during HH stages 8-14 in the chick. In this regard, we immunostained sections of the heart during HH stages 8-14 with antibodies specific to hLAMP-1. Our results showed prominent expression of hLAMP-1-positive particles in the extracellular matrix associated with the pre-cardiac mesoderm, the endoderm, ectoderm as well as neuroectoderm at HH stages 8-9. After formation of the linear heart tube at HH stage 10, the expression of hLAMP-1-stained particles disappears in those regions of original contact between the endoderm and heart forming fields due to rupture of the dorsal mesocardium while their expression becomes confined to the arterial and venous poles of the heart tube. This expression pattern is maintained until HH stage 14. This expression pattern suggests that hLAMP-1 may be involved in the formation of the endocardial tube. © 2017 Blackwell Verlag GmbH.

  4. An interspecific fungal hybrid reveals cross-kingdom rules for allopolyploid gene expression patterns.

    PubMed

    Cox, Murray P; Dong, Ting; Shen, Genggeng; Dalvi, Yogesh; Scott, D Barry; Ganley, Austen R D

    2014-03-01

    Polyploidy, a state in which the chromosome complement has undergone an increase, is a major force in evolution. Understanding the consequences of polyploidy has received much attention, and allopolyploids, which result from the union of two different parental genomes, are of particular interest because they must overcome a suite of biological responses to this merger, known as "genome shock." A key question is what happens to gene expression of the two gene copies following allopolyploidization, but until recently the tools to answer this question on a genome-wide basis were lacking. Here we utilize high throughput transcriptome sequencing to produce the first genome-wide picture of gene expression response to allopolyploidy in fungi. A novel pipeline for assigning sequence reads to the gene copies was used to quantify their expression in a fungal allopolyploid. We find that the transcriptional response to allopolyploidy is predominantly conservative: both copies of most genes are retained; over half the genes inherit parental gene expression patterns; and parental differential expression is often lost in the allopolyploid. Strikingly, the patterns of gene expression change are highly concordant with the genome-wide expression results of a cotton allopolyploid. The very different nature of these two allopolyploids implies a conserved, eukaryote-wide transcriptional response to genome merger. We provide evidence that the transcriptional responses we observe are mostly driven by intrinsic differences between the regulatory systems in the parent species, and from this propose a mechanistic model in which the cross-kingdom conservation in transcriptional response reflects conservation of the mutational processes underlying eukaryotic gene regulatory evolution. This work provides a platform to develop a universal understanding of gene expression response to allopolyploidy and suggests that allopolyploids are an exceptional system to investigate gene regulatory changes that have evolved in the parental species prior to allopolyploidization.

  5. Transcriptional expression analysis of genes involved in regulation of calcium translocation and storage in finger millet (Eleusine coracana L. Gartn.).

    PubMed

    Mirza, Neelofar; Taj, Gohar; Arora, Sandeep; Kumar, Anil

    2014-10-25

    Finger millet (Eleusine coracana) variably accumulates calcium in different tissues, due to differential expression of genes involved in uptake, translocation and accumulation of calcium. Ca(2+)/H(+) antiporter (CAX1), two pore channel (TPC1), CaM-stimulated type IIB Ca(2+) ATPase and two CaM dependent protein kinase (CaMK1 and 2) homologs were studied in finger millet. Two genotypes GP-45 and GP-1 (high and low calcium accumulating, respectively) were used to understand the role of these genes in differential calcium accumulation. For most of the genes higher expression was found in the high calcium accumulating genotype. CAX1 was strongly expressed in the late stages of spike development and could be responsible for accumulating high concentrations of calcium in seeds. TPC1 and Ca(2+) ATPase homologs recorded strong expression in the root, stem and developing spike and signify their role in calcium uptake and translocation, respectively. Calmodulin showed strong expression and a similar expression pattern to the type IIB ATPase in the developing spike only and indicating developing spike or even seed specific isoform of CaM affecting the activity of downstream target of calcium transportation. Interestingly, CaMK1 and CaMK2 had expression patterns similar to ATPase and TPC1 in various tissues raising a possibility of their respective regulation via CaM kinase. Expression pattern of 14-3-3 gene was observed to be similar to CAX1 gene in leaf and developing spike inferring a surprising possibility of CAX1 regulation through 14-3-3 protein. Our results provide a molecular insight for explaining the mechanism of calcium accumulation in finger millet. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. HIV promoter integration site primarily modulates transcriptional burst size rather than frequency.

    PubMed

    Skupsky, Ron; Burnett, John C; Foley, Jonathan E; Schaffer, David V; Arkin, Adam P

    2010-09-30

    Mammalian gene expression patterns, and their variability across populations of cells, are regulated by factors specific to each gene in concert with its surrounding cellular and genomic environment. Lentiviruses such as HIV integrate their genomes into semi-random genomic locations in the cells they infect, and the resulting viral gene expression provides a natural system to dissect the contributions of genomic environment to transcriptional regulation. Previously, we showed that expression heterogeneity and its modulation by specific host factors at HIV integration sites are key determinants of infected-cell fate and a possible source of latent infections. Here, we assess the integration context dependence of expression heterogeneity from diverse single integrations of a HIV-promoter/GFP-reporter cassette in Jurkat T-cells. Systematically fitting a stochastic model of gene expression to our data reveals an underlying transcriptional dynamic, by which multiple transcripts are produced during short, infrequent bursts, that quantitatively accounts for the wide, highly skewed protein expression distributions observed in each of our clonal cell populations. Interestingly, we find that the size of transcriptional bursts is the primary systematic covariate over integration sites, varying from a few to tens of transcripts across integration sites, and correlating well with mean expression. In contrast, burst frequencies are scattered about a typical value of several per cell-division time and demonstrate little correlation with the clonal means. This pattern of modulation generates consistently noisy distributions over the sampled integration positions, with large expression variability relative to the mean maintained even for the most productive integrations, and could contribute to specifying heterogeneous, integration-site-dependent viral production patterns in HIV-infected cells. Genomic environment thus emerges as a significant control parameter for gene expression variation that may contribute to structuring mammalian genomes, as well as be exploited for survival by integrating viruses.

  7. SCARLESS SKIN WOUND HEALING IN FOXN1 DEFICIENT (NUDE) MICE IS ASSOCIATED WITH DISTINCTIVE MATRIX METALLOPROTEINASE EXPRESSION

    PubMed Central

    Gawronska-Kozak, Barbara

    2011-01-01

    Similar to mammalian fetuses FOXN1 deficient (nude) mice are able to restore the structure and integrity of injured skin in a scarless healing process by mechanisms independent of the genetic background. Matrix metalloproteinases (MMPs) are required for regular skin wound healing and the distinctive pattern of their expression has been implicated to promote scarless healing. In this study, we analyzed the temporal and spatial expression patterns of these molecules during the incisional skin wounds in adult nude mice. Macroscopic and histological analyses of skin wounds revealed an accelerated wound healing process, minimal granulation tissue formation and markedly diminished scarring in nude mice. Quantitative RT-PCR (Mmp-2,-3,-8,-9,-10,-12,-13,-14 and Timp-1, -2, -3), Western blots (MMP-13) and gelatin zymography (MMP-9) revealed that MMP-9 and MMP-13 showed a unique, bimodal pattern of up-regulation during the early and late phases of wound healing in nude mice. Immunohistochemically MMP-9 and MMP-13 were generally detected in epidermis during the early phase and in dermis during the late (remodeling) phase. Consistent with these in vivo observations, dermal fibroblasts cultured from nude mice expressed higher levels of type I and III collagen, MMP-9 and MMP-13 mRNA levels and higher MMP enzyme activity than wild type controls. Collectively, these finding suggest that the bimodal pattern of MMP-9 and MMP-13 expression during skin repair process in nude mice could be a major component of their ability for scarless healing. PMID:21539913

  8. The Oncoprotein BRD4-NUT Generates Aberrant Histone Modification Patterns.

    PubMed

    Zee, Barry M; Dibona, Amy B; Alekseyenko, Artyom A; French, Christopher A; Kuroda, Mitzi I

    2016-01-01

    Defects in chromatin proteins frequently manifest in diseases. A striking case of a chromatin-centric disease is NUT-midline carcinoma (NMC), which is characterized by expression of NUT as a fusion partner most frequently with BRD4. ChIP-sequencing studies from NMC patients revealed that BRD4-NUT (B4N) covers large genomic regions and elevates transcription within these domains. To investigate how B4N modulates chromatin, we performed affinity purification of B4N when ectopically expressed in 293-TREx cells and quantified the associated histone posttranslational modifications (PTM) using proteomics. We observed significant enrichment of acetylation particularly on H3 K18 and of combinatorial patterns such as H3 K27 acetylation paired with K36 methylation. We postulate that B4N complexes override the preexisting histone code with new PTM patterns that reflect aberrant transcription and that epigenetically modulate the nucleosome environment toward the NMC state.

  9. The Oncoprotein BRD4-NUT Generates Aberrant Histone Modification Patterns

    PubMed Central

    Zee, Barry M.; Dibona, Amy B.; Alekseyenko, Artyom A.; French, Christopher A.; Kuroda, Mitzi I.

    2016-01-01

    Defects in chromatin proteins frequently manifest in diseases. A striking case of a chromatin-centric disease is NUT-midline carcinoma (NMC), which is characterized by expression of NUT as a fusion partner most frequently with BRD4. ChIP-sequencing studies from NMC patients revealed that BRD4-NUT (B4N) covers large genomic regions and elevates transcription within these domains. To investigate how B4N modulates chromatin, we performed affinity purification of B4N when ectopically expressed in 293-TREx cells and quantified the associated histone posttranslational modifications (PTM) using proteomics. We observed significant enrichment of acetylation particularly on H3 K18 and of combinatorial patterns such as H3 K27 acetylation paired with K36 methylation. We postulate that B4N complexes override the preexisting histone code with new PTM patterns that reflect aberrant transcription and that epigenetically modulate the nucleosome environment toward the NMC state. PMID:27698495

  10. Expression and Localization of CLC Chloride Transport Proteins in the Avian Retina

    PubMed Central

    McMains, Emily; Krishnan, Vijai; Prasad, Sujitha; Gleason, Evanna

    2011-01-01

    Members of the ubiquitously expressed CLC protein family of chloride channels and transporters play important roles in regulating cellular chloride and pH. The CLCs that function as Cl−/H+ antiporters, ClCs 3–7, are essential in particular for the acidification of endosomal compartments and protein degradation. These proteins are broadly expressed in the nervous system, and mutations that disrupt their expression are responsible for several human genetic diseases. Furthermore, knock-out of ClC3 and ClC7 in the mouse result in the degeneration of the hippocampus and the retina. Despite this evidence of their importance in retinal function, the expression patterns of different CLC transporters in different retinal cell types are as yet undescribed. Previous work in our lab has shown that in chicken amacrine cells, internal Cl− can be dynamic. To determine whether CLCs have the potential to participate, we used PCR and immunohistochemical techniques to examine CLC transporter expression in the chicken retina. We observed a high level of variation in the retinal expression levels and patterns among the different CLC proteins examined. These findings, which represent the first systematic investigation of CLC transporter expression in the retina, support diverse functions for the different CLCs in this tissue. PMID:21408174

  11. Urban-rural differences in the gene expression profiles of Ghanaian children.

    PubMed

    Amoah, A S; Obeng, B B; May, L; Kruize, Y C; Larbi, I A; Kabesch, M; Wilson, M D; Hartgers, F C; Boakye, D A; Yazdanbakhsh, M

    2014-01-01

    Recent studies indicate that urbanization is having a pronounced effect on disease patterns in developing countries. To understand the immunological basis of this, we examined mRNA expression in whole blood of genes involved in immune activation and regulation in 151 children aged 5-13 years attending rural, urban low socioeconomic status (SES) and urban high-SES schools in Ghana. Samples were also collected to detect helminth and malaria infections. Marked differences in gene expression were observed between the rural and urban areas as well as within the urban area. The expression of both interleukin (IL)-10 and programmed cell death protein 1 increased significantly across the schools from urban high SES to urban low SES to rural (P-trend <0.001). Although IL-10 gene expression was significantly elevated in the rural compared with the urban schools (P<0.001), this was not associated with parasitic infection. Significant differences in the expression of toll-like receptors (TLRs) and their signaling genes were seen between the two urban schools. Genetic differences could not fully account for the gene expression profiles in the different groups as shown by analysis of IL-10, TLR-2 and TLR-4 gene polymorphisms. Immune gene expression patterns are strongly influenced by environmental determinants and may underlie the effects of urbanization seen on health outcomes.

  12. Identifying spatially similar gene expression patterns in early stage fruit fly embryo images: binary feature versus invariant moment digital representations

    PubMed Central

    Gurunathan, Rajalakshmi; Van Emden, Bernard; Panchanathan, Sethuraman; Kumar, Sudhir

    2004-01-01

    Background Modern developmental biology relies heavily on the analysis of embryonic gene expression patterns. Investigators manually inspect hundreds or thousands of expression patterns to identify those that are spatially similar and to ultimately infer potential gene interactions. However, the rapid accumulation of gene expression pattern data over the last two decades, facilitated by high-throughput techniques, has produced a need for the development of efficient approaches for direct comparison of images, rather than their textual descriptions, to identify spatially similar expression patterns. Results The effectiveness of the Binary Feature Vector (BFV) and Invariant Moment Vector (IMV) based digital representations of the gene expression patterns in finding biologically meaningful patterns was compared for a small (226 images) and a large (1819 images) dataset. For each dataset, an ordered list of images, with respect to a query image, was generated to identify overlapping and similar gene expression patterns, in a manner comparable to what a developmental biologist might do. The results showed that the BFV representation consistently outperforms the IMV representation in finding biologically meaningful matches when spatial overlap of the gene expression pattern and the genes involved are considered. Furthermore, we explored the value of conducting image-content based searches in a dataset where individual expression components (or domains) of multi-domain expression patterns were also included separately. We found that this technique improves performance of both IMV and BFV based searches. Conclusions We conclude that the BFV representation consistently produces a more extensive and better list of biologically useful patterns than the IMV representation. The high quality of results obtained scales well as the search database becomes larger, which encourages efforts to build automated image query and retrieval systems for spatial gene expression patterns. PMID:15603586

  13. Multiple developmental programs are altered by loss of Zic1 and Zic4 to cause Dandy-Walker malformation cerebellar pathogenesis

    PubMed Central

    Blank, Marissa C.; Grinberg, Inessa; Aryee, Emmanuel; Laliberte, Christine; Chizhikov, Victor V.; Henkelman, R. Mark; Millen, Kathleen J.

    2011-01-01

    Heterozygous deletions encompassing the ZIC1;ZIC4 locus have been identified in a subset of individuals with the common cerebellar birth defect Dandy-Walker malformation (DWM). Deletion of Zic1 and Zic4 in mice produces both cerebellar size and foliation defects similar to human DWM, confirming a requirement for these genes in cerebellar development and providing a model to delineate the developmental basis of this clinically important congenital malformation. Here, we show that reduced cerebellar size in Zic1 and Zic4 mutants results from decreased postnatal granule cell progenitor proliferation. Through genetic and molecular analyses, we show that Zic1 and Zic4 have Shh-dependent function promoting proliferation of granule cell progenitors. Expression of the Shh-downstream genes Ptch1, Gli1 and Mycn was downregulated in Zic1/4 mutants, although Shh production and Purkinje cell gene expression were normal. Reduction of Shh dose on the Zic1+/−;Zic4+/− background also resulted in cerebellar size reductions and gene expression changes comparable with those observed in Zic1−/−;Zic4−/− mice. Zic1 and Zic4 are additionally required to pattern anterior vermis foliation. Zic mutant folial patterning abnormalities correlated with disrupted cerebellar anlage gene expression and Purkinje cell topography during late embryonic stages; however, this phenotype was Shh independent. In Zic1+/−;Zic4+/−;Shh+/−, we observed normal cerebellar anlage patterning and foliation. Furthermore, cerebellar patterning was normal in both Gli2-cko and Smo-cko mutant mice, where all Shh function was removed from the developing cerebellum. Thus, our data demonstrate that Zic1 and Zic4 have both Shh-dependent and -independent roles during cerebellar development and that multiple developmental disruptions underlie Zic1/4-related DWM. PMID:21307096

  14. Genome-wide analysis of the interaction between the endosymbiotic bacterium Wolbachia and its Drosophila host.

    PubMed

    Xi, Zhiyong; Gavotte, Laurent; Xie, Yan; Dobson, Stephen L

    2008-01-02

    Intracellular Wolbachia bacteria are obligate, maternally-inherited, endosymbionts found frequently in insects and other invertebrates. The success of Wolbachia can be attributed in part to an ability to alter host reproduction via mechanisms including cytoplasmic incompatibility (CI), parthenogenesis, feminization and male killing. Despite substantial scientific effort, the molecular mechanisms underlying the Wolbachia/host interaction are unknown. Here, an in vitro Wolbachia infection was generated in the Drosophila S2 cell line, and transcription profiles of infected and uninfected cells were compared by microarray. Differentially-expressed patterns related to reproduction, immune response and heat stress response are observed, including multiple genes that have been previously reported to be involved in the Wolbachia/host interaction. Subsequent in vivo characterization of differentially-expressed products in gonads demonstrates that Angiotensin Converting Enzyme (Ance) varies between Wolbachia infected and uninfected flies and that the variation occurs in a sex-specific manner. Consistent with expectations for the conserved CI mechanism, the observed Ance expression pattern is repeatable in different Drosophila species and with different Wolbachia types. To examine Ance involvement in the CI phenotype, compatible and incompatible crosses of Ance mutant flies were conducted. Significant differences are observed in the egg hatch rate resulting from incompatible crosses, providing support for additional experiments examining for an interaction of Ance with the CI mechanism. Wolbachia infection is shown to affect the expression of multiple host genes, including Ance. Evidence for potential Ance involvement in the CI mechanism is described, including the prior report of Ance in spermatid differentiation, Wolbachia-induced sex-specific effects on Ance expression and an Ance mutation effect on CI levels. The results support the use of Wolbachia infected cell cultures as an appropriate model for predicting in vivo host/Wolbachia interactions.

  15. Genome-wide analysis of the interaction between the endosymbiotic bacterium Wolbachia and its Drosophila host

    PubMed Central

    Xi, Zhiyong; Gavotte, Laurent; Xie, Yan; Dobson, Stephen L

    2008-01-01

    Background Intracellular Wolbachia bacteria are obligate, maternally-inherited, endosymbionts found frequently in insects and other invertebrates. The success of Wolbachia can be attributed in part to an ability to alter host reproduction via mechanisms including cytoplasmic incompatibility (CI), parthenogenesis, feminization and male killing. Despite substantial scientific effort, the molecular mechanisms underlying the Wolbachia/host interaction are unknown. Results Here, an in vitro Wolbachia infection was generated in the Drosophila S2 cell line, and transcription profiles of infected and uninfected cells were compared by microarray. Differentially-expressed patterns related to reproduction, immune response and heat stress response are observed, including multiple genes that have been previously reported to be involved in the Wolbachia/host interaction. Subsequent in vivo characterization of differentially-expressed products in gonads demonstrates that Angiotensin Converting Enzyme (Ance) varies between Wolbachia infected and uninfected flies and that the variation occurs in a sex-specific manner. Consistent with expectations for the conserved CI mechanism, the observed Ance expression pattern is repeatable in different Drosophila species and with different Wolbachia types. To examine Ance involvement in the CI phenotype, compatible and incompatible crosses of Ance mutant flies were conducted. Significant differences are observed in the egg hatch rate resulting from incompatible crosses, providing support for additional experiments examining for an interaction of Ance with the CI mechanism. Conclusion Wolbachia infection is shown to affect the expression of multiple host genes, including Ance. Evidence for potential Ance involvement in the CI mechanism is described, including the prior report of Ance in spermatid differentiation, Wolbachia-induced sex-specific effects on Ance expression and an Ance mutation effect on CI levels. The results support the use of Wolbachia infected cell cultures as an appropriate model for predicting in vivo host/Wolbachia interactions. PMID:18171476

  16. Methylation-Dependent Activation of CDX1 through NF-κB

    PubMed Central

    Rau, Tilman T.; Rogler, Anja; Frischauf, Myrjam; Jung, Andreas; Konturek, Peter C.; Dimmler, Arno; Faller, Gerhard; Sehnert, Bettina; El-Rifai, Wael; Hartmann, Arndt; Voll, Reinhard E.; Schneider-Stock, Regine

    2013-01-01

    The caudal homeobox factor 1 (CDX1) is an essential transcription factor for intestinal differentiation. Its aberrant expression in intestinal metaplasia of the upper gastrointestinal tract is a hallmark within the gastritis-metaplasia-carcinoma sequence. CDX1 expression is influenced by certain pathways, such as Wnt, Ras, or NF-κB signaling; however, these pathways alone cannot explain the transient expression of CDX1 in intestinal metaplasia or the molecular inactivation mechanism of its loss in cases of advanced gastric cancer. In this study, we investigated the epigenetic inactivation of CDX1 by promoter methylation, as well as the functional link of CDX1 promoter methylation to the inflammatory NF-κB signaling pathway. We identified methylation-dependent NF-κB binding to the CDX1 promoter and quantified it using competitive electrophoretic mobility shift assays and chromatin immunoprecipitation. A methylated CDX1 promoter was associated with closed chromatin structure, reduced NF-κB binding, and transcriptional silencing. Along the gastritis-metaplasia-carcinoma sequence, we observed a biphasic pattern of tumor necrosis factor-α (TNF-α) protein expression and an inverse biphasic pattern of CDX1 promoter methylation; both are highly consistent with CDX1 protein expression. The stages of hyper-, hypo-, and hyper-methylation patterns of the CDX1 promoter were inversely correlated with the NF-κB signaling activity along this sequence. In conclusion, these functionally interacting events drive CDX1 expression and contribute to intestinal metaplasia, epithelial dedifferentiation, and carcinogenesis in the human stomach. PMID:22749770

  17. DNA methylation patterns and gene expression associated with litter size in Berkshire pig placenta

    PubMed Central

    Kwon, Seulgi; Park, Da Hye; Kim, Tae Wan; Kang, Deok Gyeong; Yu, Go Eun; Kim, Il-Suk; Park, Hwa Chun; Ha, Jeongim; Kim, Chul Wook

    2017-01-01

    Increasing litter size is of great interest to the pig industry. DNA methylation is an important epigenetic modification that regulates gene expression, resulting in livestock phenotypes such as disease resistance, milk production, and reproduction. We classified Berkshire pigs into two groups according to litter size and estimated breeding value: smaller (SLG) and larger (LLG) litter size groups. Genome-wide DNA methylation and gene expression were analyzed using placenta genomic DNA and RNA to identify differentially methylated regions (DMRs) and differentially expressed genes (DEGs) associated with litter size. The methylation levels of CpG dinucleotides in different genomic regions were noticeably different between the groups, while global methylation pattern was similar, and excluding intergenic regions they were found the most frequently in gene body regions. Next, we analyzed RNA-Seq data to identify DEGs between the SLG and LLG groups. A total of 1591 DEGs were identified: 567 were downregulated and 1024 were upregulated in LLG compared to SLG. To identify genes that simultaneously exhibited changes in DNA methylation and mRNA expression, we integrated and analyzed the data from bisulfite-Seq and RNA-Seq. Nine DEGs positioned in DMRs were found. The expression of only three of these genes (PRKG2, CLCA4, and PCK1) was verified by RT-qPCR. Furthermore, we observed the same methylation patterns in blood samples as in the placental tissues by PCR-based methylation analysis. Together, these results provide useful data regarding potential epigenetic markers for selecting hyperprolific sows. PMID:28880934

  18. Evolutionary Patterns of RNA-Based Duplication in Non-Mammalian Chordates

    PubMed Central

    Li, Xin; Vibranovski, Maria D.; Gan, Xiaoni; Wang, Dengqiang; Wang, Wen; Long, Manyuan; He, Shunping

    2011-01-01

    The role of RNA-based duplication, or retroposition, in the evolution of new gene functions in mammals, plants, and Drosophila has been widely reported. However, little is known about RNA-based duplication in non-mammalian chordates. In this study, we screened ten non-mammalian chordate genomes for retrocopies and investigated their evolutionary patterns. We identified numerous retrocopies in these species. Examination of the age distribution of these retrocopies revealed no burst of young retrocopies in ancient chordate species. Upon comparing these non-mammalian chordate species to the mammalian species, we observed that a larger fraction of the non-mammalian retrocopies was under strong evolutionary constraints than mammalian retrocopies are, as evidenced by signals of purifying selection and expression profiles. For the Western clawed frog, Medaka, and Sea squirt, many retrogenes have evolved gonad and brain expression patterns, similar to what was observed in human. Testing of retrogene movement in the Medaka genome, where the nascent sex chrosomes have been well assembled, did not reveal any significant gene movement. Taken together, our analyses demonstrate that RNA-based duplication generates many functional genes and can make a significant contribution to the evolution of non-mammalian genomes. PMID:21779328

  19. Mechanisms of macroevolution: polyphagous plasticity in butterfly larvae revealed by RNA-Seq.

    PubMed

    de la Paz Celorio-Mancera, Maria; Wheat, Christopher W; Vogel, Heiko; Söderlind, Lina; Janz, Niklas; Nylin, Sören

    2013-10-01

    Transcriptome studies of insect herbivory are still rare, yet studies in model systems have uncovered patterns of transcript regulation that appear to provide insights into how insect herbivores attain polyphagy, such as a general increase in expression breadth and regulation of ribosomal, digestion- and detoxification-related genes. We investigated the potential generality of these emerging patterns, in the Swedish comma, Polygonia c-album, which is a polyphagous, widely-distributed butterfly. Urtica dioica and Ribes uva-crispa are hosts of P. c-album, but Ribes represents a recent evolutionary shift onto a very divergent host. Utilizing the assembled transcriptome for read mapping, we assessed gene expression finding that caterpillar life-history (i.e. 2nd vs. 4th-instar regulation) had a limited influence on gene expression plasticity. In contrast, differential expression in response to host-plant identified genes encoding serine-type endopeptidases, membrane-associated proteins and transporters. Differential regulation of genes involved in nucleic acid binding was also observed suggesting that polyphagy involves large scale transcriptional changes. Additionally, transcripts coding for structural constituents of the cuticle were differentially expressed in caterpillars in response to their diet indicating that the insect cuticle may be a target for plant defence. Our results state that emerging patterns of transcript regulation from model species appear relevant in species when placed in an evolutionary context. © 2013 John Wiley & Sons Ltd.

  20. Progestogen treatments for cycle management in a sheep model of assisted conception affect the growth patterns, the expression of luteinizing hormone receptors, and the progesterone secretion of induced corpora lutea.

    PubMed

    Letelier, Claudia; García-Fernández, Rosa Ana; Contreras-Solis, Ignacio; Sanchez, María Angeles; Garcia-Palencia, Pilar; Sanchez, Belen; Gonzalez-Bulnes, Antonio; Flores, Juana María

    2010-03-01

    To determine, in a sheep model, the effect of a short-term progestative treatment on growth dynamics and functionality of induced corpora lutea. Observational, model study. Public university. Sixty adult female sheep. Synchronization and induction of ovulation with progestogens and prostaglandin analogues; ovarian ultrasonography, blood sampling, and ovariectomy. Determination of pituitary function and morphologic characteristics, expression of luteinizing hormone (LH) receptors, and progesterone secretion of corpora lutea. The use of progestative pretreatments for assisted conception affect the growth patterns, the expression of LH receptors, and the progesterone secretion of induced corpora lutea. The current study indicates, in a sheep model, the existence of deleterious effects from progestogens on functionality of induced corpora lutea. Copyright 2010 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

  1. Photokinesis and Djopsin gene expression analysis during the regeneration of planarian eyes.

    PubMed

    Dong, Zimei; Yuwen, Yanqing; Sima, Yingxu; Dong, Yanping; Zhan, Huina; Chen, Guangwen; Liu, Dezeng

    2017-03-01

    Planarians provide the ideal model for studying eye development, with their simple eye structure and exceptionally rapid regeneration. Here, we observed the eye morphogenesis, photophobic behavior, spectral sensitivity and expression pattern of Djopsin in the freshwater planarian Dugesia japonica. The results showed that: (i) Djopsin encoding the putative protein belonged to the rhabdomeric opsins group and displayed high conservation during animal evolution; (ii) planarians displayed diverse photophobic response to different visible wavelengths and were more sensitive to light blue (495 nm) and yellow (635 nm); (iii) the morphogenesis and functional recovery of eyes were related to the expression pattern of Djopsin during head regeneration; and (iv) Djopsin gene plays a major role in functional recovery during eye regeneration and visual system maintenance in adult planarians. © 2016 International Society of Zoological Sciences, Institute of Zoology/Chinese Academy of Sciences and John Wiley & Sons Australia, Ltd.

  2. A segmental pattern of alkaline phosphatase activity within the notochord coincides with the initial formation of the vertebral bodies.

    PubMed

    Grotmol, Sindre; Nordvik, Kari; Kryvi, Harald; Totland, Geir K

    2005-05-01

    This study shows that segmental expression of alkaline phosphatase (ALP) activity by the notochord of the Atlantic salmon (Salmo salar L.) coincides with the initial mineralization of the vertebral body (chordacentrum), and precedes ALP expression by presumed somite-derived cells external to the notochordal sheath. The early expression of ALP indicates that the notochord plays an instructive role in the segmental patterning of the vertebral column. The chordacentra form segmentally as mineralized rings within the notochordal sheath, and ALP activity spreads within the chordoblast layer from ventral to dorsal, displaying the same progression and spatial distribution as the mineralization process. No ALP activity was observed in sclerotomal mesenchyme surrounding the notochordal sheath during initial formation of the chordacentra. Our results support previous findings indicating that the chordoblasts initiate a segmental differentiation of the notochordal sheath into chordacentra and intervertebral regions.

  3. Identification of Quantitative Trait Loci Controlling Gene Expression during the Innate Immunity Response of Soybean1[W][OA

    PubMed Central

    Valdés-López, Oswaldo; Thibivilliers, Sandra; Qiu, Jing; Xu, Wayne Wenzhong; Nguyen, Tran H.N.; Libault, Marc; Le, Brandon H.; Goldberg, Robert B.; Hill, Curtis B.; Hartman, Glen L.; Diers, Brian; Stacey, Gary

    2011-01-01

    Microbe-associated molecular pattern-triggered immunity (MTI) is an important component of the plant innate immunity response to invading pathogens. However, most of our knowledge of MTI comes from studies of model systems with relatively little work done with crop plants. In this work, we report on variation in both the microbe-associated molecular pattern-triggered oxidative burst and gene expression across four soybean (Glycine max) genotypes. Variation in MTI correlated with the level of pathogen resistance for each genotype. A quantitative trait locus analysis on these traits identified four loci that appeared to regulate gene expression during MTI in soybean. Likewise, we observed that both MTI variation and pathogen resistance were quantitatively inherited. The approach utilized in this study may have utility for identifying key resistance loci useful for developing improved soybean cultivars. PMID:21963820

  4. [Transient expression and characterization of intracellular single chain Fv against the nucleocapsid protein of Hantavirus].

    PubMed

    Bai, Wen-tao; Xu, Zhi-kai; Zhang, Fang-lin; Luo, Wen; Liu, Yong; Wu, Xing-an; Yan, Yan

    2004-11-01

    To transiently express an intracellular single chain Fv of monoclonal antibody 1A8 against nucleocapsid protein of Hantavirus and characterize the immunological activities of the expressed products. COS-7 cells were transfected with mammalian expression vector 1A8-scFv-Ckappa/pCI-neo via lipofectin. The expressed product was identified by indirect immunofluorescence and immunoprecipitation. A diffuse pattern fluorescence was observed in less than 1% cytoplasm of transfected COS-7 cells. The binding of intracellular antibody fragments to NP antigen was confirmed by immunoprecipitation analysis. Transiently expressed single chain intrabodies can effectively target NP antigen in the cytoplasm. The present study may provide a new approach for treatment of Hantavirus.

  5. Identification of new participants in the rainbow trout (Oncorhynchus mykiss) oocyte maturation and ovulation processes using cDNA microarrays

    PubMed Central

    Bobe, Julien; Montfort, Jerôme; Nguyen, Thaovi; Fostier, Alexis

    2006-01-01

    Background The hormonal control of oocyte maturation and ovulation as well as the molecular mechanisms of nuclear maturation have been thoroughly studied in fish. In contrast, the other molecular events occurring in the ovary during post-vitellogenesis have received far less attention. Methods Nylon microarrays displaying 9152 rainbow trout cDNAs were hybridized using RNA samples originating from ovarian tissue collected during late vitellogenesis, post-vitellogenesis and oocyte maturation. Differentially expressed genes were identified using a statistical analysis. A supervised clustering analysis was performed using only differentially expressed genes in order to identify gene clusters exhibiting similar expression profiles. In addition, specific genes were selected and their preovulatory ovarian expression was analyzed using real-time PCR. Results From the statistical analysis, 310 differentially expressed genes were identified. Among those genes, 90 were up-regulated at the time of oocyte maturation while 220 exhibited an opposite pattern. After clustering analysis, 90 clones belonging to 3 gene clusters exhibiting the most remarkable expression patterns were kept for further analysis. Using real-time PCR analysis, we observed a strong up-regulation of ion and water transport genes such as aquaporin 4 (aqp4) and pendrin (slc26). In addition, a dramatic up-regulation of vasotocin (avt) gene was observed. Furthermore, angiotensin-converting-enzyme 2 (ace2), coagulation factor V (cf5), adam 22, and the chemokine cxcl14 genes exhibited a sharp up-regulation at the time of oocyte maturation. Finally, ovarian aromatase (cyp19a1) exhibited a dramatic down-regulation over the post-vitellogenic period while a down-regulation of Cytidine monophosphate-N-acetylneuraminic acid hydroxylase (cmah) was observed at the time of oocyte maturation. Conclusion We showed the over or under expression of more that 300 genes, most of them being previously unstudied or unknown in the fish preovulatory ovary. Our data confirmed the down-regulation of estrogen synthesis genes during the preovulatory period. In addition, the strong up-regulation of aqp4 and slc26 genes prior to ovulation suggests their participation in the oocyte hydration process occurring at that time. Furthermore, among the most up-regulated clones, several genes such as cxcl14, ace2, adam22, cf5 have pro-inflammatory, vasodilatory, proteolytics and coagulatory functions. The identity and expression patterns of those genes support the theory comparing ovulation to an inflammatory-like reaction. PMID:16872517

  6. Amelogenin in odontogenic cysts and tumors: An immunohistochemical study

    PubMed Central

    Anigol, Praveen; Kamath, Venkatesh V.; Satelur, Krishnanand; Anand, Nagaraja; Yerlagudda, Komali

    2014-01-01

    Background: Amelogenins are the major enamel proteins that play a major role in the biomineralization and structural organization of enamel. Aberrations of enamel-related proteins are thought to be involved in oncogenesis of odontogenic epithelium. The expression of amelogenin is possibly an indicator of differentiation of epithelial cells in the odontogenic lesions. Aims and Objectives: The present study aimed to observe the expression of amelogenin immunohistochemically in various odontogenic lesions. Materials and Methods: Paraffin sections of 40 odontogenic lesions were stained immunohistochemically with amelogenin antibodies. The positivity, pattern and intensity of expression of the amelogenin antibody were assessed, graded and statistically compared between groups of odontogenic cysts and tumors. Results: Almost all the odontogenic lesions expressed amelogenin in the epithelial component with the exception of an ameloblastic carcinoma. Differing grades of intensity and pattern were seen between the cysts and tumors. Intensity of expression was uniformly prominent in all odontogenic lesions with hard tissue formation. Statistical analysis however did not indicate significant differences between the two groups. Conclusion: The expression of amelogenin antibody is ubiquitous in odontogenic tissues and can be used as a definitive marker for identification of odontogenic epithelium. PMID:25937729

  7. [Molecular cloning, expression of rat Msx-1 and Msx-2 during early embryo genesis and roles for mandibular chondrogenesis].

    PubMed

    Ishiguro, S

    1999-03-01

    Quail-chick chimera experiments have shown a contribution of carnial neural crest cells to the craniofacial skeletal elements. Moreover, tissue interactions between epithelial-mesenchymal interaction during early facial process development are required for both skeletal differentiation and morphogenesis. In this study, it was observed that Msx homeobox containing genes expressed in the facial process were important molecules of cartilage morphogenesis. Rat cDNAs were isolated and encoded by Msx-1 and -2, and then the expression patterns using in situ hybridization were investigated during early rat face development. These genes were correlatively expressed in the cranial neural crest forming area (E 9.5 dpc) and the facial process (E 12.5 dpc). Antisence inhibition of Msx genes in the E 12.5 mandibular process exhibited the alteration of their gene expression and cartilage patterns. Antisence inhibition of Msx-1 induced lack of the medial portion of cartilage, and antisence inhibition of Msx-2 enhanced chondrogenesis of mandibular process under the organ culture condition. Thus it was concluded that expression of Msx genes during mandibular process development comprises important signals of chondrogenesis.

  8. Characterization of TALE genes expression during the first lineage segregation in mammalian embryos.

    PubMed

    Sonnet, Wendy; Rezsöhazy, Rene; Donnay, Isabelle

    2012-11-01

    Three amino acid loop extension (TALE) homeodomain-containing transcription factors are generally recognized for their role in organogenesis and differentiation during embryogenesis. However, very little is known about the expression and function of Meis, Pbx, and Prep genes during early development. In order to determine whether TALE proteins could contribute to the early cell fate decisions in mammalian development, this study aimed to characterize in a systematic manner the pattern of expression of all Meis, Pbx, and Prep genes from the precompaction to blastocyst stage corresponding to the first step of cell differentiation in mammals. To reveal to what extent TALE genes expression at these early stages is a conserved feature among mammals, this study was performed in parallel in the bovine and mouse models. We demonstrated the transcription and translation of TALE genes, before gastrulation in the two species. At least one member of Meis, Pbx, and Prep subfamilies was found expressed at the RNA and protein levels but different patterns of expression were observed between genes and between species, suggesting specific gene regulations. Taken together, these results suggest a previously unexpected involvement of these factors during the early development in mammals. Copyright © 2012 Wiley Periodicals, Inc.

  9. Low-rank regularization for learning gene expression programs.

    PubMed

    Ye, Guibo; Tang, Mengfan; Cai, Jian-Feng; Nie, Qing; Xie, Xiaohui

    2013-01-01

    Learning gene expression programs directly from a set of observations is challenging due to the complexity of gene regulation, high noise of experimental measurements, and insufficient number of experimental measurements. Imposing additional constraints with strong and biologically motivated regularizations is critical in developing reliable and effective algorithms for inferring gene expression programs. Here we propose a new form of regulation that constrains the number of independent connectivity patterns between regulators and targets, motivated by the modular design of gene regulatory programs and the belief that the total number of independent regulatory modules should be small. We formulate a multi-target linear regression framework to incorporate this type of regulation, in which the number of independent connectivity patterns is expressed as the rank of the connectivity matrix between regulators and targets. We then generalize the linear framework to nonlinear cases, and prove that the generalized low-rank regularization model is still convex. Efficient algorithms are derived to solve both the linear and nonlinear low-rank regularized problems. Finally, we test the algorithms on three gene expression datasets, and show that the low-rank regularization improves the accuracy of gene expression prediction in these three datasets.

  10. Expression pattern of cdkl5 during zebrafish early development: implications for use as model for atypical Rett syndrome.

    PubMed

    Vitorino, Marta; Cunha, Nídia; Conceição, Natércia; Cancela, M Leonor

    2018-05-11

    Atypical Rett syndrome is a child neurodevelopmental disorder induced by mutations in CDKL5 gene and characterized by a progressive regression in development with loss of purposeful use of the hands, slowed brain and head growth, problems with walking, seizures, and intellectual disability. At the moment, there is no cure for this pathology and little information is available concerning animal models capable of mimicking its phenotypes, thus the development of additional animal models should be of interest to gain more knowledge about the disease. Zebrafish has been used successfully as model organism for many human genetic diseases; however, no information is available concerning the spatial and temporal expression of cdkl5 orthologous in this organism. In the present study, we identified the developmental expression patterns of cdkl5 in zebrafish by quantitative PCR and whole-mount in situ hybridization. cdkl5 is expressed maternally at low levels during the first 24 h of development. After that the expression of the gene increases significantly and it starts to be expressed mainly in the nervous system and in several brain structures, such as telencephalon, mesencephalon and diencephalon. The expression patterns of cdkl5 in zebrafish is in accordance with the tissues known to be affected in humans and associated to symptoms and deficits observed in Rett syndrome patients thus providing the first evidence that zebrafish could be an alternative model to study the molecular pathways of this disease as well as to test possible therapeutic approaches capable of rescuing the phenotype.

  11. The Smad4/PTEN Expression Pattern Predicts Clinical Outcomes in Colorectal Adenocarcinoma

    PubMed Central

    Chung, Yumin; Wi, Young Chan; Kim, Yeseul; Bang, Seong Sik; Yang, Jung-Ho; Jang, Kiseok; Min, Kyueng-Whan; Paik, Seung Sam

    2018-01-01

    Background Smad4 and PTEN are prognostic indicators for various tumor types. Smad4 regulates tumor suppression, whereas PTEN inhibits cell proliferation. We analyzed and compared the performance of Smad4 and PTEN for predicting the prognosis of patients with colorectal adenocarcinoma. Methods Combined expression patterns based on Smad4+/– and PTEN+/– status were evaluated by immunostaining using a tissue microarray of colorectal adenocarcinoma. The relationships between the protein expression and clinicopathological variables were analyzed. Results Smad4–/PTEN– status was most frequently observed in metastatic adenocarcinoma, followed by primary adenocarcinoma and tubular adenoma (p<.001). When Smad4–/PTEN– and Smad4+/PTEN+ groups were compared, Smad4–/PTEN– status was associated with high N stage (p=.018) and defective mismatch repair proteins (p=.006). Significant differences in diseasefree survival and overall survival were observed among the three groups (Smad4+/PTEN+, Smad4–/PTEN+ or Smad4+/PTEN–, and Smad4–/PTEN–) (all p<.05). Conclusions Concurrent loss of Smad4 and PTEN may lead to more aggressive disease and poor prognosis in patients with colorectal adenocarcinoma compared to the loss of Smad4 or PTEN alone. PMID:29056035

  12. Algorithms for Hidden Markov Models Restricted to Occurrences of Regular Expressions

    PubMed Central

    Tataru, Paula; Sand, Andreas; Hobolth, Asger; Mailund, Thomas; Pedersen, Christian N. S.

    2013-01-01

    Hidden Markov Models (HMMs) are widely used probabilistic models, particularly for annotating sequential data with an underlying hidden structure. Patterns in the annotation are often more relevant to study than the hidden structure itself. A typical HMM analysis consists of annotating the observed data using a decoding algorithm and analyzing the annotation to study patterns of interest. For example, given an HMM modeling genes in DNA sequences, the focus is on occurrences of genes in the annotation. In this paper, we define a pattern through a regular expression and present a restriction of three classical algorithms to take the number of occurrences of the pattern in the hidden sequence into account. We present a new algorithm to compute the distribution of the number of pattern occurrences, and we extend the two most widely used existing decoding algorithms to employ information from this distribution. We show experimentally that the expectation of the distribution of the number of pattern occurrences gives a highly accurate estimate, while the typical procedure can be biased in the sense that the identified number of pattern occurrences does not correspond to the true number. We furthermore show that using this distribution in the decoding algorithms improves the predictive power of the model. PMID:24833225

  13. Evolutionary stasis in Euphorbiaceae pollen: selection and constraints.

    PubMed

    Matamoro-Vidal, A; Furness, C A; Gouyon, P-H; Wurdack, K J; Albert, B

    2012-06-01

    Although much attention has been paid to the role of stabilizing selection, empirical analyses testing the role of developmental constraints in evolutionary stasis remain rare, particularly for plants. This topic is studied here with a focus on the evolution of a pollen ontogenetic feature, the last points of callose deposition (LPCD) pattern, involved in the determination of an adaptive morphological pollen character (aperture pattern). The LPCD pattern exhibits a low level of evolution in eudicots, as compared to the evolution observed in monocots. Stasis in this pattern might be explained by developmental constraints expressed during male meiosis (microsporogenesis) or by selective pressures expressed through the adaptive role of the aperture pattern. Here, we demonstrate that the LPCD pattern is conserved in Euphorbiaceae s.s. and that this conservatism is primarily due to selective pressures. A phylogenetic association was found between the putative removal of selective pressures on pollen morphology after the origin of inaperturate pollen, and the appearance of variation in microsporogenesis and in the resulting LPCD pattern, suggesting that stasis was due to these selective pressures. However, even in a neutral context, variation in microsporogenesis was biased. This should therefore favour the appearance of some developmental and morphological phenotypes rather than others. © 2012 The Authors. Journal of Evolutionary Biology © 2012 European Society For Evolutionary Biology.

  14. Sex differences in autism: a resting-state fMRI investigation of functional brain connectivity in males and females

    PubMed Central

    Swinnen, Stephan P.; Wenderoth, Nicole

    2016-01-01

    Autism spectrum disorders (ASD) are far more prevalent in males than in females. Little is known however about the differential neural expression of ASD in males and females. We used a resting-state fMRI-dataset comprising 42 males/42 females with ASD and 75 male/75 female typical-controls to examine whether autism-related alterations in intrinsic functional connectivity are similar or different in males and females, and particularly whether alterations reflect ‘neural masculinization’, as predicted by the Extreme Male Brain theory. Males and females showed a differential neural expression of ASD, characterized by highly consistent patterns of hypo-connectivity in males with ASD (compared to typical males), and hyper-connectivity in females with ASD (compared to typical females). Interestingly, patterns of hyper-connectivity in females with ASD reflected a shift towards the (high) connectivity levels seen in typical males (neural masculinization), whereas patterns of hypo-connectivity observed in males with ASD reflected a shift towards the (low) typical feminine connectivity patterns (neural feminization). Our data support the notion that ASD is a disorder of sexual differentiation rather than a disorder characterized by masculinization in both genders. Future work is needed to identify underlying factors such as sex hormonal alterations that drive these sex-specific neural expressions of ASD. PMID:26989195

  15. Gene expression patterns in formalin-fixed, paraffin-embedded core biopsies predict docetaxel chemosensitivity in breast cancer patients.

    PubMed

    Chang, Jenny C; Makris, Andreas; Gutierrez, M Carolina; Hilsenbeck, Susan G; Hackett, James R; Jeong, Jennie; Liu, Mei-Lan; Baker, Joffre; Clark-Langone, Kim; Baehner, Frederick L; Sexton, Krsytal; Mohsin, Syed; Gray, Tara; Alvarez, Laura; Chamness, Gary C; Osborne, C Kent; Shak, Steven

    2008-03-01

    Previously, we had identified gene expression patterns that predicted response to neoadjuvant docetaxel. Other studies have validated that a high Recurrence Score (RS) by the 21-gene RT-PCR assay is predictive of worse prognosis but better response to chemotherapy. We investigated whether tumor expression of these 21 genes and other candidate genes can predict response to docetaxel. Core biopsies from 97 patients were obtained before treatment with neoadjuvant docetaxel (4 cycles, 100 mg/m2 q3 weeks). Three 10-microm FFPE sections were submitted for quantitative RT-PCR assays of 192 genes that were selected from our previous work and the literature. Of the 97 patients, 81 (84%) had sufficient invasive cancer, 80 (82%) had sufficient RNA for QRTPCR assay, and 72 (74%) had clinical response data. Mean age was 48.5 years, and the median tumor size was 6 cm. Clinical complete responses (CR) were observed in 12 (17%), partial responses in 41 (57%), stable disease in 17 (24%), and progressive disease in 2 patients (3%). A significant relationship (P<0.05) between gene expression and CR was observed for 14 genes, including CYBA. CR was associated with lower expression of the ER gene group and higher expression of the proliferation gene group from the 21 gene assay. Of note, CR was more likely with a high RS (P=0.008). We have established molecular profiles of sensitivity to docetaxel. RT-PCR technology provides a potential platform for a predictive test of docetaxel chemosensitivity using small amounts of routinely processed material.

  16. Male sex interspecies divergence and down regulation of expression of spermatogenesis genes in Drosophila sterile hybrids.

    PubMed

    Sundararajan, Vignesh; Civetta, Alberto

    2011-01-01

    Male sex genes have shown a pattern of rapid interspecies divergence at both the coding and gene expression level. A common outcome from crosses between closely-related species is hybrid male sterility. Phenotypic and genetic studies in Drosophila sterile hybrid males have shown that spermatogenesis arrest is postmeiotic with few exceptions, and that most misregulated genes are involved in late stages of spermatogenesis. Comparative studies of gene regulation in sterile hybrids and parental species have mainly used microarrays providing a whole genome representation of regulatory problems in sterile hybrids. Real-time PCR studies can reject or reveal differences not observed in microarray assays. Moreover, differences in gene expression between samples can be dependant on the source of RNA (e.g., whole body vs. tissue). Here we survey expression in D. simulans, D. mauritiana and both intra and interspecies hybrids using a real-time PCR approach for eight genes expressed at the four main stages of sperm development. We find that all genes show a trend toward under expression in the testes of sterile hybrids relative to parental species with only the two proliferation genes (bam and bgcn) and the two meiotic class genes (can and sa) showing significant down regulation. The observed pattern of down regulation for the genes tested can not fully explain hybrid male sterility. We discuss the down regulation of spermatogenesis genes in hybrids between closely-related species within the contest of rapid divergence experienced by the male genome, hybrid sterility and possible allometric changes due to subtle testes-specific developmental abnormalities.

  17. Circadian gene expression regulates pulsatile gonadotropin-releasing hormone (GnRH) secretory patterns in the hypothalamic GnRH-secreting GT1-7 cell line.

    PubMed

    Chappell, Patrick E; White, Rachel S; Mellon, Pamela L

    2003-12-03

    Although it has long been established that episodic secretion of gonadotropin-releasing hormone (GnRH) from the hypothalamus is required for normal gonadotropin release, the molecular and cellular mechanisms underlying the synchronous release of GnRH are primarily unknown. We used the GT1-7 mouse hypothalamic cell line as a model for GnRH secretion, because these cells release GnRH in a pulsatile pattern similar to that observed in vivo. To explore possible molecular mechanisms governing secretory timing, we investigated the role of the molecular circadian clock in regulation of GnRH secretion. GT1-7 cells express many known core circadian clock genes, and we demonstrate that oscillations of these components can be induced by stimuli such as serum and the adenylyl cyclase activator forskolin, similar to effects observed in fibroblasts. Strikingly, perturbation of circadian clock function in GT1-7 cells by transient expression of the dominant-negative Clock-Delta19 gene disrupts normal ultradian patterns of GnRH secretion, significantly decreasing mean pulse frequency. Additionally, overexpression of the negative limb clock gene mCry1 in GT1-7 cells substantially increases GnRH pulse amplitude without a commensurate change in pulse frequency, demonstrating that an endogenous biological clock is coupled to the mechanism of neurosecretion in these cells and can regulate multiple secretory parameters. Finally, mice harboring a somatic mutation in the Clock gene are subfertile and exhibit a substantial increase in estrous cycle duration as revealed by examination of vaginal cytology. This effect persists in normal light/dark (LD) cycles, suggesting that a suprachiasmatic nucleus-independent endogenous clock in GnRH neurons is required for eliciting normal pulsatile patterns of GnRH secretion.

  18. Dual odontogenic origins develop at the early stage of rat maxillary incisor development.

    PubMed

    Kriangkrai, Rungarun; Iseki, Sachiko; Eto, Kazuhiro; Chareonvit, Suconta

    2006-03-01

    Developmental process of rat maxillary incisor has been studied through histological analysis and investigation of tooth-related gene expression patterns at initial tooth development. The tooth-related genes studied here are fibroblast growth factor-8 (Fgf-8), pituitary homeobox gene-2 (Pitx-2), sonic hedgehog (Shh), muscle segment homeobox-1 (Msx-1), paired box-9 (Pax-9) and bone morphogenetic protein-4 (Bmp-4). The genes are expressed in oral epithelium and/or ectomesenchyme at the stage of epithelial thickening to the early bud stage of tooth development. Both the histological observation and tooth-related gene expression patterns during early stage of maxillary incisor development demonstrate that dual odontogenic origins aligned medio-laterally in the medial nasal process develop, subsequently only single functional maxillary incisor dental placode forms. The cascade of tooth-related gene expression patterns in rat maxillary incisor studied here is quite similar to those of the previous studies in mouse mandibular molar, even though the origins of oral epithelium and ectomesenchyme involved in development of maxillary incisor and mandibular molar are different. Thus, we conclude that maxillary incisor and mandibular molar share a similar signaling control of Fgf-8, Pitx-2, Shh, Msx-1, Pax-9 and Bmp-4 genes at the stage of oral epithelial thickening to the early bud stage of tooth development.

  19. Videos of conspecifics elicit interactive looking patterns and facial expressions in monkeys

    PubMed Central

    Mosher, Clayton P.; Zimmerman, Prisca E.; Gothard, Katalin M.

    2014-01-01

    A broader understanding of the neural basis of social behavior in primates requires the use of species-specific stimuli that elicit spontaneous, but reproducible and tractable behaviors. In this context of natural behaviors, individual variation can further inform about the factors that influence social interactions. To approximate natural social interactions similar to those documented by field studies, we used unedited video footage to induce in viewer monkeys spontaneous facial expressions and looking patterns in the laboratory setting. Three adult male monkeys, previously behaviorally and genetically (5-HTTLPR) characterized (Gibboni et al., 2009), were monitored while they watched 10 s video segments depicting unfamiliar monkeys (movie monkeys) displaying affiliative, neutral, and aggressive behaviors. The gaze and head orientation of the movie monkeys alternated between ‘averted’ and ‘directed’ at the viewer. The viewers were not reinforced for watching the movies, thus their looking patterns indicated their interest and social engagement with the stimuli. The behavior of the movie monkey accounted for differences in the looking patterns and facial expressions displayed by the viewers. We also found multiple significant differences in the behavior of the viewers that correlated with their interest in these stimuli. These socially relevant dynamic stimuli elicited spontaneous social behaviors, such as eye-contact induced reciprocation of facial expression, gaze aversion, and gaze following, that were previously not observed in response to static images. This approach opens a unique opportunity to understanding the mechanisms that trigger spontaneous social behaviors in humans and non-human primates. PMID:21688888

  20. A MS-lesion pattern discrimination plot based on geostatistics.

    PubMed

    Marschallinger, Robert; Schmidt, Paul; Hofmann, Peter; Zimmer, Claus; Atkinson, Peter M; Sellner, Johann; Trinka, Eugen; Mühlau, Mark

    2016-03-01

    A geostatistical approach to characterize MS-lesion patterns based on their geometrical properties is presented. A dataset of 259 binary MS-lesion masks in MNI space was subjected to directional variography. A model function was fit to express the observed spatial variability in x, y, z directions by the geostatistical parameters Range and Sill. Parameters Range and Sill correlate with MS-lesion pattern surface complexity and total lesion volume. A scatter plot of ln(Range) versus ln(Sill), classified by pattern anisotropy, enables a consistent and clearly arranged presentation of MS-lesion patterns based on geometry: the so-called MS-Lesion Pattern Discrimination Plot. The geostatistical approach and the graphical representation of results are considered efficient exploratory data analysis tools for cross-sectional, follow-up, and medication impact analysis.

  1. Cyclin D1 is significantly associated with stage of tumor and predicts poor survival in endometrial carcinoma patients.

    PubMed

    Khabaz, Mohamad Nidal; Abdelrahman, Amer Shafie; Butt, Nadeem Shafique; Al-Maghrabi, Basim; Al-Maghrabi, Jaudah

    2017-10-01

    Cyclin D1 overexpression has been described to have oncogenic role and association with diagnosis, prognosis and survival in various tumors. This study will describe the immunohistochemical phenotype of cyclin D1, and investigate the correlation between these patterns of expression and clinicopathological parameters of endometrial carcinomas, to conclude the clinical relevance of cyclin D1 expression in the evolution of endometrial neoplasms. This study employed 101 endometrial tissue samples which include 71 endometrial carcinomas and thirty normal and benign endometrium cases. All these tissue samples were used in the assembly of tissue microarrays which have been utilized afterward in immunohistochemistry staining to detect cyclin D1 expression. Forty (56.3%) cases of endometrial carcinomas showed brown nuclear expression of cyclin D1 including 36 (61%) cases of endometrioid carcinomas, and 3 (33.3%) cases of serous carcinomas. Twenty three (76.6%) cases of control group demonstrated nuclear expression. High score cyclin D1 immunohistochemical staining has been significantly linked with patient age (P=0.0001). Large proportion of high score cyclin D1 immunohistochemical staining was observed in females who are <40years of age while high proportions of negative staining were observed in older age groups. Histologic type of tissue was also significantly related to cyclin D1 immunohistochemical staining (P-value=0.0001), high staining is more common in normal proliferative and secretory endometrium while serous carcinoma is more prevalent with negative staining. Stage of tumor was significantly associated with cyclin D1 immunohistochemical staining (P-value=0.029), proportion of stage III and IV are higher in negative cyclin D1 immunostaining. Significantly higher proportion of high score cyclin D1 immunostaining is observed in controls while higher proportion of negative cyclin D1 immunostaining is observed among carcinoma cases (P-value=0.0001). No significant associations between cyclin D1 immunohistochemical staining and grade, recurrence and alive status were observed. Significant different survival distributions were observed (P-value=0.011) and poor survival behavior was correlated with negative cyclin D1 immunohistochemical staining. In conclusion, greater frequency of cyclin D1 expression was revealed in normal endometrial tissues in comparison with carcinomas. The distribution pattern of cyclin D1 immunoexpression suggests poor prognoses in endometrial carcinoma patients. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Precipitation, temperature, and teleconnection signals across the combined North American, Monsoon Asia, and Old World Drought Atlases

    NASA Astrophysics Data System (ADS)

    Smerdon, J. E.; Baek, S. H.; Coats, S.; Williams, P.; Cook, B.; Cook, E. R.; Seager, R.

    2017-12-01

    The tree-ring-based North American Drought Atlas (NADA), Monsoon Asia Drought Atlas (MADA), and Old World Drought Atlas (OWDA) collectively yield a near-hemispheric gridded reconstruction of hydroclimate variability over the last millennium. To test the robustness of the large-scale representation of hydroclimate variability across the drought atlases, the joint expression of seasonal climate variability and teleconnections in the NADA, MADA, and OWDA are compared against two global, observation-based PDSI products. Predominantly positive (negative) correlations are determined between seasonal precipitation (surface air temperature) and collocated tree-ring-based PDSI, with average Pearson's correlation coefficients increasing in magnitude from boreal winter to summer. For precipitation, these correlations tend to be stronger in the boreal winter and summer when calculated for the observed PDSI record, while remaining similar for temperature. Notwithstanding these differences, the drought atlases robustly express teleconnection patterns associated with the El Niño-Southern Oscillation (ENSO), North Atlantic Oscillation (NAO), Pacific Decadal Oscillation (PDO), and Atlantic Multidecadal Oscillation (AMO). These expressions exist in the drought atlas estimates of boreal summer PDSI despite the fact that these modes of climate variability are dominant in boreal winter, with the exception of the Atlantic Multidecadal Oscillation. ENSO and NAO teleconnection patterns in the drought atlases are particularly consistent with their well-known dominant expressions in boreal winter and over the OWDA domain, respectively. Collectively, our findings confirm that the joint Northern Hemisphere drought atlases robustly reflect large-scale patterns of hydroclimate variability on seasonal to multidecadal timescales over the 20th century and are likely to provide similarly robust estimates of hydroclimate variability prior to the existence of widespread instrumental data.

  3. Integrin expression and glycosylation patterns regulate cell-matrix adhesion and alter with breast cancer progression.

    PubMed

    Singh, Chandrajeet; Shyanti, Ritis K; Singh, Virendra; Kale, Raosaheb K; Mishra, Jai P N; Singh, Rana P

    2018-05-05

    Integrins are the major cell adhesion glycoproteins involved in cell-extracellular matrix (ECM) interaction and metastasis. Further, glycosylation on integrin is necessary for its proper folding and functionality. Herein, differential expression of integrins viz., αvβ3 and αvβ6 was examined in MDA-MB-231, MDA-MB-468 and MCF-10A cells, which signify three different stages of breast cancer development from highly metastatic to non-tumorigenic stage. The expression of αvβ3 and αvβ6 integrins at mRNA and protein levels was observed in all three cell lines and the results displayed a distinct pattern of expression. Highly metastatic cells showed enhanced expression of αvβ3 than moderate metastatic and non-tumorigenic cells. The scenario was reversed in case of αvβ6 integrin, which was strongly expressed in moderate metastatic and non-tumorigenic cells. N-glycosylation of αvβ3 and αvβ6 integrins is required for the attachment of cells to ECM proteins like fibronectin. The cell adhesion properties were found to be different in these cancer cells with respect to the type of integrins expressed. The results testify that αvβ3 integrin in highly metastatic cells, αvβ6 integrin in both moderate metastatic and non-tumorigenic cells play an important role in cell adhesion. The investigation typify that N-glycosylation on integrins is also necessary for cell-ECM interaction. Further, glycosylation inhibition by Swainsonine is found to be more detrimental to invasive property of moderate metastatic cells. Conclusively, types of integrins expressed as well as their N-glycosylation pattern alter during the course of breast cancer progression. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Cis-regulatory underpinnings of human GLI3 expression in embryonic craniofacial structures and internal organs.

    PubMed

    Abbasi, Amir A; Minhas, Rashid; Schmidt, Ansgar; Koch, Sabine; Grzeschik, Karl-Heinz

    2013-10-01

    The zinc finger transcription factor Gli3 is an important mediator of Sonic hedgehog (Shh) signaling. During early embryonic development Gli3 participates in patterning and growth of the central nervous system, face, skeleton, limb, tooth and gut. Precise regulation of the temporal and spatial expression of Gli3 is crucial for the proper specification of these structures in mammals and other vertebrates. Previously we reported a set of human intronic cis-regulators controlling almost the entire known repertoire of endogenous Gli3 expression in mouse neural tube and limbs. However, the genetic underpinning of GLI3 expression in other embryonic domains such as craniofacial structures and internal organs remain elusive. Here we demonstrate in a transgenic mice assay the potential of a subset of human/fish conserved non-coding sequences (CNEs) residing within GLI3 intronic intervals to induce reporter gene expression at known regions of endogenous Gli3 transcription in embryonic domains other than central nervous system (CNS) and limbs. Highly specific reporter expression was observed in craniofacial structures, eye, gut, and genitourinary system. Moreover, the comparison of expression patterns directed by these intronic cis-acting regulatory elements in mouse and zebrafish embryos suggests that in accordance with sequence conservation, the target site specificity of a subset of these elements remains preserved among these two lineages. Taken together with our recent investigations, it is proposed here that during vertebrate evolution the Gli3 expression control acquired multiple, independently acting, intronic enhancers for spatiotemporal patterning of CNS, limbs, craniofacial structures and internal organs. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.

  5. The pattern of expression of guanine nucleotide-binding protein β3 (GNB3) in the retina is conserved across vertebrate species

    PubMed Central

    Ritchey, Eric R.; Bongini, Rachel E.; Code, Kimberly A.; Zelinka, Christopher; Petersen-Jones, Simon; Fischer, Andy J.

    2010-01-01

    Guanine nucleotide-binding protein β3 (GNB3) is an isoform of the β subunit of the heterotrimeric G protein second messenger complex that is commonly associated with transmembrane receptors. The presence of GNB3 in photoreceptors, and possibly bipolar cells, has been confirmed in murine, bovine and primate retinas (Lee et al., 1992, Peng et al., 1992, Huang et al., 2003). Studies have indicated that a mutation in the GNB3 gene causes progressive retinopathy and globe enlargement (RGE) in chickens. The goals of this study were to 1) examine the expression pattern of GNB3 in wild-type and RGE mutant chickens, 2) characterize the types of bipolar cells that express GNB3 and 3) examine whether the expression of GNB3 in the retina is conserved across vertebrate species. We find that chickens homozygous for the RGE allele completely lack GNB3 protein. We find that the pattern of expression of GNB3 in the retina is highly conserved across vertebrate species, including teleost fish (Carassius auratus), frogs (Xenopus laevis), chickens (Gallus domesticus), mice (Mus musculata), guinea pigs (Cavia porcellus), dogs (Canis familiaris) and non-human primates (Macaca fasicularis). Regardless of the species, we find that GNB3 is expressed by Islet1-positive cone ON-bipolar cells and by cone photoreceptors. In some vertebrates, GNB3-immunoreactivity was observed in both rod and cone photoreceptors. A protein-protein alignment of GNB3 across different vertebrates, from fish to humans, indicates a high degree (>92%) of sequence conservation. Given that analogous types of retinal neurons express GNB3 in different species, we propose that the functions and the mechanisms that regulate the expression of GNB3 are highly conserved. PMID:20538044

  6. Differential distribution of the sodium‐activated potassium channels slick and slack in mouse brain

    PubMed Central

    Knaus, Hans‐Günther; Schwarzer, Christoph

    2015-01-01

    ABSTRACT The sodium‐activated potassium channels Slick (Slo2.1, KCNT2) and Slack (Slo2.2, KCNT1) are high‐conductance potassium channels of the Slo family. In neurons, Slick and Slack channels are involved in the generation of slow afterhyperpolarization, in the regulation of firing patterns, and in setting and stabilizing the resting membrane potential. The distribution and subcellular localization of Slick and Slack channels in the mouse brain have not yet been established in detail. The present study addresses this issue through in situ hybridization and immunohistochemistry. Both channels were widely distributed and exhibited distinct distribution patterns. However, in some brain regions, their expression overlapped. Intense Slick channel immunoreactivity was observed in processes, varicosities, and neuronal cell bodies of the olfactory bulb, granular zones of cortical regions, hippocampus, amygdala, lateral septal nuclei, certain hypothalamic and midbrain nuclei, and several regions of the brainstem. The Slack channel showed primarily a diffuse immunostaining pattern, and labeling of cell somata and processes was observed only occasionally. The highest Slack channel expression was detected in the olfactory bulb, lateral septal nuclei, basal ganglia, and distinct areas of the midbrain, brainstem, and cerebellar cortex. In addition, comparing our data obtained from mouse brain with a previously published study on rat brain revealed some differences in the expression and distribution of Slick and Slack channels in these species. J. Comp. Neurol. 524:2093–2116, 2016. © 2015 The Authors The Journal of Comparative Neurology Published by Wiley Periodicals, Inc. PMID:26587966

  7. Nutritional channels in breast cancer.

    PubMed

    Godoy, Alejandro; Salazar, Katherine; Figueroa, Carlos; Smith, Gary J; de Los Angeles Garcia, Maria; Nualart, Francisco J

    2009-09-01

    Breast cancers increase glucose uptake by increasing expression of the facilitative glucose transporters (GLUTs), mainly GLUT1. However, little is known about the relationship between GLUT1 expression and malignant potential in breast cancer. In this study, expression and subcellular localization of GLUT1 was analysed in vivo in breast cancer tissue specimens with differing malignant potential, based on the Scarff-Bloom-Richardson (SBRI, II, III) histological grading system, and in vitro in the breast cancer cell lines, MDA-MB-468 and MCF-7, and in MDA-MB-468 cells grown as xenografts in nude athymic BALB/c male mice. In situ hybridization analyses demonstrated similar levels of GLUT1 mRNA expression in tissue sections from breast cancers of all histological grades. However, GLUT1 protein was expressed at higher levels in grade SBRII cancer, compared with SBRI and SBRIII, and associated with the expression of the proliferation marker PCNA. Immunolocalization analyses in SBRII cancers demonstrated a preferential localization of GLUT1 to the portions of the cellular membrane that faced neighbouring cells and formed 'canaliculi-like structures', that we hypothesize could have a potential role as 'nutritional channels'. A similar pattern of GLUT1 localization was observed in confluent cultures of MDA-MB-468 and MCF-7, and in MDA-MB-468 cells grown as xenografts, but not in the normal breast epithelial cell line HMEC. However, no relationship between GLUT1 expression and malignant potential of human breast cancer was observed. Preferential subcellular localization of GLUT1 could represent a physiological adaptation of a subset of breast cancer cells that form infiltrative tumours with a nodular growth pattern and that therefore need a major diffusion of glucose from blood vessels.

  8. Mono-allelic expression of variegating transgene locus in the mouse.

    PubMed

    Opsahl, Margaret L; Springbett, Anthea; Lathe, Richard; Colman, Alan; McClenaghan, Margaret; Whitelaw, C Bruce A

    2003-12-01

    We have generated transgenic mice which express an ovine beta-lactoglobulin transgene during lactation. In two transgenic lines, BLG/7 and BLG/45, beta-lactoglobulin protein levels vary between siblings, reflected at the cellular level by a mosaic transgene expression pattern in the mammary tissue that is reminiscent of position effect variegation. To investigate whether this variegating expression profile can be affected by the introduction of an identical variegating locus on the homologous chromosome, we compared the beta-lactoglobulin expression profiles in mice hemizygous or homozygous for the transgene locus. In BLG/45 mice, milk protein analysis revealed that transgene expression was effectively doubled in homozygous compared to hemizygous mice. In contrast, beta-lactoglobulin protein in hemizygous and homozygous BLG/7 mice displayed a similar range; although minimum expression levels were doubled in the homozygous population, the maximum level of expression was indistinguishable between the two populations. Fluorescent in situ hybridisation (FISH) for transgene mRNA indicated that for a given protein level, the extent of cellular expression is similar in both BLG/7 populations. In homozygous mice genomic DNA and nuclear RNA FISH demonstrated that only one of the two BLG/7 loci is active in expressing cells, while two transcription foci were present in BLG/45 homozygous mice. This mono-allelic transgene expression pattern is not inherited through the germline, as hemizygous mice bred from homozygous parents expressed at the expected hemizygous population level. We discuss these observations in the context of known epigenetic events such as imprinting and trans-inactivation.

  9. Tissue-specific mRNA expression profiling in grape berry tissues

    PubMed Central

    Grimplet, Jerome; Deluc, Laurent G; Tillett, Richard L; Wheatley, Matthew D; Schlauch, Karen A; Cramer, Grant R; Cushman, John C

    2007-01-01

    Background Berries of grape (Vitis vinifera) contain three major tissue types (skin, pulp and seed) all of which contribute to the aroma, color, and flavor characters of wine. The pericarp, which is composed of the exocarp (skin) and mesocarp (pulp), not only functions to protect and feed the developing seed, but also to assist in the dispersal of the mature seed by avian and mammalian vectors. The skin provides volatile and nonvolatile aroma and color compounds, the pulp contributes organic acids and sugars, and the seeds provide condensed tannins, all of which are important to the formation of organoleptic characteristics of wine. In order to understand the transcriptional network responsible for controlling tissue-specific mRNA expression patterns, mRNA expression profiling was conducted on each tissue of mature berries of V. vinifera Cabernet Sauvignon using the Affymetrix GeneChip® Vitis oligonucleotide microarray ver. 1.0. In order to monitor the influence of water-deficit stress on tissue-specific expression patterns, mRNA expression profiles were also compared from mature berries harvested from vines subjected to well-watered or water-deficit conditions. Results Overall, berry tissues were found to express approximately 76% of genes represented on the Vitis microarray. Approximately 60% of these genes exhibited significant differential expression in one or more of the three major tissue types with more than 28% of genes showing pronounced (2-fold or greater) differences in mRNA expression. The largest difference in tissue-specific expression was observed between the seed and pulp/skin. Exocarp tissue, which is involved in pathogen defense and pigment production, showed higher mRNA abundance relative to other berry tissues for genes involved with flavonoid biosynthesis, pathogen resistance, and cell wall modification. Mesocarp tissue, which is considered a nutritive tissue, exhibited a higher mRNA abundance of genes involved in cell wall function and transport processes. Seeds, which supply essential resources for embryo development, showed higher mRNA abundance of genes encoding phenylpropanoid biosynthetic enzymes, seed storage proteins, and late embryogenesis abundant proteins. Water-deficit stress affected the mRNA abundance of 13% of the genes with differential expression patterns occurring mainly in the pulp and skin. In pulp and seed tissues transcript abundance in most functional categories declined in water-deficit stressed vines relative to well-watered vines with transcripts for storage proteins and novel (no-hit) functional assignments being over represented. In the skin of berries from water-deficit stressed vines, however, transcripts from several functional categories including general phenypropanoid and ethylene metabolism, pathogenesis-related responses, energy, and interaction with the environment were significantly over-represented. Conclusion These results revealed novel insights into the tissue-specific expression mRNA expression patterns of an extensive repertoire of genes expressed in berry tissues. This work also establishes an extensive catalogue of gene expression patterns for future investigations aimed at the dissection of the transcriptional regulatory hierarchies that govern tissue-specific expression patterns associated with tissue differentiation within berries. These results also confirmed that water-deficit stress has a profound effect on mRNA expression patterns particularly associated with the biosynthesis of aroma and color metabolites within skin and pulp tissues that ultimately impact wine quality. PMID:17584945

  10. Differential Expression Patterns of occ1-Related Genes in Adult Monkey Visual Cortex

    PubMed Central

    Takahata, Toru; Komatsu, Yusuke; Watakabe, Akiya; Hashikawa, Tsutomu; Tochitani, Shiro

    2009-01-01

    We have previously revealed that occ1 is preferentially expressed in the primary visual area (V1) of the monkey neocortex. In our attempt to identify more area-selective genes in the macaque neocortex, we found that testican-1, an occ1-related gene, and its family members also exhibit characteristic expression patterns along the visual pathway. The expression levels of testican-1 and testican-2 mRNAs as well as that of occ1 mRNA start of high in V1, progressively decrease along the ventral visual pathway, and end of low in the temporal areas. Complementary to them, the neuronal expression of SPARC mRNA is abundant in the association areas and scarce in V1. Whereas occ1, testican-1, and testican-2 mRNAs are preferentially distributed in thalamorecipient layers including “blobs,” SPARC mRNA expression avoids these layers. Neither SC1 nor testican-3 mRNA expression is selective to particular areas, but SC1 mRNA is abundantly observed in blobs. The expressions of occ1, testican-1, testican-2, and SC1 mRNA were downregulated after monocular tetrodotoxin injection. These results resonate with previous works on chemical and functional gradients along the primate occipitotemporal visual pathway and raise the possibility that these gradients and functional architecture may be related to the visual activity–dependent expression of these extracellular matrix glycoproteins. PMID:19073625

  11. The GMD1 and GMD2 genes of Arabidopsis encode isoforms of GDP-D-mannose 4,6-dehydratase with cell type-specific expression patterns.

    PubMed

    Bonin, Christopher P; Freshour, Glenn; Hahn, Michael G; Vanzin, Gary F; Reiter, Wolf-Dieter

    2003-06-01

    l-Fucose (l-Fuc) is a monosaccharide constituent of plant cell wall polysaccharides and glycoproteins. The committing step in the de novo synthesis of l-Fuc is catalyzed by GDP-d-mannose 4,6-dehydratase, which, in Arabidopsis, is encoded by the GMD1 and GMD2 (MUR1) genes. To determine the functional significance of this genetic redundancy, the expression patterns of both genes were investigated via promoter-beta-glucuronidase fusions and immunolocalization of a Fuc-containing epitope. GMD2 is expressed in most cell types of the root, with the notable exception of the root tip where strong expression of GMD1 is observed. Within shoot organs, GMD1::GUS expression is confined to stipules and pollen grains leading to fucosylation of the walls of these cell types in the mur1 mutant. These results suggest that GMD2 represents the major housekeeping gene for the de novo synthesis of GDP-l-Fuc, whereas GMD1 expression is limited to a number of specialized cell types. We conclude that the synthesis of GDP-l-Fuc is controlled in a cell-autonomous manner by differential expression of two isoforms of the same enzyme.

  12. Transcriptional Modulation of Genes Encoding Structural Characteristics of Differentiating Enterocytes During Development of a Polarized Epithelium In Vitro

    PubMed Central

    Halbleib, Jennifer M.; Sääf, Annika M.

    2007-01-01

    Although there is considerable evidence implicating posttranslational mechanisms in the development of epithelial cell polarity, little is known about the patterns of gene expression and transcriptional regulation during this process. We characterized the temporal program of gene expression during cell–cell adhesion–initiated polarization of human Caco-2 cells in tissue culture, which develop structural and functional polarity similar to that of enterocytes in vivo. A distinctive switch in gene expression patterns occurred upon formation of cell–cell contacts between neighboring cells. Expression of genes involved in cell proliferation was down-regulated concomitant with induction of genes necessary for functional specialization of polarized epithelial cells. Transcriptional up-regulation of these latter genes correlated with formation of important structural and functional features in enterocyte differentiation and establishment of structural and functional cell polarity; components of the apical microvilli were induced as the brush border formed during polarization; as barrier function was established, expression of tight junction transmembrane proteins peaked; transcripts encoding components of the apical, but not the basal-lateral trafficking machinery were increased during polarization. Coordinated expression of genes encoding components of functional cell structures were often observed indicating temporal control of expression and assembly of multiprotein complexes. PMID:17699590

  13. Hidden among the crowd: differential DNA methylation-expression correlations in cancer occur at important oncogenic pathways.

    PubMed

    Mosquera Orgueira, Adrián

    2015-01-01

    DNA methylation is a frequent epigenetic mechanism that participates in transcriptional repression. Variations in DNA methylation with respect to gene expression are constant, and, for unknown reasons, some genes with highly methylated promoters are sometimes overexpressed. In this study we have analyzed the expression and methylation patterns of thousands of genes in five groups of cancer and normal tissue samples in order to determine local and genome-wide differences. We observed significant changes in global methylation-expression correlation in all the neoplasms, which suggests that differential correlation events are frequent in cancer. A focused analysis in the breast cancer cohort identified 1662 genes whose correlation varies significantly between normal and cancerous breast, but whose DNA methylation and gene expression patterns do not change substantially. These genes were enriched in cancer-related pathways and repressive chromatin features across various model cell lines, such as PRC2 binding and H3K27me3 marks. Substantial changes in methylation-expression correlation indicate that these genes are subject to epigenetic remodeling, where the differential activity of other factors break the expected relationship between both variables. Our findings suggest a complex regulatory landscape where a redistribution of local and large-scale chromatin repressive domains at differentially correlated genes (DCGs) creates epigenetic hotspots that modulate cancer-specific gene expression.

  14. Expression profiles of sugarcane under drought conditions: Variation in gene regulation.

    PubMed

    Andrade, Júlio César Farias de; Terto, Jackeline; Silva, José Vieira; Almeida, Cícero

    2015-12-01

    Drought is a major factor in decreased sugarcane productivity because of the resulting morphophysiological effects that it causes. Gene expression studies that have examined the influence of water stress in sugarcane have yielded divergent results, indicating the absence of a fixed pattern of changes in gene expression. In this work, we investigated the expression profiles of 12 genes in the leaves of a drought-tolerant genotype (RB72910) of sugarcane and compared the results with those of other studies. The genotype was subjected to 80-100% water availability (control condition) and 0-20% water availability (simulated drought). To analyze the physiological status, the SPAD index, Fv/Fm ratio, net photosynthesis (A), stomatal conductance (gs) and stomatal transpiration (E) were measured. Total RNA was extracted from leaves and the expression of SAMDC, ZmPIP2-1 protein, ZmTIP4-2 protein, WIP protein, LTP protein, histone H3, DNAj, ferredoxin I, β-tubulin, photosystem I, gene 1 and gene 2 was analyzed by quantitative real-time PCR (RT-PCR). Important differences in the expression profiles of these genes were observed when compared with other genotypes, suggesting that complex defense mechanisms are activated in response to water stress. However, there was no recognizable pattern for the changes in expression of the different proteins associated with tolerance to drought stress.

  15. Expression pattern and function of tyrosine receptor kinase B isoforms in rat mesenteric arterial smooth muscle cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Otani, Kosuke; Okada, Muneyoshi; Yamawaki, Hideyuki, E-mail: yamawaki@vmas.kitasato-u.ac.jp

    Tyrosine receptor kinaseB (TrkB) is a high affinity receptor for brain-derived neurotrophic factor (BDNF). TrkB isoforms involve full length TrkB (TrkB FL) and truncated TrkB type1 (TrkB T1) and type 2 (TrkB T2) in rats. The aim of present study was to explore their expression pattern and function in mesenteric arterial smooth muscle cells (MASMCs). The expression of TrkB isoform protein and mRNA was examined by Western blotting, immunofluorescence and quantitative RT-PCR analyses. Cell proliferation was measured by a bromodeoxyuridine (BrdU) incorporation assay. Cell migration was measured by a Boyden chamber assay. Cell morphology was observed with a phase-contrast microscope.more » Protein and mRNA expression of BDNF and TrkB isoforms was confirmed in MASMCs. Expression level of TrkB FL was less, while that of TrkB T1 was the highest in MASMCs. Although BDNF increased phosphorylation of ERK, it had no influence on migration and proliferation of MASMCs. TrkB T1 gene knockdown by a RNA interference induced morphological changes and reduced expression level of α-smooth muscle actin (α-SMA) in MASMCs. Similar morphological changes and reduced α-SMA expression were induced in MASMCs by a Rho kinase inhibitor, Y-27632. In conclusion, we for the first time demonstrate that TrkB T1 expressed highly in MASMCs contributes to maintain normal cell morphology possibly via regulation of Rho activity. This study firstly defined expression level of TrkB isoforms and partly revealed their functions in peripheral vascular cells. - Highlights: • BDNF-TrkB axis mediates neurogenesis, growth, differentiation and survival. • Expression pattern and function of TrkB in vascular smooth muscle remain unclear. • Expression of TrkB FL is low, while that of TrkB T1 is the highest. • TrkB T1 contributes to maintain normal morphology possibly via activating Rho.« less

  16. BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

    DOE PAGES

    Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana; ...

    2016-02-04

    Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

  17. BdCESA7, BdCESA8, and BdPMT utility promoter constructs for targeted expression to secondary cell-wall-forming cells of grasses

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana

    Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less

  18. PD-1 and PD-L1 expression in HNSCC primary cancer and related lymph node metastasis - impact on clinical outcome.

    PubMed

    Schneider, Sven; Kadletz, Lorenz; Wiebringhaus, Robert; Kenner, Lukas; Selzer, Edgar; Füreder, Thorsten; Rajky, Orsolya; Berghoff, Anna S; Preusser, Matthias; Heiduschka, Gregor

    2018-05-09

    Expression profiles and clinical impact of programmed cell death ligand 1 (PD-L1) and programmed cell death 1 (PD-1) expressing tumour infiltrating lymphocytes (TILs) in head and neck squamous cell carcinoma (HNSCC) are not fully elucidated. This study evaluates expression patterns in primary HNSCC and related lymph node metastasis and impact on patients' clinical outcome. Immunohistochemical staining patterns of PD-L1 and PD-1 were evaluated in 129 specimens of primary HNSCC and 77 lymph node metastases. Results were correlated to patients' clinical data. PD-L1 expression was observed in 36% of primary carcinoma and 33% of lymph node metastasis and significantly correlates with decreased overall survival (OS) (p=0.01) and disease free survival (DFS) (p=0.001) in oral cavity squamous cell carcinoma patients. PD-L1 expression was associated with presence of lymph node metastasis (p=0.0223). Infiltration of PD-1 expressing lymphocytes significantly correlates with favorable OS (p=0.001) and DFS (p=0.001) in oropharyngeal cancer and hypopharyngeal cancer patients OS (p=0.007) and DFS (p=0.001). Presence of PD-1 TILs significantly correlates with better OS (p=0.005) and DFS (p=0) also in the HPV negative cohort. Cox regression multivariate analysis revealed PD-1 TIL expression as an independent prognostic marker for OS (p=0.004) and DFS (p=0.001) and T stage was validated as negative prognostic marker for OS (p=0.011). PD-1 expressing lymphocytes (p=0.0412) and PD-L1 expression (p=0.0022) patterns correlate significantly in primary cancers and matched lymph node metastases. Our results characterize the expression profiles of PD-1 axis proteins in HNSCC which might serve as possible clinical prognostic markers. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  19. b-FGF induces corneal blood and lymphatic vessel growth in a spatially distinct pattern.

    PubMed

    Hajrasouliha, Amir R; Sadrai, Zahra; Chauhan, Sunil K; Dana, Reza

    2012-07-01

    To study the spatial variances in ligand expression and angiogenic effect in response to the inflammatory response induced by basic fibroblast growth factor (b-FGF). b-FGF micropellets (80 ng) were implanted in the temporal side of the cornea of Balb/c mice. On days 1, 3, and 7, blood (heme-) and lymphangiogenesis were observed by immunofluorescence staining of corneal flat mounts with LYVE-1 and CD31 to identify lymphatic and blood vessels, respectively. A second group of corneas were harvested for quantitative real-time polymerase chain reaction. Each cornea was divided into 2 different areas: (1) pre-pellet area and (2) opposite-pellet area. Expression of vascular endothelial growth factor (VEGF) ligands was evaluated using real-time polymerase chain reaction in each respective zone. Blood vessels grew into the cornea from the pre-pellet area, whereas corneal lymphatic vessels grew from the opposite-pellet area toward the center of the cornea. VEGF-A was upregulated in the pre-pellet, whereas VEGF-D expression was mostly observed in the opposite-pellet area. VEGF-C level increased simultaneously in both areas. A single inducing factor, that is, b-FGF, may simultaneously provoke hemangiogenesis and lymphangiogenesis in different locations of the cornea through differential expression of VEGF ligands. This distinctive spatial pattern should be considered while evaluating the corneal predilection for inflammation beyond that which is directly visible by slit lamp examination.

  20. Correlated tuning of the speckle pattern in an interferometer based on a multimode fiber-optic waveguide

    NASA Astrophysics Data System (ADS)

    Bykovskii, Iu. A.; Kul'Chin, Iu. N.; Obukh, V. F.; Smirnov, V. L.

    1990-08-01

    The correlated tuning of the speckle pattern in the radiation field of a single-fiber multimode interferometer is investigated experimentally and analytically in the presence of external action. It is found that correlated changes in the speckle pattern are observed in both the near and the far emission fields of the waveguide. An expression is obtained which provides a way to determine the maximum size of the speckle correlation region. The use of spatial filtering for isolating the effect of correlated speckle pattern tuning is suggested. It is shown that the use of a spatial filter makes it possible to increase the efficiency of fiber-optic transducers.

  1. Human growth is associated with distinct patterns of gene expression in evolutionarily conserved networks

    PubMed Central

    2013-01-01

    Background A co-ordinated tissue-independent gene expression profile associated with growth is present in rodent models and this is hypothesised to extend to all mammals. Growth in humans has similarities to other mammals but the return to active long bone growth in the pubertal growth spurt is a distinctly human growth event. The aim of this study was to describe gene expression and biological pathways associated with stages of growth in children and to assess tissue-independent expression patterns in relation to human growth. Results We conducted gene expression analysis on a library of datasets from normal children with age annotation, collated from the NCBI Gene Expression Omnibus (GEO) and EBI Arrayexpress databases. A primary data set was generated using cells of lymphoid origin from normal children; the expression of 688 genes (ANOVA false discovery rate modified p-value, q < 0.1) was associated with age, and subsets of these genes formed clusters that correlated with the phases of growth – infancy, childhood, puberty and final height. Network analysis on these clusters identified evolutionarily conserved growth pathways (NOTCH, VEGF, TGFB, WNT and glucocorticoid receptor – Hyper-geometric test, q < 0.05). The greatest degree of network ‘connectivity’ and hence functional significance was present in infancy (Wilcoxon test, p < 0.05), which then decreased through to adulthood. These observations were confirmed in a separate validation data set from lymphoid tissue. Similar biological pathways were observed to be associated with development-related gene expression in other tissues (conjunctival epithelia, temporal lobe brain tissue and bone marrow) suggesting the existence of a tissue-independent genetic program for human growth and maturation. Conclusions Similar evolutionarily conserved pathways have been associated with gene expression and child growth in multiple tissues. These expression profiles associate with the developmental phases of growth including the return to active long bone growth in puberty, a distinctly human event. These observations also have direct medical relevance to pathological changes that induce disease in children. Taking into account development-dependent gene expression profiles for normal children will be key to the appropriate selection of genes and pathways as potential biomarkers of disease or as drug targets. PMID:23941278

  2. Hair-cycle dependent differential expression of ADAM 10 and ADAM 12

    PubMed Central

    Cho, Baik-Kee; Schramme, Anja; Gutwein, Paul; Tilgen, Wolfgang; Reichrath, Jörg

    2009-01-01

    Background ADAM proteases play important roles in processes of development and differentiation. However, no report has been found in the literature addressing the expression and function of ADAM proteases during hair cycling. Results Cytoplasmic expression pattern of ADAM 10, 12 was similar between normal epidermis and hair infundibulum. In addition, cytoplasmic expression of ADAM 10 was observed in the hair bulb keratinocytes and fibroblasts of dermal papilla in anagen I–III hair follicles. In contrast, decreased ADAM 10 expression was observed in the hair matrix keratinocytes as compared to the hair bulb keratinocytes in anagen I–III hair follicles. Interestingly, ADAM 10 immunoreactivity was expressed weakly in the lower portion of outer root sheath (ORS) of anagen VI hair follicles, and strong ADAM 10 expression was detected in the ORS of catagen and telogen hair follicles. By contrast, ADAM 12 expression was not detected in the hair bulb keratinocytes of anagen I–III hair follicles. ADAM 12 immunoreactivity firstly appeared in the inner root sheath ( IRS ) of anagen IV—V hair follicles and was down-regulated in the IRS and hair cortex and medulla of catagen hair follicles, Strong ADAM 12 immunoreactivity was observed in the ORS of catagen and telogen hair follicles. Material and methods Samples of normal human skin (n = 30) were used. Immunohistochemical analysis was performed using ADAM 10, 12 specific polyclonal antibodies and a sensitive streptavidin-peroxidase technique. Conclusion Our study demonstrates a comparable staining pattern of decreased ADAM 10 immunoreactivity in hair matrix keratinocytes and the basal cell layer of normal epidermis and hair infundibulum. Expression of ADAM 10 in dermal papilla cells may imply a role in the induction and development of anagen hair follicles. In addition, expression of ADAM 10 in the ORS and hair bulb assume the involvment of ADAM 10 in the downward migration of anagen hair follicles. Furthermore ADAM 12 expression in the IRS may indicate a role in the differentiation of anagen hair follicles. Downregulation of ADAM 12 upon the onset of catagen hair stage suggests that ADAM 12 may play an important role of ADAM 12 in the apoptosis of hair follicle keratinocytes. In summary our findings suggest that ADAM 10 and 12 may be of importance for the regulation of hair cycling. PMID:20046589

  3. Developmental pattern of ANF gene expression reveals a strict localization of cardiac chamber formation in chicken.

    PubMed

    Houweling, Arjan C; Somi, Semir; Van Den Hoff, Maurice J B; Moorman, Antoon F M; Christoffels, Vincent M

    2002-02-01

    In mouse, atrial natriuretic factor (ANF) gene expression was shown to be a marker for chamber formation within the embryonic heart. To gain insight into the process of chamber formation in the chicken embryonic heart, we analyzed the expression pattern of cANF during development. We found cANF to be specifically expressed in the myocardium of the morphologically distinguishable atrial and ventricular chambers, similar to ANF in mouse. cANF expression was never detected in the myocardium of the atrioventricular canal (AVC), inner curvature, and outflow tract (OFT), which is lined by endocardial cushions. Expression was strictly excluded from the interventricular myocardium and most proximal part of the bundle branches, as identified by the expression of Msx-2, whereas the rest of the bundle branches, trabeculae, and surrounding working myocardium did express cANF. The myocardium that forms de novo within the cushions after looping did not express cANF. At HH9 cANF expression was first observed in a subset of cardiomyocytes, which was localized ventrally in the fused heart tube and laterally in the unfused cardiac sheets. Together, these results show that cANF expression can be used to distinguish differentiated chamber (working) myocardium, including the peripheral ventricular conduction system, from embryonic myocardium. We conclude that differentiation of chamber myocardium takes place already at HH9 at the ventral side of the linear heart tube, possibly preceded by latero-medial signals in the unfused cardiac sheets. Copyright 2002 Wiley-Liss, Inc.

  4. Cytokeratins in normal and malignant transitional epithelium. Maintenance of expression of urothelial differentiation features in transitional cell carcinomas and bladder carcinoma cell culture lines.

    PubMed Central

    Moll, R.; Achtstätter, T.; Becht, E.; Balcarova-Ständer, J.; Ittensohn, M.; Franke, W. W.

    1988-01-01

    The pattern of cytokeratins expressed in normal urothelium has been compared with that of various forms of transitional cell carcinomas (TCCs; 21 cases) and cultured bladder carcinoma cell lines, using immunolocalization and gel electrophoretic techniques. In normal urothelium, all simple-epithelium-type cytokeratins (polypeptides 7, 8, 18, 19) were detected in all cell layers, whereas antibodies to cytokeratins typical for stratified epithelia reacted with certain basal cells only or, in the case of cytokeratin 13, with cells of the basal and intermediate layers. This pattern was essentially maintained in low-grade (G1, G1/2) TCCs but was remarkably modified in G2 TCCs. In G3 TCCs simple-epithelial cytokeratins were predominant whereas the amounts of component 13 were greatly reduced. Squamous metaplasia was accompanied generally by increased or new expression of some stratified-epithelial cytokeratins. The cytokeratin patterns of cell culture lines RT-112 and RT-4 resembled those of G1 and G2 TCCs, whereas cell line T-24 was comparable to G3 carcinomas. The cell line EJ showed a markedly different pattern. The results indicate that, in the cell layers of the urothelium, the synthesis of stratification-related cytokeratins such as component 13 is inversely oriented compared with that in other stratified epithelia where these proteins are suprabasally expressed, that TCCs retain certain intrinsic cytoskeletal features of urothelium, and that different TCCs can be distinguished by their cytokeratin patterns. The potential value of these observations in histopathologic and cytologic diagnoses is discussed. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 Figure 8 Figure 9 PMID:2456018

  5. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii.

    PubMed

    Ali, Muhammad Y; Pavasovic, Ana; Dammannagoda, Lalith K; Mather, Peter B; Prentis, Peter J

    2017-01-01

    Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na + /K + -ATPase (NKA), H + -ATPase (HAT), Na + /K + /2Cl - cotransporter (NKCC), Na + /Cl - /HCO[Formula: see text] cotransporter (NBC), Na + /H + exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca +2 -ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish , Cherax quadricarinatus, C. destructor and C. cainii , with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types.

  6. Salt Stress Induced Variation in DNA Methylation Pattern and Its Influence on Gene Expression in Contrasting Rice Genotypes

    PubMed Central

    Karan, Ratna; DeLeon, Teresa; Biradar, Hanamareddy; Subudhi, Prasanta K.

    2012-01-01

    Background Salinity is a major environmental factor limiting productivity of crop plants including rice in which wide range of natural variability exists. Although recent evidences implicate epigenetic mechanisms for modulating the gene expression in plants under environmental stresses, epigenetic changes and their functional consequences under salinity stress in rice are underexplored. DNA methylation is one of the epigenetic mechanisms regulating gene expression in plant’s responses to environmental stresses. Better understanding of epigenetic regulation of plant growth and response to environmental stresses may create novel heritable variation for crop improvement. Methodology/Principal Findings Methylation sensitive amplification polymorphism (MSAP) technique was used to assess the effect of salt stress on extent and patterns of DNA methylation in four genotypes of rice differing in the degree of salinity tolerance. Overall, the amount of DNA methylation was more in shoot compared to root and the contribution of fully methylated loci was always more than hemi-methylated loci. Sequencing of ten randomly selected MSAP fragments indicated gene-body specific DNA methylation of retrotransposons, stress responsive genes, and chromatin modification genes, distributed on different rice chromosomes. Bisulphite sequencing and quantitative RT-PCR analysis of selected MSAP loci showed that cytosine methylation changes under salinity as well as gene expression varied with genotypes and tissue types irrespective of the level of salinity tolerance of rice genotypes. Conclusions/Significance The gene body methylation may have an important role in regulating gene expression in organ and genotype specific manner under salinity stress. Association between salt tolerance and methylation changes observed in some cases suggested that many methylation changes are not “directed”. The natural genetic variation for salt tolerance observed in rice germplasm may be independent of the extent and pattern of DNA methylation which may have been induced by abiotic stress followed by accumulation through the natural selection process. PMID:22761959

  7. Multivariate Pattern Classification of Facial Expressions Based on Large-Scale Functional Connectivity.

    PubMed

    Liang, Yin; Liu, Baolin; Li, Xianglin; Wang, Peiyuan

    2018-01-01

    It is an important question how human beings achieve efficient recognition of others' facial expressions in cognitive neuroscience, and it has been identified that specific cortical regions show preferential activation to facial expressions in previous studies. However, the potential contributions of the connectivity patterns in the processing of facial expressions remained unclear. The present functional magnetic resonance imaging (fMRI) study explored whether facial expressions could be decoded from the functional connectivity (FC) patterns using multivariate pattern analysis combined with machine learning algorithms (fcMVPA). We employed a block design experiment and collected neural activities while participants viewed facial expressions of six basic emotions (anger, disgust, fear, joy, sadness, and surprise). Both static and dynamic expression stimuli were included in our study. A behavioral experiment after scanning confirmed the validity of the facial stimuli presented during the fMRI experiment with classification accuracies and emotional intensities. We obtained whole-brain FC patterns for each facial expression and found that both static and dynamic facial expressions could be successfully decoded from the FC patterns. Moreover, we identified the expression-discriminative networks for the static and dynamic facial expressions, which span beyond the conventional face-selective areas. Overall, these results reveal that large-scale FC patterns may also contain rich expression information to accurately decode facial expressions, suggesting a novel mechanism, which includes general interactions between distributed brain regions, and that contributes to the human facial expression recognition.

  8. Multivariate Pattern Classification of Facial Expressions Based on Large-Scale Functional Connectivity

    PubMed Central

    Liang, Yin; Liu, Baolin; Li, Xianglin; Wang, Peiyuan

    2018-01-01

    It is an important question how human beings achieve efficient recognition of others’ facial expressions in cognitive neuroscience, and it has been identified that specific cortical regions show preferential activation to facial expressions in previous studies. However, the potential contributions of the connectivity patterns in the processing of facial expressions remained unclear. The present functional magnetic resonance imaging (fMRI) study explored whether facial expressions could be decoded from the functional connectivity (FC) patterns using multivariate pattern analysis combined with machine learning algorithms (fcMVPA). We employed a block design experiment and collected neural activities while participants viewed facial expressions of six basic emotions (anger, disgust, fear, joy, sadness, and surprise). Both static and dynamic expression stimuli were included in our study. A behavioral experiment after scanning confirmed the validity of the facial stimuli presented during the fMRI experiment with classification accuracies and emotional intensities. We obtained whole-brain FC patterns for each facial expression and found that both static and dynamic facial expressions could be successfully decoded from the FC patterns. Moreover, we identified the expression-discriminative networks for the static and dynamic facial expressions, which span beyond the conventional face-selective areas. Overall, these results reveal that large-scale FC patterns may also contain rich expression information to accurately decode facial expressions, suggesting a novel mechanism, which includes general interactions between distributed brain regions, and that contributes to the human facial expression recognition. PMID:29615882

  9. Visual Scanning Patterns and Executive Function in Relation to Facial Emotion Recognition in Aging

    PubMed Central

    Circelli, Karishma S.; Clark, Uraina S.; Cronin-Golomb, Alice

    2012-01-01

    Objective The ability to perceive facial emotion varies with age. Relative to younger adults (YA), older adults (OA) are less accurate at identifying fear, anger, and sadness, and more accurate at identifying disgust. Because different emotions are conveyed by different parts of the face, changes in visual scanning patterns may account for age-related variability. We investigated the relation between scanning patterns and recognition of facial emotions. Additionally, as frontal-lobe changes with age may affect scanning patterns and emotion recognition, we examined correlations between scanning parameters and performance on executive function tests. Methods We recorded eye movements from 16 OA (mean age 68.9) and 16 YA (mean age 19.2) while they categorized facial expressions and non-face control images (landscapes), and administered standard tests of executive function. Results OA were less accurate than YA at identifying fear (p<.05, r=.44) and more accurate at identifying disgust (p<.05, r=.39). OA fixated less than YA on the top half of the face for disgust, fearful, happy, neutral, and sad faces (p’s<.05, r’s≥.38), whereas there was no group difference for landscapes. For OA, executive function was correlated with recognition of sad expressions and with scanning patterns for fearful, sad, and surprised expressions. Conclusion We report significant age-related differences in visual scanning that are specific to faces. The observed relation between scanning patterns and executive function supports the hypothesis that frontal-lobe changes with age may underlie some changes in emotion recognition. PMID:22616800

  10. Comprehensive microarray-based analysis for stage-specific larval camouflage pattern-associated genes in the swallowtail butterfly, Papilio xuthus

    PubMed Central

    2012-01-01

    Background Body coloration is an ecologically important trait that is often involved in prey-predator interactions through mimicry and crypsis. Although this subject has attracted the interest of biologists and the general public, our scientific knowledge on the subject remains fragmentary. In the caterpillar of the swallowtail butterfly Papilio xuthus, spectacular changes in the color pattern are observed; the insect mimics bird droppings (mimetic pattern) as a young larva, and switches to a green camouflage coloration (cryptic pattern) in the final instar. Despite the wide variety and significance of larval color patterns, few studies have been conducted at a molecular level compared with the number of studies on adult butterfly wing patterns. Results To obtain a catalog of genes involved in larval mimetic and cryptic pattern formation, we constructed expressed sequence tag (EST) libraries of larval epidermis for P. xuthus, and P. polytes that contained 20,736 and 5,376 clones, respectively, representing one of the largest collections available in butterflies. A comparison with silkworm epidermal EST information revealed the high expression of putative blue and yellow pigment-binding proteins in Papilio species. We also designed a microarray from the EST dataset information, analyzed more than five stages each for six markings, and confirmed spatial expression patterns by whole-mount in situ hybridization. Hence, we succeeded in elucidating many novel marking-specific genes for mimetic and cryptic pattern formation, including pigment-binding protein genes, the melanin-associated gene yellow-h3, the ecdysteroid synthesis enzyme gene 3-dehydroecdysone 3b-reductase, and Papilio-specific genes. We also found many cuticular protein genes with marking specificity that may be associated with the unique surface nanostructure of the markings. Furthermore, we identified two transcription factors, spalt and ecdysteroid signal-related E75, as genes expressed in larval eyespot markings. This finding suggests that E75 is a strong candidate mediator of the hormone-dependent coordination of larval pattern formation. Conclusions This study is one of the most comprehensive molecular analyses of complicated morphological features, and it will serve as a new resource for studying insect mimetic and cryptic pattern formation in general. The wide variety of marking-associated genes (both regulatory and structural genes) identified by our screening indicates that a similar strategy will be effective for understanding other complex traits. PMID:22651552

  11. Adult neurogenesis in the hedgehog (Erinaceus concolor) and mole (Talpa europaea).

    PubMed

    Bartkowska, K; Turlejski, K; Grabiec, M; Ghazaryan, A; Yavruoyan, E; Djavadian, R L

    2010-01-01

    We investigated adult neurogenesis in two species of mammals belonging to the superorder Laurasiatheria, the southern white-breasted hedgehog (order Erinaceomorpha, species Erinaceus concolor) from Armenia and the European mole (order Soricomorpha, species Talpa europaea) from Poland. Neurogenesis in the brain of these species was examined immunohistochemically, using the endogenous markers doublecortin (DCX) and Ki-67, which are highly conserved among species. We found that in both the hedgehog and mole, like in the majority of earlier investigated mammals, neurogenesis continues in the subventricular zone (SVZ) of the lateral ventricles and in the dentate gyrus (DG). In the DG of both species, DCX-expressing cells and Ki-67-labeled cells were present in the subgranular and granular layers. In the mole, a strong bundle of DCX-labeled processes, presumably axons of granule cells, was observed in the center of the hilus. Proliferating cells (expressing Ki-67) were identified in the SVZ of lateral ventricles of both species, but neuronal precursor cells (expressing DCX) were also observed in the olfactory bulb (OB). In both species, the vast majority of cells expressing DCX in the OB were granule cells with radially orientated dendrites, although some periglomerular cells surrounding the glomeruli were also labeled. In addition, this paper is the first to show DCX-labeled fibers in the anterior commissure of the hedgehog and mole. These fibers must be axons of new neurons making interhemispheric connections between the two OB or piriform (olfactory) cortices. DCX-expressing neurons were observed in the striatum and piriform cortex of both hedgehog and mole. We postulate that in both species a fraction of cells newly generated in the SVZ migrates along the rostral migratory stream to the piriform cortex. This pattern of migration resembles that of the 'second-wave neurons' generated during embryonal development of the neocortex rather than the pattern observed during development of the allocortex. In spite of the presence of glial cells alongside DCX-expressing cells, we never found colocalization of DCX protein with a glial marker (vimentin or glial fibrillary acidic protein). Copyright © 2010 S. Karger AG, Basel.

  12. [Expression of calponin and P63 in human submandibular glands].

    PubMed

    Lu, Yu-he; Gao, Yan

    2007-02-01

    To observe the expression of new myoepithelial cell markers calponin and P63 in human submandibular glands. Calponin and P63 antigen in routinely processed human submandibular gland tissues were immunohistochemically demonstrated by monoclonal antibodies to calponin and P63. Calponin expressed around all acinus and intercalated ducts as linear or punctuate pattern. Positive staining was also noted in peripheral area of some thin striated ducts that connect to intercalated ducts. Subulate or trigonal calponin expression was sometimes seen between the duct dells of striated ducts. P63 expressed mainly in the nucleus of the basal cells of excretory duct. Calponin is an ideal gland. P63 labels mainly the basal cells of excretory duct. marker for myoepithelial cells of human submandibular

  13. Differential expression of lymphocyte function-associated antigen (LFA-1) on peripheral blood leucocytes from individuals with Down's syndrome.

    PubMed Central

    Barrena, M J; Echaniz, P; Garcia-Serrano, C; Zubillaga, P; Cuadrado, E

    1992-01-01

    We analysed the expression of lymphocyte function-associated antigen LFA-1 on the cell surface of peripheral blood lymphocytes, monocytes and granulocytes from 20 children with Down's syndrome. No differences in LFA-1 expression was found within monocytes or granulocytes from either normal or Down's syndrome children; however, a clear-cut difference was observed on lymphoid cells. Both normal and Down's syndrome lymphocytes displayed a bimodal pattern of LFA-1 staining by flow cytometry, with a predominance of cells with low expression in normal population, and an increased proportion of lymphocytes with high level of LFA-1 expression in Down's syndrome children. This difference correlates well with the abnormal proportion of T cell subsets and inversion of CD4/CD8 observed in a majority of our cases, and therefore, it could merely reflect the increase of certain T cell subsets normally expressing higher number of LFA-1 molecules. Taken together, our results do not support an abnormally increased expression of leucocytes integrins in trisomy 21 cells, and raise some doubt about the suggested role of the abnormal cellular expression of LFA-1 in the pathogensis of secondary immunodeficiency associated to Down's syndrome. PMID:1348667

  14. Developmental expression of the neuroligins and neurexins in fragile X mice.

    PubMed

    Lai, Jonathan K Y; Doering, Laurie C; Foster, Jane A

    2016-03-01

    Neuroligins and neurexins are transsynaptic proteins involved in the maturation of glutamatergic and GABAergic synapses. Research has identified synaptic proteins and function as primary contributors to the development of fragile X syndrome. Fragile X mental retardation protein (FMRP), the protein that is lacking in fragile X syndrome, binds neuroligin-1 and -3 mRNA. Using in situ hybridization, we examined temporal and spatial expression patterns of neuroligin (NLGN) and neurexin (NRXN) mRNAs in the somatosensory (S1) cortex and hippocampus in wild-type (WT) and fragile X knockout (FMR1-KO) mice during the first 5 weeks of postnatal life. Genotype-based differences in expression included increased NLGN1 mRNA in CA1 and S1 cortex, decreased NLGN2 mRNA in CA1 and dentate gyrus (DG) regions of the hippocampus, and increased NRXN3 mRNA in CA1, DG, and S1 cortex between female WT and FMR1-KO mice. In male mice, decreased expression of NRXN3 mRNA was observed in CA1 and DG regions of FMR1-KO mice. Sex differences in hippocampal expression of NLGN2, NRXN1, NRXN2, and NRXN3 mRNAs and in S1 cortex expression of NRXN3 mRNAs were observed WT mice, whereas sex differences in NLGN3, NRXN1, NRXN2, and NRXN3 mRNA expression in the hippocampus and in NLGN1, NRXN2 and NRXN3 mRNA expression in S1 cortex were detected in FMR1-KO mice. These results provide a neuroanatomical map of NLGN and NRXN expression patterns over postnatal development in WT and FMR1-KO mice. The differences in developmental trajectory of these synaptic proteins could contribute to long-term differences in CNS wiring and synaptic function. © 2015 Wiley Periodicals, Inc.

  15. Regulated necrosis-related molecule mRNA expression in humans and mice and in murine acute tissue injury and systemic autoimmunity leading to progressive organ damage, and progressive fibrosis.

    PubMed

    Honarpisheh, Mohsen; Desai, Jyaysi; Marschner, Julian A; Weidenbusch, Marc; Lech, Maciej; Vielhauer, Volker; Anders, Hans-Joachim; Mulay, Shrikant R

    2016-12-01

    The species-specific, as well as organ-specific expression of regulated necrosis (RN)-related molecules, is not known. We determined the expression levels of tumour necrosis factor receptor-1 (TNFR1), receptor activated protein kinase (RIPK)1, RIPK3, mixed lineage kinase domain-like (MLKL), CASP8, Fas-associated protein with death domain (FADD), cellular inhibitor of apoptosis protein (CIAP)1, CIAP2, glutathione peroxidase-4 (GPX4), cyclophilin D (CYPD), CASP1, NLRP3 and poly(ADP-ribose) polymerase-1 (PARP1) in human and mouse solid organs. We observed significant differences in expression of these molecules between human and mice. In addition, we characterized their expression profiles in acute as well as persistent tissue injury and chronic tissue remodelling using acute and chronic kidney injury models. We observed that the degree and pattern of induction of RN-related molecules were highly dependent on the trigger and disease pathogenesis. Furthermore, we studied their expression patterns in mice with lupus-like systemic autoimmunity, which revealed that the expression of MLKL, GPX4 and PARP1 significantly increased in the spleen along disease progression and CASP1, RIPK1, RIPK3 and CYPD were higher at the earlier stages but were significantly decreased in the later stages. In contrast, in the kidney, the expression of genes involved in pyroptosis, e.g. NLRP3 and CASP1 were significantly increased and TNFR1, RIPK1, RIPK3, CIAP1/2 and GPX4 were significantly decreased along the progression of lupus nephritis (LN). Thus, the organ- and species-specific expression of RN-related molecules should be considered during designing experiments, interpreting the results as well as extrapolating the conclusions from one species or organ to another species or organ respectively. © 2016 The Author(s).

  16. Aromatase, steroid-5-alpha-reductase type 1 and type 2 mRNA expression in gonads and in brain of Xenopus laevis during ontogeny.

    PubMed

    Urbatzka, R; Lutz, I; Kloas, W

    2007-01-01

    The key enzymes involved in the production of endogenous sex steroids are steroid-5-alpha-reductase and aromatase converting testosterone (T) into dihydrotestosterone (DHT) and into estradiol (E2), respectively. To gain more insights into the molecular mechanisms of sexual differentiation of amphibians, we determined the mRNA expression of steroid-5-alpha-reductase type1 (Srd5a1), type2 (Srd5a2) and aromatase (Aro) during ontogeny starting from the egg and ending after completion of metamorphosis in Xenopus laevis. Expression of all three enzymes was measured by means of semi-quantitative RT-PCR, determining for the first time Srd5a1 and Srd5a2 mRNA expression in amphibians. mRNA was analyzed in whole body homogenates from stage 12 to 48, while brain and gonads with kidney were studied separately from stage 48 to 66. Different ontogenetic mRNA expression patterns were observed for all genes analyzed, revealing early mRNA expression of Srd5a1 already in the egg at stage 12 whereas Srd5a2 and Aro was detected at stage 39. Sex-specific mRNA expressions of Srd5a2 and of Aro were determined in the gonads with kidney but not in brain. Srd5a2 was two-fold higher expressed in testes than in ovaries while Aro mRNA was ten-fold higher in ovaries. No gender-specific mRNA expression was observed for Srd5a1 in gonads and in brain. The ontogenetic patterns of Aro, Srd5a1 and Srd5a2 suggest that these genes are involved in sexual differentiation of gonads and brain already in early developmental stages. Especially in gonads Srd5a2 seems to be important for physiological regulation of testis development while Aro is associated with the development of ovaries.

  17. Regulated necrosis-related molecule mRNA expression in humans and mice and in murine acute tissue injury and systemic autoimmunity leading to progressive organ damage, and progressive fibrosis

    PubMed Central

    Honarpisheh, Mohsen; Desai, Jyaysi; Marschner, Julian A.; Weidenbusch, Marc; Lech, Maciej; Vielhauer, Volker; Anders, Hans-Joachim; Mulay, Shrikant R.

    2016-01-01

    The species-specific, as well as organ-specific expression of regulated necrosis (RN)-related molecules, is not known. We determined the expression levels of tumour necrosis factor receptor-1 (TNFR1), receptor activated protein kinase (RIPK)1, RIPK3, mixed lineage kinase domain-like (MLKL), CASP8, Fas-associated protein with death domain (FADD), cellular inhibitor of apoptosis protein (CIAP)1, CIAP2, glutathione peroxidase-4 (GPX4), cyclophilin D (CYPD), CASP1, NLRP3 and poly(ADP-ribose) polymerase-1 (PARP1) in human and mouse solid organs. We observed significant differences in expression of these molecules between human and mice. In addition, we characterized their expression profiles in acute as well as persistent tissue injury and chronic tissue remodelling using acute and chronic kidney injury models. We observed that the degree and pattern of induction of RN-related molecules were highly dependent on the trigger and disease pathogenesis. Furthermore, we studied their expression patterns in mice with lupus-like systemic autoimmunity, which revealed that the expression of MLKL, GPX4 and PARP1 significantly increased in the spleen along disease progression and CASP1, RIPK1, RIPK3 and CYPD were higher at the earlier stages but were significantly decreased in the later stages. In contrast, in the kidney, the expression of genes involved in pyroptosis, e.g. NLRP3 and CASP1 were significantly increased and TNFR1, RIPK1, RIPK3, CIAP1/2 and GPX4 were significantly decreased along the progression of lupus nephritis (LN). Thus, the organ- and species-specific expression of RN-related molecules should be considered during designing experiments, interpreting the results as well as extrapolating the conclusions from one species or organ to another species or organ respectively. PMID:27811014

  18. Sales of veterinary antibacterial agents in nine European countries during 2005-09: trends and patterns.

    PubMed

    Grave, Kari; Greko, Christina; Kvaale, Mari K; Torren-Edo, Jordi; Mackay, David; Muller, Arno; Moulin, Gerard

    2012-12-01

    To identify trends and patterns of sales of veterinary antimicrobial agents in nine European countries during 2005-09 in order to document the situation. Existing sales data, in tonnes of active ingredients, of veterinary antimicrobial agents by class were collected from nine European countries in a standardized manner for the years 2005-09 (one country for 2006-09). A population correction unit (PCU) is introduced as a proxy for the animal population potentially treated with antimicrobial agents. The sales data are expressed as mg of active substance/PCU. Data coverage was reported to be 98%-100% for the nine countries. Overall, sales of veterinary antimicrobials agents, in mg/PCU, declined during the reporting period in the nine countries. Substantial differences in the sales patterns and in the magnitude of sales of veterinary antimicrobial agents, expressed as mg/PCU, between the nine countries are observed. The major classes sold were penicillins, sulphonamides and tetracyclines. The sales accounted for by the various veterinary antimicrobial agents have changed substantially for most countries. An increase in the sales of third- and fourth-generation cephalosporins and fluoroquinolones were observed for the majority of the countries. Through re-analysis of existing data by application of a harmonized approach, an overall picture of the trends in the sales of veterinary antimicrobial agents in the nine countries was obtained. Notable differences in trends in sales between the countries were observed. Further studies, preferably including data by animal species, are needed to understand the factors that explain these observations.

  19. Natural language indicators of differential gene regulation in the human immune system.

    PubMed

    Mehl, Matthias R; Raison, Charles L; Pace, Thaddeus W W; Arevalo, Jesusa M G; Cole, Steve W

    2017-11-21

    Adverse social conditions have been linked to a conserved transcriptional response to adversity (CTRA) in circulating leukocytes that may contribute to social gradients in disease. However, the CNS mechanisms involved remain obscure, in part because CTRA gene-expression profiles often track external social-environmental variables more closely than they do self-reported internal affective states such as stress, depression, or anxiety. This study examined the possibility that variations in patterns of natural language use might provide more sensitive indicators of the automatic threat-detection and -response systems that proximally regulate autonomic induction of the CTRA. In 22,627 audio samples of natural speech sampled from the daily interactions of 143 healthy adults, both total language output and patterns of function-word use covaried with CTRA gene expression. These language features predicted CTRA gene expression substantially better than did conventional self-report measures of stress, depression, and anxiety and did so independently of demographic and behavioral factors (age, sex, race, smoking, body mass index) and leukocyte subset distributions. This predictive relationship held when language and gene expression were sampled more than a week apart, suggesting that associations reflect stable individual differences or chronic life circumstances. Given the observed relationship between personal expression and gene expression, patterns of natural language use may provide a useful behavioral indicator of nonconsciously evaluated well-being (implicit safety vs. threat) that is distinct from conscious affective experience and more closely tracks the neurobiological processes involved in peripheral gene regulation. Copyright © 2017 the Author(s). Published by PNAS.

  20. Divergence of Gene Body DNA Methylation and Evolution of Plant Duplicate Genes

    PubMed Central

    Wang, Jun; Marowsky, Nicholas C.; Fan, Chuanzhu

    2014-01-01

    It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica) genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences) of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes. PMID:25310342

  1. Effects of intense magnetic fields on sedimentation pattern and gene expression profile in budding yeast

    NASA Astrophysics Data System (ADS)

    Ikehata, Masateru; Iwasaka, Masakazu; Miyakoshi, Junji; Ueno, Shoogo; Koana, Takao

    2003-05-01

    Effects of magnetic fields (MFs) on biological systems are usually investigated using biological indices such as gene expression profiles. However, to precisely evaluate the biological effects of MF, the effects of intense MFs on systematic material transport processes including experimental environment must be seriously taken into consideration. In this study, a culture of the budding yeast, Saccharomyces cerevisiae, was used as a model for an in vitro biological test system. After exposure to 5 T static vertical MF, we found a difference in the sedimentation pattern of cells depending on the location of the dish in the magnet bore. Sedimented cells were localized in the center of the dish when they were placed in the lower part of the magnet bore while the sedimentation of the cells was uniform in dishes placed in the upper part of the bore because of the diamagnetic force. Genome wide gene expression profile of the yeast cells after exposure to 5 T static MF for 2 h suggested that the MF did not affect the expression level of any gene in yeast cells although the sedimentation pattern was altered. In addition, exposure to 10 T for 1 h and 5 T for 24 h also did not affect the gene expression. On the other hand, a slight change in expressions of several genes which are related to respiration was observed by exposure to a 14 T static MF for 24 h. The necessity of estimating the indirect effects of MFs on a study of its biological effect of MF in vitro will be discussed.

  2. Analysis of dofA, a fruA-dependent developmental gene, and its homologue, dofB, in Myxococcus xanthus.

    PubMed

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-12-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested.

  3. Expression profiles of genes for mitochondrial respiratory energy-dissipating systems and antioxidant enzymes in wheat leaves during de-etiolation.

    PubMed

    Garmash, Elena V; Velegzhaninov, Ilya O; Grabelnych, Olga I; Borovik, Olga A; Silina, Ekaterina V; Voinikov, Victor K; Golovko, Tamara K

    2017-08-01

    Mitochondrial respiratory components participate in the maintenance of chloroplast functional activity. This study investigates the effects 48h de-etiolation of spring wheat seedlings (Triticum aestivum L., var. Irgina) on the expression of genes that encode energy-dissipating respiratory components and antioxidant enzymes under continuous light conditions. The expression of AOX1a following the prolonged darkness exhibited a pattern indicating a prominent dependence on light. The expression of other respiratory genes, including NDA2, NDB2, and UCP1b, increased during de-etiolation and dark-to-light transition; however, changes in the expression of these genes occurred later than those in AOX1a expression. A high expression of NDA1 was detected after 12h of de-etiolation. The suppression of AOX1a, NDA2, NDB2, and UCP1b was observed 24h after de-etiolation when the photosynthetic apparatus and its defence systems against excess light were completely developed. The expression patterns of the respiratory genes and several genes encoding antioxidant enzymes (MnSOD, Cu-ZnSOD, t-APX, GR, and GRX) were quite similar. Our data indicate that the induction of nuclear genes encoding respiratory and antioxidant enzymes allow the plants to control reactive oxygen species (ROS) production and avoid oxidative stress during de-etiolation. Copyright © 2017 Elsevier GmbH. All rights reserved.

  4. Undifferentiated embryonic cell transcription factor 1 (UTF1) and deleted in azoospermia-like (DAZL) expression in the testes of donkeys.

    PubMed

    Lee, Y S; Jung, H J; Yoon, M J

    2017-04-01

    Putative markers for each specific germ cell stage can be a useful tool to study the fate and functions of these cells. Undifferentiated embryonic cell transcription factor 1 (UTF1) is a putative marker for undifferentiated spermatogonia in humans, rats and horses. The deleted in azoospermia-like (DAZL) protein is also expressed by differentiated spermatogonia and primary spermatocytes in several species. However, whether the expression patterns of these molecular markers are identical and applicable to donkeys remains to be elucidated. The objective of this study was to investigate the expression patterns of UTF1 and DAZL in donkey testicular tissue, using immunohistochemistry (IHC). Testicular samples were collected from routine field castration of donkeys in Korea. The reproductive stages (pre- or post-puberty) of the testes were determined from the morphological characteristics of cross-sections of the seminiferous tubules. For IHC, the UTF1 and DAZL primary antibodies were diluted at 1:100 and 1:200, respectively. The immunolabelling revealed that UTF1 was expressed in approximately 50% of spermatogonia in the pre-pubertal stage, whereas its expression was limited to an early subset of spermatogonia in the post-pubertal stage. DAZL was expressed in some, but not all, spermatogonia in the pre-pubertal spermatogonia, and interestingly, its expression was also observed in spermatogonia and primary spermatocytes in the post-pubertal stage. Co-immunolabelling of the germ cells with both UTF1 and DAZL revealed three types of protein expression patterns at both reproductive stages, namely UTF1 only, DAZL only and both UTF1 and DAZL. These protein molecules were not expressed in Sertoli and Leydig cells. In conclusion, a co-immunolabelling system with UTF1 and DAZL antibodies may be used to identify undifferentiated (UTF1 only), differentiating (UTF1 and DAZL), and differentiated spermatogonia (DAZL only) in donkey testes. © 2017 Blackwell Verlag GmbH.

  5. BnEPFL6, an EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) secreted peptide gene, is required for filament elongation in Brassica napus.

    PubMed

    Huang, Yi; Tao, Zhangsheng; Liu, Qiong; Wang, Xinfa; Yu, Jingyin; Liu, Guihua; Wang, Hanzhong

    2014-07-01

    Inflorescence architecture, pedicel length and stomata patterning in Arabidopsis thaliana are specified by inter-tissue communication mediated by ERECTA and its signaling ligands in the EPIDERMAL PATTERNING FACTOR-LIKE (EPFL) family of secreted cysteine-rich peptides. Here, we identified and characterized BnEPFL6 from Brassica napus. Heterologous expression of this gene under the double enhanced CaMV promoter (D35S) in Arabidopsis resulted in shortened stamen filaments, filaments degradation, and reduced filament cell size that displayed down-regulated expression of AHK2, in which phenotypic variation of ahk2-1 mutant presented highly consistent with that of BnEPFL6 transgenic lines. Especially, the expression level of BnEPFL6 in the shortened filaments of four B. napus male sterile lines (98A, 86A, SA, and Z11A) was similar to that of BnEPFL6 in the transgenic Arabidopsis lines. The activity of pBnEPFL6.2::GUS was intensive in the filaments of transgenic lines. These observations reveal that BnEPFL6 plays an important role in filament elongation and may also affect organ morphology and floral organ specification via a BnEPFL6-mediated cascade.

  6. Molecular characterization of Myf5 and comparative expression patterns of myogenic regulatory factors in Siniperca chuatsi.

    PubMed

    Zhu, Xin; Li, Yu-Long; Liu, Li; Wang, Jian-Hua; Li, Hong-Hui; Wu, Ping; Chu, Wu-Ying; Zhang, Jian-She

    2016-01-01

    Myogenic regulatory factors (MRFs) are muscle-specific basic helix-loop-helix (bHLH) transcription factor that plays an essential role in regulating skeletal muscle development and growth. To investigate molecular characterization of Myf5 and compare the expressional patterns of the four MRFs, we cloned the Myf5 cDNA sequence and analyzed the MRFs expressional patterns using quantitative real-time polymerase chain reaction in Chinese perch (Siniperca chuatsi). Sequence analysis indicated that Chinese perch Myf5 and other MRFs shared a highly conserved bHLH domain with those of other vertebrates. Sequence alignment and phylogenetic tree showed that Chinese perch MRFs had the highest identity with the MRFs of Epinephelus coioides. Spatio-temporal expressional patterns revealed that the MRFs were primarily expressed in muscle, especially in white muscle. During embryonic development period, Myf5, MyoD and MyoG mRNAs had a steep increase at neurula stage, and their highest expressional level was predominantly observed at hatching period. Whereas the highest expressional level of the MRF4 was observed at the muscular effect stage. The expressional patterns of post-embryonic development showed that the Myf5, MyoD and MyoG mRNAs were highest at 90 days post-hatching (dph). Furthermore, starvation and refeeding results showed that the transcription of the MRFs in the fast skeletal muscle of Chinese perch responded quickly to a single meal after 7 days of fasting. It indicated that the MRFs might contribute to muscle recovery after refeeding in Chinese perch. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Molecular basis of floral petaloidy: insights from androecia of Canna indica

    PubMed Central

    Fu, Qian; Liu, Huanfang; Almeida, Ana M. R.; Kuang, Yanfeng; Zou, Pu; Liao, Jingping

    2014-01-01

    Floral organs that take on the characteristics of petals can occur in all whorls of the monocot order Zingiberales. In Canna indica, the most ornamental or ‘petaloid’ parts of the flowers are of androecial origin and are considered staminodes. However, the precise nature of these petaloid organs is yet to be determined. In order to gain a better understanding of the genetic basis of androecial identity, a molecular investigation of B- and C-class genes was carried out. Two MADS-box genes GLOBOSA (GLO) and AGAMOUS (AG) were isolated from young inflorescences of C. indica by 3′ rapid amplification of cDNA ends polymerase chain reaction (3′-RACE PCR). Sequence characterization and phylogenetic analyses show that CiGLO and CiAG belong to the B- and C-class MADS-box gene family, respectively. CiAG is expressed in petaloid staminodes, the labellum, the fertile stamen and carpels. CiGLO is expressed in petals, petaloid staminodes, the labellum, the fertile stamen and carpels. Expression patterns in mature tissues of CiGLO and CiAG suggest that petaloid staminodes and the labellum are of androecial identity, in agreement with their position within the flower and with described Arabidopsis thaliana expression patterns. Although B- and C-class genes are important components of androecial determination, their expression patterns are not sufficient to explain the distinct morphology observed in staminodes and the fertile stamen in C. indica. PMID:24876297

  8. Analysis of differential protein expression in normal and neoplastic human breast epithelial cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, K.; Chubb, C.; Huberman, E.

    High resolution two dimensional get electrophoresis (2DE) and database analysis was used to establish protein expression patterns for cultured normal human mammary epithelial cells and thirteen breast cancer cell lines. The Human Breast Epithelial Cell database contains the 2DE protein patterns, including relative protein abundances, for each cell line, plus a composite pattern that contains all the common and specifically expressed proteins from all the cell lines. Significant differences in protein expression, both qualitative and quantitative, were observed not only between normal cells and tumor cells, but also among the tumor cell lines. Eight percent of the consistently detected proteinsmore » were found in significantly (P < 0.001) variable levels among the cell lines. Using a combination of immunostaining, comigration with purified protein, subcellular fractionation, and amino-terminal protein sequencing, we identified a subset of the differentially expressed proteins. These identified proteins include the cytoskeletal proteins actin, tubulin, vimentin, and cytokeratins. The cell lines can be classified into four distinct groups based on their intermediate filament protein profile. We also identified heat shock proteins; hsp27, hsp60, and hsp70 varied in abundance and in some cases in the relative phosphorylation levels among the cell lines. Finally, we identified IMP dehydrogenase in each of the cell lines, and found the levels of this enzyme in the tumor cell lines elevated 2- to 20-fold relative to the levels in normal cells.« less

  9. Expression of CDX-2 and Ki-67 in different grades of colorectal adenocarcinomas.

    PubMed

    Sen, Anway; Mitra, Sumit; Das, Ram Narayan; Dasgupta, Shatavisha; Saha, Koushik; Chatterjee, Uttara; Mukherjee, Krishnendu; Datta, Chhanda; Chattopadhyay, Bitan K

    2015-01-01

    CDX2 is a caudal homeobox gene essential for intestinal differentiation and is specifically expressed in colorectal adenocarcinomas. Its role in colorectal carcinogenesis is not fully elucidated. To study the expression pattern of CDX2 and Ki-67 in different grades of colorectal adenocarcinomas and to observe the relationship of their staining patterns in various tumor stages and to look for correlation if any, between Ki-67 labeling index (Ki-67 LI) and CDX2 expression. A total of 74 cases were enrolled. Detailed clinical profile, peroperative findings, histological grading and staging were noted. Immunohistochemistry for CDX2 and Ki-67 was done, and Ki-67 LI was calculated. CDX2 staining was graded semi-quantitatively, and statistical analysis was done. Age of presentation ranged from 20 to 75 years, and the male:female ratio was 1.83:1. There were 8, 47 and 13 cases of well, moderate and poorly differentiated adenocarcinomas, respectively. The mean Ki-67 LI of well, moderate and poorly differentiated adenocarcinomas were 14.25, 31.34 and 43.08 respectively, and their difference was statistically significant, correlation was also noted with stage. CDX2 expression appeared to be stronger in poorly differentiated cases, but there was no significant difference in its expression in the different grades and stages. There was no correlation between Ki-67 LI and CDX2 immunostaining pattern. The lymph node metastasis showed CDX2 positivity in all the cases. Expression of CDX2 does not significantly change with the grade of colorectal adenocarcinomas. However, it is an important diagnostic marker in metastatic colonic lesions. The Ki-67 LI, on the other hand, showed a strong correlation with histopathological grades.

  10. Methane monooxygenase gene expression mediated by methanobactin in the presence of mineral copper sources

    PubMed Central

    Knapp, Charles W.; Fowle, David A.; Kulczycki, Ezra; Roberts, Jennifer A.; Graham, David W.

    2007-01-01

    Methane is a major greenhouse gas linked to global warming; however, patterns of in situ methane oxidation by methane-oxidizing bacteria (methanotrophs), nature's main biological mechanism for methane suppression, are often inconsistent with laboratory predictions. For example, one would expect a strong relationship between methanotroph ecology and Cu level because methanotrophs require Cu to sustain particulate methane monooxygenase (pMMO), the most efficient enzyme for methane oxidation. However, no correlation has been observed in nature, which is surprising because methane monooxygenase (MMO) gene expression has been unequivocally linked to Cu availability. Here we provide a fundamental explanation for this lack of correlation. We propose that MMO expression in nature is largely controlled by solid-phase Cu geochemistry and the relative ability of Cu acquisition systems in methanotrophs, such as methanobactins (mb), to obtain Cu from mineral sources. To test this hypothesis, RT-PCR expression assays were developed for Methylosinus trichosporium OB3b (which produces mb) to quantify pMMO, soluble MMO (the alternate MMO expressed when Cu is “unavailable”), and 16S-rRNA gene expression under progressively more stringent Cu supply conditions. When Cu was provided as CuCl2, pMMO transcript levels increased significantly consistent with laboratory work. However, when Cu was provided as Cu-doped iron oxide, pMMO transcript levels increased only when mb was also present. Finally, when Cu was provided as Cu-doped borosilicate glass, pMMO transcription patterns varied depending on the ambient mb:Cu supply ratio. Cu geochemistry clearly influences MMO expression in terrestrial systems, and, as such, local Cu mineralogy might provide an explanation for methane oxidation patterns in the natural environment. PMID:17615240

  11. T-lymphocyte cytokine mRNA expression in cystic echinococcosis.

    PubMed

    Fauser, S; Kern, P

    1997-04-01

    In the present study we investigated cytokine mRNA expression by peripheral blood mononuclear cells (PBMC) from patients with cystic echinococcosis (CE) after stimulation with different antigens. By using reverse transcriptase polymerase chain reaction (RT-PCR) we could demonstrate that restimulation with crude Echinococcus granulosus antigen (Eg-Ag) induced or enhanced Th2 cytokine mRNA expression, especially IL-5 (by using antigen from sheep cyst fluid) in 23 out of 26 investigated CE patients and IL-10 (by using antigen from camel cyst fluid) in 10 out of 10 investigated CE patients. In contrast, IL-5 mRNA expression was absent in PBMC of healthy controls after Eg-Ag stimulation. To determine the specificity of this reaction we stimulated PBMC from 11 CE patients with crude Echinococcus multilocularis antigen (Em-Ag) and PBMC from 8 CE patients with Toxocara canis antigen (Tc-Ag). We found that the PBMC of patients showed a similar mRNA cytokine pattern on stimulation with Em-Ag when compared with Eg-Ag stimulation. The cytokine mRNA pattern on stimulation with Tc-Ag, however, resembled the cytokine mRNA pattern of unstimulated PBMC. Furthermore, the stimulation of PBMC with crude Mycobacterium tuberculosis antigen (H37Ra) and purified protein derivative (PPD) of M. tuberculosis revealed distinct IL-5 mRNA expression in all investigated CE patients, whereas in healthy controls IL-5 mRNA expression was very weak or totally absent. Thus, our results indicate an induction of Th2 cytokine mRNA expression in CE patients, which is frequently observed in parasite infections. Interestingly, this response persists after stimulation with tuberculosis antigens, which normally induce Th1 response.

  12. Bacterial Competition Reveals Differential Regulation of the pks Genes by Bacillus subtilis

    PubMed Central

    Vargas-Bautista, Carol; Rahlwes, Kathryn

    2014-01-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305–310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis. PMID:24187085

  13. Bacterial competition reveals differential regulation of the pks genes by Bacillus subtilis.

    PubMed

    Vargas-Bautista, Carol; Rahlwes, Kathryn; Straight, Paul

    2014-02-01

    Bacillus subtilis is adaptable to many environments in part due to its ability to produce a broad range of bioactive compounds. One such compound, bacillaene, is a linear polyketide/nonribosomal peptide. The pks genes encode the enzymatic megacomplex that synthesizes bacillaene. The majority of pks genes appear to be organized as a giant operon (>74 kb from pksC-pksR). In previous work (P. D. Straight, M. A. Fischbach, C. T. Walsh, D. Z. Rudner, and R. Kolter, Proc. Natl. Acad. Sci. U. S. A. 104:305-310, 2007, doi:10.1073/pnas.0609073103), a deletion of the pks operon in B. subtilis was found to induce prodiginine production by Streptomyces coelicolor. Here, colonies of wild-type B. subtilis formed a spreading population that induced prodiginine production from Streptomyces lividans, suggesting differential regulation of pks genes and, as a result, bacillaene. While the parent colony showed widespread induction of pks expression among cells in the population, we found the spreading cells uniformly and transiently repressed the expression of the pks genes. To identify regulators that control pks genes, we first determined the pattern of pks gene expression in liquid culture. We next identified mutations in regulatory genes that disrupted the wild-type pattern of pks gene expression. We found that expression of the pks genes requires the master regulator of development, Spo0A, through its repression of AbrB and the stationary-phase regulator, CodY. Deletions of degU, comA, and scoC had moderate effects, disrupting the timing and level of pks gene expression. The observed patterns of expression suggest that complex regulation of bacillaene and other antibiotics optimizes competitive fitness for B. subtilis.

  14. Parkinson's disease: increased motor network activity in the absence of movement.

    PubMed

    Ko, Ji Hyun; Mure, Hideo; Tang, Chris C; Ma, Yilong; Dhawan, Vijay; Spetsieris, Phoebe; Eidelberg, David

    2013-03-06

    We used a network approach to assess systems-level abnormalities in motor activation in humans with Parkinson's disease (PD). This was done by measuring the expression of the normal movement-related activation pattern (NMRP), a previously validated activation network deployed by healthy subjects during motor performance. In this study, NMRP expression was prospectively quantified in (15)O-water PET scans from a PD patient cohort comprised of a longitudinal early-stage group (n = 12) scanned at baseline and at two or three follow-up visits two years apart, and a moderately advanced group scanned on and off treatment with either subthalamic nucleus deep brain stimulation (n = 14) or intravenous levodopa infusion (n = 14). For each subject and condition, we measured NMRP expression during both movement and rest. Resting expression of the abnormal PD-related metabolic covariance pattern was likewise determined in the same subjects. NMRP expression was abnormally elevated (p < 0.001) in PD patients scanned in the nonmovement rest state. By contrast, network activity measured during movement did not differ from normal (p = 0.34). In the longitudinal cohort, abnormal increases in resting NMRP expression were evident at the earliest clinical stages (p < 0.05), which progressed significantly over time (p = 0.003). Analogous network changes were present at baseline in the treatment cohort (p = 0.001). These abnormalities improved with subthalamic nucleus stimulation (p < 0.005) but not levodopa (p = 0.25). In both cohorts, the changes in NMRP expression that were observed did not correlate with concurrent PD-related metabolic covariance pattern measurements (p > 0.22). Thus, the resting state in PD is characterized by changes in the activity of normal as well as pathological brain networks.

  15. Comparative transcriptomics of 5 high-altitude vertebrates and their low-altitude relatives.

    PubMed

    Tang, Qianzi; Gu, Yiren; Zhou, Xuming; Jin, Long; Guan, Jiuqiang; Liu, Rui; Li, Jing; Long, Kereng; Tian, Shilin; Che, Tiandong; Hu, Silu; Liang, Yan; Yang, Xuemei; Tao, Xuan; Zhong, Zhijun; Wang, Guosong; Chen, Xiaohui; Li, Diyan; Ma, Jideng; Wang, Xun; Mai, Miaomiao; Jiang, An'an; Luo, Xiaolin; Lv, Xuebin; Gladyshev, Vadim N; Li, Xuewei; Li, Mingzhou

    2017-12-01

    Species living at high altitude are subject to strong selective pressures due to inhospitable environments (e.g., hypoxia, low temperature, high solar radiation, and lack of biological production), making these species valuable models for comparative analyses of local adaptation. Studies that have examined high-altitude adaptation have identified a vast array of rapidly evolving genes that characterize the dramatic phenotypic changes in high-altitude animals. However, how high-altitude environment shapes gene expression programs remains largely unknown. We generated a total of 910 Gb of high-quality RNA-seq data for 180 samples derived from 6 tissues of 5 agriculturally important high-altitude vertebrates (Tibetan chicken, Tibetan pig, Tibetan sheep, Tibetan goat, and yak) and their cross-fertile relatives living in geographically neighboring low-altitude regions. Of these, ∼75% reads could be aligned to their respective reference genomes, and on average ∼60% of annotated protein coding genes in each organism showed FPKM expression values greater than 0.5. We observed a general concordance in topological relationships between the nucleotide alignments and gene expression-based trees. Tissue and species accounted for markedly more variance than altitude based on either the expression or the alternative splicing patterns. Cross-species clustering analyses showed a tissue-dominated pattern of gene expression and a species-dominated pattern for alternative splicing. We also identified numerous differentially expressed genes that could potentially be involved in phenotypic divergence shaped by high-altitude adaptation. These data serve as a valuable resource for examining the convergence and divergence of gene expression changes between species as they adapt or acclimatize to high-altitude environments. © The Authors 2017. Published by Oxford University Press.

  16. Xyloglucan endotransglycosylase/hydrolase genes from a susceptible and resistant jute species show opposite expression pattern following Macrophomina phaseolina infection

    PubMed Central

    Sharmin, Sazia; Azam, Muhammad Shafiul; Islam, Md. Shahidul; Sajib, Abu Ashfaqur; Mahmood, Niaz; Hasan, A. M. Mahedi; Ahmed, Razib; Sultana, Kishwar; Khan, Haseena

    2012-01-01

    Two of the most widely and intensively cultivated jute species, Corchorus capsularis and Corchorus olitorius, suffer severely from a stem rot disease caused by the fungus Macrophomina phaseolina. Wild jute species, C. trilocularis, shows resistance to this pathogenic fungus. In this study, the technique of differential display was applied to identify genes which are differentially expressed, under both infected and un-infected conditions, between C. trilocularis and C. olitorius var O-72. Two xyloglucan endotransglycosylase/hydrolase (XTH) genes designated CoXTH1 (from Corchorus olitorius) and CtXTH1 (from C.trilocularis) were identified from each of the two species which show different expression patterns upon fungal infection. A steady rise in the expression of CtXTH1 in response to infection was observed by quantitative real time PCR whereas the expression of CoXTH1 was found to be downregulated. Full length sequences of these two genes were determined using primer based gene walking and RACE PCR. This study confirms the involvement of XTH in molecular interactions between M. phaseolina and jute. However, it remains to be explored whether XTH is an essential component of the signaling pathway involved in plant-fungal interaction. PMID:23336031

  17. Xyloglucan endotransglycosylase/hydrolase genes from a susceptible and resistant jute species show opposite expression pattern following Macrophomina phaseolina infection.

    PubMed

    Sharmin, Sazia; Azam, Muhammad Shafiul; Islam, Md Shahidul; Sajib, Abu Ashfaqur; Mahmood, Niaz; Hasan, A M Mahedi; Ahmed, Razib; Sultana, Kishwar; Khan, Haseena

    2012-11-01

    Two of the most widely and intensively cultivated jute species, Corchorus capsularis and Corchorus olitorius, suffer severely from a stem rot disease caused by the fungus Macrophomina phaseolina. Wild jute species, C. trilocularis, shows resistance to this pathogenic fungus. In this study, the technique of differential display was applied to identify genes which are differentially expressed, under both infected and un-infected conditions, between C. trilocularis and C. olitorius var O-72. Two xyloglucan endotransglycosylase/hydrolase (XTH) genes designated CoXTH1 (from Corchorus olitorius) and CtXTH1 (from C.trilocularis) were identified from each of the two species which show different expression patterns upon fungal infection. A steady rise in the expression of CtXTH1 in response to infection was observed by quantitative real time PCR whereas the expression of CoXTH1 was found to be downregulated. Full length sequences of these two genes were determined using primer based gene walking and RACE PCR. This study confirms the involvement of XTH in molecular interactions between M. phaseolina and jute. However, it remains to be explored whether XTH is an essential component of the signaling pathway involved in plant-fungal interaction.

  18. Sodium fluoride affects zebrafish behaviour and alters mRNA expressions of biomarker genes in the brain: Role of Nrf2/Keap1.

    PubMed

    Mukhopadhyay, Debdip; Priya, Pooja; Chattopadhyay, Ansuman

    2015-09-01

    Sodium fluoride (NaF), used as pesticides and for industrial purposes are deposited in the water bodies and therefore affects its biota. Zebrafish exposed to NaF in laboratory condition showed hyperactivity and frequent surfacing activity, somersaulting and vertical swimming pattern as compared to the control group. Reactive oxygen species level was elevated and glutathione level was depleted along with increased malondialdehyde content in the brain. Levels of glutathione-s-transferase (GST), catalase (CAT) and superoxide dismutase were also elevated in the treatment groups. Expression of mRNA of nuclear factor erythroid 2 related factor 2 (Nrf2) and its inhibitor Kelch-like ECH-associated protein 1 (Keap1) during stress condition were observed along with Gst, Cat, NADPH: quinone oxidoreductase 1(Nqo1) and p38. Except Keap1, all other genes exhibited elevated expression. Nrf2/Keap1 proteins had similar expression pattern as their corresponding mRNA. The findings in this study might help to understand the molecular mechanism of fluoride induced neurotoxicity in fish. Copyright © 2015 Elsevier B.V. All rights reserved.

  19. Association between expression of cumulus expansion markers and real-time proliferation of porcine follicular granulosa cells in a primary cell culture model.

    PubMed

    Ciesiółka, S; Budna, J; Bryja, A; Kranc, W; Chachuła, A; Dyszkiewicz-Konwińska, M; Piotrowska, H; Bukowska, D; Antosik, P; Bruska, M; Brüssow, K P; Nowicki, M; Zabel, M; Kempisty, B

    2016-01-01

    Folliculogenesis is a compound process that involves both ovarian follicle growth and oocyte development, which is tightly attached to the follicular wall. During this process, cells that form the follicle structure undergo substantial morphological and molecular modifications that finally lead to differentiation and specialization of ovarian follicular cells. The differentiation of ovarian cells encompasses formation of follicle, which is composed of theca (TCs), mural granulosa (GCs), and cumulus cells (CCs). It was previously hypothesized that GCs and CCs represent undifferentiated and highly specialized follicular cells, respectively, which may have similar primordial cell origins. In this study, we investigated the expression pattern of cumulus expansion markers such as COX2, HAS2, PTX3, and TSG6 in porcine GCs during short-term, in vitro culture. We hypothesized that these genes may display an important function in GCs in relation to cellular real-time proliferation. The expression pattern of COX2, HAS2, PTX3, and TSG6 was evaluated after using RT-qPCR in relation to confocal microscopy observations of protein expression and distribution during real-time proliferation of porcine follicular GCs. The COX2 and HAS2 mRNAs were highly expressed after 120 h of in vitro culture (IVC), whereas PTX3 and TSG6 mRNAs were increased during the first 24-48 h of IVC (P less than 0.001, P less than 0.01). Conversely, all of the encoded proteins were highly expressed after 144-168 h of IVC as compared to other culture periods (P less than 0.001, P less than 0.01). When analyzing the realtime proliferation of GCs in vitro, we observed a logarithmic increase of cell proliferation between 0 h and 120 h of IVC. However, after 120-168 h of IVC, the cells reached the lag phase of proliferation. Since it is well accepted that porcine GCs undergo luteinization shortly after 24-48 h of IVC, the expression pattern of investigated genes indicated that Cox2 and Has2 are independent from the LH surge, but their increased levels may be upregulated by cell proliferation in vitro. Moreover, higher expression of PTX3 and TSG6 during first 24 h and/or 48 h of IVC suggested that their levels are accompanied by porcine GCs luteinization process.

  20. Four not six: Revealing culturally common facial expressions of emotion.

    PubMed

    Jack, Rachael E; Sun, Wei; Delis, Ioannis; Garrod, Oliver G B; Schyns, Philippe G

    2016-06-01

    As a highly social species, humans generate complex facial expressions to communicate a diverse range of emotions. Since Darwin's work, identifying among these complex patterns which are common across cultures and which are culture-specific has remained a central question in psychology, anthropology, philosophy, and more recently machine vision and social robotics. Classic approaches to addressing this question typically tested the cross-cultural recognition of theoretically motivated facial expressions representing 6 emotions, and reported universality. Yet, variable recognition accuracy across cultures suggests a narrower cross-cultural communication supported by sets of simpler expressive patterns embedded in more complex facial expressions. We explore this hypothesis by modeling the facial expressions of over 60 emotions across 2 cultures, and segregating out the latent expressive patterns. Using a multidisciplinary approach, we first map the conceptual organization of a broad spectrum of emotion words by building semantic networks in 2 cultures. For each emotion word in each culture, we then model and validate its corresponding dynamic facial expression, producing over 60 culturally valid facial expression models. We then apply to the pooled models a multivariate data reduction technique, revealing 4 latent and culturally common facial expression patterns that each communicates specific combinations of valence, arousal, and dominance. We then reveal the face movements that accentuate each latent expressive pattern to create complex facial expressions. Our data questions the widely held view that 6 facial expression patterns are universal, instead suggesting 4 latent expressive patterns with direct implications for emotion communication, social psychology, cognitive neuroscience, and social robotics. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

  1. Effects of Cultural Tightness-Looseness and Social Network Density on Expression of Positive and Negative Emotions: A Large-Scale Study of Impression Management by Facebook Users.

    PubMed

    Liu, Pan; Chan, David; Qiu, Lin; Tov, William; Tong, Victor Joo Chuan

    2018-05-01

    Using data from 13,789 Facebook users across U.S. states, this study examined the main effects of societal-level cultural tightness-looseness and its interaction effects with individuals' social network density on impression management (IM) in terms of online emotional expression. Results showed that individuals from culturally tight (vs. loose) states were more likely to express positive emotions and less likely to express negative emotions. Meanwhile, for positive emotional expression, there was a tightness-looseness by social network density interaction effect. In culturally tight states, individuals with dense (vs. sparse) networks were more likely to express positive emotions, while in culturally loose states this pattern was reversed. For negative emotional expression, however, no such interaction was observed. Our findings highlight the influence of cultural norms and social network structure on emotional expressions as IM strategies.

  2. Characterization and expression patterns of let-7 microRNA in the silkworm (Bombyx mori).

    PubMed

    Liu, Shiping; Xia, Qingyou; Zhao, Ping; Cheng, Tingcai; Hong, Kaili; Xiang, Zhonghuai

    2007-07-25

    lin-4 and let-7, the two founding members of heterochronic microRNA genes, are firstly confirmed in Caenorhabditis elegans to control the proper timing of developmental programs in a heterochronic pathway. let-7 has been thought to trigger the onset of adulthood across animal phyla. Ecdysone and Broad-Complex are required for the temporal expression of let-7 in Drosophila melanogaster. For a better understanding of the conservation and functions of let-7, we seek to explore how it is expressed in the silkworm (Bombyx mori). One member of let-7 family has been identified in silkworm computationally and experimentally. All known members of this family share the same nucleotides at ten positions within the mature sequences. Sequence logo and phylogenetic tree show that they are not only conserved but diversify to some extent among some species. The bmo-let-7 was very lowly expressed in ova harvested from newborn unmated female adult and in individuals from the first molt to the early third instar, highly expressed after the third molt, and the most abundant expression was observed after mounting, particularly after pupation. The expression levels were higher at the end of each instar and at the beginning of each molt than at other periods, coinciding with the pulse of ecdysone and BR-C as a whole. Using cultured ovary cell line, BmN-SWU1, we examined the effect of altered ecdysone levels on bmo-let-7 expression. The expression was also detected in various tissues of day 3 of the fifth instar and of from day 7 of the fifth to pupa, suggesting a wide distributing pattern with various signal intensities. bmo-let-7 is stage- and tissue-specifically expressed in the silkworm. Although no signals were detected during embryonic development and first larval instar stages, the expression of bmo-let-7 was observed from the first molt, suggesting that it might also function at early larval stage of the silkworm. The detailed expression profiles in the whole life cycle and cultured cell line of silkworm showed a clear association with ecdysone pulse and a variety of biological processes.

  3. MicroRNA networks in mouse lung organogenesis.

    PubMed

    Dong, Jie; Jiang, Guoqian; Asmann, Yan W; Tomaszek, Sandra; Jen, Jin; Kislinger, Thomas; Wigle, Dennis A

    2010-05-26

    MicroRNAs (miRNAs) are known to be important regulators of both organ development and tumorigenesis. MiRNA networks and their regulation of messenger RNA (mRNA) translation and protein expression in specific biological processes are poorly understood. We explored the dynamic regulation of miRNAs in mouse lung organogenesis. Comprehensive miRNA and mRNA profiling was performed encompassing all recognized stages of lung development beginning at embryonic day 12 and continuing to adulthood. We analyzed the expression patterns of dynamically regulated miRNAs and mRNAs using a number of statistical and computational approaches, and in an integrated manner with protein levels from an existing mass-spectrometry derived protein database for lung development. In total, 117 statistically significant miRNAs were dynamically regulated during mouse lung organogenesis and clustered into distinct temporal expression patterns. 11,220 mRNA probes were also shown to be dynamically regulated and clustered into distinct temporal expression patterns, with 3 major patterns accounting for 75% of all probes. 3,067 direct miRNA-mRNA correlation pairs were identified involving 37 miRNAs. Two defined correlation patterns were observed upon integration with protein data: 1) increased levels of specific miRNAs directly correlating with downregulation of predicted mRNA targets; and 2) increased levels of specific miRNAs directly correlating with downregulation of translated target proteins without detectable changes in mRNA levels. Of 1345 proteins analyzed, 55% appeared to be regulated in this manner with a direct correlation between miRNA and protein level, but without detectable change in mRNA levels. Systematic analysis of microRNA, mRNA, and protein levels over the time course of lung organogenesis demonstrates dynamic regulation and reveals 2 distinct patterns of miRNA-mRNA interaction. The translation of target proteins affected by miRNAs independent of changes in mRNA level appears to be a prominent mechanism of developmental regulation in lung organogenesis.

  4. Molecular characterization of BrMYB28 and BrMYB29 paralogous transcription factors involved in the regulation of aliphatic glucosinolate profiles in Brassica rapa ssp. pekinensis.

    PubMed

    Baskar, Venkidasamy; Park, Se Won

    2015-07-01

    Glucosinolates (GSL) are one of the major secondary metabolites of the Brassicaceae family. In the present study, we aim at characterizing the multiple paralogs of aliphatic GSL regulators, such as BrMYB28 and BrMYB29 genes in Brassica rapa ssp. pekinensis, by quantitative real-time PCR (qRT-PCR) analysis in different tissues and at various developmental stages. An overlapping gene expression pattern between the BrMYBs as well as their downstream genes (DSGs) was found at different developmental stages. Among the BrMYB28 and BrMYB29 paralogous genes, the BrMYB28.3 and BrMYB29.1 genes were dominantly expressed in most of the developmental stages, compared to the other paralogs of the BrMYB genes. Furthermore, the differential expression pattern of the BrMYBs was observed under various stress treatments. Interestingly, BrMYB28.2 showed the least expression in most developmental stages, while its expression was remarkably high in different stress conditions. More specifically, the BrMYB28.2, BrMYB28.3, and BrMYB29.1 genes were highly responsive to various abiotic and biotic stresses, further indicating their possible role in stress tolerance. Moreover, the in silico cis motif analysis in the upstream regulatory regions of BrMYBs showed the presence of various putative stress-specific motifs, which further indicated their responsiveness to biotic and abiotic stresses. These observations suggest that the dominantly expressed BrMYBs, both in different developmental stages and under various stress treatments (BrMYB28.3 and BrMYB29.1), may be potential candidate genes for altering the GSL level through genetic modification studies in B. rapa ssp. pekinensis. Copyright © 2015. Published by Elsevier SAS.

  5. Hazardous effects of effluent from the chrome plating industry: 70 kDa heat shock protein expression as a marker of cellular damage in transgenic Drosophila melanogaster (hsp70-lacZ).

    PubMed Central

    Mukhopadhyay, Indranil; Saxena, Daya Krishna; Chowdhuri, Debapratim Kar

    2003-01-01

    Hazardous effects of an effluent from the chrome plating industry were examined by exposing transgenic Drosophila melanogaster (hsp70-lacZ) to various concentrations (0.05, 0.1, 1.0, 10.0, and 100.0 micro L/mL) of the effluent through diet. The emergence pattern of adult flies was affected, along with impaired reproductive performance at the higher dietary concentrations of the effluent. Interestingly, the effect of the effluent was more pronounced in male than in female flies. The effect of the effluent on development of adult flies was concurrent with the expression pattern of the heat shock protein 70 gene (hsp70), both in larval tissues and in the reproductive organs of adult flies. We observed a dose- and time-dependent expression of hsp70 in third instar larvae exposed for different time intervals. Absence of hsp70 expression in larvae exposed to 0.1 micro L/mL of the effluent indicated that this is the highest nontoxic concentration for Drosophila. The stress gene assay in the reproductive organs of adult flies revealed hsp70 expression in the testis of male flies only. However, trypan blue dye exclusion tests in these tissues indicate tissue damage in the male accessory gland of adult flies, which was further confirmed by ultrastructural observations. In the present study we demonstrate the utility of transgenic Drosophila as an alternative animal model for evaluating hazardous effects of the effluent from the chrome plating industry and further reveal the cytoprotective role of hsp70 and its expression as an early marker in environmental risk assessment. PMID:14644668

  6. [Comparative study of expression of homeobox gene Msx-1, Msx-2 mRNA during the hard tissue formation of mouse tooth development].

    PubMed

    Wang, Y; Wang, J; Gao, Y

    2001-07-01

    To observe and compare the expression pattern of Msx-1, Msx-2 mRNA during the different stages of hard tissue formation in the first mandibular molar of mouse and investigate the relationship between the two genes. First mandibular molar germs from 1, 3, 7 and 14-days old mouse were separated and reverse transcription-polymerase chain reaction was performed on the total RNA of them using Msx-1, Msx-2 specific primers separately. Expression of both genes were detected during the different stages of hard tissue formation in the mouse first mandibular molars, but there was some interesting differences in the quantitiy between the two genes. Msx-1 transcripts appeared at the 1 day postnatally, and increase through 3 day, 7 day, then maximally expressed at 14 days postnatally; while Msx-2 mRNA was seen and expressed maximally at the 3 days postnatally, then there was a gradual reduction at 7 days, and 14 days postnatally. The homeobox gene Msx-1, Msx-2 may play a role in the events of the hard tissue formation. The complementary expression pattern of them during the specific stage of hard tissue formation indicates that there may be some functional redundancy between them during the biomineralization.

  7. Spectral biclustering of microarray data: coclustering genes and conditions.

    PubMed

    Kluger, Yuval; Basri, Ronen; Chang, Joseph T; Gerstein, Mark

    2003-04-01

    Global analyses of RNA expression levels are useful for classifying genes and overall phenotypes. Often these classification problems are linked, and one wants to find "marker genes" that are differentially expressed in particular sets of "conditions." We have developed a method that simultaneously clusters genes and conditions, finding distinctive "checkerboard" patterns in matrices of gene expression data, if they exist. In a cancer context, these checkerboards correspond to genes that are markedly up- or downregulated in patients with particular types of tumors. Our method, spectral biclustering, is based on the observation that checkerboard structures in matrices of expression data can be found in eigenvectors corresponding to characteristic expression patterns across genes or conditions. In addition, these eigenvectors can be readily identified by commonly used linear algebra approaches, in particular the singular value decomposition (SVD), coupled with closely integrated normalization steps. We present a number of variants of the approach, depending on whether the normalization over genes and conditions is done independently or in a coupled fashion. We then apply spectral biclustering to a selection of publicly available cancer expression data sets, and examine the degree to which the approach is able to identify checkerboard structures. Furthermore, we compare the performance of our biclustering methods against a number of reasonable benchmarks (e.g., direct application of SVD or normalized cuts to raw data).

  8. Baculovirus-mediated gene transfer in butterfly wings in vivo: an efficient expression system with an anti-gp64 antibody

    PubMed Central

    2013-01-01

    Background Candidate genes for color pattern formation in butterfly wings have been known based on gene expression patterns since the 1990s, but their functions remain elusive due to a lack of a functional assay. Several methods of transferring and expressing a foreign gene in butterfly wings have been reported, but they have suffered from low success rates or low expression levels. Here, we developed a simple, practical method to efficiently deliver and express a foreign gene using baculovirus-mediated gene transfer in butterfly wings in vivo. Results A recombinant baculovirus containing a gene for green fluorescent protein (GFP) was injected into pupae of the blue pansy butterfly Junonia orithya (Nymphalidae). GFP fluorescence was detected in the pupal wings and other body parts of the injected individuals three to five days post-injection at various degrees of fluorescence. We obtained a high GFP expression rate at relatively high virus titers, but it was associated with pupal death before color pattern formation in wings. To reduce the high mortality rate caused by the baculovirus treatment, we administered an anti-gp64 antibody, which was raised against baculovirus coat protein gp64, to infected pupae after the baculovirus injection. This treatment greatly reduced the mortality rate of the infected pupae. GFP fluorescence was observed in pupal and adult wings and other body parts of the antibody-treated individuals at various degrees of fluorescence. Importantly, we obtained completely developed wings with a normal color pattern, in which fluorescent signals originated directly from scales or the basal membrane after the removal of scales. GFP fluorescence in wing tissues spatially coincided with anti-GFP antibody staining, confirming that the fluorescent signals originated from the expressed GFP molecules. Conclusions Our baculovirus-mediated gene transfer system with an anti-gp64 antibody is reasonably efficient, and it can be an invaluable tool to transfer, express, and functionally examine foreign genes in butterfly wings and also in other non-model insect systems. PMID:23522444

  9. Expression of fragile X mental retardation protein and Fmr1 mRNA during folliculogenesis in the rat.

    PubMed

    Ferder, Ianina; Parborell, Fernanda; Sundblad, Victoria; Chiauzzi, Violeta; Gómez, Karina; Charreau, Eduardo H; Tesone, Marta; Dain, Liliana

    2013-04-01

    Fragile X mental retardation protein (FMRP) belongs to a small family of RNA-binding proteins. Its absence or inactivity is responsible for fragile X syndrome, the most common cause of inherited mental retardation. Despite its ubiquitous expression, FMRP function and expression remain almost understudied in non-neuronal tissues, though previous studies on germline development during oogenesis may suggest a special function of this protein also in ovarian tissue. In addition, the well-documented association of FMR1 premutation state with fragile X-related premature ovarian insufficiency adds interest to the role of FMRP in ovarian physiology. The aim of the present work was to investigate the expression of Fmr1 mRNA and its protein, FMRP, at different stages of rat follicular development. By immunohistochemical studies we demonstrated FMRP expression in granulosa, theca and germ cells in all stages of follicular development. In addition, changes in Fmr1 expression, both at the protein and mRNA levels, were observed. FMRP levels increased upon follicular development while preantral and early antral follicles presented similar levels of Fmr1 transcripts with decreased expression in preovulatory follicles. These observations suggest that Fmr1 expression in the ovary is regulated at different and perhaps independent levels. In addition, our results show expression of at least four different isoforms of FMRP during all stages of follicular growth with expression patterns that differ from those observed in brain and testis. Our study shows a regulated expression of Fmr1, both at mRNA and protein levels, during rat follicular development.

  10. Videos of conspecifics elicit interactive looking patterns and facial expressions in monkeys.

    PubMed

    Mosher, Clayton P; Zimmerman, Prisca E; Gothard, Katalin M

    2011-08-01

    A broader understanding of the neural basis of social behavior in primates requires the use of species-specific stimuli that elicit spontaneous, but reproducible and tractable behaviors. In this context of natural behaviors, individual variation can further inform about the factors that influence social interactions. To approximate natural social interactions similar to those documented by field studies, we used unedited video footage to induce in viewer monkeys spontaneous facial expressions and looking patterns in the laboratory setting. Three adult male monkeys (Macaca mulatta), previously behaviorally and genetically (5-HTTLPR) characterized, were monitored while they watched 10 s video segments depicting unfamiliar monkeys (movie monkeys) displaying affiliative, neutral, and aggressive behaviors. The gaze and head orientation of the movie monkeys alternated between "averted" and "directed" at the viewer. The viewers were not reinforced for watching the movies, thus their looking patterns indicated their interest and social engagement with the stimuli. The behavior of the movie monkey accounted for differences in the looking patterns and facial expressions displayed by the viewers. We also found multiple significant differences in the behavior of the viewers that correlated with their interest in these stimuli. These socially relevant dynamic stimuli elicited spontaneous social behaviors, such as eye-contact induced reciprocation of facial expression, gaze aversion, and gaze following, that were previously not observed in response to static images. This approach opens a unique opportunity to understanding the mechanisms that trigger spontaneous social behaviors in humans and nonhuman primates. (PsycINFO Database Record (c) 2011 APA, all rights reserved).

  11. Foregut separation and tracheo-oesophageal malformations: The role of tracheal outgrowth, dorso-ventral patterning and programmed cell death

    PubMed Central

    Ioannides, Adonis S.; Massa, Valentina; Ferraro, Elisabetta; Cecconi, Francesco; Spitz, Lewis; Henderson, Deborah J.; Copp, Andrew J.

    2010-01-01

    Foregut division—the separation of dorsal (oesophageal) from ventral (tracheal) foregut components—is a crucial event in gastro-respiratory development, and frequently disturbed in clinical birth defects. Here, we examined three outstanding questions of foregut morphogenesis. The origin of the trachea is suggested to result either from respiratory outgrowth or progressive septation of the foregut tube. We found normal foregut lengthening despite failure of tracheo-oesophageal separation in Adriamycin-treated embryos, whereas active septation was observed only in normal foregut morphogenesis, indicating a primary role for septation. Dorso-ventral patterning of Nkx2.1 (ventral) and Sox2 (dorsal) expression is proposed to be critical for tracheo-oesophageal separation. However, normal dorso-ventral patterning of Nkx2.1 and Sox2 expression occurred in Adriamycin-treated embryos with defective foregut separation. In contrast, Shh expression shifts dynamically, ventral-to-dorsal, solely during normal morphogenesis, particularly implicating Shh in foregut morphogenesis. Dying cells localise to the fusing foregut epithelial ridges, with disturbance of this apoptotic pattern in Adriamycin, Shh and Nkx2.1 models. Strikingly, however, genetic suppression of apoptosis in the Apaf1 mutant did not prevent foregut separation, indicating that apoptosis is not required for tracheo-oesophageal morphogenesis. Epithelial remodelling during septation may cause loss of cell-cell or cell-matrix interactions, resulting in apoptosis (anoikis) as a secondary consequence. PMID:19913007

  12. Sex differences in autism: a resting-state fMRI investigation of functional brain connectivity in males and females.

    PubMed

    Alaerts, Kaat; Swinnen, Stephan P; Wenderoth, Nicole

    2016-06-01

    Autism spectrum disorders (ASD) are far more prevalent in males than in females. Little is known however about the differential neural expression of ASD in males and females. We used a resting-state fMRI-dataset comprising 42 males/42 females with ASD and 75 male/75 female typical-controls to examine whether autism-related alterations in intrinsic functional connectivity are similar or different in males and females, and particularly whether alterations reflect 'neural masculinization', as predicted by the Extreme Male Brain theory. Males and females showed a differential neural expression of ASD, characterized by highly consistent patterns of hypo-connectivity in males with ASD (compared to typical males), and hyper-connectivity in females with ASD (compared to typical females). Interestingly, patterns of hyper-connectivity in females with ASD reflected a shift towards the (high) connectivity levels seen in typical males (neural masculinization), whereas patterns of hypo-connectivity observed in males with ASD reflected a shift towards the (low) typical feminine connectivity patterns (neural feminization). Our data support the notion that ASD is a disorder of sexual differentiation rather than a disorder characterized by masculinization in both genders. Future work is needed to identify underlying factors such as sex hormonal alterations that drive these sex-specific neural expressions of ASD. © The Author (2016). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  13. HSP70 production patterns in coastal and estuarine organisms facing increasing temperatures

    NASA Astrophysics Data System (ADS)

    Madeira, D.; Narciso, L.; Cabral, H. N.; Vinagre, C.; Diniz, M. S.

    2012-10-01

    Heat shock proteins are important components in the cellular defense against proteotoxic stress. This work aimed to reveal HSP70 (hsc70 plus hsp70) expression patterns in several marine species (fish, crabs and shrimps) within a community along a temperature gradient and at the upper thermal limit. The organisms were collected in the Tagus estuary and adjacent shore (in Cabo Raso), Portugal. Exposure trials were performed using the critical thermal maximum (CTMax) method in order to recreate a stress gradient of ecological relevance. Protein analysis was performed using an enzyme linked immunosorbent assay (ELISA). Organisms within each community (estuary, coast; subtidal, intertidal, supratidal) responded in several different ways: no change in HSP70 levels, an increase in HSP70 levels, or increases and decreases in HSP70 levels. These patterns of response occurred independently of taxa, CTMax and habitat type. Magnitude of expression relates to the habitat's thermal conditions. Species from highly variable and hot habitats i.e. intertidal/supratidal zone, and living in greater shore heights produce higher amounts of HSP70. Demersal and subtidal species inhabit colder and more stable waters thus they seem to have a slower heat shock response. No clear pattern was observed for species of the same group (fish, crabs and shrimps) or congeneric species. HSP70 expression showed high intraspecific variability potentially due to genetic traits, environmental traits and condition status.

  14. Developmental and Regional Patterns of GAP-43 Immunoreactivity in a Metamorphosing Brain

    PubMed Central

    Simmons, Andrea Megela; Tanyu, Leslie H.; Horowitz, Seth S.; Chapman, Judith A.; Brown, Rebecca A.

    2012-01-01

    Growth-associated protein-43 is typically expressed at high levels in the nervous system during development. In adult animals, its expression is lower, but still observable in brain areas showing structural or functional plasticity. We examined patterns of GAP-43 immunoreactivity in the brain of the bullfrog, an animal whose nervous system undergoes considerable reorganization across metamorphic development and retains a strong capacity for plasticity in adulthood. Immunolabeling was mostly diffuse in hatchling tadpoles, but became progressively more discrete as larval development proceeded. In many brain areas, intensity of immunolabel peaked at metamorphic climax, the time of final transition from aquatic to semi-terrestrial life. Changes in intensity of GAP-43 expression in the medial vestibular nucleus, superior olivary nucleus, and torus semicircularis appeared correlated with stage-dependent functional changes in processing auditory stimuli. Immunolabeling in the Purkinje cell layer of the cerebellum and in the cerebellar nucleus was detectable at most developmental time points. Heavy immunolabel was present from early larval stages through the end of climax in the thalamus (ventromedial, anterior, posterior, central nuclei). Immunolabel in the tadpole telencephalon was observed around the lateral ventricles, and in the medial septum and ventral striatum. In postmetamorphic animals, immunoreactivity was confined mainly to the ventricular zones and immediately adjacent cell layers. GAP-43 expression was present in olfactory, auditory and optic cranial nerves throughout larval and postmetamorphic life. The continued expression of GAP-43 in brain nuclei and in cranial nerves throughout development and into adulthood reflects the high regenerative potential of the bullfrog’s central nervous system. PMID:18431052

  15. Oral Leucine Supplementation Is Sensed by the Brain but neither Reduces Food Intake nor Induces an Anorectic Pattern of Gene Expression in the Hypothalamus

    PubMed Central

    Zampieri, Thais T.; Pedroso, João A. B.; Furigo, Isadora C.; Tirapegui, Julio; Donato, Jose

    2013-01-01

    Leucine activates the intracellular mammalian target of the rapamycin (mTOR) pathway, and hypothalamic mTOR signaling regulates food intake. Although central infusion of leucine reduces food intake, it is still uncertain whether oral leucine supplementation is able to affect the hypothalamic circuits that control energy balance. We observed increased phosphorylation of p70s6k in the mouse hypothalamus after an acute oral gavage of leucine. We then assessed whether acute oral gavage of leucine induces the activation of neurons in several hypothalamic nuclei and in the brainstem. Leucine did not induce the expression of Fos in hypothalamic nuclei, but it increased the number of Fos-immunoreactive neurons in the area postrema. In addition, oral gavage of leucine acutely increased the 24 h food intake of mice. Nonetheless, chronic leucine supplementation in the drinking water did not change the food intake and the weight gain of ob/ob mice and of wild-type mice consuming a low- or a high-fat diet. We assessed the hypothalamic gene expression and observed that leucine supplementation increased the expression of enzymes (BCAT1, BCAT2 and BCKDK) that metabolize branched-chain amino acids. Despite these effects, leucine supplementation did not induce an anorectic pattern of gene expression in the hypothalamus. In conclusion, our data show that the brain is able to sense oral leucine intake. However, the food intake is not modified by chronic oral leucine supplementation. These results question the possible efficacy of leucine supplementation as an appetite suppressant to treat obesity. PMID:24349566

  16. Automatic decoding of facial movements reveals deceptive pain expressions

    PubMed Central

    Bartlett, Marian Stewart; Littlewort, Gwen C.; Frank, Mark G.; Lee, Kang

    2014-01-01

    Summary In highly social species such as humans, faces have evolved to convey rich information for social interaction, including expressions of emotions and pain [1–3]. Two motor pathways control facial movement [4–7]. A subcortical extrapyramidal motor system drives spontaneous facial expressions of felt emotions. A cortical pyramidal motor system controls voluntary facial expressions. The pyramidal system enables humans to simulate facial expressions of emotions not actually experienced. Their simulation is so successful that they can deceive most observers [8–11]. Machine vision may, however, be able to distinguish deceptive from genuine facial signals by identifying the subtle differences between pyramidally and extrapyramidally driven movements. Here we show that human observers could not discriminate real from faked expressions of pain better than chance, and after training, improved accuracy to a modest 55%. However a computer vision system that automatically measures facial movements and performs pattern recognition on those movements attained 85% accuracy. The machine system’s superiority is attributable to its ability to differentiate the dynamics of genuine from faked expressions. Thus by revealing the dynamics of facial action through machine vision systems, our approach has the potential to elucidate behavioral fingerprints of neural control systems involved in emotional signaling. PMID:24656830

  17. The genetics of geometry

    PubMed Central

    Coen, Enrico; Rolland-Lagan, Anne-Gaëlle; Matthews, Mark; Bangham, J. Andrew; Prusinkiewicz, Przemyslaw

    2004-01-01

    Although much progress has been made in understanding how gene expression patterns are established during development, much less is known about how these patterns are related to the growth of biological shapes. Here we describe conceptual and experimental approaches to bridging this gap, with particular reference to plant development where lack of cell movement simplifies matters. Growth and shape change in plants can be fully described with four types of regional parameter: growth rate, anisotropy, direction, and rotation. A key requirement is to understand how these parameters both influence and respond to the action of genes. This can be addressed by using mechanistic models that capture interactions among three components: regional identities, regionalizing morphogens, and polarizing morphogens. By incorporating these interactions within a growing framework, it is possible to generate shape changes and associated gene expression patterns according to particular hypotheses. The results can be compared with experimental observations of growth of normal and mutant forms, allowing further hypotheses and experiments to be formulated. We illustrate these principles with a study of snapdragon petal growth. PMID:14960734

  18. The spatiotemporal relationships between chondroitin sulfate proteoglycans and terminations of calcitonin gene related peptide and parvalbumin immunoreactive afferents in the spinal cord of mouse embryos.

    PubMed

    Wang, Liqing; Yu, Chao; Wang, Jun; Zhao, Hui; Chan, Sun-On

    2017-08-10

    Chondroitin sulfate (CS) proteoglycans (PGs) are a family of complex molecules in the extracellular matrix and cell surface that regulate axon growth and guidance during development of the central nervous system. In this study, the expression of CSPGs was investigated in the mouse spinal cord at late embryonic and neonatal stages using CS-56 antibody. CS immunoreactivity was observed abundantly in ventral regions of spinal cord of embryonic day (E) 15 embryos. At E16 to E18, CS expression spread dorsally, but never reached the superficial layers of the dorsal horn. This pattern was maintained until postnatal day 4, the latest stage examined. Antibodies against calcitonin gene related peptide (CGRP) and parvalbumin (PV) were employed to label primary afferents from nociceptors and proprioceptors, respectively. CGRP-immunoreactive fibers terminated in the superficial regions of the dorsal horn where CSPGs were weakly expressed, whereas PV-immunoreactive fibers were found in CSPG-rich regions in the ventral horn. Therefore, we conclude that CS expression is spatiotemporally regulated in the spinal cord, which correlates to the termination of sensory afferents. This pattern suggests a role of CSPGs on patterning afferents in the spinal cord, probably through a differential response of axons to these growth inhibitory molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Decreased capacity of recombinant 45/47-kDa molecules (Apa) of Mycobacterium tuberculosis to stimulate T lymphocyte responses related to changes in their mannosylation pattern.

    PubMed

    Horn, C; Namane, A; Pescher, P; Rivière, M; Romain, F; Puzo, G; Bârzu, O; Marchal, G

    1999-11-05

    The Apa molecules secreted by Mycobacterium tuberculosis, Mycobacterium bovis, or BCG have been identified as major immunodominant antigens. Mass spectrometry analysis indicated similar mannosylation, a complete pattern from 1 up to 9 hexose residues/mole of protein, of the native species from the 3 reference strains. The recombinant antigen expressed in M. smegmatis revealed a different mannosylation pattern: species containing 7 to 9 sugar residues/mole of protein were in the highest proportion, whereas species bearing a low number of sugar residues were almost absent. The 45/47-kDa recombinant antigen expressed in E. coli was devoid of sugar residues. The proteins purified from M. tuberculosis, M. bovis, or BCG have a high capacity to elicit in vivo potent delayed-type hypersensitivity (DTH) reactions and to stimulate in vitro sensitized T lymphocytes of guinea pigs immunized with living BCG. The recombinant Apa expressed in Mycobacterium smegmatis was 4-fold less potent in vivo in the DTH assay and 10-fold less active in vitro to stimulate sensitized T lymphocytes than the native proteins. The recombinant protein expressed in Escherichia coli was nearly unable to elicit DTH reactions in vivo or to stimulate T lymphocytes in vitro. Thus the observed biological effects were related to the extent of glycosylation of the antigen.

  20. Characterization of the expression patterns of LEAFY/FLORICAULA and NEEDLY orthologs in female and male cones of the conifer genera Picea, Podocarpus, and Taxus: implications for current evo-devo hypotheses for gymnosperms.

    PubMed

    Vázquez-Lobo, Alejandra; Carlsbecker, Annelie; Vergara-Silva, Francisco; Alvarez-Buylla, Elena R; Piñero, Daniel; Engström, Peter

    2007-01-01

    The identity of genes causally implicated in the development and evolutionary origin of reproductive characters in gymnosperms is largely unknown. Working within the framework of plant evolutionary developmental biology, here we have cloned, sequenced, performed phylogenetic analyses upon and tested the expression patterns of LEAFY/FLORICAULA and NEEDLY orthologs in reproductive structures from selected species of the conifer genera Picea, Podocarpus, and Taxus. Contrary to expectations based on previous assessments, expression of LFY/FLO and NLY in cones of these taxa was found to occur simultaneously in a single reproductive axis, initially overlapping but later in mutually exclusive primordia and/or groups of developing cells in both female and male structures. These observations directly affect the status of the "mostly male theory" for the origin of the angiosperm flower. On the other hand, comparative spatiotemporal patterns of the expression of these genes suggest a complex genetic regulatory network of cone development, as well as a scheme of functional divergence for LFY/FLO with respect to NLY homologs in gymnosperms, both with clear heterochronic aspects. Results presented in this study contribute to the understanding of the molecular-genetic basis of morphological evolution in conifer cones, and may aid in establishing a foundation for gymnosperm-specific, testable evo-devo hypotheses.

  1. Identification of Proteins Modulated in the Date Palm Stem Infested with Red Palm Weevil (Rhynchophorus ferrugineus Oliv.) Using Two Dimensional Differential Gel Electrophoresis and Mass Spectrometry

    PubMed Central

    Rasool, Khawaja Ghulam; Khan, Muhammad Altaf; Aldawood, Abdulrahman Saad; Tufail, Muhammad; Mukhtar, Muhammad; Takeda, Makio

    2015-01-01

    A state of the art proteomic methodology using Matrix Assisted Laser Desorption/Ionization-Time of Flight (MALDI TOF) has been employed to characterize peptides modulated in the date palm stem subsequent to infestation with red palm weevil (RPW). Our analyses revealed 32 differentially expressed peptides associated with RPW infestation in date palm stem. To identify RPW infestation associated peptides (I), artificially wounded plants (W) were used as additional control beside uninfested plants, a conventional control (C). A constant unique pattern of differential expression in infested (I), wounded (W) stem samples compared to control (C) was observed. The upregulated proteins showed relative fold intensity in order of I > W and downregulated spots trend as W > I, a quite interesting pattern. This study also reveals that artificially wounding of date palm stem affects almost the same proteins as infestation; however, relative intensity is quite lower than in infested samples both in up and downregulated spots. All 32 differentially expressed spots were subjected to MALDI-TOF analysis for their identification and we were able to match 21 proteins in the already existing databases. Relatively significant modulated expression pattern of a number of peptides in infested plants predicts the possibility of developing a quick and reliable molecular methodology for detecting plants infested with date palm. PMID:26287180

  2. Identification of Proteins Modulated in the Date Palm Stem Infested with Red Palm Weevil (Rhynchophorus ferrugineus Oliv.) Using Two Dimensional Differential Gel Electrophoresis and Mass Spectrometry.

    PubMed

    Rasool, Khawaja Ghulam; Khan, Muhammad Altaf; Aldawood, Abdulrahman Saad; Tufail, Muhammad; Mukhtar, Muhammad; Takeda, Makio

    2015-08-17

    A state of the art proteomic methodology using Matrix Assisted Laser Desorption/Ionization-Time of Flight (MALDI TOF) has been employed to characterize peptides modulated in the date palm stem subsequent to infestation with red palm weevil (RPW). Our analyses revealed 32 differentially expressed peptides associated with RPW infestation in date palm stem. To identify RPW infestation associated peptides (I), artificially wounded plants (W) were used as additional control beside uninfested plants, a conventional control (C). A constant unique pattern of differential expression in infested (I), wounded (W) stem samples compared to control (C) was observed. The upregulated proteins showed relative fold intensity in order of I > W and downregulated spots trend as W > I, a quite interesting pattern. This study also reveals that artificially wounding of date palm stem affects almost the same proteins as infestation; however, relative intensity is quite lower than in infested samples both in up and downregulated spots. All 32 differentially expressed spots were subjected to MALDI-TOF analysis for their identification and we were able to match 21 proteins in the already existing databases. Relatively significant modulated expression pattern of a number of peptides in infested plants predicts the possibility of developing a quick and reliable molecular methodology for detecting plants infested with date palm.

  3. Keep your opponents close: social context affects EEG and fEMG linkage in a turn-based computer game.

    PubMed

    Spapé, Michiel M; Kivikangas, J Matias; Järvelä, Simo; Kosunen, Ilkka; Jacucci, Giulio; Ravaja, Niklas

    2013-01-01

    In daily life, we often copy the gestures and expressions of those we communicate with, but recent evidence shows that such mimicry has a physiological counterpart: interaction elicits linkage, which is a concordance between the biological signals of those involved. To find out how the type of social interaction affects linkage, pairs of participants played a turn-based computer game in which the level of competition was systematically varied between cooperation and competition. Linkage in the beta and gamma frequency bands was observed in the EEG, especially when the participants played directly against each other. Emotional expression, measured using facial EMG, reflected this pattern, with the most competitive condition showing enhanced linkage over the facial muscle-regions involved in smiling. These effects were found to be related to self-reported social presence: linkage in positive emotional expression was associated with self-reported shared negative feelings. The observed effects confirmed the hypothesis that the social context affected the degree to which participants had similar reactions to their environment and consequently showed similar patterns of brain activity. We discuss the functional resemblance between linkage, as an indicator of a shared physiology and affect, and the well-known mirror neuron system, and how they relate to social functions like empathy.

  4. Pharmacoepigenomic responses of antipsychotic drugs on pharmacogenes are likely to be modulated by miRNAs.

    PubMed

    Swathy, Babu; Saradalekshmi, Koramannil R; Nair, Indu V; Nair, Chandrasekharan; Banerjee, Moinak

    2017-06-01

    It is imperative to differentiate the role of host epigenetics from pharmacoepigenetics in resolving therapeutic response. Therefore, the objective was to identify how antipsychotic drugs influence epigenetic response on pharmacogenes. The study design was based on in vitro evaluation of pharmacoepigenetic response of haloperidol, clozapine and olanzapine. Post antipsychotic treatment, the alterations in expression of ABCB1, CYP1A2 and CYP3A4 were monitored, and followed up by promoter methylation and their target miRNA expression studies. Critical observations were followed up in a restrictive clinical setting. Under in vitro conditions increased expression of ABCB1, CYP1A2 and CYP3A4 was observed which seems to be regulated by miR-27a and miR-128a and not by methylation. A similar pattern was observed in clinical setting with ABCB1, which was reflective of good therapeutic response. The study demonstrates that antipsychotic drugs can influence miRNA-mediated epigenetic response in pharmacogenes resulting in modulating therapeutic response.

  5. A vesicular glutamate transporter in lampreys: cDNA cloning and early expression in the nervous system.

    PubMed

    Villar-Cerviño, Verona; Rocancourt, Claire; Menuet, Arnaud; Da Silva, Corinne; Wincker, Patrick; Anadón, Ramón; Mazan, Sylvie; Rodicio, Maria Celina

    2010-09-01

    Vesicular glutamate transporters (VGLUTs) accumulate glutamate into synaptic vesicles of glutamatergic neurons, and thus are considered to define the phenotype of these neurons. Glutamate also appears to play a role in the development of the nervous system of vertebrates. Here we report the characterization of a vesicular glutamate transporter of lamprey (lVGluT), a novel member of the VGluT gene family. Phylogenetic analysis indicates that lVGLUT cannot be assigned to any of the three VGLUT isoforms characterized in teleosts and mammals, suggesting that these classes may have been fixed after the splitting between cyclostomes and gnathostomes. Expression pattern analysis during lamprey embryogenesis and prolarval stages shows that lVGluT expression is restricted to the nervous system. The first structure to express lVGluT was the olfactory epithelium of late embryos. In the brain of early prolarvae, lVGluT was expressed in most of the neuronal populations that generate the early axonal scaffold. lVGluT expression was also observed in neuronal populations of the rhombencephalon and spinal cord and in ganglia of the branchiomeric, octaval and posterior lateral line nerves. In the rhombencephalon, lVGluT expression appears to be spatially restricted in dorsal and ventral longitudinal domains. Comparison of the early expression of VGluT genes between the lamprey and some anamniotan gnathostomes (frog, zebrafish) reveals a conserved expression pattern, likely to reflect ancestral vertebrate characteristics. 2010 Elsevier B.V. All rights reserved.

  6. A Baculovirus Immediate-Early Gene, ie1, Promoter Drives Efficient Expression of a Transgene in Both Drosophila melanogaster and Bombyx mori

    PubMed Central

    Masumoto, Mika; Ohde, Takahiro; Shiomi, Kunihiro; Yaginuma, Toshinobu; Niimi, Teruyuki

    2012-01-01

    Many promoters have been used to drive expression of heterologous transgenes in insects. One major obstacle in the study of non-model insects is the dearth of useful promoters for analysis of gene function. Here, we investigated whether the promoter of the immediate-early gene, ie1, from the Bombyx mori nucleopolyhedrovirus (BmNPV) could be used to drive efficient transgene expression in a wide variety of insects. We used a piggyBac-based vector with a 3xP3-DsRed transformation marker to generate a reporter construct; this construct was used to determine the expression patterns driven by the BmNPV ie1 promoter; we performed a detailed investigation of the promoter in transgene expression pattern in Drosophila melanogaster and in B. mori. Drosophila and Bombyx belong to different insect orders (Diptera and Lepidoptera, respectively); however, and to our surprise, ie1 promoter-driven expression was evident in several tissues (e.g., prothoracic gland, midgut, and tracheole) in both insects. Furthermore, in both species, the ie1 promoter drove expression of the reporter gene from a relatively early embryonic stage, and strong ubiquitous ie1 promoter-driven expression continued throughout the larval, pupal, and adult stages by surface observation. Therefore, we suggest that the ie1 promoter can be used as an efficient expression driver in a diverse range of insect species. PMID:23152896

  7. Replication pattern of the pericentromeric region of chromosome 10q and expression of the RET protooncogene.

    PubMed

    Cinti, R; Schena, F; Passalacqua, M; Ceccherini, I; Ravazzolo, R

    2004-08-15

    Regulation of the RET gene is highly specific during embryo development and is strictly tissue-specific. Control of transcription depends on mechanisms influenced by epigenetic processes, in particular, histone acetylation at regions flanking the 5' end of the gene. Since the RET gene is mapped in the pericentromeric region of the human chromosome 10, the implication of epigenetic processes is even more striking and worth to be investigated in an extended chromosomal tract. One experimental approach to study the chromatin status in relationship with gene transcription is to assess the replication timing, which we did by using fluorescent in situ hybridization in cells expressing or not expressing the RET gene. By using probes spanning a 700-kb genomic region from the RET locus toward the centromere, we found a relationship between RET expression and early replication. Different patterns were observed between cells naturally expressing RET and cells induced to expression of RET by treatment with sodium butyrate, an inhibitor of histone deacetylases. Three-dimensional analysis of the nuclear localization of fluorescent signals by confocal microscopy showed difference of localization between the RET probe and a probe for a housekeeping gene, G3PDH, located at 12p13.3, in cells that do not express RET, in accordance with previous data for other genes and chromosomal regions. However, RET-expressing cells showed a localization of signals which was not consistent with that expected for expressed genes.

  8. Differential distribution of the sodium-activated potassium channels slick and slack in mouse brain.

    PubMed

    Rizzi, Sandra; Knaus, Hans-Günther; Schwarzer, Christoph

    2016-07-01

    The sodium-activated potassium channels Slick (Slo2.1, KCNT2) and Slack (Slo2.2, KCNT1) are high-conductance potassium channels of the Slo family. In neurons, Slick and Slack channels are involved in the generation of slow afterhyperpolarization, in the regulation of firing patterns, and in setting and stabilizing the resting membrane potential. The distribution and subcellular localization of Slick and Slack channels in the mouse brain have not yet been established in detail. The present study addresses this issue through in situ hybridization and immunohistochemistry. Both channels were widely distributed and exhibited distinct distribution patterns. However, in some brain regions, their expression overlapped. Intense Slick channel immunoreactivity was observed in processes, varicosities, and neuronal cell bodies of the olfactory bulb, granular zones of cortical regions, hippocampus, amygdala, lateral septal nuclei, certain hypothalamic and midbrain nuclei, and several regions of the brainstem. The Slack channel showed primarily a diffuse immunostaining pattern, and labeling of cell somata and processes was observed only occasionally. The highest Slack channel expression was detected in the olfactory bulb, lateral septal nuclei, basal ganglia, and distinct areas of the midbrain, brainstem, and cerebellar cortex. In addition, comparing our data obtained from mouse brain with a previously published study on rat brain revealed some differences in the expression and distribution of Slick and Slack channels in these species. J. Comp. Neurol. 524:2093-2116, 2016. © 2015 The Authors The Journal of Comparative Neurology Published by Wiley Periodicals, Inc. © 2015 The Authors The Journal of Comparative Neurology Published by Wiley Periodicals, Inc.

  9. Gene expression profiling of three different stressors in the water flea Daphnia magna.

    PubMed

    Jansen, Mieke; Vergauwen, Lucia; Vandenbrouck, Tine; Knapen, Dries; Dom, Nathalie; Spanier, Katina I; Cielen, Anke; De Meester, Luc

    2013-07-01

    Microarrays are an ideal tool to screen for differences in gene expression of thousands of genes simultaneously. However, often commercial arrays are not available. In this study, we performed microarray analyses to evaluate patterns of gene transcription following exposure to two natural and one anthropogenic stressor. cDNA microarrays compiled of three life stage specific and three stressor-specific EST libraries, yielding 1734 different EST sequences, were used. We exposed juveniles of the water flea Daphnia magna for 48, 96 and 144 h to three stressors known to exert strong selection in natural populations of this species i.e. a sublethal concentration of the pesticide carbaryl, infective spores of the endoparasite Pasteuria ramosa, and fish predation risk mimicked by exposure to fish kairomones. A total of 148 gene fragments were differentially expressed compared to the control. Based on a PCA, the exposure treatments were separated into two main groups based on the extent of the transcriptional response: a low and a high (144 h of fish or carbaryl exposure and 96 h of parasite exposure) stress group. Firstly, we observed a general stress-related transcriptional expression profile independent of the treatment characterized by repression of transcripts involved in transcription, translation, signal transduction and energy metabolism. Secondly, we observed treatment-specific responses including signs of migration to deeper water layers in response to fish predation, structural challenge of the cuticle in response to carbaryl exposure, and disturbance of the ATP production in parasite exposure. A third important conclusion is that transcription expression patterns exhibit stress-specific changes over time. Parasite exposure shows the most differentially expressed gene fragments after 96 h. The peak of differentially expressed transcripts came only after 144 h of fish exposure, while carbaryl exposure induced a more stable number of differently expressed gene fragments over time.

  10. Six commercially available angiotensin II AT1 receptor antibodies are non-specific.

    PubMed

    Benicky, Julius; Hafko, Roman; Sanchez-Lemus, Enrique; Aguilera, Greti; Saavedra, Juan M

    2012-11-01

    Commercially available Angiotensin II AT1 receptor antibodies are widely employed for receptor localization and quantification, but they have not been adequately validated. In this study, six commercially available AT1 receptor antibodies were characterized by established criteria: sc-1173 and sc-579 from Santa Cruz Biotechnology, Inc., AAR-011 from Alomone Labs, Ltd., AB15552 from Millipore, and ab18801 and ab9391 from Abcam. The immunostaining patterns observed were different for every antibody tested, and were unrelated to the presence or absence of AT1 receptors. The antibodies detected a 43 kDa band in western blots, corresponding to the predicted size of the native AT1 receptor. However, identical bands were observed in wild-type mice and in AT1A knock-out mice not expressing the target protein. Moreover, immunoreactivity detected in rat hypothalamic 4B cells not expressing AT1 receptors or transfected with AT1A receptor construct was identical, as revealed by western blotting and immunocytochemistry in cultured 4B cells. Additional prominent immunoreactive bands above and below 43 kDa were observed by western blotting in extracts from tissues of AT1A knock-out and wild-type mice and in 4B cells with or without AT1 receptor expression. In all cases, the patterns of immunoreactivity were independent of the AT1 receptor expression and different for each antibody studied. We conclude that, in our experimental setup, none of the commercially available AT1 receptor antibodies tested met the criteria for specificity and that competitive radioligand binding remains the only reliable approach to study AT1 receptor physiology in the absence of full antibody characterization.

  11. Six Commercially Available Angiotensin II AT1 Receptor Antibodies are Non-specific

    PubMed Central

    Benicky, Julius; Hafko, Roman; Sanchez-Lemus, Enrique; Aguilera, Greti

    2012-01-01

    Commercially available Angiotensin II AT1 receptor antibodies are widely employed for receptor localization and quantification, but they have not been adequately validated. In this study, six commercially available AT1 receptor antibodies were characterized by established criteria: sc-1173 and sc-579 from Santa Cruz Biotechnology, Inc., AAR-011 from Alomone Labs, Ltd., AB15552 from Millipore, and ab18801 and ab9391 from Abcam. The immunostaining patterns observed were different for every antibody tested, and were unrelated to the presence or absence of AT1 receptors. The antibodies detected a 43 kDa band in western blots, corresponding to the predicted size of the native AT1 receptor. However, identical bands were observed in wild-type mice and in AT1A knock-out mice not expressing the target protein. Moreover, immunoreactivity detected in rat hypothalamic 4B cells not expressing AT1 receptors or transfected with AT1A receptor construct was identical, as revealed by western blotting and immunocytochemistry in cultured 4B cells. Additional prominent immunoreactive bands above and below 43 kDa were observed by western blotting in extracts from tissues of AT1A knock-out and wild-type mice and in 4B cells with or without AT1 receptor expression. In all cases, the patterns of immunoreactivity were independent of the AT1 receptor expression and different for each antibody studied. We conclude that, in our experimental setup, none of the commercially available AT1 receptor antibodies tested met the criteria for specificity and that competitive radioligand binding remains the only reliable approach to study AT1 receptor physiology in the absence of full antibody characterization. PMID:22843099

  12. The Expression Pattern of microRNAs in Granulosa Cells of Subordinate and Dominant Follicles during the Early Luteal Phase of the Bovine Estrous Cycle

    PubMed Central

    Gebremedhn, Samuel; Sahadevan, Sudeep; Hossain, MD Munir; Rings, Franca; Hoelker, Michael; Tholen, Ernst; Neuhoff, Christiane; Looft, Christian; Schellander, Karl; Tesfaye, Dawit

    2014-01-01

    This study aimed to investigate the miRNA expression patterns in granulosa cells of subordinate (SF) and dominant follicle (DF) during the early luteal phase of the bovine estrous cycle. For this, miRNA enriched total RNA isolated from granulosa cells of SF and DF obtained from heifers slaughtered at day 3 and day 7 of the estrous cycle was used for miRNAs deep sequencing. The results revealed that including 17 candidate novel miRNAs, several known miRNAs (n = 291–318) were detected in SF and DF at days 3 and 7 of the estrous cycle of which 244 miRNAs were common to all follicle groups. The let-7 families, bta-miR-10b, bta-miR-26a, bta-miR-99b and bta-miR-27b were among abundantly expressed miRNAs in both SF and DF at both days of the estrous cycle. Further analysis revealed that the expression patterns of 16 miRNAs including bta-miR-449a, bta-miR-449c and bta-miR-222 were differentially expressed between the granulosa cells of SF and DF at day 3 of the estrous cycle. However, at day 7 of the estrous cycle, 108 miRNAs including bta-miR-409a, bta-miR-383 and bta-miR-184 were differentially expressed between the two groups of granulosa cell revealing the presence of distinct miRNA expression profile changes between the two follicular stages at day 7 than day 3 of the estrous cycle. In addition, unlike the SF, marked temporal miRNA expression dynamics was observed in DF groups between day 3 and 7 of the estrous cycle. Target gene prediction and pathway analysis revealed that major signaling associated with follicular development including Wnt signaling, TGF-beta signaling, oocyte meiosis and GnRH signaling were affected by differentially expressed miRNAs. Thus, this study highlights the miRNA expression patterns of granulosa cells in subordinate and dominant follicles that could be associated with follicular recruitment, selection and dominance during the early luteal phase of the bovine estrous cycle. PMID:25192015

  13. Dynamic patterning by the Drosophila pair-rule network reconciles long-germ and short-germ segmentation

    PubMed Central

    2017-01-01

    Drosophila segmentation is a well-established paradigm for developmental pattern formation. However, the later stages of segment patterning, regulated by the “pair-rule” genes, are still not well understood at the system level. Building on established genetic interactions, I construct a logical model of the Drosophila pair-rule system that takes into account the demonstrated stage-specific architecture of the pair-rule gene network. Simulation of this model can accurately recapitulate the observed spatiotemporal expression of the pair-rule genes, but only when the system is provided with dynamic “gap” inputs. This result suggests that dynamic shifts of pair-rule stripes are essential for segment patterning in the trunk and provides a functional role for observed posterior-to-anterior gap domain shifts that occur during cellularisation. The model also suggests revised patterning mechanisms for the parasegment boundaries and explains the aetiology of the even-skipped null mutant phenotype. Strikingly, a slightly modified version of the model is able to pattern segments in either simultaneous or sequential modes, depending only on initial conditions. This suggests that fundamentally similar mechanisms may underlie segmentation in short-germ and long-germ arthropods. PMID:28953896

  14. Comparative interrogation of the developing xylem transcriptomes of two wood-forming species: Populus trichocarpa and Eucalyptus grandis.

    PubMed

    Hefer, Charles A; Mizrachi, Eshchar; Myburg, Alexander A; Douglas, Carl J; Mansfield, Shawn D

    2015-06-01

    Wood formation is a complex developmental process governed by genetic and environmental stimuli. Populus and Eucalyptus are fast-growing, high-yielding tree genera that represent ecologically and economically important species suitable for generating significant lignocellulosic biomass. Comparative analysis of the developing xylem and leaf transcriptomes of Populus trichocarpa and Eucalyptus grandis together with phylogenetic analyses identified clusters of homologous genes preferentially expressed during xylem formation in both species. A conserved set of 336 single gene pairs showed highly similar xylem preferential expression patterns, as well as evidence of high functional constraint. Individual members of multi-gene orthologous clusters known to be involved in secondary cell wall biosynthesis also showed conserved xylem expression profiles. However, species-specific expression as well as opposite (xylem versus leaf) expression patterns observed for a subset of genes suggest subtle differences in the transcriptional regulation important for xylem development in each species. Using sequence similarity and gene expression status, we identified functional homologs likely to be involved in xylem developmental and biosynthetic processes in Populus and Eucalyptus. Our study suggests that, while genes involved in secondary cell wall biosynthesis show high levels of gene expression conservation, differential regulation of some xylem development genes may give rise to unique xylem properties. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  15. Gene expression platform for synthetic biology in the human pathogen Streptococcus pneumoniae.

    PubMed

    Sorg, Robin A; Kuipers, Oscar P; Veening, Jan-Willem

    2015-03-20

    The human pathogen Streptococcus pneumoniae (pneumococcus) is a bacterium that owes its success to complex gene expression regulation patterns on both the cellular and the population level. Expression of virulence factors enables a mostly hazard-free presence of the commensal, in balance with the host and niche competitors. Under specific circumstances, changes in this expression can result in a more aggressive behavior and the reversion to the invasive form as pathogen. These triggering conditions are very difficult to study due to the fact that environmental cues are often unknown or barely possible to simulate outside the host (in vitro). An alternative way of investigating expression patterns is found in synthetic biology approaches of reconstructing regulatory networks that mimic an observed behavior with orthogonal components. Here, we created a genetic platform suitable for synthetic biology approaches in S. pneumoniae and characterized a set of standardized promoters and reporters. We show that our system allows for fast and easy cloning with the BglBrick system and that reliable and robust gene expression after integration into the S. pneumoniae genome is achieved. In addition, the cloning system was extended to allow for direct linker-based assembly of ribosome binding sites, peptide tags, and fusion proteins, and we called this new generally applicable standard "BglFusion". The gene expression platform and the methods described in this study pave the way for employing synthetic biology approaches in S. pneumoniae.

  16. The murine homeobox gene Msx-3 shows highly restricted expression in the developing neural tube.

    PubMed

    Shimeld, S M; McKay, I J; Sharpe, P T

    1996-04-01

    The mouse homeobox-genes Msx-1 and Msx-2 are expressed in several areas of the developing embryo, including the neural tube, neural crest, facial processes and limb buds. Here we report the characterisation of a third mouse Msx gene, which we designate Msx-3. The embryonic expression of Msx-3 was found to differ from that of Msx-1 and -2 in that it was confined to the dorsal neural tube. In embryos with 5-8 somites a segmental pattern of expression was observed in the hindbrain, with rhombomeres 3 and 5 lacking Msx-3 while other rhombomeres expressed Msx-3. This pattern was transient, however, such that in embryos with 18 or more somites expression was continuous throughout the dorsal hindbrain and anterior dorsal spinal cord. Differentiation of dorsal cell types in the neural tube can be induced by addition of members of the Tgf-beta family. Additionally, Msx-1 and -2 have been shown to be activated by addition of the Tgf-beta family member Bmp-4. To determine if Bmp-4 could activate Msx-3, we incubated embryonic hindbrain explants with exogenous Bmp-4. The dorsal expression of Msx-3 was seen to expand into more ventral regions of the neurectoderm in Bmp-4-treated cultures, implying that Bmp-4 may be able to mimic an in vivo signal that induces Msx-3.

  17. Hidden among the crowd: differential DNA methylation-expression correlations in cancer occur at important oncogenic pathways

    PubMed Central

    Mosquera Orgueira, Adrián

    2015-01-01

    DNA methylation is a frequent epigenetic mechanism that participates in transcriptional repression. Variations in DNA methylation with respect to gene expression are constant, and, for unknown reasons, some genes with highly methylated promoters are sometimes overexpressed. In this study we have analyzed the expression and methylation patterns of thousands of genes in five groups of cancer and normal tissue samples in order to determine local and genome-wide differences. We observed significant changes in global methylation-expression correlation in all the neoplasms, which suggests that differential correlation events are frequent in cancer. A focused analysis in the breast cancer cohort identified 1662 genes whose correlation varies significantly between normal and cancerous breast, but whose DNA methylation and gene expression patterns do not change substantially. These genes were enriched in cancer-related pathways and repressive chromatin features across various model cell lines, such as PRC2 binding and H3K27me3 marks. Substantial changes in methylation-expression correlation indicate that these genes are subject to epigenetic remodeling, where the differential activity of other factors break the expected relationship between both variables. Our findings suggest a complex regulatory landscape where a redistribution of local and large-scale chromatin repressive domains at differentially correlated genes (DCGs) creates epigenetic hotspots that modulate cancer-specific gene expression. PMID:26029238

  18. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    PubMed

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine

    2014-01-01

    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  19. Specific Duplication and Dorsoventrally Asymmetric Expression Patterns of Cycloidea-Like Genes in Zygomorphic Species of Ranunculaceae

    PubMed Central

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine

    2014-01-01

    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture. PMID:24752428

  20. Learning multiple variable-speed sequences in striatum via cortical tutoring.

    PubMed

    Murray, James M; Escola, G Sean

    2017-05-08

    Sparse, sequential patterns of neural activity have been observed in numerous brain areas during timekeeping and motor sequence tasks. Inspired by such observations, we construct a model of the striatum, an all-inhibitory circuit where sequential activity patterns are prominent, addressing the following key challenges: (i) obtaining control over temporal rescaling of the sequence speed, with the ability to generalize to new speeds; (ii) facilitating flexible expression of distinct sequences via selective activation, concatenation, and recycling of specific subsequences; and (iii) enabling the biologically plausible learning of sequences, consistent with the decoupling of learning and execution suggested by lesion studies showing that cortical circuits are necessary for learning, but that subcortical circuits are sufficient to drive learned behaviors. The same mechanisms that we describe can also be applied to circuits with both excitatory and inhibitory populations, and hence may underlie general features of sequential neural activity pattern generation in the brain.

  1. Segmentation of the zebrafish axial skeleton relies on notochord sheath cells and not on the segmentation clock

    PubMed Central

    Lleras Forero, Laura; Narayanan, Rachna; Huitema, Leonie FA; VanBergen, Maaike; Apschner, Alexander; Peterson-Maduro, Josi; Logister, Ive; Valentin, Guillaume

    2018-01-01

    Segmentation of the axial skeleton in amniotes depends on the segmentation clock, which patterns the paraxial mesoderm and the sclerotome. While the segmentation clock clearly operates in teleosts, the role of the sclerotome in establishing the axial skeleton is unclear. We severely disrupt zebrafish paraxial segmentation, yet observe a largely normal segmentation process of the chordacentra. We demonstrate that axial entpd5+ notochord sheath cells are responsible for chordacentrum mineralization, and serve as a marker for axial segmentation. While autonomous within the notochord sheath, entpd5 expression and centrum formation show some plasticity and can respond to myotome pattern. These observations reveal for the first time the dynamics of notochord segmentation in a teleost, and are consistent with an autonomous patterning mechanism that is influenced, but not determined by adjacent paraxial mesoderm. This behavior is not consistent with a clock-type mechanism in the notochord. PMID:29624170

  2. Advances in Measurement of Skin Friction in Airflow

    NASA Technical Reports Server (NTRS)

    Brown, James L.; Naughton, Jonathan W.

    2006-01-01

    The surface interferometric skin-friction (SISF) measurement system is an instrument for determining the distribution of surface shear stress (skin friction) on a wind-tunnel model. The SISF system utilizes the established oil-film interference method, along with advanced image-data-processing techniques and mathematical models that express the relationship between interferograms and skin friction, to determine the distribution of skin friction over an observed region of the surface of a model during a single wind-tunnel test. In the oil-film interference method, a wind-tunnel model is coated with a thin film of oil of known viscosity and is illuminated with quasi-monochromatic, collimated light, typically from a mercury lamp. The light reflected from the outer surface of the oil film interferes with the light reflected from the oil-covered surface of the model. In the present version of the oil-film interference method, a camera captures an image of the illuminated model and the image in the camera is modulated by the interference pattern. The interference pattern depends on the oil-thickness distribution on the observed surface, and this distribution can be extracted through analysis of the image acquired by the camera. The oil-film technique is augmented by a tracer technique for observing the streamline pattern. To make the streamlines visible, small dots of fluorescentchalk/oil mixture are placed on the model just before a test. During the test, the chalk particles are embedded in the oil flow and produce chalk streaks that mark the streamlines. The instantaneous rate of thinning of the oil film at a given position on the surface of the model can be expressed as a function of the instantaneous thickness, the skin-friction distribution on the surface, and the streamline pattern on the surface; the functional relationship is expressed by a mathematical model that is nonlinear in the oil-film thickness and is known simply as the thin-oil-film equation. From the image data acquired as described, the time-dependent oil-thickness distribution and streamline pattern are extracted and by inversion of the thin-oil-film equation it is then possible to determine the skin-friction distribution. In addition to a quasi-monochromatic light source, the SISF system includes a beam splitter and two video cameras equipped with filters for observing the same area on a model in different wavelength ranges, plus a frame grabber and a computer for digitizing the video images and processing the image data. One video camera acquires the interference pattern in a narrow wavelength range of the quasi-monochromatic source. The other video camera acquires the streamline image of fluorescence from the chalk in a nearby but wider wavelength range. The interference- pattern and fluorescence images are digitized, and the resulting data are processed by an algorithm that inverts the thin-oil-film equation to find the skin-friction distribution.

  3. Isoform-level gene expression patterns in single-cell RNA-sequencing data.

    PubMed

    Vu, Trung Nghia; Wills, Quin F; Kalari, Krishna R; Niu, Nifang; Wang, Liewei; Pawitan, Yudi; Rantalainen, Mattias

    2018-02-27

    RNA sequencing of single cells enables characterization of transcriptional heterogeneity in seemingly homogeneous cell populations. Single-cell sequencing has been applied in a wide range of researches fields. However, few studies have focus on characterization of isoform-level expression patterns at the single-cell level. In this study we propose and apply a novel method, ISOform-Patterns (ISOP), based on mixture modeling, to characterize the expression patterns of isoform pairs from the same gene in single-cell isoform-level expression data. We define six principal patterns of isoform expression relationships and describe a method for differential-pattern analysis. We demonstrate ISOP through analysis of single-cell RNA-sequencing data from a breast cancer cell line, with replication in three independent datasets. We assigned the pattern types to each of 16,562 isoform-pairs from 4,929 genes. Among those, 26% of the discovered patterns were significant (p<0.05), while remaining patterns are possibly effects of transcriptional bursting, drop-out and stochastic biological heterogeneity. Furthermore, 32% of genes discovered through differential-pattern analysis were not detected by differential-expression analysis. The effect of drop-out events, mean expression level, and properties of the expression distribution on the performances of ISOP were also investigated through simulated datasets. To conclude, ISOP provides a novel approach for characterization of isoformlevel preference, commitment and heterogeneity in single-cell RNA-sequencing data. The ISOP method has been implemented as a R package and is available at https://github.com/nghiavtr/ISOP under a GPL-3 license. mattias.rantalainen@ki.se. Supplementary data are available at Bioinformatics online.

  4. Fashioning the Face: Sensorimotor Simulation Contributes to Facial Expression Recognition.

    PubMed

    Wood, Adrienne; Rychlowska, Magdalena; Korb, Sebastian; Niedenthal, Paula

    2016-03-01

    When we observe a facial expression of emotion, we often mimic it. This automatic mimicry reflects underlying sensorimotor simulation that supports accurate emotion recognition. Why this is so is becoming more obvious: emotions are patterns of expressive, behavioral, physiological, and subjective feeling responses. Activation of one component can therefore automatically activate other components. When people simulate a perceived facial expression, they partially activate the corresponding emotional state in themselves, which provides a basis for inferring the underlying emotion of the expresser. We integrate recent evidence in favor of a role for sensorimotor simulation in emotion recognition. We then connect this account to a domain-general understanding of how sensory information from multiple modalities is integrated to generate perceptual predictions in the brain. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. FoxP2 expression in the cerebellum and inferior olive: development of the transverse stripe-shaped expression pattern in the mouse cerebellar cortex.

    PubMed

    Fujita, Hirofumi; Sugihara, Izumi

    2012-02-15

    Many molecules are expressed heterogeneously in subpopulations of cerebellar Purkinje cells (PCs) and inferior olive (IO) neurons during development or in adulthood. These expression patterns are often organized in longitudinal stripes in the cerebellar cortex, which may be related to functional compartmentalization. FoxP2, a transcription factor, is expressed in PCs and IO neurons, but the details of its expression pattern remain unclear. Here we examined FoxP2 expression patterns systematically by immunostaining serial sections of the hindbrain from embryonic day 14.5 to adulthood in mice. FoxP2 was highly expressed in virtually all PCs at and before postnatal day 6 (P6), except for those in the flocculus and small parts of the nodulus (vermal lobule X), where FoxP2 expression was moderate or absent. After P6, FoxP2 expression gradually diminished in PCs in some areas. In adults, FoxP2 was expressed, less intensely than in earlier stages, in subsets of PCs that were mostly arranged transversely along the folial apices. In contrast, FoxP2 was expressed intensely in most IO neurons during development and in adulthood. FoxP2 was also expressed in a small population of neurons in the cerebellar nuclei. FoxP2 expression in adult rats and chicks was generally comparable to that in adult mice, suggesting evolutionary conservation of the expression pattern. Thus, the FoxP2 expression pattern reflects new transverse compartmentalization in the adult cerebellar cortex, although its functional significance remains unclear. Copyright © 2011 Wiley-Liss, Inc.

  6. The Na, K-ATPase β-Subunit Isoforms Expression in Glioblastoma Multiforme: Moonlighting Roles

    PubMed Central

    Rotoli, Deborah; Cejas, Mariana-Mayela; Maeso, María-del-Carmen; Pérez-Rodríguez, Natalia-Dolores; Morales, Manuel; Ávila, Julio

    2017-01-01

    Glioblastoma multiforme (GBM) is the most common form of malignant glioma. Recent studies point out that gliomas exploit ion channels and transporters, including Na, K-ATPase, to sustain their singular growth and invasion as they invade the brain parenchyma. Moreover, the different isoforms of the β-subunit of Na, K-ATPase have been implicated in regulating cellular dynamics, particularly during cancer progression. The aim of this study was to determine the Na, K-ATPase β subunit isoform subcellular expression patterns in all cell types responsible for microenvironment heterogeneity of GBM using immunohistochemical analysis. All three isoforms, β1, β2/AMOG (Adhesion Molecule On Glia) and β3, were found to be expressed in GBM samples. Generally, β1 isoform was not expressed by astrocytes, in both primary and secondary GBM, although other cell types (endothelial cells, pericytes, telocytes, macrophages) did express this isoform. β2/AMOG and β3 positive expression was observed in the cytoplasm, membrane and nuclear envelope of astrocytes and GFAP (Glial Fibrillary Acidic Protein) negative cells. Interestingly, differences in isoforms expression have been observed between primary and secondary GBM: in secondary GBM, β2 isoform expression in astrocytes was lower than that observed in primary GBM, while the expression of the β3 subunit was more intense. These changes in β subunit isoforms expression in GBM could be related to a different ionic handling, to a different relationship between astrocyte and neuron (β2/AMOG) and to changes in the moonlighting roles of Na, K-ATPase β subunits as adaptor proteins and transcription factors. PMID:29117147

  7. Regulation of dietary glutamine on the growth, intestinal function, immunity and antioxidant capacity of sea cucumber Apostichopus japonicus (Selenka).

    PubMed

    Yu, Haibo; Gao, Qinfeng; Dong, Shuanglin; Lan, Ying; Ye, Zhi; Wen, Bin

    2016-03-01

    The present study examined the effects of dietary glutamine (Gln) on the growth, intestinal function, immunity and antioxidant capacity of sea cucumber Apostichopus japonicus (Selenka). The specific growth rate, intestinal morphology, activity of digestive enzymes, activity and gene expression of lysozyme and antioxidative enzymes of the sea cucumbers were determined after feeding 5 experimental diets with additions of increasing levels of Gln (at 0%, 0.4%, 0.8%,1.2% and 1.6%, respectively) for 60 days. We discovered that the specific growth rate of the sea cucumbers in 0.4%, 0.8% and 1.2% groups increased 35.3%, 27.3% and 24.1%, respectively, compared to the control (0%) group with significant differences. Dietary Gln can improve the intestinal function of the sea cucumbers by increasing the activities of trypsin and lipase in the intestine and the villus height and villus density of the intestine, eventhough significant differences were not observed in some groups. 0.4%-0.8% of dietary Gln can significantly increase the activity of lysozyme (LSZ) in the coelomic fluid of the sea cucumbers. Significant improvements were observed on the SOD activity in coelomic fluid of the sea cucumbers fed diets supplemented with 0.4%-1.6% of Gln compared to the control group. Similarly, the CAT activity in coelomic fluid of the sea cucumbers significantly increased in 0.8%, 1.2% and 1.6% groups compared to the control and 0.4% groups. Change pattern of the activity of CAT was consistent with the change pattern of the expression of CAT gene, indicating the dietary Gln can up-regulate the expression of CAT gene and consequently promote the secretion of CAT. However, the down-regulation of the expression of SOD gene by dietary Gln were observed in almost all of the treatment groups, which is in contrast with the change pattern of the activity of SOD, indicating the negative feedback regulation of the secretion of SOD on the expression of SOD gene. In summary, the suitable supplementation levels of Gln in diets of sea cucumber A. japonicus are 0.4%-0.8%, based on the effectiveness of dietary Gln on the growth, intestinal function, immunity and antioxidant capacity of the sea cucumbers. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Overlapping expression patterns and functions of three paralogous P5B ATPases in Caenorhabditis elegans.

    PubMed

    Zielich, Jeffrey; Tzima, Elena; Schröder, Eva Ayla; Jemel, Faten; Conradt, Barbara; Lambie, Eric J

    2018-01-01

    P5B ATPases are present in the genomes of diverse unicellular and multicellular eukaryotes, indicating that they have an ancient origin, and that they are important for cellular fitness. Inactivation of ATP13A2, one of the four human P5B ATPases, leads to early-onset Parkinson's disease (Kufor-Rakeb Syndrome). The presence of an invariant PPALP motif within the putative substrate interaction pocket of transmembrane segment M4 suggests that all P5B ATPases might have similar transport specificity; however, the identity of the transport substrate(s) remains unknown. Nematodes of the genus Caenorhabditis possess three paralogous P5B ATPase genes, catp-5, catp-6 and catp-7, which probably originated from a single ancestral gene around the time of origin of the Caenorhabditid clade. By using CRISPR/Cas9, we have systematically investigated the expression patterns, subcellular localization and biological functions of each of the P5B ATPases of C. elegans. We find that each gene has a unique expression pattern, and that some tissues express more than one P5B. In some tissues where their expression patterns overlap, different P5Bs are targeted to different subcellular compartments (e.g., early endosomes vs. plasma membrane), whereas in other tissues they localize to the same compartment (plasma membrane). We observed lysosomal co-localization between CATP-6::GFP and LMP-1::RFP in transgenic animals; however, this was an artifact of the tagged LMP-1 protein, since anti-LMP-1 antibody staining of native protein revealed that LMP-1 and CATP-6::GFP occupy different compartments. The nematode P5Bs are at least partially redundant, since we observed synthetic sterility in catp-5(0); catp-6(0) and catp-6(0) catp-7(0) double mutants. The double mutants exhibit defects in distal tip cell migration that resemble those of ina-1 (alpha integrin ortholog) and vab-3 (Pax6 ortholog) mutants, suggesting that the nematode P5Bs are required for ina-1and/or vab-3 function. This is potentially a conserved regulatory interaction, since mammalian ATP13A2, alpha integrin and Pax6 are all required for proper dopaminergic neuron function.

  9. Overlapping expression patterns and functions of three paralogous P5B ATPases in Caenorhabditis elegans

    PubMed Central

    Zielich, Jeffrey; Tzima, Elena; Schröder, Eva Ayla; Jemel, Faten; Conradt, Barbara

    2018-01-01

    P5B ATPases are present in the genomes of diverse unicellular and multicellular eukaryotes, indicating that they have an ancient origin, and that they are important for cellular fitness. Inactivation of ATP13A2, one of the four human P5B ATPases, leads to early-onset Parkinson’s disease (Kufor-Rakeb Syndrome). The presence of an invariant PPALP motif within the putative substrate interaction pocket of transmembrane segment M4 suggests that all P5B ATPases might have similar transport specificity; however, the identity of the transport substrate(s) remains unknown. Nematodes of the genus Caenorhabditis possess three paralogous P5B ATPase genes, catp-5, catp-6 and catp-7, which probably originated from a single ancestral gene around the time of origin of the Caenorhabditid clade. By using CRISPR/Cas9, we have systematically investigated the expression patterns, subcellular localization and biological functions of each of the P5B ATPases of C. elegans. We find that each gene has a unique expression pattern, and that some tissues express more than one P5B. In some tissues where their expression patterns overlap, different P5Bs are targeted to different subcellular compartments (e.g., early endosomes vs. plasma membrane), whereas in other tissues they localize to the same compartment (plasma membrane). We observed lysosomal co-localization between CATP-6::GFP and LMP-1::RFP in transgenic animals; however, this was an artifact of the tagged LMP-1 protein, since anti-LMP-1 antibody staining of native protein revealed that LMP-1 and CATP-6::GFP occupy different compartments. The nematode P5Bs are at least partially redundant, since we observed synthetic sterility in catp-5(0); catp-6(0) and catp-6(0) catp-7(0) double mutants. The double mutants exhibit defects in distal tip cell migration that resemble those of ina-1 (alpha integrin ortholog) and vab-3 (Pax6 ortholog) mutants, suggesting that the nematode P5Bs are required for ina-1and/or vab-3 function. This is potentially a conserved regulatory interaction, since mammalian ATP13A2, alpha integrin and Pax6 are all required for proper dopaminergic neuron function. PMID:29547664

  10. Brain-Derived Neurotrophic Factor Expression in Individuals With Schizophrenia and Healthy Aging: Testing the Accelerated Aging Hypothesis of Schizophrenia.

    PubMed

    Islam, Farhana; Mulsant, Benoit H; Voineskos, Aristotle N; Rajji, Tarek K

    2017-07-01

    Schizophrenia has been hypothesized to be a syndrome of accelerated aging. Brain plasticity is vulnerable to the normal aging process and affected in schizophrenia: brain-derived neurotrophic factor (BDNF) is an important neuroplasticity molecule. The present review explores the accelerated aging hypothesis of schizophrenia by comparing changes in BDNF expression in schizophrenia with aging-associated changes. Individuals with schizophrenia show patterns of increased overall mortality, metabolic abnormalities, and cognitive decline normally observed later in life in the healthy population. An overall decrease is observed in BDNF expression in schizophrenia compared to healthy controls and in older individuals compared to a younger cohort. There is a marked decrease in BDNF levels in the frontal regions and in the periphery among older individuals and those with schizophrenia; however, data for BDNF expression in the occipital, parietal, and temporal cortices and the hippocampus is inconclusive. Accelerated aging hypothesis is supported based on frontal regions and peripheral studies; however, further studies are needed in other brain regions.

  11. Paternal low protein diet programs preimplantation embryo gene expression, fetal growth and skeletal development in mice.

    PubMed

    Watkins, Adam J; Sirovica, Slobodan; Stokes, Ben; Isaacs, Mark; Addison, Owen; Martin, Richard A

    2017-06-01

    Defining the mechanisms underlying the programming of early life growth is fundamental for improving adult health and wellbeing. While the association between maternal diet, offspring growth and adult disease risk is well-established, the effect of father's diet on offspring development is largely unknown. Therefore, we fed male mice an imbalanced low protein diet (LPD) to determine the impact on post-fertilisation development and fetal growth. We observed that in preimplantation embryos derived from LPD fed males, expression of multiple genes within the central metabolic AMPK pathway was reduced. In late gestation, paternal LPD programmed increased fetal weight, however, placental weight was reduced, resulting in an elevated fetal:placental weight ratio. Analysis of gene expression patterns revealed increased levels of transporters for calcium, amino acids and glucose within LPD placentas. Furthermore, placental expression of the epigenetic regulators Dnmt1 and Dnmt3L were increased also, coinciding with altered patterns of maternal and paternal imprinted genes. More strikingly, we observed fetal skeletal development was perturbed in response to paternal LPD. Here, while offspring of LPD fed males possessed larger skeletons, their bones comprised lower volumes of high mineral density in combination with reduced maturity of bone apatite. These data offer new insight in the underlying programming mechanisms linking poor paternal diet at the time of conception with the development and growth of his offspring. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Structural and affinity studies of IgM polyreactive natural autoantibodies.

    PubMed

    Diaw, L; Magnac, C; Pritsch, O; Buckle, M; Alzari, P M; Dighiero, G

    1997-01-15

    Natural polyreactive autoantibodies (NAA) are an important component of the normal B cell repertoire. One intriguing characteristic of these Abs is their binding to various dissimilar Ags. It has been generally assumed that these Abs bind the Ags with low affinity, and are encoded by germline genes. We have used surface plasmon resonance to determine binding of avidities, and conducted a structural analysis of five murine monoclonal natural autoantibodies displaying a typical polyreactive binding pattern against cytoskeleton Ags and DNA. We show that 1) all the five Abs bind the different Ags with kinetic constants similar to those observed for immune Abs; 2) they express a restricted set of V(H) and V(L) genes, since the same V(H) gene is expressed by three out of the five, and one particular Vkappa gene was expressed twice. In addition, a single D gene segment was used by three of the five Abs; and 3) they express, in most cases, genes in a close germline configuration. Our amino acid sequence and modeling studies show that the distribution of exposed side chains in the NAA paratopes is close to the general pattern observed in the complementarity-determining regions (CDRs) of variable domains from immune Abs. Although CDR3 regions of the heavy chain have been postulated to play a major role in determining polyreactivity on the basis of recombinatorial experiments, our results failed to show any distinctive particularity of this region in terms of length or charge when compared with classical immune Abs.

  13. Patterns of gene expression reveal a temporally orchestrated wound healing response in the injured spinal cord.

    PubMed

    Velardo, Margaret J; Burger, Corinna; Williams, Philip R; Baker, Henry V; López, M Cecilia; Mareci, Thomas H; White, Todd E; Muzyczka, Nicholas; Reier, Paul J

    2004-09-29

    Spinal cord injury (SCI) induces a progressive pathophysiology affecting cell survival and neurological integrity via complex and evolving molecular cascades whose interrelationships are not fully understood. The present experiments were designed to: (1) determine potential functional interactions within transcriptional expression profiles obtained after a clinically relevant SCI and (2) test the consistency of transcript expression after SCI in two genetically and immunologically diverse rat strains characterized by differences in T cell competence and associated inflammatory responses. By interrogating Affymetrix U34A rat genome GeneChip microarrays, we defined the transcriptional expression patterns in midcervical contusion lesion sites between 1 and 90 d postinjury of athymic nude (AN) and Sprague Dawley (SD) strains. Stringent statistical analyses detected significant changes in 3638 probe sets, with 80 genes differing between the AN and SD groups. Subsequent detailed functional categorization of these transcripts unveiled an overall tissue remodeling response that was common to both strains. The functionally organized gene profiles were temporally distinct and correlated with repair indices observed microscopically and by magnetic resonance microimaging. Our molecular and anatomical observations have identified a novel, longitudinal perspective of the post-SCI response, namely, that of a highly orchestrated tissue repair and remodeling repertoire with a prominent cutaneous wound healing signature that is conserved between two widely differing rat strains. These results have significant bearing on the continuing development of cellular and pharmacological therapeutics directed at tissue rescue and neuronal regeneration in the injured spinal cord.

  14. Gene expression underlying adaptive variation in Heliconius wing patterns: non-modular regulation of overlapping cinnabar and vermilion prepatterns.

    PubMed

    Reed, Robert D; McMillan, W Owen; Nagy, Lisa M

    2008-01-07

    Geographical variation in the mimetic wing patterns of the butterfly Heliconius erato is a textbook example of adaptive polymorphism; however, little is known about how this variation is controlled developmentally. Using microarrays and qPCR, we identified and compared expression of candidate genes potentially involved with a red/yellow forewing band polymorphism in H. erato. We found that transcripts encoding the pigment synthesis enzymes cinnabar and vermilion showed pattern- and polymorphism-related expression patterns, respectively. cinnabar expression was associated with the forewing band regardless of pigment colour, providing the first gene expression pattern known to be correlated with a major Heliconius colour pattern. In contrast, vermilion expression changed spatially over time in red-banded butterflies, but was not expressed at detectable levels in yellow-banded butterflies, suggesting that regulation of this gene may be involved with the red/yellow polymorphism. Furthermore, we found that the yellow pigment, 3-hydroxykynurenine, is incorporated into wing scales from the haemolymph rather than being synthesized in situ. We propose that some aspects of Heliconius colour patterns are determined by spatio-temporal overlap of pigment gene transcription prepatterns and speculate that evolutionary changes in vermilion regulation may in part underlie an adaptive colour pattern polymorphism.

  15. Impact of intratumoural heterogeneity on the assessment of Ki67 expression in breast cancer.

    PubMed

    Aleskandarany, M A; Green, A R; Ashankyty, I; Elmouna, A; Diez-Rodriguez, M; Nolan, C C; Ellis, I O; Rakha, E A

    2016-07-01

    In breast cancer (BC), the prognostic value of Ki67 expression is well-documented. Intratumoural heterogeneity (ITH) of Ki67 expression is amongst the several technical issues behind the lag of its inclusion into BC prognostic work-up. The immunohistochemical (IHC) expression of anti-Ki67 antibody (MIB1 clone) was assessed in four full-face (FF) sections from different primary tumour blocks and their matched axillary nodal (LN) metastases in a series of 55 BC. Assessment was made using the highest expression hot spots (HS), lowest expression (LS), and overall/average expression scores (AS) in each section. Heterogeneity score (Hes), co-efficient of variation, and correlation co-efficient were used to assess the levels of Ki67 ITH. Ki67 HS, LS, and AS scores were highly variable within the same section and between different sections of the primary tumour, with maximal variation observed in the LS (P < 0.001). The least variability between the different slides was observed with HS scoring. Although the associations between Ki67 and clinicopathological and molecular variables were similar when using HS or AS, the best correlation between AS and HS was observed in tumours with high Ki67 expression only. Ki67 expression in LN deposits was less heterogeneous than in the primary tumours and was perfectly correlated with the HS Ki67 expression in the primary tumour sections (r = 0.98, P < 0.001). In conclusion, assessment of Ki67 expression using HS scoring method on a full-face BC tissue section can represent the primary tumour growth fraction that is likely to metastasise. The association between Ki67 expression pattern in the LN metastasis and the HS in the primary tumour may reflect the temporal heterogeneity through clonal expansion.

  16. GEsture: an online hand-drawing tool for gene expression pattern search.

    PubMed

    Wang, Chunyan; Xu, Yiqing; Wang, Xuelin; Zhang, Li; Wei, Suyun; Ye, Qiaolin; Zhu, Youxiang; Yin, Hengfu; Nainwal, Manoj; Tanon-Reyes, Luis; Cheng, Feng; Yin, Tongming; Ye, Ning

    2018-01-01

    Gene expression profiling data provide useful information for the investigation of biological function and process. However, identifying a specific expression pattern from extensive time series gene expression data is not an easy task. Clustering, a popular method, is often used to classify similar expression genes, however, genes with a 'desirable' or 'user-defined' pattern cannot be efficiently detected by clustering methods. To address these limitations, we developed an online tool called GEsture. Users can draw, or graph a curve using a mouse instead of inputting abstract parameters of clustering methods. GEsture explores genes showing similar, opposite and time-delay expression patterns with a gene expression curve as input from time series datasets. We presented three examples that illustrate the capacity of GEsture in gene hunting while following users' requirements. GEsture also provides visualization tools (such as expression pattern figure, heat map and correlation network) to display the searching results. The result outputs may provide useful information for researchers to understand the targets, function and biological processes of the involved genes.

  17. Altered expression of transmembrane mucins, MUC1 and MUC4, in bladder cancer: pathological implications in diagnosis.

    PubMed

    Kaur, Sukhwinder; Momi, Navneet; Chakraborty, Subhankar; Wagner, David G; Horn, Adam J; Lele, Subodh M; Theodorescu, Dan; Batra, Surinder K

    2014-01-01

    Radical changes in both expression and glycosylation pattern of transmembrane mucins have been observed in various malignancies. We and others have shown that MUC1 and MUC4, two transmembrane mucins, play a sentinel role in cell signaling events that drive several epithelial malignancies. In the present study, we investigated the expression profile of MUC1 and MUC4 in the non-neoplastic bladder urothelium, in various malignant neoplasms of bladder and in bladder carcinoma cell lines. Immunohistochemistry was performed on tissue sections from the urinary bladder biopsies, resection samples and tissue microarrays (TMAs) with monoclonal antibodies specific for MUC1 and MUC4. We also investigated their expression in bladder carcinoma cell lines by RT-PCR and immunoblotting. MUC1 is expressed on the apical surface or in umbrella cells of the normal non-neoplastic bladder urothelium. Strong expression of MUC1 was also observed in urothelial carcinoma (UC). MUC1 staining increased from normal urothelium (n = 27, 0.35±0.12) to urothelial carcinoma (UC, n = 323, H-score, 2.4±0.22, p≤0.0001). In contrast to MUC1, MUC4 was expressed in all the layers of non-neoplastic bladder urothelium (n = 14, 2.5±0.28), both in the cell membrane and cytoplasm. In comparison to non-neoplastic urothelium, the loss of MUC4 expression was observed during urothelial carcinoma (n = 211, 0.56±0.06). However, re-expression of MUC4 was observed in a subset of metastatic cases of urothelial carcinoma (mean H-score 0.734±0.9). The expression of MUC1 is increased while that of MUC4 decreased in UC compared to the normal non-neoplastic urothelium. Expression of both MUC1 and MUC4, however, are significantly higher in urothelial carcinoma metastatic cases compared to localized UC. These results suggest differential expression of MUC1 and MUC4 during development and progression of bladder carcinoma.

  18. Loss and Transcendence Life Themes.

    ERIC Educational Resources Information Center

    Weenolsen, Patricia

    Psychologists have often observed an underlying pattern or theme in the accounts that individuals give of their lives. To test a humanistic-existential approach to human development, 48 women were interviewed with the Loss and Transcendence (L/T) Life History Form. The L/T Life Theme is expressed in two ways: the expanded version includes the…

  19. Patterns of Interaction in Family Relationships and the Development of Identity Exploration in Adolescence.

    ERIC Educational Resources Information Center

    Grotevant, Harold D.; Cooper, Catherine R.

    1985-01-01

    Developed a model of individuation in family relationships focused on communicative processes. Expressions of four dimensions of the model (self-esteem, separateness, permeability, and mutuality) were predicted to be positively associated with identity exploration in adolescents. Analysis of observations of families in a Family Interaction Task…

  20. Assessment of the relationship between satellite AOD and ground PM₁₀ measurement data considering synoptic meteorological patterns and Lidar data.

    PubMed

    Zeeshan, Muhammad; Kim Oanh, N T

    2014-03-01

    Correlation between satellite aerosol optical depth (AOD) and ground monitoring particulate matter (PM) depends on the meteorology that determines PM optical properties, its dispersion, accumulation and vertical distribution. This study presents a novel approach to analyze PM-AOD relationship considering the totality of meteorological factors expressed as synoptic patterns. Meteorological observations at 07:00 Bangkok time from 9 regional meteorological stations, in dry seasons (November-April) of 11 years (2000-2010), were used to categorize governing meteorology over Central Thailand into four categories representing the typical observed synoptic patterns. The MANOVA analysis showed that these patterns were statistically different. PM10 recorded at 22 air quality stations in Bangkok Metropolitan Region were examined which showed the highest levels for the days belonging to pattern 1, followed by pattern 4, both with presence of a high pressure ridge, while the minimum for pattern 2 when thermal lows dominated. Lidar aerosol backscatter profiles recorded at Pimai station were used as indicator of PM vertical distribution that showed similarity within each pattern. R(2) between MODIS and Sun photometer AODs at Pimai was above 0.8. Correlation coefficients (R) between MODIS AOD and corresponding 1h PM10 for clear sky days (cloudiness ≤ 3/10) were examined for each pattern in comparison with lump case. Significant improvements were observed for pattern 1, average R across 22 stations was 0.46 for Terra and 0.38 for Aqua AOD compared to lump case with R of 0.34 and 0.31, respectively. Comparable improvement was also observed for pattern 4. For pattern 2, R values were significantly reduced which may be caused by the deeper mixing layers and varying vertical profiles with overall low values of Lidar backscatter coefficients. Improved R values in pattern 1 and 4, which had highest PM10 in BMR, suggested a better potential of using MODIS AOD for PM10 monitoring with synoptic pattern classification. Copyright © 2013 Elsevier B.V. All rights reserved.

  1. Emergent Archetype Hydrological-Biogeochemical Response Patterns in Heterogeneous Catchments

    NASA Astrophysics Data System (ADS)

    Jawitz, J. W.; Gall, H. E.; Rao, P.

    2013-12-01

    What can spatiotemporally integrated patterns observed in stream hydrologic and biogeochemical signals generated in response to transient hydro-climatic and anthropogenic forcing tell us about the interactions between spatially heterogeneous soil-mediated hydrological and biogeochemical processes? We seek to understand how the spatial structure of solute sources coupled with hydrologic responses affect observed concentration-discharge (C-Q) patterns. These patterns are expressions of the spatiotemporal structure of solute loads exported from managed catchments, and their likely ecological consequences manifested in receiving water bodies (e.g., wetlands, rivers, lakes, and coastal waters). We investigated the following broad questions: (1) How does the correlation between flow-generating areas and biogeochemical source areas across a catchment evolve under stochastic hydro-climatic forcing? (2) What are the feasible hydrologic and biogeochemical responses that lead to the emergence of the observed archetype C-Q patterns? and; (3) What implications do these coupled dynamics have for catchment monitoring and implementation of management practices? We categorize the observed temporal signals into three archetypical C-Q patterns: dilution; accretion, and constant concentration. We introduce a parsimonious stochastic model of heterogeneous catchments, which act as hydrologic and biogeochemical filters, to examine the relationship between spatial heterogeneity and temporal history of solute export signals. The core concept of the modeling framework is considering the types and degree of spatial correlation between solute source zones and flow generating zones, and activation of different portions of the catchments during rainfall events. Our overarching hypothesis is that each of the archetype C-Q patterns can be generated by explicitly linking landscape-scale hydrologic responses and spatial distributions of solute source properties within a catchment. The model simulations reproduce the three major C-Q patterns observed in published data, offering valuable insight into coupled catchment processes. The findings have important implications for effective catchment management for water quality improvement, and stream monitoring strategies.

  2. The cold-water connection: Bergmann's rule in North American freshwater fishes.

    PubMed

    Rypel, Andrew L

    2014-01-01

    Understanding general rules governing macroecological body size variations is one of the oldest pursuits in ecology. However, this science has been dominated by studies of terrestrial vertebrates, spurring debate over the validity of such rules in other taxonomic groups. Here, relationships between maximum body size and latitude, temperature, and elevation were evaluated for 29 North American freshwater fish species. Bergmann's rule (i.e., that body size correlates positively with latitude and negatively with temperature) was observed in 38% of species, converse Bergmann's rule (that body size correlates negatively with latitude and positively with temperature) was observed in 34% of species, and 28% of species showed no macroecological body size relationships. Most notably, every species that expressed Bergmann's rule was a cool- or cold-water species while every species that expressed converse Bergmann's rule was a warm-water species, highlighting how these patterns are likely connected to species thermal niches. This study contradicts previous research suggesting Bergmann's rule does not apply to freshwater fishes, and is congruent with an emerging paradigm of variable macroecological body size patterns in poikilotherms.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yan; Chen, Yue Yi; Yang, Shu Guang

    Metallothioneins (MTs) are of low molecular mass, cysteine-rich proteins. They play an important role in the detoxification of heavy metals and homeostasis of intracellular metal ions, and protecting against intracellular oxidative damages. In this study a full-length cDNA of type 2 plant metallothioneins, HbMT2a, was isolated from 25 mM Polyethyleneglycol (PEG) stressed leaves of Hevea brasiliensis by RACE. The HbMT2a was 372 bp in length and had a 237 bp open reading frame (ORF) encoding for a protein of 78 amino acid residues with molecular mass of 7.772 kDa. The expression of HbMT2a in the detached leaves of rubber tree clone RY7-33-97more » was up-regulated by Me-JA, ABA, PEG, H{sub 2}O{sub 2}, Cu{sup 2+} and Zn{sup 2+}, but down-regulated by water. The role of HbMT2a protein in protecting against metal toxicity was demonstrated in vitro. PET-28a-HbMT2-beared Escherichia coli. Differential expression of HbMT2a upon treatment with 10 °C was observed in the detached leaves of rubber tree clone 93-114 which is cold-resistant and Reken501 which is cold-sensitive. The expression patterns of HbMT2a in the two rubber tree clones may be ascribed to a change in the level of endogenous H{sub 2}O{sub 2}. - Highlights: • Cloning an HbMT2a gene from rubber tree. • Analyzing expression patterns of HbMT2a upon abiotic stress and heavy metal stress. • Finding different expression patterns of HbMT2a among two Hevea germplasm. • The expressed protein of HbMT2a enhances copper and zinc tolerance in Escherichia coli.« less

  4. Evolution of Daily Gene Co-expression Patterns from Algae to Plants

    PubMed Central

    de los Reyes, Pedro; Romero-Campero, Francisco J.; Ruiz, M. Teresa; Romero, José M.; Valverde, Federico

    2017-01-01

    Daily rhythms play a key role in transcriptome regulation in plants and microalgae orchestrating responses that, among other processes, anticipate light transitions that are essential for their metabolism and development. The recent accumulation of genome-wide transcriptomic data generated under alternating light:dark periods from plants and microalgae has made possible integrative and comparative analysis that could contribute to shed light on the evolution of daily rhythms in the green lineage. In this work, RNA-seq and microarray data generated over 24 h periods in different light regimes from the eudicot Arabidopsis thaliana and the microalgae Chlamydomonas reinhardtii and Ostreococcus tauri have been integrated and analyzed using gene co-expression networks. This analysis revealed a reduction in the size of the daily rhythmic transcriptome from around 90% in Ostreococcus, being heavily influenced by light transitions, to around 40% in Arabidopsis, where a certain independence from light transitions can be observed. A novel Multiple Bidirectional Best Hit (MBBH) algorithm was applied to associate single genes with a family of potential orthologues from evolutionary distant species. Gene duplication, amplification and divergence of rhythmic expression profiles seems to have played a central role in the evolution of gene families in the green lineage such as Pseudo Response Regulators (PRRs), CONSTANS-Likes (COLs), and DNA-binding with One Finger (DOFs). Gene clustering and functional enrichment have been used to identify groups of genes with similar rhythmic gene expression patterns. The comparison of gene clusters between species based on potential orthologous relationships has unveiled a low to moderate level of conservation of daily rhythmic expression patterns. However, a strikingly high conservation was found for the gene clusters exhibiting their highest and/or lowest expression value during the light transitions. PMID:28751903

  5. Comparative transcriptomics of 5 high-altitude vertebrates and their low-altitude relatives

    PubMed Central

    Tang, Qianzi; Zhou, Xuming; Jin, Long; Guan, Jiuqiang; Liu, Rui; Li, Jing; Long, Kereng; Tian, Shilin; Che, Tiandong; Hu, Silu; Liang, Yan; Yang, Xuemei; Tao, Xuan; Zhong, Zhijun; Wang, Guosong; Chen, Xiaohui; Li, Diyan; Ma, Jideng; Wang, Xun; Mai, Miaomiao; Jiang, An’an; Luo, Xiaolin; Lv, Xuebin; Gladyshev, Vadim N; Li, Xuewei

    2017-01-01

    Abstract Background Species living at high altitude are subject to strong selective pressures due to inhospitable environments (e.g., hypoxia, low temperature, high solar radiation, and lack of biological production), making these species valuable models for comparative analyses of local adaptation. Studies that have examined high-altitude adaptation have identified a vast array of rapidly evolving genes that characterize the dramatic phenotypic changes in high-altitude animals. However, how high-altitude environment shapes gene expression programs remains largely unknown. Findings We generated a total of 910 Gb of high-quality RNA-seq data for 180 samples derived from 6 tissues of 5 agriculturally important high-altitude vertebrates (Tibetan chicken, Tibetan pig, Tibetan sheep, Tibetan goat, and yak) and their cross-fertile relatives living in geographically neighboring low-altitude regions. Of these, ∼75% reads could be aligned to their respective reference genomes, and on average ∼60% of annotated protein coding genes in each organism showed FPKM expression values greater than 0.5. We observed a general concordance in topological relationships between the nucleotide alignments and gene expression–based trees. Tissue and species accounted for markedly more variance than altitude based on either the expression or the alternative splicing patterns. Cross-species clustering analyses showed a tissue-dominated pattern of gene expression and a species-dominated pattern for alternative splicing. We also identified numerous differentially expressed genes that could potentially be involved in phenotypic divergence shaped by high-altitude adaptation. Conclusions These data serve as a valuable resource for examining the convergence and divergence of gene expression changes between species as they adapt or acclimatize to high-altitude environments. PMID:29149296

  6. Gene expression signatures in tree shrew choroid in response to three myopiagenic conditions

    PubMed Central

    He, Li; Frost, Michael R.; Siegwart, John T.; Norton, Thomas T.

    2014-01-01

    We examined gene expression in tree shrew choroid in response to three different myopiagenic conditions: minus lens (ML) wear, form deprivation (FD), and continuous darkness (DK). Four groups of tree shrews (n = 7 per group) were used. Starting 24 days after normal eye opening (days of visual experience [DVE]), the ML group wore a monocular −5 D lens for 2 days. The FD group wore a monocular translucent diffuser for 2 days. The DK group experienced continuous darkness binocularly for 11 days, starting at 17 DVE. An age-matched normal group was examined at 26 DVE. Quantitative PCR was used to measure the relative (treated eye vs. control eye) differences in mRNA levels in the choroid for 77 candidate genes. Small myopic changes were observed in the treated eyes (relative to the control eyes) of the ML group (−1.0 ± 0.2 D; mean ± SEM) and FD group (−1.9 ± 0.2 D). A larger myopia developed in the DK group (−4.4 ± 1.0 D) relative to Normal eyes (both groups, mean of right and left eyes). In the ML group, 28 genes showed significant differential mRNA expression; eighteen were down-regulated. A very similar pattern occurred in the FD group; twenty-seven of the same genes were similarly regulated, along with five additional genes. Fewer expression differences in the DK group were significant compared to normal or the control eyes of the ML and FD groups, but the pattern was similar to that of the ML and FD differential expression patterns. These data suggest that, at the level of the choroid, the gene expression signatures produced by “GO” emmetropization signals are highly similar despite the different visual conditions. PMID:25072854

  7. [Analysis of gene expression pattern in peripheral blood leukocytes during experimental heat wave].

    PubMed

    Feoktistova, E S; Skamrov, A V; Goryunova, L E; Khaspekov, G L; Osyaeva, M K; Rodnenkov, O V; Beabealashvilli, R Sh

    2017-03-01

    The conditions of Moscow 2010 summer heat wave were simulated in an accommodation module. Six healthy men aged from 22 to 46 years stayed in the module for 30 days. Measurements of gene expression in peripheral blood leukocytes before, during and 3 day after simulated heat wave were performed using qRT-PCR. We observed a shift in the expression level of certain genes after heat exposure for a long time, and rapid return to the initial level, when volunteers leaved the accommodation module. Eight genes were chosen to form the "heat expression signature". EGR2, EGR3 were upregulated in all six volunteers, EGR1, SIRT1, CYP51A1, MAPK9, BAG5, MNDA were upregulated in 5 volunteers.

  8. Dissociation between facial and bodily expressions in emotion recognition: A case study.

    PubMed

    Leiva, Samanta; Margulis, Laura; Micciulli, Andrea; Ferreres, Aldo

    2017-12-21

    Existing single-case studies have reported deficit in recognizing basic emotions through facial expression and unaffected performance with body expressions, but not the opposite pattern. The aim of this paper is to present a case study with impaired emotion recognition through body expressions and intact performance with facial expressions. In this single-case study we assessed a 30-year-old patient with autism spectrum disorder, without intellectual disability, and a healthy control group (n = 30) with four tasks of basic and complex emotion recognition through face and body movements, and two non-emotional control tasks. To analyze the dissociation between facial and body expressions, we used Crawford and Garthwaite's operational criteria, and we compared the patient and the control group performance with a modified one-tailed t-test designed specifically for single-case studies. There were no statistically significant differences between the patient's and the control group's performances on the non-emotional body movement task or the facial perception task. For both kinds of emotions (basic and complex) when the patient's performance was compared to the control group's, statistically significant differences were only observed for the recognition of body expressions. There were no significant differences between the patient's and the control group's correct answers for emotional facial stimuli. Our results showed a profile of impaired emotion recognition through body expressions and intact performance with facial expressions. This is the first case study that describes the existence of this kind of dissociation pattern between facial and body expressions of basic and complex emotions.

  9. The complexity of gene expression dynamics revealed by permutation entropy

    PubMed Central

    2010-01-01

    Background High complexity is considered a hallmark of living systems. Here we investigate the complexity of temporal gene expression patterns using the concept of Permutation Entropy (PE) first introduced in dynamical systems theory. The analysis of gene expression data has so far focused primarily on the identification of differentially expressed genes, or on the elucidation of pathway and regulatory relationships. We aim to study gene expression time series data from the viewpoint of complexity. Results Applying the PE complexity metric to abiotic stress response time series data in Arabidopsis thaliana, genes involved in stress response and signaling were found to be associated with the highest complexity not only under stress, but surprisingly, also under reference, non-stress conditions. Genes with house-keeping functions exhibited lower PE complexity. Compared to reference conditions, the PE of temporal gene expression patterns generally increased upon stress exposure. High-complexity genes were found to have longer upstream intergenic regions and more cis-regulatory motifs in their promoter regions indicative of a more complex regulatory apparatus needed to orchestrate their expression, and to be associated with higher correlation network connectivity degree. Arabidopsis genes also present in other plant species were observed to exhibit decreased PE complexity compared to Arabidopsis specific genes. Conclusions We show that Permutation Entropy is a simple yet robust and powerful approach to identify temporal gene expression profiles of varying complexity that is equally applicable to other types of molecular profile data. PMID:21176199

  10. Analysis of dofA, a fruA-Dependent Developmental Gene, and Its Homologue, dofB, in Myxococcus xanthus

    PubMed Central

    Horiuchi, Takayuki; Akiyama, Takuya; Inouye, Sumiko; Komano, Teruya

    2002-01-01

    The developmentally regulated gene dofA, identified from pulse-labeling experiments by two-dimensional gel electrophoresis, and its homologue, dofB, were cloned and characterized in Myxococcus xanthus. Deletion of dofA and dofB did not affect the vegetative growth and development of M. xanthus. dofA was specifically expressed during development, while dofB expression was observed during vegetative growth and development. The dofA-lacZ fusion was introduced into a fruA mutant and A, B, C, D, and E extracellular signal mutants. The pattern of dofA expression in the C signal mutant was similar to that of the wild-type strain, while dofA expression was not detected in the fruA mutant. These results are consistent with those of the pulse-labeling experiments. dofA expression was reduced in A and E signal mutants, whereas dofA expression was delayed in B and D signal mutants. The patterns of expression of the dofA gene in the fruA mutant and the five signal mutants are strikingly similar to that of the tps gene, which encodes protein S, a major component of the outer surface of the myxospore; this result suggests that the dofA and tps genes are similarly regulated. The involvement of a highly GC-rich inverted repeat sequence (underlined), CGGCCCCCGATTCGTCGGGGGCCG, in developmentally regulated dofA expression is suggested. PMID:12446630

  11. Long interspersed nuclear element-1 expression and retrotransposition in prostate cancer cells.

    PubMed

    Briggs, Erica M; Ha, Susan; Mita, Paolo; Brittingham, Gregory; Sciamanna, Ilaria; Spadafora, Corrado; Logan, Susan K

    2018-01-01

    Long Interspersed Nuclear Element-1 (LINE-1) is an autonomous retrotransposon that generates new genomic insertions through the retrotransposition of a RNA intermediate. Expression of LINE-1 is tightly repressed in most somatic tissues to prevent DNA damage and ensure genomic integrity. However, the reactivation of LINE-1 has been documented in cancer and the role of LINE-1 protein expression and retrotransposition has become of interest in the development, progression, and adaptation of many epithelial neoplasms, including prostate cancer. Here, we examined endogenous LINE-1 protein expression and localization in a panel of prostate cancer cells and observed a diverse range of LINE-1 expression patterns between cell lines. Subcellular localization of LINE-1 proteins, ORF1p and ORF2p, revealed distinct expression patterns. ORF1p, a nucleic acid chaperone that binds LINE-1 mRNA, was predominantly expressed in the cytoplasm, with minor localization in the nucleus. ORF2p, containing endonuclease and reverse transcriptase domains, exhibited punctate foci in the nucleus and also displayed co-localization with PCNA and γH2AX. Using a retrotransposition reporter assay, we found variations in LINE-1 retrotransposition between cell lines. Overall, our findings reveal new insight into the expression and retrotransposition of LINE-1 in prostate cancer. The prostate cancer cells we investigated provide a unique model for investigating endogenous LINE-1 activity and provide a functional model for studying LINE-1 mechanisms in prostate cancer.

  12. BiGGEsTS: integrated environment for biclustering analysis of time series gene expression data

    PubMed Central

    Gonçalves, Joana P; Madeira, Sara C; Oliveira, Arlindo L

    2009-01-01

    Background The ability to monitor changes in expression patterns over time, and to observe the emergence of coherent temporal responses using expression time series, is critical to advance our understanding of complex biological processes. Biclustering has been recognized as an effective method for discovering local temporal expression patterns and unraveling potential regulatory mechanisms. The general biclustering problem is NP-hard. In the case of time series this problem is tractable, and efficient algorithms can be used. However, there is still a need for specialized applications able to take advantage of the temporal properties inherent to expression time series, both from a computational and a biological perspective. Findings BiGGEsTS makes available state-of-the-art biclustering algorithms for analyzing expression time series. Gene Ontology (GO) annotations are used to assess the biological relevance of the biclusters. Methods for preprocessing expression time series and post-processing results are also included. The analysis is additionally supported by a visualization module capable of displaying informative representations of the data, including heatmaps, dendrograms, expression charts and graphs of enriched GO terms. Conclusion BiGGEsTS is a free open source graphical software tool for revealing local coexpression of genes in specific intervals of time, while integrating meaningful information on gene annotations. It is freely available at: . We present a case study on the discovery of transcriptional regulatory modules in the response of Saccharomyces cerevisiae to heat stress. PMID:19583847

  13. Divergent and nonuniform gene expression patterns in mouse brain

    PubMed Central

    Morris, John A.; Royall, Joshua J.; Bertagnolli, Darren; Boe, Andrew F.; Burnell, Josh J.; Byrnes, Emi J.; Copeland, Cathy; Desta, Tsega; Fischer, Shanna R.; Goldy, Jeff; Glattfelder, Katie J.; Kidney, Jolene M.; Lemon, Tracy; Orta, Geralyn J.; Parry, Sheana E.; Pathak, Sayan D.; Pearson, Owen C.; Reding, Melissa; Shapouri, Sheila; Smith, Kimberly A.; Soden, Chad; Solan, Beth M.; Weller, John; Takahashi, Joseph S.; Overly, Caroline C.; Lein, Ed S.; Hawrylycz, Michael J.; Hohmann, John G.; Jones, Allan R.

    2010-01-01

    Considerable progress has been made in understanding variations in gene sequence and expression level associated with phenotype, yet how genetic diversity translates into complex phenotypic differences remains poorly understood. Here, we examine the relationship between genetic background and spatial patterns of gene expression across seven strains of mice, providing the most extensive cellular-resolution comparative analysis of gene expression in the mammalian brain to date. Using comprehensive brainwide anatomic coverage (more than 200 brain regions), we applied in situ hybridization to analyze the spatial expression patterns of 49 genes encoding well-known pharmaceutical drug targets. Remarkably, over 50% of the genes examined showed interstrain expression variation. In addition, the variability was nonuniformly distributed across strain and neuroanatomic region, suggesting certain organizing principles. First, the degree of expression variance among strains mirrors genealogic relationships. Second, expression pattern differences were concentrated in higher-order brain regions such as the cortex and hippocampus. Divergence in gene expression patterns across the brain could contribute significantly to variations in behavior and responses to neuroactive drugs in laboratory mouse strains and may help to explain individual differences in human responsiveness to neuroactive drugs. PMID:20956311

  14. Dual Transcriptome Profiling of Leishmania-Infected Human Macrophages Reveals Distinct Reprogramming Signatures.

    PubMed

    Fernandes, Maria Cecilia; Dillon, Laura A L; Belew, Ashton Trey; Bravo, Hector Corrada; Mosser, David M; El-Sayed, Najib M

    2016-05-10

    Macrophages are mononuclear phagocytes that constitute a first line of defense against pathogens. While lethal to many microbes, they are the primary host cells of Leishmania spp. parasites, the obligate intracellular pathogens that cause leishmaniasis. We conducted transcriptomic profiling of two Leishmania species and the human macrophage over the course of intracellular infection by using high-throughput RNA sequencing to characterize the global gene expression changes and reprogramming events that underlie the interactions between the pathogen and its host. A systematic exclusion of the generic effects of large-particle phagocytosis revealed a vigorous, parasite-specific response of the human macrophage early in the infection that was greatly tempered at later time points. An analogous temporal expression pattern was observed with the parasite, suggesting that much of the reprogramming that occurs as parasites transform into intracellular forms generally stabilizes shortly after entry. Following that, the parasite establishes an intracellular niche within macrophages, with minimal communication between the parasite and the host cell later during the infection. No significant difference was observed between parasite species transcriptomes or in the transcriptional response of macrophages infected with each species. Our comparative analysis of gene expression changes that occur as mouse and human macrophages are infected by Leishmania spp. points toward a general signature of the Leishmania-macrophage infectome. Little is known about the transcriptional changes that occur within mammalian cells harboring intracellular pathogens. This study characterizes the gene expression signatures of Leishmania spp. parasites and the coordinated response of infected human macrophages as the pathogen enters and persists within them. After accounting for the generic effects of large-particle phagocytosis, we observed a parasite-specific response of the human macrophages early in infection that was reduced at later time points. A similar expression pattern was observed in the parasites. Our analyses provide specific insights into the interplay between human macrophages and Leishmania parasites and constitute an important general resource for the study of how pathogens evade host defenses and modulate the functions of the cell to survive intracellularly. Copyright © 2016 Fernandes et al.

  15. Ontogeny of cholecystokinin-like immunoreactivity in the Brazilian opossum brain.

    PubMed

    Fox, C A; Jeyapalan, M; Ross, L R; Jacobson, C D

    1991-12-17

    We have studied the anatomical distribution of cholecystokinin-like immunoreactive (CCK-IR) somata and fibers in the brain of the adult and developing Brazilian short-tailed opossum, Monodelphis domestica. Animals ranged in age from the day of birth (1PN) to young adulthood (180PN). A nickel enhanced, avidin-biotin, indirect immunohistochemical technique was used to identify CCK-IR structures. Somata containing CCK immunoreactivity were observed in the cerebral cortex, hippocampus, hypothalamus, thalamus, midbrain, and brainstem in the adult. Cholecystokinin immunoreactive fibers had a wide distribution in the adult Monodelphis brain. The only major region of the brain that did not contain CCK-IR fibers was the cerebellum. The earliest expression of CCK immunoreactivity was found in fibers in the dorsal brainstem of 5-day-old opossum pups. It is possible that the CCK-IR fibers in the brainstem at 5PN are of vagal origin. Cholecystokinin immunoreactive somata were observed in the brainstem on 10PN. The CCK-IR cell bodies observed in the brainstem at 10PN may mark the first expression of CCK-IR elements intrinsic to the brain. A broad spectrum of patterns of onset of CCK expression was observed in the opossum brain. The early occurrence and varied ontogenesis of CCK-IR structures indicates CCK may be involved in the function of a variety of circuits from the brainstem to the cerebral cortex. The early expression of CCK-IR structures in the dorsal brainstem suggests that CCK may modulate feeding behavior in the Monodelphis neonate. Cholecystokinin immunoreactivity in forebrain structures such as the suprachiasmatic nucleus, medial preoptic area, thalamus and cortical structures indicates that CCK may also be involved in circadian rhythmicity, reproductive functions, as well as the state of arousal of the Brazilian opossum. The ontogenic timing of CCK immunoreactivity in specific circuitry also indicates that CCK expression does not occur simultaneously throughout the brain. This pattern of CCK onset may relate to the temporal need for CCK in specific circuits of the central nervous system (CNS) during development.

  16. Predicting variations of perceptual performance across individuals from neural activity using pattern classifiers.

    PubMed

    Das, Koel; Giesbrecht, Barry; Eckstein, Miguel P

    2010-07-15

    Within the past decade computational approaches adopted from the field of machine learning have provided neuroscientists with powerful new tools for analyzing neural data. For instance, previous studies have applied pattern classification algorithms to electroencephalography data to predict the category of presented visual stimuli, human observer decision choices and task difficulty. Here, we quantitatively compare the ability of pattern classifiers and three ERP metrics (peak amplitude, mean amplitude, and onset latency of the face-selective N170) to predict variations across individuals' behavioral performance in a difficult perceptual task identifying images of faces and cars embedded in noise. We investigate three different pattern classifiers (Classwise Principal Component Analysis, CPCA; Linear Discriminant Analysis, LDA; and Support Vector Machine, SVM), five training methods differing in the selection of training data sets and three analyses procedures for the ERP measures. We show that all three pattern classifier algorithms surpass traditional ERP measurements in their ability to predict individual differences in performance. Although the differences across pattern classifiers were not large, the CPCA method with training data sets restricted to EEG activity for trials in which observers expressed high confidence about their decisions performed the highest at predicting perceptual performance of observers. We also show that the neural activity predicting the performance across individuals was distributed through time starting at 120ms, and unlike the face-selective ERP response, sustained for more than 400ms after stimulus presentation, indicating that both early and late components contain information correlated with observers' behavioral performance. Together, our results further demonstrate the potential of pattern classifiers compared to more traditional ERP techniques as an analysis tool for modeling spatiotemporal dynamics of the human brain and relating neural activity to behavior. Copyright 2010 Elsevier Inc. All rights reserved.

  17. Phytoplankton-bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge.

    PubMed

    Bertrand, Erin M; McCrow, John P; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B; Delmont, Tom O; Post, Anton F; Sipler, Rachel E; Spackeen, Jenna L; Xu, Kai; Bronk, Deborah A; Hutchins, David A; Allen, Andrew E

    2015-08-11

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton-bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton-bacterial interactions in both positive and negative feedback loops.

  18. Diurnal Cycling Transcription Factors of Pineapple Revealed by Genome-Wide Annotation and Global Transcriptomic Analysis

    PubMed Central

    Sharma, Anupma; Wai, Ching Man; Ming, Ray

    2017-01-01

    Abstract Circadian clock provides fitness advantage by coordinating internal metabolic and physiological processes to external cyclic environments. Core clock components exhibit daily rhythmic changes in gene expression, and the majority of them are transcription factors (TFs) and transcription coregulators (TCs). We annotated 1,398 TFs from 67 TF families and 80 TCs from 20 TC families in pineapple, and analyzed their tissue-specific and diurnal expression patterns. Approximately 42% of TFs and 45% of TCs displayed diel rhythmic expression, including 177 TF/TCs cycling only in the nonphotosynthetic leaf tissue, 247 cycling only in the photosynthetic leaf tissue, and 201 cycling in both. We identified 68 TF/TCs whose cycling expression was tightly coupled between the photosynthetic and nonphotosynthetic leaf tissues. These TF/TCs likely coordinate key biological processes in pineapple as we demonstrated that this group is enriched in homologous genes that form the core circadian clock in Arabidopsis and includes a STOP1 homolog. Two lines of evidence support the important role of the STOP1 homolog in regulating CAM photosynthesis in pineapple. First, STOP1 responds to acidic pH and regulates a malate channel in multiple plant species. Second, the cycling expression pattern of the pineapple STOP1 and the diurnal pattern of malate accumulation in pineapple leaf are correlated. We further examined duplicate-gene retention and loss in major known circadian genes and refined their evolutionary relationships between pineapple and other plants. Significant variations in duplicate-gene retention and loss were observed for most clock genes in both monocots and dicots. PMID:28922793

  19. Binocular pattern deprivation interferes with the expression of proteins involved in primary visual cortex maturation in the cat.

    PubMed

    Laskowska-Macios, Karolina; Nys, Julie; Hu, Tjing-Tjing; Zapasnik, Monika; Van der Perren, Anke; Kossut, Malgorzata; Burnat, Kalina; Arckens, Lutgarde

    2015-08-14

    Binocular pattern deprivation from eye opening (early BD) delays the maturation of the primary visual cortex. This delay is more pronounced for the peripheral than the central visual field representation within area 17, particularly between the age of 2 and 4 months [Laskowska-Macios, Cereb Cortex, 2014]. In this study, we probed for related dynamic changes in the cortical proteome. We introduced age, cortical region and BD as principal variables in a 2-D DIGE screen of area 17. In this way we explored the potential of BD-related protein expression changes between central and peripheral area 17 of 2- and 4-month-old BD (2BD, 4BD) kittens as a valid parameter towards the identification of brain maturation-related molecular processes. Consistent with the maturation delay, distinct developmental protein expression changes observed for normal kittens were postponed by BD, especially in the peripheral region. These BD-induced proteomic changes suggest a negative regulation of neurite outgrowth, synaptic transmission and clathrin-mediated endocytosis, thereby implicating these processes in normal experience-induced visual cortex maturation. Verification of the expression of proteins from each of the biological processes via Western analysis disclosed that some of the transient proteomic changes correlate to the distinct behavioral outcome in adult life, depending on timing and duration of the BD period [Neuroscience 2013;255:99-109]. Taken together, the plasticity potential to recover from BD, in relation to ensuing restoration of normal visual input, appears to rely on specific protein expression changes and cellular processes induced by the loss of pattern vision in early life.

  20. Phytoplankton–bacterial interactions mediate micronutrient colimitation at the coastal Antarctic sea ice edge

    PubMed Central

    Bertrand, Erin M.; McCrow, John P.; Moustafa, Ahmed; Zheng, Hong; McQuaid, Jeffrey B.; Delmont, Tom O.; Post, Anton F.; Sipler, Rachel E.; Spackeen, Jenna L.; Xu, Kai; Bronk, Deborah A.; Hutchins, David A.; Allen, Andrew E.

    2015-01-01

    Southern Ocean primary productivity plays a key role in global ocean biogeochemistry and climate. At the Southern Ocean sea ice edge in coastal McMurdo Sound, we observed simultaneous cobalamin and iron limitation of surface water phytoplankton communities in late Austral summer. Cobalamin is produced only by bacteria and archaea, suggesting phytoplankton–bacterial interactions must play a role in this limitation. To characterize these interactions and investigate the molecular basis of multiple nutrient limitation, we examined transitions in global gene expression over short time scales, induced by shifts in micronutrient availability. Diatoms, the dominant primary producers, exhibited transcriptional patterns indicative of co-occurring iron and cobalamin deprivation. The major contributor to cobalamin biosynthesis gene expression was a gammaproteobacterial population, Oceanospirillaceae ASP10-02a. This group also contributed significantly to metagenomic cobalamin biosynthesis gene abundance throughout Southern Ocean surface waters. Oceanospirillaceae ASP10-02a displayed elevated expression of organic matter acquisition and cell surface attachment-related genes, consistent with a mutualistic relationship in which they are dependent on phytoplankton growth to fuel cobalamin production. Separate bacterial groups, including Methylophaga, appeared to rely on phytoplankton for carbon and energy sources, but displayed gene expression patterns consistent with iron and cobalamin deprivation. This suggests they also compete with phytoplankton and are important cobalamin consumers. Expression patterns of siderophore- related genes offer evidence for bacterial influences on iron availability as well. The nature and degree of this episodic colimitation appear to be mediated by a series of phytoplankton–bacterial interactions in both positive and negative feedback loops. PMID:26221022

  1. Binary Gene Expression Patterning of the Molt Cycle: The Case of Chitin Metabolism

    PubMed Central

    Abehsera, Shai; Glazer, Lilah; Tynyakov, Jenny; Plaschkes, Inbar; Chalifa-Caspi, Vered; Khalaila, Isam; Aflalo, Eliahu D.; Sagi, Amir

    2015-01-01

    In crustaceans, like all arthropods, growth is accompanied by a molting cycle. This cycle comprises major physiological events in which mineralized chitinous structures are built and degraded. These events are in turn governed by genes whose patterns of expression are presumably linked to the molting cycle. To study these genes we performed next generation sequencing and constructed a molt-related transcriptomic library from two exoskeletal-forming tissues of the crayfish Cherax quadricarinatus, namely the gastrolith and the mandible cuticle-forming epithelium. To simplify the study of such a complex process as molting, a novel approach, binary patterning of gene expression, was employed. This approach revealed that key genes involved in the synthesis and breakdown of chitin exhibit a molt-related pattern in the gastrolith-forming epithelium. On the other hand, the same genes in the mandible cuticle-forming epithelium showed a molt-independent pattern of expression. Genes related to the metabolism of glucosamine-6-phosphate, a chitin precursor synthesized from simple sugars, showed a molt-related pattern of expression in both tissues. The binary patterning approach unfolds typical patterns of gene expression during the molt cycle of a crustacean. The use of such a simplifying integrative tool for assessing gene patterning seems appropriate for the study of complex biological processes. PMID:25919476

  2. Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch

    PubMed Central

    Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

    2015-01-01

    Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance. PMID:26270529

  3. Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch.

    PubMed

    Zhao, Tian-Tian; Zhang, Jin; Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

    2015-01-01

    Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance.

  4. Genome-wide identification of novel expression signatures reveal distinct patterns and prevalence of binding motifs for p53, nuclear factor-κB and other signal transcription factors in head and neck squamous cell carcinoma

    PubMed Central

    Yan, Bin; Yang, Xinping; Lee, Tin-Lap; Friedman, Jay; Tang, Jun; Van Waes, Carter; Chen, Zhong

    2007-01-01

    Background Differentially expressed gene profiles have previously been observed among pathologically defined cancers by microarray technologies, including head and neck squamous cell carcinomas (HNSCCs). However, the molecular expression signatures and transcriptional regulatory controls that underlie the heterogeneity in HNSCCs are not well defined. Results Genome-wide cDNA microarray profiling of ten HNSCC cell lines revealed novel gene expression signatures that distinguished cancer cell subsets associated with p53 status. Three major clusters of over-expressed genes (A to C) were defined through hierarchical clustering, Gene Ontology, and statistical modeling. The promoters of genes in these clusters exhibited different patterns and prevalence of transcription factor binding sites for p53, nuclear factor-κB (NF-κB), activator protein (AP)-1, signal transducer and activator of transcription (STAT)3 and early growth response (EGR)1, as compared with the frequency in vertebrate promoters. Cluster A genes involved in chromatin structure and function exhibited enrichment for p53 and decreased AP-1 binding sites, whereas clusters B and C, containing cytokine and antiapoptotic genes, exhibited a significant increase in prevalence of NF-κB binding sites. An increase in STAT3 and EGR1 binding sites was distributed among the over-expressed clusters. Novel regulatory modules containing p53 or NF-κB concomitant with other transcription factor binding motifs were identified, and experimental data supported the predicted transcriptional regulation and binding activity. Conclusion The transcription factors p53, NF-κB, and AP-1 may be important determinants of the heterogeneous pattern of gene expression, whereas STAT3 and EGR1 may broadly enhance gene expression in HNSCCs. Defining these novel gene signatures and regulatory mechanisms will be important for establishing new molecular classifications and subtyping, which in turn will promote development of targeted therapeutics for HNSCC. PMID:17498291

  5. Quantitative expression patterns of GDF9 and BMP15 genes in sheep ovarian follicles grown in vivo or cultured in vitro.

    PubMed

    Kona, S S R; Praveen Chakravarthi, V; Siva Kumar, A V N; Srividya, D; Padmaja, K; Rao, V H

    2016-01-15

    Quantitative patterns of expression of the growth differentiation factor 9 (GDF9) and bone morphogenic protein 15 (BMP15) genes in different development stages of in vivo and in vitro grown ovarian follicles in sheep were studied for the first time. Both GDF9 and BMP15 were expressed in the cumulus cells and oocytes at all the development stages of in vivo and in vitro grown ovarian follicles. Growth differentiation factor 9 and bone morphogenic protein 15 exhibited stage-specific undulations in the expression in the cumulus cells and oocytes isolated from in vivo grown ovarian follicles. These undulations could be related to discrete development events during the ovarian follicle development. The expression of GDF9 and BMP15 was highest (3.38 ± 0.02 and 2.69 ± 0.06, respectively; P ≤ 0.05) in the primordial follicles compared with preantral, early antral, antral, and large antral stages. Similarly, GDF9 and BMP15 expression in the cumulus cells (0 ± 0.16 and 0 ± 0.07) and oocytes (1.47 ± 0.07 and 1.32 ± 0.03) was lowest (P ≤ 0.05) in the in vivo grown antral follicles. In the cultured follicles, the stage-specific undulations observed in the expression of GDF9 and BMP15 in the in vivo grown follicles were either different or abolished. For example, in the oocytes from in vitro grown follicles, the expression of BMP15 did not change as the development progressed all the way from preantral to large antral follicle stage although in the oocytes from in vivo grown follicles BMP15 expression exhibited stage-specific variations. It is concluded that GDF9 and BMP15 follow a stage-specific pattern of expression during the in vivo development of ovarian follicles in sheep, and in vitro culture altered the stage-specific changes in the expression of these two genes. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. GABAA receptor subunit gene expression in human prefrontal cortex: comparison of schizophrenics and controls

    NASA Technical Reports Server (NTRS)

    Akbarian, S.; Huntsman, M. M.; Kim, J. J.; Tafazzoli, A.; Potkin, S. G.; Bunney, W. E. Jr; Jones, E. G.; Bloom, F. E. (Principal Investigator)

    1995-01-01

    The prefrontal cortex of schizophrenics is hypoactive and displays changes related to inhibitory, GABAergic neurons, and GABAergic synapses. These changes include decreased levels of glutamic acid decarboxylase (GAD), the enzyme for GABA synthesis, upregulation of muscimol binding, and downregulation of benzodiazepine binding to GABAA receptors. Studies in the visual cortex of nonhuman primates have demonstrated that gene expression for GAD and for several GABAA receptor subunit polypeptides is under control of neuronal activity, raising the possibility that similar mechanisms in the hypoactive prefrontal cortex of schizophrenics may explain the abnormalities in GAD and in GABAA receptor regulation. In the present study, which is the first of its type on human cerebral cortex, levels of mRNAs for six GABAA receptor subunits (alpha 1, alpha 2, alpha 5, beta 1, beta 2, gamma 2) and their laminar expression patterns were analyzed in the prefrontal cortex of schizophrenics and matched controls, using in situ hybridization histochemistry and densitometry. Three types of laminar expression pattern were observed: mRNAs for the alpha 1, beta 2, and gamma 2 subunits, which are the predominant receptor subunits expressed in the mature cortex, were expressed at comparatively high levels by cells of all six cortical layers, but most intensely by cells in lower layer III and layer IV. mRNAs for the alpha 2, alpha 5, and beta 1 subunits were expressed at lower levels; alpha 2 and beta 1 were expressed predominantly by cells in layers II, III, and IV; alpha 5 was expressed predominantly in layers IV, V, and VI. There were no significant changes in overall mRNA levels for any of the receptor subunits in the prefrontal cortex of schizophrenics, and the laminar expression pattern of all six receptor subunit mRNAs did not differ between schizophrenics and controls. Because gene expression for GABAA receptor subunits is not consistently altered in the prefrontal cortex of schizophrenics, the previously reported upregulation of muscimol binding sites and downregulation of benzodiazepine binding sites in the prefrontal and adjacent cingulate cortex of schizophrenics are possibly due to posttranscriptional modifications of mRNAs and their translated polypeptides.

  7. Differential expression of decorin and biglycan genes during palatogenesis in normal and retinoic acid-treated mice.

    PubMed

    Zhang, Yuxiang; Mori, Tetsuji; Iseki, Ken; Hagino, Seita; Takaki, Hiromi; Takeuchi, Mayumi; Hikake, Tsuyoshi; Tase, Choichiro; Murakawa, Masahiro; Yokoya, Sachihiko; Wanaka, Akio

    2003-04-01

    Proteoglycans are involved in secondary palate formation. In the present study, we focused on two small leucine-rich proteoglycans, decorin and biglycan, because they assembled extracellular matrix molecules such as collagens and modulated signaling pathway of transforming growth factor-beta. To investigate the functions of decorin and biglycan in palatogenesis, we compared their mRNA expression patterns between normal palate and retinoic acid-induced cleft palate in mice by using in situ hybridization analysis during the period of embryonic day 13.5 (E13.5) to E15.5. On E13.5, decorin mRNA was expressed in the epithelia and mesenchyme on the nasal side of the developing secondary palate. During the period the palate shelves were fusing (E14.5), decorin mRNA was strongly expressed in the mesenchyme but its expression pattern was asymmetric; decorin mRNA expression area in the nasal side was broader than that in the oral side. The expression of decorin mRNA was hardly detected in the mesenchyme on either side of the medial edge epithelium. After fusion (E15.5), its expression converged to the mesenchyme just around the palatine bone. Biglycan mRNA was ubiquitously distributed throughout the palatal mesenchyme for the mid-gestation period. Its expression area became limited to the ossification area within the palate after the late gestation period. In the retinoic acid-treated mice, the area of the decorin gene expression expanded to the core region of the palate primordium where little signal was observed in control mice. On the other hand, biglycan in the retinoic acid-treated mice did not show remarkable change in its distribution patterns compared with that in the control mice. These findings suggest that decorin and biglycan play distinct roles in palatogenesis, and decorin was more actively involved in the process of secondary palate formation than biglycan. Up-regulation of decorin gene expression in the retinoic acid-treated mice might influence the pathogenesis of cleft palate. Copyright 2003 Wiley-Liss, Inc.

  8. What a Smile Means: Contextual Beliefs and Facial Emotion Expressions in a Non-verbal Zero-Sum Game

    PubMed Central

    Pádua Júnior, Fábio P.; Prado, Paulo H. M.; Roeder, Scott S.; Andrade, Eduardo B.

    2016-01-01

    Research into the authenticity of facial emotion expressions often focuses on the physical properties of the face while paying little attention to the role of beliefs in emotion perception. Further, the literature most often investigates how people express a pre-determined emotion rather than what facial emotion expressions people strategically choose to express. To fill these gaps, this paper proposes a non-verbal zero-sum game – the Face X Game – to assess the role of contextual beliefs and strategic displays of facial emotion expression in interpersonal interactions. This new research paradigm was used in a series of three studies, where two participants are asked to play the role of the sender (individual expressing emotional information on his/her face) or the observer (individual interpreting the meaning of that expression). Study 1 examines the outcome of the game with reference to the sex of the pair, where senders won more frequently when the pair was comprised of at least one female. Study 2 examines the strategic display of facial emotion expressions. The outcome of the game was again contingent upon the sex of the pair. Among female pairs, senders won the game more frequently, replicating the pattern of results from study 1. We also demonstrate that senders who strategically express an emotion incongruent with the valence of the event (e.g., smile after seeing a negative event) are able to mislead observers, who tend to hold a congruent belief about the meaning of the emotion expression. If sending an incongruent signal helps to explain why female senders win more frequently, it logically follows that female observers were more prone to hold a congruent, and therefore inaccurate, belief. This prospect implies that while female senders are willing and/or capable of displaying fake smiles, paired-female observers are not taking this into account. Study 3 investigates the role of contextual factors by manipulating female observers’ beliefs. When prompted to think in an incongruent manner, these observers significantly improve their performance in the game. These findings emphasize the role that contextual factors play in emotion perception—observers’ beliefs do indeed affect their judgments of facial emotion expressions. PMID:27148142

  9. Vertebrate Left-Right Asymmetry: What Can Nodal Cascade Gene Expression Patterns Tell Us?

    PubMed

    Schweickert, Axel; Ott, Tim; Kurz, Sabrina; Tingler, Melanie; Maerker, Markus; Fuhl, Franziska; Blum, Martin

    2017-12-29

    Laterality of inner organs is a wide-spread characteristic of vertebrates and beyond. It is ultimately controlled by the left-asymmetric activation of the Nodal signaling cascade in the lateral plate mesoderm of the neurula stage embryo, which results from a cilia-driven leftward flow of extracellular fluids at the left-right organizer. This scenario is widely accepted for laterality determination in wildtype specimens. Deviations from this norm come in different flavors. At the level of organ morphogenesis, laterality may be inverted (situs inversus) or non-concordant with respect to the main body axis (situs ambiguus or heterotaxia). At the level of Nodal cascade gene activation, expression may be inverted, bilaterally induced, or absent. In a given genetic situation, patterns may be randomized or predominantly lacking laterality (absence or bilateral activation). We propose that the distributions of patterns observed may be indicative of the underlying molecular defects, with randomizations being primarily caused by defects in the flow-generating ciliary set-up, and symmetrical patterns being the result of impaired flow sensing, on the left, the right, or both sides. This prediction, the reasoning of which is detailed in this review, pinpoints functions of genes whose role in laterality determination have remained obscure.

  10. Clustering of change patterns using Fourier coefficients.

    PubMed

    Kim, Jaehee; Kim, Haseong

    2008-01-15

    To understand the behavior of genes, it is important to explore how the patterns of gene expression change over a time period because biologically related gene groups can share the same change patterns. Many clustering algorithms have been proposed to group observation data. However, because of the complexity of the underlying functions there have not been many studies on grouping data based on change patterns. In this study, the problem of finding similar change patterns is induced to clustering with the derivative Fourier coefficients. The sample Fourier coefficients not only provide information about the underlying functions, but also reduce the dimension. In addition, as their limiting distribution is a multivariate normal, a model-based clustering method incorporating statistical properties would be appropriate. This work is aimed at discovering gene groups with similar change patterns that share similar biological properties. We developed a statistical model using derivative Fourier coefficients to identify similar change patterns of gene expression. We used a model-based method to cluster the Fourier series estimation of derivatives. The model-based method is advantageous over other methods in our proposed model because the sample Fourier coefficients asymptotically follow the multivariate normal distribution. Change patterns are automatically estimated with the Fourier representation in our model. Our model was tested in simulations and on real gene data sets. The simulation results showed that the model-based clustering method with the sample Fourier coefficients has a lower clustering error rate than K-means clustering. Even when the number of repeated time points was small, the same results were obtained. We also applied our model to cluster change patterns of yeast cell cycle microarray expression data with alpha-factor synchronization. It showed that, as the method clusters with the probability-neighboring data, the model-based clustering with our proposed model yielded biologically interpretable results. We expect that our proposed Fourier analysis with suitably chosen smoothing parameters could serve as a useful tool in classifying genes and interpreting possible biological change patterns. The R program is available upon the request.

  11. Finding gene clusters for a replicated time course study

    PubMed Central

    2014-01-01

    Background Finding genes that share similar expression patterns across samples is an important question that is frequently asked in high-throughput microarray studies. Traditional clustering algorithms such as K-means clustering and hierarchical clustering base gene clustering directly on the observed measurements and do not take into account the specific experimental design under which the microarray data were collected. A new model-based clustering method, the clustering of regression models method, takes into account the specific design of the microarray study and bases the clustering on how genes are related to sample covariates. It can find useful gene clusters for studies from complicated study designs such as replicated time course studies. Findings In this paper, we applied the clustering of regression models method to data from a time course study of yeast on two genotypes, wild type and YOX1 mutant, each with two technical replicates, and compared the clustering results with K-means clustering. We identified gene clusters that have similar expression patterns in wild type yeast, two of which were missed by K-means clustering. We further identified gene clusters whose expression patterns were changed in YOX1 mutant yeast compared to wild type yeast. Conclusions The clustering of regression models method can be a valuable tool for identifying genes that are coordinately transcribed by a common mechanism. PMID:24460656

  12. Pattern identification in time-course gene expression data with the CoGAPS matrix factorization.

    PubMed

    Fertig, Elana J; Stein-O'Brien, Genevieve; Jaffe, Andrew; Colantuoni, Carlo

    2014-01-01

    Patterns in time-course gene expression data can represent the biological processes that are active over the measured time period. However, the orthogonality constraint in standard pattern-finding algorithms, including notably principal components analysis (PCA), confounds expression changes resulting from simultaneous, non-orthogonal biological processes. Previously, we have shown that Markov chain Monte Carlo nonnegative matrix factorization algorithms are particularly adept at distinguishing such concurrent patterns. One such matrix factorization is implemented in the software package CoGAPS. We describe the application of this software and several technical considerations for identification of age-related patterns in a public, prefrontal cortex gene expression dataset.

  13. Parallels between Global Transcriptional Programs of Polarizing Caco-2 Intestinal Epithelial Cells In Vitro and Gene Expression Programs in Normal Colon and Colon Cancer

    PubMed Central

    Sääf, Annika M.; Halbleib, Jennifer M.; Chen, Xin; Yuen, Siu Tsan; Leung, Suet Yi

    2007-01-01

    Posttranslational mechanisms are implicated in the development of epithelial cell polarity, but little is known about the patterns of gene expression and transcriptional regulation during this process. We characterized temporal patterns of gene expression during cell–cell adhesion-initiated polarization of cultured human Caco-2 cells, which develop structural and functional polarity resembling enterocytes in vivo. A distinctive switch in gene expression patterns occurred upon formation of cell–cell contacts. Comparison to gene expression patterns in normal human colon and colon tumors revealed that the pattern in proliferating, nonpolarized Caco-2 cells paralleled patterns seen in human colon cancer in vivo, including expression of genes involved in cell proliferation. The pattern switched in polarized Caco-2 cells to one more closely resembling that in normal colon tissue, indicating that regulation of transcription underlying Caco-2 cell polarization is similar to that during enterocyte differentiation in vivo. Surprisingly, the temporal program of gene expression in polarizing Caco-2 cells involved changes in signaling pathways (e.g., Wnt, Hh, BMP, FGF) in patterns similar to those during migration and differentiation of intestinal epithelial cells in vivo, despite the absence of morphogen gradients and interactions with stromal cells characteristic of enterocyte differentiation in situ. The full data set is available at http://microarray-pubs.stanford.edu/CACO2. PMID:17699589

  14. Patterns of activity expressed by juvenile horseshoe crabs.

    PubMed

    Dubofsky, E A; Simpson, S D; Chabot, Christopher C; Watson, Winsor H

    2013-09-01

    Adult American horseshoe crabs, Limulus polyphemus, possess endogenous circadian and circatidal clocks controlling visual sensitivity and locomotion, respectively. The goal of this study was to determine the types of activity rhythms expressed by juvenile horseshoe crabs (n = 24) when exposed to a 14:10 light/dark cycle (LD) for 10 days, followed by 10 days of constant darkness (DD). Horseshoe crab activity was recorded with a digital time-lapse video system that used an infrared-sensitive camera so animals could be monitored at night. In LD, 15 animals expressed daily patterns of activity, 6 displayed a circatidal pattern, and the remaining 3 were arrhythmic. Of the 15 animals with daily patterns of locomotion, 7 had a significant preference (P < 0.05) for diurnal activity and 3 for nocturnal activity; the remainder did not express a significant preference for day or night activity. In DD, 13 horseshoe crabs expressed circatidal rhythms and 8 maintained a pattern of about 24 h. Although these results suggest the presence of a circadian clock influencing circatidal patterns of locomotion, these apparent circadian rhythms may actually represent the expression of just one of the two bouts of activity driven by the putative circalunidian clocks that control their tidal rhythms. Overall, these results indicate that, like adults, juvenile horseshoe crabs express both daily and tidal patterns of activity and that at least one, and maybe both, of these patterns is driven by endogenous clocks.

  15. Single-cell and coupled GRN models of cell patterning in the Arabidopsis thaliana root stem cell niche

    PubMed Central

    2010-01-01

    Background Recent experimental work has uncovered some of the genetic components required to maintain the Arabidopsis thaliana root stem cell niche (SCN) and its structure. Two main pathways are involved. One pathway depends on the genes SHORTROOT and SCARECROW and the other depends on the PLETHORA genes, which have been proposed to constitute the auxin readouts. Recent evidence suggests that a regulatory circuit, composed of WOX5 and CLE40, also contributes to the SCN maintenance. Yet, we still do not understand how the niche is dynamically maintained and patterned or if the uncovered molecular components are sufficient to recover the observed gene expression configurations that characterize the cell types within the root SCN. Mathematical and computational tools have proven useful in understanding the dynamics of cell differentiation. Hence, to further explore root SCN patterning, we integrated available experimental data into dynamic Gene Regulatory Network (GRN) models and addressed if these are sufficient to attain observed gene expression configurations in the root SCN in a robust and autonomous manner. Results We found that an SCN GRN model based only on experimental data did not reproduce the configurations observed within the root SCN. We developed several alternative GRN models that recover these expected stable gene configurations. Such models incorporate a few additional components and interactions in addition to those that have been uncovered. The recovered configurations are stable to perturbations, and the models are able to recover the observed gene expression profiles of almost all the mutants described so far. However, the robustness of the postulated GRNs is not as high as that of other previously studied networks. Conclusions These models are the first published approximations for a dynamic mechanism of the A. thaliana root SCN cellular pattering. Our model is useful to formally show that the data now available are not sufficient to fully reproduce root SCN organization and genetic profiles. We then highlight some experimental holes that remain to be studied and postulate some novel gene interactions. Finally, we suggest the existence of a generic dynamical motif that can be involved in both plant and animal SCN maintenance. PMID:20920363

  16. Expression pattern of NMDA receptors reveals antiepileptic potential of apigenin 8-C-glucoside and chlorogenic acid in pilocarpine induced epileptic mice.

    PubMed

    Aseervatham, G Smilin Bell; Suryakala, U; Doulethunisha; Sundaram, S; Bose, P Chandra; Sivasudha, T

    2016-08-01

    The present study was aimed to evaluate the effect of apigenin 8-C-glucoside (Vitexin) and chlorogenic acid on epileptic mice induced by pilocarpine and explored its possible mechanisms. Intraperitonial administration of pilocarpine (85mg/kg) induced seizure in mice was assessed by behavior observations, which is significantly (p>0.05) reduced by apigenin 8-C-glucoside (AP8CG) (10mg/kg) and chlorogenic acid (CA) (5mg/kg), similar to diazepam. Seizure was accompanied by an imbalance in the levels of Gamma-aminobutyric acid (GABA) and glutamate in the pilocarpine administered group. Moreover, convulsion along with reduced acetylcholinesterase, increased monoamine oxidase and oxidative stress was observed in epileptic mice brain. AP8CG and CA significantly restored back to normal levels even at lower doses. Further, increased lipid peroxidation and nitrite content was also significantly attenuated by AP8CG and CA. However, CA was found to be more effective when compared to AP8CG. In addition, the mRNA expression of N-methyl-d-aspartate receptor (NMDAR), mGluR1 and mGlu5 was significantly (P≤0.05) inhibited by AP8CG and CA in a lower dose. The mRNA expression of GRIK1 did not differ significantly in any of the group and showed a similar pattern of expression. Our result shows that AP8CG and CA selectively inhibit NMDAR, mGluR1 and mGlu5 expression. Modification in the provoked NMDAR calcium response coupled with neuronal death. Hence, these findings underline that the polyphenolics, AP8CG and CA have exerted antiepileptic and neuroprotective activity by suppressing glutamate receptors. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  17. Differentially expressed miRNAs in triple negative breast cancer between African-American and non-Hispanic white women

    PubMed Central

    Sugita, Bruna; Gill, Mandeep; Mahajan, Akanskha; Duttargi, Anju; Kirolikar, Saurabh; Almeida, Rodrigo; Regis, Kenny; Oluwasanmi, Olusayo L.; Marchi, Fabio; Marian, Catalin; Makambi, Kepher; Kallakury, Bhaskar; Sheahan, Laura; Cavalli, Iglenir J.; Ribeiro, Enilze M.; Madhavan, Subha; Boca, Simina; Gusev, Yuriy; Cavalli, Luciane R.

    2016-01-01

    Triple Negative Breast Cancer (TNBC), a clinically aggressive subtype of breast cancer, disproportionately affects African American (AA) women when compared to non-Hispanic Whites (NHW). MiRNAs(miRNAs) play a critical role in these tumors, through the regulation of cancer driver genes. In this study, our goal was to characterize and compare the patterns of miRNA expression in TNBC of AA (n = 27) and NHW women (n = 30). A total of 256 miRNAs were differentially expressed between these groups, and distinct from the ones observed in their respective non-TNBC subtypes. Fifty-five of these miRNAs were mapped in cytobands carrying copy number alterations (CNAs); 26 of them presented expression levels concordant with the observed CNAs. Receiving operating characteristic (ROC) analysis showed a good power (AUC ≥ 0.80; 95% CI) for over 65% of the individual miRNAs and a high combined power with superior sensitivity and specificity (AUC = 0.88 (0.78−0.99); 95% CI) of the 26 miRNA panel in discriminating TNBC between these populations. Subsequent miRNA target analysis revealed their involvement in the interconnected PI3K/AKT, MAPK and insulin signaling pathways. Additionally, three miRNAs of this panel were associated with early age at diagnosis. Altogether, these findings indicated that there are different patterns of miRNA expression between TNBC of AA and NHW women and that their mapping in genomic regions with high levels of CNAs is not merely physical, but biologically relevant to the TNBC phenotype. Once validated in distinct cohorts of AA women, this panel can potentially represent their intrinsic TNBC genome signature. PMID:27813494

  18. Epithelial-to-mesenchymal transition and estrogen receptor α mediated epithelial dedifferentiation mark the development of benign prostatic hyperplasia.

    PubMed

    Shao, Rui; Shi, Jiandang; Liu, Haitao; Shi, Xiaoyu; Du, Xiaoling; Klocker, Helmut; Lee, Chung; Zhu, Yan; Zhang, Ju

    2014-06-01

    Epithelial-to-mesenchymal transition (EMT) has been reported involved in the pathogenesis of fibrotic disorders and associated with stemness characteristics. Recent studies demonstrated that human benign prostatic hyperplasia (BPH) development involves accumulation of mesenchymal-like cells derived from the prostatic epithelium. However, the inductive factors of EMT in the adult prostate and the cause-and-effect relationship between EMT and stemness characteristics are not yet resolved. EMT expression patterns were immunohistochemically identified in the human epithelia of normal/BPH prostate tissue and in a rat BPH model induced by estrogen/androgen (E2/T, ratio 1:100) alone or in the presence of the ER antagonist raloxifene. Gene expression profiles were analyzed in micro-dissected prostatic epithelia of rat stimulated by E2/T for 3 days. Two main morphological features both accompanied with EMT were observed in the epithelia of human BPH. Luminal cells undergoing EMT dedifferentiated from a cytokeratin (CK) CK18(+) /CK8(+) /CK19(+) to a CK18(-) /CK8(+) /CK19(-) phenotype and CK14 expression increased in basal epithelial cells. ERα expression was closely related to these dedifferentiated cells and the expression of EMT markers. A similar pattern of EMT events was observed in the E2/T induced rat model of BPH in comparison to the prostates of untreated rats, which could be prevented by raloxifene. Epithelial and mesenchymal phenotype switching is an important mechanism in the etiology of BPH. ERα mediated enhanced estrogenic effect is a crucial inductive factor of epithelial dedifferentiation giving rise to activation of an EMT program in prostate epithelium. © 2014 Wiley Periodicals, Inc.

  19. Differentially expressed miRNAs in triple negative breast cancer between African-American and non-Hispanic white women.

    PubMed

    Sugita, Bruna; Gill, Mandeep; Mahajan, Akanskha; Duttargi, Anju; Kirolikar, Saurabh; Almeida, Rodrigo; Regis, Kenny; Oluwasanmi, Olusayo L; Marchi, Fabio; Marian, Catalin; Makambi, Kepher; Kallakury, Bhaskar; Sheahan, Laura; Cavalli, Iglenir J; Ribeiro, Enilze M; Madhavan, Subha; Boca, Simina; Gusev, Yuriy; Cavalli, Luciane R

    2016-11-29

    Triple Negative Breast Cancer (TNBC), a clinically aggressive subtype of breast cancer, disproportionately affects African American (AA) women when compared to non-Hispanic Whites (NHW). MiRNAs(miRNAs) play a critical role in these tumors, through the regulation of cancer driver genes. In this study, our goal was to characterize and compare the patterns of miRNA expression in TNBC of AA (n = 27) and NHW women (n = 30). A total of 256 miRNAs were differentially expressed between these groups, and distinct from the ones observed in their respective non-TNBC subtypes. Fifty-five of these miRNAs were mapped in cytobands carrying copy number alterations (CNAs); 26 of them presented expression levels concordant with the observed CNAs. Receiving operating characteristic (ROC) analysis showed a good power (AUC ≥ 0.80; 95% CI) for over 65% of the individual miRNAs and a high combined power with superior sensitivity and specificity (AUC = 0.88 (0.78-0.99); 95% CI) of the 26 miRNA panel in discriminating TNBC between these populations. Subsequent miRNA target analysis revealed their involvement in the interconnected PI3K/AKT, MAPK and insulin signaling pathways. Additionally, three miRNAs of this panel were associated with early age at diagnosis. Altogether, these findings indicated that there are different patterns of miRNA expression between TNBC of AA and NHW women and that their mapping in genomic regions with high levels of CNAs is not merely physical, but biologically relevant to the TNBC phenotype. Once validated in distinct cohorts of AA women, this panel can potentially represent their intrinsic TNBC genome signature.

  20. Slower skeletal muscle phenotypes are critical for constitutive expression of Hsp70 in overloaded rat plantaris muscle.

    PubMed

    O'Neill, David E T; Aubrey, F Kris; Zeldin, David A; Michel, Robin N; Noble, Earl G

    2006-03-01

    Heat shock protein 72 (Hsp70) is constitutively expressed in rat hindlimb muscles, reportedly in proportion to their content of type I myosin heavy chain. This distribution pattern has been suggested to result from the higher recruitment and activity of such muscles and/or a specific relationship between myosin phenotype and Hsp70 content. To differentiate between these possibilities, the fiber-specific distribution of Hsp70 was examined in male Sprague-Dawley rat plantaris under control conditions, following a fast-to-slow phenotypic shift in response to surgically induced overload (O) and in response to O when the phenotypic shift was prevented by 3,5,3'-triiodo-dl-thyronine administration. Constitutive expression of Hsp70 was restricted to type I and IIa fibers in plantaris from control rats, and this fiber-specific pattern of expression was maintained following O of up to 28 days, although Hsp70 content in the O muscle doubled. When O (for 40 days) of the plantaris was combined with 3,5,3'-triiodo-dl-thyronine administration, despite typical hypertrophy in the overloaded plantaris, prevention of the normal phenotypic transformation also blocked the increased expression of Hsp70 observed in euthyroid controls. Collectively, these data suggest that chronic changes in constitutive expression of Hsp70 with altered contractile activity appear critically dependent on fast-to-slow phenotypic remodeling.

  1. Spectral Biclustering of Microarray Data: Coclustering Genes and Conditions

    PubMed Central

    Kluger, Yuval; Basri, Ronen; Chang, Joseph T.; Gerstein, Mark

    2003-01-01

    Global analyses of RNA expression levels are useful for classifying genes and overall phenotypes. Often these classification problems are linked, and one wants to find “marker genes” that are differentially expressed in particular sets of “conditions.” We have developed a method that simultaneously clusters genes and conditions, finding distinctive “checkerboard” patterns in matrices of gene expression data, if they exist. In a cancer context, these checkerboards correspond to genes that are markedly up- or downregulated in patients with particular types of tumors. Our method, spectral biclustering, is based on the observation that checkerboard structures in matrices of expression data can be found in eigenvectors corresponding to characteristic expression patterns across genes or conditions. In addition, these eigenvectors can be readily identified by commonly used linear algebra approaches, in particular the singular value decomposition (SVD), coupled with closely integrated normalization steps. We present a number of variants of the approach, depending on whether the normalization over genes and conditions is done independently or in a coupled fashion. We then apply spectral biclustering to a selection of publicly available cancer expression data sets, and examine the degree to which the approach is able to identify checkerboard structures. Furthermore, we compare the performance of our biclustering methods against a number of reasonable benchmarks (e.g., direct application of SVD or normalized cuts to raw data). PMID:12671006

  2. Molecular cloning, developmental expression, and cellular localization of the 70-kDa RPA-1 subunit of Drosophila melanogaster.

    PubMed

    Perdigão, J; Logarinho, E; Avides, M C; Sunkel, C E

    1999-12-01

    Replication protein A (RPA) is a highly conserved multifunctional heterotrimeric complex, involved in DNA replication, repair, recombination, and possibly transcription. Here, we report the cloning of the gene that codes for the largest subunit of the Drosophila melanogaster RPA homolog, dmRPA70. In situ hybridization showed that dmRPA70 RNA is present in developing embryos during the first 16 cycles. After this point, dm-RPA70 expression is downregulated in cells that enter a G1 phase and exit the mitotic cycle, becoming restricted to brief bursts of accumulation from late G1 to S phase. This pattern of regulated expression is also observed in the developing eye imaginal disc. In addition, we have shown that the presence of cyclin E is necessary and sufficient to drive the expression of dmRPA70 in embryonic cells arrested in G1 but is not required in tissues undergoing endoreduplication. Immunolocalization showed that in early developing embryos, the dmRPA70 protein associates with chromatin from the end of mitosis until the beginning of the next prophase in a dynamic speckled pattern that is strongly suggestive of its association with replication foci.

  3. Differential expression of CK20, β-catenin, and MUC2/5AC/6 in Lynch syndrome and familial colorectal cancer type X.

    PubMed

    Haraldsson, Stefan; Klarskov, Louise; Nilbert, Mef; Bernstein, Inge; Bonde, Jesper; Holck, Susanne

    2017-01-01

    Hereditary non-polyposis colorectal cancer comprises Lynch syndrome and familial colorectal cancer type X (FCCTX). Differences in genetics, demographics and histopathology have been extensively studied. The purpose of this study is to characterize their immunoprofile of markers other than MMR proteins. We compared the expression patterns of cytokeratins (CK7 and CK20), mucins (MUC2/5 AC/6), CDX2 and β-catenin in Lynch syndrome and FCCTX. Differences were identified for CK20 and nuclear β-catenin, which were significantly more often expressed in FCCTX than in Lynch syndrome ( p  < 0.001), whereas MUC2, MUC5AC and MUC6 were overexpressed in Lynch syndrome tumors compared with FCCTX tumors ( p  = 0.001, < 0.01, and < 0.001, respectively). We observed no differences in the expression patterns of CK7 and CDX2. In summary, we identified significant differences in the immunoprofiles of colorectal cancers linked to FCCTX and Lynch syndrome with a more sporadic-like profile in the former group and a more distinct profile with frequent MUC6 positivity in the latter group.

  4. Toll-like receptor expression and function differ between splenic marginal zone B cell lymphoma and splenic diffuse red pulp B cell lymphoma

    PubMed Central

    Verney, Aurélie; Traverse-Glehen, Alexandra; Callet-Bauchu, Evelyne; Jallades, Laurent; Magaud, Jean-Pierre; Salles, Gilles; Genestier, Laurent; Baseggio, Lucile

    2018-01-01

    In splenic marginal zone lymphoma (SMZL), specific and functional Toll-like Receptor (TLR) patterns have been recently described, suggesting their involvement in tumoral proliferation. Splenic diffuse red pulp lymphoma with villous lymphocytes (SDRPL) is close to but distinct from SMZL, justifying here the comparison of TLR patterns and functionality in both entities. Distinct TLR profiles were observed in both lymphoma subtypes. SDRPL B cells showed higher expression of TLR7 and to a lesser degree TLR9, in comparison to SMZL B cells. In both entities, TLR7 and TLR9 pathways appeared functional, as shown by IL-6 production upon TLR7 and TLR9 agonists stimulations. Interestingly, circulating SDRPL, but not SMZL B cells, constitutively expressed CD86. In addition, stimulation with both TLR7 and TLR9 agonists significantly increased CD80 expression in circulating SDRPL but not SMZL B cells. Finally, TLR7 and TLR9 stimulations had no impact on proliferation and apoptosis of SMZL or SDRPL B cells. In conclusion, SMZL and SDRPL may derive from different splenic memory B cells with specific immunological features that can be used as diagnosis markers in the peripheral blood.

  5. Sexual selection drives evolution and rapid turnover of male gene expression.

    PubMed

    Harrison, Peter W; Wright, Alison E; Zimmer, Fabian; Dean, Rebecca; Montgomery, Stephen H; Pointer, Marie A; Mank, Judith E

    2015-04-07

    The profound and pervasive differences in gene expression observed between males and females, and the unique evolutionary properties of these genes in many species, have led to the widespread assumption that they are the product of sexual selection and sexual conflict. However, we still lack a clear understanding of the connection between sexual selection and transcriptional dimorphism, often termed sex-biased gene expression. Moreover, the relative contribution of sexual selection vs. drift in shaping broad patterns of expression, divergence, and polymorphism remains unknown. To assess the role of sexual selection in shaping these patterns, we assembled transcriptomes from an avian clade representing the full range of sexual dimorphism and sexual selection. We use these species to test the links between sexual selection and sex-biased gene expression evolution in a comparative framework. Through ancestral reconstruction of sex bias, we demonstrate a rapid turnover of sex bias across this clade driven by sexual selection and show it to be primarily the result of expression changes in males. We use phylogenetically controlled comparative methods to demonstrate that phenotypic measures of sexual selection predict the proportion of male-biased but not female-biased gene expression. Although male-biased genes show elevated rates of coding sequence evolution, consistent with previous reports in a range of taxa, there is no association between sexual selection and rates of coding sequence evolution, suggesting that expression changes may be more important than coding sequence in sexual selection. Taken together, our results highlight the power of sexual selection to act on gene expression differences and shape genome evolution.

  6. YAP expression in normal and neoplastic breast tissue: an immunohistochemical study.

    PubMed

    Jaramillo-Rodríguez, Yolanda; Cerda-Flores, Ricardo M; Ruiz-Ramos, Ruben; López-Márquez, Francisco C; Calderón-Garcidueñas, Ana Laura

    2014-04-01

    Yes-associated protein (YAP) is a transcriptional factor involved in normal cell proliferation, apoptosis and carcinogenesis; however, its contribution to breast cancer (BC) is still controversial. We undertook this study to compare the expression of YAP by immunohistochemistry (IHC) in normal breast tissue of women without breast cancer (BC) (controls), non-neoplastic breast tissue in women with cancer (internal controls) and in four different subtypes of invasive ductal carcinoma. There were 17 controls and 105 tumor cases (53 luminal A, 15 luminal B, 20 overexpression of HER2 and 17 triple negative cases) studied by IHC. Statistical analysis included χ(2) for linear trend (Extended Mantel-Haenszel). There were 40% of internal controls that showed expression of YAP in myoepithelial cells, whereas in controls expression was 100%. In controls, 3/17 (17.6%) showed cytoplasmic staining in luminal cells. There was a significant difference in nuclear expression between the ductal BC subtypes. Luminal A had 4% of positive cases with <10% of cells affected in each case; in contrast, there were 17-20% of positive cases in the other groups with 50% or more of stained cells. YAP expression in stromal cells was not observed in controls or in triple-negative cases, and luminal B pattern had the highest YAP nuclear expression (20%). YAP showed decreased expression in tumor cells compared with normal breast tissue. These findings are consistent with a role of YAP as a suppressor gene in BC and show differences in YAP expression in different patterns of ductal BC. Copyright © 2014 IMSS. Published by Elsevier Inc. All rights reserved.

  7. Identification of Emotional Facial Expressions: Effects of Expression, Intensity, and Sex on Eye Gaze.

    PubMed

    Wells, Laura Jean; Gillespie, Steven Mark; Rotshtein, Pia

    2016-01-01

    The identification of emotional expressions is vital for social interaction, and can be affected by various factors, including the expressed emotion, the intensity of the expression, the sex of the face, and the gender of the observer. This study investigates how these factors affect the speed and accuracy of expression recognition, as well as dwell time on the two most significant areas of the face: the eyes and the mouth. Participants were asked to identify expressions from female and male faces displaying six expressions (anger, disgust, fear, happiness, sadness, and surprise), each with three levels of intensity (low, moderate, and normal). Overall, responses were fastest and most accurate for happy expressions, but slowest and least accurate for fearful expressions. More intense expressions were also classified most accurately. Reaction time showed a different pattern, with slowest response times recorded for expressions of moderate intensity. Overall, responses were slowest, but also most accurate, for female faces. Relative to male observers, women showed greater accuracy and speed when recognizing female expressions. Dwell time analyses revealed that attention to the eyes was about three times greater than on the mouth, with fearful eyes in particular attracting longer dwell times. The mouth region was attended to the most for fearful, angry, and disgusted expressions and least for surprise. These results extend upon previous findings to show important effects of expression, emotion intensity, and sex on expression recognition and gaze behaviour, and may have implications for understanding the ways in which emotion recognition abilities break down.

  8. Identification of Emotional Facial Expressions: Effects of Expression, Intensity, and Sex on Eye Gaze

    PubMed Central

    Rotshtein, Pia

    2016-01-01

    The identification of emotional expressions is vital for social interaction, and can be affected by various factors, including the expressed emotion, the intensity of the expression, the sex of the face, and the gender of the observer. This study investigates how these factors affect the speed and accuracy of expression recognition, as well as dwell time on the two most significant areas of the face: the eyes and the mouth. Participants were asked to identify expressions from female and male faces displaying six expressions (anger, disgust, fear, happiness, sadness, and surprise), each with three levels of intensity (low, moderate, and normal). Overall, responses were fastest and most accurate for happy expressions, but slowest and least accurate for fearful expressions. More intense expressions were also classified most accurately. Reaction time showed a different pattern, with slowest response times recorded for expressions of moderate intensity. Overall, responses were slowest, but also most accurate, for female faces. Relative to male observers, women showed greater accuracy and speed when recognizing female expressions. Dwell time analyses revealed that attention to the eyes was about three times greater than on the mouth, with fearful eyes in particular attracting longer dwell times. The mouth region was attended to the most for fearful, angry, and disgusted expressions and least for surprise. These results extend upon previous findings to show important effects of expression, emotion intensity, and sex on expression recognition and gaze behaviour, and may have implications for understanding the ways in which emotion recognition abilities break down. PMID:27942030

  9. Comparative molecular analyses of select pH- and osmoregulatory genes in three freshwater crayfish Cherax quadricarinatus, C. destructor and C. cainii

    PubMed Central

    Pavasovic, Ana; Dammannagoda, Lalith K.; Mather, Peter B.; Prentis, Peter J.

    2017-01-01

    Systemic acid-base balance and osmotic/ionic regulation in decapod crustaceans are in part maintained by a set of transport-related enzymes such as carbonic anhydrase (CA), Na+/K+-ATPase (NKA), H+-ATPase (HAT), Na+/K+/2Cl− cotransporter (NKCC), Na+/Cl−/HCO\\documentclass[12pt]{minimal} \\usepackage{amsmath} \\usepackage{wasysym} \\usepackage{amsfonts} \\usepackage{amssymb} \\usepackage{amsbsy} \\usepackage{upgreek} \\usepackage{mathrsfs} \\setlength{\\oddsidemargin}{-69pt} \\begin{document} }{}${}_{3}^{-}$\\end{document}3− cotransporter (NBC), Na+/H+ exchanger (NHE), Arginine kinase (AK), Sarcoplasmic Ca+2-ATPase (SERCA) and Calreticulin (CRT). We carried out a comparative molecular analysis of these genes in three commercially important yet eco-physiologically distinct freshwater crayfish, Cherax quadricarinatus, C. destructor and C. cainii, with the aim to identify mutations in these genes and determine if observed patterns of mutations were consistent with the action of natural selection. We also conducted a tissue-specific expression analysis of these genes across seven different organs, including gills, hepatopancreas, heart, kidney, liver, nerve and testes using NGS transcriptome data. The molecular analysis of the candidate genes revealed a high level of sequence conservation across the three Cherax sp. Hyphy analysis revealed that all candidate genes showed patterns of molecular variation consistent with neutral evolution. The tissue-specific expression analysis showed that 46% of candidate genes were expressed in all tissue types examined, while approximately 10% of candidate genes were only expressed in a single tissue type. The largest number of genes was observed in nerve (84%) and gills (78%) and the lowest in testes (66%). The tissue-specific expression analysis also revealed that most of the master genes regulating pH and osmoregulation (CA, NKA, HAT, NKCC, NBC, NHE) were expressed in all tissue types indicating an important physiological role for these genes outside of osmoregulation in other tissue types. The high level of sequence conservation observed in the candidate genes may be explained by the important role of these genes as well as potentially having a number of other basic physiological functions in different tissue types. PMID:28852583

  10. Skeletal muscle repair in a mouse model of nemaline myopathy

    PubMed Central

    Sanoudou, Despina; Corbett, Mark A.; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T.; Vlahovich, Nicole; Hardeman, Edna C.; Beggs, Alan H.

    2012-01-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles. PMID:16877500

  11. Skeletal muscle repair in a mouse model of nemaline myopathy.

    PubMed

    Sanoudou, Despina; Corbett, Mark A; Han, Mei; Ghoddusi, Majid; Nguyen, Mai-Anh T; Vlahovich, Nicole; Hardeman, Edna C; Beggs, Alan H

    2006-09-01

    Nemaline myopathy (NM), the most common non-dystrophic congenital myopathy, is a variably severe neuromuscular disorder for which no effective treatment is available. Although a number of genes have been identified in which mutations can cause NM, the pathogenetic mechanisms leading to the phenotypes are poorly understood. To address this question, we examined gene expression patterns in an NM mouse model carrying the human Met9Arg mutation of alpha-tropomyosin slow (Tpm3). We assessed five different skeletal muscles from affected mice, which are representative of muscles with differing fiber-type compositions, different physiological specializations and variable degrees of pathology. Although these same muscles in non-affected mice showed marked variation in patterns of gene expression, with diaphragm being the most dissimilar, the presence of the mutant protein in nemaline muscles resulted in a more similar pattern of gene expression among the muscles. This result suggests a common process or mechanism operating in nemaline muscles independent of the variable degrees of pathology. Transcriptional and protein expression data indicate the presence of a repair process and possibly delayed maturation in nemaline muscles. Markers indicative of satellite cell number, activated satellite cells and immature fibers including M-Cadherin, MyoD, desmin, Pax7 and Myf6 were elevated by western-blot analysis or immunohistochemistry. Evidence suggesting elevated focal repair was observed in nemaline muscle in electron micrographs. This analysis reveals that NM is characterized by a novel repair feature operating in multiple different muscles.

  12. Ontogenetic expression of the vanilloid receptors TRPV1 and TRPV2 in the rat retina.

    PubMed

    Leonelli, Mauro; Martins, Daniel O; Kihara, Alexandre H; Britto, Luiz R G

    2009-11-01

    The present study aimed to analyze the gene and protein expression and the pattern of distribution of the vanilloid receptors TRPV1 and TRPV2 in the developing rat retina. During the early phases of development, TRPV1 was found mainly in the neuroblastic layer of the retina and in the pigmented epithelium. In the adult, TRPV1 was found in microglial cells, blood vessels, astrocytes and in neuronal structures, namely synaptic boutons of both retinal plexiform layers, as well as in cell bodies of the inner nuclear layer and the ganglion cell layer. The pattern of distribution of TRPV1 was mainly punctate, and there was higher TRPV1 labeling in the peripheral retina than in central regions. TRPV2 expression was quite distinct. Its expression was virtually undetectable by immunoblotting before P1, and that receptor was found by immunohistochemistry only by postnatal day 15 (P15). RNA and protein analysis showed that the adult levels are only reached by P60, which includes small processes in the retinal plexiform layers, and labeled cellular bodies in the inner nuclear layer and the ganglion cell layer. There was no overlapping between the signal observed for both receptors. In conclusion, our results showed that the patterns of distribution of TRPV1 and TRPV2 are different during the development of the rat retina, suggesting that they have specific roles in both visual processing and in providing specific cues to neural development.

  13. Prognostic Significance of Vascular Endothelial Growth Factor (VEGF) and Her-2 Protein in the Genesis of Cervical Carcinoma.

    PubMed

    Rahmani, Arshad H; Babiker, Ali Yousif; Alsahli, Mohammed A; Almatroodi, Saleh A; Husain, Nazik Elmalaika O S

    2018-02-15

    Angiogenesis plays a pivotal role in the progression of tumours through the formation of new blood vessels. Vascular endothelial growth factor (VEGF) is a chief factor responsible for inducing and regulating angiogenesis. Additionally, the human epidermal growth factor receptor family of receptors also plays an important role in the pathogenesis of tumours. This study aimed to examine the association between VEGF and Her-2 protein expression and its correlation with clinic-pathological characteristics; in particular, prognosis. A total of 65 cases of cervical carcinoma and 10 samples of inflammatory lesions were evaluated for VEGF and Her-2 protein expression. Expression of VEGF and Her-2 was detected in 63.07% and 43.07% in cervical carcinoma cases respectively whereas control cases did not show any expression. The difference in the expression pattern of both markers comparing cancer and control cases was statistically significant (p < 0.05). However, no significant difference in the expression pattern of VEGF protein was observed among the different grades and stages of tumours (p > 0.05). Comparing different grades of a tumour, expression of Her-2 was detected in 31.8% of well-differentiated tumours, 36.0 % in moderately differentiated tumours and 66.66 % in poorly differentiated cancers. The expression of Her-2 was increased in high-grade tumours, and the difference of expression level between tumour grades was statistically significant (p < 0.05). The expression level of Her-2 protein was not correlated with the stage of a tumour (p > 0.05). The present study supports earlier findings that over-expression / up-regulation of VEGF and Her - 2 is linked with poor prognosis and may play a vital role in the development and progression of cervical cancer.

  14. Prognostic Significance of Vascular Endothelial Growth Factor (VEGF) and Her-2 Protein in the Genesis of Cervical Carcinoma

    PubMed Central

    Rahmani, Arshad H.; Babiker, Ali Yousif; Alsahli, Mohammed A.; Almatroodi, Saleh A.; Husain, Nazik Elmalaika O. S.

    2018-01-01

    BACKGROUND: Angiogenesis plays a pivotal role in the progression of tumours through the formation of new blood vessels. Vascular endothelial growth factor (VEGF) is a chief factor responsible for inducing and regulating angiogenesis. Additionally, the human epidermal growth factor receptor family of receptors also plays an important role in the pathogenesis of tumours. AIM: This study aimed to examine the association between VEGF and Her-2 protein expression and its correlation with clinic-pathological characteristics; in particular, prognosis. METHODS: A total of 65 cases of cervical carcinoma and 10 samples of inflammatory lesions were evaluated for VEGF and Her-2 protein expression. RESULTS: Expression of VEGF and Her-2 was detected in 63.07% and 43.07% in cervical carcinoma cases respectively whereas control cases did not show any expression. The difference in the expression pattern of both markers comparing cancer and control cases was statistically significant (p < 0.05). However, no significant difference in the expression pattern of VEGF protein was observed among the different grades and stages of tumours (p > 0.05). Comparing different grades of a tumour, expression of Her-2 was detected in 31.8% of well-differentiated tumours, 36.0 % in moderately differentiated tumours and 66.66 % in poorly differentiated cancers. The expression of Her-2 was increased in high-grade tumours, and the difference of expression level between tumour grades was statistically significant (p < 0.05). The expression level of Her-2 protein was not correlated with the stage of a tumour (p > 0.05). CONCLUSION: The present study supports earlier findings that over-expression / up-regulation of VEGF and Her - 2 is linked with poor prognosis and may play a vital role in the development and progression of cervical cancer. PMID:29531585

  15. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing

    PubMed Central

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L.

    2016-01-01

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1, an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from −938 to −337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1. We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34+ selected hematopoietic stem and progenitor cells. PMID:27570841

  16. Epigenetic Loss of MLH1 Expression in Normal Human Hematopoietic Stem Cell Clones is Defined by the Promoter CpG Methylation Pattern Observed by High-Throughput Methylation Specific Sequencing.

    PubMed

    Kenyon, Jonathan; Nickel-Meester, Gabrielle; Qing, Yulan; Santos-Guasch, Gabriela; Drake, Ellen; PingfuFu; Sun, Shuying; Bai, Xiaodong; Wald, David; Arts, Eric; Gerson, Stanton L

    Normal human hematopoietic stem and progenitor cells (HPC) lose expression of MLH1 , an important mismatch repair (MMR) pathway gene, with age. Loss of MMR leads to replication dependent mutational events and microsatellite instability observed in secondary acute myelogenous leukemia and other hematologic malignancies. Epigenetic CpG methylation upstream of the MLH1 promoter is a contributing factor to acquired loss of MLH1 expression in tumors of the epithelia and proximal mucosa. Using single molecule high-throughput bisulfite sequencing we have characterized the CpG methylation landscape from -938 to -337 bp upstream of the MLH1 transcriptional start site (position +0), from 30 hematopoietic colony forming cell clones (CFC) either expressing or not expressing MLH1 . We identify a correlation between MLH1 promoter methylation and loss of MLH1 expression. Additionally, using the CpG site methylation frequencies obtained in this study we were able to generate a classification algorithm capable of sorting the expressing and non-expressing CFC. Thus, as has been previously described for many tumor cell types, we report for the first time a correlation between the loss of MLH1 expression and increased MLH1 promoter methylation in CFC derived from CD34 + selected hematopoietic stem and progenitor cells.

  17. Transcription Factor Binding Site Enrichment Analysis in Co-Expression Modules in Celiac Disease

    PubMed Central

    Romero-Garmendia, Irati; Jauregi-Miguel, Amaia; Plaza-Izurieta, Leticia; Cros, Marie-Pierre; Legarda, Maria; Irastorza, Iñaki; Herceg, Zdenko; Fernandez-Jimenez, Nora

    2018-01-01

    The aim of this study was to construct celiac co-expression patterns at a whole genome level and to identify transcription factors (TFs) that could drive the gliadin-related changes in coordination of gene expression observed in celiac disease (CD). Differential co-expression modules were identified in the acute and chronic responses to gliadin using expression data from a previous microarray study in duodenal biopsies. Transcription factor binding site (TFBS) and Gene Ontology (GO) annotation enrichment analyses were performed in differentially co-expressed genes (DCGs) and selection of candidate regulators was performed. Expression of candidates was measured in clinical samples and the activation of the TFs was further characterized in C2BBe1 cells upon gliadin challenge. Enrichment analyses of the DCGs identified 10 TFs and five were selected for further investigation. Expression changes related to active CD were detected in four TFs, as well as in several of their in silico predicted targets. The activation of TFs was further characterized in C2BBe1 cells upon gliadin challenge, and an increase in nuclear translocation of CAMP Responsive Element Binding Protein 1 (CREB1) and IFN regulatory factor-1 (IRF1) in response to gliadin was observed. Using transcriptome-wide co-expression analyses we are able to propose novel genes involved in CD pathogenesis that respond upon gliadin stimulation, also in non-celiac models. PMID:29748492

  18. Transcription Factor Binding Site Enrichment Analysis in Co-Expression Modules in Celiac Disease.

    PubMed

    Romero-Garmendia, Irati; Garcia-Etxebarria, Koldo; Hernandez-Vargas, Hector; Santin, Izortze; Jauregi-Miguel, Amaia; Plaza-Izurieta, Leticia; Cros, Marie-Pierre; Legarda, Maria; Irastorza, Iñaki; Herceg, Zdenko; Fernandez-Jimenez, Nora; Bilbao, Jose Ramon

    2018-05-10

    The aim of this study was to construct celiac co-expression patterns at a whole genome level and to identify transcription factors (TFs) that could drive the gliadin-related changes in coordination of gene expression observed in celiac disease (CD). Differential co-expression modules were identified in the acute and chronic responses to gliadin using expression data from a previous microarray study in duodenal biopsies. Transcription factor binding site (TFBS) and Gene Ontology (GO) annotation enrichment analyses were performed in differentially co-expressed genes (DCGs) and selection of candidate regulators was performed. Expression of candidates was measured in clinical samples and the activation of the TFs was further characterized in C2BBe1 cells upon gliadin challenge. Enrichment analyses of the DCGs identified 10 TFs and five were selected for further investigation. Expression changes related to active CD were detected in four TFs, as well as in several of their in silico predicted targets. The activation of TFs was further characterized in C2BBe1 cells upon gliadin challenge, and an increase in nuclear translocation of CAMP Responsive Element Binding Protein 1 (CREB1) and IFN regulatory factor-1 (IRF1) in response to gliadin was observed. Using transcriptome-wide co-expression analyses we are able to propose novel genes involved in CD pathogenesis that respond upon gliadin stimulation, also in non-celiac models.

  19. Molecular characterization of a KIF3B-like kinesin gene in the testis of Octopus tankahkeei (Cephalopoda, Octopus).

    PubMed

    Dang, Ran; Zhu, Jun-Quan; Tan, Fu-Qing; Wang, Wei; Zhou, Hong; Yang, Wan-Xi

    2012-05-01

    KIF3B is known for maintaining and assembling cilia and flagellum. To date, the function of KIF3B and its relationship with KIF3A during spermiogenesis in the cephalopod Octopus tankahkeei remains unknown. In the present study, we characterized a gene encoding a homologue of rat KIF3B in the O. tankahkeei testis and examined its temporal and spatial expression pattern during spermiogenesis. The cDNA of KIF3B was obtained with degenerate and RACE PCR and the distribution pattern of ot-kif3b were observed with RT-PCR. The morphological development during spermiogenesis was illustrated by histological and transmission electron microscopy and mRNA expression of ot-kif3b was observed by in situ hybridization. The 2,365 nucleotides cDNA consisted of a 102 bp 5' untranslated region (UTR), a 2,208 bp open reading frame (ORF) encoding a protein of 736 amino acids, and a 55 bp 3' UTR. Multiple alignments revealed that the putative Ot-KIF3B shared 68, 68, 69, 68, and 67% identity with that of Homo sapiens, Mus musculus, Gallus gallus, Danio rerio, and Xenopus laevis, respectively, along with high identities with Ot-KIF3A in fundamental structures. Ot-kif3b transcripts appeared gradually in early spermatids, increased in intermediate spermatids and maximized in drastically remodeled and final spermatids. The kif3b gene is identified and its expression pattern is demonstrated for the first time in O. tankahkeei. Compared to ot-kif3a reported by our laboratory before, our data suggested that the putative heterodimeric motor proteins Ot-KIF3A/B may be involved in intraspermatic transport and might contribute to structural changes during spermiogenesis.

  20. Transcriptional responses of zebrafish to complex metal mixtures in laboratory studies overestimates the responses observed with environmental water.

    PubMed

    Pradhan, Ajay; Ivarsson, Per; Ragnvaldsson, Daniel; Berg, Håkan; Jass, Jana; Olsson, Per-Erik

    2017-04-15

    Metals released into the environment continue to be of concern for human health. However, risk assessment of metal exposure is often based on total metal levels and usually does not take bioavailability data, metal speciation or matrix effects into consideration. The continued development of biological endpoint analyses are therefore of high importance for improved eco-toxicological risk analyses. While there is an on-going debate concerning synergistic or additive effects of low-level mixed exposures there is little environmental data confirming the observations obtained from laboratory experiments. In the present study we utilized qRT-PCR analysis to identify key metal response genes to develop a method for biomonitoring and risk-assessment of metal pollution. The gene expression patterns were determined for juvenile zebrafish exposed to waters from sites down-stream of a closed mining operation. Genes representing different physiological processes including stress response, inflammation, apoptosis, drug metabolism, ion channels and receptors, and genotoxicity were analyzed. The gene expression patterns of zebrafish exposed to laboratory prepared metal mixes were compared to the patterns obtained with fish exposed to the environmental samples with the same metal composition and concentrations. Exposure to environmental samples resulted in fewer alterations in gene expression compared to laboratory mixes. A biotic ligand model (BLM) was used to approximate the bioavailability of the metals in the environmental setting. However, the BLM results were not in agreement with the experimental data, suggesting that the BLM may be overestimating the risk in the environment. The present study therefore supports the inclusion of site-specific biological analyses to complement the present chemical based assays used for environmental risk-assessment. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Maize Opaque Endosperm Mutations Create Extensive Changes in Patterns of Gene ExpressionW⃞

    PubMed Central

    Hunter, Brenda G.; Beatty, Mary K.; Singletary, George W.; Hamaker, Bruce R.; Dilkes, Brian P.; Larkins, Brian A.; Jung, Rudolf

    2002-01-01

    Maize starchy endosperm mutants have kernel phenotypes that include a brittle texture, susceptibility to insect pests, and inferior functional characteristics of products made from their flour. At least 18 such mutants have been identified, but only in the cases of opaque2 (o2) and floury2 (fl2), which affect different aspects of storage protein synthesis, is the molecular basis of the mutation known. To better understand the relationship between the phenotypes of these mutants and their biochemical bases, we characterized the protein and amino acid composition, as well as the mRNA transcript profiles, of nearly isogenic inbred lines of W64A o1, o2, o5, o9, o11, Mucuronate (Mc), Defective endosperm B30 (DeB30), and fl2. The largest reductions in zein protein synthesis occur in the W64A o2, DeB30, and fl2 mutants, which have ∼35 to 55% of the wild-type level of storage proteins. Zeins in W64A o5, o9, o11, and Mc are within 80 to 90% of the amount found in the wild type. Only in the cases of o5 and Mc were significant qualitative changes in zein synthesis observed. The pattern of gene expression in normal and mutant genotypes was assayed by profiling endosperm mRNA transcripts at 18 days after pollination with an Affymetrix GeneChip containing >1400 selected maize gene sequences. Compared with W64A sugary1, a mutant defective in starch synthesis, alterations in the gene expression patterns of the opaque mutants are very pleiotropic. Increased expression of genes associated with physiological stress, and the unfolded protein response, are common features of the opaque mutants. Based on global patterns of gene expression, these mutants were categorized in four phenotypic groups as follows: W64A+ and o1; o2; o5/o9/o11; and Mc and fl2. PMID:12368507

  2. Acidic digestion in a teleost: postprandial and circadian pattern of gastric pH, pepsin activity, and pepsinogen and proton pump mRNAs expression.

    PubMed

    Yúfera, Manuel; Moyano, Francisco J; Astola, Antonio; Pousão-Ferreira, Pedro; Martínez-Rodríguez, Gonzalo

    2012-01-01

    Two different modes for regulation of stomach acid secretion have been described in vertebrates. Some species exhibit a continuous acid secretion maintaining a low gastric pH during fasting. Others, as some teleosts, maintain a neutral gastric pH during fasting while the hydrochloric acid is released only after the ingestion of a meal. Those different patterns seem to be closely related to specific feeding habits. However, our recent observations suggest that this acidification pattern could be modified by changes in daily feeding frequency and time schedule. The aim of this study was to advance in understanding the regulation mechanisms of stomach digestion and pattern of acid secretion in teleost fish. We have examined the postprandial pattern of gastric pH, pepsin activity, and mRNA expression for pepsinogen and proton pump in white seabream juveniles maintained under a light/dark 12/12 hours cycle and receiving only one morning meal. The pepsin activity was analyzed according to the standard protocol buffering at pH 2 and using the actual pH measured in the stomach. The results show how the enzyme precursor is permanently available while the hydrochloric acid, which activates the zymogen fraction, is secreted just after the ingestion of food. Results also reveal that analytical protocol at pH 2 notably overestimates true pepsin activity in fish stomach. The expression of the mRNA encoding pepsinogen and proton pump exhibited almost parallel patterns, with notable increases during the darkness period and sharp decreases just before the morning meal. These results indicate that white seabream uses the resting hours for recovering the mRNA stock that will be quickly used during the feeding process. Our data clearly shows that both daily illumination pattern and feeding time are involved at different level in the regulation of the secretion of digestive juices.

  3. Emergence of the self-similar property in gene expression dynamics

    NASA Astrophysics Data System (ADS)

    Ochiai, T.; Nacher, J. C.; Akutsu, T.

    2007-08-01

    Many theoretical models have recently been proposed to understand the structure of cellular systems composed of various types of elements (e.g., proteins, metabolites and genes) and their interactions. However, the cell is a highly dynamic system with thousands of functional elements fluctuating across temporal states. Therefore, structural analysis alone is not sufficient to reproduce the cell's observed behavior. In this article, we analyze the gene expression dynamics (i.e., how the amount of mRNA molecules in cell fluctuate in time) by using a new constructive approach, which reveals a symmetry embedded in gene expression fluctuations and characterizes the dynamical equation of gene expression (i.e., a specific stochastic differential equation). First, by using experimental data of human and yeast gene expression time series, we found a symmetry in short-time transition probability from time t to time t+1. We call it self-similarity symmetry (i.e., the gene expression short-time fluctuations contain a repeating pattern of smaller and smaller parts that are like the whole, but different in size). Secondly, we reconstruct the global behavior of the observed distribution of gene expression (i.e., scaling-law) and the local behavior of the power-law tail of this distribution. This approach may represent a step forward toward an integrated image of the basic elements of the whole cell.

  4. Expression of the Norrie disease gene (Ndp) in developing and adult mouse eye, ear, and brain.

    PubMed

    Ye, Xin; Smallwood, Philip; Nathans, Jeremy

    2011-01-01

    The Norrie disease gene (Ndp) codes for a secreted protein, Norrin, that activates canonical Wnt signaling by binding to its receptor, Frizzled-4. This signaling system is required for normal vascular development in the retina and for vascular survival in the cochlea. In mammals, the pattern of Ndp expression beyond the retina is poorly defined due to the low abundance of Norrin mRNA and protein. Here, we characterize Ndp expression during mouse development by studying a knock-in mouse that carries the coding sequence of human placental alkaline phosphatase (AP) inserted at the Ndp locus (Ndp(AP)). In the CNS, Ndp(AP) expression is apparent by E10.5 and is dynamic and complex. The anatomically delimited regions of Ndp(AP) expression observed prenatally in the CNS are replaced postnatally by widespread expression in astrocytes in the forebrain and midbrain, Bergman glia in the cerebellum, and Müller glia in the retina. In the developing and adult cochlea, Ndp(AP) expression is closely associated with two densely vascularized regions, the stria vascularis and a capillary plexus between the organ of Corti and the spiral ganglion. These observations suggest the possibility that Norrin may have developmental and/or homeostatic functions beyond the retina and cochlea. Copyright © 2010 Elsevier B.V. All rights reserved.

  5. Expression of the Norrie disease gene (Ndp) in developing and adult mouse eye, ear, and brain

    PubMed Central

    Ye, Xin; Smallwood, Philip; Nathans, Jeremy

    2011-01-01

    The Norrie disease gene (Ndp) codes for a secreted protein, Norrin, that activates canonical Wnt signaling by binding to its receptor, Frizzled-4. This signaling system is required for normal vascular development in the retina and for vascular survival in the cochlea. In mammals, the pattern of Ndp expression beyond the retina is poorly defined due to the low abundance of Norrin mRNA and protein. Here we characterize Ndp expression during mouse development by studying a knock-in mouse that carries the coding sequence of human placental alkaline phosphatase (AP) inserted at the Ndp locus (NdpAP). In the CNS, NdpAP expression is apparent by E10.5 and is dynamic and complex. The anatomically delimited regions of NdpAP expression observed prenatally in the CNS are replaced postnatally by widespread expression in astrocytes in the forebrain and midbrain, Bergman glia in the cerebellum, and Müller glia in the retina. In the developing and adult cochlea, NdpAP expression is closely associated with two densely vascularized regions, the stria vascularis and a capillary plexus between the organ of Corti and the spiral ganglion. These observations suggest the possibility that Norrin may have developmental and/or homeostatic functions beyond the retina and cochlea. PMID:21055480

  6. Quantitative expression analysis of selected transcription factors in pavement, basal and trichome cells of mature leaves from Arabidopsis thaliana

    PubMed Central

    Schliep, Martin; Ebert, Berit; Simon-Rosin, Ulrike; Zoeller, Daniela

    2010-01-01

    Gene expression levels of several transcription factors from Arabidopsis thaliana that were described previously to be involved in leaf development and trichome formation were analysed in trichome, basal and pavement cells of mature leaves. Single cell samples of these three cells types were collected by glass micro-capillaries. Real-time reverse transcription (RT)-PCR was used to analyse expression patterns of the following transcription factors: MYB23, MYB55, AtHB1, FILAMENTOUS FLOWER (FIL)/YABBY1 (YAB1), TRIPTYCHON (TRY) and CAPRICE (CPC). A difference in the expression patterns of TRY and CPC was revealed. Contrary to the CPC expression pattern, no transcripts of TRY could be detected in pavement cells. FIL/YAB1 was exclusively expressed in trichome cells. AtHB1 was highly expressed throughout all three cell types. MYB55 was higher expressed in basal cells than in trichome and pavement cells. MYB23 showed a pattern of low expression in pavement cells, medium in basal cells and high expression in trichomes. Expression patterns obtained by single cell sampling and real-time RT-PCR were compared to promoter GUS fusions of the selected transcription factors. Therefore, we regenerated two transgenic Arabidopsis lines that expressed the GUS reporter gene under control of the promoters of MYB55 and YAB1. In conclusion, despite their function in leaf morphogenesis, all six transcription factors were detected in mature leaves. Furthermore, single cell sampling and promoter GUS staining patterns demonstrated the predominant presence of MYB55 in basal cells as compared to pavement cells and trichomes. PMID:20101514

  7. Quantitative expression analysis of selected transcription factors in pavement, basal and trichome cells of mature leaves from Arabidopsis thaliana.

    PubMed

    Schliep, Martin; Ebert, Berit; Simon-Rosin, Ulrike; Zoeller, Daniela; Fisahn, Joachim

    2010-05-01

    Gene expression levels of several transcription factors from Arabidopsis thaliana that were described previously to be involved in leaf development and trichome formation were analysed in trichome, basal and pavement cells of mature leaves. Single cell samples of these three cells types were collected by glass micro-capillaries. Real-time reverse transcription (RT)-PCR was used to analyse expression patterns of the following transcription factors: MYB23, MYB55, AtHB1, FILAMENTOUS FLOWER (FIL)/YABBY1 (YAB1), TRIPTYCHON (TRY) and CAPRICE (CPC). A difference in the expression patterns of TRY and CPC was revealed. Contrary to the CPC expression pattern, no transcripts of TRY could be detected in pavement cells. FIL/YAB1 was exclusively expressed in trichome cells. AtHB1 was highly expressed throughout all three cell types. MYB55 was higher expressed in basal cells than in trichome and pavement cells. MYB23 showed a pattern of low expression in pavement cells, medium in basal cells and high expression in trichomes. Expression patterns obtained by single cell sampling and real-time RT-PCR were compared to promoter GUS fusions of the selected transcription factors. Therefore, we regenerated two transgenic Arabidopsis lines that expressed the GUS reporter gene under control of the promoters of MYB55 and YAB1. In conclusion, despite their function in leaf morphogenesis, all six transcription factors were detected in mature leaves. Furthermore, single cell sampling and promoter GUS staining patterns demonstrated the predominant presence of MYB55 in basal cells as compared to pavement cells and trichomes.

  8. Prothymosin-α and parathymosin expression predicts poor prognosis in squamous and adenosquamous carcinomas of the gallbladder

    PubMed Central

    Chen, Kang; Xiong, Li; Yang, Zhuling; Huang, Shengfu; Zeng, Rong; Miao, Xiongying

    2018-01-01

    The present study aimed to investigate the expression patterns of prothymosin-α (PTMA) and parathymosin (PTMS) in patients with squamous cell carcinoma (SCC), adenosquamous cell carcinoma (ASC) and adenocarcinoma (AC) of the gallbladder, and to assess their association with the clinicopathological characteristics and prognosis of the patients. A retrospective analysis of data pertaining to patients with SCC/ASC (n=46) and AC (n=80) of the gallbladder, who were treated with surgical resection, was conducted. Kaplan-Meier survival analysis was also performed to assess the correlation of the expression pattern with survival. The results revealed a higher percentage of patients with a large tumor diameter (>3 cm) in the SCC/ASC group as compared with those in the AC group (P<0.05). No significant differences were observed between patients with SCC/ASC and those with AC with respect to the patient sex, presence of gallstones, TNM stage, lymph node metastasis, invasive growth into anatomically contiguous structures, surgical methods used, survival rate, and the expression levels of PTMA and PTMA (P>0.05). However, positive expression of PTMA and PTMA was associated with tumor size, TNM stage, lymph node metastasis, locally invasive growth, and treatment with radical resection in patients with SCC/ASC and AC (P<0.05). In addition, positive expression of PTMA and PTMA was observed in a significantly lower number of patients with advanced AC as compared with those in early AC (P<0.05), while these expression levels were also associated with shorter survival in the SCC/ASC group and AC group (P<0.05). Cox multivariate analysis also demonstrated a negative correlation between PTMA and PTMA levels, and the postoperative survival rate in the two groups. In conclusion, the present study indicated that the expression levels of PTMA and PTMA were closely associated with the tumorigenesis and progression of SCC, ASC and AC of the gallbladder. Positive expression of PTMA and PTMA may serve as a valuable prognostic factor in these patients. PMID:29541218

  9. Examining Communicative Behaviors in a 3-Year-Old Boy Who Is Blind.

    ERIC Educational Resources Information Center

    Perfect, Michelle M.

    2001-01-01

    The communication patterns of a 3-year-old boy who is blind were observed during 35 videotaped classroom sessions to determine if his echolalic responses varied according to school activity and message category. Analysis revealed that, although the child was expressive with adults, he had difficulty communicating with his peers and in producing…

  10. Modeling leaderless transcription and atypical genes results in more accurate gene prediction in prokaryotes.

    PubMed

    Lomsadze, Alexandre; Gemayel, Karl; Tang, Shiyuyun; Borodovsky, Mark

    2018-05-17

    In a conventional view of the prokaryotic genome organization, promoters precede operons and ribosome binding sites (RBSs) with Shine-Dalgarno consensus precede genes. However, recent experimental research suggesting a more diverse view motivated us to develop an algorithm with improved gene-finding accuracy. We describe GeneMarkS-2, an ab initio algorithm that uses a model derived by self-training for finding species-specific (native) genes, along with an array of precomputed "heuristic" models designed to identify harder-to-detect genes (likely horizontally transferred). Importantly, we designed GeneMarkS-2 to identify several types of distinct sequence patterns (signals) involved in gene expression control, among them the patterns characteristic for leaderless transcription as well as noncanonical RBS patterns. To assess the accuracy of GeneMarkS-2, we used genes validated by COG (Clusters of Orthologous Groups) annotation, proteomics experiments, and N-terminal protein sequencing. We observed that GeneMarkS-2 performed better on average in all accuracy measures when compared with the current state-of-the-art gene prediction tools. Furthermore, the screening of ∼5000 representative prokaryotic genomes made by GeneMarkS-2 predicted frequent leaderless transcription in both archaea and bacteria. We also observed that the RBS sites in some species with leadered transcription did not necessarily exhibit the Shine-Dalgarno consensus. The modeling of different types of sequence motifs regulating gene expression prompted a division of prokaryotic genomes into five categories with distinct sequence patterns around the gene starts. © 2018 Lomsadze et al.; Published by Cold Spring Harbor Laboratory Press.

  11. Effects of microbial transglutaminase on physicochemical properties, electrophoretic patterns and sensory attributes of veggie burger.

    PubMed

    Forghani, Zahra; Eskandari, Mohammad Hadi; Aminlari, Mahmoud; Shekarforoush, Seyed Shahram

    2017-07-01

    The main objective of this study was to investigate the effects of microbial-transglutaminase (MTGase 0-0.75%)/sodium-caseinate (SC 0-2%) as crosslinker agents on proximate analysis, binding properties (expressible moisture and shrinkage), texture analysis, electrophoretic patterns, instrumental color, and sensory properties of veggie burgers. Addition of SC and MTGase positively affected shrinkage and expressible moisture. It also increased hardness, springiness, chewiness, and cutting-force of burgers. Presence of SC had no effects on cohesiveness of burgers. Total protein and ash of samples were increased by treatment with SC. The lightness (L*) of samples was significantly decreased by 0.75% MTGase. No significant influence of SC on samples color parameters was observed. The results indicated that distinct protein bands were not formed on the SDS-PAGE of burger samples and resulted in a smearing pattern on the gel. When soy-protein was incubated with MTGase, a progressive decrease in the intensity of the bands corresponding to the subunits 7S and 11S globulins was observed concomitant with disappearance of A3 and B3 bands. Electrophoresis pattern of gluten was slightly changed after MTGase treatment. There were significant differences in color, taste, appearance, mouth feel, and overall acceptability between treated and control samples. Results suggest that production of veggie burgers using MTGase alone or in combination with SC brings about covalent cross-linking between homologous and heterologous proteins to form high-molecular weight polymers, thereby improving the mechanical properties of veggie burgers and profoundly increases the acceptability of the end product.

  12. Genome-wide analysis of alternative splicing in medulloblastoma identifies splicing patterns characteristic of normal cerebellar development

    PubMed Central

    Menghi, Francesca; Jacques, Thomas S.; Barenco, Martino; Schwalbe, Ed C.; Clifford, Steven C.; Hubank, Mike; Ham, Jonathan

    2011-01-01

    Alternative splicing is an important mechanism for the generation of protein diversity at a post-transcriptional level. Modifications in the splicing patterns of several genes have been shown to contribute to the malignant transformation of different tissue types. In this study, we used the Affymetrix Exon arrays to investigate patterns of differential splicing between paediatric medulloblastomas and normal cerebellum on a genome-wide scale. Of the 1262 genes identified as potentially generating tumour-associated splice forms, we selected 14 examples of differential splicing of known cassette exons and successfully validated 11 of them by RT-PCR. The pattern of differential splicing of three validated events was characteristic for the molecular subset of Sonic Hedgehog (Shh)-driven medulloblastomas, suggesting that their unique gene signature includes the expression of distinctive transcript variants. Generally, we observed that tumour and normal fetal cerebellar samples shared significantly lower exon inclusion rates compared to normal adult cerebellum. We investigated whether tumour-associated splice forms were expressed in primary cultures of Shh-dependent mouse cerebellar granule cell precursors (GCPs) and found that Shh caused a decrease in the cassette exon inclusion rate of five out of the seven tested genes. Furthermore, we observed a significant increase in exon inclusion between post-natal days 7 and 14 of mouse cerebellar development, at the time when GCPs mature into post-mitotic neurons. We conclude that inappropriate splicing frequently occurs in human medulloblastomas and may be linked to the activation of developmental signalling pathways and a failure of cerebellar precursor cells to differentiate. PMID:21248070

  13. Harvest patterns and effort dynamics of indigenous and non-indigenous commercial sectors of the eastern Torres Strait reef line fishery

    NASA Astrophysics Data System (ADS)

    Williams, Ashley J.; Ballagh, Aaron C.; Begg, Gavin A.; Murchie, Cameron D.; Currey, Leanne M.

    2008-09-01

    The reef line fishery (RLF) in eastern Torres Strait (ETS) is unique in that it has both a commercial indigenous sector and a commercial non-indigenous sector. Recently, concerns have been expressed by all stakeholders about the long-term sustainability of the fishery. These concerns have been exacerbated by the lack of detailed catch and effort information from both sectors, which has precluded any formal assessment of the fishery. In this paper, we characterise the harvest patterns and effort dynamics of the indigenous and non-indigenous commercial sectors of the ETS RLF using a range of data sources including commercial logbooks, community freezer records, voluntary logbooks and observer surveys. We demonstrate that bycatch is a significant component of the catch for both sectors and identify substantial differences in harvest patterns and effort dynamics between the sectors. Differences between sectors were observed in species composition and spatial and temporal patterns in catch, effort and catch per unit effort. These results highlight the inherent variation in catch and effort dynamics between the two commercial sectors of the ETS RLF and provide valuable information for the development of future assessments and appropriate management strategies for the fishery. The more reliable estimates of harvest patterns and effort dynamics for both sectors obtained from observer surveys will also assist in resolving issues relating to allocation of reef fish resources in Torres Strait.

  14. Function does not follow form in gene regulatory circuits.

    PubMed

    Payne, Joshua L; Wagner, Andreas

    2015-08-20

    Gene regulatory circuits are to the cell what arithmetic logic units are to the chip: fundamental components of information processing that map an input onto an output. Gene regulatory circuits come in many different forms, distinct structural configurations that determine who regulates whom. Studies that have focused on the gene expression patterns (functions) of circuits with a given structure (form) have examined just a few structures or gene expression patterns. Here, we use a computational model to exhaustively characterize the gene expression patterns of nearly 17 million three-gene circuits in order to systematically explore the relationship between circuit form and function. Three main conclusions emerge. First, function does not follow form. A circuit of any one structure can have between twelve and nearly thirty thousand distinct gene expression patterns. Second, and conversely, form does not follow function. Most gene expression patterns can be realized by more than one circuit structure. And third, multifunctionality severely constrains circuit form. The number of circuit structures able to drive multiple gene expression patterns decreases rapidly with the number of these patterns. These results indicate that it is generally not possible to infer circuit function from circuit form, or vice versa.

  15. Dexmedetomidine and propofol sedation requirements in an autistic rat model.

    PubMed

    Elmorsy, Soha A; Soliman, Ghada F; Rashed, Laila A; Elgendy, Hamed

    2018-05-30

    Autism is a challenging neurodevelopmental disorder. Previous clinical observations suggest altered sedation requirements for autistic children. Our study aimed to test this observation experimentally with an animal model and, to explore its possible mechanisms. Eight adult pregnant female Sprague Dawley rats were randomly selected into two groups. Four were injected with intraperitoneal sodium valproate on the gestational day 12 and four were injected with normal saline. On post-natal day 28 the newborn male rats were subjected to an open field test to confirm autistic features. Each rat was injected intraperitoneally with a single dose of propofol (50 mg/kg) or dexmedetomidine (0.2 mg/kg). Times to Loss of Righting Reflex (LORR) and to Return of Righting Reflex (RORR) were recorded. On the next day, all rats were re-sedated and their EEGs were recorded. The rats were sacrificed and hippocampal GABAA and glutamate NMDA receptor gene expression were assessed. Autistic rats showed significantly longer time to LORR and a shorter time to RORR compared to controls (Median time to LORR: 12.0 versus 5.0 for dexmedetomidine and 22.0 and 8.0 for propofol; p < 0.05). EEG showed a low frequency, high amplitude wave pattern two minutes after LORR in control rats. Autistic rats showed a high frequency, low amplitude awake pattern. Hippocampal GABAA receptor gene expression was significantly less in autistic rats and NMDA gene expression was greater. This study in rat supports the clinical observations of increased anesthetic sedative requirements in autistic children and proposes a mechanism for it.

  16. Cultural similarities and differences in the perception of emotional valence and intensity: a comparison of Americans and Hong Kong Chinese.

    PubMed

    Zhu, Zhuoying; Ho, Samuel M Y; Bonanno, George A

    2013-01-01

    Despite being challenged for their ecological validity, studies of emotion perception have often relied on static, posed expressions. One of the key reasons is that dynamic, spontaneous expressions are difficult to control because of the existence of display rules and frequent co-occurrence of non-emotion related facial movements. The present study investigated cross-cultural patterns in the perception of emotion using an expressive regulation paradigm for generating facial expressions. The paradigm largely balances out the competing concerns for ecological and internal validity. Americans and Hong Kong Chinese (expressors) were presented with positively and negatively valenced pictures and were asked to enhance, suppress, or naturally display their facial expressions according to their subjective emotions. Videos of naturalistic and dynamic expressions of emotions were rated by Americans and Hong Kong Chinese (judges) for valence and intensity. The 2 cultures agreed on the valence and relative intensity of emotion expressions, but cultural differences were observed in absolute intensity ratings. The differences varied between positive and negative expressions. With positive expressions, ratings were higher when there was a cultural match between the expressor and the judge and when the expression was enhanced by the expressor. With negative expressions, Chinese judges gave higher ratings than their American counterparts for Chinese expressions under all 3 expressive conditions, and the discrepancy increased with expression intensity; no cultural differences were observed when American expressions were judged. The results were discussed with respect to the "decoding rules" and "same-culture advantage" approaches of emotion perception and a negativity bias in the Chinese collective culture.

  17. Osmoregulation in larvae and juveniles of two recently separated Macrobrachium species: Expression patterns of ion transporter genes.

    PubMed

    Boudour-Boucheker, Nesrine; Boulo, Viviane; Charmantier-Daures, Mireille; Anger, Klaus; Charmantier, Guy; Lorin-Nebel, Catherine

    2016-05-01

    In this comparative study, osmoregulatory mechanisms were analyzed in two closely related species of palaemonid shrimp from Brazil, Macrobrachium pantanalense and Macrobrachium amazonicum. A previous investigation showed that all postembryonic stages of M. pantanalense from inland waters of the Pantanal are able to hyper-osmoregulate in fresh water, while this species was not able to hypo-osmoregulate at high salinities. In M. amazonicum originating from the Amazon estuary, in contrast, all stages are able to hypo-osmoregulate, but only first-stage larvae, late juveniles and adults are able to hyper-osmoregulate in fresh water. The underlying molecular mechanisms of these physiological differences have not been known. We therefore investigated the expression patterns of three ion transporters (NKA α-subunit, VHA B-subunit and NHE3) following differential salinity acclimation in different ontogenetic stages (stage-V larvae, juveniles) of both species. Larval NKAα expression was at both salinities significantly higher in M. pantanalense than in M. amazonicum, whereas no difference was noted in juveniles. VHA was also more expressed in larvae of M. pantanalense than in those of M. amazonicum. When NHE3 expression is compared between the larvae of the two species, further salinity-related differences were observed, with generally higher expression in the inland species. Overall, a high expression of ion pumps in M. pantanalense suggests an evolutionary key role of these transporters in freshwater invasion. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Characterization of big bang, a novel gene encoding for PDZ domain-containing proteins that are dynamically expressed throughout Drosophila development.

    PubMed

    Kim, Sabrina Y; Renihan, Maia K; Boulianne, Gabrielle L

    2006-06-01

    PDZ (PSD-95, Discs-large, ZO-1) domain proteins often function as scaffolding proteins and have been shown to play important roles in diverse cellular processes such as the establishment and maintenance of cell polarity, and signal transduction. Here, we report the identification and cloning of a novel Drosophila melanogaster gene that is predicted to produce several different PDZ domain-containing proteins through alternative promoter usage and alternative splicing. This gene, that we have named big bang (bbg), was first identified as C96-GAL4, a GAL4 enhancer trap line that was generated in our lab. To further characterize bbg, its expression pattern was examined in ovaries, embryos, and late third instar larvae using UAS reporter gene constructs, in situ hybridization, or immunocytochemistry. In addition, the expression of alternatively spliced transcripts was examined in more detail using in situ hybridization. We find that during embryogenesis bbg is predominantly expressed in the developing gut, but it is also expressed in external sensory organs found in the epidermis. In the late third instar larva, bbg is expressed along the presumptive wing margin in the wing disc, broadly in the eye disc, and in other imaginal discs as well as in the brain. The expression patterns observed are dynamic and specific during development, suggesting that like other genes that encode for several different PDZ domain protein isoforms, bbg likely plays important roles in multiple developmental processes.

  19. Msx genes are expressed in the carapacial ridge of turtle shell: a study of the European pond turtle, Emys orbicularis.

    PubMed

    Vincent, Christine; Bontoux, Martine; Le Douarin, Nicole M; Pieau, Claude; Monsoro-Burq, Anne-Hélène

    2003-09-01

    The turtle shell forms by extensive ossification of dermis ventrally and dorsally. The carapacial ridge (CR) controls early dorsal shell formation and is thought to play a similar role in shell growth as the apical ectodermal ridge during limb development. However, the molecular mechanisms underlying carapace development are still unknown. Msx genes are involved in the development of limb mesenchyme and of various skeletal structures. In particular, precocious Msx expression is recorded in skeletal precursors that develop close to the ectoderm, such as vertebral spinous processes or skull. Here, we have studied the embryonic expression of Msx genes in the European pond turtle, Emys orbicularis. The overall Msx expression in head, limb, and trunk is similar to what is observed in other vertebrates. We have focused on the CR area and pre-skeletal shell condensations. The CR expresses Msx genes transiently, in a pattern similar to that of fgf10. In the future carapace domain, the dermis located dorsal to the spinal cord expresses Msx genes, as in other vertebrates, but we did not see expansion of this expression in the dermis located more laterally, on top of the dermomyotomes. In the ventral plastron, although the dermal osseous condensations form in the embryonic Msx-positive somatopleura, we did not observe enhanced Msx expression around these elements. These observations may indicate that common mechanisms participate in limb bud and CR early development, but that pre-differentiation steps differ between shell and other skeletal structures and involve other gene activities than that of Msx genes.

  20. Relation Between Motility, Accelerated Aging and Gene Expression in Selected Drosophila Strains under Hypergravity Conditions

    NASA Astrophysics Data System (ADS)

    Serrano, Paloma; van Loon, Jack J. W. A.; Medina, F. Javier; Herranz, Raúl

    2013-02-01

    Motility and aging in Drosophila have proven to be highly modified under altered gravity conditions (both in space and ground simulation facilities). In order to find out how closely connected they are, five strains with altered geotactic response or survival rates were selected and exposed to an altered gravity environment of 2 g. By analysing the different motile and behavioural patterns and the median survival rates, we show that altered gravity leads to changes in motility, which will have a negative impact on the flies' survival. Previous results show a differential gene expression between sessile samples and adults and confirm that environmentally-conditioned behavioural patterns constrain flies' gene expression and life span. Therefore, hypergravity is considered an environmental stress factor and strains that do not respond to this new environment experience an increment in motility, which is the major cause for the observed increased mortality also under microgravity conditions. The neutral-geotaxis selected strain (strain M) showed the most severe phenotype, unable to respond to variations in the gravitational field. Alternatively, the opposite phenotype was observed in positive-geotaxis and long-life selected flies (strains B and L, respectively), suggesting that these populations are less sensitive to alterations in the gravitational load. We conclude that the behavioural response has a greater contribution to aging than the modified energy consumption in altered gravity environments.

  1. Maternal hyperthyroidism alters the pattern of expression of cardiac renin-angiotensin system components in rat offspring.

    PubMed

    Lino, Caroline A; Shibata, Caroline E R; Barreto-Chaves, Maria Luiza M

    2014-03-01

    Changes in perinatal environment can lead to physiological, morphological, or metabolic alterations in adult life. It is well known that thyroid hormones (TH) are critical for the development, growth, and maturation of organs and systems. In addition, TH interact with the renin-angiotensin system (RAS), and both play a critical role in adult cardiovascular function. The objective of this study was to evaluate the effect of maternal hyperthyroidism on cardiac RAS components in pups during development. From gestational day nine (GD9), pregnant Wistar rats received thyroxine (T4, 12 mg/l in tap water; Hyper group) or vehicle (control group). Dams and pups were killed on GD18 and GD20. Serum concentrations of triiodothyronine (T3) and T4 were higher in the Hyper group than in the control group dams. Cardiac hypertrophy was observed in Hyper pups on GD20. Cardiac angiotensin-converting enzyme (ACE) activity was significantly lower in Hyper pups on both GD18 and GD20, but there was no difference in Ang I/Ang II levels. Ang II receptors expression was higher in the Hyper pup heart on GD18. Maternal hyperthyroidism is associated with alterations in fetal development and altered pattern of expression in RAS components, which in addition to cardiac hypertrophy observed on GD20 may represent an important predisposing factor to cardiovascular diseases in adult life.

  2. On the diffraction pattern of bundled rare-earth silicide nanowires on Si(0 0 1).

    PubMed

    Timmer, F; Bahlmann, J; Wollschläger, J

    2017-11-01

    Motivated by the complex diffraction pattern observed for bundled rare-earth silicide nanowires on the Si(0 0 1) surface, we investigate the influence of the width and the spacing distribution of the nanowires on the diffraction pattern. The diffraction pattern of the bundled rare-earth silicide nanowires is analyzed by the binary surface technique applying a kinematic approach to diffraction. Assuming a categorical distribution for the (individual) nanowire size and a Poisson distribution for the size of the spacing between adjacent nanowire-bundles, we are able to determine the parameters of these distributions and derive an expression for the distribution of the nanowire-bundle size. Additionally, the comparison of our simulations to the experimental diffraction pattern reveal that a (1  ×  1)-periodicity on top of the nanowires has to be assumed for a good match.

  3. Solution NMR studies provide structural basis for endotoxin pattern recognition by the innate immune receptor CD14

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Albright, Seth; Chen Bin; Holbrook, Kristen

    CD14 functions as a key pattern recognition receptor for a diverse array of Gram-negative and Gram-positive cell-wall components in the host innate immune response by binding to pathogen-associated molecular patterns (PAMPs) at partially overlapping binding site(s). To determine the potential contribution of CD14 residues in this pattern recognition, we have examined using solution NMR spectroscopy, the binding of three different endotoxin ligands, lipopolysaccharide, lipoteichoic acid, and a PGN-derived compound, muramyl dipeptide to a {sup 15}N isotopically labeled 152-residue N-terminal fragment of sCD14 expressed in Pichia pastoris. Mapping of NMR spectral changes upon addition of ligands revealed that the pattern ofmore » residues affected by binding of each ligand is partially similar and partially different. This first direct structural observation of the ability of specific residue combinations of CD14 to differentially affect endotoxin binding may help explain the broad specificity of CD14 in ligand recognition and provide a structural basis for pattern recognition. Another interesting finding from the observed spectral changes is that the mode of binding may be dynamically modulated and could provide a mechanism for binding endotoxins with structural diversity through a common binding site.« less

  4. The Expression of TaRca2-α Gene Associated with Net Photosynthesis Rate, Biomass and Grain Yield in Bread Wheat (Triticum aestivum L.) under Field Conditions

    PubMed Central

    Saeed, Iqbal; Bachir, Daoura Goudia; Chen, Liang; Hu, Yin-Gang

    2016-01-01

    Improvement in activation of Rubisco by Rubisco activase can potentially enhance CO2 assimilation and photosynthetic efficiency in plants. The three homoeologous copies of TaRca2-α were identified on chromosomes 4AL, 4BS and 4DS (TaRca2-α-4AL, TaRca2-α-4BS, and TaRca2-α-4DS) in bread wheat. Expression patterns of the three copies at heading (Z55), anthesis (Z67) and grain-filling (Z73) stages were investigated through qRT-PCR analyses in a panel of 59 bread wheat genotypes and their effects on net photosynthesis rate (Pn), biomass plant-1 (BMPP) and grain yield plant-1 (GYPP) were further explored. Different but similar expression patterns were observed for the three copies of TaRca2-α at the three growth stages with highest expression at grain-filling stage. TaRca2-α-4BS expressed higher at the three stages than TaRca2-α-4AL and TaRca2-α-4DS. The 59 genotypes could be clustered into three groups as high (7 genotypes), intermediate (41 genotypes) and low (11 genotypes) expression based on the expression of the three copies of TaRca2-α at three growth stages. Significant variations (P<0.01) were observed among the three groups of bread wheat genotypes for Pn, BMPP and GYPP. Generally, the genotypes with higher TaRca2-α expression also showed higher values for Pn, BMPP and GYPP. The expressions of the three copies of TaRca2-α at heading, anthesis and grain-filling stages were positively correlated with Pn, BMPP and GYPP (P<0.01) with stronger association for TaRca2-α-4BS at grain-filling stage. These results revealed that the expression of TaRca2-α contribute substantially to Pn, BMPP and GYPP, and suggested that manipulating TaRca-α expression may efficiently improve Pn, BMPP and GYPP in bread wheat and detecting TaRca-α expression levels with emphasis on TaRca2-α-4BS may be a positive strategy for selection in improving photosynthetic efficiency and grain yield of bread wheat. PMID:27548477

  5. Immunohistochemical analysis of human milk fat globulin expression in extramammary Paget's disease.

    PubMed

    Ohnishi, T; Watanabe, S

    2001-03-01

    Primary extramammary Paget's disease is thought to be an intraepidermal carcinoma indicating apocrine secretory differentiation. In addition to expression in breast tissue, human milk fat globulin (HMFG) is expressed in the normal apocrine glands and tumours with apocrine differentiation. In this study HMFG expression in extramammary Paget's disease was analysed immunohistochemically in 18 cases of primary extramammary Paget's disease and two cases of secondary extramammary Paget's disease. The proportion and staining pattern of positive tumour cells with the anti-HMFG antibody was variable in each case. Cytoplasmic staining was observed frequently in dermal invasion and metastasis of Paget cells. The variabilities were thought to be due to modulation of the cellular localization of the cell surface component, HMFG, according to changes in cellular differentiation or malignant potency.

  6. Epigenetic regulation of serotype expression antagonizes transcriptome dynamics in Paramecium tetraurelia

    PubMed Central

    Cheaib, Miriam; Dehghani Amirabad, Azim; Nordström, Karl J. V.; Schulz, Marcel H.; Simon, Martin

    2015-01-01

    Phenotypic variation of a single genotype is achieved by alterations in gene expression patterns. Regulation of such alterations depends on their time scale, where short-time adaptations differ from permanently established gene expression patterns maintained by epigenetic mechanisms. In the ciliate Paramecium, serotypes were described for an epigenetically controlled gene expression pattern of an individual multigene family. Paradoxically, individual serotypes can be triggered in Paramecium by alternating environments but are then stabilized by epigenetic mechanisms, thus raising the question to which extend their expression follows environmental stimuli. To characterize environmental adaptation in the context of epigenetically controlled serotype expression, we used RNA-seq to characterize transcriptomes of serotype pure cultures. The resulting vegetative transcriptome resource is first analysed for genes involved in the adaptive response to the altered environment. Secondly, we identified groups of genes that do not follow the adaptive response but show co-regulation with the epigenetically controlled serotype system, suggesting that their gene expression pattern becomes manifested by similar mechanisms. In our experimental set-up, serotype expression and the entire group of co-regulated genes were stable among environmental changes and only heat-shock genes altered expression of these gene groups. The data suggest that the maintenance of these gene expression patterns in a lineage represents epigenetically controlled robustness counteracting short-time adaptation processes. PMID:26231545

  7. Integrating Circadian Activity and Gene Expression Profiles to Predict Chronotoxicity of Drosophila suzukii Response to Insecticides

    PubMed Central

    Hamby, Kelly A.; Kwok, Rosanna S.; Zalom, Frank G.; Chiu, Joanna C.

    2013-01-01

    Native to Southeast Asia, Drosophila suzukii (Matsumura) is a recent invader that infests intact ripe and ripening fruit, leading to significant crop losses in the U.S., Canada, and Europe. Since current D. suzukii management strategies rely heavily on insecticide usage and insecticide detoxification gene expression is under circadian regulation in the closely related Drosophila melanogaster, we set out to determine if integrative analysis of daily activity patterns and detoxification gene expression can predict chronotoxicity of D. suzukii to insecticides. Locomotor assays were performed under conditions that approximate a typical summer or winter day in Watsonville, California, where D. suzukii was first detected in North America. As expected, daily activity patterns of D. suzukii appeared quite different between ‘summer’ and ‘winter’ conditions due to differences in photoperiod and temperature. In the ‘summer’, D. suzukii assumed a more bimodal activity pattern, with maximum activity occurring at dawn and dusk. In the ‘winter’, activity was unimodal and restricted to the warmest part of the circadian cycle. Expression analysis of six detoxification genes and acute contact bioassays were performed at multiple circadian times, but only in conditions approximating Watsonville summer, the cropping season, when most insecticide applications occur. Five of the genes tested exhibited rhythmic expression, with the majority showing peak expression at dawn (ZT0, 6am). We observed significant differences in the chronotoxicity of D. suzukii towards malathion, with highest susceptibility at ZT0 (6am), corresponding to peak expression of cytochrome P450s that may be involved in bioactivation of malathion. High activity levels were not found to correlate with high insecticide susceptibility as initially hypothesized. Chronobiology and chronotoxicity of D. suzukii provide valuable insights for monitoring and control efforts, because insect activity as well as insecticide timing and efficacy are crucial considerations for pest management. However, field research is necessary for extrapolation to agricultural settings. PMID:23861907

  8. Genomic identification, characterization and differential expression analysis of SBP-box gene family in Brassica napus.

    PubMed

    Cheng, Hongtao; Hao, Mengyu; Wang, Wenxiang; Mei, Desheng; Tong, Chaobo; Wang, Hui; Liu, Jia; Fu, Li; Hu, Qiong

    2016-09-08

    SBP-box genes belong to one of the largest families of transcription factors. Though members of this family have been characterized to be important regulators of diverse biological processes, information of SBP-box genes in the third most important oilseed crop Brassica napus is largely undefined. In the present study, by whole genome bioinformatics analysis and transcriptional profiling, 58 putative members of SBP-box gene family in oilseed rape (Brassica napus L.) were identified and their expression pattern in different tissues as well as possible interaction with miRNAs were analyzed. In addition, B. napus lines with contrasting branch angle were used for investigating the involvement of SBP-box genes in plant architecture regulation. Detailed gene information, including genomic organization, structural feature, conserved domain and phylogenetic relationship of the genes were systematically characterized. By phylogenetic analysis, BnaSBP proteins were classified into eight distinct groups representing the clear orthologous relationships to their family members in Arabidopsis and rice. Expression analysis in twelve tissues including vegetative and reproductive organs showed different expression patterns among the SBP-box genes and a number of the genes exhibit tissue specific expression, indicating their diverse functions involved in the developmental process. Forty-four SBP-box genes were ascertained to contain the putative miR156 binding site, with 30 and 14 of the genes targeted by miR156 at the coding and 3'UTR region, respectively. Relative expression level of miR156 is varied across tissues. Different expression pattern of some BnaSBP genes and the negative correlation of transcription levels between miR156 and its target BnaSBP gene were observed in lines with different branch angle. Taken together, this study represents the first systematic analysis of the SBP-box gene family in Brassica napus. The data presented here provides base foundation for understanding the crucial roles of BnaSBP genes in plant development and other biological processes.

  9. CFTR expression and organ damage in cystic fibrosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tizzano, E.; Chitayat, D.; Buchwald, M.

    1994-09-01

    To assist our understanding of the origin of organ damage caused by cystic fibrosis (CF) disease, we have analyzed the pattern of expression of the CF gene (CFTR). mRNA in situ hybridization analysis was carried out in human fetal, newborn, infant and adult tissues and the abundance of the mRNA was correlated with the known pathology at the various stages of human development. Analysis of the pattern of expression indicates a constitutive level of mRNA in gastrointestinal tissues starting during early development and maintained throughout life. Prenatal respiratory tissues show qualitative and quantitative major differences in comparison to postnatal lungmore » samples. Male reproductive tissues show high levels of expression in the head of the epididymis compared with the rest of the male ducts. Female reproductive tissues show a variable pattern of expression at different stages during fetal development and during puberty probably due to changes in hormonal levels. Gastrointestinal and male reproductive tissues have a consistent pathology at birth, whereas no lung abnormalities have been described in newborns affected by CF. Our results show that there is no exact correlations between organ damage present at birth and the degree of CFTR expression. To explain these observations, we hypothesize that the pathogenesis of organ damage in CF depend on at least three factors: the rate of CFTR-mediated fluid secretion, differences in genotype and environmental factors, such as the amount of macromolecules in the lumen of the ducts. This last element predicts that damage will occur in tissues with high protein loads and low flow rates (e.g. pancreas, epididymis), where the absence of CFTR function leads to obstruction and pathology. Organs that express CFTR but with no significant damage (e.g. prenatal lung, female reproductive tissues), will have a low protein load and a high flow rates.« less

  10. Integrating circadian activity and gene expression profiles to predict chronotoxicity of Drosophila suzukii response to insecticides.

    PubMed

    Hamby, Kelly A; Kwok, Rosanna S; Zalom, Frank G; Chiu, Joanna C

    2013-01-01

    Native to Southeast Asia, Drosophila suzukii (Matsumura) is a recent invader that infests intact ripe and ripening fruit, leading to significant crop losses in the U.S., Canada, and Europe. Since current D. suzukii management strategies rely heavily on insecticide usage and insecticide detoxification gene expression is under circadian regulation in the closely related Drosophila melanogaster, we set out to determine if integrative analysis of daily activity patterns and detoxification gene expression can predict chronotoxicity of D. suzukii to insecticides. Locomotor assays were performed under conditions that approximate a typical summer or winter day in Watsonville, California, where D. suzukii was first detected in North America. As expected, daily activity patterns of D. suzukii appeared quite different between 'summer' and 'winter' conditions due to differences in photoperiod and temperature. In the 'summer', D. suzukii assumed a more bimodal activity pattern, with maximum activity occurring at dawn and dusk. In the 'winter', activity was unimodal and restricted to the warmest part of the circadian cycle. Expression analysis of six detoxification genes and acute contact bioassays were performed at multiple circadian times, but only in conditions approximating Watsonville summer, the cropping season, when most insecticide applications occur. Five of the genes tested exhibited rhythmic expression, with the majority showing peak expression at dawn (ZT0, 6am). We observed significant differences in the chronotoxicity of D. suzukii towards malathion, with highest susceptibility at ZT0 (6am), corresponding to peak expression of cytochrome P450s that may be involved in bioactivation of malathion. High activity levels were not found to correlate with high insecticide susceptibility as initially hypothesized. Chronobiology and chronotoxicity of D. suzukii provide valuable insights for monitoring and control efforts, because insect activity as well as insecticide timing and efficacy are crucial considerations for pest management. However, field research is necessary for extrapolation to agricultural settings.

  11. PiiL: visualization of DNA methylation and gene expression data in gene pathways.

    PubMed

    Moghadam, Behrooz Torabi; Zamani, Neda; Komorowski, Jan; Grabherr, Manfred

    2017-08-02

    DNA methylation is a major mechanism involved in the epigenetic state of a cell. It has been observed that the methylation status of certain CpG sites close to or within a gene can directly affect its expression, either by silencing or, in some cases, up-regulating transcription. However, a vertebrate genome contains millions of CpG sites, all of which are potential targets for methylation, and the specific effects of most sites have not been characterized to date. To study the complex interplay between methylation status, cellular programs, and the resulting phenotypes, we present PiiL, an interactive gene expression pathway browser, facilitating analyses through an integrated view of methylation and expression on multiple levels. PiiL allows for specific hypothesis testing by quickly assessing pathways or gene networks, where the data is projected onto pathways that can be downloaded directly from the online KEGG database. PiiL provides a comprehensive set of analysis features that allow for quick and specific pattern searches. Individual CpG sites and their impact on host gene expression, as well as the impact on other genes present in the regulatory network, can be examined. To exemplify the power of this approach, we analyzed two types of brain tumors, Glioblastoma multiform and lower grade gliomas. At a glance, we could confirm earlier findings that the predominant methylation and expression patterns separate perfectly by mutations in the IDH genes, rather than by histology. We could also infer the IDH mutation status for samples for which the genotype was not known. By applying different filtering methods, we show that a subset of CpG sites exhibits consistent methylation patterns, and that the status of sites affect the expression of key regulator genes, as well as other genes located downstream in the same pathways. PiiL is implemented in Java with focus on a user-friendly graphical interface. The source code is available under the GPL license from https://github.com/behroozt/PiiL.git .

  12. Presenilin expression during induced differentiation of the human neuroblastoma SH-SY5Y cell line.

    PubMed

    Flood, Fiona; Sundström, Erik; Samuelsson, Eva-Britt; Wiehager, Birgitta; Seiger, Ake; Johnston, Janet A; Cowburn, Richard F

    2004-06-01

    Human neuroblastoma SH-SY5Y cells stably transfected with both wild-type and exon-9 deleted (deltaE9) presenilin constructs were used to study the role of the presenilin proteins during differentiation. Cells transfected with either wild-type or deltaE9 PS1, of which the latter abolishes normal endoproteolytic cleavage of the protein, showed no obvious differences in their ability to differentiate to a neuronal-like phenotype upon treatment with retinoic acid (RA). A defined pattern of PS1 expression was observed during differentiation with both RA and the phorbol ester TPA. Full-length PS1 was shown to increase dramatically within 5-24 h of RA treatment. TPA gave an earlier and longer lasting increase in full-length PS1 levels. The intracellular distribution pattern of PS1 was markedly altered following RA treatment. Within 24h PS1 was highly up-regulated throughout the cell body around the nucleus. Between 2 and 4 weeks PS1 staining appeared punctate and also localised to the nucleus. Increases in PS1 expression upon treatment with RA and TPA were blocked by treatment with cycloheximide, indicating a role of de-novo protein synthesis in this effect. PS2 expression remained unchanged during differentiation. Levels of full-length PS1 were also seen to increase during neurogenesis and neuronal differentiation in the forebrain of first trimester human foetuses between 6.5 and 11 weeks. These combined observations support the idea that PS1 is involved in neuronal differentiation by a mechanism likely independent of endoproteolysis of the protein.

  13. Lipid metabolism-related gene expression pattern of Atlantic bluefin tuna (Thunnus thynnus L.) larvae fed on live prey.

    PubMed

    Betancor, Mónica B; Ortega, Aurelio; de la Gándara, Fernando; Tocher, Douglas R; Mourente, Gabriel

    2017-04-01

    The present study is the first to evaluate lipid metabolism in first-feeding Atlantic bluefin tuna (ABT; Thunnus thynnus L.) larvae fed different live prey including enriched rotifers Brachionus plicatilis and Acartia sp. copepod nauplii from 2 days after hatch. Understanding the molecular basis of lipid metabolism and regulation in ABT will provide insights to optimize diet formulations for this high-value species new to aquaculture. To this end, we investigated the effect of dietary lipid on whole larvae lipid class and fatty acid compositions and the expression of key genes involved in lipid metabolism in first feeding ABT larvae fed different live prey. Additionally, the expression of lipid metabolism genes in tissues of adult broodstock ABT was evaluated. Growth and survival data indicated that copepods were the best live prey for first feeding ABT and that differences in growth performance and lipid metabolism observed between larvae from different year classes could be a consequence of broodstock nutrition. In addition, expression patterns of lipid metabolic genes observed in ABT larvae in the trials could reflect differences in lipid class and fatty acid compositions of the live prey. The lipid nutritional requirements, including essential fatty acid requirements of larval ABT during the early feeding stages, are unknown, and the present study represents a first step in addressing these highly relevant issues. However, further studies are required to determine nutritional requirements and understand lipid metabolism during development of ABT larvae and to apply the knowledge to the commercial culture of this iconic species.

  14. Steroids are required for epidermal cell fate establishment in Arabidopsis roots.

    PubMed

    Kuppusamy, Kavitha T; Chen, Andrew Y; Nemhauser, Jennifer L

    2009-05-12

    The simple structure of Arabidopsis roots provides an excellent model system to study epidermal cell fate specification. Epidermal cells in contact with 2 underlying cortical cells differentiate into hair cells (H cells; trichoblasts), whereas cells that contact only a single cortical cell differentiate into mature hairless cells (N cells; atrichoblasts). This position-dependent patterning, in combination with the constrained orientation of cell divisions, results in hair and nonhair cell files running longitudinally along the root epidermis. Here, we present strong evidence that steroid hormones called brassinosteroids (BRs) are required to maintain position-dependent fate specification in roots. We show that BRs are required for normal expression levels and patterns of WEREWOLF (WER) and GLABRA2 (GL2), master regulators of epidermal patterning. Loss of BR signaling results in loss of hair cells in H positions, likely as a consequence of reduced expression of CAPRICE (CPC), a direct downstream target of WER. Our observations demonstrate that in addition to their well-known role in cell expansion, BRs play an essential role in directing cell fate.

  15. Steroids are required for epidermal cell fate establishment in Arabidopsis roots

    PubMed Central

    Kuppusamy, Kavitha T.; Chen, Andrew Y.; Nemhauser, Jennifer L.

    2009-01-01

    The simple structure of Arabidopsis roots provides an excellent model system to study epidermal cell fate specification. Epidermal cells in contact with 2 underlying cortical cells differentiate into hair cells (H cells; trichoblasts), whereas cells that contact only a single cortical cell differentiate into mature hairless cells (N cells; atrichoblasts). This position-dependent patterning, in combination with the constrained orientation of cell divisions, results in hair and nonhair cell files running longitudinally along the root epidermis. Here, we present strong evidence that steroid hormones called brassinosteroids (BRs) are required to maintain position-dependent fate specification in roots. We show that BRs are required for normal expression levels and patterns of WEREWOLF (WER) and GLABRA2 (GL2), master regulators of epidermal patterning. Loss of BR signaling results in loss of hair cells in H positions, likely as a consequence of reduced expression of CAPRICE (CPC), a direct downstream target of WER. Our observations demonstrate that in addition to their well-known role in cell expansion, BRs play an essential role in directing cell fate. PMID:19416891

  16. Genetically increased cell-intrinsic excitability enhances neuronal integration into adult brain circuits

    PubMed Central

    Lin, Chia-Wei; Sim, Shuyin; Ainsworth, Alice; Okada, Masayoshi; Kelsch, Wolfgang; Lois, Carlos

    2009-01-01

    New neurons are added to the adult brain throughout life, but only half ultimately integrate into existing circuits. Sensory experience is an important regulator of the selection of new neurons but it remains unknown whether experience provides specific patterns of synaptic input, or simply a minimum level of overall membrane depolarization critical for integration. To investigate this issue, we genetically modified intrinsic electrical properties of adult-generated neurons in the mammalian olfactory bulb. First, we observed that suppressing levels of cell-intrinsic neuronal activity via expression of ESKir2.1 potassium channels decreases, whereas enhancing activity via expression of NaChBac sodium channels increases survival of new neurons. Neither of these modulations affects synaptic formation. Furthermore, even when neurons are induced to fire dramatically altered patterns of action potentials, increased levels of cell-intrinsic activity completely blocks cell death triggered by NMDA receptor deletion. These findings demonstrate that overall levels of cell-intrinsic activity govern survival of new neurons and precise firing patterns are not essential for neuronal integration into existing brain circuits. PMID:20152111

  17. Characterization and expression of cyp19a gene in the Chinese giant salamander Andrias davidianus.

    PubMed

    Hu, Qiaomu; Xiao, Hanbing; Tian, HaiFeng; Meng, Yan

    2016-02-01

    We cloned the full length cyp19a of Chinese giant salamander Andrias davidianus, determined its distribution in tissues and developing gonads, and analyzed the CpG methylation pattern of the cyp19a promoter. The results revealed isoforms of 1706 bp (G arom) and 1698 bp (B arom) in length, differing in the 5' flanking region, both encoding 502 amino acids. The G arom gene was observed mainly in the ovary and kidney, with little in other investigated tissues, while B arom expression was high in the brain, ovary, testis, and pituitary, with low or undetected expression in other examined tissues. Total aromatase expression was high in the ovary; moderate in the kidney, brain, testis, and pituitary; and low in the remaining tissues. G arom expression was significantly higher in the ovary than in the testis and gradually decreased with maturation of the salamander. A single injection of methyltestosterone or letrozole resulted in ovarian G arom expression decreasing over a 12-96 h period. A 1366 bp sequence of the cyp19a promoter was cloned and shown to be conserved in selected species. CpG methylation level was negatively correlated with cyp19a expression in the examined tissues and developing ovaries. Five and three CpG methylation sites positively correlated with DNA methylation levels in tissues and developing ovary, suggesting that they play an important role in regulating cyp19a expression. The aromatase gene showed two isoforms with distinct expression patterns, and the promoter methylation level at specific CpG sites was associated with variation in expression profiles of tissues and developing ovaries. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Fox (forkhead) genes are involved in the dorso-ventral patterning of the Xenopus mesoderm.

    PubMed

    El-Hodiri, H; Bhatia-Dey, N; Kenyon, K; Ault, K; Dirksen, M; Jamrich, M

    2001-01-01

    Fox (forkhead/winged helix) genes encode a family of transcription factors that are involved in embryonic pattern formation, regulation of tissue specific gene expression and tumorigenesis. Several of them are transcribed during Xenopus embryogenesis and are important for the patterning of ectoderm, mesoderm and endoderm. We have isolated three forkhead genes that are activated during gastrulation and play an important role in the dorso-ventral patterning of the mesoderm. XFKH1 (FoxA4b), the first vertebrate forkhead gene to be implicated in embryonic pattern formation, is expressed in the Spemann-Mangold organizer region and later in the embryonic notochord. XFKH7, the Xenopus orthologue of the murine Mfh1(Foxc2), is expressed in the presomitic mesoderm, but not in the notochord or lateral plate mesoderm. Finally, XFD-13'(FoxF1b)1 is expressed in the lateral plate mesoderm, but not in the notochord or presomitic mesoderm. Expression pattern and functional experiments indicate that these three forkhead genes are involved in the dorso-ventral patterning of the mesoderm.

  19. Wing Defects in Drosophila xenicid Mutant Clones Are Caused by C-Terminal Deletion of Additional Sex Combs (Asx)

    PubMed Central

    Bischoff, Kara; Ballew, Anna C.; Simon, Michael A.; O'Reilly, Alana M.

    2009-01-01

    Background The coordinated action of genes that control patterning, cell fate determination, cell size, and cell adhesion is required for proper wing formation in Drosophila. Defects in any of these basic processes can lead to wing aberrations, including blisters. The xenicid mutation was originally identified in a screen designed to uncover regulators of adhesion between wing surfaces [1]. Principal Findings Here, we demonstrate that expression of the βPS integrin or the patterning protein Engrailed are not affected in developing wing imaginal discs in xenicid mutants. Instead, expression of the homeotic protein Ultrabithorax (Ubx) is strongly increased in xenicid mutant cells. Conclusion Our results suggest that upregulation of Ubx transforms cells from a wing blade fate to a haltere fate, and that the presence of haltere cells within the wing blade is the primary defect leading to the adult wing phenotypes observed. PMID:19956620

  20. Estradiol stimulates an anti-translocation expression pattern of glucocorticoid co-regulators in a hippocampal cell model

    PubMed Central

    Malviya, Sanjana A.; Kelly, Sean D.; Greenlee, Megan M.; Eaton, Douglas C.; Duke, Billie Jeanne; Bourke, Chase H.; Neigh, Gretchen N.

    2013-01-01

    A consistent clinical finding in patients with major depressive disorder (MDD) is hyperactivity of the hypothalamic–pituitary–adrenal (HPA) axis, the system in the body that facilitates the response to stress. It has been suggested that alterations in glucocorticoid receptor (GR)-mediated feedback prolong activation of the HPA axis, leading to the dysfunction observed in MDD. Additionally, the risk for developing MDD is heightened by several risk factors, namely gender, genetics and early life stress. Previous studies have demonstrated that GR translocation is sexually dimorphic and this difference may be facilitated by differential expression of GR co-regulators. The purpose of this study was to determine the extent to which ovarian hormones alter expression of GR and its co-regulators, Fkbp5 and Ppid, in HT-22 hippocampal neurons. The impact of corticosterone (cort), estradiol (E2), and progesterone (P4) treatments on the expression of the genes Nr3c1, Ppid, and Fkbp5 was assessed in HT-22 hippocampal neurons. Treatment of cells with increasing doses of cort increased the expression of Fkbp5, an effect that was potentiated by E2. Exposure of HT-22 cells to E2 decreased the expression of Ppid and simultaneous exposure to E2 and P4 had combinatory effects on Ppid expression. The effects of E2 on Ppid extend previous work which demonstrated that serum E2 concentrations correlate with hippocampal Ppid expression in female rats. The results presented here illustrate that E2 generates an anti-translocation pattern of GR co-regulators in hippocampal cells. PMID:23541378

Top