Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.
Modification and identification of a vector for making a large phage antibody library.
Zhang, Guo-min; Chen, Yü-ping; Guan, Yuan-zhi; Wang, Yan; An, Yun-qing
2007-11-20
The large phage antibody library is used to obtain high-affinity human antibody, and the Loxp/cre site-specific recombination system is a potential method for constructing a large phage antibody library. In the present study, a phage antibody library vector pDF was reconstructed to construct diabody more quickly and conveniently without injury to homologous recombination and the expression function of the vector and thus to integrate construction of the large phage antibody library with the preparation of diabodies. scFv was obtained by overlap polymerase chain reaction (PCR) amplification with the newly designed VL and VH extension primers. loxp511 was flanked by VL and VH and the endonuclease ACC III encoding sequences were introduced on both sides of loxp511. scFv was cloned into the vector pDF to obtain the vector pDscFv. The vector expression function was identified and the feasibility of diabody preparation was evaluated. A large phage antibody library was constructed in pDscFv. Several antigens were used to screen the antibody library and the quality of the antibody library was evaluated. The phage antibody library expression vector pDscFv was successfully constructed and confirmed to express functional scFv. The large phage antibody library constructed using this vector was of high diversity. Screening of the library on 6 antigens confirmed the generation of specific antibodies to these antigens. Two antibodies were subjected to enzymatic digestion and were prepared into diabody with functional expression. The reconstructed vector pDscFv retains its recombination capability and expression function and can be used to construct large phage antibody libraries. It can be used as a convenient and quick method for preparing diabodies after simple enzymatic digestion, which facilitates clinical trials and application of antibody therapy.
[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].
Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng
2014-05-01
To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.
Construction of siRNA/miRNA expression vectors based on a one-step PCR process
Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin
2009-01-01
Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634
[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].
Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing
2010-10-01
This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.
Park, Jong-Uk; Jo, Jae-Hyung; Kim, Young-Ji; Chung, So-Sun; Lee, Jin-Ho; Lee, Hyune Hwan
2008-04-01
The heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, CJ1 and CJ4 that express genes constitutively in C. ammoniagenes.. Although the promoters were isolated from C. ammoniagenes, CJ1 and CJ4 were also active in C. glutamicum. To construct vectors, the OL1 from the lambdaPL promoter was isolated and fused to the CJ1 and CJ4 promoters by recombinant PCR. The resulting artificial promoters, CJ1O and CJ4O, which have one lambdaOL1, and CJ1OX2, which has two successive lambdaOL1, were fused to the green fluorescent protein (GFP) gene followed by subcloning into pCES208. The expression of GFP in the corynebacteria harboring the vectors was regulated successfully by the temperature sensitive cI857 repressor. Among them, C. ammoniagenes harboring plasmid pCJ1OX2G containing GFP fused to CJ1OX2 showed more GFP than the other ones and the expression was tightly regulated by the repressor. To construct the generally applicable expression vector using the plasmid pCJ1OX2G, the His-tag, enterokinase (EK) moiety, and the MCS were inserted in front of the GFP gene. Using the vector, the expression of pyrR from C. glutamicum was tried by temperature shift-up. The results indicated that the constructed vectors (pCeHEMG) can be successfully used in the expression and regulation of foreign genes in corynebacteria.
Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua
2015-07-01
To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.
Construction of two vectors for gene expression in Trichoderma reesei.
Lv, Dandan; Wang, Wei; Wei, Dongzhi
2012-01-01
We report the construction of two filamentous fungi Trichoderma reesei expression vectors, pWEF31 and pWEF32. Both vectors possess the hygromycin phosphotransferase B gene expression cassette and the strong promoter and terminator of the cellobiohydrolase 1 gene (cbh1) from T. reesei. The two newly constructed vectors can be efficiently transformed into T. reesei with Agrobacterium-mediated transformation. The difference between pWEF31 and pWEF32 is that pWEF32 has two longer homologous arms. As a result, pWEF32 easily undergoes homologous recombination. On the other hand, pWEF31 undergoes random recombination. The applicability of both vectors was tested by first generating the expression vectors pWEF31-red and pWEF32-red and then detecting the expression of the DsRed2 gene in T. reesei Rut C30. Additionally, we measured the exo-1,4-β-glucanase activity of the recombinant cells. Our work provides an effective transformation system for homologous and heterologous gene expression and gene knockout in T. reesei. It also provides a method for recombination at a specific chromosomal location. Finally, both vectors will be useful for the large-scale gene expression industry. Copyright © 2011 Elsevier Inc. All rights reserved.
Kagale, Sateesh; Uzuhashi, Shihomi; Wigness, Merek; Bender, Tricia; Yang, Wen; Borhan, M. Hossein; Rozwadowski, Kevin
2012-01-01
Plant viral expression vectors are advantageous for high-throughput functional characterization studies of genes due to their capability for rapid, high-level transient expression of proteins. We have constructed a series of tobacco mosaic virus (TMV) based vectors that are compatible with Gateway technology to enable rapid assembly of expression constructs and exploitation of ORFeome collections. In addition to the potential of producing recombinant protein at grams per kilogram FW of leaf tissue, these vectors facilitate either N- or C-terminal fusions to a broad series of epitope tag(s) and fluorescent proteins. We demonstrate the utility of these vectors in affinity purification, immunodetection and subcellular localisation studies. We also apply the vectors to characterize protein-protein interactions and demonstrate their utility in screening plant pathogen effectors. Given its broad utility in defining protein properties, this vector series will serve as a useful resource to expedite gene characterization efforts. PMID:23166857
Zhu, Lijuan; Liao, Wenjun; Zhu, Huifen; Lei, Ping; Wang, Zhihua; Shao, Jingfang; Zhang, Yue; Shen, Guanxin
2006-01-01
The expression vector of SmIg scFv fragment was constructed in patient with B cell chronic lymphocyte leukemia (B-CLL) and expressed in E. coli to obtain scFv fragment, and the effect of the protein on the proliferation of stimulated peripheral blood mononuclear cells (PBMC) was investigated in vitro. Two pairs of primers were designed, and variable region genes of light chain and heavy chain were amplified by PCR respectively from the pGEM-T vectors previously constructed in our laboratory which containing light chain gene or Fd fragment of heavy chain gene. The PCR product was digested, purified and inserted into pHEN2 vector to construct the soluble expression vector pHEN2-scFv. After the induction by IPTG, the scFv protein was identified by SDS-PAGE electrophoresis and purified by Ni-NTA-Chromatography. MTT was used to determine the effect of purified protein on the proliferation of stimulated PBMC in vitro. Plasmid PCR and restriction enzyme digestion of pHEN2-scFv revealed the pHEN2-scFv vector was constructed successfully. Id-scFv protein was expressed in positive clone after induced by IPTG. SDS-PAGE analysis showed that the relative molecular weight of fusion protein was about 30 kD (1 kD= 0.9921 ku), which was consistent with the theoretically predicted value. Proliferation of PBMC could be induced by purified Id-scFv. It was suggested that the expression vector of SmIg scFv fragment was constructed successfully, and scFv protein was expressed and secreted from E. coli, which could induce proliferation of PBMC. This may lay an experimental foundation for further research of Id-HSP complex vaccine for B-CLL.
Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying
2008-02-01
To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.
Geiling, Benjamin; Vandal, Guillaume; Posner, Ada R.; de Bruyns, Angeline; Dutchak, Kendall L.; Garnett, Samantha; Dankort, David
2013-01-01
The ability to express exogenous cDNAs while suppressing endogenous genes via RNAi represents an extremely powerful research tool with the most efficient non-transient approach being accomplished through stable viral vector integration. Unfortunately, since traditional restriction enzyme based methods for constructing such vectors are sequence dependent, their construction is often difficult and not amenable to mass production. Here we describe a non-sequence dependent Gateway recombination cloning system for the rapid production of novel lentiviral (pLEG) and retroviral (pREG) vectors. Using this system to recombine 3 or 4 modular plasmid components it is possible to generate viral vectors expressing cDNAs with or without inhibitory RNAs (shRNAmirs). In addition, we demonstrate a method to rapidly produce and triage novel shRNAmirs for use with this system. Once strong candidate shRNAmirs have been identified they may be linked together in tandem to knockdown expression of multiple targets simultaneously or to improve the knockdown of a single target. Here we demonstrate that these recombinant vectors are able to express cDNA and effectively knockdown protein expression using both cell culture and animal model systems. PMID:24146852
[Construction and expression of fusion protein TRX-hJagged1 in E.coli BL21].
Li, Guo-Hui; Fan, Yu-Zhen; Huang, Si-Yong; Liu, Qiang; Yin, Dan-Dan; Liu, Li; Chen, Ren-An; Hao, Miao-Wang; Liang, Ying-Min
2014-06-01
This study was purposed to construct prokaryotic expression vector and to investigate the expression of Notch ligand Jagged1 in E.coli. An expression vector pET-hJagged1 was constructed, which can be inserted in Jagged1 with different lengths, but the DSL domain of human Jagged1 should be contained. Then the recombinant plasmids were transformed into the competent cell of E.coli BL21, and the expression of the fusion protein was induced by IPTG. Fusion protein was purified from the supernatant of cell lysates via the Nickel affinity chromatography. The results showed that prokaryotic expression vectors pET-hJagged1 (Bgl II), pET-hJagged1 (Hind I) and pET-hJagged1 (Stu I) were successfully constructed, but only pET-hJagged1 (Stu I) could express the soluble TRX-hJagged1. The purified TRX-Jagged1 protein could be obtained via the Nickel affinity chromatography, and then confirmed by Western Blot. It is concluded that prokaryotic expression vector pET-hJagged1 is successfully constructed, but only pET-hJagged1 (Stu I) can express the soluble TRX-hJagged1 and the TRX-Jagged1 fusion protein is obtained through the prokaryotic expression system, which laid a solid foundation for further to explore the effects of Jagged1 in hematopoietic and lymphoid system.
Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun
2013-08-01
To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.
He, Zuoping; Luo, Peifang; Hu, Feihuan; Weng, Yunceng; Wang, Wenjing; Li, Chengyao
2016-04-01
To construct eukaryotic expression vectors carrying Brucella melitensis outer membrane protein 19 (OMP19), express them in transfected Huh7.5.1 and JEG-3 cells, and analyze their role in cell apoptosis. Brucella melitensis lipidated OMP19 (L-OMP19) gene and unlipidated OMP19 (U-OMP19) gene were amplified by PCR and inserted into the vector pZeroBack/blunt. The correct L-OMP19 and U-OMP19 genes verified by XbaI and BamHI double digestion and sequencing were cloned into the lentivirus expression vector pHAGE-CMV-MCS-IZsGreen to construct vectors pHAGE-L-OMP19 and pHAGE-U-OMP19, which were separately transfected into 293FT cells, Huh7.5.1 and JEG-3 cells. L-OMP19 and U-OMP19 in the cells were detected by Western blotting and immunofluorescence technique. Flow cytometry combined with annexin V-PE/7-AAD staining was used to detect the cell apoptosis. The lentiviral vectors pHAGE-L-OMP19 and pHAGE-U-OMP19 were constructed correctly and the recombinant lipoproteins L-OMP19 and U-OMP19 expressed in the above cells were well recognized by the specific antibodies against L-OMP19 in Western blotting and immunofluorescence technique. L-OMP19 and U-OMP19 induced JEG-3 cell death, but did not induce the apoptosis of Huh7.5.1 cells. The eukaryotic expression vectors of L-OMP19 and U-OMP19 have been constructed successfully. Recombinant lipoproteins L-OMP19 and U-OMP19 expressed in cells have a good antigenicity, which could be used as experimental materials for the research on the relationship between host cells and lipoproteins in Brucella infection.
Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong
2014-01-01
To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.
Nakashima, N; Tamura, T
2013-06-01
Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.
[The expression of interferon-lambda1 in CHO cell].
Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu
2013-06-01
To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.
Development of a GFP expression vector for Cucurbit chlorotic yellows virus.
Wei, Ying; Han, Xiaoyu; Wang, Zhenyue; Gu, Qinsheng; Li, Honglian; Chen, Linlin; Sun, Bingjian; Shi, Yan
2018-05-24
Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date. We constructed a CCYV GFP expression vector using the "add a gene" strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFP SGC , pCCYVGFP CGC , and pCCYVGFP CGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFP CGC -infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFP SGC and pCCYVGFP CGS were mainly found in single cells. Further observation of pCCYVGFP CGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves. We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.
Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc
2017-07-25
Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.
Dang, Yin-li; Yan, Yan; Zhang, Xiao-xiao; Li, Pu-yuan; Yu, Lan; Zhang, Lei; Zhang, Fang-lin; Xu, Zhi-kai; Wu, Xing-an
2011-05-01
To stably express herpes simplex virus type 1 (HSV-1) glycoprotein C (gC) in Chinese hamster ovary cells (CHO-K1). The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed and transfected into CHO-K1 cells by Lipofectamine 2000. The transfected cells were selected by G418 and methotrexate (MTX). The expression of HSV-1 gC was analyzed by Slot blot. HSV-1 gC proteins were purified with His-Ni Sepharose and then detected by Western blot. The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed successfully. CHO-K1 cells stably expressing HSV-1 gC proteins were established and confirmed by Western blot. The HSV-1 gC proteins have been expressed successfully and have good bioactivity. The results make it possible for further study and clinical use of HSV-1 gC.
Ishii, Jun; Kondo, Takashi; Makino, Harumi; Ogura, Akira; Matsuda, Fumio; Kondo, Akihiko
2014-05-01
Yeast has the potential to be used in bulk-scale fermentative production of fuels and chemicals due to its tolerance for low pH and robustness for autolysis. However, expression of multiple external genes in one host yeast strain is considerably labor-intensive due to the lack of polycistronic transcription. To promote the metabolic engineering of yeast, we generated systematic and convenient genetic engineering tools to express multiple genes in Saccharomyces cerevisiae. We constructed a series of multi-copy and integration vector sets for concurrently expressing two or three genes in S. cerevisiae by embedding three classical promoters. The comparative expression capabilities of the constructed vectors were monitored with green fluorescent protein, and the concurrent expression of genes was monitored with three different fluorescent proteins. Our multiple gene expression tool will be helpful to the advanced construction of genetically engineered yeast strains in a variety of research fields other than metabolic engineering. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
The immune response induced by DNA vaccine expressing nfa1 gene against Naegleria fowleri.
Kim, Jong-Hyun; Lee, Sang-Hee; Sohn, Hae-Jin; Lee, Jinyoung; Chwae, Yong-Joon; Park, Sun; Kim, Kyongmin; Shin, Ho-Joon
2012-12-01
The pathogenic free-living amoeba, Naegleria fowleri, causes fatal primary amoebic meningoencephalitis in experimental animals and in humans. The nfa1 gene that was cloned from N. fowleri is located on pseudopodia, especially amoebic food cups and plays an important role in the pathogenesis of N. fowleri. In this study, we constructed and characterized retroviral vector and lentiviral vector systems for nfa1 DNA vaccination in mice. We constructed the retroviral vector (pQCXIN) and the lentiviral vector (pCDH) cloned with the egfp-nfa1 gene. The expression of nfa1 gene in Chinese hamster ovary cell and human primary nasal epithelial cell transfected with the pQCXIN/egfp-nfa1 vector or pCDH/egfp-nfa1 vector was observed by fluorescent microscopy and Western blotting analysis. Our viral vector systems effectively delivered the nfa1 gene to the target cells and expressed the Nfa1 protein within the target cells. To evaluate immune responses of nfa1-vaccinated mice, BALB/c mice were intranasally vaccinated with viral particles of each retro- or lentiviral vector expressing nfa1 gene. DNA vaccination using viral vectors expressing nfa1 significantly stimulated the production of Nfa1-specific IgG subclass, as well as IgG levels. In particular, both levels of IgG2a (Th1) and IgG1 (Th2) were significantly increased in mice vaccinated with viral vectors. These results show the nfa1-vaccination induce efficiently Th1 type, as well as Th2 type immune responses. This is the first report to construct viral vector systems and to evaluate immune responses as DNA vaccination in N. fowleri infection. Furthermore, these results suggest that nfal vaccination may be an effective method for treatment of N. fowleri infection.
[Construction of the superantigen SEA transfected laryngocarcinoma cells].
Ji, Xiaobin; Jingli, J V; Liu, Qicai; Xie, Jinghua
2013-04-01
To construct an eukaryotic expression vectors containing superantigen staphylococcal enterotoxin A (SEA) gene, and to identify its expression in laryngeal squamous carcinoma cells. SEA full-length gene fragment was obtained from ATCC13565 genome of the staphylococcus, referencing standard strains producing SEA. Coding sequence of SEA was artificially synthetized. Than, SEA gene fragments was subcloned into eukaryotic expression vector pIRES-EGFP. The recombinant plasmid pSEA-IRES-EGFP was constructed and was transfected to laryngocarcinoma Hep-2 cells. Resistant clones were screened by G418. The expression of SEA in laryngocarcinoma cells was identified with ELISA and RT-PCR method. The subclone of artificially synthetized SEA gene was subclone to eukaryotic expression vector pires-EGFP. Flanking sequence confirmed that SEA sequence was fully identical to the coding sequence of standard staphylococcus strains ATCC13565 in Genbank. After recombinant plasmid transfected to laryngocarcinoma cells, the resistant clones was obtained after screening for two weeks. The clones were selected. The specific gene fragment was obtained by RT-PCR amplification. ELISA assay confirmed that the content of SEA protein in supernatant fluid of cell culture had reached about Pg level. The recombinant eukaryotic expression vector containing superantigen SEA gene is successfully constructed, and is capable of effective expression and continued secretion of SEA protein in laryngochrcinoma Hep-2 cells after recombinant plasmid transfected to laryngocarcinoma cells.
Li, Xue-rong; Wu, Yin-juan; Shang, Mei; Li, Ye; Xu, Jin; Yu, Xin-bing; Athar, Chishti
2014-08-01
To construct recombinant plasmid pSPPcGT which contains signal peptide peptidase gene of Plasmodium falciparum (PJSPP) and GFP, and transfect into P. falciparum (3D7 strain) to obtain mutant parasites which can express PJSPP-GFP. Plasmodium falciparum(3D7 strain) genomic DNA was extracted from cultured malaria parasites. The C-terminal region of PJSPP, an 883 bp gene fragment was amplified by PCR, and then cloned into pPM2GT vector to get recombinant vector pSPPcGT. The recombinant vectors were identified by PCR, double restriction enzyme digestion and DNA sequencing. pSPPcGT vector was transfected into malaria parasites. The positive clones were selected by adding inhibitor of Plasmodium falciparum dihydrofolate reductase WR99210 to the culture medium. The pSPP-GFP-transfected parasites were fixed with methanol, stained with DAPI, and observed under immunofluorescence microscope. The PJSPP-GFP expression in P. falciparum was identified by SDS-PAGE and Western blotting. The C-terminal region of PJSPP was amplified from P.falciparum (3D7 strain) genomic DNA by PCR with the length of 883 bp. The constructed recombinant vectors were identified by PCR screening, double restriction enzyme digestion and DNA sequencing. The pSPPcGT vector was transfected into P. falciparum and the positive clones were selected by WR99210. GFP fluorescence was observed in transfected parasites by immunofluorescence microscopy, and mainly located in the cytoplasm. The PJSPP-GFP expression in malaria parasites was confirmed by Western blotting with a relative molecular mass of Mr 64,000. Recombinant vector PJSPP-GFP is constructed and transfected into P. falciparum to obtain P. falciparum mutant clone which can express PfSPP-GFP.
Kim, Hyun Ah; Nam, Kihoon; Lee, Minhyung; Kim, Sung Wan
2013-10-10
Gene therapy is suggested as a promising alternative strategy of hepatocellular carcinoma (HCC, also called hepatoma) therapy. To achieve a successful and safe gene therapy, tight regulation of gene expression is required to minimize side-effects in normal tissues. In this study, we developed a novel hypoxia and hepatoma dual specific gene expression vector. The constructed vectors were transfected into various cell lines using bio-reducible polymer, PAM-ABP. First, pAFPS-Luc or pAFPL-Luc vector was constructed with the alpha-fectoprotein (AFP) promoter and enhancer for hepatoma tissue specific gene expression. Then, pEpo-AFPL-Luc was constructed by insertion of the erythropoietin (Epo) enhancer for hypoxic cancer specific gene expression. In vitro transfection assay showed that pEpo-AFPL-Luc transfected hepatoma cell increased gene expression under hypoxic condition. To confirm the therapeutic effect of dual specific vector, herpes simplex virus thymidine kinase (HSV-TK) gene was introduced for cancer cell killing. The pEpo-AFPL-TK was transfected into hepatoma cell lines in the presence of ganciclovir (GCV) pro-drug. Caspase-3/7, MTT and TUNEL assays elucidated that pEpo-AFPL-TK transfected cells showed significant increasing of death rate in hypoxic hepatoma cells compared to controls. Therefore, the hypoxia/hepatoma dual specific gene expression vector with the Epo enhancer and AFP promoter may be useful for hepatoma specific gene therapy. © 2013.
Gui, Tao; Liu, Xing; Tao, Jia; Chen, Jianwen; Li, Yunsheng; Zhang, Meiling; Wu, Ronghua; Zhang, Yuanliang; Peng, Kaisong; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai
2013-12-01
Human bactericidal/permeability-increasing protein (hBPI) is the only antibacterial peptide which acts against both gram-negative bacteria and neutralizes endotoxins in human polymorphonuclear neutrophils; therefore, hBPI is of great value in clinical applications. In the study, we constructed a hBPI expression vector (pBC1-Loxp-Neo-Loxp-hBPI) containing the full-length hBPI coding sequence which could be specifically expressed in the mammary gland. To validate the function of the vector, in vitro cultured C127 (mouse mammary Carcinoma Cells) were transfected with the vector, and the transgenic cell clones were selected to express hBPI by hormone induction. The mRNA and protein expression of hBPI showed that the constructed vector was effective and suitable for future application in producing mammary gland bioreactor. Then, female and male goat fibroblasts were transfected with the vector, and two male and two female transgenic clonal cell lines were obtained. Using the transgenic cell lines as nuclear donors for somatic cell nuclear transfer, the reconstructed goat embryos produced from all four clones could develop to blastocysts in vitro. In conclusion, we constructed and validated an efficient mammary gland-specific hBPI expression vector, pBC1-Loxp-Neo-Loxp-hBPI, and transgenic hBPI goat embryos were successfully produced, laying foundations for future production of recombinant hBPI in goat mammary gland. Copyright © 2013 Elsevier B.V. All rights reserved.
Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong
2003-02-01
To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.
A modular toolset for recombination transgenesis and neurogenetic analysis of Drosophila.
Wang, Ji-Wu; Beck, Erin S; McCabe, Brian D
2012-01-01
Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues.
Lausberg, Frank; Chattopadhyay, Ava Rebecca; Heyer, Antonia; Eggeling, Lothar; Freudl, Roland
2012-09-01
Here we report on the construction of a tetracycline inducible expression vector that allows a tightly regulable gene expression in Corynebacterium glutamicum which is used in industry for production of small molecules such as amino acids. Using the green fluorescent protein (GFP) as a reporter protein we show that this vector, named pCLTON1, is characterized by tight repression under non-induced conditions as compared to a conventional IPTG inducible expression vector, and that it allows gradual GFP synthesis upon gradual increase of anhydrotetracycline addition. Copyright © 2012 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...
Design and construction of 2A peptide-linked multicistronic vectors.
Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A
2012-02-01
The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. This article describes the design and construction of 2A peptide-linked multicistronic vectors, which can be used to express multiple proteins from a single open reading frame (ORF). The small 2A peptide sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector.
Douillard, François P; Mahony, Jennifer; Campanacci, Valérie; Cambillau, Christian; van Sinderen, Douwe
2011-09-01
Over the last 10 years, the NIsin Controlled Expression (NICE) system has been extensively used in the food-grade bacterium Lactococcus lactis subsp. cremoris to produce homologous and heterologous proteins for academic and biotechnological purposes. Although various L. lactis molecular tools have been developed, no expression vectors harboring the popular Gateway recombination system are currently available for this widely used cloning host. In this study, we constructed two expression vectors that combine the NICE and the Gateway recombination systems and we tested their applicability by recombining and over-expressing genes encoding structural proteins of lactococcal phages Tuc2009 and TP901-1. Over-expressed phage proteins were analyzed by immunoblotting and purified by His-tag affinity chromatography with protein productions yielding 2.8-3.7 mg/l of culture. This therefore is the first description of L. lactis NICE expression vectors which integrate the Gateway cloning technology and which are suitable for the production of sufficient amounts of proteins to facilitate subsequent structural and functional analyses. Copyright © 2011 Elsevier Inc. All rights reserved.
Rule-Based Design of Plant Expression Vectors Using GenoCAD.
Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean
2015-01-01
Plant synthetic biology requires software tools to assist on the design of complex multi-genic expression plasmids. Here a vector design strategy to express genes in plants is formalized and implemented as a grammar in GenoCAD, a Computer-Aided Design software for synthetic biology. It includes a library of plant biological parts organized in structural categories and a set of rules describing how to assemble these parts into large constructs. Rules developed here are organized and divided into three main subsections according to the aim of the final construct: protein localization studies, promoter analysis and protein-protein interaction experiments. The GenoCAD plant grammar guides the user through the design while allowing users to customize vectors according to their needs. Therefore the plant grammar implemented in GenoCAD will help plant biologists take advantage of methods from synthetic biology to design expression vectors supporting their research projects.
Srivastava, Preeti; Deb, J K
2002-07-02
A series of fusion vectors containing glutathione-S-transferase (GST) were constructed by inserting GST fusion cassette of Escherichia coli vectors pGEX4T-1, -2 and -3 in corynebacterial vector pBK2. Efficient expression of GST driven by inducible tac promoter of E. coli was observed in Corynebacterium acetoacidophilum. Fusion of enhanced green fluorescent protein (EGFP) and streptokinase genes in this vector resulted in the synthesis of both the fusion proteins. The ability of this recombinant organism to produce several-fold more of the product in the extracellular medium than in the intracellular space would make this system quite attractive as far as the downstream processing of the product is concerned.
Liu, Fang; Li, Li; Zhang, Wei; Wang, Qi
2013-04-01
This research was to construct the lentiviral expression vector for anti- p185(erbB2) mouse/human chimeric antibody and to determine the expression of the chimeric antibody gene in 293T cells transfected with this vector. The genes (vL and vH) coding light and heavy chain of variable regions of anti-p185(erbB2) mAb and the constant regions of human IgG1 (kappa and gamma1) were cloned with PCR method. The target genes were assembled by three-primers PCR method to obtain the chimeric light chain (L) and the chimeric heavy chain (H). Both chains inserted into the down stream and upper stream of IRES gene of the plasmid pVAX1/IRES respectively. We digested the plasmid pVAX1/ H-IRES-L with endoenzyme and subcloned H-IRES-L into the lentiviral vector pWPI. The enzyme digestion and sequence analysis showed that the lentiviral expression vector pWPI/H-IRES-L was constructed correctly. Then, it was transfected into 293T cells and after 48h, GFP protein expression in 293T cells were detected by fluorescent microscope and the chimeric antibody expression was detected by RT-PCR and direct ELISA. The results showed that after 293T cells were transfected with recombination plasmid, both light and heavy chains of the chimeric antibody genes could express together. The chimeric antibody expressed could bind to p185(erbB2) specifically. This research may lay a sound foundation for further study of anti-p185(erbB2) engineered antibody.
A universal expression/silencing vector in plants.
Peretz, Yuval; Mozes-Koch, Rita; Akad, Fuad; Tanne, Edna; Czosnek, Henryk; Sela, Ilan
2007-12-01
A universal vector (IL-60 and auxiliary constructs), expressing or silencing genes in every plant tested to date, is described. Plants that have been successfully manipulated by the IL-60 system include hard-to-manipulate species such as wheat (Triticum duram), pepper (Capsicum annuum), grapevine (Vitis vinifera), citrus, and olive (Olea europaea). Expression or silencing develops within a few days in tomato (Solanum lycopersicum), wheat, and most herbaceous plants and in up to 3 weeks in woody trees. Expression, as tested in tomato, is durable and persists throughout the life span of the plant. The vector is, in fact, a disarmed form of Tomato yellow leaf curl virus, which is applied as a double-stranded DNA and replicates as such. However, the disarmed virus does not support rolling-circle replication, and therefore viral progeny single-stranded DNA is not produced. IL-60 does not integrate into the plant's genome, and the construct, including the expressed gene, is not heritable. IL-60 is not transmitted by the Tomato yellow leaf curl virus's natural insect vector. In addition, artificial satellites were constructed that require a helper virus for replication, movement, and expression. With IL-60 as the disarmed helper "virus," transactivation occurs, resulting in an inducible expressing/silencing system. The system's potential is demonstrated by IL-60-derived suppression of a viral-silencing suppressor of Grapevine virus A, resulting in Grapevine virus A-resistant/tolerant plants.
Reflections on the early development of poxvirus vectors.
Moss, Bernard
2013-09-06
Poxvirus expression vectors were described in 1982 and quickly became widely used for vaccine development as well as research in numerous fields. Advantages of the vectors include simple construction, ability to accommodate large amounts of foreign DNA and high expression levels. Numerous poxvirus-based veterinary vaccines are currently in use and many others are in human clinical trials. The early reports of poxvirus vectors paved the way for and stimulated the development of other viral vectors and recombinant DNA vaccines. Published by Elsevier Ltd.
A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila
Wang, Ji-Wu; Beck, Erin S.; McCabe, Brian D.
2012-01-01
Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues. PMID:22848718
Lim, Seungmo; Nam, Moon; Kim, Kil Hyun; Lee, Su-Heon; Moon, Jung-Kyung; Lim, Hyoun-Sub; Choung, Myoung-Gun; Kim, Sang-Mok; Moon, Jae Sun
2016-02-01
A new vector using Soybean yellow common mosaic virus (SYCMV) was constructed for gene function study or heterologous protein expression in soybeans. The in vitro transcript with a 5' cap analog m7GpppG from an SYCMV full-length infectious vector driven by a T7 promoter infected soybeans (pSYCMVT7-full). The symptoms observed in the soybeans infected with either the sap from SYCMV-infected leaves or pSYCMVT7-full were indistinguishable, suggesting that the vector exhibits equivalent biological activity as the virus itself. To utilize the vector further, a DNA-based vector driven by the Cauliflower mosaic virus (CaMV) 35S promoter was constructed. The complete sequence of the SYCMV genome was inserted into a binary vector flanked by a CaMV 35S promoter at the 5' terminus of the SYCMV genome and a cis-cleaving ribozyme sequence followed by a nopaline synthase terminator at the 3' terminus of the SYCMV genome (pSYCMV-full). The SYCMV-derived vector was tested for use as a virus-induced gene silencing (VIGS) vector for the functional analysis of soybean genes. VIGS constructs containing either a fragment of the Phytoene desaturase (PDS) gene (pSYCMV-PDS1) or a fragment of the small subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase (RbcS) gene (pSYCMV-RbcS2) were constructed. Plants infiltrated with each vector using the Agrobacterium-mediated inoculation method exhibited distinct symptoms, such as photo-bleaching in plants infiltrated with pSYCMV-PDS1 and yellow or pale green coloring in plants infiltrated with pSYCMV-RbcS2. In addition, down-regulation of the transcripts of the two target genes was confirmed via northern blot analysis. Particle bombardment and direct plasmid DNA rubbing were also confirmed as alternative inoculation methods. To determine if the SYCMV vector can be used for the expression of heterologous proteins in soybean plants, the vector encoding amino acids 135-160 of VP1 of Foot-and-mouth disease virus (FMDV) serotype O1 Campos (O1C) was constructed (pSYCMV-FMDV). Plants infiltrated with pSYCMV-FMDV were only detected via western blotting using the O1C antibody. Based on these results, we propose that the SYCMV-derived vector can be used for gene function study or expression of useful heterologous proteins in soybeans. Copyright © 2015 Elsevier B.V. All rights reserved.
A stable RNA virus-based vector for citrus trees
DOE Office of Scientific and Technical Information (OSTI.GOV)
Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe
Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter.more » These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees.« less
Kittel, Christian; Wressnigg, Nina; Shurygina, Anna Polina; Wolschek, Markus; Stukova, Marina; Romanovskaya-Romanko, Ekatherina; Romanova, Julia; Kiselev, Oleg; Muster, Thomas; Egorov, Andrej
2015-10-01
The existence of multiple antigenically distinct types and subtypes of influenza viruses allows the construction of a multivalent vector system for the mucosal delivery of foreign sequences. Influenza A viruses have been exploited successfully for the expression of extraneous antigens as well as immunostimulatory molecules. In this study, we describe the development of an influenza B virus vector whose functional part of the interferon antagonist NS1 was replaced by human interleukin 2 (IL2) as a genetic adjuvant. We demonstrate that IL2 expressed by this viral vector displays immune adjuvant activity in immunized mice. Animals vaccinated with the IL2 viral vector showed an increased hemagglutination inhibition antibody response and higher protective efficacy after challenge with a wild-type influenza B virus when compared to mice vaccinated with a control virus. Our results demonstrate that it is feasible to construct influenza B vaccine strains expressing immune-potentiating foreign sequences from the NS genomic segment. Based on these data, it is now hypothetically possible to create a trivalent (or quadrivalent) live attenuated influenza vaccine in which each component expresses a selected genetic adjuvant with tailored expression levels.
Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S
2017-04-01
Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.
Nephron segment-specific gene expression using AAV vectors.
Asico, Laureano D; Cuevas, Santiago; Ma, Xiaobo; Jose, Pedro A; Armando, Ines; Konkalmatt, Prasad R
2018-02-26
AAV9 vector provides efficient gene transfer in all segments of the renal nephron, with minimum expression in non-renal cells, when administered retrogradely via the ureter. It is important to restrict the transgene expression to the desired cell type within the kidney, so that the physiological endpoints represent the function of the transgene expressed in that specific cell type within kidney. We hypothesized that segment-specific gene expression within the kidney can be accomplished using the highly efficient AAV9 vectors carrying the promoters of genes that are expressed exclusively in the desired segment of the nephron in combination with administration by retrograde infusion into the kidney via the ureter. We constructed AAV vectors carrying eGFP under the control of: kidney-specific cadherin (KSPC) gene promoter for expression in the entire nephron; Na + /glucose co-transporter (SGLT2) gene promoter for expression in the S1 and S2 segments of the proximal tubule; sodium, potassium, 2 chloride co-transporter (NKCC2) gene promoter for expression in the thick ascending limb of Henle's loop (TALH); E-cadherin (ECAD) gene promoter for expression in the collecting duct (CD); and cytomegalovirus (CMV) early promoter that provides expression in most of the mammalian cells, as control. We tested the specificity of the promoter constructs in vitro for cell type-specific expression in mouse kidney cells in primary culture, followed by retrograde infusion of the AAV vectors via the ureter in the mouse. Our data show that AAV9 vector, in combination with the segment-specific promoters administered by retrograde infusion via the ureter, provides renal nephron segment-specific gene expression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi
2013-01-01
We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.
Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Singh, Surender; Kumar, Sudarshan; Kaushik, Jai K; Mohanty, Ashok K; Malakar, Dhruba
2015-12-01
Oct4, pluripotency marker and transcription factor, expresses in embryonic stem cells. It plays a pivotal role in determination of stem cells fate. Up and down regulation of Oct4 causes differentiation of embryonic stem cells. It is one of the main transcription factors which remained concerned in every study related to induced pluripotent stem cell. Here, we report the production of goat Oct4 protein using plasmid and lentiviral based vectors. Firstly, Oct4 ORF was cloned in pAcGFP1-N1 plasmid vector and positive clones were screened with colony PCR. Oct4 was over-expressed in CHO-K1 cell line and expression was confirmed by observing green florescent protein expression in CHO-K1 cells. Secondly, Oct4 lentiviral expression construct has been prepared using pLenti-gw vector. Oct4 ORF was cloned into pLenti4/V5-DEST vector and viral particles were produced in 293FT cells. Oct4 viral particles were used to infect goat fibroblast cells. Oct4 expression was observed and confirmed in transfected goat fibroblast cells using RT-PCR. Detection of Oct4 protein in western blotting assay affirmed the capacity of over-expression of our Oct4 lentiviral vector. The lentiviral expression construct and recombinant Oct4 protein may be used for reprogramming of somatic cell into induced pluripotent stem cell.
Zhu, Shengming; Wang, Yanping; Zheng, Hong; Cheng, Jingqiu; Lu, Yanrong; Zeng, Yangzhi; Wang, Yu; Wang, Zhu
2009-04-01
This study sought to clone Chinese Banna minipig inbred-line (BMI) alpha1,3-galactosyltransferase (alpha1,3-GT) gene and construct its recombinant eukaryotic expression vector. Total RNA was isolated from BMI liver. Full length cDNA of alpha1,3-GT gene was amplified by RT-PCR and cloned into pMD18-T vector to sequence. Subsequently, alpha1,3-GT gene was inserted into pEGFP-N1 to construct eukaryotic expression vector pEGFP-N1-GT. Then the reconstructed plasmid pEGFP-N1-GT was transiently transfected into human lung cancer cell line A549. The expression of alpha1,3-GT mRNA in transfected cells was detected by RT-PCR. FITC-BS-IB4 lectin was used in the direct immunofluorescence method, which was performed to observe the alpha-Gal synthesis function of BMI alpha1,3-GT in transfected cells. The results showed that full length of BMI alpha1,3-GT cDNA was 1116 bp. BMI alpha1,3-GT cDNA sequence was highly homogenous with those of mouse and bovine, and was exactly the same as the complete sequence of those of swine, pEGFP-N1-GT was confirmed by enzyme digestion and PCR. The expression of alpha1,3-GT mRNA was detected in A549 cells transfected by pEGFP-N1-GT. The expression of alpha-Gal was observed on the membrane of A549 cells transfected by pEGFP-N1-GT. Successful cloning of BMI alpha1,3-GT cDNA and construction of its eukaryotic expression vector have established a foundation for further research and application of BMI alpha1,3-GT in the fields of xenotransplantation and immunological therapy of cancer.
Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.
Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu
2015-04-01
Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.
Shao, Huanhuan; Cao, Qinghua; Zhao, Hongyan; Tan, Xuemei; Feng, Hong
2015-01-01
A native plasmid (pSU01) was detected by genome sequencing of Bacillus subtilis strain S1-4. Two pSU01-based shuttle expression vectors pSU02-AP and pSU03-AP were constructed enabling stable replication in B. subtilis WB600. These vectors contained the reporter gene aprE, encoding an alkaline protease from Bacillus pumilus BA06. The expression vector pSU03-AP only possessed the minimal replication elements (rep, SSO, DSO) and exhibited more stability on structure, suggesting that the rest of the genes in pSU01 (ORF1, ORF2, mob, hsp) were unessential for the structural stability of plasmid in B. subtilis. In addition, recombinant production of the alkaline protease was achieved more efficiently with pSU03-AP whose copy number was estimated to be more than 100 per chromosome. Furthermore, pSU03-AP could also be used to transform and replicate in B. pumilus BA06 under selective pressure. In conclusion, pSU03-AP is expected to be a useful tool for gene expression in Bacillus subtilis and B. pumilus.
Takala, T M; Saris, P E J; Tynkkynen, S S H
2003-01-01
A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.
Lukan, Tjaša; Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina
2018-01-01
Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science.
Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina
2018-01-01
Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science. PMID:29300787
Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A
2009-12-30
Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.
Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei
2006-11-01
To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.
NASA Astrophysics Data System (ADS)
Wang, Ze; Zhang, Hui
As research previously demonstrated, suppression of AFP expression or its biological activities might inhibit the proliferation of AFP positive human hepatocellular carcinoma cells. In this study, we constructed an anti-AFP gene vector and transfected it to HepG2 cells. RT-PCR showed AFP gene expression in the transfected cells was reduced. MTT assay suggested the proliferation of the transfected cells was also inhibited comparing with the untransfected cells. This result provides a new insight into AFP as the target for preventing and treating hepatocellular carcinoma.
Design and construction of functional AAV vectors.
Gray, John T; Zolotukhin, Serge
2011-01-01
Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.
Nguyen, Khuyen Thi; Ho, Quynh Ngoc; Pham, Thu Ha; Phan, Tuan-Nghia; Tran, Van-Tuan
2016-12-01
Aspergillus oryzae is a safe mold widely used in food industry. It is also considered as a microbial cell factory for production of recombinant proteins and enzymes. Currently, genetic manipulation of filamentous fungi is achieved via Agrobacterium tumefaciens-mediated transformation methods usually employing antibiotic resistance markers. These methods are hardly usable for A. oryzae due to its strong resistance to the common antifungal compounds used for fungal transformation. In this study, we have constructed two binary vectors carrying the pyrG gene from A. oryzae as a biochemical marker than an antibiotic resistance marker, and an expression cassette for GFP or DsRed reporter gene under control of the constitutive gpdA promoter from Aspergillus nidulans. All components of these vectors are changeable to generate new versions for specific research purposes. The developed vectors are fully functional for heterologous expression of the GFP and DsRed fluorescent proteins in the uridine/uracil auxotrophic A. oryzae strain. Our study provides a new approach for A. oryzae transformation using pyrG as the selectable auxotrophic marker, A. tumefaciens as the DNA transfer tool and fungal spores as the transformation material. The binary vectors constructed can be used for gene expression studies in this industrially important filamentous fungus.
Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding
2011-07-01
To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.
Lin, Chao-Fen; Lo, Ta-Chun; Kuo, Yang-Cheng; Lin, Thy-Hou
2013-04-01
An integration vector capable of stably integrating and maintaining in the chromosomes of several lactobacilli over hundreds of generations has been constructed. The major integration machinery used is based on the ΦAT3 integrase (int) and attP sequences determined previously. A novel core sequence located at the 3' end of the tRNA(leu) gene is identified in Lactobacillus fermentum ATCC 14931 as the integration target by the integration vector though most of such sequences found in other lactobacilli are similar to that determined previously. Due to the lack of an appropriate attB site in Lactococcus lactis MG1363, the integration vector is found to be unable to integrate into the chromosome of the strain. However, such integration can be successfully restored by cotransforming the integration vector with a replicative one harboring both attB and erythromycin resistance sequences into the strain. Furthermore, the integration vector constructed carries a promoter region of placT from the chromosome of Lactobacillus rhamnosus TCELL-1 which is used to express green fluorescence and luminance protein genes in the lactobacilli studied.
2013-01-01
Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834
Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs
2013-08-20
Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.
Fowl adenovirus serotype 9 vectored vaccine for protection of avian influenza virus
USDA-ARS?s Scientific Manuscript database
A fowl adenovirus serotype 9, a non-pathogenic large double stranded DNA virus, was developed as a viral vector to express influenza genes as a potential vaccine. Two separate constructs were developed that expressed either the hemagglutinin gene of A/Chicken/Jalisco/2012 (H7) or A/ Chicken/Iowa/20...
Tian, Shi-Lin; Li, Zheng; Li, Li; Shah, S N M; Gong, Zhen-Hui
2017-07-01
Capsanthin/capsorubin synthase ( Ccs ) gene is a key gene that regulates the synthesis of capsanthin and the development of red coloration in pepper fruits. There are three tandem repeat units in the promoter region of Ccs , but the potential effects of the number of repetitive units on the transcriptional regulation of Ccs has been unclear. In the present study, expression vectors carrying different numbers of repeat units of the Ccs promoter were constructed, and the transient expression of the β-glucuronidase ( GUS ) gene was used to detect differences in expression levels associated with the promoter fragments. These repeat fragments and the plant expression vector PBI121 containing the 35s CaMV promoter were ligated to form recombinant vectors that were transfected into Agrobacterium tumefaciens GV3101. A fluorescence spectrophotometer was used to analyze the expression associated with the various repeat units. It was concluded that the constructs containing at least one repeat were associated with GUS expression, though they did not differ from one another. This repeating unit likely plays a role in transcription and regulation of Ccs expression.
Nie, Xiao-wei; Sun, Li-jun; Hao, Yue-wen; Yang, Guang-xiao; Wang, Quan-ying
2011-03-01
To synthesize the minimal and artificial HRE, and to insert it into the anterior extremity of CMV promoter of a AAV plasmid, and then to construct the AAV regulated by hypoxic-responsive element which was introduced into 293 cell by method of Ca3(PO4)2 using three plasmids. Thus obtaining the adenoassociated virus vector regulated by hypoxic-responsive element was possibly used for gene therapy in ischemia angiocardiopathy and cerebrovascular disease. Artificially synthesize the 36 bp nucleotide sequences of four connection in series HIF-binding sites A/GCGTG(4×HBS)and a 35 bp nucleotide sequences spacing inserted into anterior extremity of CMV promoter TATA Box, then amplified by PCR. The cDNA fragment was confirmed to be right by DNA sequencing. Molecular biology routine method was used to construct a AAV vector regulated by minimal hypoxic-responsive element after the normal CMV promoter in AAV vector was replaced by the CMV promoter included minimal hypoxic-responsive element. Then, NT4-6His-PR39 fusogenic peptide was inserted into MCS of the plasmid, the recombinant AAV vector was obtained by three plasmid co-transfection in 293 cells, in which we can also investigate the expression of 6×His using immunochemistry in hypoxia environment. Artificial HRE was inserted into anterior extremity of CMV promoter and there was a correct spacing between the HRE and the TATA-box. The DNA sequencing and restriction enzyme digestion results indicated that the AAV regulated by hypoxic-responsive element was successfully constructed. Compared to the control group, the expressions of 6×His was significantly increased in the experimental groups in hypoxia environment, which confirmed that the AAV effectually regulated by the minimal HRE was inserted into anterior extremity of CMV promoter. The HRE is inserted into anterior extremity of CMV promoter to lack incision enzyme recognition site by PCR. And eukaryotic expression vector regulated by hypoxic-responsive is constructed. The AAV effectually regulated by the minimal HRE inserted into anterior extremity of CMV promoter. The vector is successfully constructed and it has important theoretical and practical value in the synteresis and therapy of ischemia angiocardiopathy and cerebrovascular disease.
[Zinc-dependent metalloprotease 1 promotes apoptosis of RAW264.7 macrophages].
Li, Peng; He, Yonglin; Zhang, Jiming; Fang, Chencheng
2015-12-01
To construct the eukaryotic expression vector of zinc-dependent metalloprotease 1 (zmp1) gene from Bacillus Calmette-Guerin (BCG) and investigate its impact on the apoptosis of RAW264.7 macrophages. Zmp1 gene was amplified from the genome of BCG by PCR. The zmp1 gene fragment was inserted into multiple cloning sites of pEGFP-N1 to construct the eukaryotic expression vector pEGFP-N1-zmp1. The constructed pEGFP-N1-zmp1 was transfected into RAW264.7 cells by Lipofectamine(TM) 2000. The expression of green fluorescent protein (GFP) was observed by fluorescence microscopy. The zmp1 mRNA was detected by quantitative real-time PCR (qR-PCR). The effect of Zmp1 protein on the apoptosis of RAW264.7 macrophages was detected by flow cytometry (FCM). With zmp1 gene amplified by PCR, we successfully constructed the recombinant vector pEGFP-N1-zmp1 as demonstrated by restriction enzyme analysis and sequencing. GFP was seen in RAW264.7 cells 24 hours after transfected with the recombinant plasmid. As qRT-PCR showed, the expression level of zmp1 mRNA was up-regulated. The early apoptotic rate increased 48 hours after transfection. The increased expression of Zmp1 in RAW264.7 cells promotes the apoptosis of RAW264.7 cells.
NASA Astrophysics Data System (ADS)
Gong, Qianhong; Yu, Wengong; Dai, Jixun; Liu, Hongquan; Xu, Rifu; Guan, Huashi; Pan, Kehou
2007-01-01
Endogenous tubulin promoter has been widely used for expressing foreign genes in green algae, but the efficiency and feasibility of endogenous tubulin promoter in the economically important Porphyra yezoensis (Rhodophyta) are unknown. In this study, the flanking sequences of beta-tubulin gene from P. yezoensis were amplified and two transient expression vectors were constructed to determine their transcription promoting feasibility for foreign gene gusA. The testing vector pATubGUS was constructed by inserting 5'-and 3'-flanking regions ( Tub5' and Tub3') up-and down-stream of β-glucuronidase (GUS) gene ( gusA), respectively, into pA, a derivative of pCAT®3-enhancer vector. The control construct, pAGUSTub3, contains only gusA and Tub3'. These constructs were electroporated into P. yezoensis protoplasts and the GUS activities were quantitatively analyzed by spectrometry. The results demonstrated that gusA gene was efficiently expressed in P. yezoensis protoplasts under the regulation of 5'-flanking sequence of the beta-tubulin gene. More interestingly, the pATubGUS produced stronger GUS activity in P. yezoensis protoplasts when compared to the result from pBI221, in which the gusA gene was directed by a constitutive CaMV 35S promoter. The data suggest that the integration of P. yezoensis protoplast and its endogenous beta-tubulin flanking sequences is a potential novel system for foreign gene expression.
2009-01-01
Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112
The Function of Herpes Simplex Virus Genes: A Primer for Genetic Engineering of Novel Vectors
NASA Astrophysics Data System (ADS)
Roizman, Bernard
1996-10-01
Herpes simplex virus vectors are being developed for delivery and expression of human genes to the central nervous system, selective destruction of cancer cells, and as carriers for genes encoding antigens that induce protective immunity against infectious agents. Vectors constructed to meet these objectives must differ from wild-type virus with respect to host range, reactivation from latency, and expression of viral genes. The vectors currently being developed are (i) helper free amplicons, (ii) replication defective viruses, and (iii) genetically engineered replication competent viruses with restricted host range. Whereas the former two types of vectors require stable, continuous cell lines expressing viral genes for their replication, the replication competent viruses will replicate on approved primary human cell strains.
Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M
2001-04-01
Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.
Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid
2018-06-01
This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2018. Published by Elsevier Inc.
Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C
1990-01-01
Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285
Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C
1990-01-01
Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.
Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi
2017-07-21
Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.
Geminivirus vectors for high-level expression of foreign proteins in plant cells.
Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S
2003-02-20
Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.
Keogh, M C; Chen, D; Schmitt, J F; Dennehy, U; Kakkar, V V; Lemoine, N R
1999-04-01
The facility to direct tissue-specific expression of therapeutic gene constructs is desirable for many gene therapy applications. We describe the creation of a muscle-selective expression vector which supports transcription in vascular smooth muscle, cardiac muscle and skeletal muscle, while it is essentially silent in other cell types such as endothelial cells, hepatocytes and fibroblasts. Specific transcriptional regulatory elements have been identified in the human vascular smooth muscle cell (VSMC) alpha-actin gene, and used to create an expression vector which directs the expression of genes in cis to muscle cells. The vector contains an enhancer element we have identified in the 5' flanking region of the human VSMC alpha-actin gene involved in mediating VSMC expression. Heterologous pairing experiments have shown that the enhancer does not interact with the basal transcription complex recruited at the minimal SV40 early promoter. Such a vector has direct application in the modulation of VSMC proliferation associated with intimal hyperplasia/restenosis.
Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia
2012-11-04
To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P < 0.05). The lymphocyte proliferation indices of VP2 + cIL-7/cIL-2 vector-immunized mice were also higher than that of other two groups although not statistically significant. However, the IFN-gamma expression levels of VP2 + cIL-7/cIL-2 vector-immunized mice were significantly higher than other immunized mice (P < 0.05). The cIL-2 and cIL-7 genes showed the significant synergic effects on enhancing the immunogenecity of CPV VP2 DNA vaccine.
Design and cloning strategies for constructing shRNA expression vectors
McIntyre, Glen J; Fanning, Gregory C
2006-01-01
Background Short hairpin RNA (shRNA) encoded within an expression vector has proven an effective means of harnessing the RNA interference (RNAi) pathway in mammalian cells. A survey of the literature revealed that shRNA vector construction can be hindered by high mutation rates and the ensuing sequencing is often problematic. Current options for constructing shRNA vectors include the use of annealed complementary oligonucleotides (74 % of surveyed studies), a PCR approach using hairpin containing primers (22 %) and primer extension of hairpin templates (4 %). Results We considered primer extension the most attractive method in terms of cost. However, in initial experiments we encountered a mutation frequency of 50 % compared to a reported 20 – 40 % for other strategies. By modifying the technique to be an isothermal reaction using the DNA polymerase Phi29, we reduced the error rate to 10 %, making primer extension the most efficient and cost-effective approach tested. We also found that inclusion of a restriction site in the loop could be exploited for confirming construct integrity by automated sequencing, while maintaining intended gene suppression. Conclusion In this study we detail simple improvements for constructing and sequencing shRNA that overcome current limitations. We also compare the advantages of our solutions against proposed alternatives. Our technical modifications will be of tangible benefit to researchers looking for a more efficient and reliable shRNA construction process. PMID:16396676
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
Chen, Tingfang; Luo, Na; Xie, Huaping; Wu, Xiushan; Deng, Yun
2010-02-01
In an effort to generate a desired expression construct for making heart-specific expression transgenic zebrafish, a Tol2 plasmid, which can drive EGFP reporter gene specifically expressed in the heart, was modified using subcloning technology. An IRES fragment bearing multiple cloning site (MCS) was amplified directly from pIRES2-EGFP plasmid and was inserted between the CMLC2 promoter and EGFP fragment of the pDestTol2CG vector. This recombinant expression plasmid pTol2-CMLC2-IRES-EGFP can drive any interested gene specifically expressed in the zebrafish heart along with EGFP reporter gene. To test the effectiveness of this new expression plasmid, we constructed pTol2-CMLC2-RED-IRES-EGFP plasmid by inserting another reporter gene DsRed-Monome into MCS downstream of the CMLC2 promoter and injected this transgenic recombinant plasmid into one-cell stage embryos of zebrafish. Under fluorescence microscope, both the red fluorescence and the green fluorescence produced by pTol2-CMLC2-RED-IRES-EGFP were detected specifically in the heart tissue in the same expression pattern. This novel expression construct pTol2-CMLC2-IRES-EGFP will become an important tool for our research on identifying heart development candidate genes' function using zebrafish as a model.
[Construction and expression of recombinant lentiviral vectors of AKT2,PDK1 and BAD].
Zhu, Jing; Chen, Bo-Jiang; Huang, Na; Li, Wei-Min
2014-03-01
To construct human protein kinase B (ATK2), phosphoinositide-dependent kinase 1 (PDK1) and bcl-2-associated death protein (BAD) lentiviral expression vector, and to determine their expressions in 293T cells. Total RNA was extracted from lung cancer tissues. The full-length coding regions of human ATK2, BAD and PDK1 cDNA were amplified via RT-PCR using specific primers, subcloned into PGEM-Teasy and then sequenced for confirmation. The full-length coding sequence was cut out with a specific restriction enzyme digest and subclone into pCDF1-MCS2-EF1-copGFP. The plasmids were transfected into 293T cells using the calcium phosphate method. The over expression of AKT2, BAD and PDK1 were detected by Western blot. AKT2, PDK1 and BAD were subcloned into pCDF1-MCS2-EF1-copGFP, with an efficiency of transfection of 100%, 95%, and 90% respectively. The virus titers were 6.7 x 10(6) PFU/mL in the supernatant. After infection, the proteins of AKT2, PDK1 and BAD were detected by Western blot. The lentivial vector pCDF1-MCS2-EF1-copGFP containing AKT2, BAD and PDK1 were successfully constructed and expressed in 293T cells.
Automated solid-phase subcloning based on beads brought into proximity by magnetic force.
Hudson, Elton P; Nikoshkov, Andrej; Uhlen, Mathias; Rockberg, Johan
2012-01-01
In the fields of proteomics, metabolic engineering and synthetic biology there is a need for high-throughput and reliable cloning methods to facilitate construction of expression vectors and genetic pathways. Here, we describe a new approach for solid-phase cloning in which both the vector and the gene are immobilized to separate paramagnetic beads and brought into proximity by magnetic force. Ligation events were directly evaluated using fluorescent-based microscopy and flow cytometry. The highest ligation efficiencies were obtained when gene- and vector-coated beads were brought into close contact by application of a magnet during the ligation step. An automated procedure was developed using a laboratory workstation to transfer genes into various expression vectors and more than 95% correct clones were obtained in a number of various applications. The method presented here is suitable for efficient subcloning in an automated manner to rapidly generate a large number of gene constructs in various vectors intended for high throughput applications.
Automated Solid-Phase Subcloning Based on Beads Brought into Proximity by Magnetic Force
Hudson, Elton P.; Nikoshkov, Andrej; Uhlen, Mathias; Rockberg, Johan
2012-01-01
In the fields of proteomics, metabolic engineering and synthetic biology there is a need for high-throughput and reliable cloning methods to facilitate construction of expression vectors and genetic pathways. Here, we describe a new approach for solid-phase cloning in which both the vector and the gene are immobilized to separate paramagnetic beads and brought into proximity by magnetic force. Ligation events were directly evaluated using fluorescent-based microscopy and flow cytometry. The highest ligation efficiencies were obtained when gene- and vector-coated beads were brought into close contact by application of a magnet during the ligation step. An automated procedure was developed using a laboratory workstation to transfer genes into various expression vectors and more than 95% correct clones were obtained in a number of various applications. The method presented here is suitable for efficient subcloning in an automated manner to rapidly generate a large number of gene constructs in various vectors intended for high throughput applications. PMID:22624028
Epigenetic Control of Prostate Cancer Metastasis: Role of Runx2 Phosphorylation
2014-04-01
prostate cancer cells. In the third budget year, we achieved the following: a. Generation of retrovirus and lentivirus vectors expressing WT RUNX2 and S301A... retrovirus vectors will be developed that express β-galactosidase (negative control), wild type Runx2, S301A/S319A (non-phosphorylated) or S301E/S310E...constitutively active) Runx2 mutants. As described last year, retrovirus and lentivirus vectors were constructed to stably introduce wild type and mutant
Drop-out phagemid vector for switching from phage displayed affinity reagents to expression formats.
Pershad, Kritika; Sullivan, Mark A; Kay, Brian K
2011-05-15
Affinity reagents that are generated by phage display are typically subcloned into an expression vector for further biochemical characterization. This insert transfer process is time consuming and laborious especially if many inserts are to be subcloned. To simplify the transfer process, we have constructed a "drop-out" phagemid vector that can be rapidly converted to an expression vector by a simple restriction enzyme digestion with MfeI (to "drop-out" the gene III coding sequence), which generates alkaline phosphatase (AP) fusions of the affinity reagents on religation. Subsequently, restriction digestion with AscI drops out the AP coding region and religation generates affinity reagents with a C-terminal six-histidine tag. To validate the usefulness of this vector, four different human single chain Fragments of variable regions (scFv) were tested, three of which show specific binding to three zebrafish (Danio rerio) proteins, namely suppression of tumorigenicity 13, recoverin, and Ppib and the fourth binds to human Lactoferrin protein. For each of the constructs tested, the gene III and AP drop-out efficiency was between 90% and 100%. This vector is especially useful in speeding up the downstream screening of affinity reagents and bypassing the time-consuming subcloning experiments. Copyright © 2011 Elsevier Inc. All rights reserved.
Gao, Rong-Bao; Li, Yan-Qiu; Wang, Ming-Li
2006-06-01
To construct eucaryotic expression recombinant vector containing vivo truncated region of UL83 gene of human cytomegalovirus, realize its steady expression in Hep-2 cell, and study sheltered effect of the eucaryotic expression recombinant vector as DNA vaccine. A vivo truncated UL83 gene fragment encoding for truncated HCMV pp65 was obtained by PCR from human cytomegalovirus AD169 stock genome. By gene recombinant ways, the truncated UL83 gene fragment was cloned into eucaryotic expression vector pEGFP-C1 with reported gene coding GFP to construct recombinant vector pEGFP-C1-UL83. The recombinant vector pEGFP-C1-UL83 was tested by different methods including PCR, restriction digestion and gene sequencing. Test results showed the recombinant vector was constructed successfully. After pEGFP-C1-UL83 was transfected into Hep-2 cell by lipofectin mediation, expression of GFP and truncated pp65 fusion protein in Hep-2 cell was observed at different time points by fluorescence microscope. Results showed that quantity of fusion protein expression was the highest at 36h point. Then, Hep-2 cell was cultured selectively by RPMI-1640 containing G418 (200 microg/mL) to obtain a new cell stock of expressing truncated UL83 Gene fragment steadily. RT-PCR and Western blot results showed the truncated fragment of UL83 gene could be expressed steadily in Hep-2 cell. The result showed a new cell stock of expressing Tpp65 was established. This cell stock could be useful in some HCMV research fields, for example, it could be a tool in study of pp65 and HCMV infection, and it could provide a platform for the research into the therapy of HCMV infection. Immune sheltered effect of pEGFP-C1-UL83 as DNA vaccine was studied in vivo of HCMV congenital infection mouse model. The mouse model was immunized solely by pEGFP-C1-UL83, and was immunized jointly by pEGFP-C1-UL83 and its expression product. When the mouse was pregnant and brought to bed, differential antibody of anti-HCMV pp65 was tested by indirect ELISA in mother mouse, the infectious virus was separated with the method of virus separation, and pp65 antigen was checked up by indirect immunofluorescence staining in fetal mouse. Results showed differential antibody of anti-HCMV pp65 was produced in mouse model. Tilter of the antibody was from 1:2.51 to 1:50.79. Results of virus separation and pp65 checkup of fetal mouse brain tissue were negative. So the conclusion can be reached that pEGFP-C1-UL83 as DNA vaccine in vivo has sheltered effect which can prevent HCMV vertical transmission from mother mouse to her fetus.
Simple cloning strategy using GFPuv gene as positive/negative indicator.
Miura, Hiromi; Inoko, Hidetoshi; Inoue, Ituro; Tanaka, Masafumi; Sato, Masahiro; Ohtsuka, Masato
2011-09-15
Because construction of expression vectors is the first requisite in the functional analysis of genes, development of simple cloning systems is a major requirement during the postgenomic era. In the current study, we developed cloning vectors for gain- or loss-of-function studies by using the GFPuv gene as a positive/negative indicator of cloning. These vectors allow us to easily detect correct clones and obtain expression vectors from a simple procedure by means of the combined use of the GFPuv gene and a type IIS restriction enzyme. Copyright © 2011 Elsevier Inc. All rights reserved.
Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping
2015-08-15
A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Ma, Benjiang; Hang, Changshou; Zhao, Yun; Wang, Shiwen; Xie, Yanxiang
2002-09-01
To construct a novel baculovirus vector which is capable of promoting the high-yield expression of foreign gene in mammalian cells and to express by this vector the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV) Chinese isolate (Xinjiang hemorrhagic fever virus, XHFV) BA88166 in insect and Vero cells. Human cytomegalovirus (CMV) immediate early (IE) promoter was ligated to the baculovirus vector pFastBac1 downstream of the polyhedrin promoter to give rise to the novel vector pCB1. XHFV NP gene was cloned to this vector and was well expressed in COS-7 cells and Vero cells by means of recombinant plasmid transfection and baculovirus infection. The XHFV NP gene in vector pCB1 could be well expressed in mammalian cells. Vero cells infected with recombinant baculovirus harboring NP gene could be employed as antigens to detect XHF serum specimens whose results were in good correlation with those of ELISA and in parallel with clinical diagnoses. This novel baculovirus vector is able to express the foreign gene efficiently in both insect and mammalian cells, which provides not only the convenient diagnostic antigens but also the potential for developing recombinant virus vaccines and gene therapies.
A Simple And Rapid Minicircle DNA Vector Manufacturing System
Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying
2010-01-01
Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455
DOE Office of Scientific and Technical Information (OSTI.GOV)
Allen, L.N.; Hanson, R.S.
Four new cloning vectors have been constructed from the broad-host-range cloning vector pRK290. These vectors, pLA2901, pLA2905, pLA2910, and pLA2917, confer resistance to kanamycin and tetracycline. The latter two are cosmid derivatives of pLA2901. The new vectors can be mobilized into, and are stably maintained in, a variety of gram-negative bacteria. A Sau3A genomic bank of Methylobacterium organophilum strain xx DNA has been constructed in pLA2917, and complementation analysis, with a variety of mutants unable to grow on methanol, revealed at least five separate regions necessary for growth on methanol. Complementation analysis and Tn5 mutagenesis data suggest that at leastmore » three genes are responsible for expression of active methanol dehydrogenase.« less
Kim, Hyun Ah; Lim, Soyeon; Moon, Hyung-Ho; Kim, Sung Wan; Hwang, Ki-Chul; Lee, Minhyung; Kim, Sun Hwa; Choi, Donghoon
2010-10-01
A hypoxia-inducible VEGF expression system with the oxygen-dependent degradation (ODD) domain was constructed and tested to be used in gene therapy for ischemic myocardial disease. Luciferase and VEGF expression vector systems were constructed with or without the ODD domain: pEpo-SV-Luc (or pEpo-SV-VEGF) and pEpo-SV-Luc-ODD (or pEpo-SV-VEGF-ODD). In vitro gene expression efficiency of each vector type was evaluated in HEK 293 cells under both hypoxic and normoxic conditions. The amount of VEGF protein was estimated by ELISA. The VEGF expression vectors with or without the ODD domain were injected into ischemic rat myocardium. Fibrosis, neovascularization, and cardiomyocyte apoptosis were assessed using Masson's trichrome staining, α-smooth muscle actin (α-SMA) immunostaining, and the TUNEL assay, respectively. The plasmid vectors containing ODD significantly improved the expression level of VEGF protein in hypoxic conditions. The enhancement of VEGF protein production was attributed to increased protein stability due to oxygen deficiency. In a rat model of myocardial ischemia, the pEpo-SV-VEGF-ODD group exhibited less myocardial fibrosis, higher microvessel density, and less cardiomyocyte apoptosis compared to the control groups (saline and pEpo-SV-VEGF treatments). An ODD-mediated VEGF expression system that facilitates VEGF-production under hypoxia may be useful in the treatment of ischemic heart disease.
Construction of pTM series plasmids for gene expression in Brucella species.
Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing
2016-04-01
Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.
[Construction and eukaryotic expression of PVAX1-hPV58mE6E7fcGB composite gene vaccine].
Wang, He; Yu, Jiyun; Li, Li
2013-10-01
To construct and express a composite gene vaccine for human papillomavirus 58(HPV58)-associated cervical cancer, we inserted HPV58mE6E7 fusion gene into pCI-Fc-GPI eukaryotic expression vector, constructing a recombinant plasmid named pCI-sig-HPV58mE6E7-Fc-GPI. Then we further inserted fragment of sig-HPV58mE6E7Fc-GPI into the novel vaccine vector PVAX1-IRES-GM/B7, constructing PVAX1-HPV58mE6E7FcGB composite gene vaccine. PVAX1-HPV58mE6E7FcGB vaccine was successfully constructed and identified by restriction endonuclease and sequencing analysis. Eukaryotic expression of fusion antigen sig-HPV58mE6E7-Fc-GPI and molecular ad-juvant GM-CSF and B7. 1 were proved to be realized at the same time by flow cytometry and immunofluorescence. So PVAX1-HPV58mE6E7FcGB can be taken as a candidate of therapeutic vaccine for HPV58-associated tumors and their precancerous transformations.
Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh; Mahboudi, Fereidoun
2017-01-01
Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios.
Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh
2017-01-01
Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios. PMID:28662065
[Construction of rAAV2-GPIIb/IIIa vector and test of its expression and function in vitro].
Wang, Kai; Peng, Jian-Qiang; Chen, Fang-Ping; Wu, Xiao-Bin
2006-04-01
This study was aimed to explore the possibility of rAAV2 vector-mediating gene therapy for Glanzmann' s thrombasthenia. The rAAV2-GPIIb/IIIa vector was constructed. The GPIIb/IIIa gene expression in mammal cell were examined by different methods, such as: detection of mRNA expression in BHK-21 cells after 24 hours of infection (MOI = 1 x 10(5) v.g/cell) was performed by RT-PCR; the relation between MOI and quantity of GPII6/IIIa gene expression was detected by FACS after 48 hours of infection; GPIIb/IIIa protein expression in BHK-21 cells after 48 hours of infection (MOI = 10(5) v x g/cell) was assayed by Western blot, GPIIb/IIIa protein expression on cell surface was detected by immunofluorescence, and the biological function of expressing product was determined by PAC-1 conjunct experiments. The results showed that GPIIb/IIIa gene expression in mRNA level could be detected in BHK-21 cells after 24 hours of infection at MOI = 1 x 10(5) v x g/cell and the GPIIb/IIIa gene expression in protein level could be detected in BHK-21 cells after 48 hours of infection at MOI = 1 x 10(5) v x g/cell. In certain range, quantity of GPIIb/IIIa gene expression increased with MOI, but overdose of MOI decreased quantity of GPIIb/IIIa gene expression. Activated product of GPIIb/IIIa gene expression could combined with PAC-I, and possesed normal biological function. In conclusion, rAAV2 vactor can effectively mediate GPIIb and GPIIIa gene expressing in mammal cells, and the products of these genes exhibit biological function. This result may provide a basis for application of rAAV2 vector in Glanzmann's thrombasthenia gene therapy in furture.
Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying
2009-04-01
This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.
Rhee, Sun-Ju; Jang, Yoon Jeong; Lee, Gung Pyo
2016-06-01
Heterologous gene expression using plant virus vectors enables research on host-virus interactions and the production of useful proteins, but the host range of plant viruses limits the practical applications of such vectors. Here, we aimed to develop a viral vector based on cucumber fruit mottle mosaic virus (CFMMV), a member of the genus Tobamovirus, whose members infect cucurbits. The subgenomic promoter (SGP) in the coat protein (CP) gene, which was used to drive heterologous expression, was mapped by analyzing deletion mutants from a CaMV 35S promoter-driven infectious CFMMV clone. The region from nucleotides (nt) -55 to +160 relative to the start codon of the open reading frame (ORF) of CP was found to be a fully active promoter, and the region from nt -55 to +100 was identified as the active core promoter. Based on these SGPs, we constructed a cloning site in the CFMMV vector and successfully expressed enhanced green fluorescent protein (EGFP) in Nicotiana benthamiana and watermelon (Citrullus lanatus). Co-inoculation with the P19 suppressor increased EGFP expression and viral replication by blocking degradation of the viral genome. Our CFMMV vector will be useful as an expression vector in cucurbits.
Yin, Yanchen; Mao, Youzhi; Yin, Xiaolie; Gao, Bei; Wei, Dongzhi
2015-07-01
The filamentous fungus Aspergillus oryzae is a well-known expression host used to express homologous and heterologous proteins in a number of industrial applications. To facilitate higher yields of proteins of interest, we constructed the pAsOP vector to express heterologous proteins in A. oryzae. pAsOP carries a selectable marker, pyrG, derived from Aspergillus nidulans, and a strong promoter and a terminator of the amyB gene derived from A. oryzae. pAsOP transformed A. oryzae efficiently via the PEG-CaCl2-mediated transformation method. As proof of concept, green fluorescent protein (GFP) was successfully expressed in A. oryzae transformed by pAsOP-GFP. Additionally, we identified a novel fungal α-amylase (PcAmy) gene from Penicillium sp. and cloned the gene into the vector. After transformation by pAsOPPcAmy, the α-amylase PcAmy from Penicillium sp. was successfully expressed in a heterologous host system for the first time. The α-amylase activity in the A. oryzae transformant was increased by 62.3% compared with the untransformed A. oryzae control. The PcAmy protein produced in the system had an optimum pH of 5.0 and optimum temperature of 30°C. As a cold-adapted enzyme, PcAmy shows potential value in industrial applications because of its high catalytic activity at low temperature. Furthermore, the expression vector reported in this study provides promising utility for further scientific research and biotechnological applications.
Construction of an agglutination tool: recombinant Fab fragments biotinylated in vitro.
Czerwinski, Marcin; Krop-Watorek, Anna; Wasniowska, Kazimiera; Smolarek, Dorota; Spitalnik, Steven L
2009-11-30
The pComb3H vector system is used for constructing and panning recombinant antibody libraries. It allows for expression of monovalent Fab fragments, either on the surface of M13 phage, or in the form of soluble proteins secreted into the periplasmic space of bacteria. We constructed a modified pComb3H vector containing cDNA encoding for a 23-amino acid fragment of the Escherichia coli biotin carboxy carrier protein (BCCP), which is an acceptor sequence for biotinylation. The vector was used to express the Fab fragment recognizing human glycophorin A. The purified Fab fragment containing this biotin acceptor sequence was effectively biotinylated in vitro using biotin ligase (BirA). The specificity and avidity of the biotinylated Fab fragments were similar to the previously produced, unmodified Fab fragments. An avidin-alkaline phosphatase conjugate was used to detect the recombinant Fab fragments, instead of secondary antibody. In addition, when biotinylated Fab fragments were mixed with avidin, red blood cells were directly agglutinated.
Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J
2016-10-01
Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.
Helper-Free Foamy Virus Vectors
TROBRIDGE, GRANT D.; RUSSELL, DAVID W.
2010-01-01
Retroviral vectors based on human foamy virus (HFV) have been developed and show promise as gene therapy vehicles. Here we describe a method for the production of HFV vector stocks free of detectable helper virus. The helper and vector plasmid constructs used both lack the HFV bel genes, so recombination between these constructs cannot create a wild-type virus. A fusion promoter that combines portions of the cytomegalovirus (CMV) immediate-early and HFV long terminal repeat (LTR) promoters was used to drive expression of both the helper and vector constructs. The CMV–LTR fusion promoter allows for HFV vector production in the absence of the Bel-1 trans-activator protein, which would otherwise be necessary for efficient transcription from the HFV LTR. Vector stocks containing either neomycin phosphotransferase or alkaline phosphatase reporter genes were produced by transient transfection at titers greater than 105 transducing units/ml. G418-resistant BHK-21 cells obtained by transduction with neo vectors contained randomly integrated HFV vector proviruses without detectable deletions or rearrangements. The vector stocks generated were free of replication-competent retrovirus (RCR), as determined by assays for LTR trans-activation and a marker rescue assay developed here for the detection of Bel-independent RCR. OVERVIEW SUMMARY Vectors based on human foamy virus have been developed but low titers and the presence of replication-competent retrovirus (RCR) in vector stocks have prevented their use in preclinical animal experiments. We have developed a transient transfection method that can be used to produce replication-incompetent HFV vector stocks at titers greater than 105/ml, and that does not produce contaminating RCR. The use of CMV-HFV LTR fusion promoters in the helper and vector constructs has circumvented the requirement for the HFV Bel-1 trans-activator protein. Consequently, the potential for generating wild-type HFV by recombination between helper and vector constructs during vector production has been eliminated. Here we describe HFV vector production using this Bel-independent system. PMID:9853518
In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering
Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang
2017-01-01
Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids. PMID:28871270
In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering.
Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang
2017-01-01
Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5' untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3'UTR from the E. coli ribosomal RNA operon rrnB . Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.
Generation of 2A-linked multicistronic cassettes by recombinant PCR.
Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A
2012-02-01
The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. It is now possible to express multiple proteins from a single open reading frame (ORF) using 2A peptide-linked multicistronic vectors. These small sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector. This protocol describes the use of recombinant polymerase chain reaction (PCR) to connect multiple 2A-linked protein sequences. The final construct is subcloned into an expression vector.
[Expression and Preliminary Research on the Soluble Domain of EV-D68 3A Protein].
Li, Ting; Kong, Jia; Yu, Xiao-fang; Han, Xue
2015-11-01
To understand the structure of the soluble region of Enterovirus 68 3A protein, we construct a prokaryotic expression vector expressing the soluble region of EV-D68 3A protein, and identify the forms of expression product after purification. The EV-D68 3A(1-61) gene was amplified by PCR and then cloned into the expression vector pET-28a-His-SUMO. The recombinant plasmid was transformed into Escherichia coli BL21 induced by IPTG to express the fusion protein His-SUMO-3A(1-61). The recombinant protein was purified by Ni-NTA Agarose and cleaved by ULP Protease to remove His-SUMO tag. After that, the target protein 3A(1-61) was purified by a series of purification methods such as Ni-NTA, anion exchange chromatography and gel filtration chromato- graphy. Chemical cross-linking reaction assay was taken to determine the multiple polymerization state of the 3A soluble region. A prokaryotic expression vector pET28a-His-SUMO-3A(1-61) expressing the solution region of EV-D68 3A was successfully constructed and plenty of highly pure target proteins were obtained by multiple purification steps . The total protein amount was about 5 mg obtained from 1L Escherichia coli BL21 with purity > 95%. At the same time, those results determined the homomultimer form of soluble 3A construct. These data demonstrated that the expression and purification system of the soluble region of 3A were successfully set up and provide some basic konwledge for the research about 3A crystal structure and the development of antiviral drugs targeted at 3A to block viral replication.
Arazi, T; Slutsky, S G; Shiboleth, Y M; Wang, Y; Rubinstein, M; Barak, S; Yang, J; Gal-On, A
2001-04-27
Plant virus vectors provide an attractive biotechnological tool for the transient expression of foreign genes in whole plants. As yet there has been no use of recombinant viruses for the improvement of commercial crops. This is mainly because the viruses used to create vectors usually cause significant yield loss and can be transmitted in the field. A novel attenuated zucchini yellow mosaic potyvirus (AG) was used for the development of an environmentally safe non-pathogenic virus vector. The suitability of AG as an expression vector in plants was tested by analysis of two infectious viral constructs, each containing a distinct gene insertion site. Introduction of a foreign viral coat protein gene into AG genome between the P1 and HC-Pro genes, resulted in no expression in planta. In contrast, the same gene was stably expressed when inserted between NIb and CP genes, suggesting that this site is more suitable for a gene vector. Virus-mediated expression of reporter genes was observed in squash and cucumber leaves, stems, roots and edible fruit. Furthermore, AG stably expressed human interferon-alpha 2, an important human anti-viral drug, without affecting plant development and yield. Interferon biological activity was measured in cucumber and squash fruit. Together, these data corroborate a biotechnological utility of AG as a non-pathogenic vector for the expression of a foreign gene, as a benefit trait, in cucurbits and their edible fruit.
Wang, Jichun; Ge, Aimin; Xu, Mengwei; Wang, Zhisheng; Qiao, Yongfeng; Gu, Yiqi; Liu, Chang; Liu, Yamei; Hou, Jibo
2015-08-13
Highly pathogenic avian influenza virus (AIV) subtype H5N1 remains a threat to poultry. Duck enteritis virus (DEV)-vectored vaccines expressing AIV H5N1 hemagglutinin (HA) may be viable AIV and DEV vaccine candidates. To facilitate the generation and further improvement of DEV-vectored HA(H5) vaccines, we first constructed an infectious clone of DEV Chinese vaccine strain C-KCE (DEV(C-KCE)). Then, we generated a DEV-vectored HA(H5) vaccine (DEV-H5(UL55)) based on the bacterial artificial chromosome (BAC) by inserting a synthesized HA(H5) expression cassette with a pMCMV IE promoter and a consensus HA sequence into the noncoding area between UL55 and LORF11. The immunogenicity and protective efficacy of the resulting recombinant vaccine against DEV and AIV H5N1 were evaluated in both ducks and chickens. The successful construction of DEV BAC and DEV-H5(UL55) was verified by restriction fragment length polymorphism analysis. Recovered virus from the BAC or mutants showed similar growth kinetics to their parental viruses. The robust expression of HA in chicken embryo fibroblasts infected with the DEV-vectored vaccine was confirmed by indirect immunofluorescence and western blotting analyses. A single dose of 10(6) TCID50 DEV-vectored vaccine provided 100 % protection against duck viral enteritis in ducks, and the hemagglutination inhibition (HI) antibody titer of AIV H5N1 with a peak of 8.2 log2 was detected in 3-week-old layer chickens. In contrast, only very weak HI titers were observed in ducks immunized with 10(7) TCID50 DEV-vectored vaccine. A mortality rate of 60 % (6/10) was observed in 1-week-old specific pathogen free chickens inoculated with 10(6) TCID50 DEV-vectored vaccine. We demonstrate the following in this study. (i) The constructed BAC is a whole genome clone of DEV(C-KCE). (ii) The insertion of an HA expression cassette sequence into the noncoding area between UL55 and LORF11 of DEV(C-KCE) affects neither the growth kinetics of the virus nor its protection against DEV. (iii) DEV-H5(UL55) can generate a strong humoral immune response in 3-week-old chickens, despite the virulence of this virus observed in 1-week-old chickens. (iv) DEV-H5(UL55) induces a weak HI titer in ducks. An increase in the HI titers induced by DEV-vectored HA(H5) will be required prior to its wide application.
A dual host vector for Fab phage display and expression of native IgG in mammalian cells.
Tesar, Devin; Hötzel, Isidro
2013-10-01
A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.
[Construction of BAD Lentivirus Vector and Its Effect on Proliferation in A549 Cell Lines].
Huang, Na; He, Yan-qi; Zhu, Jing; Li, Wei-min
2015-05-01
To construct the recombinant lentivirus expressing vector BAD (Bcl-2-associated death protein) gene and to study its effect on A549 cell proliferation. The BAD gene was amplified from plasmid pAV-MCMV-BAD-GFP by PCR. The purified BAD gene fragment was inserted into a lentivirus vector (pLVX-IRES-ZsGreen 1), and the insertion was identified by PCR, restriction endonuclease analysis and DNA sequencing. A549 cells were then transfected with the packaged recombinant lentivirus, and resistant cell clones were selected with flow cytometry. The expression of BAD in A549 cell lines stably transduction with a lentivirus was examined using Western blot. The effect of BAD overexpression on proliferation of A549 cells was evaluated by using CCK-8 kit. Restriction enzyme digestion and DNA sequencing showed that the full-length BAD gene (507 bp) had been successfully subcloned into the lentiviral vector to result in the recombinant vector pLVX-IRES-ZsGreen 1. Monoclonal cell lines BAD-A549 was produced after transfection with the recombinant lentivirus and selected with flow cytometry. Stable expression of BAD protein was verified by Western blot. In vitro, the OD value in BAD group was significantly lower than that of control groups from 120-144 h (P<0. 05). A549 cell lines stably transduced with a lentivirus expressing the BAD gene had been successfully generated. In vitro, BAD overexpression significantly inhibited A549 cells proliferation.
Design and construction of targeted AAVP vectors for mammalian cell transduction.
Hajitou, Amin; Rangel, Roberto; Trepel, Martin; Soghomonyan, Suren; Gelovani, Juri G; Alauddin, Mian M; Pasqualini, Renata; Arap, Wadih
2007-01-01
Bacteriophage (phage) evolved as bacterial viruses, but can be adapted to transduce mammalian cells through ligand-directed targeting to a specific receptor. We have recently reported a new generation of hybrid prokaryotic-eukaryotic vectors, which are chimeras of genetic cis-elements of recombinant adeno-associated virus and phage (termed AAVP). This protocol describes the design and construction of ligand-directed AAVP vectors, production of AAVP particles and the methodology to transduce mammalian cells in vitro and to target tissues in vivo after systemic administration. Targeted AAVP particles are made in a two-step process. First, a ligand peptide of choice is displayed on the coat protein to generate a targeted backbone phage vector. Then, a recombinant AAV carrying a mammalian transgene cassette is inserted into an intergenomic region. High-titer suspensions (approximately 10(10)-10(11) transducing units per microl) can be produced within 3 days after vector construction. Transgene expression by targeted AAVP usually reaches maximum levels within 1 week.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strauss, Bryan E.; Patricio, Juliana Rotelli; Program in Biotechnology, University of Sao Paulo
2006-10-06
We have constructed a lentiviral vector with expression limited to cells presenting active E2F-1 protein, a potential advantage for gene therapy of proliferative diseases. For the FE2FLW vector, the promoter region of the human E2F-1 gene was utilized to drive expression of luciferase cDNA, included as a reporter of viral expression. Primary, immortalized, and transformed cells were transduced with the FE2FLW vector and cell cycle alterations were induced with serum starvation/replacement, contact inhibition or drug treatment, revealing cell cycle-dependent changes in reporter activity. Forced E2F-1 expression, but not E2F-2 or E2F-3, increased reporter activity, indicating a major role for thismore » factor in controlling expression from the FE2FLW virus. We show the utility of this vector as a reporter of E2F-1 and proliferation-dependent cellular alterations upon cytotoxic/cytostatic treatment, such as the introduction of tumor suppressor genes. We propose that the FE2FLW vector may be a starting point for the development of gene therapy strategies for proliferative diseases, such as cancer or restinosis.« less
Schoberle, Taylor J; Nguyen-Coleman, C Kim; May, Gregory S
2013-01-01
Fungal species are continuously being studied to not only understand disease in humans and plants but also to identify novel antibiotics and other metabolites of industrial importance. Genetic manipulations, such as gene deletion, gene complementation, and gene over-expression, are common techniques to investigate fungal gene functions. Although advances in transformation efficiency and promoter usage have improved genetic studies, some basic steps in vector construction are still laborious and time-consuming. Gateway cloning technology solves this problem by increasing the efficiency of vector construction through the use of λ phage integrase proteins and att recombination sites. We developed a series of Gateway-compatible vectors for use in genetic studies in a range of fungal species. They contain nutritional and drug-resistance markers and can be utilized to manipulate different filamentous fungal genomes. Copyright © 2013 Elsevier Inc. All rights reserved.
He, Xianzhi; Zhang, Lei; Liu, Pengchong; Liu, Li; Deng, Hui; Huang, Jinhai
2015-03-01
Staphylococcal enterotoxins (SEs) produced by Staphylococcus aureus have increasingly given rise to human health and food safety. Genetically engineered small molecular antibody is a useful tool in immuno-detection and treatment for clinical illness caused by SEs. In this study, we constructed the V(L)-V(H) tail-parallel genetically engineered antibody against SEs by using the repertoire of rearranged germ-line immunoglobulin variable region genes. Total RNA were extracted from six hybridoma cell lines that stably express anti-SEs antibodies. The variable region genes of light chain (V(L)) and heavy chain (V(H)) were cloned by reverse transcription PCR, and their classical murine antibody structure and functional V(D)J gene rearrangement were analyzed. To construct the eukaryotic V(H)-V(L) tail-parallel co-expression vectors based on the "5'-V(H)-ivs-IRES-V(L)-3'" mode, the ivs-IRES fragment and V(L) genes were spliced by two-step overlap extension PCR, and then, the recombined gene fragment and V(H) genes were inserted into the pcDNA3.1(+) expression vector sequentially. And then the constructed eukaryotic expression clones termed as p2C2HILO and p5C12HILO were transfected into baby hamster kidney 21 cell line, respectively. Two clonal cell lines stably expressing V(L)-V(H) tail-parallel antibodies against SEs were obtained, and the antibodies that expressed intracytoplasma were evaluated by enzyme-linked immunosorbent assay, immunofluorescence assay, and flow cytometry. SEs can stimulate the expression of some chemokines and chemokine receptors in porcine IPEC-J2 cells; mRNA transcription level of four chemokines and chemokine receptors can be blocked by the recombinant SE antibody prepared in this study. Our results showed that it is possible to get functional V(L)-V(H) tail-parallel genetically engineered antibodies in same vector using eukaryotic expression system.
Transformation of Lesquerella fendleri with the new binary vector pGPro4-35S
USDA-ARS?s Scientific Manuscript database
Crop genetic engineering requires the use of various promoters to control the expression of introduced transgenes. Some of the binary vectors currently available for promoter characterization in dicotyledonous plants have pitfalls due to their construction, such as containing a selectable marker ca...
Vector and axial-vector decomposition of Einstein's gravitational action
NASA Astrophysics Data System (ADS)
Soh, Kwang S.
1991-08-01
Vector and axial-vector gravitational fields are introduced to express the Einstein action in the manner of electromagnetism. Their conformal scaling properties are examined, and the resemblance between the general coordinate and electromagnetic gauge transformation is elucidated. The chiral formulation of the gravitational action is constructed. I am deeply grateful to Professor S. Hawking, and Professor G. Lloyd for warm hospitality at DAMTP, and Darwin College, University of Cambridge, respectively. I also appreciate much help received from Dr. Q.-H. Park.
USDA-ARS?s Scientific Manuscript database
Recombinant adenovirus-5 vectored foot-and-mouth disease constructs (Ad5- FMD) were made for three Indian vaccine virus serotypes O,A and Asia 1. Constructs co-expressing foot-and- mouth disease virus (FMDV) capsid and viral 3C protease sequences, were evaluated for their ability to induce a neutral...
Cereal transformation through particle bombardment
NASA Technical Reports Server (NTRS)
Casas, A. M.; Kononowicz, A. K.; Bressan, R. A.; Hasegawa, P. M.; Mitchell, C. A. (Principal Investigator)
1995-01-01
The review focuses on experiments that lead to stable transformation in cereals using microprojectile bombardment. The discussion of biological factors that affect transformation examines target tissues and vector systems for gene transfer. The vector systems include reporter genes, selectable markers, genes of agronomic interest, and vector constructions. Other topics include physical parameters that affect DNA delivery, selection of stably transformed cells and plant regeneration, and analysis of gene expression and transmission to the progeny.
Construction of recombinant FGFR1 containing full-length gene and its potential application.
Zhou, Yali; Luo, Wenjuan; Zheng, Lei; Li, Miao; Zhang, Yanmin
2010-07-01
FGFR1, one of the four fibroblast growth factor receptors, has been found to be over-expressed in many cancers. In this study, a full-length expression plasmid for FGFR1 was obtained by fragment amplification. The amplified PCR product was then digested and inserted into the pcDNA3.1(+) vector. A recombinant eukaryotic expression vector containing the complete CDS region of FGFR1 was successfully constructed. After it was transfected to Hek293 cell, the expression of the FGFR1 receptor in recombinant Hek293/FGFR1 was 18 times higher than that of Hek293 cell. The biological activities of high expression FGFR1 cell (Hek293/FGFR1) were verified by FCM, immunofluorescent, RT-PCR, western blot and cell cycle analysis. Then, Hek293/FGFR1 was used to screen taspine with cell membrane chromatography (CMC). Finally, we analyzed the effects of taspine on Hek293/FGFR1 cell and MCF-7 cell. In conclusion, Hek293/FGFR1 was successfully constructed. The results demonstrate that taspine can down-regulate phosphorylation of FGFR1 and ERK, and inhibit Hek293/FGFR1 and MCF-7 cell proliferation. Copyright 2010 Elsevier Inc. All rights reserved.
GenoCAD Plant Grammar to Design Plant Expression Vectors for Promoter Analysis.
Coll, Anna; Wilson, Mandy L; Gruden, Kristina; Peccoud, Jean
2016-01-01
With the rapid advances in prediction tools for discovery of new promoters and their cis-elements, there is a need to improve plant expression methodologies in order to facilitate a high-throughput functional validation of these promoters in planta. The promoter-reporter analysis is an indispensible approach for characterization of plant promoters. It requires the design of complex plant expression vectors, which can be challenging. Here, we describe the use of a plant grammar implemented in GenoCAD that will allow the users to quickly design constructs for promoter analysis experiments but also for other in planta functional studies. The GenoCAD plant grammar includes a library of plant biological parts organized in structural categories to facilitate their use and management and a set of rules that guides the process of assembling these biological parts into large constructs.
Wilson, Mandy L; Okumoto, Sakiko; Adam, Laura; Peccoud, Jean
2014-01-15
Expression vectors used in different biotechnology applications are designed with domain-specific rules. For instance, promoters, origins of replication or homologous recombination sites are host-specific. Similarly, chromosomal integration or viral delivery of an expression cassette imposes specific structural constraints. As de novo gene synthesis and synthetic biology methods permeate many biotechnology specialties, the design of application-specific expression vectors becomes the new norm. In this context, it is desirable to formalize vector design strategies applicable in different domains. Using the design of constructs to express genes in the chloroplast of Chlamydomonas reinhardtii as an example, we show that a vector design strategy can be formalized as a domain-specific language. We have developed a graphical editor of context-free grammars usable by biologists without prior exposure to language theory. This environment makes it possible for biologists to iteratively improve their design strategies throughout the course of a project. It is also possible to ensure that vectors designed with early iterations of the language are consistent with the latest iteration of the language. The context-free grammar editor is part of the GenoCAD application. A public instance of GenoCAD is available at http://www.genocad.org. GenoCAD source code is available from SourceForge and licensed under the Apache v2.0 open source license.
Akbarzadeh-Sharbaf, Soudabeh; Yakhchali, Bagher; Minuchehr, Zarrin; Shokrgozar, Mohammad Ali; Zeinali, Sirous
2012-01-01
Background: There is a novel hypothesis in that antibodies may have specificity for two distinct antigens that have been named “dual specificity”. This hypothesis was evaluated for some defined therapeutic monoclonal antibodies (mAbs) such as Trastuzumab, Pertuzumab, Bevacizumab, and Cetuximab. In silico design and construction of expression vectors for trastuzumab monoclonal antibody also in this work were performed. Materials and Methods: First, in bioinformatics studies the 3D structures of concerned mAbs were obtained from the Protein Data Bank (PDB). Three-dimensional structural alignments were performed with SIM and MUSTANG softwares. AutoDock4.2 software also was used for the docking analysis. Second, the suitable genes for trastuzumab heavy and light chains were designed, synthesized, and cloned in the prokaryotic vector. These fragments individually were PCR amplified and cloned into pcDNA™ 3.3-TOPO® and pOptiVEC™ TOPO® shuttle vectors, using standard methods. Results: First, many bioinformatics tools and softwares were applied but we did not meet any new dual specificity in the selected antibodies. In the following step, the suitable expression cascade for the heavy and light chains of Trastuzumab therapeutic mAb were designed and constructed. Gene cloning was successfully performed and created constructs were confirmed using gene mapping and sequencing. Conclusions: This study was based on a recently developed technology for mAb expression in mammalian cells. The obtained constructs could be successfully used for biosimilar recombinant mAb production in CHO DG44 dihydrofolate reductase (DHFR) gene deficient cell line in the suspension culture medium. PMID:23210080
Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A
2007-08-01
Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.
Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B
2006-03-06
Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics.
Colwill, Karen; Wells, Clark D; Elder, Kelly; Goudreault, Marilyn; Hersi, Kadija; Kulkarni, Sarang; Hardy, W Rod; Pawson, Tony; Morin, Gregg B
2006-01-01
Background Recombinational systems have been developed to rapidly shuttle Open Reading Frames (ORFs) into multiple expression vectors in order to analyze the large number of cDNAs available in the post-genomic era. In the Creator system, an ORF introduced into a donor vector can be transferred with Cre recombinase to a library of acceptor vectors optimized for different applications. Usability of the Creator system is impacted by the ability to easily manipulate DNA, the number of acceptor vectors for downstream applications, and the level of protein expression from Creator vectors. Results To date, we have developed over 20 novel acceptor vectors that employ a variety of promoters and epitope tags commonly employed for proteomics applications and gene function analysis. We also made several enhancements to the donor vectors including addition of different multiple cloning sites to allow shuttling from pre-existing vectors and introduction of the lacZ alpha reporter gene to allow for selection. Importantly, in order to ameliorate any effects on protein expression of the loxP site between a 5' tag and ORF, we introduced a splicing event into our expression vectors. The message produced from the resulting 'Creator Splice' vector undergoes splicing in mammalian systems to remove the loxP site. Upon analysis of our Creator Splice constructs, we discovered that protein expression levels were also significantly increased. Conclusion The development of new donor and acceptor vectors has increased versatility during the cloning process and made this system compatible with a wider variety of downstream applications. The modifications introduced in our Creator Splice system were designed to remove extraneous sequences due to recombination but also aided in downstream analysis by increasing protein expression levels. As a result, we can now employ epitope tags that are detected less efficiently and reduce our assay scale to allow for higher throughput. The Creator Splice system appears to be an extremely useful tool for proteomics. PMID:16519801
Giuraniuc, Claudiu V.; MacPherson, Murray; Saka, Yasushi
2013-01-01
Construction of synthetic genetic networks requires the assembly of DNA fragments encoding functional biological parts in a defined order. Yet this may become a time-consuming procedure. To address this technical bottleneck, we have created a series of Gateway shuttle vectors and an integration vector, which facilitate the assembly of artificial genes and their expression in the budding yeast Saccharomyces cerevisiae. Our method enables the rapid construction of an artificial gene from a promoter and an open reading frame (ORF) cassette by one-step recombination reaction in vitro. Furthermore, the plasmid thus created can readily be introduced into yeast cells to test the assembled gene’s functionality. As flexible regulatory components of a synthetic genetic network, we also created new versions of the tetracycline-regulated transactivators tTA and rtTA by fusing them to the auxin-inducible degron (AID). Using our gene assembly approach, we made yeast expression vectors of these engineered transactivators, AIDtTA and AIDrtTA and then tested their functions in yeast. We showed that these factors can be regulated by doxycycline and degraded rapidly after addition of auxin to the medium. Taken together, the method for combinatorial gene assembly described here is versatile and would be a valuable tool for yeast synthetic biology. PMID:23675537
Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.
Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo
2014-01-01
A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.
An integrated vector system for cellular studies of phage display-derived peptides.
Voss, Stephan D; DeGrand, Alec M; Romeo, Giulio R; Cantley, Lewis C; Frangioni, John V
2002-09-15
Peptide phage display is a method by which large numbers of diverse peptides can be screened for binding to a target of interest. Even when successful, the rate-limiting step is usually validation of peptide bioactivity using living cells. In this paper, we describe an integrated system of vectors that expedites both the screening and the characterization processes. Library construction and screening is performed using an optimized type 3 phage display vector, mJ(1), which is shown to accept peptide libraries of at least 23 amino acids in length. Peptide coding sequences are shuttled from mJ(1) into one of three families of mammalian expression vectors for cell physiological studies. The vector pAL(1) expresses phage display-derived peptides as Gal4 DNA binding domain fusion proteins for transcriptional activation studies. The vectors pG(1), pG(1)N, and pG(1)C express phage display-derived peptides as green fluorescent protein fusions targeted to the entire cell, nucleus, or cytoplasm, respectively. The vector pAP(1) expresses phage display-derived peptides as fusions to secreted placental alkaline phosphatase. Such enzyme fusions can be used as highly sensitive affinity reagents for high-throughput assays and for cloning of peptide-binding cell surface receptors. Taken together, this system of vectors should facilitate the development of phage display-derived peptides into useful biomolecules.
Ford, Kathryn L.; Baumgartner, Kendra; Henricot, Béatrice; Bailey, Andy M.; Foster, Gary D.
2016-01-01
Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled using yeast-based recombination methods. These have been designed to allow easy exchange of promoters and inclusion of introns. The vectors were first tested by transformation into basidiomycete Clitopilus passeckerianus to ascertain vector functionality then used to transform A. mellea. We show that heterologous promoters from the basidiomycetes Agaricus bisporus and Phanerochaete chrysosporium that were used successfully to control the hygromycin resistance cassette were not able to support expression of mRFP or GFP in A. mellea. The endogenous A. mellea gpd promoter delivered efficient expression, and we show that inclusion of an intron was also required for transgene expression. GFP and mRFP expression was stable in mycelia and fluorescence was visible in transgenic fruiting bodies and GFP was detectable in planta. Use of these vectors has been successful in giving expression of the fluorescent proteins GFP and mRFP in A. mellea, providing an additional molecular tool for this pathogen. PMID:27384974
Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana; ...
2016-02-04
Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Petrik, Deborah L.; Cass, Cynthia L.; Padmakshan, Dharshana
Utility vectors with promoters that confer desired spatial and temporal expression patterns are useful tools for studying gene and cellular function and for industrial applications. To target the expression of DNA sequences of interest to cells forming plant secondary cell walls, which generate most of the vegetative biomass, upstream regulatory sequences of the Brachypodium distachyon lignin biosynthetic gene BdPMT and the cellulose synthase genes BdCESA7 and BdCESA8 were isolated and cloned into binary vectors designed for Agrobacterium-mediated transformation of monocots. Expression patterns were assessed using the β-glucuronidase gene GUSPlus and X-glucuronide staining. All three promoters showed strong expression levels inmore » stem tissue at the base of internodes where cell wall deposition is most active, in both vascular bundle xylem vessels and tracheids, and in interfascicular tissues, with expression less pronounced in developmentally older tissues. In leaves, BdCESA7 and BdCESA8 promoter-driven expression was strongest in leaf veins, leaf margins, and trichomes; relatively weaker and patchy expression was observed in the epidermis. BdPMT promoter-driven expression was similar to the BdCESA promoters expression patterns, including strong expression in trichomes. The intensity and extent of GUS staining varied considerably between transgenic lines, suggesting that positional effects influenced promoter activity. Introducing the BdPMT and BdCESA8 Open Reading Frames into BdPMT and BdCESA8 utility promoter binary vectors, respectively, and transforming those constructs into Brachypodium pmt and cesa8 loss-of-function mutants resulted in rescue of the corresponding mutant phenotypes. This work therefore validates the functionality of these utility promoter binary vectors for use in Brachypodium and likely other grass species. Lastly, the identification, in Bdcesa8-1 T-DNA mutant stems, of an 80% reduction in crystalline cellulose levels confirms that the BdCESA8 gene is a secondary-cell-wall-forming cellulose synthase.« less
Oki, Hiroshi; Yazawa, Takuya; Baba, Yasuko; Kanegae, Yumi; Sato, Hanako; Sakamoto, Seiko; Goto, Takahisa; Saito, Izumu; Kurahashi, Kiyoyasu
2017-07-01
Pulmonary emphysema impairs quality of life and increases mortality. It has previously been shown that administration of adenovirus vector expressing murine keratinocyte growth factor (KGF) before elastase instillation prevents pulmonary emphysema in mice. We therefore hypothesized that therapeutic administration of KGF would restore damage to lungs caused by elastase instillation and thus improve pulmonary function in an animal model. KGF expressing adenovirus vector, which prevented bleomycin-induced pulmonary fibrosis in a previous study, was constructed. Adenovirus vector (1.0 × 10 9 plaque-forming units) was administered intratracheally one week after administration of elastase into mouse lungs. One week after administration of KGF-vector, exercise tolerance testing and blood gas analysis were performed, after which the lungs were removed under deep anesthesia. KGF-positive pneumocytes were more numerous, surfactant protein secretion in the airspace greater and mean linear intercept of lungs shorter in animals that had received KGF than in control animals. Unexpectedly, however, arterial blood oxygenation was worse in the KGF group and maximum running speed, an indicator of exercise capacity, had not improved after KGF in mice with elastase-induced emphysema, indicating that KGF-expressing adenovirus vector impaired pulmonary function in these mice. Notably, vector lacking KGF-expression unit did not induce such impairment, implying that the KGF expression unit itself may cause the damage to alveolar cells. Possible involvement of the CAG promoter used for KGF expression in impairing pulmonary function is discussed. © 2017 The Societies and John Wiley & Sons Australia, Ltd.
[Construction and expression of a recombinant adenovirus with LZP3].
Chen, Bang-dang; Zhang, Fu-chun; Sun, Mei-yu; Li, Yi-jie; Ma, Zheng-hai
2007-08-01
To explore a new immunocontraceptive vaccine and construct an attenuated recombinant adenoviral vaccine against Lagurus lagurus zona pellucida 3(LZP3). LZP3 gene was subcloned into the shuttle vector pShuttle-CMV, and then a two-step transformation procedure was employed to construct a recombinant adenoviral plasmid with LZP3, which was digested with Pac I and transfected into HEK293 cells to package recombinant adenovirus particles. Finally, HeLa cells were infected by the recombinant adenovirus. LZP3 gene was detected from the recombinant virus by PCR, and its transcription and expression were analyzed by RT-PCR and Western blot. Recombinant adenovirus vector pAd-LZP3 with LZP3 gene was constructed by homologous recombination in E.coli, and a recombinant adenovirus was obtained by transfecting HEK293 cells with pAd-LZP3. PCR test indicated that LZP3 gene was successfully integrated into the adenoviral genome, and the titer of the recombinant adenovirus reached 1.2x10(10) pfu/L. The transcription and expression of LZP3 gene in the infected HeLa cells were confirmed by RT-PCR and Western blot. The recombinant adenovirus RAd-LZP3 can be successfully expressed in the infected HeLa cells, which lays the foundation for further researches into immunizing animals with RAd-LZP3.
Distance between RBS and AUG plays an important role in overexpression of recombinant proteins.
Berwal, Sunil K; Sreejith, R K; Pal, Jayanta K
2010-10-15
The spacing between ribosome binding site (RBS) and AUG is crucial for efficient overexpression of genes when cloned in prokaryotic expression vectors. We undertook a brief study on the overexpression of genes cloned in Escherichia coli expression vectors, wherein the spacing between the RBS and the start codon was varied. SDS-PAGE and Western blot analysis indicated a high level of protein expression only in constructs where the spacing between RBS and AUG was approximately 40 nucleotides or more, despite the synthesis of the transcripts in the representative cases investigated. Copyright 2010 Elsevier Inc. All rights reserved.
Weng, Daihui; Lei, Yingfeng; Dong, Yangchao; Han, Peijun; Ye, Chuantao; Yang, Jing; Wang, Yuan; Yin, Wen
2015-12-01
To construct the plasmid expressing the fusion protein of Dengue virus type 2 (DENV2) nonstructural protein 3 (NS3) with affinity tag, and isolate the cellular proteins interacting with NS3 protein using tandem affinity purification (TAP) assay. Primers for amplifying NS3 gene were designed according to the sequence of DENV2 genome and chemically synthesized. The NS3 fragments, after amplified by PCR with DENV2 cDNA as template, were digested and cloned into the mammalian eukaryotic expression vector pCI-SF with the tandem affinity tag (FLAG-StrepII). The recombinant pCI-NS3-SF was transiently transformed by Lipofectamine(TM) 2000 into HEK293T cells, and the expression of the fusion protein was confirmed by Western blotting. Cellular proteins that interacted with NS3 were isolated and purified by TAP assay. The eukaryotic expression vector expressing NS3 protein was successfully constructed. The host proteins interacting with NS3 protein were isolated by TAP system. TAP is an efficient method to isolate the cellular proteins interacting with DENV2 NS3.
A versatile and efficient high-throughput cloning tool for structural biology.
Geertsma, Eric R; Dutzler, Raimund
2011-04-19
Methods for the cloning of large numbers of open reading frames into expression vectors are of critical importance for challenging structural biology projects. Here we describe a system termed fragment exchange (FX) cloning that facilitates the high-throughput generation of expression constructs. The method is based on a class IIS restriction enzyme and negative selection markers. FX cloning combines attractive features of established recombination- and ligation-independent cloning methods: It allows the straightforward transfer of an open reading frame into a variety of expression vectors and is highly efficient and very economic in its use. In addition, FX cloning avoids the common but undesirable feature of significantly extending target open reading frames with cloning related sequences, as it leaves a minimal seam of only a single extra amino acid to either side of the protein. The method has proven to be very robust and suitable for all common pro- and eukaryotic expression systems. It considerably speeds up the generation of expression constructs compared to traditional methods and thus facilitates a broader expression screening.
An efficient transgenic system by TA cloning vectors and RNAi for C. elegans
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako
2006-11-03
In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less
Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D
1982-01-01
An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675
Gui, Tao; Zhang, Meiling; Chen, Jianwen; Zhang, Yuanliang; Zhou, Naru; Zhang, Yu; Tao, Jia; Sui, Liucai; Li, Yunsheng; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai
2012-08-01
A vector expressing human lysozyme (pBC1-hLYZ-GFP-Neo) was evaluated for gene and protein expression following liposome-mediated transformation of C-127 mouse mammary cancer cells. Cultures of G418-resistant clones were harvested 24-72 h after induction with prolactin, insulin and hydrocortisone. Target gene expression was analyzed by RT-PCR and Western blot and recombinant human lysozyme (rhLYZ) bacteriostatic activity was also evaluated. The hLYZ gene was correctly transcribed and translated in C-127 cells and hLYZ inhibited gram-positive bacterial growth, indicating the potential of this expression vector for development of a mammary gland bioreactor in goats. Guanzhong dairy goat skin fibroblasts transfected with pBC1-hLYZ-GFP-Neo were used to construct a goat embryo transgenically expressing rhLYZ by somatic nuclear transplantation with a blastocyst rate of 9.0 ± 2.8 %. These data establish the basis for cultivation of mastitis-resistant hLYZ transgenic goats.
Kardinal, C; Selmayr, M; Mocikat, R
1996-01-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation. Images Figure 2 PMID:8958041
Kardinal, C; Selmayr, M; Mocikat, R
1996-11-01
Gene targeting at the immunoglobulin loci of B cells is an efficient tool for studying immunoglobulin expression or generating chimeric antibodies. We have shown that vector integration induced by human immunoglobulin G1 (IgG1) insertion vectors results in subsequent vector excision mediated by the duplicated target sequence, whereas replacement events which could be induced by the same constructs remain stable. We could demonstrate that the distribution of the vector homology strongly influences the genetic stability obtained. To this end we developed a novel type of a heavy chain replacement vector making use of the heavy chain class switch recombination sequence. Despite the presence of a two-sided homology this construct is universally applicable irrespective of the constant gene region utilized by the B cell. In comparison to an integration vector the frequency of stable incorporation was strongly increased, but we still observed vector excision, although at a markedly reduced rate. The latter events even occurred with circular constructs. Linearization of the construct at various sites and the comparison with an integration vector that carries the identical homology sequence, but differs in the distribution of homology, revealed the following features of homologous recombination of immunoglobulin genes: (i) the integration frequency is only determined by the length of the homology flank where the cross-over takes place; (ii) a 5' flank that does not meet the minimum requirement of homology length cannot be complemented by a sufficient 3' flank; (iii) free vector ends play a role for integration as well as for replacement targeting; (iv) truncating recombination events are suppressed in the presence of two flanks. Furthermore, we show that the switch region that was used as 3' flank is non-functional in an inverted orientation.
USDA-ARS?s Scientific Manuscript database
Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled u...
USDA-ARS?s Scientific Manuscript database
Utilizing the Pahenu2 mouse model for phenylketonuria (PKU), we developed an improved expression vector containing the Woodchuck Hepatitis Virus post-transcriptional regulatory element inserted into a rAAV-mPAH construct (rAAV-mPAH-WPRE) for treatment of PKU. Following portal vein delivery of these ...
A path model for Whittaker vectors
NASA Astrophysics Data System (ADS)
Di Francesco, Philippe; Kedem, Rinat; Turmunkh, Bolor
2017-06-01
In this paper we construct weighted path models to compute Whittaker vectors in the completion of Verma modules, as well as Whittaker functions of fundamental type, for all finite-dimensional simple Lie algebras, affine Lie algebras, and the quantum algebra U_q(slr+1) . This leads to series expressions for the Whittaker functions. We show how this construction leads directly to the quantum Toda equations satisfied by these functions, and to the q-difference equations in the quantum case. We investigate the critical limit of affine Whittaker functions computed in this way.
Ronald, John A.; Katzenberg, Regina; Nielsen, Carsten H.; Jae, Hwan Jun; Hofmann, Lawrence V.; Gambhir, Sanjiv S.
2013-01-01
In hepatocellular carcinoma, tumor specificity of gene therapy is of utmost importance to preserve liver function. MicroRNAs are powerful negative regulators of gene expression and many are down-regulated in human HCC. We identified seven miRNAs that are also down-regulated in tumors in a rat hepatoma model (p<0.05) and attempted to improve tumor specificity by constructing a panel of luciferase-expressing vectors containing binding sites for these microRNAs. Attenuation of luciferase expression by the corresponding microRNAs was confirmed across various cell lines and in mouse liver. We then tested our vectors in tumor-bearing rats and identified two microRNAs, miR-26a and miR-122, that significantly decreased expression in liver compared to control vector (6.40% and 0.26%, respectively; p<0.05). In tumor, miR-122 had a non-significant trend towards decreased (~50%) expression , while miR-26 had no significant effect on tumor expression. To our knowledge this is the first work using differentially expressed microRNAs to de-target transgene expression in an orthotopic hepatoma model and identification of miR-26a in addition to miR-122 for de-targeting liver. Considering the heterogeneity of microRNA expression in human HCC, this information will be important in guiding development of more personalized vectors for the treatment of this devastating disease. PMID:23719066
[Prokaryotic expression of Nanog gene and preparation of anti-Nanog antibody].
Li, Jun; Wang, Xiao-min; Dou, Zhong-ying; Li, Yong
2012-07-01
To express Nanog fusion protein in Escherichia coli ( E.coli), and to prepare rabbit anti-mouse polyclonal antibodies to the Nanog fusion protein. Mouse Nanog gene was amplified from the pNA992 recombinant plasmid and inserted into pET-32a vector to construct a recombinant expression vector pET-32a-Nanog. The recombinant vector was transfected into E.coli BL21 and induced by IPTG to express in them. The acquired Nanog fusion protein was purified with HisTrap affinity column and injected as an antigen into rabbits for preparing polyclonal antibodies. At last, the titer and specificity of the polyclonal antibodies were analyzed with indirect ELISA, Western blotting and immunocytochemical staining, respectively. The recombinant expression vector pET-32a-Nanog was successfully prepared, transfected and induced to obtain the high expression of the Nanog fusion protein in a form of inclusion bodies in E.coli. After purification, its purity was up to 97%. The titer of anti-Nanog antibodies was 1:32 000 in the immunized rabbit serum, and exhibited a high specificity to Nanog protein. The rabbit anti-mouse polyclonal antibodies have been prepared successfully with a high titer and specificity to the Nanog fusion protein.
RNAi Mediated curcin precursor gene silencing in Jatropha (Jatropha curcas L.).
Patade, Vikas Yadav; Khatri, Deepti; Kumar, Kamal; Grover, Atul; Kumari, Maya; Gupta, Sanjay Mohan; Kumar, Devender; Nasim, Mohammed
2014-07-01
Curcin, a type I ribosomal inhibiting protein-RIP, encoded by curcin precursor gene, is a phytotoxin present in Jatropha (Jatropha curcas L.). Here, we report designing of RNAi construct for the curcin precursor gene and further its genetic transformation of Jatropha to reduce its transcript expression. Curcin precursor gene was first cloned from Jatropha strain DARL-2 and part of the gene sequence was cloned in sense and antisense orientation separated by an intron sequence in plant expression binary vector pRI101 AN. The construction of the RNAi vector was confirmed by double digestion and nucleotide sequencing. The vector was then mobilized into Agrobacterium tumefaciens strain GV 3101 and used for tissue culture independent in planta transformation protocol optimized for Jatropha. Germinating seeds were injured with a needle before infection with Agrobacterium and then transferred to sterilized sand medium. The seedlings were grown for 90 days and genomic DNA was isolated from leaves for transgenic confirmation based on real time PCR with NPT II specific dual labeled probe. Result of the transgenic confirmation analysis revealed presence of the gene silencing construct in ten out of 30 tested seedlings. Further, quantitative transcript expression analysis of the curcin precursor gene revealed reduction in the transcript abundance by more than 98% to undetectable level. The transgenic plants are being grown in containment for further studies on reduction in curcin protein content in Jatropha seeds.
RNA interference mediated in human primary cells via recombinant baculoviral vectors.
Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T
2005-04-01
The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.
Agaphonov, Michael O
2017-12-01
The use of plasmids possessing a regulatable gene coding for a site-specific recombinase together with its recognition sequences significantly facilitates genome manipulations since it allows self-excision of the portion of the genetic construct integrated into the host genome. Stable maintenance of such plasmids in Escherichia coli, which is used for plasmid preparation, requires prevention of recombinase synthesis in this host, which can be achieved by interrupting the recombinase gene with an intron. Based on this approach, Saccharomyces cerevisiae and Hansenula polymorpha self-excising vectors possessing intronated gene for Cre recombinase and its recognition sites (LoxP) were previously constructed. However, this work shows instability of the H. polymorpha vectors during plasmid maintenance in E. coli cells. This could be due to recombination between the loxP sites caused by residual expression of the cre gene. Prevention of translation reinitiation on an internal methionine codon completely solved this problem. A similar modification was made in a self-excising vector designed for S. cerevisiae. Apart from substantial improvement of yeast self-excising vectors, the obtained results also narrow down the essential part of Cre sequence. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Weber, K; Mock, U; Petrowitz, B; Bartsch, U; Fehse, B
2010-04-01
Vector-encoded fluorescent proteins (FPs) facilitate unambiguous identification or sorting of gene-modified cells by fluorescence-activated cell sorting (FACS). Exploiting this feature, we have recently developed lentiviral gene ontology (LeGO) vectors (www.LentiGO-Vectors.de) for multi-gene analysis in different target cells. In this study, we extend the LeGO principle by introducing 10 different drug-selectable FPs created by fusing one of the five selection marker (protecting against blasticidin, hygromycin, neomycin, puromycin and zeocin) and one of the five FP genes (Cerulean, eGFP, Venus, dTomato and mCherry). All tested fusion proteins allowed both fluorescence-mediated detection and drug-mediated selection of LeGO-transduced cells. Newly generated codon-optimized hygromycin- and neomycin-resistance genes showed improved expression as compared with their ancestors. New LeGO constructs were produced at titers >10(6) per ml (for non-concentrated supernatants). We show efficient combinatorial marking and selection of various cells, including mesenchymal stem cells, simultaneously transduced with different LeGO constructs. Inclusion of the cytomegalovirus early enhancer/chicken beta-actin promoter into LeGO vectors facilitated robust transgene expression in and selection of neural stem cells and their differentiated progeny. We suppose that the new drug-selectable markers combining advantages of FACS and drug selection are well suited for numerous applications and vector systems. Their inclusion into LeGO vectors opens new possibilities for (stem) cell tracking and functional multi-gene analysis.
USDA-ARS?s Scientific Manuscript database
Dual luciferase reporter systems are valuable tools for functional genomic studies, but have not previously been developed for use in tick cell culture. We evaluated expression of available luciferase constructs in tick cell cultures derived from Rhipicephalus (Boophilus) microplus, an important vec...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gambhir, Sanjiv; Pritha, Ray
Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.
Gambhir, Sanjiv; Pritha, Ray
2015-07-14
Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.
Vectors expressing chimeric Japanese encephalitis dengue 2 viruses.
Wei, Y; Wang, S; Wang, X
2014-01-01
Vectors based on self-replicating RNAs (replicons) of flaviviruses are becoming powerful tool for expression of heterologous genes in mammalian cells and development of novel antiviral and anticancer vaccines. We constructed two vectors expressing chimeric viruses consisting of attenuated SA14-14-2 strain of Japanese encephalitis virus (JEV) in which the PrM/M-E genes were replaced fully or partially with those of dengue 2 virus (DENV-2). These vectors, named pJED2 and pJED2-1770 were transfected to BHK-21 cells and produced chimeric viruses JED2V and JED2-1770V, respectively. The chimeric viruses could be passaged in C6/36 but not BHK-21 cells. The chimeric viruses produced in C6/36 cells CPE 4-5 days after infection and RT-PCR, sequencing, immunofluorescence assay (IFA) and Western blot analysis confirmed the chimeric nature of produced viruses. The immunogenicity of chimeric viruses in mice was proved by detecting DENV-2 E protein-specific serum IgG antibodies with neutralization titer of 10. Successful preparation of infectious clones of chimeric JEV-DENV-2 viruses showed that JEV-based expression vectors are fully functional.
Co-expression of five genes in E coli for L-phenylalanine in Brevibacterium flavum
Wu, Yong-Qing; Jiang, Pei-Hong; Fan, Chang-Sheng; Wang, Jian-Gang; Shang, Liang; Huang, Wei-Da
2003-01-01
AIM: To study the effect of co-expression of ppsA, pckA, aroG, pheA and tyrB genes on the production of L-phenylalanine, and to construct a genetic engineering strain for L-phenylalanine. METHODS: ppsA and pckA genes were amplified from genomic DNA of E. coli by polymerase chain reaction, and then introduced into shuttle vectors between E coli and Brevibacterium flavum to generate constructs pJN2 and pJN5. pJN2 was generated by inserting ppsA and pckA genes into vector pCZ; whereas pJN5 was obtained by introducing ppsA and pckA genes into pCZ-GAB, which was originally constructed for co-expression of aroG, pheA and tyrB genes. The recombinant plasmids were then introduced into B. flavum by electroporation and the transformants were used for L-phenylalanine fermentation. RESULTS: Compared with the original B. flavum cells, all the transformants were showed to have increased five enzyme activities specifically, and have enhanced L-phenylalanine biosynthesis ability variably. pJN5 transformant was observed to have the highest elevation of L-phenylalanine production by a 3.4-fold. Co-expression of ppsA and pckA increased activity of DAHP synthetase significantly. CONCLUSION: Co-expression of ppsA and pckA genes in B. flavum could remarkably increase the expression of DAHP synthetase; Co-expression of ppsA, pckA, aroG, pheA and tyrB of E. coli in B. flavum was a feasible approach to construct a strain for phenylalanine production. PMID:12532463
A transposase strategy for creating libraries of circularly permuted proteins.
Mehta, Manan M; Liu, Shirley; Silberg, Jonathan J
2012-05-01
A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions.
A transposase strategy for creating libraries of circularly permuted proteins
Mehta, Manan M.; Liu, Shirley; Silberg, Jonathan J.
2012-01-01
A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions. PMID:22319214
Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John
2010-06-20
We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.
Generation of mammalian cells stably expressing multiple genes at predetermined levels.
Liu, X; Constantinescu, S N; Sun, Y; Bogan, J S; Hirsch, D; Weinberg, R A; Lodish, H F
2000-04-10
Expression of cloned genes at desired levels in cultured mammalian cells is essential for studying protein function. Controlled levels of expression have been difficult to achieve, especially for cell lines with low transfection efficiency or when expression of multiple genes is required. An internal ribosomal entry site (IRES) has been incorporated into many types of expression vectors to allow simultaneous expression of two genes. However, there has been no systematic quantitative analysis of expression levels in individual cells of genes linked by an IRES, and thus the broad use of these vectors in functional analysis has been limited. We constructed a set of retroviral expression vectors containing an IRES followed by a quantitative selectable marker such as green fluorescent protein (GFP) or truncated cell surface proteins CD2 or CD4. The gene of interest is placed in a multiple cloning site 5' of the IRES sequence under the control of the retroviral long terminal repeat (LTR) promoter. These vectors exploit the approximately 100-fold differences in levels of expression of a retrovirus vector depending on its site of insertion in the host chromosome. We show that the level of expression of the gene downstream of the IRES and the expression level and functional activity of the gene cloned upstream of the IRES are highly correlated in stably infected target cells. This feature makes our vectors extremely useful for the rapid generation of stably transfected cell populations or clonal cell lines expressing specific amounts of a desired protein simply by fluorescent activated cell sorting (FACS) based on the level of expression of the gene downstream of the IRES. We show how these vectors can be used to generate cells expressing high levels of the erythropoietin receptor (EpoR) or a dominant negative Smad3 protein and to generate cells expressing two different cloned proteins, Ski and Smad4. Correlation of a biologic effect with the level of expression of the protein downstream of the IRES provides strong evidence for the function of the protein placed upstream of the IRES.
Cui, Yulin; Zhao, Jialin; Hou, Shichang; Qin, Song
2016-05-01
On the basis of fundamental genetic transformation technologies, the goal of this study was to optimize Tetraselmis subcordiformis chloroplast transformation through the use of endogenous regulators. The genes rrn16S, rbcL, psbA, and psbC are commonly highly expressed in chloroplasts, and the regulators of these genes are often used in chloroplast transformation. For lack of a known chloroplast genome sequence, the genome-walking method was used here to obtain full sequences of T. subcordiformis endogenous regulators. The resulting regulators, including three promoters, two terminators, and a ribosome combination sequence, were inserted into the previously constructed plasmid pPSC-R, with the egfp gene included as a reporter gene, and five chloroplast expression vectors prepared. These vectors were successfully transformed into T. subcordiformis by particle bombardment and the efficiency of each vector tested by assessing EGFP fluorescence via microscopy. The results showed that these vectors exhibited higher efficiency than the former vector pPSC-G carrying exogenous regulators, and the vector pRFA with Prrn, psbA-5'RE, and TpsbA showed the highest efficiency. This research provides a set of effective endogenous regulators for T. subcordiformis and will facilitate future fundamental studies of this alga.
Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G; Corydon, Thomas J; Mikkelsen, Jacob Giehm; Aagaard, Lars
2015-08-01
Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo.
Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G.; Corydon, Thomas J.; Mikkelsen, Jacob Giehm; Aagaard, Lars
2015-01-01
Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo. PMID:26204415
A Significant Increase of RNAi Efficiency in Human Cells by the CMV Enhancer with a tRNAlys Promoter
Weiwei, Ma; Zhenhua, Xie; Feng, Liu; Hang, Ning; Yuyang, Jiang
2009-01-01
RNA interference (RNAi) is the process of mRNA degradation induced by double-stranded RNA in a sequence-specific manner. Different types of promoters, such as U6, H1, tRNA, and CMV, have been used to control the inhibitory effect of RNAi expression vectors. In the present study, we constructed two shRNA expression vectors, respectively, controlled by tRNAlys and CMV enhancer-tRNAlys promoters. Compared to the vectors with tRNAlys or U6 promoter, the vector with a CMV enhancer-tRNAlys promoter silenced pokemon more efficiently on both the mRNA and the protein levels. Meanwhile, the silencing of pokemon inhibited the proliferation of MCF7 cells, but the induction of apoptosis of MCF7 cells was not observed. We conclude that the CMV enhancer-tRNAlys promoter may be a powerful tool in driving intracellular expression of shRNA which can efficiently silence targeted gene. PMID:19859553
Wang, Tiantian; Sun, Hui; Zhang, Jie; Liu, Qing; Wang, Longjiang; Chen, Peipei; Wang, Fangkun; Li, Hongmei; Xiao, Yihong; Zhao, Xiaomin
2014-03-01
In the present study, an a-agglutinin-based Saccharomyces boulardii surface display system was successfully established using a single expression vector. Based on the two protein co-expression vector pSP-G1 built by Partow et al., a S. boulardii surface display vector-pSDSb containing all the display elements was constructed. The display results of heterologous proteins were confirmed by successfully displaying enhanced green fluorescent protein (EGFP) and chicken Eimeria tenella Microneme-2 proteins (EtMic2) on the S. boulardii cell surface. The DNA sequence of AGA1 gene from S. boulardii (SbAGA1) was determined and used as the cell wall anchor partner. This is the first time heterologous proteins have been displayed on the cell surface of S. boulardii. Because S. boulardii is probiotic and eukaryotic, its surface display system would be very valuable, particularly in the development of a live vaccine against various pathogenic organisms especially eukaryotic pathogens such as protistan parasites. Copyright © 2013 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Phlebotomus papatasi vectors zoonotic cutaneous leishmaniasis, widespread in intertropical and temperate regions of the world. Previous cloning, expression, and biochemical characterization of recombinant P. papatasi acetylcholinesterase 1 (PpAChE1) revealed 85% amino acid sequence identity to mosq...
Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard
2013-01-01
Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863
Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.
Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H
2016-03-20
RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.
Assessment of RNAi-induced silencing in banana (Musa spp.).
Dang, Tuong Vi T; Windelinckx, Saskia; Henry, Isabelle M; De Coninck, Barbara; Cammue, Bruno P A; Swennen, Rony; Remy, Serge
2014-09-18
In plants, RNA- based gene silencing mediated by small RNAs functions at the transcriptional or post-transcriptional level to negatively regulate target genes, repetitive sequences, viral RNAs and/or transposon elements. Post-transcriptional gene silencing (PTGS) or the RNA interference (RNAi) approach has been achieved in a wide range of plant species for inhibiting the expression of target genes by generating double-stranded RNA (dsRNA). However, to our knowledge, successful RNAi-application to knock-down endogenous genes has not been reported in the important staple food crop banana. Using embryogenic cell suspension (ECS) transformed with ß-glucuronidase (GUS) as a model system, we assessed silencing of gusAINT using three intron-spliced hairpin RNA (ihpRNA) constructs containing gusAINT sequences of 299-nt, 26-nt and 19-nt, respectively. Their silencing potential was analysed in 2 different experimental set-ups. In the first, Agrobacterium-mediated co-transformation of banana ECS with a gusAINT containing vector and an ihpRNA construct resulted in a significantly reduced GUS enzyme activity 6-8 days after co-cultivation with either the 299-nt and 19-nt ihpRNA vectors. In the second approach, these ihpRNA constructs were transferred to stable GUS-expressing ECS and their silencing potential was evaluated in the regenerated in vitro plants. In comparison to control plants, transgenic plants transformed with the 299-nt gusAINT targeting sequence showed a 4.5 fold down-regulated gusA mRNA expression level, while GUS enzyme activity was reduced by 9 fold. Histochemical staining of plant tissues confirmed these findings. Northern blotting used to detect the expression of siRNA in the 299-nt ihpRNA vector transgenic in vitro plants revealed a negative relationship between siRNA expression and GUS enzyme activity. In contrast, no reduction in GUS activity or GUS mRNA expression occurred in the regenerated lines transformed with either of the two gusAINT oligo target sequences (26-nt and 19-nt). RNAi-induced silencing was achieved in banana, both at transient and stable level, resulting in significant reduction of gene expression and enzyme activity. The success of silencing was dependent on the targeted region of the target gene. The successful generation of transgenic ECS for second transformation with (an)other construct(s) can be of value for functional genomics research in banana.
Pan, Zihao; Liu, Jin; Ma, Jiale; Jin, Qiuli; Yao, Huochun; Osterrieder, Nikolaus
2017-10-01
Canine distemper virus (CDV), is a pantropic agent of morbillivirus that causes fetal disease in dogs. Base on a broad host rang of CDV, the continued vaccines inoculation is unavoidable to pose gene recombination risk in vaccine virus and wild virus. The current study presents the construction of novel vectors, using equine herpesvirus type 1 (EHV-1) expressing the canine distemper virus (CDV). The recent field strain hemagglutinin protein and nucleoprotein were used for the construction of the viral vector vaccines. Based on the Bacterial artificial chromosome (BAC) genomes of EHV-1 RacH strain, the recombinant EHV-1 vaccine virus encoding CDV hemagglutinin protein (EHV-H) or CDV nucleoprotein (EHV-N) was constructed separately. The constructed BACs were rescued after 72 h post infection, and the expression of H or N in the recombinant viruses was confirmed by western-blotting. Furthermore, high levels of neutralizing antibodies were induced persistently following vaccination in the groups EHV-H&EHV-N and EHV-H, but the EHV-N group. The groups of vaccinated EHV-H and EHV-H&EHV-N pups were monitored for clinical signs, whereas the vaccinated EHV-N group developed moderate symptoms. The present study demonstrated that EHV-1 based recombinant virus carrying CDV H could be a promising vaccine candidate against canine distemper. Copyright © 2017. Published by Elsevier Ltd.
USDA-ARS?s Scientific Manuscript database
Our ability to genetically manipulate microbial systems is often hampered by the availability of genetic tools. Thus, there is a need for the continued expansion of our molecular tool box. In support of this expansion, this study reports the design, construction, and validation of a new shuttle vect...
[Cloning of human CD45 gene and its expression in Hela cells].
Li, Jie; Xu, Tianyu; Wu, Lulin; Zhang, Liyun; Lu, Xiao; Zuo, Daming; Chen, Zhengliang
2015-11-01
To clone human CD45 gene PTPRC and establish Hela cells overexpressing recombinant human CD45 protein. The intact cDNA encoding human CD45 amplified using RT-PCR from the total RNA extracted from peripheral blood mononuclear cells (PBMCs) of a healthy donor was cloned into pMD-18T vector. The CD45 cDNA fragment amplified from the pMD-18T-CD45 by PCR was inserted to the coding region of the PcDNA3.1-3xflag vector, and the resultant recombinant expression vector PcDNA3.1-3xflag-CD45 was transfected into Hela cells. The expression of CD45 in Hela cells was detected by flow cytometry and Western blotting, and the phosphastase activity of CD45 was quantified using an alkaline phosphatase assay kit. The cDNA fragment of about 3 900 bp was amplified from human PBMCs and cloned into pMD-18T vector. The recombinant expression vector PcDNA3.1-3xflag-CD45 was constructed, whose restriction maps and sequence were consistent with those expected. The expression of CD45 in transfected Hela cells was detected by flow cytometry and Western blotting, and the expressed recombinant CD45 protein in Hela cells showed a phosphastase activity. The cDNA of human CD45 was successfully cloned and effectively expressed in Hela cells, which provides a basis for further exploration of the functions of CD45.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dai, Guodong; Peng, Tao; Zhou, Xuhong
2013-11-01
Highlight: •Construction of shRNA segments expression vectors is valid by the investigation of RT-PCR for IGF1R, EGFR and Bcl-xl mRNA and protein expression. •Studies have suggested that the vectors in blocking these genes of the growth factor receptors and anti- apoptosis is capable of breaking the balance of tumor growth so that tumor trend apoptosis and senescence. •Simultaneously blocking multiple genes that are abnormally expressed may be more effective in treating cancer cells than silencing a single gene. -- Abstract: Background: In previous work, we constructed short hairpin RNA (shRNA) expression plasmids that targeted human EGF and IGF-1 receptors messengermore » RNA, respectively, and demonstrated that these vectors could induce apoptosis of human nasopharyngeal cell lines (CNE2) and inhibit ligand-induced pAkt and pErk activation. Method: We have constructed multiple shRNA expression vectors of targeting EGFR, IGF1R and Bcl-xl, which were transfected to the CNE2 cells. The mRNA expression was assessed by RT-PCR. The growth of the cells, cell cycle progression, apoptosis of the cells, senescent tumor cells and the proteins of EGFR, IGF1R and Bcl-xl were analyzed by MTT, flow cytometry, cytochemical therapy or Western blot. Results: In group of simultaneously blocking EGFR, IGF1R and Bcl-xl genes, the mRNA of EGFR, IGF1R and Bcl-xl expression was decreased by (66.66 ± 3.42)%, (73.97 ± 2.83)% and (64.79 ± 2.83)%, and the protein expressions was diminished to (67.69 ± 4.02)%, (74.32 ± 2.30)%, and (60.00 ± 3.34)%, respectively. Meanwhile, the cell apoptosis increased by 65.32 ± 0.18%, 65.16 ± 0.25% and 55.47 ± 0.45%, and senescent cells increased by 1.42 ± 0.15%, 2.26 ± 0.15% and 3.22 ± 0.15% in the second, third and fourth day cultures, respectively. Conclusions: Simultaneously blocking EGFR, IGF1R and Bcl-xl genes is capable of altering the balance between proliferating versus apoptotic and senescent cells in the favor of both of apoptosis and senescence and, therefore, the tumor cells regression.« less
Blythe, Amanda; Gunasekara, Sanjika; Walshe, James; Mackay, Joel P; Hartzog, Grant A; Vrielink, Alice
2014-08-01
Spt4/5 is a hetero-dimeric transcription elongation factor that can both inhibit and promote transcription elongation by RNA polymerase II (RNAPII). However, Spt4/5's mechanism of action remains elusive. Spt5 is an essential protein and the only universally-conserved RNAP-associated transcription elongation factor. The protein contains multiple Kyrpides, Ouzounis and Woese (KOW) domains. These domains, in other proteins, are thought to bind RNA although there is little direct evidence in the literature to support such a function in Spt5. This could be due, at least in part, to difficulties in expressing and purifying recombinant Spt5. When expressed in Escherichia coli (E. coli), Spt5 is innately insoluble. Here we report a new approach for the successful expression and purification of milligram quantities of three different multi-KOW domain complexes of Saccharomyces cerevisiae Spt4/5 for use in future functional studies. Using the E. coli strain Rosetta2 (DE3) we have developed strategies for co-expression of Spt4 and multi-KOW domain Spt5 complexes from the bi-cistronic pET-Duet vector. In a second strategy, Spt4/5 was expressed via co-transformation of Spt4 in the vector pET-M11 with Spt5 ubiquitin fusion constructs in the vector pHUE. We characterized the multi-KOW domain Spt4/5 complexes by Western blot, limited proteolysis, circular dichroism, SDS-PAGE and size exclusion chromatography-multiangle light scattering and found that the proteins are folded with a Spt4:Spt5 hetero-dimeric stoichiometry of 1:1. These expression constructs encompass a larger region of Spt5 than has previously been reported, and will provide the opportunity to elucidate the biological function of the multi-KOW containing Spt5. Copyright © 2014 Elsevier Inc. All rights reserved.
Toda, Hiroshi; Itoh, Nobuya
2017-01-01
The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli - Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 ( rhsmo ) and alcohol dehydrogenase gene from Leifsonia sp. S749 ( lsadh ), in K . rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) promotor. The RhSMO-LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent-water biphasic reaction system to efficiently convert styrene into ( S )-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells.
Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo
2016-05-01
Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. © 2016 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Umei, Tomohiko C; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki
2017-08-19
Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming.
Umei, Tomohiko C.; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki
2017-01-01
Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming. PMID:28825623
Douin, Victorine; Bornes, Stephanie; Creancier, Laurent; Rochaix, Philippe; Favre, Gilles; Prats, Anne-Catherine; Couderc, Bettina
2004-01-01
Background Polycistronic retroviral vectors that contain several therapeutic genes linked via internal ribosome entry sites (IRES), provide new and effective tools for the co-expression of exogenous cDNAs in clinical gene therapy protocols. For example, tricistronic retroviral vectors could be used to genetically modify antigen presenting cells, enabling them to express different co-stimulatory molecules known to enhance tumor cell immunogenicity. Results We have constructed and compared different retroviral vectors containing two co-stimulatory molecules (CD70, CD80) and selectable marker genes linked to different IRES sequences (IRES from EMCV, c-myc, FGF-2 and HTLV-1). The tricistronic recombinant amphotropic viruses containing the IRES from EMCV, FGF-2 or HTLV-1 were equally efficient in inducing the expression of an exogenous gene in the transduced murine or human cells, without displaying any cell type specificity. The simultaneous presence of several IRESes on the same mRNA, however, can induce the differential expression of the various cistrons. Here we show that the IRESes of HTLV-1 and EMCV interfere with the translation induced by other IRESes in mouse melanoma cells. The IRES from FGF-2 did however induce the expression of exogenous cDNA in human melanoma cells without any positive or negative regulation from the other IRESs present within the vectors. Tumor cells that were genetically modified with the tricistronic retroviral vectors, were able to induce an in vivo anti-tumor immune response in murine models. Conclusion Translation of the exogenous gene is directed by the IRES and its high level of expression not only depends on the type of cell that is transduced but also on the presence of other genetic elements within the vector. PMID:15279677
Suzuki, Nobuhiro; Geletka, Lynn M.; Nuss, Donald L.
2000-01-01
We have investigated whether hypoviruses, viral agents responsible for virulence attenuation (hypovirulence) of the chestnut blight fungus Cryphonectria parasitica, could serve as gene expression vectors. The infectious cDNA clone of the prototypic hypovirus CHV1-EP713 was modified to generate 20 different vector candidates. Although transient expression was achieved for a subset of vectors that contained the green fluorescent protein gene from Aequorea victoria, long-term expression (past day 8) was not observed for any vector construct. Analysis of viral RNAs recovered from transfected fungal colonies revealed that the foreign genes were readily deleted from the replicating virus, although small portions of foreign sequences were retained by some vectors after months of replication. However, the results of vector viability and progeny characterization provided unexpected new insights into essential and dispensable elements of hypovirus replication. The N-terminal portion (codons 1 to 24) of the 5′-proximal open reading frame (ORF), ORF A, was found to be required for virus replication, while the remaining 598 codons of this ORF were completely dispensable. Substantial alterations were tolerated in the pentanucleotide UAAUG that contains the ORF A termination codon and the overlapping putative initiation codon of the second of the two hypovirus ORFs, ORF B. Replication competence was maintained following either a frameshift mutation that caused a two-codon extension of ORF A or a modification that produced a single-ORF genomic organization. These results are discussed in terms of determinants of hypovirus replication, the potential utility of hypoviruses as gene expression vectors, and possible mechanisms by which hypoviruses recognize and delete foreign sequences. PMID:10906211
Sun, Huai-Chang; Xue, Fang-Ming; Qian, Ke; Fang, Hao-Xia; Qiu, Hua-Lei; Zhang, Xin-Yu; Yin, Zhao-Hua
2006-01-01
To develop a gene therapy strategy for treating bovine mastitis, a new mammary-specific vector containing human lysozyme (hLYZ) cDNA and kanamycin resistance gene was constructed for intramammary expression and clinical studies. After one time acupuncture or intracisternal infusion of healthy cows with 400 μg of the p215C3LYZ vector, over 2.0 μg/ml of rhLYZ could be detected by enzymatic assay for about 3 weeks in the milk samples. Western blotting showed that rhLYZ secreted into milk samples from the vector-injected cows had molecular weight similar to that of the natural hLYZ in human colostrums. Twenty days after the primary injection, the quarters were re-injected with the same vector by quarter acupuncture and even higher concentrations of rhLYZ could be detected. Indirect competitive ELISA of milk samples showed that the vector injection did not induce detectable humoral immune response against hLYZ. Clinical studies showed that twice acupuncture of quarters with the p215C3LYZ vector had overt therapeutic effect on clinical and subclinical mastitis previously treated with antibiotics, including disappearance of clinical symptoms and relatively high microbiological cure rates. These data provide a solid rationale for using the vector to develop gene therapy for treating bovine mastitis. PMID:16532537
Shang, Shu-huan; Zhang, Yu-feng; Shi, Bin; Cheng, Xiang-rong
2008-10-01
To construct a recombinant human platelet-derived growth factor-B (PDGF-B) adenoviral vector and to transfect it into human periodontal ligament stem cells (PDLSC). The recombinant plasmid pAd-PDGF-B was constructed by homologous recombination and confirmed by restriction endonucleases digestion. Recombinant adenovirus was packaged in HEK293 cells. PDLSC were transfected with recombinant adenovirus and PDGF-B expression was confirmed. Expression of collagen type I gene was determined by quantitative analysis of the products of RT-PCR. The cell proliferation was determined with MTT colorimetric assay. The recombinant plasmid pAd-PDGF-B was confirmed by restriction endonucleases digestion. EGFP expression was observed on the third day after transfecting, and the expression of PDGF-B was detected. Immunohistochemical methods revealed that PDGF-B was expressed in PDLSC. Levels of expression of collagen type I gene were increased significantly by transfer of the exogenous PDGF-B gene to PDLSC. At the same time, findings indicated that Ad-PDGF-B stimulated PDLSC proliferation. MTT assay indicated the absorbance of PDLSC by stimulating with Ad-PDGF-B was (0.68 +/- 0.02), P < 0.01. Using the AdEasy system, the human PDGF-B recombinant adenovirus can be rapidly obtained. These results indicate that recombinant adenoviruses encoding PDGF-B transgenes could modulate proliferative activity of PDLSC, enhance the high expression of collagen type I and lay the foundation for periodontal tissue regeneration and dental implant gene therapy.
Li, Lixuan; Li, Jia
2015-05-01
To study the effects of lentivirus-mediated short hairpin RNA (shRNA) silencing of lysosome-associated membrane protein type 2A (LAMP2A) expression on the proliferation of multiple myeloma cells. The constructed shRNA lentiviral vector was applied to infect human multiple myeloma cell line MM.1S, and stable expression cell line was obtained by puromycin screening. Western blotting was used to verify the inhibitory effect on LAMP2A protein expression. MTT assay was conducted to detect the effect of knocked-down LAMP2A on MM.1S cell proliferation, and the anti-tumor potency of suberoylanilide hydroxamic acid (SAHA) against the obtained MM.1S LAMP2A(shRNA) stable cell line. Lactate assay was performed to observe the impact of low LAMP2A expression on cell glycolysis. The stable cell line with low LAMP2A expression were obtained with the constructed human LAMP2A-shRNA lentiviral vector. Down-regulation of LAMP2A expression significantly inhibited MM.1S cell proliferation and enhanced the anti-tumor activity of SAHA. Interestingly, decreased LAMP2A expression also inhibited MM.1S cell lactic acid secretion. Down-regulation of LAMP2A expression could inhibit cell proliferation in multiple myeloma cells.
Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi
2015-09-01
For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.
2012-01-01
Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697
Nafissi, Nafiseh; Slavcev, Roderick
2012-12-06
While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.
Liu, Jie-Qiong; Li, Chen-Hong; Luo, Qiong; Yin, Ping-Ping; Lei, Tao; Luo, Fang
2016-11-20
To construct a replication-deficient herpes simplex virus (HSV-1) for delivering a short hairpin RNA (shRNA) targeting vesicular glutamate transporter 3 (VGLUT3) and observe its effect in alleviating allodynia in mice. The recombinant HSV-1 vector carrying the shRNA targeting Vglut3 (HSV-1-shvglut3) was constructed and inoculated in the sciatic nerve in a mouse model of mechanical allodynia to test its analgesia effect. Mechanical allodynia and heat hypersensitivity of the mice were tested by von Frey filaments and Hargreaves' test, respectively. VGLUT3 expression in the dorsal root ganglion (DRG) was evaluated by immunohistochemistry and Western blotting. Following inoculation in the sciatic nerve, the HSV vector HSV-1-shvglut3 was retrogradely transported to the DRG. Mechanical withdraw thresholds of the mouse models receiving HSV-1-shvglut3 inoculation were reversed to nearly the baseline level, and VGLUT3 expression in the DRG was down-regulated 2 weeks after vector inoculation. The analgesic effect lasted for over 2 weeks in these mice without obvious systematic side effects or changes in heat hypersensitivity threshold. Vglut3 in the DRG is a promising therapeutic target for alleviating mechanical allodynia, and HSV-1 vector-mediated RNA interference is safe and efficient for inducing long-lasting analgesia after peripheral inoculation of the vector.
Enshell-Seijffers, D; Smelyanski, L; Gershoni, J M
2001-05-15
Filamentous bacteriophages are particularly efficient for the expression and display of combinatorial random peptides. Two phage proteins are often employed for peptide display: the infectivity protein, PIII, and the major coat protein, PVIII. The use of PVIII typically requires the expression of two pVIII genes: the wild-type and the recombinant pVIII gene, to generate mosaic phages. 'Type 88' vectors contain two pVIII genes in one phage genome. In this study a novel 'type 88' expression vector has been rationally designed and constructed. Two factors were taken into account: the insertion site and the genetic stability of the second pVIII gene. It was found that selective deletion of recombinant genes was encountered when inserts were cloned into either of the two non-coding regions of the phage genome. The deletions were independent of recA yet required a functional F-episome. Transcription was also found to be a positive factor for deletion. Taking the above into account led to the generation of a novel vector, designated fth1, which can be used to express recombinant peptides as pVIII chimeric proteins in mosaic bacteriophages. The fth1 vector is not only genetically stable but also of high copy number and produces high titers of recombinant phages.
Core labeling of adenovirus with EGFP
DOE Office of Scientific and Technical Information (OSTI.GOV)
Le, Long P.; Le, Helen N.; Nelson, Amy R.
2006-08-01
The study of adenovirus could greatly benefit from diverse methods of virus detection. Recently, it has been demonstrated that carboxy-terminal EGFP fusions of adenovirus core proteins Mu, V, and VII properly localize to the nucleus and display novel function in the cell. Based on these observations, we hypothesized that the core proteins may serve as targets for labeling the adenovirus core with fluorescent proteins. To this end, we constructed various chimeric expression vectors with fusion core genes (Mu-EGFP, V-EGFP, preVII-EGFP, and matVII-EGFP) while maintaining expression of the native proteins. Expression of the fusion core proteins was suboptimal using E1 expressionmore » vectors with both conventional CMV and modified (with adenovirus tripartite leader sequence) CMV5 promoters, resulting in non-labeled viral particles. However, robust expression equivalent to the native protein was observed when the fusion genes were placed in the deleted E3 region. The efficient Ad-wt-E3-V-EGFP and Ad-wt-E3-preVII-EGFP expression vectors were labeled allowing visualization of purified virus and tracking of the viral core during early infection. The vectors maintained their viral function, including viral DNA replication, viral DNA encapsidation, cytopathic effect, and thermostability. Core labeling offers a means to track the adenovirus core in vector targeting studies as well as basic adenovirus virology.« less
Meseda, Clement A; Atukorale, Vajini; Soto, Jackeline; Eichelberger, Maryna C; Gao, Jin; Wang, Wei; Weiss, Carol D; Weir, Jerry P
2018-03-29
Influenza subtypes such as H7 have pandemic potential since they are able to infect humans with severe consequences, as evidenced by the ongoing H7N9 infections in China that began in 2013. The diversity of H7 viruses calls for a broadly cross-protective vaccine for protection. We describe the construction of recombinant modified vaccinia virus Ankara (MVA) vectors expressing the hemagglutinin (HA) or neuraminidase (NA) from three H7 viruses representing both Eurasian and North American H7 lineages - A/mallard/Netherlands/12/2000 (H7N3), A/Canada/rv444/2004 (H7N3), and A/Shanghai/02/2013 (H7N9). These vectors were evaluated for immunogenicity and protective efficacy against H7N3 virus in a murine model of intranasal challenge. High levels of H7-, N3-, and N9-specific antibodies, including neutralizing antibodies, were induced by the MVA-HA and MVA-NA vectors. Mice vaccinated with MVA vectors expressing any of the H7 antigens were protected, suggesting cross-protection among H7 viruses. In addition, MVA vectors expressing N3 but not N9 elicited protection against H7N3 virus challenge. Similar outcomes were obtained when immune sera from MVA vector-immunized mice were passively transferred to naïve mice prior to challenge with the H7N3 virus. The results support the further development of an MVA vector platform as a candidate vaccine for influenza strains with pandemic potential.
Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni
2014-01-01
Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guss, Adam M.; Rother, Michael; Zhang, Jun Kai
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less
Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...
2008-01-01
A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less
Lee, Young Mok; Pan, Chi-Jiunn; Koeberl, Dwight D; Mansfield, Brian C; Chou, Janice Y
2013-11-01
Glycogen storage disease type-Ia (GSD-Ia) patients deficient in glucose-6-phosphatase-α (G6Pase-α or G6PC) manifest impaired glucose homeostasis characterized by fasting hypoglycemia, growth retardation, hepatomegaly, nephromegaly, hyperlipidemia, hyperuricemia, and lactic acidemia. Two efficacious recombinant adeno-associated virus pseudotype 2/8 (rAAV8) vectors expressing human G6Pase-α have been independently developed. One is a single-stranded vector containing a 2864-bp of the G6PC promoter/enhancer (rAAV8-GPE) and the other is a double-stranded vector containing a shorter 382-bp minimal G6PC promoter/enhancer (rAAV8-miGPE). To identify the best construct, a direct comparison of the rAAV8-GPE and the rAAV8-miGPE vectors was initiated to determine the best vector to take forward into clinical trials. We show that the rAAV8-GPE vector directed significantly higher levels of hepatic G6Pase-α expression, achieved greater reduction in hepatic glycogen accumulation, and led to a better toleration of fasting in GSD-Ia mice than the rAAV8-miGPE vector. Our results indicated that additional control elements in the rAAV8-GPE vector outweigh the gains from the double-stranded rAAV8-miGPE transduction efficiency, and that the rAAV8-GPE vector is the current choice for clinical translation in human GSD-Ia. © 2013.
Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying
2018-05-02
The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.
Clément, Nathalie; Velu, Thierry; Brandenburger, Annick
2002-09-01
The production of currently available vectors derived from autonomous parvoviruses requires the expression of capsid proteins in trans, from helper sequences. Cotransfection of a helper plasmid always generates significant amounts of replication-competent virus (RCV) that can be reduced by the integration of helper sequences into a packaging cell line. Although stocks of minute virus of mice (MVM)-based vectors with no detectable RCV could be produced by transfection into packaging cells; the latter appear after one or two rounds of replication, precluding further amplification of the vector stock. Indeed, once RCVs become detectable, they are efficiently amplified and rapidly take over the culture. Theoretically RCV-free vector stocks could be produced if all homology between vector and helper DNA is eliminated, thus preventing homologous recombination. We constructed new vectors based on the structure of spontaneously occurring defective particles of MVM. Based on published observations related to the size of vectors and the sequence of the viral origin of replication, these vectors were modified by the insertion of foreign DNA sequences downstream of the transgene and by the introduction of a consensus NS-1 nick site near the origin of replication to optimize their production. In one of the vectors the inserted fragment of mouse genomic DNA had a synergistic effect with the modified origin of replication in increasing vector production.
Mohammadzadeh, Sara; Roohvand, Farzin; Memarnejadian, Arash; Jafari, Anis; Ajdary, Soheila; Salmanian, Ali-Hatef; Ehsani, Parastoo
2016-01-01
Plants transformed by virus-based vectors have emerged as promising tools to rapidly express large amounts and inexpensive antigens in transient condition. We studied the possibility of transient-expression of an HBsAg-fused polytopic construct (HCVpc) [containing H-2d and HLA-A2-restricted CD8+CTL-epitopic peptides of C (Core; aa 132-142), E6 (Envelope2; aa 614-622), N (NS3; aa 1406-1415), and E4 (Envelope2; aa 405-414) in tandem of CE6NE4] in tobacco (Nicotiana tabacum) leaves for the development of a plant-based HCV vaccine. A codon-optimized gene encoding the Kozak sequence, hexahistidine (6×His)-tag peptide, and HCVpc in tandem was designed, chemically synthesized, fused to HBsAg gene, and inserted into Potato virus X (PVX-GW) vector under the control of duplicated PVX coat protein promoter (CPP). The resulted recombinant plasmids (after confirmation by restriction and sequencing analyses) were transferred into Agrobacterium tumefaciens strain GV3101 and vacuum infiltrated into tobacco leaves. The effect of gene-silencing suppressor, p19 protein from tomato bushy stunt virus, on the expression yield of HCVpc-HBsAg was also evaluated by co-infiltration of a p19 expression vector. Codon-optimized gene increased adaptation index (CAI) value (from 0.61 to 0.92) in tobacco. The expression of the HCVpc-HBsAg was confirmed by western blot and HBsAg-based detection ELISA on total extractable proteins of tobacco leaves. The expression level of the fusion protein was significantly higher in p19 co-agroinfiltrated plants. The results indicated the possibility of expression of HCVpc-HBsAg constructs with proper protein conformations in tobacco for final application as a plant-derived HCV vaccine.
Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.
2003-01-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cdr phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus. PMID:14532023
Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W
2003-10-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.
Scavuzzo-Duggan, Tess R.; Chaves, Arielle M.; Roberts, Alison W.
2015-07-14
Here, a method for rapid in vivo functional analysis of engineered proteins was developed using Physcomitrella patens. A complementation assay was designed for testing structure/function relationships in cellulose synthase (CESA) proteins. The components of the assay include (1) construction of test vectors that drive expression of epitope-tagged PpCESA5 carrying engineered mutations, (2) transformation of a ppcesa5 knockout line that fails to produce gametophores with test and control vectors, (3) scoring the stable transformants for gametophore production, (4) statistical analysis comparing complementation rates for test vectors to positive and negative control vectors, and (5) analysis of transgenic protein expression by Westernmore » blotting. The assay distinguished mutations that generate fully functional, nonfunctional, and partially functional proteins. In conclusion, compared with existing methods for in vivo testing of protein function, this complementation assay provides a rapid method for investigating protein structure/function relationships in plants.« less
Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon
2015-01-01
A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882
Chen, X G; Liu, Y M; Lv, Q X; Ma, J
2017-01-01
We investigated the effects of recombinant adenovirus vectors that overexpress or silence PLCγ2 on the expression of this gene during hepatocyte proliferation. Hepatocytes were isolated, identified by immunofluorescent cytochemical staining and infected by previously constructed Ad-PLCγ2 and Ad-PLCγ2 siRNA1, siRNA2 and siRNA3. Green fluorescent protein (GFP) expression was observed by fluorescence microscopy. Infection percentage was calculated by flow cytometry. mRNA and protein levels of PLCγ2 were detected by quantitative reverse transcription-PCR (qRT-PCR) and western blotting, respectively. The viability of the infected hepatocytes was measured by 3-(4,5-dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. We found that nearly 97% of cells were positive for the hepatocyte marker, CK18. After infection of Ad-PLCγ2 and Ad-PLCγ2 siRNA, more than 99% of hepatocytes expressed GFP significantly, and mRNA and protein expression of PLCγ2 was up-regulated significantly in Ad-PLCγ2 infected hepatocytes, but down-regulated in Ad-PLCγ2 siRNA2 infected cells. The cell proliferation rate decreased in PLCγ2-overexpressing cells, while the rate increased in PLCγ2-silencing cells. We verified that recombinant Ad-PLCγ2 and Ad-PLCγ2 siRNA2 were constructed successfully. These two recombinant vectors promoted or decreased the expression of PLCγ2 in rat hepatocytes and affected the cell proliferation rate, which provides a useful tool for further investigation of the role of PLCγ2 in hepatocyte apoptosis.
Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W
2010-08-01
The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.
Suppression of hedgehog signaling regulates hepatic stellate cell activation and collagen secretion.
Li, Tao; Leng, Xi-Sheng; Zhu, Ji-Ye; Wang, Gang
2015-01-01
Hepatic stellate cells (HSCs) play an important role in liver fibrosis. This study investigates the expression of hedgehog in HSC and the role of hedgehog signaling on activation and collagen secretion of HSC. Liver ex vivo perfusion with collagenase IV and density gradient centrifugation were used to isolate HSC. Expression of hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 in HSC were detected by RT-PCR. Hedgehog siRNA vectors targeting Ihh, Smo and Gli2 were constructed and transfected into HSC respectively. Suppression of hedgehog signaling were detected by SYBR Green fluorescence quantitative RT-PCR. Effects of hedgehog signaling inhibition on HSC activation and collagen I secretion were analyzed. Hedgehog signaling components Ihh, Smo, Ptc, Gli2 and Gli3 were expressed in HSC. siRNA vectors targeting Ihh, Smo and Gli2 were successfully constructed and decreased target gene expression. Suppression of hedgehog signaling significantly decreased the expression of α-SMA in HSC (P<0.01). Collagen type I secretion of HSC were also significantly decreased (P<0.01). In summary, HSC activation and collagen secretion can be regulated by hedgehog signaling. Hedgehog may play a role in the pathogenesis of liver fibrosis.
Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard
2012-04-01
Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng
2016-06-21
To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.
Xuan, X; Tuchiya, K; Sato, I; Nishikawa, Y; Onoderaz, Y; Takashima, Y; Yamamoto, A; Katsumata, A; Iwata, A; Ueda, S; Mikami, T; Otsuka, H
1998-01-01
In order to evaluate whether canine herpesvirus (CHV) could be used as a live vector for the expression of heterologous immunogenes, we constructed a recombinant canine herpesvirus (CHV) expressing glycoprotein (G protein) of rabies virus (RV). The gene of G protein was inserted within the thymidine kinase gene of CHV YP11mu strain under the control of the human cytomegalovirus immediate early promoter. The G protein expressed by the recombinant CHV was processed and transported to the cell surface as in RV infected cells, and showed the same biological activities such as low pH dependent cell fusion and hemadsorption. The antigenic authenticity of the recombinant G protein was confirmed by a panel of monoclonal antibodies specific for G protein. Dogs inoculated intransally with the recombinant CHV produced higher titres of virus neutralizing antibodies against RV than those inoculated with a commercial, inactivated rabies vaccine. These results suggest that the CHV recombinant expressing G protein can be used as a vaccine to control canine rabies and that CHV may be useful as a vector to develop live recombinant against other infectious diseases in dogs.
Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein
2017-01-01
Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.
Abdoli, Shahriyar; Roohvand, Farzin; Teimoori-Toolabi, Ladan; Shokrgozar, Mohammad Ali; Bahrololoumi, Mina; Azadmanesh, Kayhan
2017-07-01
Oncolytic herpes simplex virus (oHSV)-based vectors lacking γ34.5 gene, are considered as ideal templates to construct efficient vectors for (targeted) cancer gene therapy. Herein, we reported the construction of three single/dually-flourescence labeled and γ34.5-deleted, recombinant HSV-1 vectors for rapid generation and easy selection/isolation of different HSV-Based vectors. Generation of recombinant viruses was performed with conventional homologous recombination methods using green fluorescent protein (GFP) and BleCherry harboring shuttle vectors. Viruses were isolated by direct fluorescence observation and standard plaque purifying methods and confirmed by PCR and sequencing and flow cytometry. XTT and plaque assay titration were performed on Vero, U87MG, and T98 GBM cell lines. We generated three recombinant viruses, HSV-GFP, HSV-GR (Green-Red), and HSV-Red. The HSV-GFP showed two log higher titer (1010 PFU) than wild type (108 PFU). In contrast, HSV-GR and HSV-Red showed one log lower titer (107 PFU) than parental HSV. Cytotoxicity analysis showed that HSV-GR and HSV-Red can lyse target tumor cells at multiplicity of infection of 10 and 1 (P<0.001). Moreover, HSV-GFP showed higher infection potency (98%) in comparison with HSV-GR (82%). Our oHSVs provide a simple and an efficient platform for construction and rapid isolation of 2nd and 3rd generation oHSVs by replacing the inserted dyes with transgenes and also for rapid identification via fluorescence activated cell sorting. These vectors can also be used for tracing the efficacy of therapeutic agents on target cells, imaging of neural or tumoral cells in vitro/in vivo and as oncolytic agents in cancer therapy.
Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H
2016-01-01
The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.
A simple and robust vector-based shRNA expression system used for RNA interference.
Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi
2013-01-01
RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.
NASA Astrophysics Data System (ADS)
Su, Hua; Lu, Ronghua; Chang, Judy C.; Kan, Yuet Wai
1997-12-01
About 70% of hepatocellular carcinomas are known to express α -fetoprotein, which is normally expressed in fetal but not in adult livers. To induce herpes simplex virus-thymidine kinase expression in these cancer cells, we constructed an adeno-associated viral vector containing the HSV-TK gene under the control of the α -fetoprotein enhancer and albumin promoter. We previously demonstrated in vitro that although this vector can transduce a variety of human cells, only transduced AFP and albumin-expressing hepatocellular carcinoma cell lines were sensitive to killing by ganciclovir (GCV). In the present study, we explored the effect of this vector on hepatocellular carcinoma cells in vivo. Subcutaneous tumors generated in nude mice by implanting hepatocellular carcinoma cells previously transduced with this vector shrank dramatically after treatment with GCV. Bystander effect was also observed on the tumors generated by mixing transduced and untransduced cells. To test whether the tumor cells can be transduced by the virus in vivo, we injected the recombinant adeno-associated virus into tumors generated by untransduced hepatocarcinoma cell line. Tumor growth were retarded after treatment with GCV. These experiments demonstrate the feasibility of in vivo transduction of tumor cell with rAAV.
Hagstrom, J N; Couto, L B; Scallan, C; Burton, M; McCleland, M L; Fields, P A; Arruda, V R; Herzog, R W; High, K A
2000-04-15
Hemophilia B is caused by the absence of functional coagulation factor IX (F.IX) and represents an important model for treatment of genetic diseases by gene therapy. Recent studies have shown that intramuscular injection of an adeno-associated viral (AAV) vector into mice and hemophilia B dogs results in vector dose-dependent, long-term expression of biologically active F.IX at therapeutic levels. In this study, we demonstrate that levels of expression of approximately 300 ng/mL (6% of normal human F.IX levels) can be reached by intramuscular injection of mice using a 2- to 4-fold lower vector dose (1 x 10(11) vector genomes/mouse, injected into 4 intramuscular sites) than previously described. This was accomplished through the use of an improved expression cassette that uses the cytomegalovirus (CMV) immediate early enhancer/promoter in combination with a 1.2-kilobase portion of human skeletal actin promoter. These results correlated with enhanced levels of F.IX transcript and secreted F.IX protein in transduced murine C2C12 myotubes. Systemic F.IX expression from constructs containing the CMV enhancer/promoter alone was 120 to 200 ng/mL in mice injected with 1 x 10(11) vector genomes. Muscle-specific promoters performed poorly for F.IX transgene expression in vitro and in vivo. However, the incorporation of a sequence from the alpha-skeletal actin promoter containing at least 1 muscle-specific enhancer and 1 enhancer-like element further improved muscle-derived expression of F.IX from a CMV enhancer/promoter-driven expression cassette over previously published results. These findings will allow the design of a clinical protocol for therapeutic levels of F.IX expression with lower vector doses, thus enhancing efficacy and safety of the protocol. (Blood. 2000;95:2536-2542)
Gorziglia, M I; Kadan, M J; Yei, S; Lim, J; Lee, G M; Luthra, R; Trapnell, B C
1996-01-01
A novel recombinant adenovirus vector, Av3nBg, was constructed with deletions in adenovirus E1, E2a, and E3 regions and expressing a beta-galactosidase reporter gene. Av3nBg can be propagated at a high titer in a corresponding A549-derived cell line, AE1-2a, which contains the adenovirus E1 and E2a region genes inducibly expressed from separate glucocorticoid-responsive promoters. Av3nBg demonstrated gene transfer and expression comparable to that of Av1nBg, a first-generation adenovirus vector with deletions in E1 and E3. Several lines of evidence suggest that this vector is significantly more attenuated than E1 and E3 deletion vectors. Metabolic DNA labeling studies showed no detectable de novo vector DNA synthesis or accumulation, and metabolic protein labeling demonstrated no detectable de novo hexon protein synthesis for Av3nBg in naive A549 cells even at a multiplicity of infection of up to 3,000 PFU per cell. Additionally, naive A549 cells infected by Av3nBg did not accumulate infectious virions. In contrast, both Av1nBg and Av2Lu vectors showed DNA replication and hexon protein synthesis at multiplicities of infection of 500 PFU per cell. Av2Lu has a deletion in E1 and also carries a temperature-sensitive mutation in E2a. Thus, molecular characterization has demonstrated that the Av3nBg vector is improved with respect to the potential for vector DNA replication and hexon protein expression compared with both first-generation (Av1nBg) and second-generation (Av2Lu) adenoviral vectors. These observations may have important implications for potential use of adenovirus vectors in human gene therapy. PMID:8648763
[Effects of SREBP-1 over-expression on fatty acid metabolism related genes expression in goats].
Xu, Huifen; Luo, Jun; Li, Fang; Yu, Kang; Shi, Hengbo; Li, Jun; Lin, Xianzi; Zhu, Jiangjiang
2012-11-01
The aim of the study was to construct a recombinant adenovirus overexpression vector for Sterol Regulatory Element Binding Protein-1 (SREBP-1) of Xinong Saanen dairy goat, and to detect its effect on genes related to fatty acid metabolism in goat mammary epithelial cells, to establish foundation for further study of its roles in metabolism of fatty acid synthesis and lactation. First, we designed primers based on the SREBP-1 gene sequence in GenBank for PCR amplification and inserted the sequence into shuttle vector pAdTrack-CMV. The recombinant plasmid pAdTrack-CMV-SREBP-1 linearized by Pme I was transformed into E. coli BJ5183 competence cell containing the backbone vector pAdEasy-1 to obtain recombinant vector pAd-SREBP-1 by homologous recombination. pAd-SREBP-1 was linearized by Pac I and transfected into HEK 293 cell. Then we infected goat mammary epithelial cells with recombinant adenovirus which was packaged in HEK 293 cell line. The results showed that the recombinant adenovirus vector containing SREBP-1 was successfully constructed, and the titer of virus was 10(9) U/mL. Compared with the control group, mRNA level of SREBP-1 increased by about 15 times after infected for 48 h and 30 times after infected for 72 h. Fatty acid synthase (FASN) and Acetyl-CoA carboxylase (ACC) was upregulated by almost 2 times. The expression level of Peroxisome proliferator activated receptorgamma (PPARgamma) increased by 1.5 times. Liver X receptoralpha (LXRalpha) and Adipose triglyceride lipase (ATGL) upregulated by 1.2 times compared with that of control. But Stearoyl-coenzyme A desaturase (SCD) had no obvious change. In conclusion, SREBP-1 can activate the expression of genes related to fatty acid synthesis in mammary epithelial cells of Xinong Saanen dairy goat, demonstrated a regulatory function on the fatty acid metabolism in goat mammary gland.
Mechanism of estrogen activation of c-myc oncogene expression.
Dubik, D; Shiu, R P
1992-08-01
The estrogen receptor complex is a known trans-acting factor that regulates transcription of specific genes through an interaction with a specific estrogen-responsive cis-acting element (ERE). In previous studies we have shown that in estrogen-responsive human breast cancer cells estrogen rapidly activates c-myc expression. This activated expression occurs through enhanced transcription and does not require the synthesis of new protein intermediates; therefore, an ERE is present in the human c-myc gene regulatory region. To localize the ERE, constructs containing varying lengths of the c-myc 5'-flanking region ranging from -2327 to +25 (relative to the P1 promoter) placed adjacent to the chloramphenicol acetyl transferase reporter gene (CAT) were prepared. They were used in transient transfection studies in MCF-7 and HeLa cells co-transfected with an estrogen receptor expression vector. These studies reveal that all constructs containing the P2 promoter region exhibited estrogen-regulated CAT expression and that a 116-bp region upstream and encompassing the P2 TATA box is necessary for this activity. Analysis of this 116-bp region failed to identify a cis-acting element with sequences resembling the consensus ERE; however, co-transfection studies with mutant estrogen receptor expression vectors showed that the DNA-binding domain of the receptor is essential for estrogen-regulated CAT gene expression. We have also observed that anti-estrogen receptor complexes can weakly trans-activate from this 116-bp region but fail to do so from the ERE-containing ApoVLDLII-CAT construct. To explain these results we propose a new mechanism of estrogen trans-activation in the c-myc gene promoter.
Rapid Assembly of Customized TALENs into Multiple Delivery Systems
Zhang, Zhengxing; Zhang, Siliang; Huang, Xin; Orwig, Kyle E.; Sheng, Yi
2013-01-01
Transcriptional activator-like effector nucleases (TALENs) have become a powerful tool for genome editing. Here we present an efficient TALEN assembly approach in which TALENs are assembled by direct Golden Gate ligation into Gateway® Entry vectors from a repeat variable di-residue (RVD) plasmid array. We constructed TALEN pairs targeted to mouse Ddx3 subfamily genes, and demonstrated that our modified TALEN assembly approach efficiently generates accurate TALEN moieties that effectively introduce mutations into target genes. We generated “user friendly” TALEN Entry vectors containing TALEN expression cassettes with fluorescent reporter genes that can be efficiently transferred via Gateway (LR) recombination into different delivery systems. We demonstrated that the TALEN Entry vectors can be easily transferred to an adenoviral delivery system to expand application to cells that are difficult to transfect. Since TALENs work in pairs, we also generated a TALEN Entry vector set that combines a TALEN pair into one PiggyBac transposon-based destination vector. The approach described here can also be modified for construction of TALE transcriptional activators, repressors or other functional domains. PMID:24244669
Construction of a novel shuttle vector for use in Gluconobacter oxydans.
Zhang, Lin; Lin, Jinping; Ma, Yushu; Wei, Dongzhi; Sun, Ming
2010-11-01
A shuttle vector pZL1 which can replicate both in Gluconobacter oxydans and Escherichia coli was constructed based on G. oxydans DSM2003 cryptic plasmid pGOX3, a homology of G. oxydans 621H pGOX3, and E. coli cloning vector pUC18. It was found to be stably maintained in G. oxydans during the serial subcultures in the absence of antibiotic pressure for 144 h. With pGOX3 as the reference sample, the relative copy number of pZL1 in G. oxydans is 13 determined by real-time fluorescence quantitative PCR (qPCR). The copy number of pZL1 is much higher than pBBR1MCS5 in E. coli. The vector pZL1 contains six commonly used restriction endonuclease sites, HindIII, SalI, XbaI, BamHI, SmaI, KpnI, and SacI, and is easy to manipulate in molecular biology experiments. The shuttle vector was used to express a reporter protein wasabi successfully in G. oxydans DSM2003 under the control of the tufB promoter.
[Construction and characterization of liposomal magnetofection system in pig kidney cells].
Chen, Wenjie; Cui, Haixin; Zhao, Xiang; Cui, Jinhui; Wang, Yan; Sun, Changjiao
2014-06-01
Magnetic nano gene vector is one of the non-viral gene vectors, modified by functional group to bind cationic transfect reagents. Coupling magnetofection with the universal lipofection we developed a novel somatic cell transfection method as the so-called liposomal magnetofection (LMF). This approach is potential to provide somatic cell cloning with stable genetic cell lines to cultivate transgenic animals. In order to construct such liposomal magnetic gene vectors complexes system, we used nano magnetic gene vector to combine with liposomal cationic transfect reagents by molecular self-assembly. This vectors system successfully carried exogenous gene and then transfected animal somatic cells. Here, we conducted atomic force microscopy (AFM), zeta potential-diameter analysis and other characterization experiments to investegate the size distribution and morphology of magnetic nanoparticles, the way of the vectors to load and concentrate DNA molecules. Our data reveal that, the LMF of Pig Kidney cells exhibited higher transfection efficiency comparing with the transfection mediated by the commercial lipofectamine2000. Moreover, LMF method overcomes the constraint of transient expression mediated by lipofection. Meanwhile, MTT assay showed low cytotoxicity of LMF. Hence, LMF is a feasible, low cytotoxic and effective method of cell transfection.
Throm, Robert E.; Ouma, Annastasia A.; Zhou, Sheng; Chandrasekaran, Anantharaman; Lockey, Timothy; Greene, Michael; De Ravin, Suk See; Moayeri, Morvarid; Malech, Harry L.; Sorrentino, Brian P.
2009-01-01
Retroviral vectors containing internal promoters, chromatin insulators, and self-inactivating (SIN) long terminal repeats (LTRs) may have significantly reduced genotoxicity relative to the conventional retroviral vectors used in recent, otherwise successful clinical trials. Large-scale production of such vectors is problematic, however, as the introduction of SIN vectors into packaging cells cannot be accomplished with the traditional method of viral transduction. We have derived a set of packaging cell lines for HIV-based lentiviral vectors and developed a novel concatemeric array transfection technique for the introduction of SIN vector genomes devoid of enhancer and promoter sequences in the LTR. We used this method to derive a producer cell clone for a SIN lentiviral vector expressing green fluorescent protein, which when grown in a bioreactor generated more than 20 L of supernatant with titers above 107 transducing units (TU) per milliliter. Further refinement of our technique enabled the rapid generation of whole populations of stably transformed cells that produced similar titers. Finally, we describe the construction of an insulated, SIN lentiviral vector encoding the human interleukin 2 receptor common γ chain (IL2RG) gene and the efficient derivation of cloned producer cells that generate supernatants with titers greater than 5 × 107 TU/mL and that are suitable for use in a clinical trial for X-linked severe combined immunodeficiency (SCID-X1). PMID:19286997
Regulatable Transgene Expression for Prevention of Chemotherapy-Induced Peripheral Neuropathy.
Kawata, Daisuke; Wu, Zetang
2017-09-15
Chemotherapy-induced peripheral neuropathy (CIPN) is a debilitating complication associated with drug treatment of cancer for which there are no effective strategies of prevention or treatment. In this study, we examined the effect of intermittent expression of neurotophin-3 (NT-3) or interleukin-10 (IL-10) from replication-defective herpes simplex virus (HSV)-based regulatable vectors delivered by subcutaneous inoculation to the dorsal root ganglion (DRG) on the development of paclitaxel-induced peripheral neuropathy. We constructed two different tetracycline (tet)-on-based regulatable HSV vectors, one expressing NT-3 and the other expressing IL-10, in which the transactivator expression in the tet-on system was under the control of HSV latency-associated promoter 2 (LAP-2), and expression of the transgene was controlled by doxycycline (DOX). We examined the therapeutic effect of intermittent expression of the transgene in animals with paclitaxel-induced peripheral neuropathy modeled by intraperitoneal injection of paclitaxel (16 mg/kg) once a week for 5 weeks. Intermittent expression of either NT-3 or IL-10 3 days before and 1 day after paclitaxel administration protected animals against paclitaxel-induced peripheral neuropathy over the course of 5 weeks. These results suggest the potential of regulatable vectors for prevention of chemotherapy-induced peripheral neuropathy.
Ye, Xing-Guo; Qin, Hua
2007-01-01
Obtaining marker-free plants with high efficiency will benefit the environmental release of transgenic crops. To achieve this point, a binary vector pNB35SVIP1 with three T-DNAs was constructed by using several mediate plasmids, in which one copy of bar gene expression cassette and two copies of VIP1 gene expression cassette were included. EHA101 Agrobacterium strain harboring the final construct was applied to transform soybean (Glycine max) cotyledon nodes. Through 2 - 3 months regeneration and selection on 3 - 5mg/L glufosinate containing medium, transgenic soybean plants were confirmed to be obtained at 0.83% - 3.16%, and co-transformation efficiency of both gene in the same individual reached up to 86.4%, based on southern blot test. By the analysis of PCR, southern blot and northern blot combining with leaf painting of herbicide in T1 progenies, 41 plants were confirmed to be eliminated of bar gene with the frequency of 7.6% . Among the T1 populations tested, the loss of the alien genes happened in 22.7% lines, the silence of bar gene took place in 27.3% lines, and VIP1 gene silence existed in 37.1% marker-free plants. The result also suggested that the plasmid with three T-DNAs might be an ideal vector to generate maker-free genetic modified organism.
Winton, Alexander J; Baptiste, Janae L; Allen, Mark A
2018-09-01
Proteins and polypeptides represent nature's most complex and versatile polymer. They provide complicated shapes, diverse chemical functionalities, and tightly regulated and controlled sizes. Several disease states are related to the misfolding or overproduction of polypeptides and yet polypeptides are present in several therapeutic molecules. In addition to biological roles; short chain polypeptides have been shown to interact with and drive the bio-inspired synthesis or modification of inorganic materials. This paper outlines the development of a versatile cloning vector which allows for the expression of a short polypeptide by controlling the incorporation of a desired DNA coding insert. As a demonstration of the efficacy of the expression system, a solid binding polypeptide identified from M13 phage display was expressed and purified. The solid binding polypeptide was expressed as a soluble 6xHis-SUMO tagged construct. Expression was performed in E. coli using auto-induction followed by Ni-NTA affinity chromatography and ULP1 protease cleavage. Methodology demonstrates the production of greater than 8 mg of purified polypeptide per liter of E. coli culture. Isotopic labeling of the peptide is also demonstrated. The versatility of the designed cloning vector, use of the 6xHis-SUMO solubility partner, bacterial expression in auto-inducing media and the purification methodology make this expressionun vector a readily scalable and user-friendly system for the creation of desired peptide domains. Copyright © 2018. Published by Elsevier Inc.
Toda, Hiroshi; Itoh, Nobuya
2017-01-01
The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli–Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 (rhsmo) and alcohol dehydrogenase gene from Leifsonia sp. S749 (lsadh), in K. rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase (gapdh) promotor. The RhSMO–LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent–water biphasic reaction system to efficiently convert styrene into (S)-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells. PMID:29230202
[Construction of plant expression plasmid of chimera SBR-CT delta A1].
Mai, Sui; Ling, Junqi
2003-08-01
The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.
Simultaneous neuron- and astrocyte-specific fluorescent marking
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schulze, Wiebke; Hayata-Takano, Atsuko; Kamo, Toshihiko
2015-03-27
Systematic and simultaneous analysis of multiple cell types in the brain is becoming important, but such tools have not yet been adequately developed. Here, we aimed to generate a method for the specific fluorescent labeling of neurons and astrocytes, two major cell types in the brain, and we have developed lentiviral vectors to express the red fluorescent protein tdTomato in neurons and the enhanced green fluorescent protein (EGFP) in astrocytes. Importantly, both fluorescent proteins are fused to histone 2B protein (H2B) to confer nuclear localization to distinguish between single cells. We also constructed several expression constructs, including a tandem alignmentmore » of the neuron- and astrocyte-expression cassettes for simultaneous labeling. Introducing these vectors and constructs in vitro and in vivo resulted in cell type-specific and nuclear-localized fluorescence signals enabling easy detection and distinguishability of neurons and astrocytes. This tool is expected to be utilized for the simultaneous analysis of changes in neurons and astrocytes in healthy and diseased brains. - Highlights: • We develop a method for the specific fluorescent labeling of neurons and astrocytes. • Neuron-specific labeling is achieved using Scg10 and synapsin promoters. • Astrocyte-specific labeling is generated using the minimal GFAP promoter. • Nuclear localization of fluorescent proteins is achieved with histone 2B protein.« less
HSV as a vector in vaccine development and gene therapy.
Marconi, Peggy; Argnani, Rafaela; Epstein, Alberto L; Manservigi, Roberto
2009-01-01
The very deep knowledge acquired on the genetics and molecular biology of herpes simplex virus (HSV), major human pathogen whose lifestyle is based on a long-term dual interaction with the infected host characterized by the existence of lytic and latent infections, has allowed the development of potential vectors for several applications in human healthcare. These include delivery and expression of human genes to cells of the nervous system, selective destruction of cancer cells, prophylaxis against infection with HSV or other infectious diseases and targeted infection of specific tissues or organs. Three different classes of vectors can be derived from HSV-1: replication-competent attenuated vectors, replication-incompetent recombinant vectors and defective helper-dependent vectors known as amplicons. This chapter highlights the current knowledge concerning design, construction and recent applications, as well as the potential and current limitations of the three different classes of HSV-1-based vectors.
[Construction and expression of recombinant human serum albumin-EPO fusion protein].
Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing
2011-05-01
OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.
Basanta, Antonio; Herranz, Carmen; Gutiérrez, Jorge; Criado, Raquel; Hernández, Pablo E.; Cintas, Luis M.
2009-01-01
A segregationally stable expression and secretion vector for Saccharomyces cerevisiae, named pYABD01, was constructed by cloning the yeast gene region encoding the mating pheromone α-factor 1 secretion signal (MFα1s) into the S. cerevisiae high-copy-number expression vector pYES2. The structural genes of the two leaderless peptides of enterocin L50 (EntL50A and EntL50B) from Enterococcus faecium L50 were cloned, separately (entL50A or entL50B) and together (entL50AB), into pYABD01 under the control of the galactose-inducible promoter PGAL1. The generation of recombinant S. cerevisiae strains heterologously expressing and secreting biologically active EntL50A and EntL50B demonstrates the suitability of the MFα1s-containing vector pYABD01 to direct processing and secretion of these antimicrobial peptides through the S. cerevisiae Sec system. PMID:19218405
Ohno, Satoshi; Yoshikawa, Katsunori; Shimizu, Hiroshi; Tamura, Tomohiro
2014-01-01
We describe here the construction of a series of 71 vectors to silence central carbon metabolism genes in Escherichia coli. The vectors inducibly express antisense RNAs called paired-terminus antisense RNAs, which have a higher silencing efficacy than ordinary antisense RNAs. By measuring mRNA amounts, measuring activities of target proteins, or observing specific phenotypes, it was confirmed that all the vectors were able to silence the expression of target genes efficiently. Using this vector set, each of the central carbon metabolism genes was silenced individually, and the accumulation of metabolites was investigated. We were able to obtain accurate information on ways to increase the production of pyruvate, an industrially valuable compound, from the silencing results. Furthermore, the experimental results of pyruvate accumulation were compared to in silico predictions, and both sets of results were consistent. Compared to the gene disruption approach, the silencing approach has an advantage in that any E. coli strain can be used and multiple gene silencing is easily possible in any combination. PMID:24212579
Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni
2014-01-01
Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells. PMID:25502183
[HSV-1 based vector mediated IL-1Rα gene for knee osteoarthritis in rabbits].
Wu, Yi; Li, Jianming; Kong, Ying; Chen, Ding; Liu, Bo; Wang, Wanchun
2013-06-01
To investigate the effect and mechanism of herpes simplex virus type 1 (HSV-1) based vector mediated interlukin-1 receptor antagonist (IL-1Rα) gene for knee osteoarthritis in rabbits. HSV-1 vectors containing IL-1Rα genes were constructed and injected into the joint space of the osteoarthritis knee in rabbits for 4 weeks. The rabbits were sacrificed, and the knees were lavaged, dissected and the effect of transgene expression was analyzed. Levels of IL-1Rα and IL-1 expression in the recovered lavage fluids were measured with a cytokine ELISA kit. Cartilage from the lesion areas of medial femoral condyle and synovium were observed with hematoxylin and eosin (cartilage and synovium) and toluidine blue (cartilage). The blank control group was injected pHSV-LacZ vector into rabbit knees. Intra-articular delivery of pHSV-IL-1Rα-LacZ resulted in a significant inhibition of IL-1 level and cartilage degradation compared with those in the blank control group (P<0.05). pHSV-LacZ is an ideal vector to mediate intra-articular gene delivery in the rabbit model of osteoarthritis. Continuous intra-articular expression of IL-1Rα can treat knee osteoarthritis by inhibiting IL-1.
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji
2015-12-01
Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.
Chakraborti, Dipankar; Sarkar, Anindya; Mondal, Hossain A; Schuermann, David; Hohn, Barbara; Sarmah, Bidyut K; Das, Sampa
2008-10-01
A binary expression vector was constructed containing the insecticidal gene Allium sativum leaf agglutinin (ASAL), and a selectable nptII marker gene cassette, flanked by lox sites. Similarly, another binary vector was developed with the chimeric cre gene construct. Transformed tobacco plants were generated with these two independent vectors. Each of the T(0) lox plants was crossed with T(0) Cre plants. PCR analyses followed by the sequencing of the target T-DNA part of the hybrid T(1) plants demonstrated the excision of the nptII gene in highly precised manner in certain percentage of the T(1) hybrid lines. The frequency of such marker gene excision was calculated to be 19.2% in the hybrids. Marker free plants were able to express ASAL efficiently and reduce the survivability of Myzus persiceae, the deadly pest of tobacco significantly, compared to the control tobacco plants. Results of PCR and Southern blot analyses of some of the T(2) plants detected the absence of cre as well as nptII genes. Thus, the crossing strategy involving Cre/lox system for the excision of marker genes appears to be very effective and easy to execute. Documentation of such marker excision phenomenon in the transgenic plants expressing the important insecticidal protein for the first time has a great significance from agricultural and biotechnological points of view.
Zhang, X; Zhu, J; Zhang, K; Liu, T; Zhang, Z
2016-12-30
This study was aimed at investigating the expression of brain-derived neurotrophic factor (BDNF) in mesenchymal stem cells (MSCs) modified with recombinant lentivirus bearing BDNF gene. Lentivirus vectors bearing BDNF gene were constructed. MSCs were isolated from rats and cultured. The lentiviral vectors containing BDNF gene were transfected into the MSCs, and BDNF gene and protein expressions were monitored with enhanced green fluorescent protein (EGFP). RT-PCR and Western blot were used to measure gene and protein expressions, respectibvely in MSCs, MSCs-EGFP and MSCs-EGFP-BDNF groups. Green fluorescence assay confirmed successful transfection of BDNF gene recombinant lentivirus into MSCs. RT-PCR and Western blot revealed that BDNF gene and protein expressions in the MSCs-EGFP-BDNF group were significantly higher than that in MSCs group and MSCs-EGFP group. There were no statistically significant differences in gene expression between MSCs and MSCs-EGFP groups. MSCs can over-express BDNF when transfected with recombinant lentivirus bearing BDNF gene.
Hodara, Vida L.; Velasquillo, M. Cristina; Parodi, Laura M.; Giavedoni, Luis D.
2005-01-01
Human immunodeficiency virus infection is characterized by dysregulation of antigen-presenting cell function and defects in cell-mediated immunity. Recent evidence suggests that impaired ability of CD4+ T cells to upregulate the costimulatory molecule CD154 is at the core of this dysregulation. To test the hypothesis that increased expression of CD154 on infected CD4+ T cells could modulate immune function, we constructed a replication-competent simian immunodeficiency virus (SIV) vector that expressed CD154. We found that this recombinant vector directed the expression of CD154 on the surface of infected CD4+ T cells and that expression of CD154 resulted in activation of B cells present in the same cultures. Experimental infection of rhesus macaques resulted in very low viral loads for the CD154-expressing virus and the control virus, indicating that expression of CD154 did not result in increased viral replication. Analyses of the anti-SIV immune responses and the phenotype of lymphocytes in blood and lymphoid tissues showed changes that occurred during the acute phase of infection only in animals infected with the CD154-expressing SIV, but that became indistinguishable from those seen in animals infected with the control virus at later time points. We conclude that the level of expression of CD154 in itself is not responsible for affecting the immune response to an attenuated virus. Considering that the CD154-expressing SIV vector and the virus control did not carry an active nef gene, our results suggest that, in CD4+ T cells infected with wild-type virus, Nef is the viral factor that interferes with the immune mechanisms that regulate expression of CD154. PMID:15795254
Characterization of BRCA2 Transcriptional Regulation
2000-08-01
Renilla luciferase vector (Promega) with 4 ll of Fugene-6 was used for each transfection. The pRL-TK Renilla luciferase activity was used to control for...experiments, cells received 0.5 jig of BRCA2 promoter construct, 0.1 jig of pRL-TK Renilla luciferase vector, and 0.5 jig of the indicated expression...Myc, and pCMV-Max. Firefly lucifer- ase and renilla luciferase assays were performed using the Dual-Luciferase Reporter Assay Sys- tem (Promega
Fernandes, Alinda R; Chari, Divya M
2016-09-28
Genetically engineered neural stem cell (NSC) transplant populations offer key benefits in regenerative neurology, for release of therapeutic biomolecules in ex vivo gene therapy. NSCs are 'hard-to-transfect' but amenable to 'magnetofection'. Despite the high clinical potential of this approach, the low and transient transfection associated with the large size of therapeutic DNA constructs is a critical barrier to translation. We demonstrate for the first time that DNA minicircles (small DNA vectors encoding essential gene expression components but devoid of a bacterial backbone, thereby reducing construct size versus conventional plasmids) deployed with magnetofection achieve the highest, safe non-viral DNA transfection levels (up to 54%) reported so far for primary NSCs. Minicircle-functionalized magnetic nanoparticle (MNP)-mediated gene delivery also resulted in sustained gene expression for up to four weeks. All daughter cell types of engineered NSCs (neurons, astrocytes and oligodendrocytes) were transfected (in contrast to conventional plasmids which usually yield transfected astrocytes only), offering advantages for targeted cell engineering. In addition to enhancing MNP functionality as gene delivery vectors, minicircle technology provides key benefits from safety/scale up perspectives. Therefore, we consider the proof-of-concept of fusion of technologies used here offers high potential as a clinically translatable genetic modification strategy for cell therapy. Copyright © 2016 Elsevier B.V. All rights reserved.
Promoters and proteins from Clostridium thermocellum and uses thereof
Wu, J. H. David; Newcomb, Michael
2012-11-13
The present invention relates to an inducible and a high expression nucleic acid promoter isolated from Clostridium thermocellum. These promoters are useful for directing expression of a protein or polypeptide encoded by a nucleic acid molecule operably associated with the nucleic acid promoters. The present invention also relates to nucleic acid constructs including the C. thermocellum promoters, and expression vectors and hosts containing such nucleic acid constructs. The present invention also relates to protein isolated from Clostridium thermocellum, including a repressor protein. The present invention also provides methods of using the isolated promoters and proteins from Clostridium thermocellum, including methods for directing inducible in vitro and in vivo expression of a protein or polypeptide in a host, and methods of producing ethanol from a cellulosic biomass.
Ren, Shoufeng; Wei, Qimei; Cai, Liya; Yang, Xuejing; Xing, Cuicui; Tan, Feng; Leavenworth, Jianmei W.; Liang, Shaohui; Liu, Wenquan
2018-01-01
Ebola virus (EBOV) causes severe hemorrhagic fevers in humans, and no approved therapeutics or vaccine is currently available. Glycoprotein (GP) is the major protective antigen of EBOV, and can generate virus-like particles (VLPs) by co-expression with matrix protein (VP40). In this study, we constructed a recombinant Alphavirus Semliki Forest virus (SFV) replicon vector DREP to express EBOV GP and matrix viral protein (VP40). EBOV VLPs were successfully generated and achieved budding from 293 cells after co-transfection with DREP-based GP and VP40 vectors (DREP-GP+DREP-VP40). Vaccination of BALB/c mice with DREP-GP, DREP-VP40, or DREP-GP+DREP-VP40 vectors, followed by immediate electroporation resulted in a mixed IgG subclass production, which recognized EBOV GP and/or VP40 proteins. This vaccination regimen also led to the generation of both Th1 and Th2 cellular immune responses in mice. Notably, vaccination with DREP-GP and DREP-VP40, which produces both GP and VP40 antigens, induced a significantly higher level of anti-GP IgG2a antibody and increased IFN-γ secreting CD8+ T-cell responses relative to vaccination with DREP-GP or DREP-VP40 vector alone. Our study indicates that co-expression of GP and VP40 antigens based on the SFV replicon vector generates EBOV VLPs in vitro, and vaccination with recombinant DREP vectors containing GP and VP40 antigens induces Ebola antigen-specific humoral and cellular immune responses in mice. This novel approach provides a simple and efficient vaccine platform for Ebola disease prevention. PMID:29375526
Families of vector-like deformations of relativistic quantum phase spaces, twists and symmetries
NASA Astrophysics Data System (ADS)
Meljanac, Daniel; Meljanac, Stjepan; Pikutić, Danijel
2017-12-01
Families of vector-like deformed relativistic quantum phase spaces and corresponding realizations are analyzed. A method for a general construction of the star product is presented. The corresponding twist, expressed in terms of phase space coordinates, in the Hopf algebroid sense is presented. General linear realizations are considered and corresponding twists, in terms of momenta and Poincaré-Weyl generators or gl(n) generators are constructed and R-matrix is discussed. A classification of linear realizations leading to vector-like deformed phase spaces is given. There are three types of spaces: (i) commutative spaces, (ii) κ -Minkowski spaces and (iii) κ -Snyder spaces. The corresponding star products are (i) associative and commutative (but non-local), (ii) associative and non-commutative and (iii) non-associative and non-commutative, respectively. Twisted symmetry algebras are considered. Transposed twists and left-right dual algebras are presented. Finally, some physical applications are discussed.
The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector
NASA Technical Reports Server (NTRS)
Ludwig, D. L.; Bruschi, C. V.
1991-01-01
The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.
Ghanbari Safari, Maryam; Baesi, Kazem; Hosseinkhani, Saman
2017-03-01
MicroRNAs are small noncoding RNAs that regulate gene expression by repressing translation of target cellular transcripts. Increasing evidences indicate that miRNAs have different expression profiles and play crucial roles in numerous cellular processes. Delivery and expression of transgenes for cancer therapy must be specific for tumors to avoid killing of healthy tissues. Many investigators have shown that transgene expression can be suppressed in normal cells using vectors that are responsive to microRNA regulation. To overcome this problem, miR-145 that exhibits downregulation in many types of cancer cells was chosen for posttranscriptional regulatory systems mediated by microRNAs. In this study, a psiCHECK-145T vector carrying four tandem copies of target sequences of miR-145 into 3'-UTR of the Renilla luciferase gene was constructed. Renilla luciferase activity from the psiCHECK-145T vector was 57% lower in MCF10A cells with high miR-145 expression as compared to a control condition. Additionally, overexpression of miR-145 in MCF-7 cells with low expression level of miR-145 showed more than 76% reduction in the Renilla luciferase activity from the psiCHECK-145T vector. Inclusion of miR-145 target sequences into the 3'-UTR of the Renilla luciferase gene is a feasible strategy for restricting transgene expression in a breast cancer cell line while sparing a breast normal cell line. © 2015 International Union of Biochemistry and Molecular Biology, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yokoo, Masako; Fujita, Ryosuke; Innate Immunity Laboratory, Graduate School of Life Science and Creative Research Institution, Hokkaido University, Sapporo 001-0021
Highlights: •The baculovirus vector infiltrates the cells of economic important fishes. •Drosophila Mos1 transposase expressed in fish cells maintains its ability to localize to the nucleus. •The baculoviral vector carrying Mos1 is a useful tool to stably transform fish cells. -- Abstract: Drosophila Mos1 belongs to the mariner family of transposons, which are one of the most ubiquitous transposons among eukaryotes. We first determined nuclear transportation of the Drosophila Mos1-EGFP fusion protein in fish cell lines because it is required for a function of transposons. We next constructed recombinant baculoviral vectors harboring the Drosophila Mos1 transposon or marker genes locatedmore » between Mos1 inverted repeats. The infectivity of the recombinant virus to fish cells was assessed by monitoring the expression of a fluorescent protein encoded in the viral genome. We detected transgene expression in CHSE-214, HINAE, and EPC cells, but not in GF or RTG-2 cells. In the co-infection assay of the Mos1-expressing virus and reporter gene-expressing virus, we successfully transformed CHSE-214 and HINAE cells. These results suggest that the combination of a baculovirus and Mos1 transposable element may be a tool for transgenesis in fish cells.« less
Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells.
Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G; Martin, Francisco
2016-11-17
Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny.
Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells
Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G.; Martin, Francisco
2016-01-01
Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny. PMID:27853296
Green fluorescent protein is lighting up fungal biology
Lorang, J.M.; Tuori, R.P; Martinez, J.P; Sawyer, T.L.; Redman, R.S.; Rollins, J. A.; Wolpert, T.J.; Johnson, K.B.; Rodriguez, R.J.; Dickman, M. B.; Ciuffetti, L.M.
2001-01-01
Expression of gfp in filamentous fungi requires agfp variant that is efficiently translated in fungi, a transformation system, and a fungal promoter that satisfies the requirements of a given experimental objective. Transformation of fungi has recently been reviewed by Gold et al. (26). Robinson and Sharon (44) suggest that GFP can actually be used to optimize transformation protocols. In addition to reporting the construction of a new fungal transformation vector that expressesSGFP under the control of the ToxA gene promoter from Pyrenophora tritici-repentis (12) and demonstrating its use in plant pathogens belonging to eight different genera of filamentous fungi (Fusarium, Botrytis, Pyrenophora, Alternaria, Cochliobolus, Sclerotinia, Colletotrichum, andVerticillium), in this review we also enumerate and describe a comprehensive list of vectors for expressing GFP in fungi.
Bassett, Carole L; Callahan, Ann M; Artlip, Timothy S; Scorza, Ralph; Srinivasan, Chinnathambi
2007-01-01
Background Promoters with tissue-specificity are desirable to drive expression of transgenes in crops to avoid accumulation of foreign proteins in edible tissues/organs. Several photosynthetic promoters have been shown to be strong regulators of expression of transgenes in light-responsive tissues and would be good candidates for leaf and immature fruit tissue-specificity, if expression in the mature fruit were minimized. Results A minimal peach chlorophyll a/b-binding protein gene (Lhcb2*Pp1) promoter (Cab19) was isolated and fused to an uidA (β-glucuronidase [GUS]) gene containing the PIV2 intron. A control vector carrying an enhanced mas35S CaMV promoter fused to uidA was also constructed. Two different orientations of the Cab19::GUS fusion relative to the left T-DNA border of the binary vector were transformed into tomato. Ten independent regenerants of each construct and an untransformed control line were assessed both qualitatively and quantitatively for GUS expression in leaves, fruit and flowers, and quantitatively in roots. Conclusion The minimal CAB19 promoter conferred GUS activity primarily in leaves and green fruit, as well as in response to light. GUS activity in the leaves of both Cab19 constructs averaged about 2/3 that observed with mas35S::GUS controls. Surprisingly, GUS activity in transgenic green fruit was considerably higher than leaves for all promoter constructs; however, in red, ripe fruit activities were much lower for the Cab19 promoter constructs than the mas35S::GUS. Although GUS activity was readily detectable in flowers and roots of mas35S::GUStransgenic plants, little activity was observed in plants carrying the Cab19 promoter constructs. In addition, the light-inducibility of the Cab19::GUS constructs indicated that all the requisite cis-elements for light responsiveness were contained on the Cab19 fragment. The minimal Cab19 promoter retains both tissue-specificity and light regulation and can be used to drive expression of foreign genes with minimal activity in mature, edible fruit. PMID:17697347
Quan, Shuo; Yang, Liming; Abraham, Nader G.; Kappas, Attallah
2001-01-01
Our objective was to determine whether overexpression and underexpression of human heme oxygenase (HHO)-1 could be controlled on a long-term basis by introduction of the HO-1 gene in sense (S) and antisense (AS) orientation with an appropriate vector into endothelial cells. Retroviral vector (LXSN) containing viral long terminal repeat promoter-driven human HO-1 S (LSN-HHO-1) and LXSN vectors containing HHO-1 promoter (HOP)-controlled HHO-1 S and AS (LSN-HOP-HHO-1 and LSN-HOP-HHO-1-AS) sequences were constructed and used to transfect rat lung microvessel endothelial cells (RLMV cells) and human dermal microvessel endothelial cells (HMEC-1 cells). RLMV cells transduced with HHO-1 S expressed human HO-1 mRNA and HO-1 protein associated with elevation in total HO activity compared with nontransduced cells. Vector-mediated expression of HHO-1 S or AS under control of HOP resulted in effective production of HO-1 or blocked induction of endogenous human HO-1 in HMEC-1 cells, respectively. Overexpression of HO-1 AS was associated with a long-term decrease (45%) of endogenous HO-1 protein and an increase (167%) in unmetabolized exogenous heme in HMEC-1 cells. Carbon monoxide (CO) production in HO-1 S- or AS-transduced HMEC-1 cells after heme treatment was increased (159%) or decreased (50%), respectively, compared with nontransduced cells. HO-2 protein levels did not change. These findings demonstrate that HHO-1 S and AS retroviral constructs are functional in enhancing and reducing HO activity, respectively, and thus can be used to regulate cellular heme levels, the activity of heme-dependent enzymes, and the rate of heme catabolism to CO and bilirubin. PMID:11593038
Quan, S; Yang, L; Abraham, N G; Kappas, A
2001-10-09
Our objective was to determine whether overexpression and underexpression of human heme oxygenase (HHO)-1 could be controlled on a long-term basis by introduction of the HO-1 gene in sense (S) and antisense (AS) orientation with an appropriate vector into endothelial cells. Retroviral vector (LXSN) containing viral long terminal repeat promoter-driven human HO-1 S (LSN-HHO-1) and LXSN vectors containing HHO-1 promoter (HOP)-controlled HHO-1 S and AS (LSN-HOP-HHO-1 and LSN-HOP-HHO-1-AS) sequences were constructed and used to transfect rat lung microvessel endothelial cells (RLMV cells) and human dermal microvessel endothelial cells (HMEC-1 cells). RLMV cells transduced with HHO-1 S expressed human HO-1 mRNA and HO-1 protein associated with elevation in total HO activity compared with nontransduced cells. Vector-mediated expression of HHO-1 S or AS under control of HOP resulted in effective production of HO-1 or blocked induction of endogenous human HO-1 in HMEC-1 cells, respectively. Overexpression of HO-1 AS was associated with a long-term decrease (45%) of endogenous HO-1 protein and an increase (167%) in unmetabolized exogenous heme in HMEC-1 cells. Carbon monoxide (CO) production in HO-1 S- or AS-transduced HMEC-1 cells after heme treatment was increased (159%) or decreased (50%), respectively, compared with nontransduced cells. HO-2 protein levels did not change. These findings demonstrate that HHO-1 S and AS retroviral constructs are functional in enhancing and reducing HO activity, respectively, and thus can be used to regulate cellular heme levels, the activity of heme-dependent enzymes, and the rate of heme catabolism to CO and bilirubin.
Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar; Kharazmi, Sara
2018-01-01
It has already been demonstrated that a betasatellite associated with cotton leaf curl Multan virus (CLCuMB) can be used as a plant and animal gene delivery vector to plants. To examine the ability of CLCuMB as a tool to transfer coat protein genes of HIV-1 to plants, two recombinant CLCuMB constructs in which the CLCuMB βC1 ORF was replaced with two HIV-1 genes fractions including a 696 bp DNA fragment related to the HIV-1 p24 gene and a 1501 bp DNA fragment related to the HIV-1 gag gene were constructed. Gag is the HIV-1 coat protein gene and p24 is a component of the particle capsid. Gag and p24 are used for vaccine production. Recombinant constructs were inoculated to Nicotiana glutinosa and N. benthamiana plants in the presence of an Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]) as a helper virus. PCR analysis of inoculated plants indicated that p24 gene was successfully replicated in inoculated plants, but the gag gene was not. Real-time PCR and ELISA analysis of N. glutinosa and N. benthamiana plants containing the replicative forms of recombinant construct of CLCuMB/p24 indicated that p24 was expressed in these plants. This CLCuMB-based expression system offers the possibility of mass production of recombinant HIV-1 p24 protein in plants.
Estornell, Leandro Hueso; Orzáez, Diego; López-Peña, Lucas; Pineda, Benito; Antón, María Teresa; Moreno, Vicente; Granell, Antonio
2009-04-01
A collection of fruit promoters, reporter genes and protein tags has been constructed in a triple-gateway format, a recombination-based cloning system that facilitates the tandem assembly of three DNA fragments into plant expression vectors. The new pENFRUIT collection includes, among others, the classical tomato-ripening promoters E8 and 2A11 and a set of six new tomato promoters. The new promoter activities were characterized in both transient assays and stable transgenic plants. The range of expression of the new promoters comprises strong (PNH, PLI), medium (PLE, PFF, PHD) and weak (PSN) promoters driving gene expression preferentially in the fruit, and covering a wide range of tissues and developmental stages. Together, a total of 78 possible combinations for the expression of a gene of interest in the fruit, plus a set of five reporters for new promoter analysis, was made available in the current collection. Moreover, the pENFRUIT promoter collection is adaptable to hairpin RNA strategies aimed at tissue/organ-specific gene silencing with only an additional cloning step. The pENFRUIT toolkit broadens the spectrum of promoter activities available for fruit biotechnology and fundamental research, and bypasses technical difficulties of current ligase-dependent cloning techniques in the construction of fruit expression cassettes. The pENFRUIT vector collection is available for the research community in a plasmid repository, facilitating its accessibility.
Yang, Xian-Xian; Zhang, Mei; Yan, Zhao-Wen; Zhang, Ru-Hong; Mu, Xiong-Zheng
2008-01-01
To construct a high effective eukaryotic expressing plasmid PcDNA 3.1-MSX-2 encoding Sprague-Dawley rat MSX-2 gene for the further study of MSX-2 gene function. The full length SD rat MSX-2 gene was amplified by PCR, and the full length DNA was inserted in the PMD1 8-T vector. It was isolated by restriction enzyme digest with BamHI and Xhol, then ligated into the cloning site of the PcDNA3.1 expression plasmid. The positive recombinant was identified by PCR analysis, restriction endonudease analysis and sequence analysis. Expression of RNA and protein was detected by RT-PCR and Western blot analysis in PcDNA3.1-MSX-2 transfected HEK293 cells. Sequence analysis and restriction endonudease analysis of PcDNA3.1-MSX-2 demonstrated that the position and size of MSX-2 cDNA insertion were consistent with the design. RT-PCR and Western blot analysis showed specific expression of mRNA and protein of MSX-2 in the transfected HEK293 cells. The high effective eukaryotic expression plasmid PcDNA3.1-MSX-2 encoding Sprague-Dawley Rat MSX-2 gene which is related to craniofacial development can be successfully reconstructed. It may serve as the basis for the further study of MSX-2 gene function.
[Construction of transgenic tobacco expressing popW and analysis of its biological phenotype].
Wang, Cui; Liu, Hongxia; Cao, Jing; Wang, Chao; Guo, Jianhua
2014-04-01
In a previous study, we cloned popW from Ralstonia solanacearum strain ZJ3721, coding PopW, a new harpin protein. The procaryotically expressed PopW can induce resistance to Tobacco mosaic virus (TMV), enhance growth and improve quality of tobacco, when sprayed onto tobacco leaves. Here, we constructed an expression vector pB- popW by cloning popW into the bionary vector pBI121 and transformed it into Agrobacterium tumefaciens strain EHA105 via freeze-thaw method. Tobacco (Nicotiana tobacum cv. Xanthi nc.) transformation was conducted by infection of tobacco leaf discs with recombinant A. tumefaciens. After screening on MS medium containing kanamycin, PCR and RT-PCR analysis, 21 T3 lines were identified as positive transgenic. Genomic intergration and expression of the transferred gene were determined by PCR and RT-PCR. And GUS staining analysis indicated that the protein expressed in transgenic tobacco was bioactive and exhibited different expression levels among lines. Disease bioassays showed that the transgenic tobacco had enhanced resistance to TMV with biocontrol efficiency up to 54.25%. Transgenic tobacco also exhibited enhanced plant growth, the root length of 15 d old seedlings was 1.7 times longer than that of wild type tobacco. 60 d after transplanting to pots, the height, fresh weight and dry weight of transgenic tobacco were 1.4, 1.7, 1.8 times larger than that of wild type tobacco, respectively.
Munir, Shirin; Amaro-Carambot, Emerito; Surman, Sonja; Mackow, Natalie; Yang, Lijuan; Buchholz, Ursula J.; Collins, Peter L.; Schaap-Nutt, Anne
2014-01-01
ABSTRACT A recombinant chimeric bovine/human parainfluenza type 3 virus (rB/HPIV3) vector expressing the respiratory syncytial virus (RSV) fusion F glycoprotein previously exhibited disappointing levels of RSV F immunogenicity and genetic stability in children (D. Bernstein et al., Pediatr. Infect. Dis. J. 31:109–114, 2012; C.-F. Yang et al., Vaccine 31:2822–2827, 2013). To investigate parameters that might affect vaccine performance and stability, we constructed and characterized rB/HPIV3 viruses expressing RSV F from the first (pre-N), second (N-P), third (P-M), and sixth (HN-L) genome positions. There was a 30- to 69-fold gradient in RSV F expression from the first to the sixth position. The inserts moderately attenuated vector replication in vitro and in the upper and lower respiratory tracts of hamsters: this was not influenced by the level of RSV F expression and syncytium formation. Surprisingly, inserts in the second, third, and sixth positions conferred increased temperature sensitivity: this was greatest for the third position and was the most attenuating in vivo. Each rB/HPIV3 vector induced a high titer of neutralizing antibodies in hamsters against RSV and HPIV3. Protection against RSV challenge was greater for position 2 than for position 6. Evaluation of insert stability suggested that RSV F is under selective pressure to be silenced during vector replication in vivo, but this was not exacerbated by a high level of RSV F expression and generally involved a small percentage of recovered vector. Vector passaged in vitro accumulated mutations in the HN open reading frame, causing a dramatic increase in plaque size that may have implications for vaccine production and immunogenicity. IMPORTANCE The research findings presented here will be instrumental for improving the design of a bivalent pediatric vaccine for respiratory syncytial virus and parainfluenza virus type 3, two major causes of severe respiratory tract infection in infants and young children. Moreover, this knowledge has general application to the development and clinical evaluation of other mononegavirus vectors and vaccines. PMID:24478424
NASA Astrophysics Data System (ADS)
Lau, Yun-Fai; Kan, Yuet Wai
1983-09-01
We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.
Fujioka, Takashi; Matsunaga, Naoya; Okazaki, Hiroyuki; Koyanagi, Satoru; Ohdo, Shigehiro
2010-01-01
Hypoxia-induced gene expression frequently occurs in malignant solid tumors because they often have hypoxic areas in which circulation is compromised due to structurally disorganized blood vessels. Hypoxia-response elements (HREs) are responsible for activating gene transcription in response to hypoxia. In this study, we constructed a hypoxia-response plasmid vector producing short hairpin RNA (shRNA) against B-cell leukemia/lymphoma-2 (bcl-2), an anti-apoptotic factor. The hypoxia-response promoter was made by inserting tandem repeats of HREs upstream of cytomegalovirus (CMV) promoter (HRE-CMV). HRE-CMV shbcl-2 vector consisted of bcl-2 shRNA under the control of HRE-CMV promoter. In hypoxic mouse rectum carcinoma cells (colon-26), the production of bcl-2 shRNA driven by HRE-CMV promoter was approximately 2-fold greater than that driven by CMV promoter. A single intratumoral (i.t.) injection of 40 microg HRE-CMV shbcl-2 to colon-26 tumor-bearing mice caused apoptotic cell death, and repetitive treatment with HRE-CMV shbcl-2 (40 microg/mouse, i.t.) also significantly suppressed the growth of colon-26 tumor cells implanted in mice. Apoptotic and anti-tumor effects were not observed in tumor-bearing mice treated with CMV shbcl-2. These results reveal the ability of HRE-CMV shbcl-2 vector to suppress the expression of bcl-2 in hypoxic tumor cells and suggest the usefulness of our constructed hypoxia-response plasmid vector to treat malignant tumors. [Supplementary Figures: available only at http://dx.doi.org/10.1254/jphs.10054FP].
Bahniuk, Markian S; Alshememry, Abdullah K; Unsworth, Larry D
2016-12-01
The protocol described here is designed as an extension of existing techniques for creating elastin-like polypeptides. It allows for the expression and purification of elastin-like polypeptide (ELP) constructs that are poorly expressed or have very low transition temperatures. DNA concatemerization has been modified to reduce issues caused by methylation sensitivity and inefficient cloning. Linearization of the modified expression vector has been altered to greatly increase cleavage efficiency. The purification regimen is based upon using denaturing metal affinity chromatography to fully solubilize and, if necessary, pre-concentrate the target peptide before purification by inverse temperature cycling (ITC). This protocol has been used to express multiple leucine-containing elastin-like polypeptides, with final yields of 250-660 mg per liter of cells, depending on the specific construct. This was considerably greater than previously reported yields for similar ELPs. Due to the relative hydrophobicity of the tested constructs, even compared with commonly employed ELPs, conventional methods would not have been able to be purify these peptides.
Binder, Andreas; Lambert, Jayne; Morbitzer, Robert; Popp, Claudia; Ott, Thomas; Lahaye, Thomas; Parniske, Martin
2014-01-01
The Golden Gate (GG) modular assembly approach offers a standardized, inexpensive and reliable way to ligate multiple DNA fragments in a pre-defined order in a single-tube reaction. We developed a GG based toolkit for the flexible construction of binary plasmids for transgene expression in plants. Starting from a common set of modules, such as promoters, protein tags and transcribed regions of interest, synthetic genes are assembled, which can be further combined to multigene constructs. As an example, we created T-DNA constructs encoding multiple fluorescent proteins targeted to distinct cellular compartments (nucleus, cytosol, plastids) and demonstrated simultaneous expression of all genes in Nicotiana benthamiana, Lotus japonicus and Arabidopsis thaliana. We assembled an RNA interference (RNAi) module for the construction of intron-spliced hairpin RNA constructs and demonstrated silencing of GFP in N. benthamiana. By combination of the silencing construct together with a codon adapted rescue construct into one vector, our system facilitates genetic complementation and thus confirmation of the causative gene responsible for a given RNAi phenotype. As proof of principle, we silenced a destabilized GFP gene (dGFP) and restored GFP fluorescence by expression of a recoded version of dGFP, which was not targeted by the silencing construct. PMID:24551083
Tao, Zhi-Wei; Zou, Ping-An
2018-06-13
Osteosarcoma is a disease prone to recurrence and metastasis, and adenovirus expression vector is frequently studied as a therapeutic target of osteosarcoma in recent year. This study attempts to explore the effect of adenovirus-mediated small interfering RNA (siRNA) targeting ezrin on the proliferation, migration, invasion and apoptosis of human osteosarcoma MG-63 cells. Human osteosarcoma MG-63 cell line was selected for construction of recombinant adenovirus vector. The mRNA and protein levels of ezrin, Bcl2-associated X protein (Bax), B cell lymphoma-2 (Bcl-2), p21, p53, Caspase-3, matrix metalloproteinase 2 (MMP-2) and MMP-9, Cyclin D1, and cyclin-dependent kinase 4a (CDK4a) were determined. Through ELISA, the levels of Caspase-3, MMP-2 and MMP-9 were examined. Finally, human osteosarcoma MG-63 cell viability, growth, invasion, migration, and apoptosis were detected. Initially, adenovirus expression vector of ezrin was constructed by ezrin 2 siRNA sequence. Adenovirus-mediated siRNA targeting ezrin reduced expression of ezrin in MG-63 cells. The results revealed that adenovirus-mediated siRNA targeting ezrin elevated expression levels of Bax, P21, P53, and Caspase-3, Cyclin D1, and CDK4a and reduced expression levels of Bcl-2, MMP-2, and MMP-9. Furthermore, adenovirus-mediated siRNA targeting ezrin inhibited human osteosarcoma MG-63 cell viability, growth, invasion, and migration, and promoted apoptosis. Our study demonstrates that adenovirus-mediated siRNA targeting ezrin can induce apoptosis and inhibit the proliferation, migration and invasion of human osteosarcoma MG-63 cells. ©2018 The Author(s).
Overexpression of SASH1 related to the decreased invasion ability of human glioma U251 cells.
Yang, Liu; Liu, Mei; Gu, Zhikai; Chen, Jianguo; Yan, Yaohua; Li, Jian
2012-12-01
The purpose of this study was to investigate the impact of SAM- and SH3-domain containing 1 (SASH1) on the biological behavior of glioma cells, including its effects on cellular growth, proliferation, apoptosis, invasion, and metastasis, and thereby to provide an experimental basis for future therapeutic treatments. A pcDNA3.1-SASH1 eukaryotic expression vector was constructed and transfected into the U251 human glioma cell line. Using the tetrazolium-based colorimetric (MTT) assay, flow cytometry analyses, transwell invasion chamber experiments, and other methods, we examined the impact of SASH1 on the biological behaviors of U251 cells, including effects on viability, cell cycle, apoptosis, and invasion. Furthermore, the effect of SASH1 on the expression of cyclin D1, caspase-3, matrix metalloproteinase (MMP)-2, MMP-9, and other proteins was observed. Compared to the empty vector and blank control groups, the pcDNA3.1-SASH1 group of U251 cells exhibited significantly reduced cell viability, proliferation, and invasion (p < 0.05), although there was no difference between the empty vector and blank control groups. The pcDNA3.1-SASH1 group demonstrated a significantly higher apoptotic index than did the empty vector and blank control groups (p < 0.05), and the percentage of apoptotic cells was similar between the empty vector and blank control groups. In addition, the pcDNA3.1-SASH1 group expressed significantly lower protein levels of cyclin D1 and MMP-2/9 compared to the control and empty vector groups (p < 0.05) and significantly higher protein levels of caspase-3 than the other two groups (p < 0.05). Cyclin D1, caspase-3, and MMP-2/9 expression was unchanged between the empty vector and blank control groups. SASH1 gene expression might be related to the inhibition of the growth, proliferation, and invasion of U251 cells and the promotion of U251 cells apoptosis.
Roth, Andreas H F J; Dersch, Petra
2010-03-01
A set of different integrative expression vectors for the intracellular production of recombinant proteins with or without affinity tag in Aspergillus niger was developed. Target genes can be expressed under the control of the highly efficient, constitutive pkiA promoter or the novel sucrose-inducible promoter of the beta-fructofuranosidase (sucA) gene of A. niger in the presence or absence of alternative carbon sources. All expression plasmids contain an identical multiple cloning sequence that allows parallel construction of N- or C-terminally His6- and StrepII-tagged versions of the target proteins. Production of two heterologous model proteins, the green fluorescence protein and the Thermobifida fusca hydrolase, proved the functionality of the vector system. Efficient production and easy detection of the target proteins as well as their fast purification by a one-step affinity chromatography, using the His6- or StrepII-tag sequence, was demonstrated.
Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference
Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi
2018-01-01
Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933
Student difficulties regarding symbolic and graphical representations of vector fields
NASA Astrophysics Data System (ADS)
Bollen, Laurens; van Kampen, Paul; Baily, Charles; Kelly, Mossy; De Cock, Mieke
2017-12-01
The ability to switch between various representations is an invaluable problem-solving skill in physics. In addition, research has shown that using multiple representations can greatly enhance a person's understanding of mathematical and physical concepts. This paper describes a study of student difficulties regarding interpreting, constructing, and switching between representations of vector fields, using both qualitative and quantitative methods. We first identified to what extent students are fluent with the use of field vector plots, field line diagrams, and symbolic expressions of vector fields by conducting individual student interviews and analyzing in-class student activities. Based on those findings, we designed the Vector Field Representations test, a free response assessment tool that has been given to 196 second- and third-year physics, mathematics, and engineering students from four different universities. From the obtained results we gained a comprehensive overview of typical errors that students make when switching between vector field representations. In addition, the study allowed us to determine the relative prevalence of the observed difficulties. Although the results varied greatly between institutions, a general trend revealed that many students struggle with vector addition, fail to recognize the field line density as an indication of the magnitude of the field, confuse characteristics of field lines and equipotential lines, and do not choose the appropriate coordinate system when writing out mathematical expressions of vector fields.
Liao, Fang; He, Chao; Liu, Hai-Peng; Song, Qi-Fa; Yan, Jie
2006-11-01
To clone PIB gene of Neisseria gonorrhoeae, and to construct a recombinant eukaryotic expression vector pCI-PIB and to understand the effects of pCI-PIB vaccination in mice to induce specific humoral and cellular immune responses. The entire PIB gene of Neisseria gonorrhoeae (960 bp) was amplified by using PCR. An eukaryotic eukaryotic vector pCI-PIB was then constructed. BALB/c mice (n = 65, 100 microg/time/mouse) were immunized with pCI-PIB by intramuscular injection. ABC assay was employed to examine the PIB expression in muscular cells of the pCI-PIB-immunized mice (n = 10). ELISA and MTT assays were used to measure the effects of humoral and cellular immune responses of the remaining pCI-PIB-immunized mice. By using slide agglutination test and complement bacteriolytic test, the serum anti-bacterial activity of the pCI-PIB immunized mice was determined. The entire PIB gene amplification fragment of the expected size (960 bp) was successfully obtained by PCR. In comparison with the reported PIB gene sequence (GenBank No: AF090801), the homology of nucleotide sequence of the target inserted fragment in the recombinant plasmid pCI-PIB was as high as 99.28%. The muscular cells of the immunized mice could take in pCI-PIB and then express PIB. In the pCI-PIB immunized mice, the higher titer (1:4000) of specific serum IgG and the specific T lymphocyte response were found. The proliferation index (4.031) was significantly higher than that of the controls (1.127) (t = 71.71, P < 0.05). The sera and washings from the pCI-PIB immunized mice could agglutinate Neisseria gonorrhoeae and kill this microbe in presence of complements. In this study we successfully constructed a recombinant eukaryotic expression vector pCI-PIB. The mice inoculated with pCI-PIB might efficiently produce the specific humoral and cellular immune responses, suggesting that pCI-PIB should be potential service as a candidate of Neisseria gonorrhoeae DNA vaccines.
Rothermel, Markus; Brunert, Daniela; Zabawa, Christine; Díaz-Quesada, Marta; Wachowiak, Matt
2013-09-18
Tools enabling the manipulation of well defined neuronal subpopulations are critical for probing complex neuronal networks. Cre recombinase (Cre) mouse driver lines in combination with the Cre-dependent expression of proteins using viral vectors--in particular, recombinant adeno-associated viral vectors (rAAVs)--have emerged as a widely used platform for achieving transgene expression in specified neural populations. However, the ability of rAAVs to further specify neuronal subsets on the basis of their anatomical connectivity has been reported as limited or inconsistent. Here, we systematically tested a variety of widely used neurotropic rAAVs for their ability to mediate retrograde gene transduction in the mouse brain. We tested pseudotyped rAAVs of several common serotypes (rAAV 2/1, 2/5, and 2/9) as well as constructs both with and without Cre-dependent expression switches. Many of the rAAVs tested--in particular, though not exclusively, Cre-dependent vectors--showed a robust capacity for retrograde infection and transgene expression. Retrograde expression was successful over distances as large as 6 mm and in multiple neuron types, including olfactory projection neurons, neocortical pyramidal cells projecting to distinct targets, and corticofugal and modulatory projection neurons. Retrograde infection using transgenes such as ChR2 allowed for optical control or optically assisted electrophysiological identification of neurons defined genetically as well as by their projection target. These results establish a widely accessible tool for achieving combinatorial specificity and stable, long-term transgene expression to isolate precisely defined neuron populations in the intact animal.
Carbonell, Alberto; Fahlgren, Noah; Mitchell, Skyler; ...
2015-05-20
Artificial microRNAs (amiRNAs) are used for selective gene silencing in plants. However, current methods to produce amiRNA constructs for silencing transcripts in monocot species are not suitable for simple, cost-effective and large-scale synthesis. Here, a series of expression vectors based on Oryza sativa MIR390 (OsMIR390) precursor was developed for high-throughput cloning and high expression of amiRNAs in monocots. Four different amiRNA sequences designed to target specifically endogenous genes and expressed from OsMIR390-based vectors were validated in transgenic Brachypodium distachyon plants. Surprisingly, amiRNAs accumulated to higher levels and were processed more accurately when expressed from chimeric OsMIR390-based precursors that include distalmore » stem-loop sequences from Arabidopsis thaliana MIR390a (AtMIR390a). In all cases, transgenic plants displayed the predicted phenotypes induced by target gene repression, and accumulated high levels of amiRNAs and low levels of the corresponding target transcripts. Genome-wide transcriptome profiling combined with 5-RLM-RACE analysis in transgenic plants confirmed that amiRNAs were highly specific. Finally, significance Statement A series of amiRNA vectors based on Oryza sativa MIR390 (OsMIR390) precursor were developed for simple, cost-effective and large-scale synthesis of amiRNA constructs to silence genes in monocots. Unexpectedly, amiRNAs produced from chimeric OsMIR390-based precursors including Arabidopsis thaliana MIR390a distal stem-loop sequences accumulated elevated levels of highly effective and specific amiRNAs in transgenic Brachypodium distachyon plants.« less
Characterization of chicken c-ski oncogene products expressed by retrovirus vectors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sutrave, P.; Copeland, T.D.; Hughes, S.H.
1990-06-01
The authors have constructed replication-competent avian retrovirus vectors that contain two of the three known types of chicken c-{ital ski} cDNAs and a third vector that contains a truncated c-{ital ski} cDNA. They developed antisera that recognize the c-{ital ski} proteins made by the three transforming c-{ital ski} viruses. All three proteins (apparent molecular masses, 50, 60, and 90 kilodaltons) are localized primarily in the nucleus. The proteins are differentially phosphorylated; immunofluorescence also suggests that there are differences in subnuclear localization of the c-{ital ski} proteins and that c-{ital ski} protein is associated with condensed chromatin in dividing cells.
Sreenivasa, B P; Mohapatra, J K; Pauszek, S J; Koster, M; Dhanya, V C; Tamil Selvan, R P; Hosamani, M; Saravanan, P; Basagoudanavar, Suresh H; de Los Santos, T; Venkataramanan, R; Rodriguez, L L; Grubman, M J
2017-05-01
Recombinant adenovirus-5 vectored foot-and-mouth disease constructs (Ad5- FMD) were made for three Indian vaccine virus serotypes O, A and Asia 1. Constructs co-expressing foot-and- mouth disease virus (FMDV) capsid and viral 3C protease sequences, were evaluated for their ability to induce a neutralizing antibody response in indigenous cattle (Bos indicus). Purified Ad5-FMD viruses were inoculated in cattle as monovalent (5×10 9 pfu/animal) or trivalent (5×10 9 pfu/animal per serotype) vaccines. Animals vaccinated with monovalent Ad5-FMD vaccines were boosted 63days later with the same dose. After primary immunization, virus neutralization tests (VNT) showed seroconversion in 83, 67 and 33% of animals vaccinated with Ad5-FMD O, A and Asia 1, respectively. Booster immunization elicited seroconversion in all of the animals (100%) in the monovalent groups. When used in a trivalent form, the Ad5-FMD vaccine induced neutralizing antibodies in only 33, 50 and 16% of animals against serotypes O, A and Asia 1, respectively on primo-vaccination, and titers were significantly lower than when the same vectors were used in monovalent form. Neutralizing antibody titers differed by serotype for both Ad5-FMD monovalent and trivalent vaccines, with Asia 1 serotype inducing the lowest titers. Antibody response to Ad5 vector in immunized cattle was also assessed by VNT. It appeared that the vector immunity did not impact the recall responses to expressed FMDV antigens on booster immunization. In summary, the study suggested that the recombinant Ad5-FMD vaccine has a potential use in monovalent form, while its application in multivalent form is not currently encouraging. Copyright © 2017 Elsevier B.V. All rights reserved.
An efficient strategy for cell-based antibody library selection using an integrated vector system.
Yoon, Hyerim; Song, Jin Myung; Ryu, Chun Jeih; Kim, Yeon-Gu; Lee, Eun Kyo; Kang, Sunghyun; Kim, Sang Jick
2012-09-18
Cell panning of phage-displayed antibody library is a powerful tool for the development of therapeutic and imaging agents since disease-related cell surface proteins in native complex conformation can be directly targeted. Here, we employed a strategy taking advantage of an integrated vector system which allows rapid conversion of scFv-displaying phage into scFv-Fc format for efficient cell-based scFv library selection on a tetraspanin protein, CD9. A mouse scFv library constructed by using a phagemid vector, pDR-D1 was subjected to cell panning against stable CD9 transfectant, and the scFv repertoire from the enriched phage pool was directly transferred to a mammalian cassette vector, pDR-OriP-Fc1. The resulting constructs enabled transient expression of enough amounts of scFv-Fcs in HEK293E cells, and flow cytometric screening of binders for CD9 transfectant could be performed simply by using the culture supernatants. All three clones selected from the screening showed correct CD9-specificity. They could immunoprecipitate CD9 molecules out of the transfectant cell lysate and correctly stain endogenous CD9 expression on cancer cell membrane. Furthermore, competition assay with a known anti-CD9 monoclonal antibody (mAb) suggested that the binding epitopes of some of them overlap with that of the mAb which resides within the large extracellular loop of CD9. This study demonstrates that scFv-Fc from mammalian transient expression can be chosen as a reliable format for rapid screening and validation in cell-based scFv library selection, and the strategy described here will be applicable to efficient discovery of antibodies to diverse cell-surface targets.
[RS-1 enhanced the efficiency of CRISPR-Cas9 mediated knock-in of human lactoferrin].
Zhou, Wenjun; Guo, Rihong; Deng, Mingtian; Wang, Feng; Zhang, Yanli
2017-08-25
This study aims to knock out the goat β-lactoglobulin (BLG) gene using CRISPR-Cas9 system and knock in human lactoferrin (hLF) at the BLG locus, and further study the effect of RAD51 stimulatory compound (RS-1) on homologous recombination efficiency. First, we designed an sgRNA targeting the first exon of goat BLG gene and constructed a co-expression vector pCas9-sgBLG. This sgRNA vector was then transfected into goat ear fibroblasts (GEFs), and the target region was examined by T7EN1 assay and sequencing. Second, we constructed a targeting vector pBHA-hLF-NIE including NEO and EGFP genes based on BLG gene locus. This targeting vector together with pCas9-sgBLG expression vector was co-transfected into GEFs. Transfected cells were then treated with 0, 5, 10 and 20 μmol/L RS-1 for 72 h to analyse the EGFP expression efficiency. Next, we used 800 μg/mL G418 to screen G418-resistent cell clones, and studied hLF site-specific knock-in cell clones by PCR and sequencing. The editing efficiency of sgBLG was between 25% and 31%. The EGFP expression efficiency indicated that the gene knock-in efficiency was improved by RS-1 in a dose-dependent manner, which could reach 3.5-fold compared to the control group. The percentage of positive cells with hLF knock-in was increased to 32.61% when 10 μmol/L RS-1 was used. However, when the concentration of RS-1 increased to 20 μmol/L, the percentage of positive cells decreased to 22.22% and resulted in an increase of senescent cell clone number. These results suggested that hLF knock-in and BLG knock-out in GEFs were achieved by using CRISPR/Cas9 system, and optimum concentration of RS-1 could improve knock-in efficiency, which provides a reference for efficiently obtaining gene knock-in cells using CRISPR/Cas9 in the future.
Santangeloyz, K.S.; Bertoneyz, A.L.
2011-01-01
summary Objective To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Methods Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RTPCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2−ΔΔCT) method. Results Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P= 0.0045) or >90% (P= 0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Conclusions Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. PMID:21945742
Nambiar, P. T. C.; Ma, S.-W.; Iyer, V. N.
1990-01-01
A region of DNA which determined the production of the insecticidal toxin of Bacillus thuringiensis subsp. israelensis was cloned into a derivative of a broad-host-range group IncQ plasmid vector of gram-negative bacteria. The plasmid which we constructed was transferred by conjugative mobilization into a Bradyrhizobium species that nodulates pigeon peas. In this species the construction was maintained stably in the absence of selection and expressed the gene that was installed. Experiments in a greenhouse with the strain which we constructed indicated that this organism provides protection against root nodule damage by the larvae of the insect Rivellia angulata (Diptera). Images PMID:16348294
Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam
2014-08-05
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam Huu
2015-11-24
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
Szczesny, Roman J.; Kowalska, Katarzyna; Klosowska-Kosicka, Kamila; Chlebowski, Aleksander; Owczarek, Ewelina P.; Warkocki, Zbigniew; Kulinski, Tomasz M.; Adamska, Dorota; Affek, Kamila; Jedroszkowiak, Agata; Kotrys, Anna V.; Tomecki, Rafal; Krawczyk, Pawel S.; Borowski, Lukasz S.; Dziembowski, Andrzej
2018-01-01
Deciphering a function of a given protein requires investigating various biological aspects. Usually, the protein of interest is expressed with a fusion tag that aids or allows subsequent analyses. Additionally, downregulation or inactivation of the studied gene enables functional studies. Development of the CRISPR/Cas9 methodology opened many possibilities but in many cases it is restricted to non-essential genes. Recombinase-dependent gene integration methods, like the Flp-In system, are very good alternatives. The system is widely used in different research areas, which calls for the existence of compatible vectors and efficient protocols that ensure straightforward DNA cloning and generation of stable cell lines. We have created and validated a robust series of 52 vectors for streamlined generation of stable mammalian cell lines using the FLP recombinase-based methodology. Using the sequence-independent DNA cloning method all constructs for a given coding-sequence can be made with just three universal PCR primers. Our collection allows tetracycline-inducible expression of proteins with various tags suitable for protein localization, FRET, bimolecular fluorescence complementation (BiFC), protein dynamics studies (FRAP), co-immunoprecipitation, the RNA tethering assay and cell sorting. Some of the vectors contain a bidirectional promoter for concomitant expression of miRNA and mRNA, so that a gene can be silenced and its product replaced by a mutated miRNA-insensitive version. Our toolkit and protocols have allowed us to create more than 500 constructs with ease. We demonstrate the efficacy of our vectors by creating stable cell lines with various tagged proteins (numatrin, fibrillarin, coilin, centrin, THOC5, PCNA). We have analysed transgene expression over time to provide a guideline for future experiments and compared the effectiveness of commonly used inducers for tetracycline-responsive promoters. As proof of concept we examined the role of the exoribonuclease XRN2 in transcription termination by RNAseq. PMID:29590189
Andargie, Mebeaselassie; Yang, Chao; Li, Jianxiong
2016-12-01
An Agrobacterium-mediated genetic transformation system for the rice false smut fungus Ustilaginoidea virens was developed using conidia as recipients. A binary vector, pCAMBIA1301-P gpdA -GUS-T trpC , was constructed. The gpdA promoter (P gpdA ) from Aspergillus nidulans was used to drive the expression of the β-glucuronidase (GUS) gene which enabled GUS activity visualization. The conidia transformation efficiency reached approximately 110 to 250 transformants per 1×10 5 conidia. Based on the analysis made on five successive generations of subcultures and PCR, the pCAMBIA1301-GUS cassette had integrated into the genomes of all transformants and clearly showed mitotic stability. The novel reporter vector constructed will promote the functional characterization of genes and the construction of genetically engineered strains of this important fungus. Copyright © 2016 Elsevier B.V. All rights reserved.
Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-12-20
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.
Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra
2014-09-30
The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.
Mehlmer, Norbert; Parvin, Nargis; Hurst, Charlotte H.; Knight, Marc R.; Teige, Markus; Vothknecht, Ute C.
2014-01-01
Calcium has long been acknowledged as one of the most important signalling components in plants. Many abiotic and biotic stimuli are transduced into a cellular response by temporal and spatial changes in cellular calcium concentration and the calcium-sensitive protein aequorin has been exploited as a genetically encoded calcium indicator for the measurement of calcium in planta. The objective of this work was to generate a compatible set of aequorin expression plasmids for the generation of transgenic plant lines to measure changes in calcium levels in different cellular subcompartments. Aequorin was fused to different targeting peptides or organellar proteins as a means to localize it to the cytosol, the nucleus, the plasma membrane, and the mitochondria. Furthermore, constructs were designed to localize aequorin in the stroma as well as the inner and outer surface of the chloroplast envelope membranes. The modular set-up of the plasmids also allows the easy replacement of targeting sequences to include other compartments. An additional YFP-fusion was included to verify the correct subcellular localization of all constructs by laser scanning confocal microscopy. For each construct, pBin19-based binary expression vectors driven by the 35S or UBI10 promoter were made for Agrobacterium-mediated transformation. Stable Arabidopsis lines were generated and initial tests of several lines confirmed their feasibility to measure calcium signals in vivo. PMID:22213817
Cloning-independent plasmid construction for genetic studies in streptococci
Xie, Zhoujie; Qi, Fengxia; Merritt, Justin
2013-01-01
Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in E. coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5×103 – 2×105 CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli – Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. PMID:23673081
Cloning-independent plasmid construction for genetic studies in streptococci.
Xie, Zhoujie; Qi, Fengxia; Merritt, Justin
2013-08-01
Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in Escherichia coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5 × 10³ to 2 × 10⁵ CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli-Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. Copyright © 2013 Elsevier B.V. All rights reserved.
Terrón-González, L; Medina, C; Limón-Mortés, M C; Santero, E
2013-01-01
The extraordinary potential of metagenomic functional analyses to identify activities of interest present in uncultured microorganisms has been limited by reduced gene expression in surrogate hosts. We have developed vectors and specialized E. coli strains as improved metagenomic DNA heterologous expression systems, taking advantage of viral components that prevent transcription termination at metagenomic terminators. One of the systems uses the phage T7 RNA-polymerase to drive metagenomic gene expression, while the other approach uses the lambda phage transcription anti-termination protein N to limit transcription termination. A metagenomic library was constructed and functionally screened to identify genes conferring carbenicillin resistance to E. coli. The use of these enhanced expression systems resulted in a 6-fold increase in the frequency of carbenicillin resistant clones. Subcloning and sequence analysis showed that, besides β-lactamases, efflux pumps are not only able contribute to carbenicillin resistance but may in fact be sufficient by themselves to convey carbenicillin resistance.
Development of Plant Gene Vectors for Tissue-Specific Expression Using GFP as a Reporter Gene
NASA Technical Reports Server (NTRS)
Jackson, Jacquelyn; Egnin, Marceline; Xue, Qi-Han; Prakash, C. S.
1997-01-01
Reporter genes are widely employed in plant molecular biology research to analyze gene expression and to identify promoters. Gus (UidA) is currently the most popular reporter gene but its detection requires a destructive assay. The use of jellyfish green fluorescent protein (GFP) gene from Aequorea Victoria holds promise for noninvasive detection of in vivo gene expression. To study how various plant promoters are expressed in sweet potato (Ipomoea batatas), we are transcriptionally fusing the intron-modified (mGFP) or synthetic (modified for codon-usage) GFP coding regions to these promoters: double cauliflower mosaic virus 35S (CaMV 35S) with AMV translational enhancer, ubiquitin7-intron-ubiquitin coding region (ubi7-intron-UQ) and sporaminA. A few of these vectors have been constructed and introduced into E. coli DH5a and Agrobacterium tumefaciens EHA105. Transient expression studies are underway using protoplast-electroporation and particle bombardment of leaf tissues.
Designing a Soluble Near Full-Length HIV-1 GP41 Trimer
2012-11-26
envelope; gp41 trimer; bacteriophage T4 display; prehairpin fusion intermediate. Background: The envelope glycoprotein gp41 is a key component of...protein into trimers and defined oligomers. These gp41 trimers were displayed on bacteriophage T4 capsid nanoparticles by attaching to the small...Construction of the Expression Vectors —All the gp41 constructs were generated by splicing-by- overlap extension PCR using wild-type HXB2 gp41 DNA
Expression of human argininosuccinate synthetase after retroviral-mediated gene transfer.
Wood, P A; Partridge, C A; O'Brien, W E; Beaudet, A L
1986-09-01
The cDNA sequence for human argininosuccinate synthetase (AS) was introduced into plasmid expression vectors with an SV40 promoter or Rous sarcoma virus promoter to construct pSV2-AS and pRSV-AS, respectively, and human enzyme was synthesized after gene transfer into Chinese hamster cells. The functional cDNA was inserted into the retroviral vectors pZIP-NeoSV(X) and pZIP-NeoSV(B). Ecotropic AS retrovirus was produced after calcium-phosphate-mediated gene transfer of these constructions into the packaging cell line psi-2, and viral titers up to 10(5) CFU/ml were obtained. Recombinant AS retrovirus was evaluated by detecting G-418-resistant colonies after infection of the rodent cells, XC, NRK, and 3T3. Colonies were also obtained when infected XC cells were selected in citrulline medium for expression of AS activity. Southern blot analysis of infected cells demonstrated that the recombinant retroviral genome was not altered grossly after infecting some rodent cells, while other cells showed evidence of rearrangement. A rapid assay for detecting AS retrovirus was developed based on the incorporation of [14C]citrulline into protein by intact 3T3 cells or XC cells.
Construction of baculovirus expression vector of miRNAs and its expression in insect cells.
Huang, Yong; Zou, Quan; Shen, Xing Jia; Yu, Xue Li; Wang, Zhan Bin; Cheng, Xiang Chao
2012-01-01
MicroRNAs (miRNAs) are endogenous small non-protein coding RNAs that play important regulatory roles in animals and plants by binding to target transcripts for cleavage or translational repression. The miR-9a is very conservative in animals from flies to humans. Studies indicated that miR-9a is involved in the regulation of neurogenesis in animals. In our study, the baculovirus expression system was used to transcribe a recombinant vector containing miR-9a for further analysis the function ofmiR-9a. The sequence ofpre-miR-9a from silkworm DNA was first cloned into the donor pFastBac. The enhanced green fluorescent protein (EGFP) was used as reporter gene. The recombinant donor plasmid pFastBac-miR-9a was transformed into E.coli DH10Bac/AcNPV forming Bacmid-9a which was transfected into insect cells with cational lipofectin. The transcription of mature miR-9a was detected by Real-time PCR. The results show the recombinant Bacmid-9a was successfully constructed and effectively transcribed miR-9a in infected Sf21 insect cells.
[Cloning and gene expression in lactic acid bacteria].
Bondarenko, V M; Beliavskaia, V A
2000-01-01
The possibility of using the genera Lactobacillus and Lactococcus as vector representatives is widely discussed at present. The prospects of the construction of recombinant bacteria are closely connected with the solution of a number of problems: the level of the transcription of cloned genes, the effectiveness of the translation of heterologous mRNA, the stability of protein with respect to bacterial intracellular proteases, the method by protein molecules leave the cell (by secretion or as the result of lysis). To prevent segregation instability, the construction of vector molecules on the basis of stable cryptic plasmids found in wild strains of lactic acid bacteria was proposed. High copying plasmids with low molecular weight were detected in L. plantarum and L. pentosus strains. Several plasmids with molecular weights of 1.7, 1.8 and 2.3 kb were isolated from bacterial cells to be used as the basis for the construction of vector molecules. Genes of chloramphenicol- and erythromycin-resistance from Staphylococcus aureus plasmids were used as marker genes ensuring cell transformation. The vector plasmids thus constructed exhibited high transformation activity in the electroporation of different strains, including L. casei, L. plantarum, L. acidophilus, L. fermentum and L. brevis which could be classified with the replicons of a wide circle of hosts. But the use of these plasmids was limited due to the risk of the uncontrolled dissemination of recombinant plasmids. L. acidophilus were also found to have strictly specific plasmids with good prospects of being used as the basis for the creation of vectors, incapable of dissemination. In addition to the search of strain-specific plasmids, incapable of uncontrolled gene transmission, the use of chromosome-integrated heterologous genes is recommended in cloning to ensure the maximum safety.
Rosenberg, Jonathan B; Hicks, Martin J; De, Bishnu P; Pagovich, Odelya; Frenk, Esther; Janda, Kim D; Wee, Sunmee; Koob, George F; Hackett, Neil R; Kaminsky, Stephen M; Worgall, Stefan; Tignor, Nicole; Mezey, Jason G; Crystal, Ronald G
2012-05-01
Cocaine addiction is a major problem affecting all societal and economic classes for which there is no effective therapy. We hypothesized an effective anti-cocaine vaccine could be developed by using an adeno-associated virus (AAV) gene transfer vector as the delivery vehicle to persistently express an anti-cocaine monoclonal antibody in vivo, which would sequester cocaine in the blood, preventing access to cognate receptors in the brain. To accomplish this, we constructed AAVrh.10antiCoc.Mab, an AAVrh.10 gene transfer vector expressing the heavy and light chains of the high affinity anti-cocaine monoclonal antibody GNC92H2. Intravenous administration of AAVrh.10antiCoc.Mab to mice mediated high, persistent serum levels of high-affinity, cocaine-specific antibodies that sequestered intravenously administered cocaine in the blood. With repeated intravenous cocaine challenge, naive mice exhibited hyperactivity, while the AAVrh.10antiCoc.Mab-vaccinated mice were completely resistant to the cocaine. These observations demonstrate a novel strategy for cocaine addiction by requiring only a single administration of an AAV vector mediating persistent, systemic anti-cocaine passive immunity.
Kamencayová, M; Košík, I; Hunková, J; Subr, Z W
2014-01-01
PB1-F2 protein of influenza A virus (IAV) was cloned in a plum pox virus (PPV) genome-based vector and attempts to express it in biolistically transfected Nicotiana benthamiana plants were performed. The vector-insert construct replicated in infected plants properly and was stable during repeated passage by mechanical inoculation, as demonstrated by disease symptoms and immunoblot detection of PPV capsid protein, while PB1-F2-specific band was more faint. We showed that it was due its low solubility. Modification of sample preparation (denaturation/solubilization preceding the centrifugation of cell debris) led to substantial signal enhancement. Maximal level of PB1-F2 expression in plants was observed 12 days post inoculation (dpi). Only 1% SDS properly solubilized the protein, other detergents were much less efficient. Solubilization with 8M urea released approximately 50% of PB1-F2 from the plant tissues, thus the treatment with this removable chaotropic agent may be a good starting point for the purification of the protein for eventual functional studies in the future.
Lunina, Natalia A; Agafonova, Elena V; Chekanovskaya, Lyudmila A; Dvortsov, Igor A; Berezina, Oksana V; Shedova, Ekaterina N; Kostrov, Sergey V; Velikodvorskaya, Galina A
2007-07-01
A cluster of Thermotoga neapolitana genes participating in starch degradation includes the malG gene of sugar transport protein and the aglB gene of cyclomaltodextrinase. The start and stop codons of these genes share a common overlapping sequence, aTGAtg. Here, we compared properties of expression products of three different constructs with aglB from T. neapolitana. The first expression vector contained the aglB gene linked to an upstream 90-bp 3'-terminal region of the malG gene with the stop codon overlapping with the start codon of aglB. The second construct included the isolated coding sequence of aglB with two tandem potential start codons. The expression product of this construct in Escherichia coli had two tandem Met residues at its N terminus and was characterized by low thermostability and high tendency to aggregate. In contrast, co-expression of aglB and the 3'-terminal region of malG (the first construct) resulted in AglB with only one N-terminal Met residue and a much higher specific activity of cyclomaltodextrinase. Moreover, the enzyme expressed by such a construct was more thermostable and less prone to aggregation. The third construct was the same as the second one except that it contained only one ATG start codon. The product of its expression had kinetic and other properties similar to those of the enzyme with only one N-terminal Met residue.
Feng, Yong-qian; Zha, Xiao-jun; Zhai, Chao-yang
2007-07-01
To construct the eucaryotic recombinant plasmid of pYES2/LactoferricinB expressing in yeast of S. cerevisiae, of which the expressed protein antibacterial activity was verified in preliminary. By self-template PCR method, the gene of Lactoferricin B and its several sequence mutations were amplified with the parts of the pre-synthesized single chains. And then Lactoferricin B gene and its mutants were cloned into the vector of pYES2 to construct the recombined expression plasmid pYES2/Lactoferricin B etc. extracted and used to transform the yeast S. cerevisiae. The expressions of proteins were determined after induced by galactose. The expression proteins were collected and purified by hydronium-exchange column, and the bacterial inhibited test was applied to identify the protein antibacterial activities. The PCR amplifying and DNA sequencing tests indicated that the purpose plasmid contained the Lactoferricin B gene and several mutations. The induced target proteins were confirmed by SDS-PAGE electrophoresis and mass spectrum test. The protein antibacterial activities of mutations were verified in preliminary. The recombined plasmid pYES2/Lactoferricin B etc. are successfully constructed and induced to express in yeast cell of S. cerevisiae; the obtained recombined protein of Lactoferricin B provides a basis for further research work on the biological function and antibacterial activity.
Liu, Xiang; Liang, Bo; Ngwuta, Joan; Liu, Xueqiao; Surman, Sonja; Lingemann, Matthias; Kwong, Peter D.; Graham, Barney S.; Collins, Peter L.
2017-01-01
ABSTRACT Human respiratory syncytial virus (RSV) is the most prevalent worldwide cause of severe respiratory tract infection in infants and young children. Human parainfluenza virus type 1 (HPIV1) also causes severe pediatric respiratory illness, especially croup. Both viruses lack vaccines. Here, we describe the preclinical development of a bivalent RSV/HPIV1 vaccine based on a recombinant HPIV1 vector, attenuated by a stabilized mutation, that expresses RSV F protein modified for increased stability in the prefusion (pre-F) conformation by previously described disulfide bond (DS) and hydrophobic cavity-filling (Cav1) mutations. RSV F was expressed from the first or second gene position as the full-length protein or as a chimeric protein with its transmembrane and cytoplasmic tail (TMCT) domains substituted with those of HPIV1 F in an effort to direct packaging in the vector particles. All constructs were recovered by reverse genetics. The TMCT versions of RSV F were packaged in the rHPIV1 particles much more efficiently than their full-length counterparts. In hamsters, the presence of the RSV F gene, and in particular the TMCT versions, was attenuating and resulted in reduced immunogenicity. However, the vector expressing full-length RSV F from the pre-N position was immunogenic for RSV and HPIV1. It conferred complement-independent high-quality RSV-neutralizing antibodies at titers similar to those of wild-type RSV and provided protection against RSV challenge. The vectors exhibited stable RSV F expression in vitro and in vivo. In conclusion, an attenuated rHPIV1 vector expressing a pre-F-stabilized form of RSV F demonstrated promising immunogenicity and should be further developed as an intranasal pediatric vaccine. IMPORTANCE RSV and HPIV1 are major viral causes of acute pediatric respiratory illness for which no vaccines or suitable antiviral drugs are available. The RSV F glycoprotein is the major RSV neutralization antigen. We used a rHPIV1 vector, bearing a stabilized attenuating mutation, to express the RSV F glycoprotein bearing amino acid substitutions that increase its stability in the pre-F form, the most immunogenic form that elicits highly functional virus-neutralizing antibodies. RSV F was expressed from the pre-N or N-P gene position of the rHPIV1 vector as a full-length protein or as a chimeric form with its TMCT domain derived from HPIV1 F. TMCT modification greatly increased packaging of RSV F into the vector particles but also increased vector attenuation in vivo, resulting in reduced immunogenicity. In contrast, full-length RSV F expressed from the pre-N position was immunogenic, eliciting complement-independent RSV-neutralizing antibodies and providing protection against RSV challenge. PMID:28835504
Immunogenicity of ORFV-based vectors expressing the rabies virus glycoprotein in livestock species.
Martins, Mathias; Joshi, Lok R; Rodrigues, Fernando S; Anziliero, Deniz; Frandoloso, Rafael; Kutish, Gerald F; Rock, Daniel L; Weiblen, Rudi; Flores, Eduardo F; Diel, Diego G
2017-11-01
The parapoxvirus Orf virus (ORFV) encodes several immunomodulatory proteins (IMPs) that modulate host-innate and pro-inflammatory responses and has been proposed as a vaccine delivery vector for use in animal species. Here we describe the construction and characterization of two recombinant ORFV vectors expressing the rabies virus (RABV) glycoprotein (G). The RABV-G gene was inserted in the ORFV024 or ORFV121 gene loci, which encode for IMPs that are unique to parapoxviruses and inhibit activation of the NF-κB signaling pathway. The immunogenicity of the resultant recombinant viruses (ORFV ∆024 RABV-G or ORFV ∆121 RABV-G, respectively) was evaluated in pigs and cattle. Immunization of the target species with ORFV ∆024 RABV-G and ORFV ∆121 RABV-G elicited robust neutralizing antibody responses against RABV. Notably, neutralizing antibody titers induced in ORFV ∆121 RABV-G-immunized pigs and cattle were significantly higher than those detected in ORFV ∆024 RABV-G-immunized animals, indicating a higher immunogenicity of ORFV Δ121 -based vectors in these animal species. Copyright © 2017 Elsevier Inc. All rights reserved.
Bhattarai, Shanta Raj; Kim, Sun Young; Jang, Kyu Yun; Lee, Ki Chang; Yi, Ho Keun; Lee, Dae Yeol; Kim, Hak Yong; Hwang, Pyoung Han
2008-02-01
One factor critical to successful gene therapy is the development of efficient delivery systems. Although advances in gene transfer technology including viral and non-viral vectors have been made, an ideal vector system has not yet been constructed. Due to the growing concerns over the toxicity and immunogenicity of viral DNA delivery systems, DNA delivery via improve viral routes has become more desirable and advantageous. The ideal improve viral DNA delivery system should be a synthetic materials plus viral vectors. The materials should also be biocompatible, efficient, and modular so that it is tunable to various applications in both research and clinical settings. The successful steps towards this improve viral DNA delivery system is demonstrated: a magnetofection system mediated by modified cationic chitosan-coated iron oxide nanoparticles. Dense colloidal cationic iron oxide nanoparticles serve as an uptake-enhancing component by physical concentration at the cell surface in presence of external magnetic fields; enhanced viral gene expression (3-100-fold) due to the particles is seen as compared to virus vector alone with little virus dose.
Inglis, Peter W.; Queiroz, Paulo R.; Valadares-Inglis, M. Cléria
1999-04-01
A plasmid vector for fungal expression of an enhanced, red-shifted variant of the Aequoria victoriae green fluorescent protein was constructed by fusion of the EGFP gene to the highly expressed Aspergillus nidulans gpd promoter and the A. nidulans trpC terminator. This construction was introduced by cotransformation, using benomyl selection, into Trichoderma harzianum strain 1051, a strain being evaluated for the biological control of witches'-broom disease of cocoa caused by Crinipellis perniciosa. Epifluorescence microscopy was used to monitor germination and attachment of stable transformant conidia on the surface of C. perniciosa hyphae.
Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P
1998-07-01
By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.
Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P
1998-11-01
By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.
Wang, Longxin; Dong, Jie; Wei, Ming; Wen, Weihong; Gao, Jianping; Zhang, Zhengyu; Qin, Weijun
2016-03-01
The present study was carried out to evaluate the specific and amplified β-glucuronidase (βG) expression in prostate cancer cells by using a prostate‑specific antigen (PSA) promoter-controlled bicistronic adenovirus and to evaluate the specific killing of prostate cancer cells after the application of the prodrug DOX‑GA3. Bicistronic adenoviral expression vectors were constructed, and the effectiveness of specific and amplified expression was evaluated using luciferase and EGFP as reporter genes. βG expression was detected in LNCaP cells after they were infected with the βG‑expressing PSA promoter-controlled bicistronic adenovirus. MTT assays were conducted to evaluate the cytoxicity on the infected cells after the application of the prodrug DOX‑GA3. Tumor growth inhibition was also evaluated in nude mice after treatment with the βG‑expressing adenovirus and DOX‑GA3. Selective and amplified expression was observed in the PSA-producing LNCaP cells, but not in the PSA‑non‑producing DU145 cells. Potent cytotoxity and a strong bystander effect were observed in the LNCaP cells after infection with the βG‑expressing adenovirus and the application of DOX‑GA3. Intravenous injection of a GAL4 regulated bicistronic adenovirus vector constructed to express βG under the control of the PSA promoter (Ad/PSAP‑GV16‑βG) and the application of DOX‑GA3 strongly inhibited tumor growth and prolonged the survival time of tumor‑bearing nude mice. Selective and amplified βG expression together with the prodrug DOX‑GA3 had an increased antitumor effect, showing great potential for prostate cancer therapy.
Miyata, Luzia Yuriko; Harakava, Ricardo; Stipp, Liliane Cristina Libório; Mendes, Beatriz Madalena Januzzi; Appezzato-da-Glória, Beatriz; de Assis Alves Mourão Filho, Francisco
2012-11-01
Huanglongbing (HLB) is associated with Candidatus Liberibacter spp., endogenous, sieve tube-restricted bacteria that are transmitted by citrus psyllid insect vectors. Transgenic expression in the phloem of specific genes that might affect Ca. Liberibacter spp. growth and development may be an adequate strategy to improve citrus resistance to HLB. To study specific phloem gene expression in citrus, we developed three different binary vector constructs with expression cassettes bearing the β-glucuronidase (GUS) reporter gene (uidA) under the control of one of the three different promoters: Citrus phloem protein 2 (CsPP2), Arabidopsis thaliana phloem protein 2 (AtPP2), and Arabidopsis thaliana sucrose transporter 2 (AtSUC2). Transgenic lines of 'Hamlin', 'Pera', and 'Valencia' sweet oranges [Citrus sinensis (L.) Osbeck] were produced via Agrobacterium tumefaciens transformation. The epicotyl segments collected from in vitro germinated seedlings were used as explants. The gene nptII, which confers resistance to the antibiotic kanamycin, was used for selection. The transformation efficiency was expressed as the number of GUS-positive shoots over the total number of explants and varied from 1.54 to 6.08 % among the three cultivars and three constructs studied. Several lines of the three sweet orange cultivars analyzed using PCR and Southern blot analysis were genetically transformed with the three constructs evaluated. The histological GUS activity in the leaves indicates that the uidA gene was preferentially expressed in the phloem, which suggests that the use of the three promoters might be adequate for producing HLB-resistant transgenic sweet oranges. The results reported here conclusively demonstrate the preferential expression of GUS in the phloem driven by two heterologous and one homologous gene promoters. Key message The results reported here conclusively demonstrate the preferential expression of GUS in the phloem driven by two heterologous and one homologous gene promoters.
Rocke, Tonie E.; Kingstad-Bakke, Brock; Berlier, Willy; Osorio, Jorge E.
2014-01-01
In previous studies, we demonstrated in mice and prairie dogs that simultaneous administration of two recombinant raccoon poxviruses (rRCN) expressing Yersinia pestis antigens (F1 and V307—a truncated version of the V protein) provided superior protection against plague challenge compared to individual single antigen constructs. To reduce costs of vaccine production and facilitate implementation of a sylvatic plague vaccine (SPV) control program for prairie dogs, a dual antigen construct is more desirable. Here we report the construction and characterization of a novel RCN-vectored vaccine that simultaneously expresses both F1 and V307 antigens. This dual antigen vaccine provided similar levels of protection against plague in both mice and prairie dogs as compared to simultaneous administration of the two single antigen constructs and was also shown to protect mice against an F1 negative strain of Y. pestis. The equivalent safety, immunogenicity and efficacy profile of the dual RCN-F1/V307 construct warrants further evaluation in field efficacy studies in sylvatic plague endemic areas. PMID:26344891
Rocke, Tonie E.; Kingstad-Bakke, B; Berlier, W; Osorio, J.E.
2014-01-01
In previous studies, we demonstrated in mice and prairie dogs that simultaneous administration of two recombinant raccoon poxviruses (rRCN) expressing Yersinia pestis antigens (F1 and V307-a truncated version of the V protein) provided superior protection against plague challenge compared to individual single antigen constructs. To reduce costs of vaccine production and facilitate implementation of a sylvatic plague vaccine (SPV) control program for prairie dogs, a dual antigen construct is more desirable. Here we report the construction and characterization of a novel RCN-vectored vaccine that simultaneously expresses both F1 and V307 antigens. This dual antigen vaccine provided similar levels of protection against plague in both mice and prairie dogs as compared to simultaneous administration of the two single antigen constructs and was also shown to protect mice against an F1 negative strain of Y. pestis.. The equivalent safety, immunogenicity and efficacy profile of the dual RCN-F1/V307 construct warrants further evaluation in field efficacy studies in sylvatic plague endemic areas.
Li, Hui; Li, Rong; Zhong, Sen; Ren, Hong; Deng, Cun-liang; Shi, Xiao-ling; Wang, Ming-yong
2006-04-01
To construct and express a chimeric Mtb8.4 with signal peptide (MS)/hIL12 eukaryotic expression plasmid, and to study the immunogenicity of the MS/hIL-12 chimeric genetic vaccines. The MS/hIL-12 chimeric gene was amplified by polymerase chain reaction (PCR) and cloned into the eukaryotic expression vector pCI-neo. The correct pCI-neo-MS/hIL12 (pMSI) recombinant plasmid was identified by PCR, restricted enzyme digestion and DNA sequencing. COS-7 cells were transfected with pMSI constructs by cationic liposome. After 48 hours, mRNA of the target gene was detected by RT-PCR, and hIL-12 protein in culture supernatant and cell lysates was detected by Western blot. C57BL/6N mice were vaccinated with MS/hIL-12 chimeric gene vaccine for three times at 3 week intervals. Four weeks after the final inoculation, three mice were sacrificed for measurement of the cytokine response and cytotoxic T lymphocyte (CTL) induction. The accuracy of plasmid construction was confirmed by a number of molecular biological techniques. Transfection of COS-7 cells with plasmids pMSI lead to transient expression of fusion proteins. The IFN-gamma and IL-2 titers were (1,521 +/- 48) ng/L and (755 +/- 41) ng/L in MS/hIL-12 chimeric gene vaccine group, (820 +/- 50) ng/L and (297 +/- 31) ng/L in MS gene vaccine group, (1,487 +/- 40) ng/L and (767 +/- 50) ng/L in BCG group, (121 +/- 16) ng/L and (62 +/- 10) ng/L in vacant vector group, and (48 +/- 16) ng/L and (32 +/- 17) ng/L in PBS group respectively. The levels of IFN-gamma and IL-2 in MS/hIL-12 chimeric gene vaccine group were higher than those of MS gene vaccine group, vacant vector group and PBS group (P < 0.01) and was similar to the BCG group (P > 0.05). The level of IL-4 in BCG group [(91 +/- 11) ng/L] increased significantly as compared to other groups (P < 0.01). When effector-cell-to-target-cell ratio (E:T ratio) were 100:1, 50:1, and 10:1 respectively, the CTL activity was 77.5%, 51.2%, 30.3% in MS/hIL-12 chimeric gene vaccine group, 56.2%, 37.8%, 11.5% in MS gene vaccine group, 28.9%, 21.4%, 9.8% in BCG group. The cytotoxicity in MS/hIL-12 chimeric gene vaccine group was higher than that of other groups (P < 0.01). When used to construct the chimeric gene vaccine, hIL-12 could improve the immunogenicity of MS gene vaccine.
All-in-One CRISPR-Cas9/FokI-dCas9 Vector-Mediated Multiplex Genome Engineering in Cultured Cells.
Sakuma, Tetsushi; Sakamoto, Takuya; Yamamoto, Takashi
2017-01-01
CRISPR-Cas9 enables highly convenient multiplex genome engineering in cultured cells, because it utilizes generic Cas9 nuclease and an easily customizable single-guide RNA (sgRNA) for site-specific DNA double-strand break induction. We previously established a multiplex CRISPR-Cas9 assembly system for constructing an all-in-one vector simultaneously expressing multiple sgRNAs and Cas9 nuclease or other Cas9 variants including FokI-dCas9, which supersedes the wild-type Cas9 with regard to high specificity. In this chapter, we describe a streamlined protocol to design and construct multiplex CRISPR-Cas9 or FokI-dCas9 vectors, to introduce them into cultured cells by lipofection or electroporation, to enrich the genomically edited cells with a transient puromycin selection, to validate the mutation efficiency by Surveyor nuclease assay, and to perform off-target analyses. We show that our protocol enables highly efficient multiplex genome engineering even in hard-to-transfect HepG2 cells.
Stading, Benjamin; Osorio, Jorge E.; Velasco-Villa, Andres; Smotherman, Michael; Kingstad-Bakke, Brock; Rocke, Tonie E.
2016-01-01
Bats (Order Chiroptera) are an abundant group of mammals with tremendous ecological value as insectivores and plant dispersers, but their role as reservoirs of zoonotic diseases has received more attention in the last decade. With the goal of managing disease in free-ranging bats, we tested modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN) as potential vaccine vectors in the Brazilian Free-tailed bat (Tadarida brasiliensis), using biophotonic in vivo imaging and immunogenicity studies. Animals were administered recombinant poxviral vectors expressing the luciferase gene (MVA-luc, RCN-luc) through oronasal (ON) or intramuscular (IM) routes and subsequently monitored for bioluminescent signal indicative of viral infection. No clinical illness was noted after exposure to any of the vectors, and limited luciferase expression was observed. Higher and longer levels of expression were observed with the RCN-luc construct. When given IM, luciferase expression was limited to the site of injection, while ON exposure led to initial expression in the oral cavity, often followed by secondary replication at another location, likely the gastric mucosa or gastric associated lymphatic tissue. Viral DNA was detected in oral swabs up to 7 and 9 days post infection (dpi) for MVA and RCN, respectively. While no live virus was detected in oral swabs from MVA-infected bats, titers up to 3.88 x 104 PFU/ml were recovered from oral swabs of RCN-infected bats. Viral DNA was also detected in fecal samples from two bats inoculated IM with RCN, but no live virus was recovered. Finally, we examined the immunogenicity of a RCN based rabies vaccine (RCN-G) following ON administration. Significant rabies neutralizing antibody titers were detected in the serum of immunized bats using the rapid fluorescence focus inhibition test (RFFIT). These studies highlight the safety and immunogenicity of attenuated poxviruses and their potential use as vaccine vectors in bats.
Stading, Ben R.; Osorio, Jorge E.; Velasco-Villa, Andres; Smotherman, Michael; Kingstad-Bakke, Brock
2017-01-01
Bats (Order Chiroptera) are an abundant group of mammals with tremendous ecological value as insectivores and plant dispersers, but their role as reservoirs of zoonotic diseases has received more attention in the last decade. With the goal of managing disease in free-ranging bats, we tested modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN) as potential vaccine vectors in the Brazilian Free-tailed bat (Tadarida brasiliensis), using biophotonic in vivo imaging and immunogenicity studies. Animals were administered recombinant poxviral vectors expressing the luciferase gene (MVA-luc, RCN-luc) through oronasal (ON) or intramuscular (IM) routes and subsequently monitored for bioluminescent signal indicative of viral infection. No clinical illness was noted after exposure to any of the vectors, and limited luciferase expression was observed. Higher and longer levels of expression were observed with the RCN-luc construct. When given IM, luciferase expression was limited to the site of injection, while ON exposure led to initial expression in the oral cavity, often followed by secondary replication at another location, likely the gastric mucosa or gastric associated lymphatic tissue. Viral DNA was detected in oral swabs up to 7 and 9 days post infection (dpi) for MVA and RCN, respectively. While no live virus was detected in oral swabs from MVA-infected bats, titers up to 3.88 × 104 PFU/ml were recovered from oral swabs of RCN-infected bats. Viral DNA was also detected in fecal samples from two bats inoculated IM with RCN, but no live virus was recovered. Finally, we examined the immunogenicity of a RCN based rabies vaccine (RCN-G) following ON administration. Significant rabies neutralizing antibody titers were detected in the serum of immunized bats using the rapid fluorescence focus inhibition test (RFFIT). These studies highlight the safety and immunogenicity of attenuated poxviruses and their potential use as vaccine vectors in bats. PMID:27650872
The Role of Tim50 in Chemoresistance and Oncogenesis of Breast Cancer
2011-02-01
digested with Hind III and Kpn I and ligated into the pGL3 vector (Promega, Madison WI) upstream of the luciferase reporter gene. This construct was...expressing vector (HC5) or mutant p53-R273H (3 x 106) were cross-linked with 1% formaldehyde for 15 min and the reaction stopped by addition of glycine to...10 mg/ml) and treated with proteinase K (20 mg/ml). Proteins were removed by phenol – chloroform extraction and the DNA isolated by ethanol
Construction of human artificial chromosome vectors by recombineering.
Kotzamanis, George; Cheung, Wing; Abdulrazzak, Hassan; Perez-Luz, Sara; Howe, Steven; Cooke, Howard; Huxley, Clare
2005-05-23
Human artificial chromosomes (HACs) can be formed de novo by transfection of large fragments of cloned alphoid DNA into human HT1080 cells in tissue culture. In order to generate HACs carrying a gene of interest, one can either co-transfect the alphoid DNA and the gene of interest, or one can clone both into a single vector prior to transfection. Here we describe linking approximately 70 kb of alphoid DNA onto a 156-kb BAC carrying the human HPRT gene using Red homologous recombination in the EL350 Escherichia coli host [Lee et al., Genomics 73 (2001) 56-65]. A selectable marker and EGFP marker were then added by loxP/Cre recombination using the arabinose inducible cre gene in the EL350 bacteria. The final construct generates minichromosomes in HT1080 cells and the HPRT gene is expressed. The retrofitting vector can be used to add the approximately 70 kb of alphoid DNA to any BAC carrying a gene of interest to generate a HAC vector. The method can also be used to link any unrelated BAC or PAC insert onto another BAC clone. The EL350 bacteria are an excellent host for building up complex vectors by a combination of homologous and loxP/Cre recombination.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tenney, Rebeca M.; Bell, Christie L.; Wilson, James M., E-mail: wilsonjm@mail.med.upenn.edu
Adeno-associated virus serotype 8 (AAV8) is a promising vector for liver-directed gene therapy. Although efficient uncoating of viral capsids has been implicated in AAV8's robust liver transduction, much about the biology of AAV8 hepatotropism remains unclear. Our study investigated the structural basis of AAV8 liver transduction efficiency by constructing chimeric vector capsids containing sequences derived from AAV8 and AAV2 – a highly homologous yet poorly hepatotropic serotype. Engineered vectors containing capsid variable regions (VR) VII and IX from AAV8 in an AAV2 backbone mediated near AAV8-like transduction in mouse liver, with higher numbers of chimeric genomes detected in whole livermore » cells and isolated nuclei. Interestingly, chimeric capsids within liver nuclei also uncoated similarly to AAV8 by 6 weeks after administration, in contrast with AAV2, of which a significantly smaller proportion were uncoated. This study links specific AAV capsid regions to the transduction ability of a clinically relevant AAV serotype. - Highlights: • We construct chimeric vectors to identify determinants of AAV8 liver transduction. • An AAV2-based vector with 17 AAV8 residues exhibited high liver transduction in mice. • This vector also surpassed AAV2 in cell entry, nuclear entry and onset of expression. • Most chimeric vector particles were uncoated at 6 weeks, like AAV8 and unlike AAV2. • Chimera retained heparin binding and was antigenically distinct from AAV2 and AAV8.« less
Jeng, Lily; Olsen, Bjorn R; Spector, Myron
2010-10-01
Although there is widespread recognition of the importance of angiogenesis in tissue repair, there is little work on the inhibition of angiogenesis in the context of tissue engineering of naturally avascular tissues, like articular cartilage. The objective was to engineer a collagen-scaffold-based cartilaginous construct overexpressing a potent antiangiogenic factor, endostatin, using nonviral transfection. Endostatin-plasmid-supplemented collagen scaffolds were seeded with mesenchymal stem cells and chondrocytes and cultured for 20–22 days. The effects of the following variables on endostatin expression and chondrogenesis were examined: collagen scaffold material, method of nonviral vector incorporation, plasmid load, culture medium, and oxygen tension. An increase and peak of endostatin protein was observed during the first week of culture, followed by a decrease to low levels, suggesting that overexpression of endostatin could be sustained for several days using the nonviral vector. The amount of endostatin produced was tunable with the external factors. Chondrogenesis was observed in the engineered constructs cultured in chondrogenic medium at the 3-week time point, demonstrating that endostatin did not inhibit the chondrogenic potential of mesenchymal stem cells or the general viability of the cells. The ability to engineer endostatin-expressing cartilaginous constructs will be of value for future work exercising regulatory control of angiogenesis in cartilage repair.
Migita, M; Medin, J A; Pawliuk, R; Jacobson, S; Nagle, J W; Anderson, S; Amiri, M; Humphries, R K; Karlsson, S
1995-01-01
The gene transfer efficiency of human hematopoietic stem cells is still inadequate for efficient gene therapy of most disorders. To overcome this problem, a selectable retroviral vector system for gene therapy has been developed for gene therapy of Gaucher disease. We constructed a bicistronic retroviral vector containing the human glucocerebrosidase (GC) cDNA and the human small cell surface antigen CD24 (243 bp). Expression of both cDNAs was controlled by the long terminal repeat enhancer/promoter of the Molony murine leukemia virus. The CD24 selectable marker was placed downstream of the GC cDNA and its translation was enhanced by inclusion of the long 5' untranslated region of encephalomyocarditis virus internal ribosomal entry site. Virus-producing GP+envAM12 cells were created by multiple supernatant transductions to create vector producer cells. The vector LGEC has a high titer and can drive expression of GC and the cell surface antigen CD24 simultaneously in transduced NIH 3T3 cells and Gaucher skin fibroblasts. These transduced cells have been successfully separated from untransduced cells by fluorescence-activated cell sorting, based on cell surface expression of CD24. Transduced and sorted NIH 3T3 cells showed higher GC enzyme activity than the unsorted population, demonstrating coordinated expression of both genes. Fibroblasts from Gaucher patients were transduced and sorted for CD24 expression, and GC enzyme activity was measured. The transduced sorted Gaucher fibroblasts had a marked increase in enzyme activity (149%) compared with virgin Gaucher fibroblasts (17% of normal GC enzyme activity). Efficient transduction of CD34+ hematopoietic progenitors (20-40%) was accomplished and fluorescence-activated cell sorted CD24(+)-expressing progenitors generated colonies, all of which (100%) were vector positive. The sorted, CD24-expressing progenitors generated erythroid burst-forming units, colony-forming units (CFU)-granulocyte, CFU-macrophage, CFU-granulocyte/macrophage, and CFU-mix hematopoietic colonies, demonstrating their ability to differentiate into these myeloid lineages in vitro. The transduced, sorted progenitors raised the GC enzyme levels in their progeny cells manyfold compared with untransduced CD34+ progenitors. Collectively, this demonstrates the development of high titer, selectable bicistronic vectors that allow isolation of transduced hematopoietic progenitors and cells that have been metabolically corrected. Images Fig. 2 Fig. 3 PMID:8618847
2011-01-01
Background Bioluminescent tumor cell lines are experimental tools of major importance for cancer investigation, especially imaging of tumors in xenografted animals. Stable expression of exogenous luciferase in tumor cells combined to systemic injection of luciferin provides an excellent signal/background ratio for external optical imaging. Therefore, there is a need to rationalize and speed up the production of luciferase-positive tumor cell lines representative of multiple tumor phenotypes. For this aim we have designed a fusion gene linking the luciferase 2 protein to the c-terminus of a truncated form of the rat CD2 protein (tCD2-luc2). To allow simultaneous assessment of the wild-type luciferase 2 in a context of tCD2 co-expression, we have made a bicistronic construct for concomitant but separate expression of these two proteins (luc2-IRES-tCD2). Both the mono- and bi-cistronic constructs were transduced in lymphoid and epithelial cells using lentiviral vectors. Results The tCD2-luc2 chimera behaves as a type I membrane protein with surface presentation of CD2 epitopes. One of these epitopes reacts with the OX34, a widely spread, high affinity monoclonal antibody. Stably transfected cells are sorted by flow cytometry on the basis of OX34 staining. In vitro and, moreover, in xenografted tumors, the tCD2-luc2 chimera retains a substantial and stable luciferase activity, although not as high as the wild-type luciferase expressed from the luc2-IRES-tCD2 construct. Expression of the tCD2-luc2 chimera does not harm cell and tumor growth. Conclusion Lentiviral transduction of the chimeric tCD2-luc2 fusion gene allows selection of cell clones with stable luciferase expression in less than seven days without antibiotic selection. We believe that it will be helpful to increase the number of tumor cell lines available for in vivo imaging and assessment of novel therapeutic modalities. On a longer term, the tCD2-luc2 chimera has the potential to be expressed from multi-cassette vectors in combination with various inserts of interest. PMID:21435248
Zhao, Yan-Yan; Sun, Kai-Lai; Ashok, Kumar
1998-01-01
The work was aimed to identify the estrogen responsive element in the human angiotensinogen gene. The nucleotide sequence between the transcription initiation site and TATA box in angiotensinogen gene promoter was found to be strongly homologous with the consensus estrogen responsive element. This sequence was confirmed as the estrogen responsive element (HAG ERE) by electrophoretic mobility shift assay. The recombinant expression vectors were constructed in which chloramphenicol acetyltransferase (CAT) reporter gene was driven by angiotensinogen core promoter with HAG ERE of by TK core promoter with multiplied HAG ERE, and were used in cotransfection with the human estrogen receptor expression vector into HepG(2) cells; CAT assays showed an increase of the CAT activity on 17beta-estradiol treatment in those transfectants. These results suggest that the human angiotensinogen gene is transcriptionally up-regulated by estrogen through the estrogen responsive element near TATA box of the promoter.
Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang
2012-01-01
Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115
Yan, Yuzhao; Yu, Tenghua; Tu, Gang; Liu, Manran; Yuan, Jie; Yang, Guanglun
2015-09-01
To construct a lentiviral vector (Lenti-GPER-shRNA) targeting G-protein coupled estrogen receptor (GPER) and explore the role of GPER in the effect of tamoxifen on cell proliferation and apoptosis in breast cancer associated fibroblasts (BCAFs). The target sequence of GPER gene and negative control were cloned into lentiviral vectors. The recombinant lentivirus and control were extracted after HEK293T cells were transfected with the recombinant vector and helper vectors. After infection of BCAFs with the GPER lentiviral vector under the best interfering condition, GPER expression was detected by real-time quantitative PCR and Western blotting. BCAFs were divided into negative control group, GPER-RNAi group, negative control combined with tamoxifen (10(-8) mmol/L) group and GPER-RNAi combined with tamoxifen (10(-8) mmol/L) group. CCK-8 assay was used to detect the proliferation and annexin V-fluorescein isothiocyanate/propidium iodide (annexin V-FITC/PI) combined with flow cytometry was used to detect the apoptosis of BCAFs after the treatment of tamoxifen. Lenti-GPER-shRNA significantly interfered the expression of GPER in BCAFs. Tamoxifen promoted the growth of BCAFs, which could be attenuated by knockdown of GPER. Moreover, the apoptosis of BCAFs was reduced by tamoxifen, which was also reversed by knockdown of GPER. Lenti-GPER-shRNA could effectively silence the GPER expression in BCAFs. The ability of tamoxifen to accelerate cell proliferation and decrease cell apoptosis could be weakened by knockdown of GPER.
Preferential expression and immunogenicity of HIV-1 Tat fusion protein expressed in tomato plant.
Cueno, Marni E; Hibi, Yurina; Karamatsu, Katsuo; Yasutomi, Yasuhiro; Imai, Kenichi; Laurena, Antonio C; Okamoto, Takashi
2010-10-01
HIV-1 Tat plays a major role in viral replication and is essential for AIDS development making it an ideal vaccine target providing that both humoral and cellular immune responses are induced. Plant-based antigen production, due to its cheaper cost, appears ideal for vaccine production. In this study, we created a plant-optimized tat and mutant (Cys30Ala/Lys41Ala) tat (mtat) gene and ligated each into a pBI121 expression vector with a stop codon and a gusA gene positioned immediately downstream. The vector construct was bombarded into tomato leaf calli and allowed to develop. We thus generated recombinant tomato plants preferentially expressing a Tat-GUS fusion protein over a Tat-only protein. In addition, plants bombarded with either tat or mtat genes showed no phenotypic difference and produced 2-4 microg Tat-GUS fusion protein per milligram soluble plant protein. Furthermore, tomato extracts intradermally inoculated into mice were found to induce a humoral and, most importantly, cellular immunity.
[A new strategy of gene therapy for hyperphenylalaninemia rats].
Jia, X; Liu, J; Xiang, H
2000-06-01
To construct a recombinant vector which expresses active phenylalanine-amonia-lyase (PAL) in Lactococcus lactis (L. L.), and to convert phe into cinnamic acid in small intestine by the engineering L. L. to decrease the phe level in the peripheral blood, and to cure hyperphenylalaninemia rats. PAL cDNA from Petroselinum crispum was subcloned into expression vector pMG36e and transformed L. L. The pMG36ePAL/L.L. was screened and characterized by using PCR and HPLC, and prepared as enteric-coated microcapsules and oral liquid type preparation that were given orally to hyperphenylalaninemia-rats. Engineering L. L. expressing PAL activity was obtained. The phe levels plasma of in the rats receiving preparations made from the engineering L. L. were significantly reduced compared with non-treated hyperphenylalaninemia rats. And the effects of different preparations were different from each other. The engineering L. L. expressing PAL activity can reduce the blood phe level of the hyperphenylalaninemia rats. This may be a potential way for PKU gene therapeutics.
Chee Wei, T; Nurul Wahida, A G; Shaharum, S
2014-12-01
Malaysia first reported H5N1 poultry case in 2004 and subsequently outbreak in poultry population in 2007. Here, a recombinant gene encoding of peptide epitopes, consisting fragments of HA1, HA2 and a polybasic cleavage site of H5N1 strain Malaysia, was amplified and cloned into pET-47b(+) bacterial expression vector. DNA sequencing and alignment analysis confirmed that the gene had no alteration and in-frame to the vector. Then, His-tagged truncated HA protein was expressed in Escherichia coli BL21 (DE3) under 1 mM IPTG induction. The protein expression was optimized under a time-course induction study and further purified using Ni-NTA agarose under reducing condition. Migration size of protein was detected at 15 kDa by Western blot using anti-His tag monoclonal antibody and demonstrated no discrepancy compared to its calculated molecular weight.
Gene transfer to brain using herpes simplex virus vectors.
Glorioso, J C; Goins, W F; Meaney, C A; Fink, D J; DeLuca, N A
1994-01-01
Herpes simplex virus type 1 represents an ideal candidate for development as a vehicle for gene transfer to postmitotic neurons of the central nervous system. The natural biology of this virus makes it well suited for this purpose as it is capable of infecting a variety of neuronal cell types in the brain where the viral genome can persist indefinitely in a latent state. In latency, the viral lytic genes are transcriptionally silent and a unique set of latency-associated transcripts are expressed. Two impediments to using herpes simplex virus vectors must be overcome: (1) A noncytotoxic mutant virus backbone must be engineered, and (2) a suitable promoter-regulator that stably expresses foreign genes from the vector genome during latency must be constructed. Deletion of specific immediate early genes from the vector can render the virus nontoxic to neurons in culture and in vivo following stereotactic inoculation into specific regions of the brain. Because these viruses cannot replicate, they enter latency on infection of central nervous system neurons. A number of viral and cellular promoters have been tested for their ability to express genes during latency. Strong viral promoters and neurospecific promoters display transient activity. Although the promoter regions for the latency-associated transcripts are highly active in the peripheral nervous system, they show low-level but persistent activity in the brain. Experiments are in progress to exploit RNA polymerase III gene promoters or novel recombinant promoters capable of auto-inducing their own expression in order to increase gene expression during latency in brain neurons.
Farshadpour, Fatemeh; Makvandi, Manoochehr; Taherkhani, Reza
2015-01-01
Background: Hepatitis E Virus (HEV) is the causative agent of enterically transmitted acute hepatitis and has high mortality rate of up to 30% among pregnant women. Therefore, development of a novel vaccine is a desirable goal. Objectives: The aim of this study was to construct tPAsp-PADRE-truncated open reading frame 2 (ORF2) and truncated ORF2 DNA plasmid, which can assist future studies with the preparation of an effective vaccine against Hepatitis E Virus. Materials and Methods: A synthetic codon-optimized gene cassette encoding tPAsp-PADRE-truncated ORF2 protein was designed, constructed and analyzed by some bioinformatics software. Furthermore, a codon-optimized truncated ORF2 gene was amplified by the polymerase chain reaction (PCR), with a specific primer from the previous construct. The constructs were sub-cloned in the pVAX1 expression vector and finally expressed in eukaryotic cells. Results: Sequence analysis and bioinformatics studies of the codon-optimized gene cassette revealed that codon adaptation index (CAI), GC content, and frequency of optimal codon usage (Fop) value were improved, and performance of the secretory signal was confirmed. Cloning and sub-cloning of the tPAsp-PADRE-truncated ORF2 gene cassette and truncated ORF2 gene were confirmed by colony PCR, restriction enzymes digestion and DNA sequencing of the recombinant plasmids pVAX-tPAsp-PADRE-truncated ORF2 (aa 112-660) and pVAX-truncated ORF2 (aa 112-660). The expression of truncated ORF2 protein in eukaryotic cells was approved by an Immunofluorescence assay (IFA) and the reverse transcriptase polymerase chain reaction (RT-PCR) method. Conclusions: The results of this study demonstrated that the tPAsp-PADRE-truncated ORF2 gene cassette and the truncated ORF2 gene in recombinant plasmids are successfully expressed in eukaryotic cells. The immunogenicity of the two recombinant plasmids with different formulations will be evaluated as a novel DNA vaccine in future investigations. PMID:26865938
Monedero, Vicente; Rodríguez-Díaz, Jesús; Viana, Rosa; Buesa, Javier; Pérez-Martínez, Gaspar
2004-01-01
Single-chain antibodies (scFv) recognizing the VP8* fraction of rotavirus outer capsid and blocking rotavirus infection in vitro were isolated by phage display. Vectors for the extracellular expression in Lactobacillus casei of one of the scFv were constructed. L. casei was able to secrete active scFv to the growth medium, showing the potential of probiotic bacteria to be engineered to express molecules suitable for in vivo antirotavirus therapies. PMID:15528568
Zhong, Shumei; Sun, Shihua; Teng, Ba-Bie
2004-01-01
Background In humans, overproduction of apolipoprotein B (apoB) is positively associated with premature coronary artery diseases. To reduce the levels of apoB mRNA, we have designed an apoB mRNA-specific hammerhead ribozyme targeted at nucleotide sequences GUA6679 (RB15) mediated by adenovirus, which efficiently cleaves and decreases apoB mRNA by 80% in mouse liver and attenuates the hyperlipidemic condition. In the current study, we used an adeno-associated virus vector, serotype 2 (AAV2) and a self-complementary AAV2 vector (scAAV2) to demonstrate the effect of long-term tissue-specific gene expression of RB15 on the regulation apoB mRNA in vivo. Methods We constructed a hammerhead ribozyme RB15 driven by a liver-specific transthyretin (TTR) promoter using an AAV2 vector (rAAV2-TTR-RB15). HepG2 cells and hyperlipidemic mice deficient in both the low density lipoprotein receptor and the apoB mRNA editing enzyme genes (LDLR-/-Apobec1-/-; LDb) were transduced with rAAV2-TTR-RB15 and a control vector rAAV-TTR-RB15-mutant (inactive ribozyme). The effects of ribozyme RB15 on apoB metabolism and atherosclerosis development were determined in LDb mice at 5-month after transduction. A self-complementary AAV2 vector expressing ribozyme RB15 (scAAV2-TTR-RB15) was also engineered and used to transduce HepG2 cells. Studies were designed to compare the gene expression efficiency between rAAV2-TTR-RB15 and scAAV2-TTR-RB15. Results The effect of ribozyme RB15 RNA on reducing apoB mRNA levels in HepG2 cells was observed only on day-7 after rAAV2-TTR-RB15 transduction. And, at 5-month after rAAV2-TTR-RB15 treatment, the apoB mRNA levels in LDb mice were significantly decreased by 43%, compared to LDb mice treated with control vector rAAV2-TTR-RB15-mutant. Moreover, both the rAAV2-TTR-RB15 viral DNA and ribozyme RB15 RNA were still detectable in mice livers at 5-month after treatment. However, this rAAV2-TTR-RB15 vector mediated a prolonged but low level of ribozyme RB15 gene expression in the mice livers, which did not produce the therapeutic effects on alteration the lipid levels or the inhibition of atherosclerosis development. In contrast, the ribozyme RB15 RNA mediated by scAAV2-TTR-RB15 vector was expressed immediately at day-1 after transduction in HepG2 cells. The apoB mRNA levels were decreased 47% (p = 0.001), compared to the control vector scAAV2-TTR-RB15-mutant. Conclusion This study provided evidence that the rAAV2 single-strand vector mediated a prolonged but not efficient transduction in mouse liver. However, the scAAV2 double-strand vector mediated a rapid and efficient gene expression in liver cells. This strategy using scAAV2 vectors represents a better approach to express small molecules such as ribozyme. PMID:15193153
Santangelo, K S; Bertone, A L
2011-12-01
To ascertain a viral vector-based short hairpin RNA (shRNA) capable of reducing the interleukin-1β (IL-1β) transcript in osteoarthritis (OA)-prone chondrocytes and detect corresponding changes in the expression patterns of several critical disease mediators. Cultured chondrocytes from 2-month-old Hartley guinea pigs were screened for reduction of the IL-1β transcript following plasmid-based delivery of U6-driven shRNA sequences. A successful plasmid/shRNA knockdown combination was identified and used to construct an adeno-associated virus serotype 5 (AAV5) vector for further evaluation. Relative real-time reverse transcription polymerase chain reaction (RT-PCR) was used to quantify in vitro transcript changes of IL-1β and an additional nine genes following transduction with this targeting knockdown vector. To validate in vitro findings, this AAV5 vector was injected into one knee, while either an equivalent volume of saline vehicle (three animals) or non-targeting control vector (three animals) were injected into opposite knees. Fold differences and subsequent percent gene expression levels relative to control groups were calculated using the comparative CT (2(-ΔΔCT)) method. Statistically significant decreases in IL-1β expression were achieved by the targeting knockdown vector relative to both the mock-transduced control and non-targeting vector control groups in vitro. Transcript levels of anabolic transforming growth factor-β (TGF-β) were significantly increased by use of this targeting knockdown vector. Transduction with this targeting AAV5 vector also significantly decreased the transcript levels of key inflammatory cytokines [tumor necrosis factor-α (TNF-α), IL-2, IL-8, and IL-12] and catabolic agents [matrix metalloproteinase (MMP)13, MMP2, interferon-γ (IFN-γ), and inducible nitrous oxide synthase (iNOS)] relative to both mock-transduced and non-targeting vector control groups. In vivo application of this targeting knockdown vector resulted in a >50% reduction (P=0.0045) or >90% (P=0.0001) of the IL-1β transcript relative to vehicle-only or non-targeting vector control exposed cartilage, respectively. Successful reduction of the IL-1β transcript was achieved via RNA interference (RNAi) techniques. Importantly, this alteration significantly influenced the transcript levels of several major players involved in OA pathogenesis in the direction of disease modification. Investigations to characterize additional gene expression changes influenced by targeting knockdown AAV5 vector-based diminution of the IL-1β transcript in vivo are warranted. Copyright © 2011 Osteoarthritis Research Society International. Published by Elsevier Ltd. All rights reserved.
Chattopadhyay, M; Krisky, D; Wolfe, D; Glorioso, JC; Mata, M; Fink, DJ
2005-01-01
We examined the utility of herpes simplex virus (HSV) vector-mediated gene transfer of vascular endothelial growth factor (VEGF) in a mouse model of diabetic neuropathy. A replication-incompetent HSV vector with VEGF under the control of the HSV ICP0 promoter (vector T0VEGF) was constructed. T0VEGF expressed and released VEGF from primary dorsal root ganglion (DRG) neurons in vitro, and following subcutaneous inoculation in the foot, expressed VEGF in DRG and nerve in vivo. At 2 weeks after induction of diabetes, subcutaneous inoculation of T0VEGF prevented the reduction in sensory nerve amplitude characteristic of diabetic neuropathy measured 4 weeks later, preserved autonomic function measured by pilocarpine-induced sweating, and prevented the loss of nerve fibers in the skin and reduction of neuropeptide calcitonin gene-related peptide and substance P in DRG neurons of the diabetic mice. HSV-mediated transfer of VEGF to DRG may prove useful in treatment of diabetic neuropathy. PMID:15843809
Engineering T7 bacteriophage as a potential DNA vaccine targeting delivery vector.
Xu, Hai; Bao, Xi; Wang, Yiwei; Xu, Yue; Deng, Bihua; Lu, Yu; Hou, Jibo
2018-03-20
DNA delivery with bacteriophage by surface-displayed mammalian cell penetrating peptides has been reported. Although, various phages have been used to facilitate DNA transfer by surface displaying the protein transduction domain of human immunodeficiency virus type 1 Tat protein (Tat peptide), no similar study has been conducted using T7 phage. In this study, we engineeredT7 phage as a DNA targeting delivery vector to facilitate cellular internalization. We constructed recombinant T7 phages that displayed Tat peptide on their surface and carried eukaryotic expression box (EEB) as a part of their genomes (T7-EEB-Tat). We demonstrated that T7 phage harboring foreign gene insertion had packaged into infective progeny phage particles. Moreover, when mammalian cells that were briefly exposed to T7-EEB-Tat, expressed a significant higher level of the marker gene with the control cells infected with the wide type phage without displaying Tat peptides. These data suggested that the potential of T7 phage as an effective delivery vector for DNA vaccine transfer.
Kon, Tatsuya; Yoshikawa, Nobuyuki
2014-01-01
Apple latent spherical virus (ALSV) is an efficient virus-induced gene silencing vector in functional genomics analyses of a broad range of plant species. Here, an Agrobacterium-mediated inoculation (agroinoculation) system was developed for the ALSV vector, and virus-induced transcriptional gene silencing (VITGS) is described in plants infected with the ALSV vector. The cDNAs of ALSV RNA1 and RNA2 were inserted between the cauliflower mosaic virus 35S promoter and the NOS-T sequences in a binary vector pCAMBIA1300 to produce pCALSR1 and pCALSR2-XSB or pCALSR2-XSB/MN. When these vector constructs were agroinoculated into Nicotiana benthamiana plants with a construct expressing a viral silencing suppressor, the infection efficiency of the vectors was 100%. A recombinant ALSV vector carrying part of the 35S promoter sequence induced transcriptional gene silencing of the green fluorescent protein gene in a line of N. benthamiana plants, resulting in the disappearance of green fluorescence of infected plants. Bisulfite sequencing showed that cytosine residues at CG and CHG sites of the 35S promoter sequence were highly methylated in the silenced generation zero plants infected with the ALSV carrying the promoter sequence as well as in progeny. The ALSV-mediated VITGS state was inherited by progeny for multiple generations. In addition, induction of VITGS of an endogenous gene (chalcone synthase-A) was demonstrated in petunia plants infected with an ALSV vector carrying the native promoter sequence. These results suggest that ALSV-based vectors can be applied to study DNA methylation in plant genomes, and provide a useful tool for plant breeding via epigenetic modification. PMID:25426109
A novel bicistronic sensor vector for detecting caspase-3 activation.
Vagner, Tatyana; Mouravlev, Alexandre; Young, Deborah
2015-01-01
Apoptosis is involved in pathological cell death of a wide range of human diseases. One of the most important biochemical markers of apoptosis is activation of caspase-3. Ability to detect caspase-3 activation early in the pathological process is important for determining the timing for interfering with apoptosis initiation and prevention of cell damage. Techniques allowing detection of caspase-3 activity at a single cell level show increased sensitivity, compared to biochemical assays; therefore, we developed a novel bicistronic caspase-3 sensor vector enabling detection of caspase-3 activity in individual cells. We employed green fluorescent protein (GFP) as a reporter for caspase-3 activation in our constructs and assessed the functionality of the generated constructs in transiently transfected Neuro2A and HEK293 cells under basal conditions and following application of okadaic acid (OA) or staurosporine (STS) to induce apoptosis. To ensure responsiveness of the new sensor vector to active caspase-3, we co-transfected the sensor with plasmid(s) overexpressing active caspase-3 and quantified GFP fluorescence using a plate reader. We observed an increase in GFP expression in cells transfected with the new bicistronic caspase-3 sensor in response to both OA and STS. We also showed a significant increase in GFP fluorescence intensity in cells co-expressing the sensor with the plasmid(s) encoding active caspase-3. We generated a novel bicistronic caspase-3 sensor vector which relies on a transcription factor/response element system. The obtained sensor combines high sensitivity of the single cell level detection with the possibility of automated quantification. Copyright © 2015 Elsevier Inc. All rights reserved.
Nishida, Takashi; Watanabe, Kenta; Tachibana, Masato; Shimizu, Takashi; Watarai, Masahisa
2017-03-01
In this study, a cryptic plasmid pOfk55 from Legionella pneumophila was isolated and characterized. pOfk55 comprised 2584bp with a GC content of 37.3% and contained three putative open reading frames (ORFs). orf1 encoded a protein of 195 amino acids and the putative protein shared 39% sequence identity with a putative plasmid replication protein RepL. ORF1 was needed for replication in L. pneumophila but pOfk55 did not replicate in Escherichia coli. orf2 and orf3 encoded putative hypothetical proteins of 114 amino acids and 78 amino acids, respectively, but the functions of the putative proteins ORF2 and OFR3 are not clear. The transfer mechanism for pOfk55 was independent on the type IVB secretion system in the original host. A L. pneumophila-E. coli shuttle vector, pNT562 (5058bp, Km R ), was constructed by In-Fusion Cloning of pOfk55 with a kanamycin-resistance gene from pUTmini-Tn5Km and the origin of replication from pBluescript SK(+) (pNT561). Multiple cloning sites from pBluescript SK(+) as well as the tac promoter region and lacI gene from pAM239-GFP were inserted into pNT561 to construct pNT562. The transformation efficiency of pNT562 in L. pneumophila strains ranged from 1.6×10 1 to 1.0×10 5 CFU/ng. The relative number of pNT562 was estimated at 5.7±1.0 copies and 73.6% of cells maintained the plasmid after 1week in liquid culture without kanamycin. A green fluorescent protein (GFP) expression vector, pNT563, was constructed by ligating pNT562 with the gfpmut3 gene from pAM239-GFP. pNT563 was introduced into L. pneumophila Lp02 and E. coli DH5α, and both strains expressed GFP successfully. These results suggest that the shuttle vector is useful for genetic studies in L. pneumophila. Copyright © 2017 Elsevier Inc. All rights reserved.
Jiang, Yong-Xiang; Liu, Tian-Jing; Yang, Jin; Chen, Yan; Fang, Yan-Wen
2011-01-01
Purpose To establish a novel, targeted lentivirus-based HSV-tk (herpes simplex virus thymidine kinase)/GCV (ganciclovir) gene therapy system to inhibit lens epithelial cell proliferation for treatment of posterior capsular opacification (PCO) after cataract surgery. Methods An enhanced Cre recombinase (Cre/loxP) system with a lentiviral vector expressing Cre under the control of the lens-specific promoter LEP503 (Lenti-LEP503-HSVtk-Cre [LTKCRE]) was constructed, as well as another lentiviral vector containing a switching unit. The latter vector contains a stuffer sequence encoding EGFP (Lenti-hPGK-Loxp-EGFP-pA-Loxp-HSVtk [PGFPTK]) with a functional polyadenylation signal between two loxP sites, followed by the herpes simplex virus thymidine kinase (HSV-tk) gene, both under the control of the human posphoglycerate kinase (hPGK) promoter. Expression of the downstream gene (HSV-tk) is activated by co-expression of Cre. Human lens epithelial cells (HLECs) or retinal pigmental epithelial cells (RPECs) were co-infected with LTKCRE and PGFPTK. The inhibitory effects on HLECs and RPECs infected by the enhanced specific lentiviral vector combination at the concentration of 20 µg/ml GCV were assayed and compared. Results The specific gene expression of Cre and HSV-tk in HLECs is activated by the LEP503 promoter. LTKCRE and PGFPTK co-infected HLECs, but not RPECs, expressed high levels of the HSV-tk protein. After 96 h of GCV treatment, the percentage of apoptotic HLECs infected by the enhanced specific lentiviral vector combination was 87.23%, whereas that of apoptotic RPECs was only 10.12%. Electron microscopy showed that GCV induced apoptosis and necrosis of the infected HLECs. Conclusions The enhanced specific lentiviral vector combination selectively and effectively expressed HSV-tk in HLECs. A concentration of 20 µg/ml, GCV is effective against the proliferation of HLECs in vitro. This cell-type-specific gene therapy using a Cre/loxP lentivirus system may be a feasible treatment strategy to prevent PCO. PMID:21283526
Liu, Kan; Zhao, Chaofei; Chen, Jianwen; Wu, Shengpan; Yao, Yuanxin; Wu, Chong; Luo, Guoxiong; Zhang, Xu
2016-06-01
Objective To establish selenoprotein P, plasma 1 (SEPP1) gene recombinant lentiviral vector and investigate the effect of SEPP1 on the proliferation of human clear cell renal cell carcinoma (ccRCC) cells. Methods cDNA sequence of SEPP1 was cloned from the total cDNA of HEK293T cells by PCR. Then, the cDNA fragment was combined with the pLV-EGFP(2A)Puro vector and the constructed plasmid pLV-EGFP(2A)Puro-SEPP1 was transfected into HEK293T cells for packaging the virus. Forty-eight hours after transfected with the virus supernatant, the level of SEPP1 protein in 769-P and 786-O cells were tested by Western blotting. Cells were divided into recombinant lentivirus-infected cells, empty vector lentivirus-infected cells and the blank control cells. Cell proliferation rate was detected by MTS assay, colony forming ability was evaluated by plate clony formation assay and cell cycle change was assayed by flow cytometry after transfected with pLV-EGFP(2A)Puro-SEPP1 or empty pLV-EGFP(2A)Puro vector. Results Enzyme digestion analysis and DNA sequencing showed that the recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 was constructed successfully. After being infected by the virus supernatant, the 786-O and 769-P cells expressed EGFP. Compared with the empty vector group and the blank control group, expression level of SEPP1 in the experimental group was much higher. The cell proliferative ability was inhibited in the cells overexpressing SEPP1, and the colony forming ability of SEPP1-overexpressed cells evidently decreased. Cell cycle was arrested in G2/M phase in 786-O cells overexpressing SEPP1. Conclusion The recombinant plasmid pLV-EGFP(2A)Puro-SEPP1 has been constructed successfully. Overexpression of SEPP1 could significantly reduce the proliferation rate of 786-O and 769P cells, and cause G2/M phase arrest of 786-O cells.
Zheng, Xiangrong; Zhang, Shangshang; Yang, Yujia; Wang, Xia; Zhong, Le; Yu, Xiaohe
2008-11-01
The success of gene therapy depends largely on the efficacy of gene delivery vector systems that can deliver genes to target organs or cells selectively and efficiently with minimal toxicity. Here, we show that by using the HRE.ppET-1 regulatory element, we were able to restrict expression of the transgene of vascular endothelial growth factor (VEGF) to endothelial cells exclusively in hypoxic conditions. Eukaryotic expression vectors such as pEGFP-HRE.ppET-1, pcDNA3.1-VEGF+Pa, pcDNA3.1-ppET-1+ EGF+Pa, and pcDNA3.1-HRE.ppET-1+VEGF+Pa were constructed by using a series of nuclear molecule handling methods like PCR, enzyme digestion. The recombinant vectors were transfected into HUVEC cells and HL7702 cells by the lipofectin method. GFP expression was observed with a fluorescence microscope to validate the specificity of expression in endothelial cells under the regulation of HRE.ppET-1 element. Cobalt chloride (final concentration 100 mumol/L) was added to the medium to mimic hypoxia in vitro. After transfection of vectors, the expression of VEGF mRNA was detected by RT-PCR, and the expression of VEGF was detected by Western blotting and ELISA methods under normoxia and hypoxia, respectively. The cell proliferation rate was detected by the MTT test. The expression of GFP revealed that the exterior gene was transcripted effectively in endothelial cells regulated by the HRE.ppET-1 element, while the expression of GFP was very weak in nonendothelial cells. The results of RT-PCR, Western blotting and ELISA showed that VEGF gene expression in the pcDNA3.1-HRE.ppET-1+VEGF+Pa group and in the pcDNA3.1-ppET-1+VEGF+Pa group was higher in hypoxia than it was in normoxia (P<0.05). The MTT test showed that the proliferation rate of HUVEC transfected with HPVA under hypoxia exceeded that of the control group. We conclude that the HRE.ppET-1 element was expressed specifically in endothelial cells, and can increase the expression of VEGF in hypoxia and stimulate proliferation of endothelial cells. Taking advantage of these facts could greatly improve the efficiency of gene therapy. The vector would be valuable for various gene transfer studies targeting endothelial cells.
Zhou, J-X; Xue, J-D; Yu, T; Zhang, J-B; Liu, Y; Jiang, N; Li, Y-L; Hu, R-L
2010-04-01
To develop a new type vaccine for porcine reproductive and respiratory syndrome (PRRS) prevention by using canine adenovirus 2(CAV-2) as vector, the Glycoprotein 5(GP5) gene from PRRSV strain JL was amplified by RT-PCR, and the expression cassette of GP5 was constructed using the human cytomegalovirus (HCMV) promoter and the simian virus 40 (SV40) early mRNA polyadenylation signal. The expression cassette of Glycoprotein 5 was cloned into the CAV-2 genome in which E3 region had been partly deleted, and the recombinant virus (CAV-2-GP5) was obtained by transfecting the recombinant CAV-2-GP5 genome into MDCK cells together with Lipofectamine 2000. Immunization trial in pigs with the recombinant virus CAV-2-GP5 showed that CAV-2-GP5 could stimulate a specific immune response to PRRSV. Immune response to the GP5 and PRRSV was confirmed by ELISA, neutralization test and lymphocyte proliferative responses, and western blotting confirmed expression of GP5 by the vector in cells. These results indicated that CAV-2 may serve as a vector for development of PRRSV vaccine in pigs, and the CAV-2-GP5 might be a candidate vaccine to be tested for preventing PRRSV infection.
[Establishment of RAW264.7 cell strain stably expressing RFP-GFP-LC3].
Wang, Wan; Zhang, Qing; Zhao, Runpeng; Xu, Xuewei; Xing, Yingru; Zhang, Rongbo; Wu, Jing; Hu, Dong
2015-09-01
To establish murine macrophage RAW264.7 cell strain with stable expression of red fluorescent protein-green fluorescent protein-microtubule associated protein light chain 3 (RFP-GFP-LC3). A lentiviral vector containing RFP-GFP-LC3 gene was constructed and then packaged in HEK293T cells with the packaging plasmids. The viral supernatant was collected to infect RAW264.7 cells. The RAW264.7 cell strain with stable expression of RFP-GFP-LC3 was screened with puromycin and analyzed with flow cytometry and fluorescent microscopy for infection efficiency. The number of RFP-GFP-LC3 puncta was observed using florescence microscopy following starvation treatment. The recombinant lentivirus pLV-CMV-RFP-GFP-LC3 was successfully constructed. The RAW264.7 cells with stable expression of RFP-GFP-LC3 were obtained by viral infection and puromycin screening. Fluorescent microscopy and flow cytometry demonstrated the expression rates of RFP and GFP reached to 100%. The number of autophagic puncta significantly increased after starvation treatment. The RAW264.7 cell strain with stable expression of RFP-GFP-LC3 has been successfully constructed, which provides a reliable cellular platform for autophagy research.
Mori, Keisuke; Ando, Akira; Gehlbach, Peter; Nesbitt, David; Takahashi, Kyoichi; Goldsteen, Donna; Penn, Michael; Chen, Cheauyan T.; Mori, Keiko; Melia, Michele; Phipps, Sandrina; Moffat, Diana; Brazzell, Kim; Liau, Gene; Dixon, Katharine H.; Campochiaro, Peter A.
2001-01-01
Endostatin is a cleavage product of collagen XVIII that inhibits tumor angiogenesis and growth. Interferon α2a blocks tumor angiogenesis and causes regression of hemangiomas, but has no effect on choroidal neovascularization (CNV). Therefore, inhibitors of tumor angiogenesis do not necessarily inhibit ocular neovascularization. In this study, we used an intravenous injection of adenoviral vectors containing a sig-mEndo transgene consisting of murine immunoglobulin κ-chain leader sequence coupled to sequence coding for murine endostatin to investigate the effect of high serum levels of endostatin on CNV in mice. Mice injected with a construct in which sig-mEndo expression was driven by the Rous sarcoma virus promoter had moderately high serum levels of endostatin and significantly smaller CNV lesions at sites of laser-induced rupture of Bruch’s membrane than mice injected with null vector. Mice injected with a construct in which sig-mEndo was driven by the simian cytomegalovirus promoter had ∼10-fold higher endostatin serum levels and had nearly complete prevention of CNV. There was a strong inverse correlation between endostatin serum level and area of CNV. This study provides proof of principle that gene therapy to increase levels of endostatin can prevent the development of CNV and may provide a new treatment for the leading cause of severe loss of vision in patients with age-related macular degeneration. PMID:11438478
Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.
Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E
2009-11-20
In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.
Liu, Xiang; Liang, Bo; Ngwuta, Joan; Liu, Xueqiao; Surman, Sonja; Lingemann, Matthias; Kwong, Peter D; Graham, Barney S; Collins, Peter L; Munir, Shirin
2017-11-15
Human respiratory syncytial virus (RSV) is the most prevalent worldwide cause of severe respiratory tract infection in infants and young children. Human parainfluenza virus type 1 (HPIV1) also causes severe pediatric respiratory illness, especially croup. Both viruses lack vaccines. Here, we describe the preclinical development of a bivalent RSV/HPIV1 vaccine based on a recombinant HPIV1 vector, attenuated by a stabilized mutation, that expresses RSV F protein modified for increased stability in the prefusion (pre-F) conformation by previously described disulfide bond (DS) and hydrophobic cavity-filling (Cav1) mutations. RSV F was expressed from the first or second gene position as the full-length protein or as a chimeric protein with its transmembrane and cytoplasmic tail (TMCT) domains substituted with those of HPIV1 F in an effort to direct packaging in the vector particles. All constructs were recovered by reverse genetics. The TMCT versions of RSV F were packaged in the rHPIV1 particles much more efficiently than their full-length counterparts. In hamsters, the presence of the RSV F gene, and in particular the TMCT versions, was attenuating and resulted in reduced immunogenicity. However, the vector expressing full-length RSV F from the pre-N position was immunogenic for RSV and HPIV1. It conferred complement-independent high-quality RSV-neutralizing antibodies at titers similar to those of wild-type RSV and provided protection against RSV challenge. The vectors exhibited stable RSV F expression in vitro and in vivo In conclusion, an attenuated rHPIV1 vector expressing a pre-F-stabilized form of RSV F demonstrated promising immunogenicity and should be further developed as an intranasal pediatric vaccine. IMPORTANCE RSV and HPIV1 are major viral causes of acute pediatric respiratory illness for which no vaccines or suitable antiviral drugs are available. The RSV F glycoprotein is the major RSV neutralization antigen. We used a rHPIV1 vector, bearing a stabilized attenuating mutation, to express the RSV F glycoprotein bearing amino acid substitutions that increase its stability in the pre-F form, the most immunogenic form that elicits highly functional virus-neutralizing antibodies. RSV F was expressed from the pre-N or N-P gene position of the rHPIV1 vector as a full-length protein or as a chimeric form with its TMCT domain derived from HPIV1 F. TMCT modification greatly increased packaging of RSV F into the vector particles but also increased vector attenuation in vivo , resulting in reduced immunogenicity. In contrast, full-length RSV F expressed from the pre-N position was immunogenic, eliciting complement-independent RSV-neutralizing antibodies and providing protection against RSV challenge. Copyright © 2017 American Society for Microbiology.
Xiang, Hongfei; Liu, Zhen; Wang, Fei; Xu, Hao; Roberts, Christopher; Fischer, Gregory; Stucky, Cheryl L; Dean, Caron; Pan, Bin; Hogan, Quinn H; Yu, Hongwei
2017-01-01
Background TRPV1 (transient receptor potential vanilloid subfamily member 1) is a pain signaling channel highly expressed in primary sensory neurons. Attempts for analgesia by systemic TRPV1 blockade produce undesirable side effects, such as hyperthermia and impaired heat pain sensation. One approach for TRPV1 analgesia is to target TRPV1 along the peripheral sensory pathway. Results For functional blockade of TRPV1 signaling, we constructed an adeno-associated virus (AAV) vector expressing a recombinant TRPV1 interfering peptide aptamer, derived from a 38mer tetrameric assembly domain (TAD), encompassing residues 735 to 772 of rat TRPV1, fused to the C-terminus of enhanced green fluorescent protein (EGFP). AAV-targeted sensory neurons expressing EGFP-TAD after vector injection into the dorsal root ganglia (DRG) revealed decreased inward calcium current and diminished intracellular calcium accumulation in response to capsaicin, compared to neurons of naïve or expressing EGFP alone. To examine the potential for treating neuropathic pain, AAV-EGFP-TAD was injected into fourth and fifth lumbar (L) DRGs of rats subjected to neuropathic pain by tibial nerve injury (TNI). Results showed that AAV-directed selective expression of EGFP-TAD in L4/L5 DRG neuron somata, and their peripheral and central axonal projections can limit TNI-induced neuropathic pain behavior, including hypersensitivity to heat and, to a less extent, mechanical stimulation. Conclusion Selective inhibition of TRPV1 activity in primary sensory neurons by DRG delivery of AAV-encoded analgesic interfering peptide aptamers is efficacious in attenuation of neuropathic pain. With further improvements of vector constructs and in vivo application, this approach might have the potential to develop as an alternative gene therapy strategy to treat chronic pain, especially heat hypersensitivity, without complications due to systemic TRPV1 blockade. PMID:28604222
Pan, Li; Zhang, Yong-Guang; Wang, Yong-Lu; Wang, Bao-Qin; Xie, Qing-Ge
2006-10-01
The plant constitutive expression vector pBin438/VP1 for VP1 gene of foot-and-mouth disease virus strain O/ China/99 was constructed. Mediated with Agrobacterium tumefaciens GV3101 harboring pBin438/VP1, VP1 gene was transferred into cotyledons of tomato. After selected by Kanamysin, sixty resistant lines were obtained. The integration and transcription of the VP1 gene in transformed plants was detected by PCR and RT-PCR. After being detected by sandwich-ELISA assays, about 40% transformed plants confirmed to express the recombinant protein. The leave extracts of two positive lines were respectively emulsified in Freund's adjuvant and guinea pigs were intramuscular inoculation at days 0, 15 and 30d. According to the sera antibody levels and the protection of the vaccinated guinea pigs against challenge with 100ID50 FMDV, probed into the immunogenicity of the target protein expressed in transgenic plants. Experimental results showed that the plant expression vector was successfully constructed. PCR and RT-PCR analyses confirmed VP1 gene was transformed into tomato plants and got expression at the transcription levels. The expressed VP1 protein of FMDV, which was identified by ELISA and Western blot, can be specifically recognized by polyclonal antibodies against FMDV. Indirect-ELISA antibody titers reached 1:64 twenty-one days after the third inoculation. In the challenge test, the protection against FMDV challenge in two groups was 80% and 40% respectively. The immunization test in guinea pigs indicated that the expression product of transgenic tomato plants had immunogenicity and could effectively induce the specific antibodies against FMDV.
Gene transfer strategies in animal transgenesis.
Montoliu, Lluís
2002-01-01
Position effects in animal transgenesis have prevented the reproducible success and limited the initial expectations of this technique in many biotechnological projects. Historically, several strategies have been devised to overcome such position effects, including the progressive addition of regulatory elements belonging to the same or to a heterologous expression domain. An expression domain is thought to contain all regulatory elements that are needed to specifically control the expression of a given gene in time and space. The lack of profound knowledge on the chromatin structure of expression domains of biotechnological interest, such as mammary gland-specific genes, explains why most standard expression vectors have failed to drive high-level, position-independent, and copy-number-dependent expression of transgenes in a reproducible manner. In contrast, the application of artificial chromosome-type constructs to animal transgenesis usually ensures optimal expression levels. YACs, BACs, and PACs have become crucial tools in animal transgenesis, allowing the inclusion of distant key regulatory sequences, previously unknown, that are characteristic for each expression domain. These elements contribute to insulating the artificial chromosome-type constructs from chromosomal position effects and are fundamental in order to guarantee the correct expression of transgenes.
Vector modifications to eliminate transposase expression following piggyBac-mediated transgenesis
Chakraborty, Syandan; Ji, HaYeun; Chen, Jack; Gersbach, Charles A.; Leong, Kam W.
2014-01-01
Transgene insertion plays an important role in gene therapy and in biological studies. Transposon-based systems that integrate transgenes by transposase-catalyzed “cut-and-paste” mechanism have emerged as an attractive system for transgenesis. Hyperactive piggyBac transposon is particularly promising due to its ability to integrate large transgenes with high efficiency. However, prolonged expression of transposase can become a potential source of genotoxic effects due to uncontrolled transposition of the integrated transgene from one chromosomal locus to another. In this study we propose a vector design to decrease post-transposition expression of transposase and to eliminate the cells that have residual transposase expression. We design a single plasmid construct that combines the transposase and the transpositioning transgene element to share a single polyA sequence for termination. Consequently, the separation of the transposase element from the polyA sequence after transposition leads to its deactivation. We also co-express Herpes Simplex Virus thymidine kinase (HSV-tk) with the transposase. Therefore, cells having residual transposase expression can be eliminated by the administration of ganciclovir. We demonstrate the utility of this combination transposon system by integrating and expressing a model therapeutic gene, human coagulation Factor IX, in HEK293T cells. PMID:25492703
Said, Abdelrahman; Elmanzalawy, Mona; Ma, Guanggang; Damiani, Armando Mario; Osterrieder, Nikolaus
2017-08-14
Rift Valley fever virus (RVFV) is an arthropod-borne bunyavirus that can cause serious and fatal disease in humans and animals. RVFV is a negative-sense RNA virus of the Phlebovirus genus in the Bunyaviridae family. The main envelope RVFV glycoproteins, Gn and Gc, are encoded on the M segment of RVFV and known inducers of protective immunity. In an attempt to develop a safe and efficacious RVF vaccine, we constructed and tested a vectored equine herpesvirus type 1 (EHV-1) vaccine that expresses RVFV Gn and Gc. The Gn and Gc genes were custom-synthesized after codon optimization and inserted into EHV-1 strain RacH genome. The rH_Gn-Gc recombinant virus grew in cultured cells with kinetics that were comparable to those of the parental virus and stably expressed Gn and Gc. Upon immunization of sheep, the natural host, neutralizing antibodies against RVFV were elicited by rH_Gn-Gc and protective titers reached to 1:320 at day 49 post immunization but not by parental EHV-1, indicating that EHV-1 is a promising vector alternative in the development of a safe marker RVFV vaccine.
Rosenberg, Jonathan B.; Hicks, Martin J.; De, Bishnu P.; Pagovich, Odelya; Frenk, Esther; Janda, Kim D.; Wee, Sunmee; Koob, George F.; Hackett, Neil R.; Kaminsky, Stephen M.; Worgall, Stefan; Tignor, Nicole; Mezey, Jason G.
2012-01-01
Abstract Cocaine addiction is a major problem affecting all societal and economic classes for which there is no effective therapy. We hypothesized an effective anti-cocaine vaccine could be developed by using an adeno-associated virus (AAV) gene transfer vector as the delivery vehicle to persistently express an anti-cocaine monoclonal antibody in vivo, which would sequester cocaine in the blood, preventing access to cognate receptors in the brain. To accomplish this, we constructed AAVrh.10antiCoc.Mab, an AAVrh.10 gene transfer vector expressing the heavy and light chains of the high affinity anti-cocaine monoclonal antibody GNC92H2. Intravenous administration of AAVrh.10antiCoc.Mab to mice mediated high, persistent serum levels of high-affinity, cocaine-specific antibodies that sequestered intravenously administered cocaine in the blood. With repeated intravenous cocaine challenge, naive mice exhibited hyperactivity, while the AAVrh.10antiCoc.Mab-vaccinated mice were completely resistant to the cocaine. These observations demonstrate a novel strategy for cocaine addiction by requiring only a single administration of an AAV vector mediating persistent, systemic anti-cocaine passive immunity. PMID:22486244
Whitesell, L; Rosolen, A; Neckers, L M
1991-01-01
Neuroectodermal tumors of childhood provide a unique opportunity to examine the role of genes potentially regulating neuronal growth and differentiation because many cell lines derived from these tumors are composed of at least two distinct morphologic cell types. These types display variant phenotypic characteristics and spontaneously interconvert, or transdifferentiate, in vitro. The factors that regulate transdifferentiation are unknown. Application of antisense approaches to the transdifferentiation process has allowed us to explore the precise role that N-myc may play in regulating developing systems. We now report construction of an episomally replicating expression vector designed to generate RNA antisense to part of the human N-myc gene. Such a vector is able to specifically inhibit N-myc expression in cell lines carrying both normal and amplified N-myc alleles. Inhibition of N-myc expression blocks transdifferentiation in these lines, with accumulation of cells of an intermediate phenotype. A concomitant decrease in growth rate but not loss of tumorigenicity was observed in the N-myc nonamplified cell line CHP-100. Vector-generated antisense RNA should allow identification of genes specifically regulated by the proto-oncogene N-myc. Images PMID:1996098
Haga, K; Lemp, N A; Logg, C R; Nagashima, J; Faure-Kumar, E; Gomez, G G; Kruse, C A; Mendez, R; Stripecke, R; Kasahara, N; Kasahara, N A; Cicciarelli, J C
2006-12-01
Transplantation of many tissues requires histocompatibility matching of human leukocyte antigens (HLA) to prevent graft rejection, to reduce the level of immunosuppression needed to maintain graft survival, and to minimize the risk of graft-versus-host disease, particularly in the case of bone marrow transplantation. However, recent advances in fields of gene delivery and genetic regulation technologies have opened the possibility of engineering grafts that display reduced levels of HLA expression. Suppression of HLA expression could help to overcome the limitations imposed by extensive HLA polymorphisms that restrict the availability of suitable donors, necessitate the maintenance of large donor registries, and complicate the logistics of procuring and delivering matched tissues and organs to the recipient. Accordingly, we investigated whether knockdown of HLA by RNA interference (RNAi), a ubiquitous regulatory system that can efficiently and selectively inhibit the expression of specific gene products, would enable allogeneic cells to evade immune recognition. For efficient and stable delivery of short hairpin-type RNAi constructs (shRNA), we employed lentivirus-based gene transfer vectors, which provide a delivery system that can achieve integration into genomic DNA, thereby permanently modifying transduced graft cells. Our results show that lentivirus-mediated delivery of shRNA targeting pan-Class I and allele-specific HLA can achieve efficient and dose-dependent reduction in surface expression of HLA in human cells, associated with enhanced resistance to alloreactive T lymphocyte-mediated cytotoxicity, while avoiding MHC-non-restricted killing. We hypothesize that RNAi-induced silencing of HLA expression has the potential to create histocompatibility-enhanced, and, eventually, perhaps "universally" compatible cellular grafts.
Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu
2008-06-01
This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.
Sequence and immunogenicity of a clinically approved novel measles virus vaccine vector
Zuniga, Amando; Liniger, Mathias; Morin, Teldja Neige Azzouz; Marty, René R.; Wiegand, Marian; Ilter, Orhan; Weibel, Sara; Billeter, Martin A.; Knuchel, Marlyse C.; Naim, Hussein Y.
2013-01-01
The measles virus vaccine (MVbv) is a clinically certified and well-tolerated vaccine strain that has been given both parenterally and mucosally. It has been extensively used in children and has proven to be safe and effective in eliciting protective immunity. This specific strain was therefore chosen to generate a measles viral vector. The genome of the commercial MVbv vaccine strain was isolated, sequenced and a plasmid, p(+)MVb, enabling transcription of the viral antigenome and rescue of MVb, was constructed. Phylogenic and phenotypic analysis revealed that MVbv and the rescued MVb constitute another evolutionary branch within the hitherto classified measles vaccines. Plasmid p(+)MVb was modified by insertion of artificial MV-type transcription units (ATUs) for the generation of recombinant viruses (rMVb) expressing additional proteins. Replication characteristics and immunogenicity of rMVb vectors were similar to the parental MVbv and to other vaccine strains. The expression of the additional proteins was stable over 10 serial virus transfers, which corresponds to an amplification greater than 1020. The excellent safety record and its efficient application as aerosol may add to the usefulness of the derived vectors. PMID:23324616
Kushnir, Susanna; Marsac, Yoann; Breitling, Reinhard; Granovsky, Igor; Brok-Volchanskaya, Vera; Goody, Roger S; Becker, Christian F W; Alexandrov, Kirill
2006-01-01
Functional genomics and proteomics have been very active fields since the sequencing of several genomes was completed. To assign a physiological role to the newly discovered coding genes with unknown function, new generic methods for protein production, purification, and targeted functionalization are needed. This work presents a new vector, pCYSLIC, that allows rapid generation of Escherichia coli expression constructs via ligation-independent cloning (LIC). The vector is designed to facilitate protein purification by either Ni-NTA or GSH affinity chromatography. Subsequent proteolytic removal of affinity tags liberates an N-terminal cysteine residue that is then used for covalent modification of the target protein with different biophysical probes via protein ligation. The described system has been tested on 36 mammalian Rab GTPases, and it was demonstrated that recombinant GTPases produced with pCYSLIC could be efficiently modified with fluorescein or biotin in vitro. Finally, LIC was compared with the recently developed In-Fusion cloning method, and it was demonstrated that In-Fusion provides superior flexibility in choice of expression vector. By the application of In-Fusion cloning Cys-Rab6A GTPase with an N-terminal cysteine residue was generated employing unmodified pET30a vector and TVMV protease.
Further development of raccoon poxvirus-vectored vaccines against plague (Yersinia pestis)
Rocke, Tonie E.; Iams, Keith P.; Dawe, S.; Smith, Susan; Williamson, Judy L.; Heisey, Dennis M.; Osorio, Jorge E.
2009-01-01
In previous studies, we demonstrated protection against plague in mice and prairie dogs using a raccoon pox (RCN) virus-vectored vaccine that expressed the F1 capsular antigen of Yersinia pestis. In order to improve vaccine efficacy, we have now constructed additional RCN-plague vaccines containing two different forms of the lcrV (V) gene, including full-length (Vfull) and a truncated form (V307). Mouse challenge studies with Y. pestis strain CO92 showed that vaccination with a combination of RCN-F1 and the truncated V construct (RCN-V307) provided the greatest improvement (P = 0.01) in protection against plague over vaccination with RCN-F1 alone. This effect was mediated primarily by anti-F1 and anti-V antibodies and both contributed independently to increased survival of vaccinated mice.
Further development of raccoon poxvirus-vectored vaccines against plague (Yersinia pestis).
Rocke, Tonie E; Iams, Keith P; Dawe, Sandra; Smith, Susan R; Williamson, Judy L; Heisey, Dennis M; Osorio, Jorge E
2009-12-11
In previous studies, we demonstrated protection against plague in mice and prairie dogs using a raccoon pox (RCN) virus-vectored vaccine that expressed the F1 capsular antigen of Yersinia pestis. In order to improve vaccine efficacy, we have now constructed additional RCN-plague vaccines containing two different forms of the lcrV (V) gene, including full-length (Vfull) and a truncated form (V307). Mouse challenge studies with Y. pestis strain CO92 showed that vaccination with a combination of RCN-F1 and the truncated V construct (RCN-V307) provided the greatest improvement (P=0.01) in protection against plague over vaccination with RCN-F1 alone. This effect was mediated primarily by anti-F1 and anti-V antibodies and both contributed independently to increased survival of vaccinated mice.
Li, Da; Ping, Yuan; Xu, Fujian; Yu, Hai; Pan, Hongming; Huang, Hongliang; Wang, Qingqing; Tang, Guping; Li, Jun
2010-09-13
The success of cancer gene therapy highly relies on the gene delivery vector with high transfection activity and low toxicity. In the present study, eight-armed polyethylene glycol (EAP) and low molecular weight (LMW) polyethylenimine (PEI) were used as basic units to construct the architecture of a new star-shaped EAP-PEI copolymer (EAPP). MC11, a peptide capable of selectively binding fibroblast growth factor receptor (FGFR) on tumor cell membranes, was further conjugated to EAPP to produce the vector EAPP-MC11 (EAPPM) to enhance tumor targetability. This tumor-targeting vector EAPPM was observed to retard the plasmids mobility at a nitrogen/phosphorus (N/P) ratio of 3. The vector could efficiently condense plasmids within 300 nm nanoparticles with a positive zeta potential at the N/P ratio of 20 or above. While the cytotoxicity of EAPPM polyplexes was similar to that of LMW PEI, it was significantly lower than that of PEI (25 kDa) in HepG2 and PC3 cell lines. In vitro gene transfection with pDNA mediated by EAPPM showed that the transfection efficiency increased 15 times in HepG2 cells but remained at a similar level in PC3 cells in comparison with that of EAPP. By systemic injection of EAPPM/pDNA complexes into a HepG2-bearing mice model, luciferase expression detected in lung, liver, and tumor tissues demonstrated EAPPM could deliver in a targeted manner a reporter gene into tumor tissues, where the luciferase expression of EAPPM was 4 times higher than that of EAPP and even 23 times higher than that of PEI (25 kDa). Furthermore, it was found that the systemic delivery of EAPPM/pCSK-α-interferon complexes in vivo were much more effective in inhibiting tumor growth than EAPP or PEI (25 kDa). These results clearly show that EAPPM is an efficient and safe vector for FGFR-mediated targeted gene delivery both in vitro and in vivo. With low cytotoxicity and high targetability, EAPPM may have great potential as a delivery vector for future cancer gene therapy applications.
Coherent state constructions of bases for some physically relevant group chains
NASA Technical Reports Server (NTRS)
Hecht, Karl T.
1995-01-01
Rotor coherent state constructions are given for the Wigner supermultiplet SU(4) contains SU(2)xSU(2) and for the special irreducible representations (N0) of the SO(5) contains SO(3) contains SO(2) group chain in exact parallel with the rotor coherent state construction for the SU(3) contains SO(3) contains SO(2) case given by Rowe, LeBlanc,, and Repka. Matrix elements of the coherent state realizations of the group generators are given in all cases by very simple expressions in terms of angular momentum Wigner coefficients involving intrinsic projection labels K. The K-matrix technique of vector coherent state theory is used to effectively elevate these K labels to the status of good quantum numbers. Analytic expressions are given for the (K K*)-matrices for many of the more important irreducible representations.
Zhang, YongSheng; Xi, JiFeng; Jia, Bin; Wang, XiangZu; Wang, XuHai; Li, ChaoCheng; Li, YaQiang; Zeng, XianCun; Ying, RuiWen; Li, Xin; Jiang, Song; Yuan, FangYuan
2017-04-01
The objective of this study was to explore a novel method to alter the sex-ratio balance of mouse offspring by silencing the paralogous genes Zfx/Zfy (Zinc finger X/Y-chromosomal transcription factor gene) during spermatogenesis. Four recombined vectors PRZ1, PRZ2, PRZ3, and PRZ4 (RNAi-Ready-pSIREN-RetroQ-ZsGreen) were constructed for interrupting the Zfx gene. Additionally, a recombined vector Psilencer/Zfy-shRNA was constructed for interrupting the Zfy gene. Male mice were randomly divided into 8 groups, with 20 animals per group. Five groups of mice were injected with PRZ1, PRZ2, PRZ3, PRZ4, and Psilencer/Zfy-shRNA vectors, respectively. The three control groups were injected with an equal volume of physiological saline, empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector, and empty Psilencer/Zfy-shRNA vector, respectively. All groups were injected every 7 days for a total of four injections. Fourteen days after the fourth injection, 10 male mice from each group were mated individually with 10 females. Testicular tissue of 10 male mice in each group was collected, and the expression level of Zfx/Zfy mRNA was determined by qRT-PCR. Results showed that, compared with the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and the physiological saline group, expression of Zfx mRNA decreased significantly after injection of PRZ1 (p < 0.01), PRZ3 (p < 0.01), and PRZ4 (p < 0.01), and 78.75 ± 7.50% of the offspring were male in PRZ4 group, significantly higher than the offspring derived from the empty RNAi-Ready-pSIREN-RetroQ-ZsGreen vector and physiological saline group (p < 0.01). In the PRZ1 group, the expression of Zfx mRNA was also significantly lower (p < 0.01), but the male rate of offspring was not different (p > 0.05). Conversely, the expression of Zfy mRNA decreased significantly after injection of Psilencer/Zfy-shRNA (p < 0.01) and 31.00 ± 11.00% of the offspring were male, significantly lower than in the physiological saline group (p < 0.01). In conclusion, our findings show that RNAi-mediated disruption of Zfx/Zfy in mouse testis affected X/Y spermatogenesis. Additionally, results suggest that the paralogous genes Zfx/Zfy play an important role in the process of X and Y sperm development. The individual interference of Zfx/Zfy may predict the outcome of X and Y haploid sperms. Presented herein is an advanced method developed to control mouse X/Y spermatogenesis and sex ratio of offspring.
Nygårdas, Michaela; Paavilainen, Henrik; Müther, Nadine; Nagel, Claus-Henning; Röyttä, Matias; Sodeik, Beate; Hukkanen, Veijo
2013-01-01
Herpes simplex virus type 1 (HSV-1) has properties that can be exploited for the development of gene therapy vectors. The neurotropism of HSV enables delivery of therapeutic genes to the nervous system. Using a bacterial artificial chromosome (BAC), we constructed an HSV-1(17+)-based replicative vector deleted of the neurovirulence gene γ134.5, and expressing leukemia inhibitory factor (LIF) as a transgene for treatment of experimental autoimmune encephalomyelitis (EAE). EAE is an inducible T-cell mediated autoimmune disease of the central nervous system (CNS) and is used as an animal model for multiple sclerosis. Demyelination and inflammation are hallmarks of both diseases. LIF is a cytokine that has the potential to limit demyelination and oligodendrocyte loss in CNS autoimmune diseases and to affect the T-cell mediated autoimmune response. In this study SJL/J mice, induced for EAE, were treated with a HSV-LIF vector intracranially and the subsequent changes in disease parameters and immune responses during the acute disease were investigated. Replicating HSV-LIF and its DNA were detected in the CNS during the acute infection, and the vector spread to the spinal cord but was non-virulent. The HSV-LIF significantly ameliorated the EAE and contributed to a higher number of oligodendrocytes in the brains when compared to untreated mice. The HSV-LIF therapy also induced favorable changes in the expression of immunoregulatory cytokines and T-cell population markers in the CNS during the acute disease. These data suggest that BAC-derived HSV vectors are suitable for gene therapy of CNS disease and can be used to test the therapeutic potential of immunomodulatory factors for treatment of EAE. PMID:23700462
Ding, Jiaqi; Chen, Xiaoli; Lin, Jiaji; Zhu, Junling; Li, Zhuyi
2018-01-01
Objective To study the effects of dopamine receptor D2 (DRD2) on the adipogenesis genes in mouse primary mesencephalic neurons. Methods The lentiviral vectors which expressed specific shRNA targeting DRD2 were constructed to decrease DRD2 expression in mouse primary mesencephalic neurons. High throughput sequencing (HTS) analysis was used to investigate gene expression changes between the DRD2 knock-down group and the negative control group. Real-time quantitative PCR (qRT-PCR) and Western blot analysis were applied to verify the differently expressed genes. Fatty acids were measured by fatty acid detection kit. Results DRD2 expression was effectively down-regulated in mouse primary mesencephalic neurons by lentiviral vectors. HTS revealed adipogenesis genes were significantly up-regulated after DRD2 down-regulation, mainly including delta(14)-sterol reductase, acetyl-coenzyme A synthetase, insulin-induced gene 1 protein and especially stearoyl-coenzyme A desaturase 1 (SCD1, 4-fold upregulated). The qRT-PCR and Western blot analysis verified that SCD1 was upregulated 2.6 folds and 2 folds respectively by lentiviral DRD2-shRNA vectors. Moreover, the SCD1-related free fatty acids were significantly more increased than the negative control group. Conclusion DRD2 in primary mesencephalic neurons had a significant regulative effect on the adipogenesis genes. The up-regulation of SCD1 can accelerate the conversion of saturated fatty acids to monounsaturated fatty acids and prevent the damage of lipid toxicity to cells.
Nayduch, Dana; Lee, Matthew B; Saski, Christopher A
2014-01-01
Unlike other important vectors such as mosquitoes and sandflies, genetic and genomic tools for Culicoides biting midges are lacking, despite the fact that they vector a large number of arboviruses and other pathogens impacting humans and domestic animals world-wide. In North America, female Culicoides sonorensis midges are important vectors of bluetongue virus (BTV) and epizootic hemorrhagic disease virus (EHDV), orbiviruses that cause significant disease in livestock and wildlife. Libraries of tissue-specific transcripts expressed in response to feeding and oral orbivirus challenge in C. sonorensis have previously been reported, but extensive genome-wide expression profiling in the midge has not. Here, we successfully used deep sequencing technologies to construct the first adult female C. sonorensis reference transcriptome, and utilized genome-wide expression profiling to elucidate the genetic response to blood and sucrose feeding over time. The adult female midge unigene consists of 19,041 genes, of which less than 7% are differentially expressed during the course of a sucrose meal, while up to 52% of the genes respond significantly in blood-fed midges, indicating hematophagy induces complex physiological processes. Many genes that were differentially expressed during blood feeding were associated with digestion (e.g. proteases, lipases), hematophagy (e.g., salivary proteins), and vitellogenesis, revealing many major metabolic and biological factors underlying these critical processes. Additionally, key genes in the vitellogenesis pathway were identified, which provides the first glimpse into the molecular basis of anautogeny for C. sonorensis. This is the first extensive transcriptome for this genus, which will serve as a framework for future expression studies, RNAi, and provide a rich dataset contributing to the ultimate goal of informing a reference genome assembly and annotation. Moreover, this study will serve as a foundation for subsequent studies of genome-wide expression analyses during early orbivirus infection and dissecting the molecular mechanisms behind vector competence in midges.
White, April F; Mazur, Marina; Sorscher, Eric J; Zinn, Kurt R; Ponnazhagan, Selvarangan
2008-12-01
Cystic fibrosis (CF) is a common genetic disease characterized by defects in the expression of the CF transmembrane conductance regulator (CFTR) gene. Gene therapy offers better hope for the treatment of CF. Adeno-associated viral (AAV) vectors are capable of stable expression with low immunogenicity. Despite their potential in CF gene therapy, gene transfer efficiency by AAV is limited because of pathophysiological barriers in these patients. Although a few AAV serotypes have shown better transduction compared with the AAV2-based vectors, gene transfer efficiency in human airway epithelium has still not reached therapeutic levels. To engineer better AAV vectors for enhanced gene delivery in human airway epithelium, we developed and characterized mutant AAV vectors by genetic capsid modification, modeling the well-characterized AAV2 serotype. We genetically incorporated putative high-affinity peptide ligands to human airway epithelium on the GH loop region of AAV2 capsid protein. Six independent mutant AAV were constructed, containing peptide ligands previously reported to bind with high affinity for known and unknown receptors on human airway epithelial cells. The vectors were tested on nonairway cells and nonpolarized and polarized human airway epithelial cells for enhanced infectivity. One of the mutant vectors, with the peptide sequence THALWHT, not only showed the highest transduction in undifferentiated human airway epithelial cells but also indicated significant transduction in polarized cells. Interestingly, this modified vector was also able to infect cells independently of the heparan sulfate proteoglycan receptor. Incorporation of this ligand on other AAV serotypes, which have shown improved gene transfer efficiency in the human airway epithelium, may enhance the application of AAV vectors in CF gene therapy.
Shi, Xue; Zeng, Haiyang; Xue, Yadong; Luo, Meizhong
2011-10-11
Large-insert BAC and BIBAC libraries are important tools for structural and functional genomics studies of eukaryotic genomes. To facilitate the construction of BAC and BIBAC libraries and the transfer of complete large BAC inserts into BIBAC vectors, which is desired in positional cloning, we developed a pair of new BAC and BIBAC vectors. The new BAC vector pIndigoBAC536-S and the new BIBAC vector BIBAC-S have the following features: 1) both contain two 18-bp non-palindromic I-SceI sites in an inverted orientation at positions that flank an identical DNA fragment containing the lacZ selection marker and the cloning site. Large DNA inserts can be excised from the vectors as single fragments by cutting with I-SceI, allowing the inserts to be easily sized. More importantly, because the two vectors contain different antibiotic resistance genes for transformant selection and produce the same non-complementary 3' protruding ATAA ends by I-SceI that suppress self- and inter-ligations, the exchange of intact large genomic DNA inserts between the BAC and BIBAC vectors is straightforward; 2) both were constructed as high-copy composite vectors. Reliable linearized and dephosphorylated original low-copy pIndigoBAC536-S and BIBAC-S vectors that are ready for library construction can be prepared from the high-copy composite vectors pHZAUBAC1 and pHZAUBIBAC1, respectively, without the need for additional preparation steps or special reagents, thus simplifying the construction of BAC and BIBAC libraries. BIBAC clones constructed with the new BIBAC-S vector are stable in both E. coli and Agrobacterium. The vectors can be accessed through our website http://GResource.hzau.edu.cn. The two new vectors and their respective high-copy composite vectors can largely facilitate the construction and characterization of BAC and BIBAC libraries. The transfer of complete large genomic DNA inserts from one vector to the other is made straightforward.
Construction of a functional silk-based biomaterial complex with immortalized chondrocytes in vivo.
Ni, Yusu; Jiang, Yi; Wen, Jianchuan; Shao, Zhenzhong; Chen, Xin; Sun, Shan; Yu, Huiqian; Li, Wen
2014-04-01
To explore the feasibility of constructing a functional biomaterial complex with regenerated silk fibroin membrane and immortalized chondrocytes in vivo. Rat auricular chondrocytes (RACs) were transfected with the lentivirus vector pGC-FU-hTERT-3FLAG or pGC-FU-GFP-3FLAG, encoding the human telomerase reverse transcriptase (hTERT) or GFP gene. The effects of regenerated silk fibroin film on the adhesion, growth of immortalized chondrocytes and expression of collagen II in vitro were analyzed with immunofluorescent histochemistry. Immortalized RACs were transformed. Induction by nutrient medium promoted higher expression levels of collagen II in transformed chondrocytes. The regenerated silk fibroin film was not cytotoxic to immortalized chondrocytes and had no adverse influence on their adhesion. Collagen II expression was good in the immortalized chondrocytes in vivo. The construction of a silk-based biomaterial complex with immortalized chondrocytes may provide a feasible kind of functional biomaterial for the repair of cartilage defects in clinical applications. Copyright © 2013 Wiley Periodicals, Inc.
Li, Yan-Jie; Cao, Jiang; Chen, Chong; Wang, Dong-Yang; Zeng, Ling-Yu; Pan, Xiu-Ying; Xu, Kai-Lin
2010-02-01
This study was purposed to construct a lentiviral vector encoding red fluorescent protein (DsRed) and transfect DsRed into EL4 cells for establishing mouse leukemia/lymphoma model expressing DsRed. The bicistronic SIN lentiviral transfer plasmid containing the genes encoding neo and internal ribosomal entry site-red fluorescent protein (IRES-DsRed) was constructed. Human embryonic kidney 293FT cells were co-transfected with the three plasmids by liposome method. The viral particles were collected and used to transfect EL4 cells, then the cells were selected by G418. The results showed that the plasmid pXZ208-neo-IRES-DsRed was constructed successfully, and the viral titer reached to 10(6) U/ml. EL4 cells were transfected by the viral solution efficiently. The transfected EL4 cells expressing DsRed survived in the final concentration 600 microg/ml of G418. The expression of DsRed in the transfected EL4 cells was demonstrated by fluorescence microscopy and flow cytometry. In conclusion, the EL4/DsRed cell line was established successfully.
Peripheral infrastructure vectors and an extended set of plant parts for the Modular Cloning system
Kretschmer, Carola; Gruetzner, Ramona; Löfke, Christian; Dagdas, Yasin; Bürstenbinder, Katharina; Marillonnet, Sylvestre
2018-01-01
Standardized DNA assembly strategies facilitate the generation of multigene constructs from collections of building blocks in plant synthetic biology. A common syntax for hierarchical DNA assembly following the Golden Gate principle employing Type IIs restriction endonucleases was recently developed, and underlies the Modular Cloning and GoldenBraid systems. In these systems, transcriptional units and/or multigene constructs are assembled from libraries of standardized building blocks, also referred to as phytobricks, in several hierarchical levels and by iterative Golden Gate reactions. Here, a toolkit containing further modules for the novel DNA assembly standards was developed. Intended for use with Modular Cloning, most modules are also compatible with GoldenBraid. Firstly, a collection of approximately 80 additional phytobricks is provided, comprising e.g. modules for inducible expression systems, promoters or epitope tags. Furthermore, DNA modules were developed for connecting Modular Cloning and Gateway cloning, either for toggling between systems or for standardized Gateway destination vector assembly. Finally, first instances of a “peripheral infrastructure” around Modular Cloning are presented: While available toolkits are designed for the assembly of plant transformation constructs, vectors were created to also use coding sequence-containing phytobricks directly in yeast two hybrid interaction or bacterial infection assays. The presented material will further enhance versatility of hierarchical DNA assembly strategies. PMID:29847550
Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan
2017-08-03
One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.
Perturbative matching of lattice and continuum heavy-light currents with NRQCD heavy quarks
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morningstar, C.J.; Shigemitsu, J.
1999-05-01
The temporal and spatial components of the heavy-light vector current and the spatial components of the axial-vector current are expressed in terms of lattice-regulated operators suitable for simulations of {ital B} and {ital D} mesons. The currents are constructed by matching the appropriate scattering amplitudes in continuum QCD and a lattice model to one-loop order in perturbation theory. In the lattice theory, the heavy quarks are treated using the nonrelativistic (NRQCD) formulation and the light quarks are described by the tadpole-improved clover action. The light quarks are treated as massless. Our currents include relativistic and discretization corrections through O({alpha}{sub s}/M,a{alpha}{submore » s}), where {ital M} is the heavy-quark mass, {ital a} is the lattice spacing, and {alpha}{sub s} is the QCD coupling. As in our previous construction of the temporal component of the heavy-light axial-vector current, mixing between several lattice operators is encountered at one-loop order, and O(a{alpha}{sub s}) dimension-four improvement terms are identified. {copyright} {ital 1999} {ital The American Physical Society}« less
NASA Astrophysics Data System (ADS)
Li, Junbo; Wu, Wenlan; Gao, Jiayu; Liang, Ju; Zhou, Huiyun; Liang, Lijuan
2017-03-01
Synthesized vectors with nanoscale size and stable colloid dispersion are highly desirable for improving gene delivery efficiency. Here, a core-shell template particle was constructed with polyethylene glycol- b-poly1-(3-aminopropyl)-3-(2-methacryloyloxy propylimidazolium bromine) (PEG- b-PAMPImB) coating gold nanoparticles (PEG- b-PAMPImB-@-Au NPs) for loading DNA and delivering in vitro. Data from transmission electron microscopy (TEM) and dynamic light scattering (DLS) suggest that these nanoplexes, by forming an electrostatic complex with DNA at the inner PAMPImB shell, offer steric protection for the outer PEG corona leading to single dispersion and small size. Notably, higher colloid stability and lower cytotoxicity were achieved with these nanoplexes when compared with PAMPImB monolayer-coated gold nanoparticles (Au NPs). Confocal laser scanning microscopy and intracellular trafficking TEM further indicate that the nanoplexes can translocate across the cell membrane and partly enter the nucleus for high efficient expression. Thus, template assembly represents a promising approach to control the size and colloid stability of gene vectors and ensure safety and efficiency of DNA delivery.
Jin, Erqing; Wong, Lynn; Jiao, Yun; Engel, Jake; Holdridge, Benjamin; Xu, Peng
2017-12-01
Engineering cell factories for producing biofuels and pharmaceuticals has spurred great interests to develop rapid and efficient synthetic biology tools customized for modular pathway engineering. Along the way, combinatorial gene expression control through modification of regulatory element offered tremendous opportunity for fine-tuning gene expression and generating digital-like genetic circuits. In this report, we present an efficient evolutionary approach to build a range of regulatory control elements. The reported method allows for rapid construction of promoter, 5'UTR, terminator and trans -activating RNA libraries. Synthetic overlapping oligos with high portion of degenerate nucleotides flanking the regulatory element could be efficiently assembled to a vector expressing fluorescence reporter. This approach combines high mutation rate of the synthetic DNA with the high assembly efficiency of Gibson Mix. Our constructed library demonstrates broad range of transcriptional or translational gene expression dynamics. Specifically, both the promoter library and 5'UTR library exhibits gene expression dynamics spanning across three order of magnitude. The terminator library and trans -activating RNA library displays relatively narrowed gene expression pattern. The reported study provides a versatile toolbox for rapidly constructing a large family of prokaryotic regulatory elements. These libraries also facilitate the implementation of combinatorial pathway engineering principles and the engineering of more efficient microbial cell factory for various biomanufacturing applications.
Zhang, Yuan; Qiao, Lei; Hu, Xiao; Zhao, Kang; Zhang, Yanwen; Chai, Feng; Pan, Zishu
2016-01-04
Baculovirus has been exploited for use as a novel vaccine vector. To investigate the feasibility and efficacy of recombinant baculoviruses (rBVs) expressing respiratory syncytial virus (RSV) fusion (F) proteins, four constructs (Bac-tF/64, Bac-CF, Bac-CF/tF64 and Bac-CF/tF64-VISA) were generated. Bac-tF64 displays the F ectodomain (tF) on the envelope of rBVs, whereas Bac-CF expresses full-length F protein in transduced mammalian cells. Bac-CF/tF64 not only displays tF on the envelope but also expresses F in cells. Bac-CF/tF64-VISA comprises Bac-CF/tF64 harboring the virus-induced signaling adaptor (VISA) gene. After administration to BALB/c mice, all four vectors elicited RSV neutralizing antibody (Ab), systemic Ab (IgG, IgG1, and IgG2a), and cytokine responses. Compared with Bac-tF64, mice inoculated with Bac-CF and Bac-CF/tF64 exhibited an increased mixed Th1/Th2 cytokine response, increased ratios of IgG2a/IgG1 antibody responses, and reduced immunopathology upon RSV challenge. Intriguingly, co-expression of VISA reduced Th2 cytokine (IL-4, IL-5, and IL-10) production induced by Bac-CF/tF64, thus relieving lung pathology upon a subsequent RSV challenge. Our results indicated that the Bac-CF/tF64 vector incorporated with the VISA molecule may provide an effective vaccine strategy for protection against RSV. Copyright © 2015 Elsevier Ltd. All rights reserved.
Highly repressible expression system for cloning genes that specify potentially toxic proteins.
O'Connor, C D; Timmis, K N
1987-01-01
A highly repressible expression vector system that allows the cloning of potentially deleterious genes has been constructed. Undesired expression of a cloned gene was prevented (i) at the level of initiation of transcription, by the presence of the strong but highly repressible leftward promoter of bacteriophage lambda, lambda pL, and (ii) at the level of transcript elongation or translation, through synthesis of antisense RNA complementary to the mRNA of the cloned gene. The system was tested by measuring the inhibition of expression of traT, the gene for the TraT major outer membrane lipoprotein. Direct detection and functional assays indicated that an essentially complete inhibition of traT expression was obtained. As a further test of the system, the gene encoding the EcoRI restriction endonuclease was cloned in the absence of the gene of the corresponding protective EcoRI modification methylase. Transformants harboring this construct were only viable when both repression controls were operational. Images PMID:2443481
A simple and reliable multi-gene transformation method for switchgrass.
Ogawa, Yoichi; Shirakawa, Makoto; Koumoto, Yasuko; Honda, Masaho; Asami, Yuki; Kondo, Yasuhiro; Hara-Nishimura, Ikuko
2014-07-01
A simple and reliable Agrobacterium -mediated transformation method was developed for switchgrass. Using this method, many transgenic plants carrying multiple genes-of-interest could be produced without untransformed escape. Switchgrass (Panicum virgatum L.) is a promising biomass crop for bioenergy. To obtain transgenic switchgrass plants carrying a multi-gene trait in a simple manner, an Agrobacterium-mediated transformation method was established by constructing a Gateway-based binary vector, optimizing transformation conditions and developing a novel selection method. A MultiRound Gateway-compatible destination binary vector carrying the bar selectable marker gene, pHKGB110, was constructed to introduce multiple genes of interest in a single transformation. Two reporter gene expression cassettes, GUSPlus and gfp, were constructed independently on two entry vectors and then introduced into a single T-DNA region of pHKGB110 via sequential LR reactions. Agrobacterium tumefaciens EHA101 carrying the resultant binary vector pHKGB112 and caryopsis-derived compact embryogenic calli were used for transformation experiments. Prolonged cocultivation for 7 days followed by cultivation on media containing meropenem improved transformation efficiency without overgrowth of Agrobacterium, which was, however, not inhibited by cefotaxime or Timentin. In addition, untransformed escape shoots were completely eliminated during the rooting stage by direct dipping the putatively transformed shoots into the herbicide Basta solution for a few seconds, designated as the 'herbicide dipping method'. It was also demonstrated that more than 90 % of the bar-positive transformants carried both reporters delivered from pHKGB112. This simple and reliable transformation method, which incorporates a new selection technique and the use of a MultiRound Gateway-based binary vector, would be suitable for producing a large number of transgenic lines carrying multiple genes.
The tripartite leader sequence is required for ectopic expression of HAdV-B and HAdV-E E3 CR1 genes.
Bair, Camden R; Kotha Lakshmi Narayan, Poornima; Kajon, Adriana E
2017-05-01
The unique repertoire of genes that characterizes the early region 3 (E3) of the different species of human adenovirus (HAdV) likely contributes to their distinct pathogenic traits. The function of many E3 CR1 proteins remains unknown possibly due to unidentified intrinsic properties that make them difficult to express ectopically. This study shows that the species HAdV-B- and HAdV-E-specific E3 CR1 genes can be expressed from vectors carrying the HAdV tripartite leader (TPL) sequence but not from traditional mammalian expression vectors. Insertion of the TPL sequence upstream of the HAdV-B and HAdV-E E3 CR1 open reading frames was sufficient to rescue protein expression from pCI-neo constructs in transfected 293T cells. The detection of higher levels of HAdV-B and HAdV-E E3 CR1 transcripts suggests that the TPL sequence may enhance gene expression at both the transcriptional and translational levels. Our findings will facilitate the characterization of additional AdV E3 proteins. Copyright © 2017 Elsevier Inc. All rights reserved.
Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich
2005-12-01
Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.
Kanno, Alex I; Goulart, Cibelly; Rofatto, Henrique K; Oliveira, Sergio C; Leite, Luciana C C; McFadden, Johnjoe
2016-04-01
The expression of many antigens, stimulatory molecules, or even metabolic pathways in mycobacteria such as Mycobacterium bovis BCG or M. smegmatis was made possible through the development of shuttle vectors, and several recombinant vaccines have been constructed. However, gene expression in any of these systems relied mostly on the selection of natural promoters expected to provide the required level of expression by trial and error. To establish a systematic selection of promoters with a range of strengths, we generated a library of mutagenized promoters through error-prone PCR of the strong PL5 promoter, originally from mycobacteriophage L5. These promoters were cloned upstream of the enhanced green fluorescent protein reporter gene, and recombinant M. smegmatis bacteria exhibiting a wide range of fluorescence levels were identified. A set of promoters was selected and identified as having high (pJK-F8), intermediate (pJK-B7, pJK-E6, pJK-D6), or low (pJK-C1) promoter strengths in both M. smegmatis and M. bovisBCG. The sequencing of the promoter region demonstrated that it was extensively modified (6 to 11%) in all of the plasmids selected. To test the functionality of the system, two different expression vectors were demonstrated to allow corresponding expression levels of the Schistosoma mansoni antigen Sm29 in BCG. The approach used here can be used to adjust expression levels for synthetic and/or systems biology studies or for vaccine development to maximize the immune response. Copyright © 2016 Kanno et al.
Expression and activity analysis of a new fusion protein targeting ovarian cancer cells.
Su, Manman; Chang, Weiqin; Wang, Dingding; Cui, Manhua; Lin, Yang; Wu, Shuying; Xu, Tianmin
2015-09-01
The aim of the present study was to develop a new therapeutic drug to improve the prognosis of ovarian cancer patients. Human urokinase-type plasminogen activator (uPA)17-34-kunitz-type protease inhibitor (KPI) eukaryotic expression vector was constructed and recombinant human uPA17-34-KPI (rhuPA17-34-KPI) in P. pastoris was expressed. In the present study, the DNA sequences that encode uPA 17-34 amino acids were created according to the native amino acids sequence and inserted into the KPI-pPICZαC vector, which was constructed. Then, uPA17‑34-KPI-pPICZαC was transformed into P. pastoris X-33, and rhuPA17-34-KPI was expressed by induction of methanol. The bioactivities of a recombinant fusion protein were detected with trypsin inhibition analysis, and the inhibitory effects on the growth of ovarian cancer cells were identified using the TUNEL assay, in vitro wound‑healing assay and Matrigel model analysis. The results of the DNA sequence analysis of the recombinant vector uPA17-34-KPI‑pPICZα demonstrated that the DNA‑encoding human uPA 17-34 amino acids, 285-288 amino acids of amyloid precursor protein (APP) and 1-57 amino acids of KPI were correctly inserted into the pPICZαC vector. Following induction by methonal, the fusion protein with a molecular weight of 8.8 kDa was observed using SDS-PAGE and western blot analysis. RhuPA17-34-KPI was expressed in P. pastoris with a yield of 50 mg/l in a 50-ml tube. The recombinant fusion protein was able to inhibit the activity of trypsin, inhibit growth and induce apoptosis of SKOV3 cells, and inhibit the invasion and metastasis of ovarian cancer cells. By considering uPA17-34 amino acid specific binding uPAR as the targeted part of fusion protein and utilizing the serine protease inhibitor activity of KPI, it was found that the recombinant fusion protein uPA17-34-KPI inhibited the invasion and metastasis of ovarian tumors, and may therefore be regarded as effective in targeted treatment.
Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo
2015-01-01
To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.
Kerekov, Nikola S; Ivanova, Iva I; Mihaylova, Nikolina M; Nikolova, Maria; Prechl, Jozsef; Tchorbanov, Andrey I
2014-10-01
Highly purified, subunit, or synthetic viral antigens are known to be weakly immunogenic and potentate only the antibody, rather than cell-mediated immune responses. An alternative approach for inducing protective immunity with small viral peptides would be the direct targeting of viral epitopes to the immunocompetent cells by DNA vaccines encoding antibody fragments specific to activating cell surface co-receptor molecules. Here, we are exploring as a new genetic vaccine, a DNA chimeric molecule encoding a T and B cell epitope-containing influenza A virus hemagglutinin peptide joined to sequences encoding a single-chain variable fragment antibody fragment specific for the costimulatory B cell complement receptors 1 and 2. This recombinant DNA molecule was inserted into eukaryotic expression vector and used as a naked DNA vaccine in WT and CR1/2 KO mice. The intramuscular administration of the DNA construct resulted in the in vivo expression of an immunogenic chimeric protein, which cross-links cell surface receptors on influenza-specific B cells. The DNA vaccination was followed by prime-boosting with the protein-engineered replica of the DNA construct, thus delivering an activation intracellular signal. Immunization with an expression vector containing the described construct and boosting with the protein chimera induced a strong anti-influenza cytotoxic response, modulation of cytokine profile, and a weak antibody response in Balb/c mice. The same immunization scheme did not result in generation of influenza-specific response in mice lacking the target receptor, underlining the molecular adjuvant effect of receptor targeting.
Chen, Bao-an; Mao, Pei-pei; Cheng, Jian; Gao, Feng; Xia, Guo-hua; Xu, Wen-lin; Shen, Hui-lin; Ding, Jia-hua; Gao, Chong; Sun, Qian; Chen, Wen-ji; Chen, Ning-na; Liu, Li-jie; Li, Xiao-mao; Wang, Xue-mei
2010-08-09
In many instances, multidrug resistance (MDR) is mediated by increasing the expression at the cell surface of the MDR1 gene product, P-glycoprotein (P-gp), a 170-kD energy-dependent efflux pump. The aim of this study was to investigate the potential benefit of combination therapy with magnetic Fe(3)O(4) nanoparticle [MNP (Fe(3)O(4))] and MDR1 shRNA expression vector in K562/A02 cells. For stable reversal of "classical" MDR by short hairpin RNA (shRNA) aiming directly at the target sequence (3491-3509, 1539-1557, and 3103-3121 nucleotide) of MDR1 mRNA. PGC silencer-U6-neo-GFP-shRNA/MDR1 called PGY1-1, PGY1-2, and PGY1-3 were constructed and transfected into K562/A02 cells by lipofectamine 2000. After transfected and incubated with or without MNP (Fe(3)O(4)) for 48 hours, the transcription of MDR1 mRNA and the expression of P-gp were detected by quantitative real-time PCR and Western-blot assay respectively. Meanwhile intracellular concentration of DNR in K562/A02 cells was detected by flow cytometry (FCM). PGC silencer-U6-neo-GFP-shRNA/MDR1 was successfully constructed, which was confirmed by sequencing and PGY1-2 had the greatest MDR1 gene inhibitory ratio. Analysis of the reversal ratio of MDR, the concentration of daunorubicin (DNR) and the transcription of MDR1 gene and expression of P-gp in K562/A02 showed that combination of DNR with either MNP (Fe(3)O(4)) or PGY1-2 exerted a potent cytotoxic effect on K562/A02 cells, while combination of MNP (Fe(3)O(4)) and PGY1-2 could synergistically reverse multidrug resistance. Thus our in vitro data strongly suggested that a combination of MNP (Fe(3)O(4)) and shRNA expression vector might be a more sufficient and less toxic anti-MDR method on leukemia.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li Hongwei; Department of Neurological Surgery, University of Virginia Health System, Charlottesville, VA 22908; Li Jinzhong
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of themore » luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.« less
Shen, Yang; Ai, Hong-Xin; Song, Ren; Liang, Zhen-Ning; Li, Jian-Feng; Zhang, Shuang-Quan
2010-10-20
Different strategies have been developed to produce small antimicrobial peptides using recombinant techniques. Here we report a new technology of biosynthesis of moricin CM4 and human β-defensins 4 (HβD4) in the Escherichia coli. The CM4 and HβD4 gene were cloned into a vector containing the tags elastin-like peptide (ELP) and intein to construct the expression vector pET-EI-CM4 and pET-EI-HβD4. All the peptides, expressed as soluble fusions, were isolated from the protein debris by the method called inverse transition cycling (ITC) rather than traditional immobilized metal affinity chromatography (IMAC) and separated from the fusion leader by self-cleavage. Fully reduced peptides that were purified exhibited expected antimicrobial activity. The approach described here is a low-cost, convenient and potential way for generating small antimicrobial peptide. Copyright © 2010 Elsevier GmbH. All rights reserved.
Production and purification of non replicative canine adenovirus type 2 derived vectors.
Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard
2013-12-03
Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.
Wang, H; Miao, S; Chen, D; Wang, L; Koide, S S
1999-10-06
The gene (HSD-1) coding a human sperm membrane protein (hSMP-1) was isolated from a human testis cDNA expression library using antibodies found in the serum of an infertile woman. HSD-1 was localized to a single locus on chromosome 9 and assigned to band 9p12-p13 by fluorescent in situ hybridization (FISH) mapping and DAPI (4,6-diamidino-2-phenylindole) banding, using rat/human somatic cell hybrids and metaphase chromosomes of human lymphocytes. In rescreening a testis lambdagt10 cDNA expression library, the full-length cDNA (HSD-1) and several truncated cDNAs with heterologous regions were isolated from positive clones. The heterology consisted of deletion, insertion and alteration of the 5'-end. These heterologous truncated fragments may be produced by alternative splicing of mRNAs. Two recombinant prokaryotic expression vectors were constructed with one of the heterologous fragment (clone #26) with and without the alternative 5'-end. Escherichia coli transfected with the construct containing the alternative 5'-end failed to produce the recombinant product, whereas those transfected with the vector lacking the 5'-end produced hSMP-1. DNASIS analysis of the structure of #26 mRNA suggests that the 5'-end has a stable secondary configuration that may maintain the mRNA in an inactivated state, whereby hindering its translation and preventing the expression of the gene.
Integrability of geodesics and action-angle variables in Sasaki-Einstein space T^{1,1}
NASA Astrophysics Data System (ADS)
Visinescu, Mihai
2016-09-01
We briefly describe the construction of Stäkel-Killing and Killing-Yano tensors on toric Sasaki-Einstein manifolds without working out intricate generalized Killing equations. The integrals of geodesic motions are expressed in terms of Killing vectors and Killing-Yano tensors of the homogeneous Sasaki-Einstein space T^{1,1}. We discuss the integrability of geodesics and construct explicitly the action-angle variables. Two pairs of frequencies of the geodesic motions are resonant giving way to chaotic behavior when the system is perturbed.
Xue, Qing-Jie; Dai, Jun; Li, Xiu-Zhen; Zhu, Wei; Si, Chuan-Ping; Chen, Ting
2014-10-01
The signal peptide Ag85B of Bacillus Chalmette-Guerin (BCG) was used to construct a recombinant plasmid of BCG. The BCG-Ag85B gene and fused EBV LMP2A and BZLF1 genes were amplified and successively inserted into the Escherichia coli-BCG shuttle-vector pMV261. The recombinant plasmids were then amplified in E. coli DH5α and transformed into competent BCG. The expression of BZLF1 and LMP2A fusion proteins in recombinant-BCG (rBCG) was shown by Western blot. After the injection of recombinant-BCG into mice, antibodies against the fusion protein BZLF1 and LMP2A were measured by ELISA, and the cellular immune effects were determined by the lactate dehydrogenate (LDH) release assays. The results confirmed that the cloned genes of BCG-Ag85B and Z2A were correctly inserted into the vector pMV261. The recombinant plasmid pMVZ2A expressed Z2A in BCG effectively after transformation. The rBCG proteins were recognized by the BZLF1 (LMP2A) antibody. An ELISA demonstrated that rBCG could stimulate the generation of antibody against the fusion protein. The fusion gene was constructed successfully, and the rBCG induced humoral and cellular immune response in mice. © 2014 Wiley Periodicals, Inc.
A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants[OPEN
Gil-Humanes, Javier; Čegan, Radim; Kono, Thomas J.Y.; Konečná, Eva; Belanto, Joseph J.; Starker, Colby G.
2017-01-01
We report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A Web-based tool streamlines vector selection and construction. One advantage of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 (Csy4) and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing 12 gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare). PMID:28522548
A multi-purpose toolkit to enable advanced genome engineering in plants
Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier; ...
2017-05-18
Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less
A multi-purpose toolkit to enable advanced genome engineering in plants
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier
Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less
Zhang, Q; Zhu, M W; Yang, Y Q; Shao, M; Zhang, Z Y; Lan, H Y; Yan, W Y; Wu, J J; Zheng, Z X
2003-01-01
On the basis of amino acid (aa) sequence of the tandem repeat 133-158-20-34-133-158 which consisted of aa 133-158 of VP1 and aa 20-34 of VP4 of Foot-and-mouth disease virus (FMDV) type Asia 1 a recombinant prokaryotic expression vector pAS1-P encoding a fusion protein and eukaryotic expression vectors pAS1-E and pAS1-EdeltaCpG-ODN representing DNA vaccines were constructed. Guinea pigs immunized with these vaccines showed both neutralizing antibody and T cell proliferation responses. FMDV challenge tests for the first time showed that the recombinant fusion protein and pAS1-E and pAS1-EdeltaCpG-ODN vaccines protected 86%, 60% and 43% of guinea pigs from FMDV type Asia1 challenge, respectively. The results also indicated that the immune response of animals treated with the vector pAS1-E containing an oligodeoxynucleotide (ODN), which consisted of immunostimulatory cytosine-phosphate-guanosine (CpG) motifs, was augmented by CpG ODN.
Construction and characterization of recombinant adenovirus carrying a mouse TIGIT-GFP gene.
Zheng, J M; Cui, J L; He, W T; Yu, D W; Gao, Y; Wang, L; Chen, Z K; Zhou, H M
2015-12-29
Recombinant adenovirus vector systems have been used extensively in protein research and gene therapy. However, the construction and characterization of recombinant adenovirus is a tedious and time-consuming process. TIGIT is a recently discovered immunosuppressive molecule that plays an important role in maintaining immunological balance. The construction of recombinant adenovirus mediating TIGIT expression must be simplified to facilitate its use in the study of TIGIT. In this study, the TIGIT gene was combined with green fluorescent protein (GFP); the TIGIT-GFP gene was inserted into a gateway plasmid to construct a TIGIT-GFP adenovirus. HEK 293A cells were infected with the adenovirus, which was then purified and subjected to virus titering. TIGIT-GFP adenovirus was characterized by flow cytometry and immunofluorescence, and its expression in mouse liver was detected by infection through caudal vein injection. The results showed the successful construction of the TIGIT-GFP adenovirus (5 x 10(10) PFU/mL). Co-expression of TIGIT and GFP was identified in 293A and liver cells; synthesis and positioning of TIGIT-GFP was viewed under a fluorescence microscope. TIGIT-GFP was highly expressed on liver cells 1 day (25.53%) after infection and faded 3 days (11.36%) after injection. In conclusion, the fusion of TIGIT with GFP allows easy, rapid, and uncomplicated detection of TIGIT translation. The construction of a TIGIT-GFP adenovirus, mediating TIGIT expression in vitro and in vivo, lays the foundation for further research into TIGIT function and gene therapy. Moreover, the TIGIT-GFP adenovirus is a helpful tool for studying other proteins (which could replace the TIGIT gene).
A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.
Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu
2015-05-01
Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Ribosomal Binding Site Switching: An Effective Strategy for High-Throughput Cloning Constructions
Li, Yunlong; Zhang, Yong; Lu, Pei; Rayner, Simon; Chen, Shiyun
2012-01-01
Direct cloning of PCR fragments by TA cloning or blunt end ligation are two simple methods which would greatly benefit high-throughput (HTP) cloning constructions if the efficiency can be improved. In this study, we have developed a ribosomal binding site (RBS) switching strategy for direct cloning of PCR fragments. RBS is an A/G rich region upstream of the translational start codon and is essential for gene expression. Change from A/G to T/C in the RBS blocks its activity and thereby abolishes gene expression. Based on this property, we introduced an inactive RBS upstream of a selectable marker gene, and designed a fragment insertion site within this inactive RBS. Forward and reverse insertions of specifically tailed fragments will respectively form an active and inactive RBS, thus all background from vector self-ligation and fragment reverse insertions will be eliminated due to the non-expression of the marker gene. The effectiveness of our strategy for TA cloning and blunt end ligation are confirmed. Application of this strategy to gene over-expression, a bacterial two-hybrid system, a bacterial one-hybrid system, and promoter bank construction are also verified. The advantages of this simple procedure, together with its low cost and high efficiency, makes our strategy extremely useful in HTP cloning constructions. PMID:23185557
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Plasmodium parasite as an effective hepatocellular carcinoma antigen glypican-3 delivery vector.
Liu, Quan; Yang, Yijun; Tan, Xuefang; Tao, Zhu; Adah, Dickson; Yu, Songlin; Lu, Junnan; Zhao, Siting; Qin, Limei; Qin, Li; Chen, Xiaoping
2017-04-11
We have previously demonstrated that malaria parasite infection has an anti-tumor effect in a mouse model. This research aimed to investigate the possibility of using Plasmodium parasite as a novel vaccine vector for hepatocellular carcinoma (HCC) immunotherapy. We constructed a Plasmodium yoelii 17XNL strain (P.y) expressing murine glypican-3 (GPC3) protein (P.y-GPC3), and examined its therapeutic potency in a murine Hepa1-6-induced hepatoma model that highly expressed GPC3 protein. The prerequisites for invoking a CD8+ T cell response were assessed after P.y-based immunization, which included obviously increased concentrations of T helper cell type 1 (Th1)-associated cytokines, such as IL-2, IFN-γ and TNF-α, in serum and preferential expansion of the CD8α+ dendritic cell (DC) subset with higher expression of CD80 and CD86 molecules. Compared with uninfected and wild-type P.y-infected mice, a significant GPC3-specific cytotoxic T lymphocyte (CTL) response was detected in P.y-GPC3 vaccinated mice. Furthermore, P.y-GPC3-based vaccination dramatically inhibited Hepa1-6-induced tumor growth in the implanted HCC and prolonged the survival of tumor-bearing mice. We concluded that a Plasmodium-based vector is highly efficient in inducing tumor antigen-specific T cell-mediated immunity and protection against tumor cells. More broadly, this strategy supported our hypothesis that Plasmodium parasites, as novel therapeutic antigen vectors, may be applicable to tumor immunotherapy for patients with HCC.
A virus vector based on Canine Herpesvirus for vaccine applications in canids.
Strive, T; Hardy, C M; Wright, J; Reubel, G H
2007-01-31
Canine Herpesvirus (CHV) is being developed as a virus vector for the vaccination of European red foxes. However, initial studies using recombinant CHV vaccines in foxes revealed viral attenuation and lack of antibody response to inserted foreign antigens. These findings were attributed both to inactivation of the thymidine kinase (TK) gene and excess foreign genetic material in the recombinant viral genome. In this study, we report an improved CHV-bacterial artificial chromosome (BAC) vector system designed to overcome attenuation in foxes. A non-essential region was identified in the CHV genome as an alternative insertion site for foreign genes. Replacement of a guanine/cytosine (GC)-rich intergenic region between UL21 and UL22 of CHV with a marker gene did not change growth behaviour in vitro, showing that this region is not essential for virus growth in cell culture. We subsequently produced a CHV-BAC vector with an intact TK gene in which the bacterial genes and the antigen expression cassette were inserted into this GC-rich locus. Unlike earlier constructs, the new CHV-BAC allowed self-excision of the bacterial genes via homologous recombination after transfection of BACs into cell culture. The BAC-CHV system was used to produce a recombinant virus that constitutively expressed porcine zona pellucida subunit C protein between the UL21 and UL22 genes of CHV. Complete self-excision of the bacterial genes from CHV was achieved within one round of replication whilst retaining antigen gene expression.
Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou
2012-01-01
Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Abraitiene, Asta; US Department of Agriculture, Agricultural Research Service, Molecular Plant Pathology Laboratory, Room 214 Building 004 BARC-West, 10300 Baltimore Avenue, Beltsville, MD 20705; Zhao Yan
Transient expression of engineered reporter RNAs encoding an intron-containing green fluorescent protein (GFP) from a Potato virus X-based expression vector previously demonstrated the nuclear targeting capability of the 359 nucleotide Potato spindle tuber viroid (PSTVd) RNA genome. To further delimit the putative nuclear-targeting signal, PSTVd subgenomic fragments were embedded within the intron, and recombinant reporter RNAs were inoculated onto Nicotiana benthamiana plants. Appearance of green fluorescence in leaf tissue inoculated with PSTVd-fragment-containing constructs indicated shuttling of the RNA into the nucleus by fragments as short as 80 nucleotides in length. Plant-to-plant variation in the timing of intron removal and subsequentmore » GFP fluorescence was observed; however, earliest and most abundant GFP expression was obtained with constructs containing the conserved hairpin I palindrome structure and embedded upper central conserved region. Our results suggest that this conserved sequence and/or the stem-loop structure it forms is sufficient for import of PSTVd into the nucleus.« less
[The role of the serotonin system in the stress response of various cells
NASA Technical Reports Server (NTRS)
Belzhelarskaia, S. N.; Satton, F. F.; Sutton, F. (Principal Investigator)
2003-01-01
The recombinant mouse brain serotonin receptor (5HT1c) was used to study the response of plant cells and oocytes to a stress signal activated by the serotonin-serotonin receptor interaction and associated Ca2+ flow. Based on plant expression vectors, recombinant constructs were obtained to direct production of 5HT1c fused with the green fluorescent protein in plant cells. The mRNAs for hybrid proteins were synthesized in an in vitro transcription system. The expression and function of the hybrid protein and the function of the associated ion channels were electrophysiologically studied in Xenopus laevis oocytes injected with the hybrid mRNA. The hybrid protein was functional and changed the operation of the Ca2+ channel in oocytes. To study the expression of the hybrid constructs in plant cells, the in vitro transcription product was inoculated in tobacco leaves, which then fluoresced.
Panicali, D; Davis, S W; Weinberg, R L; Paoletti, E
1983-01-01
Recombinant vaccinia viruses containing the cloned hemagglutinin (HA) gene from influenza virus were constructed. The biological activity of these poxvirus vectors was demonstrated both in vitro and in vivo. Expression of HA in cells infected with recombinant vaccinia was detected by using specific anti-HA antiserum and 125I-labeled protein A, showing that HA synthesized under the regulation of vaccinia virus was antigenic. Immunization of rabbits with these recombinant poxviruses resulted in the production of antibodies reactive with authentic influenza HA as detected by radioimmunoassay, by inhibition of HA erythrocyte agglutination, and by neutralization of influenza virus infectivity. The production of antibodies directed against influenza HA suggested that the HA gene expressed in vaccinia is immunogenic. These data indicate the potential of genetically engineered poxviruses for use as generic live vaccine vehicles that have both human and veterinary applications. Images PMID:6310573
Expanding the genetic toolbox for Leptospira species by generation of fluorescent bacteria.
Aviat, Florence; Slamti, Leyla; Cerqueira, Gustavo M; Lourdault, Kristel; Picardeau, Mathieu
2010-12-01
Our knowledge of the genetics and molecular basis of the pathogenesis associated with Leptospira, in comparison to those of other bacterial species, is very limited. An improved understanding of pathogenic mechanisms requires reliable genetic tools for functional genetic analysis. Here, we report the expression of gfp and mRFP1 genes under the control of constitutive spirochetal promoters in both saprophytic and pathogenic Leptospira strains. We were able to reliably measure the fluorescence of Leptospira by fluorescence microscopy and a fluorometric microplate reader-based assay. We showed that the expression of the gfp gene had no significant effects on growth in vivo and pathogenicity in L. interrogans. We constructed an expression vector for L. biflexa that contains the lacI repressor, an inducible lac promoter, and gfp as the reporter, demonstrating that the lac system is functional in Leptospira. Green fluorescent protein (GFP) expression was induced by the addition of isopropyl-β-d-thiogalactopyranoside (IPTG) in L. biflexa transformants harboring the expression vector. Finally, we showed that GFP can be used as a reporter to assess promoter activity in different environmental conditions. These results may facilitate further advances for studying the genetics of Leptospira spp.
NASA Astrophysics Data System (ADS)
Sauter, Bernhard V.; Martinet, Olivier; Zhang, Wei-Jian; Mandeli, John; Woo, Savio L. C.
2000-04-01
Inhibition of angiogenesis has been shown to be an effective strategy in cancer therapy in mice. However, its widespread application has been hampered by difficulties in the large-scale production of the antiangiogenic proteins. This limitation may be resolved by in vivo delivery and expression of the antiangiogenic genes. We have constructed a recombinant adenovirus that expresses murine endostatin that is biologically active both in vitro, as determined in endothelial cell proliferation assays, and in vivo, by suppression of angiogenesis induced by vascular endothelial growth factor 165. Persistent high serum levels of endostatin (605-1740 ng/ml; mean, 936 ng/ml) were achieved after systemic administration of the vector to nude mice, which resulted in significant reduction of the growth rates and the volumes of JC breast carcinoma and Lewis lung carcinoma (P < 0.001 and P < 0.05, respectively). In addition, the endostatin vector treatment completely prevented the formation of pulmonary micrometastases in Lewis lung carcinoma (P = 0.0001). Immunohistochemical staining of the tumors demonstrated a decreased number of blood vessels in the treatment group versus the controls. In conclusion, the present study clearly demonstrates the potential of vector-mediated antiangiogenic gene therapy as a component in cancer therapy.
Repressor-mediated tissue-specific gene expression in plants
Meagher, Richard B [Athens, GA; Balish, Rebecca S [Oxford, OH; Tehryung, Kim [Athens, GA; McKinney, Elizabeth C [Athens, GA
2009-02-17
Plant tissue specific gene expression by way of repressor-operator complexes, has enabled outcomes including, without limitation, male sterility and engineered plants having root-specific gene expression of relevant proteins to clean environmental pollutants from soil and water. A mercury hyperaccumulation strategy requires that mercuric ion reductase coding sequence is strongly expressed. The actin promoter vector, A2pot, engineered to contain bacterial lac operator sequences, directed strong expression in all plant vegetative organs and tissues. In contrast, the expression from the A2pot construct was restricted primarily to root tissues when a modified bacterial repressor (LacIn) was coexpressed from the light-regulated rubisco small subunit promoter in above-ground tissues. Also provided are analogous repressor operator complexes for selective expression in other plant tissues, for example, to produce male sterile plants.
Transient Tcf3 Gene Repression by TALE-Transcription Factor Targeting.
Masuda, Junko; Kawamoto, Hiroshi; Strober, Warren; Takayama, Eiji; Mizutani, Akifumi; Murakami, Hiroshi; Ikawa, Tomokatsu; Kitani, Atsushi; Maeno, Narumi; Shigehiro, Tsukasa; Satoh, Ayano; Seno, Akimasa; Arun, Vaidyanath; Kasai, Tomonari; Fuss, Ivan J; Katsura, Yoshimoto; Seno, Masaharu
2016-12-01
Transplantation of hematopoietic stem and progenitor cells (HSCs) i.e., self-renewing cells that retain multipotentiality, is now a widely performed therapy for many hematopoietic diseases. However, these cells are present in low number and are subject to replicative senescence after extraction; thus, the acquisition of sufficient numbers of cells for transplantation requires donors able to provide repetitive blood samples and/or methods of expanding cell numbers without disturbing cell multipotentiality. Previous studies have shown that HSCs maintain their multipotentiality and self-renewal activity if TCF3 transcription function is blocked under B cell differentiating conditions. Taking advantage of this finding to devise a new approach to HSC expansion in vitro, we constructed an episomal expression vector that specifically targets and transiently represses the TCF3 gene. This consisted of a vector encoding a transcription activator-like effector (TALE) fused to a Krüppel-associated box (KRAB) repressor. We showed that this TALE-KRAB vector repressed expression of an exogenous reporter gene in HEK293 and COS-7 cell lines and, more importantly, efficiently repressed endogenous TCF3 in a human B lymphoma cell line. These findings suggest that this vector can be used to maintain multipotentiality in HSC being subjected to a long-term expansion regimen prior to transplantation.
Analysis of protein function in clinical C. albicans isolates
Gerami-Nejad, Maryam; Forche, Anja; McClellan, Mark; Berman, Judith
2012-01-01
Clinical isolates are prototrophic and hence are not amenable to genetic manipulation using nutritional markers. Here we describe a new set of plasmids carrying the NAT1 (nourseothricin) drug resistance marker (Shen et al., 2005) that can be used both in clinical isolates and in laboratory strains. We constructed novel plasmids containing HA-NAT1 or MYC-NAT1 cassettes to facilitate PCR-mediated construction of strains with C-terminal epitope-tagged proteins and a NAT1-pMet3-GFP plasmid to enable conditional expression of proteins with or without the green fluorescent protein fused at the N-terminus. Furthermore, for proteins that require both the endogenous N- and C-termini for function, we have constructed a GF-NAT1-FP cassette carrying truncated alleles that facilitate insertion of an intact, single copy of GFP internal to the coding sequence. In addition, GFP-NAT1, RFP-NAT1, and M-Cherry-NAT1 plasmids were constructed expressing two differently labeled gene products for the study of protein co-expression and co-localization in vivo. Together, these vectors provide a useful set of genetic tools for studying diverse aspects of gene function in C. albicans clinical as well as laboratory strains. PMID:22777821
Luo, Qun; He, Ying; Hou, Deng-Yong; Zhang, Jian-Guo; Shen, Xian-Rong
2015-01-01
To facilitate the biodegradation of diesel oil, an oil biodegradation bacterial consortium was constructed. The alkane hydroxylase (alkB) gene of Pseudomonas putida GPo1 was constructed in a pCom8 expression vector, and the pCom8-GPo1 alkB plasmid was transformed into Escherichia coli DH5α. The AlkB protein was expressed by diesel oil induction and detected through SDS-polyacrylamide gel electrophoresis. The culture of the recombinant (pCom8-GPo1 alkB/E. coli DH5α) with the oil biodegradation bacterial consortium increased the degradation ratio of diesel oil at 24 h from 31% to 50%, and the facilitation rates were increased as the proportion of pCom8-GPo1 alkB/E. coli DH5α to the consortium increased. The results suggested that the expression of the GPo1 gene in E. coli DH5α could enhance the function of diesel oil degradation by the bacterial consortium.
Koehorst-van Putten, Herma J J; Wolters, Anne-Marie A; Pereira-Bertram, Isolde M; van den Berg, Hans H J; van der Krol, Alexander R; Visser, Richard G F
2012-12-01
In order to obtain a tuberous root-specific promoter to be used in the transformation of cassava, a 1,728 bp sequence containing the cassava granule-bound starch synthase (GBSSI) promoter was isolated. The sequence proved to contain light- and sugar-responsive cis elements. Part of this sequence (1,167 bp) was cloned into binary vectors to drive expression of the firefly luciferase gene. Cassava cultivar Adira 4 was transformed with this construct or a control construct in which the luciferase gene was cloned behind the 35S promoter. Luciferase activity was measured in leaves, stems, roots and tuberous roots. As expected, the 35S promoter induced luciferase activity in all organs at similar levels, whereas the GBSSI promoter showed very low expression in leaves, stems and roots, but very high expression in tuberous roots. These results show that the cassava GBSSI promoter is an excellent candidate to achieve tuberous root-specific expression in cassava.
GPo1 alkB gene expression for improvement of the degradation of diesel oil by a bacterial consortium
Luo, Qun; He, Ying; Hou, Deng-Yong; Zhang, Jian-Guo; Shen, Xian-Rong
2015-01-01
To facilitate the biodegradation of diesel oil, an oil biodegradation bacterial consortium was constructed. The alkane hydroxylase (alkB) gene of Pseudomonas putida GPo1 was constructed in a pCom8 expression vector, and the pCom8-GPo1 alkB plasmid was transformed into Escherichia coli DH5α. The AlkB protein was expressed by diesel oil induction and detected through SDS-polyacrylamide gel electrophoresis. The culture of the recombinant (pCom8-GPo1 alkB/E. coli DH5α) with the oil biodegradation bacterial consortium increased the degradation ratio of diesel oil at 24 h from 31% to 50%, and the facilitation rates were increased as the proportion of pCom8-GPo1 alkB/E. coli DH5α to the consortium increased. The results suggested that the expression of the GPo1 gene in E. coli DH5α could enhance the function of diesel oil degradation by the bacterial consortium. PMID:26413044
Gene Composer: database software for protein construct design, codon engineering, and gene synthesis
Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance
2009-01-01
Background To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. Results An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. Conclusion We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease error correction in combination with PIPE cloning. In a sister manuscript we present data on how Gene Composer designed genes and protein constructs can result in improved protein production for structural studies. PMID:19383142
Lorimer, Don; Raymond, Amy; Walchli, John; Mixon, Mark; Barrow, Adrienne; Wallace, Ellen; Grice, Rena; Burgin, Alex; Stewart, Lance
2009-04-21
To improve efficiency in high throughput protein structure determination, we have developed a database software package, Gene Composer, which facilitates the information-rich design of protein constructs and their codon engineered synthetic gene sequences. With its modular workflow design and numerous graphical user interfaces, Gene Composer enables researchers to perform all common bio-informatics steps used in modern structure guided protein engineering and synthetic gene engineering. An interactive Alignment Viewer allows the researcher to simultaneously visualize sequence conservation in the context of known protein secondary structure, ligand contacts, water contacts, crystal contacts, B-factors, solvent accessible area, residue property type and several other useful property views. The Construct Design Module enables the facile design of novel protein constructs with altered N- and C-termini, internal insertions or deletions, point mutations, and desired affinity tags. The modifications can be combined and permuted into multiple protein constructs, and then virtually cloned in silico into defined expression vectors. The Gene Design Module uses a protein-to-gene algorithm that automates the back-translation of a protein amino acid sequence into a codon engineered nucleic acid gene sequence according to a selected codon usage table with minimal codon usage threshold, defined G:C% content, and desired sequence features achieved through synonymous codon selection that is optimized for the intended expression system. The gene-to-oligo algorithm of the Gene Design Module plans out all of the required overlapping oligonucleotides and mutagenic primers needed to synthesize the desired gene constructs by PCR, and for physically cloning them into selected vectors by the most popular subcloning strategies. We present a complete description of Gene Composer functionality, and an efficient PCR-based synthetic gene assembly procedure with mis-match specific endonuclease error correction in combination with PIPE cloning. In a sister manuscript we present data on how Gene Composer designed genes and protein constructs can result in improved protein production for structural studies.
Wulff, Holger; Krieger, Thorsten; Krüger, Karen; Stahmer, Ingrid; Thaiss, Friedrich; Schäfer, Hansjörg; Block, Andreas
2007-01-01
Background Interleukin-12 (IL-12) is well characterized to induce cellular antitumoral immunity by activation of NK-cells and T-lymphocytes. However, systemic administration of recombinant human IL-12 resulted in severe toxicity without perceptible therapeutic benefit. Even though intratumoral expression of IL-12 leads to tumor regression and long-term survival in a variety of animal models, clinical trials have not yet shown a significant therapeutic benefit. One major obstacle in the treatment with IL-12 is to overcome the relatively low expression of the therapeutic gene without compromising the safety of such an approach. Our objective was to generate an adenoviral vector system enabling the regulated expression of very high levels of bioactive, human IL-12. Results High gene expression was obtained utilizing the VP16 herpes simplex transactivator. Strong regulation of gene expression was realized by fusion of the VP16 to a tetracycline repressor with binding of the fusion protein to a flanking tetracycline operator and further enhanced by auto-regulated expression of its fusion gene within a bicistronic promoter construct. Infection of human colon cancer cells (HT29) at a multiplicity of infection (m.o.i.) of 10 resulted in the production of up to 8000 ng/106 cells in 48 h, thus exceeding any published vector system so far. Doxycycline concentrations as low as 30 ng/ml resulted in up to 5000-fold suppression, enabling significant reduction of gene expression in a possible clinical setting. Bioactivity of the human single-chain IL-12 was similar to purified human heterodimeric IL-12. Frozen sections of human colon cancer showed high expression of the coxsackie adenovirus receptor with significant production of human single chain IL-12 in colon cancer biopsies after infection with 3*107 p.f.u. Ad.3r-scIL12. Doxycycline mediated suppression of gene expression was up to 9000-fold in the infected colon cancer tissue. Conclusion VP16 transactivator-mediated and doxycycline-regulated expression of the human interleukin-12 gene enables highly efficient and tightly controlled cytokine expression in human cancer. These data illustrate the potential of the described adenoviral vector system for the safe and superior expression of therapeutic genes in the treatment of colorectal cancer and other malignancies. PMID:17594499
Deb, J K; Nath, N
1999-06-01
Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.
Screening and large-scale expression of membrane proteins in mammalian cells for structural studies
Goehring, April; Lee, Chia-Hsueh; Wang, Kevin H.; Michel, Jennifer Carlisle; Claxton, Derek P.; Baconguis, Isabelle; Althoff, Thorsten; Fischer, Suzanne; Garcia, K. Christopher; Gouaux, Eric
2014-01-01
Structural, biochemical and biophysical studies of eukaryotic membrane proteins are often hampered by difficulties in over-expression of the candidate molecule. Baculovirus transduction of mammalian cells (BacMam), although a powerful method to heterologously express membrane proteins, can be cumbersome for screening and expression of multiple constructs. We therefore developed plasmid Eric Gouaux (pEG) BacMam, a vector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target protein. In this protocol we show how to use small-scale transient transfection and fluorescence-detection, size-exclusion chromatography (FSEC) experiments using a GFP-His8 tagged candidate protein to screen for monodispersity and expression level. Once promising candidates are identified, we describe how to generate baculovirus, transduce HEK293S GnTI− (N-acetylglucosaminyltransferase I-negative) cells in suspension culture, and over-express the candidate protein. We have used these methods to prepare pure samples of chicken acid-sensing ion channel 1a (cASIC1) and Caenorhabditis elegans glutamate-gated chloride channel (GluCl), for X-ray crystallography, demonstrating how to rapidly and efficiently screen hundreds of constructs and accomplish large-scale expression in 4-6 weeks. PMID:25299155
Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon
2013-07-01
Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection.
Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun
2013-01-01
Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection. PMID:23677321
Yoshida, Kimiko; Goto, Naoko; Ohnami, Shumpei; Aoki, Kazunori
2012-01-01
The targeting of gene transfer at the cell-entry level is one of the most attractive challenges in vector development. However, attempts to redirect adenovirus vectors to alternative receptors by engineering the capsid-coding region have shown limited success, because the proper targeting ligands on the cells of interest are generally unknown. To overcome this limitation, we have constructed a random peptide library displayed on the adenoviral fiber knob, and have successfully selected targeted vectors by screening the library on cancer cell lines in vitro. The infection of targeted vectors was considered to be mediated by specific receptors on target cells. However, the expression levels and kinds of cell surface receptors may be substantially different between in vitro culture and in vivo tumor tissue. Here, we screened the peptide display-adenovirus library in the peritoneal dissemination model of AsPC-1 pancreatic cancer cells. The vector displaying a selected peptide (PFWSGAV) showed higher infectivity in the AsPC-1 peritoneal tumors but not in organs and other peritoneal tumors as compared with a non-targeted vector. Furthermore, the infectivity of the PFWSGAV-displaying vector for AsPC-1 peritoneal tumors was significantly higher than that of a vector displaying a peptide selected by in vitro screening, indicating the usefulness of in vivo screening in exploring the targeting vectors. This vector-screening system can facilitate the development of targeted adenovirus vectors for a variety of applications in medicine. PMID:23029088
Kemppainen, Minna J.; Pardo, Alejandro G.
2010-01-01
Summary pSILBAγ silencing vector was constructed for efficient RNA silencing triggering in the model mycorrhizal fungus Laccaria bicolor. This cloning vector carries the Agaricus bisporus gpdII promoter, two multiple cloning sites separated by a L. bicolor nitrate reductase intron and the Aspergillus nidulans trpC terminator. pSILBAγ allows an easy oriented two‐step PCR cloning of hairpin sequences to be expressed in basidiomycetes. With one further cloning step into pHg, a pCAMBIA1300‐based binary vector carrying a hygromycin resistance cassette, the pHg/pSILBAγ plasmid is used for Agrobacterium‐mediated transformation. The pHg/pSILBAγ system results in predominantly single integrations of RNA silencing triggering T‐DNAs in the fungal genome and the integration sites of the transgenes can be resolved by plasmid rescue. pSILBAγ construct and two other pSILBA plasmid variants (pSILBA and pSILBAα) were evaluated for their capacity to silence Laccaria nitrate reductase gene. While all pSILBA variants tested resulted in up to 65–76% of transformants with reduced growth on nitrate, pSILBAγ produced the highest number (65%) of strongly affected fungal strains. The strongly silenced phenotype was shown to correlate with T‐DNA integration in transcriptionally active genomic sites. pHg/pSILBAγ was shown to produce T‐DNAs with minimum CpG methylation in transgene promoter regions which assures the maximum silencing trigger production in Laccaria. Methylation of the target endogene was only slight in RNA silencing triggered with constructs carrying an intronic spacer hairpin sequence. The silencing capacity of the pHg/pSILBAγ was further tested with Laccaria inositol‐1,4,5‐triphosphate 5‐phosphatase gene. Besides its use in silencing triggering, the herein described plasmid system can also be used for transgene expression in Laccaria. pHg/pSILBAγ silencing system is optimized for L. bicolor but it should be highly useful also for other homobasidiomycetes, group of fungi currently lacking molecular tools for RNA silencing. PMID:21255319
Display of adenoregulin with a novel Pichia pastoris cell surface display system.
Ren, Ren; Jiang, Zhengbing; Liu, Meiyun; Tao, Xinyi; Ma, Yushu; Wei, Dongzhi
2007-02-01
Two Pichia pastoris cell surface display vectors were constructed. The vectors consisted of the flocculation functional domain of Flo1p with its own secretion signal sequence or the alpha-factor secretion signal sequence, a polyhistidine (6xHis) tag for detection, an enterokinase recognition site, and the insertion sites for target proteins. Adenoregulin (ADR) is a 33-amino-acid antimicrobial peptide isolated from Phyllomedusa bicolor skin. The ADR was expressed and displayed on the Pichia pastoris KM71 cell surface with the system reported. The displayed recombinant ADR fusion protein was detected by fluorescence microscopy and confocal laser scanning microscopy (CLSM). The antimicrobial activity of the recombinant adenoregulin was detected after proteolytic cleavage of the fusion protein on cell surface. The validity of the Pichia pastoris cell surface display vectors was proved by the displayed ADR.
Meng, Jinhong; Counsell, John R; Reza, Mojgan; Laval, Steven H; Danos, Olivier; Thrasher, Adrian; Lochmüller, Hanns; Muntoni, Francesco; Morgan, Jennifer E
2016-01-27
Autologous stem cells that have been genetically modified to express dystrophin are a possible means of treating Duchenne Muscular Dystrophy (DMD). To maximize the therapeutic effect, dystrophin construct needs to contain as many functional motifs as possible, within the packaging capacity of the viral vector. Existing dystrophin constructs used for transduction of muscle stem cells do not contain the nNOS binding site, an important functional motif within the dystrophin gene. In this proof-of-concept study, using stem cells derived from skeletal muscle of a DMD patient (mdcs) transplanted into an immunodeficient mouse model of DMD, we report that two novel dystrophin constructs, C1 (ΔR3-R13) and C2 (ΔH2-R23), can be lentivirally transduced into mdcs and produce dystrophin. These dystrophin proteins were functional in vivo, as members of the dystrophin glycoprotein complex were restored in muscle fibres containing donor-derived dystrophin. In muscle fibres derived from cells that had been transduced with construct C1, the largest dystrophin construct packaged into a lentiviral system, nNOS was restored. The combination of autologous stem cells and a lentivirus expressing a novel dystrophin construct which optimally restores proteins of the dystrophin glycoprotein complex may have therapeutic application for all DMD patients, regardless of their dystrophin mutation.
Complex eigenvalue analysis of rotating structures
NASA Technical Reports Server (NTRS)
Patel, J. S.; Seltzer, S. M.
1972-01-01
A FORTRAN subroutine to NASTRAN which constructs coriolis and centripetal acceleration matrices, and a centrifugal load vector due to spin about a selected point or about the mass center of the structure is discussed. The rigid translational degrees of freedom can be removed by using a transformation matrix T and its explicitly given inverse. These matrices are generated in the subroutine and their explicit expressions are given.
Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui
2015-09-01
Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier Inc. All rights reserved.
Expansin polynucleotides, related polypeptides and methods of use
Cosgrove, Daniel J.; Wu, Yajun
2006-02-21
The present invention relates to beta expansin polypeptides, nucleotide sequences encoding the same and regulatory elements and their use in altering cell wall structure in plants. Nucleic acid constructs comprising a beta expansin sequence operably linked to a promoter, or other regulatory sequence are disclosed as well as vectors, plant cells, plants, and transformed seeds containing such constructs are provided. Methods for the use of such constructs in repressing or inducing expression of a beta expansin sequences in a plant are also provided as well as methods for harvesting transgenic expansin proteins. In addition, methods are provided for inhibiting or improving cell wall structure in plants by repression or induction of expansin sequences in plants.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.
Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less
Chen, Hang; Li, Li; Fang, Jin
2012-04-01
To construct and express the recombinant ND-1-scFv/SEA, a fusion protein of superantigen (staphylococcal enterotoxinA, SEA) and single-chain variable fragment of monoclonal antibody ND-1 against human clolorectal carcinoma, and to enhance the targeted killing effect of SEA. The expression of the fusion protein was induced in E.coli M15 by IPTG. Ni-NTA resin affinity chromatography was used to separate and purify the expressed product. The specific binding activity of the purified ND-1-scFv/SEA protein was examined by indirect immunofluorescence assay and the targeted-cytotoxicity was determined using MTT assay. The expressing vector of fusion gene ND-1scFv/SEA was constructed successfully. ND-1-scFv/SEA protein retained a high binding affinity to antigen-positive human colorectal cancer cell CCL-187 and had a stronger capability to activate PBMC and kill the target cells compared to SEA alone, with a killing rate of 91% at 4 μg/mL. ND-1-scFv/SEA fusion protein could specifically target colorectal cancer cell, enhance the activity of kill tumor cell and has potential applications in the targeted therapy of colorectal cancer.
Czarnecki, Olaf; Bryan, Anthony C.; Jawdy, Sara S.; ...
2016-02-17
Genetic engineering of plants that results in successful establishment of new biochemical or regulatory pathways requires stable introduction of one or more genes into the plant genome. It might also be necessary to down-regulate or turn off expression of endogenous genes in order to reduce activity of competing pathways. An established way to knockdown gene expression in plants is expressing a hairpin-RNAi construct, eventually leading to degradation of a specifically targeted mRNA. Knockdown of multiple genes that do not share homologous sequences is still challenging and involves either sophisticated cloning strategies to create vectors with different serial expression constructs ormore » multiple transformation events that is often restricted by a lack of available transformation markers. Synthetic RNAi fragments were assembled in yeast carrying homologous sequences to six or seven non-family genes and introduced into pAGRIKOLA. Transformation of Arabidopsis thaliana and subsequent expression analysis of targeted genes proved efficient knockdown of all target genes. In conclusion, we present a simple and cost-effective method to create constructs to simultaneously knockdown multiple non-family genes or genes that do not share sequence homology. The presented method can be applied in plant and animal synthetic biology as well as traditional plant and animal genetic engineering.« less
Moutos, Franklin T.; Glass, Katherine A.; Compton, Sarah A.; Ross, Alison K.; Gersbach, Charles A.; Estes, Bradley T.
2016-01-01
Biological resurfacing of entire articular surfaces represents an important but challenging strategy for treatment of cartilage degeneration that occurs in osteoarthritis. Not only does this approach require anatomically sized and functional engineered cartilage, but the inflammatory environment within an arthritic joint may also inhibit chondrogenesis and induce degradation of native and engineered cartilage. The goal of this study was to use adult stem cells to engineer anatomically shaped, functional cartilage constructs capable of tunable and inducible expression of antiinflammatory molecules, specifically IL-1 receptor antagonist (IL-1Ra). Large (22-mm-diameter) hemispherical scaffolds were fabricated from 3D woven poly(ε-caprolactone) (PCL) fibers into two different configurations and seeded with human adipose-derived stem cells (ASCs). Doxycycline (dox)-inducible lentiviral vectors containing eGFP or IL-1Ra transgenes were immobilized to the PCL to transduce ASCs upon seeding, and constructs were cultured in chondrogenic conditions for 28 d. Constructs showed biomimetic cartilage properties and uniform tissue growth while maintaining their anatomic shape throughout culture. IL-1Ra–expressing constructs produced nearly 1 µg/mL of IL-1Ra upon controlled induction with dox. Treatment with IL-1 significantly increased matrix metalloprotease activity in the conditioned media of eGFP-expressing constructs but not in IL-1Ra–expressing constructs. Our findings show that advanced textile manufacturing combined with scaffold-mediated gene delivery can be used to tissue engineer large anatomically shaped cartilage constructs that possess controlled delivery of anticytokine therapy. Importantly, these cartilage constructs have the potential to provide mechanical functionality immediately upon implantation, as they will need to replace a majority, if not the entire joint surface to restore function. PMID:27432980
Han, Sung-Woong; Nakamura, Chikashi; Imai, Yosuke; Nakamura, Noriyuki; Miyake, Jun
2009-01-01
In this study, we have evaluated a sensor system for a hormonal drug effect in a single cell level using a novel low invasive single cell DNA delivery technology using a nanoneedle. An estrogen responsive GFP reporter vector (pEREGFP9) was constructed and its estrogenic response activity was confirmed in breast cancer cells (MCF-7) using lipofection as the means of transferring the vector to the cells. The pEREGFP9 vector was delivered to a single MCF-7 using a nanoneedle and the effect of ICI 182,780, which is an antagonist of estrogen, was observed using the GFP expression level. By ICI 182,780 treatment, the fluorescence intensity of the GFP was decreased by 30-50% within 24h. This technology is the very first trial of single cell diagnosis and we are looking forward to applying it to precious single cell diagnosis in medical fields.
Generating an Open Reading Frame (ORF) Entry Clone and Destination Clone.
Reece-Hoyes, John S; Walhout, Albertha J M
2018-01-02
This protocol describes using the Gateway recombinatorial cloning system to create an Entry clone carrying an open reading frame (ORF) and then to transfer the ORF into a Destination vector. In this example, BP recombination is used to clone an ORF from a cDNA source into the Donor vector pDONR 221. The ORF from the resulting Entry clone is then transferred into the Destination vector pDEST-15; the product (the Destination clone) will express the ORF as an amino-terminal GST-fusion. The technique can be used as a guide for cloning any other DNA fragment of interest-a promoter sequence or 3' untranslated region (UTR), for example-with substitutions of different genetic material such as genomic DNA, att sites, and vectors as required. The series of constructions and transformations requires 9-15 d, not including time that may be required for sequence confirmation, if desired/necessary. © 2018 Cold Spring Harbor Laboratory Press.
Method: low-cost delivery of the cotton leaf crumple virus-induced gene silencing system
2012-01-01
Background We previously developed a virus-induced gene silencing (VIGS) vector for cotton from the bipartite geminivirusCotton leaf crumple virus (CLCrV). The original CLCrV VIGS vector was designed for biolistic delivery by a gene gun. This prerequisite limited the use of the system to labs with access to biolistic equipment. Here we describe the adaptation of this system for delivery by Agrobacterium (Agrobacterium tumefaciens). We also describe the construction of two low-cost particle inflow guns. Results The biolistic CLCrV vector was transferred into two Agrobacterium binary plasmids. Agroinoculation of the binary plasmids into cotton resulted in silencing and GFP expression comparable to the biolistic vector. Two homemade low-cost gene guns were used to successfully inoculate cotton (G. hirsutum) and N. benthamiana with either the CLCrV VIGS vector or the Tomato golden mosaic virus (TGMV) VIGS vector respectively. Conclusions These innovations extend the versatility of CLCrV-based VIGS for analyzing gene function in cotton. The two low-cost gene guns make VIGS experiments affordable for both research and teaching labs by providing a working alternative to expensive commercial gene guns. PMID:22853641
Zhou, Yanrong; Lin, Yanli; Wu, Xiaojie; Xiong, Fuyin; Lv, Yuemeng; Zheng, Tao; Huang, Peitang; Chen, Hongxing
2012-02-01
Transgene expression for the mammary gland bioreactor aimed at producing recombinant proteins requires optimized expression vector construction. Previously we presented a hybrid gene locus strategy, which was originally tested with human lactoferrin (hLF) as target transgene, and an extremely high-level expression of rhLF ever been achieved as to 29.8 g/l in mice milk. Here to demonstrate the broad application of this strategy, another 38.4 kb mWAP-htPA hybrid gene locus was constructed, in which the 3-kb genomic coding sequence in the 24-kb mouse whey acidic protein (mWAP) gene locus was substituted by the 17.4-kb genomic coding sequence of human tissue plasminogen activator (htPA), exactly from the start codon to the end codon. Corresponding five transgenic mice lines were generated and the highest expression level of rhtPA in the milk attained as to 3.3 g/l. Our strategy will provide a universal way for the large-scale production of pharmaceutical proteins in the mammary gland of transgenic animals.
[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].
Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua
2013-02-01
To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.
Hooley, R P; Paterson, M; Brown, P; Kerr, K; Saunders, P T K
2009-01-01
Spermatogenesis is a complex process that cannot be modelled in vitro. The somatic Sertoli cells (SCs) within the seminiferous tubules perform a key role in supporting maturation of germ cells (GCs). Progress has been made in determining what aspects of SC function are critical to maintenance of fertility by developing rodent models based on the Cre/LoxP system; however, this is time-consuming and is only applicable to mice. The aim of the present study was to establish methods for direct injection of adenoviral vectors containing shRNA constructs into the testis as a way of inducing target-selective knock-down in vivo. This paper describes a series of experiments using adenovirus expressing a green fluorescent protein (GFP) transgene. Injection via the efferent ductules resulted in SC-specific expression of GFP; expression levels paralleled the amount of infective viral particles injected. At the highest doses of virus seminiferous tubule architecture were grossly disturbed and immune cell invasion noted. At lower concentrations, the expression of GFP was variable/negligible, the seminiferous tubule lumen was maintained but stage-dependent GC loss and development of numerous basal vacuoles was observed. These resembled intercellular dilations of SC junctional complexes previously described in rats and may be a consequence of disturbances in SC function due to interaction of the viral particles with the coxsackie/adenovirus receptor that is a component of the junctional complexes within the blood testis barrier. In conclusion, intra-testicular injection of adenoviral vectors disturbs SC function in vivo and future work will therefore focus on the use of lentiviral delivery systems. PMID:18955374
Suarez, D L; Schultz-Cherry, S
2000-01-01
Vaccination of poultry with naked plasmid DNA has been successfully demonstrated with several different poultry pathogens, but the technology needs to be further developed before it can be practically implemented. Many different methods can conceivably enhance the efficacy of DNA vaccines, and this report examines the use of different eukaryotic expression vectors with different promoters and different adjuvants to express the influenza hemagglutinin protein. Four different promoters in five different plasmids were used to express the hemagglutinin protein of an H5 avian influenza virus, including two different immediate early cytomegaloviruses (CMVs), Rous sarcoma virus, chicken actin, and simian virus 40 promoters. All five constructs expressed detectable hemagglutinin protein in cell culture, but the pCI-neo HA plasmid with the CMV promoter provided the best response in chickens when vaccinated intramuscularly at 1 day of age on the basis of antibody titer and survivability after challenge with a highly pathogenic avian influenza virus at 6 wk postinoculation. A beneficial response was observed in birds boostered at 3 wk of age, in birds given larger amounts of DNA, and with the use of multiple injection sites to administer the vaccine. With the use of the pCI-neo construct, the effects of different adjuvants designed to increase the uptake of plasmid DNA, including 25% sucrose, diethylaminoethyl dextran, calcium phosphate, polybrene, and two different cationic liposomes, were examined. Both liposomes tested enhanced antibody titers as compared with the positive controls, but the other chemical adjuvants decreased the antibody response as compared with the control chickens that received just the plasmid alone. The results observed are promising for continued studies, but continued improvements in vaccine response and reduced costs are necessary before the technology can be commercially developed.
Adapter-directed display: a modular design for shuttling display on phage surfaces.
Wang, Kevin Caili; Wang, Xinwei; Zhong, Pingyu; Luo, Peter Peizhi
2010-02-05
A novel adapter-directed phage display system was developed with modular features. In this system, the target protein is expressed as a fusion protein consisting of adapter GR1 from the phagemid vector, while the recombinant phage coat protein is expressed as a fusion protein consisting of adapter GR2 in the helper phage vector. Surface display of the target protein is accomplished through specific heterodimerization of GR1 and GR2 adapters, followed by incorporation of the heterodimers into phage particles. A series of engineered helper phages were constructed to facilitate both display valency and formats, based on various phage coat proteins. As the target protein is independent of a specific phage coat protein, this modular system allows the target protein to be displayed on any given phage coat protein and allows various display formats from the same vector without the need for reengineering. Here, we demonstrate the shuttling display of a single-chain Fv antibody on phage surfaces between multivalent and monovalent formats, as well as the shuttling display of an antigen-binding fragment molecule on phage coat proteins pIII, pVII, and pVIII using the same phagemid vectors combined with different helper phage vectors. This adapter-directed display concept has been applied to eukaryotic yeast surface display and to a novel cross-species display that can shuttle between prokaryotic phage and eukaryotic yeast systems. Copyright 2009 Elsevier Ltd. All rights reserved.
Stadelmann, Britta; Birkestedt, Sandra; Hellman, Ulf; Svärd, Staffan G.
2012-01-01
In recent years, proteomics has come of age with the development of efficient tools for purification, identification, and characterization of gene products predicted by genome projects. The intestinal protozoan Giardia intestinalis can be transfected, but there is only a limited set of vectors available, and most of them are not user friendly. This work delineates the construction of a suite of cassette-based expression vectors for use in Giardia. Expression is provided by the strong constitutive ornithine carbamoyltransferase (OCT) promoter, and tagging is possible in both N- and C-terminal configurations. Taken together, the vectors are capable of providing protein localization and production of recombinant proteins, followed by efficient purification by a novel affinity tag combination, streptavidin binding peptide–glutathione S-transferase (SBP-GST). The option of removing the tags from purified proteins was provided by the inclusion of a PreScission protease site. The efficiency and feasibility of producing and purifying endogenous recombinant Giardia proteins with the developed vectors was demonstrated by the purification of active recombinant arginine deiminase (ADI) and OCT from stably transfected trophozoites. Moreover, we describe the tagging, purification by StrepTactin affinity chromatography, and compositional analysis by mass spectrometry of the G. intestinalis 26S proteasome by employing the Strep II-FLAG–tandem affinity purification (SF-TAP) tag. This is the first report of efficient production and purification of recombinant proteins in and from Giardia, which will allow the study of specific parasite proteins and protein complexes. PMID:22611020
ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.
2009-01-01
Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune responses against lentiviral vectors was effective in causing a decrease in transgene expression only if the immune response was directed against the transgene. A systemic immune response against vector components alone did not cause brain inflammation, possibly because vector-derived epitopes were not being presented in the CNS. PMID:15960605
Zhu, Xin-Hua; Liao, Bing; Xu, Yi; Liu, Ke; Huang, Yun; Huang, Quan-Long; Liu, Yue-Hui
2017-02-01
RNA interference has been considered as an effective gene silencing method in basic and preclinical investigations. The aims of the present study were to construct a lentiviral vector expressing a short hairpin RNA (shRNA) targeting the murine CC chemokine receptor 3 (mCCR3), and to investigate its effects on the proliferation and apoptosis of mouse eosinophils. A recombinant lentiviral vector expressing four fragments of mouse CCR3 shRNA (pLVX‑mCCR3‑1+2+3+4‑shRNA) was constructed using subcloning techniques. This novel lentivirus was then packaged into 293T cells by co‑transduction with plasmids, including Baculo p35, pCMV R8.2 and VSV. The interference effects of the vector were verified using polymerase chain reaction (PCR) and western blot analyses. The effects of the interference on the proliferation and apoptosis of mouse eosinophils were investigated using 3‑(4,5‑dimethylthiazol‑2‑yl)‑5‑(3‑carboxymethoxyphenyl)‑2‑(4‑sulfophenyl)‑2H‑tetrazolium and terminal deoxynucleotidyl transferase dUTP nick end labeling methods, respectively. The results of the PCR and western blot analyses confirmed that the novel recombinant vector, pLVX‑mCCR3‑1+2+3+4‑shRNA, had high efficiency in inhibiting the mRNA and protein expression levels of mCCR3 in mouse eosinophils. The downregulation of mCCR3 significantly inhibited proliferation of the eosinophils. Furthermore, the present study found that the downregulation of mCCR3 significantly promoted apoptosis of the eosinophils. Therefore, the downregulation of mCCR3 led to the inhibition of proliferation and induction of apoptosis in mouse eosinophils. The predominant characteristics of allergic rhinitis are eosinophil infiltration and release of inflammatory mediators, which appear in a variety of clinical manifestations. The results of the present study indicate that mCCR3 silencing may serve as a putative approach for the treatment of allergic rhinitis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Watanabe, Daisuke; Brockman, Mark A.; Ndung'u, Thumbi
2007-01-20
Herpes simplex virus (HSV) recombinants induce durable immune responses in rhesus macaques and mice and have induced partial protection in rhesus macaques against mucosal challenge with virulent simian immunodeficiency virus (SIV). In this study, we evaluated the properties of a new generation HSV vaccine vector, an HSV-1 multiple immediate-early (IE) gene deletion mutant virus, d106, which contains deletions in the ICP4, ICP27, ICP22, and ICP47 genes. Because several of the HSV IE genes have been implicated in immune evasion, inactivation of the genes encoding these proteins was expected to result in enhanced immunogenicity. The d106 virus expresses few HSV genemore » products and shows minimal cytopathic effect in cultured cells. When d106 was inoculated into mice, viral DNA accumulated at high levels in draining lymph nodes, consistent with an ability to transduce dendritic cells and activate their maturation and movement to lymph nodes. A d106 recombinant expressing Escherichia coli {beta}-galactosidase induced durable {beta}-gal-specific IgG and CD8{sup +} T cell responses in naive and HSV-immune mice. Finally, d106-based recombinants have been constructed that express simian immunodeficiency virus (SIV) gag, env, or a rev-tat-nef fusion protein for several days in cultured cells. Thus, d106 shows many of the properties desirable in a vaccine vector: limited expression of HSV gene products and cytopathogenicity, high level expression of transgenes, ability to induce durable immune responses, and an ability to transduce dendritic cells and induce their maturation and migration to lymph nodes.« less
Kang, Jun Won; Wilkerson, Hui-Wen; Farin, Federico M; Bammler, Theo K; Beyer, Richard P; Strand, Stuart E; Doty, Sharon L
2010-08-01
Trichloroethylene (TCE) is an important environmental contaminant of soil, groundwater, and air. Studies of the metabolism of TCE by poplar trees suggest that cytochrome P450 enzymes are involved. Using poplar genome microarrays, we report a number of putative genes that are differentially expressed in response to TCE. In a previous study, transgenic hybrid poplar plants expressing mammalian cytochrome P450 2E1 (CYP2E1) had increased metabolism of TCE. In the vector control plants for this construct, 24 h following TCE exposure, 517 genes were upregulated and 650 genes were downregulated over 2-fold when compared with the non-exposed vector control plants. However, in the transgenic CYP2E1 plant, line 78, 1,601 genes were upregulated and 1,705 genes were downregulated over 2-fold when compared with the non-exposed transgenic CYP2E1 plant. It appeared that the CYP2E1 transgenic hybrid poplar plants overexpressing mammalian CYP2E1 showed a larger number of differentially expressed transcripts, suggesting a metabolic pathway for TCE to metabolites had been initiated by activity of CYP2E1 on TCE. These results suggest that either the over-expression of the CYP2E1 gene or the abundance of TCE metabolites from CYP450 2E1 activity triggered a strong genetic response to TCE. Particularly, cytochrome p450s, glutathione S-transferases, glucosyltransferases, and ABC transporters in the CYP2E1 transgenic hybrid poplar plants were highly expressed compared with in vector controls.
Melman, A; Biggs, G; Davies, K; Zhao, W; Tar, M T; Christ, G J
2008-03-01
Previous reports have demonstrated that gene transfer with the alpha, or pore-forming, subunit of the human Maxi-K channel (hSlo) restores the decline in erectile capacity observed in established rat models of diabetes and aging. Preliminary data from a human clinical trial also showed safety and potential efficacy in 11 men treated with the same plasmid construct expressing the Maxi-K channel. In all instances, the original plasmid was driven by the heterologous cytomegalovirus promoter which is broadly active in a wide variety of cell and tissue types. To more precisely determine the contribution of the corporal myocyte to the observed physiological effects in vivo, we report here our initial work using a distinct vector (pSMAA-hSlo) in which hSlo gene expression was driven off the mouse smooth muscle alpha-actin (SMAA) promoter. Specifically, older rats, with diminished erectile capacity, were given a single intracorporal injection with either 100 mug pVAX-hSlo or 10, 100 or 1000 mug pSMAA-hSlo, or vector or vehicle alone. Significantly increased intracavernous pressure (ICP) responses to cavernous nerve stimulation were observed for all doses of both plasmids encoding hSlo, relative to control injections. These data confirm and extend previous observations to document that smooth muscle cell-specific expression of hSlo in corporal tissue is both necessary and sufficient to restore erectile function in aging rats.
Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul
2014-01-01
CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967
An agmatine-inducible system for the expression of recombinant proteins in Enterococcus faecalis.
Linares, Daniel M; Perez, Marta; Ladero, Victor; Del Rio, Beatriz; Redruello, Begoña; Martin, M Cruz; Fernandez, María; Alvarez, Miguel A
2014-12-04
Scientific interest in Enterococcus faecalis has increased greatly over recent decades. Some strains are involved in food fermentation and offer health benefits, whereas others are vancomycin-resistant and cause infections that are difficult to treat. The limited availability of vectors able to express cloned genes efficiently in E. faecalis has hindered biotechnological studies on the bacterium's regulatory and pathogenicity-related genes. The agmatine deiminase (AGDI) pathway of E. faecalis, involved in the conversion of agmatine into putrescine, is driven by a response inducer gene aguR. This study describes that the exposure to the induction factor (agmatine) results in the transcription of genes under the control of the aguB promoter, including the aguBDAC operon. A novel E. faecalis expression vector, named pAGEnt, combining the aguR inducer gene and the aguB promoter followed by a cloning site and a stop codon was constructed. pAGEnt was designed for the overexpression and purification of a protein fused to a 10-amino-acid His-tag at the C-terminus. The use of GFP as a reporter of gene expression in E. faecalis revealed that under induction with 60 mM agmatine, fluorescence reached 40 arbitrary units compared to 0 in uninduced cells. pAGEnt vector can be used for the overexpression of recombinant proteins under the induction of agmatine in E. faecalis, with a close correlation between agmatine concentration and fluorescence when GFP was used as reporter.
Rincon, Melvin Y; de Vin, Filip; Duqué, Sandra I; Fripont, Shelly; Castaldo, Stephanie A; Bouhuijzen-Wenger, Jessica; Holt, Matthew G
2018-04-01
Until recently, adeno-associated virus 9 (AAV9) was considered the AAV serotype most effective in crossing the blood-brain barrier (BBB) and transducing cells of the central nervous system (CNS), following systemic injection. However, a newly engineered capsid, AAV-PHP.B, is reported to cross the BBB at even higher efficiency. We investigated how much we could boost CNS transgene expression by using AAV-PHP.B carrying a self-complementary (sc) genome. To allow comparison, 6 weeks old C57BL/6 mice received intravenous injections of scAAV2/9-GFP or scAAV2/PHP.B-GFP at equivalent doses. Three weeks postinjection, transgene expression was assessed in brain and spinal cord. We consistently observed more widespread CNS transduction and higher levels of transgene expression when using the scAAV2/PHP.B-GFP vector. In particular, we observed an unprecedented level of astrocyte transduction in the cortex, when using a ubiquitous CBA promoter. In comparison, neuronal transduction was much lower than previously reported. However, strong neuronal expression (including spinal motor neurons) was observed when the human synapsin promoter was used. These findings constitute the first reported use of an AAV-PHP.B capsid, encapsulating a scAAV genome, for gene transfer in adult mice. Our results underscore the potential of this AAV construct as a platform for safer and more efficacious gene therapy vectors for the CNS.
Morral, Núria; O’Neal, Wanda; Rice, Karen; Leland, Michele; Kaplan, Johanne; Piedra, Pedro A.; Zhou, Heshan; Parks, Robin J.; Velji, Rizwan; Aguilar-Córdova, Estuardo; Wadsworth, Samuel; Graham, Frank L.; Kochanek, Stefan; Carey, K. Dee; Beaudet, Arthur L.
1999-01-01
The efficiency of first-generation adenoviral vectors as gene delivery tools is often limited by the short duration of transgene expression, which can be related to immune responses and to toxic effects of viral proteins. In addition, readministration is usually ineffective unless the animals are immunocompromised or a different adenovirus serotype is used. Recently, adenoviral vectors devoid of all viral coding sequences (helper-dependent or gutless vectors) have been developed to avoid expression of viral proteins. In mice, liver-directed gene transfer with AdSTK109, a helper-dependent adenoviral (Ad) vector containing the human α1-antitrypsin (hAAT) gene, resulted in sustained expression for longer than 10 months with negligible toxicity to the liver. In the present report, we have examined the duration of expression of AdSTK109 in the liver of baboons and compared it to first-generation vectors expressing hAAT. Transgene expression was limited to approximately 3–5 months with the first-generation vectors. In contrast, administration of AdSTK109 resulted in transgene expression for longer than a year in two of three baboons. We have also investigated the feasibility of circumventing the humoral response to the virus by sequential administration of vectors of different serotypes. We found that the ineffectiveness of readministration due to the humoral response to an Ad5 first-generation vector was overcome by use of an Ad2-based vector expressing hAAT. These data suggest that long-term expression of transgenes should be possible by combining the reduced immunogenicity and toxicity of helper-dependent vectors with sequential delivery of vectors of different serotypes. PMID:10536005
Novel strategies to construct complex synthetic vectors to produce DNA molecular weight standards.
Chen, Zhe; Wu, Jianbing; Li, Xiaojuan; Ye, Chunjiang; Wenxing, He
2009-05-01
DNA molecular weight standards (DNA markers, nucleic acid ladders) are commonly used in molecular biology laboratories as references to estimate the size of various DNA samples in electrophoresis process. One method of DNA marker production is digestion of synthetic vectors harboring multiple DNA fragments of known sizes by restriction enzymes. In this article, we described three novel strategies-sequential DNA fragment ligation, screening of ligation products by polymerase chain reaction (PCR) with end primers, and "small fragment accumulation"-for constructing complex synthetic vectors and minimizing the mass differences between DNA fragments produced from restrictive digestion of synthetic vectors. The strategy could be applied to construct various complex synthetic vectors to produce any type of low-range DNA markers, usually available commercially. In addition, the strategy is useful for single-step ligation of multiple DNA fragments for construction of complex synthetic vectors and other applications in molecular biology field.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kilbane, J.J. II
1994-06-01
IGT has developed a microbial culture of Rhodococcus rhodochrous, IGTS8, that is capable of specifically cleaving carbon-sulfur bonds in a range of organosulfur model compounds and is capable of removing organic sulfur from coal and petroleum. Although IGTS8 possesses the ability to specifically remove organic sulfur from coal, a major research need is to develop improved strain`s of microorganisms that possess higher levels of desulfurization activity and therefore wall permit more favorable biodesulfurization process conditions: faster rates, mare complete removal, and smaller reactor size. Strain improvement is the single most important aspect to the development of a practical coal biodesulfurizationmore » process and accordingly is the focus of research in this project. Several possible strong promoters have been isolated and are in the process of being analyzed. When these promoters have been characterized for inducibility, strength, transcriptional start sites and other physical properties, they will be placed in front of the desulfurization genes and expression will be monitored. Improved promoter probe vectors have been constructed, allowing a conclusive screen of all putative Rhodococcus promoters. With the improved methodologies in the handling of Rhodococcus RNA, we have begun to gauge promoter expression using Northern blots. During this quarter we have constructed and successfully used a promoter probe vector using the {beta}-galactosidane gene from E. coli. A chromosomal promoter library was constructed upstream from the {beta}-galactosidase gene. Over 200 colonies were isolated that yielded {beta}-galactosidase activity.« less
Autonomous Environment-Monitoring Networks
NASA Technical Reports Server (NTRS)
Hand, Charles
2004-01-01
Autonomous environment-monitoring networks (AEMNs) are artificial neural networks that are specialized for recognizing familiarity and, conversely, novelty. Like a biological neural network, an AEMN receives a constant stream of inputs. For purposes of computational implementation, the inputs are vector representations of the information of interest. As long as the most recent input vector is similar to the previous input vectors, no action is taken. Action is taken only when a novel vector is encountered. Whether a given input vector is regarded as novel depends on the previous vectors; hence, the same input vector could be regarded as familiar or novel, depending on the context of previous input vectors. AEMNs have been proposed as means to enable exploratory robots on remote planets to recognize novel features that could merit closer scientific attention. AEMNs could also be useful for processing data from medical instrumentation for automated monitoring or diagnosis. The primary substructure of an AEMN is called a spindle. In its simplest form, a spindle consists of a central vector (C), a scalar (r), and algorithms for changing C and r. The vector C is constructed from all the vectors in a given continuous stream of inputs, such that it is minimally distant from those vectors. The scalar r is the distance between C and the most remote vector in the same set. The construction of a spindle involves four vital parameters: setup size, spindle-population size, and the radii of two novelty boundaries. The setup size is the number of vectors that are taken into account before computing C. The spindle-population size is the total number of input vectors used in constructing the spindle counting both those that arrive before and those that arrive after the computation of C. The novelty-boundary radii are distances from C that partition the neighborhood around C into three concentric regions (see Figure 1). During construction of the spindle, the changing spindle radius is denoted by h. It is the final value of h, reached before beginning construction on the next spindle, that is denoted by r. During construction of a spindle, if a new vector falls between C and the inner boundary, the vector is regarded as completely familiar and no action is taken. If the new vector falls into the region between the inner and outer boundaries, it is considered unusual enough to warrant the adjustment of C and r by use of the aforementioned algorithms, but not unusual enough to be considered novel. If a vector falls outside the outer boundary, it is considered novel, in which case one of several appropriate responses could be initiation of construction of a new spindle.
Gritz, L; Davies, J
1983-11-01
The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.
Mirshahabi, H; Soleimanjahi, H; Pourpak, Z; Meshkat, Z; Hassan, ZM
2012-01-01
Background Cervical cancer is one of the most important and widespread cancer which affects women. There are several causes of cervical cancer; among them HPV types 16 and 18 are the most prominent ones which are recurrent and persistent infections. These genotypes are currently about 70% of cervical cancer causes in developing countries. Due to the importance of these viruses in cervical cancer, we pioneered the production of Human Papilloma Virus type16 E6 oncoprotein as a recombinant protein in order to develop a vaccine. Two HPV oncoproteins, E6 and E7, are consistently expressed in HPV-associated cancer cells and are responsible for malignant transformation. These oncogenic proteins represent ideal target antigens for developing vaccine and immunotherapeutic strategies against HPV-associated neoplasm. Methods In the present study, the cloned E6-oncoprotein of HPV16 in pTZ57R/T-E6 vector was used to produce professional expression vector. The target gene was subcloned in a eukaryotic expression vector. The pcDNA3-E6 vector was propagated in E.coli strain DH5α and transfected into CHO cells 72 hours post-transfection. Results The transfected cells were harvested; mRNA detection and the interest protein production were confirmed by western blot analysis using specific anti E6 monoclonal antibody. Conclusion HPV16-E6 target protein recognized by specific antibody could be an appropriate form of protein, which can be used for further studies. Due to potential effect of this protein, its DNA construction can be used for DNA vaccine in future studies. PMID:25780534
Rahpeyma, Mehdi; Fotouhi, Fatemeh; Makvandi, Manouchehr; Ghadiri, Ata; Samarbaf-Zadeh, Alireza
2015-11-01
Crimean-Congo hemorrhagic fever virus (CCHFV) is a member of the nairovirus, a genus in the Bunyaviridae family, which causes a life threatening disease in human. Currently, there is no vaccine against CCHFV and detailed structural analysis of CCHFV proteins remains undefined. The CCHFV M RNA segment encodes two viral surface glycoproteins known as Gn and Gc. Viral glycoproteins can be considered as key targets for vaccine development. The current study aimed to investigate structural bioinformatics of CCHFV Gn protein and design a construct to make a recombinant bacmid to express by baculovirus system. To express the Gn protein in insect cells that can be used as antigen in animal model vaccine studies. Bioinformatic analysis of CCHFV Gn protein was performed and designed a construct and cloned into pFastBacHTb vector and a recombinant Gn-bacmid was generated by Bac to Bac system. Primary, secondary, and 3D structure of CCHFV Gn were obtained and PCR reaction with M13 forward and reverse primers confirmed the generation of recombinant bacmid DNA harboring Gn coding region under polyhedron promoter. Characterization of the detailed structure of CCHFV Gn by bioinformatics software provides the basis for development of new experiments and construction of a recombinant bacmid harboring CCHFV Gn, which is valuable for designing a recombinant vaccine against deadly pathogens like CCHFV.
Van Ba, Hoa; Hwang, Inho
2014-02-01
Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.
Zhao, Mingzhi; Wu, Feilin; Xu, Ping
2015-12-01
Trypsin is one of the most important enzymatic tools in proteomics and biopharmaceutical studies. Here, we describe the complete recombinant expression and purification from a trypsinogen expression vector construct. The Sus scrofa cationic trypsin gene with a propeptide sequence was optimized according to Escherichia coli codon-usage bias and chemically synthesized. The gene was inserted into pET-11c plasmid to yield an expression vector. Using high-density E. coli fed-batch fermentation, trypsinogen was expressed in inclusion bodies at 1.47 g/L. The inclusion body was refolded with a high yield of 36%. The purified trypsinogen was then activated to produce trypsin. To address stability problems, the trypsin thus produced was acetylated. The final product was generated upon gel filtration. The final yield of acetylated trypsin was 182 mg/L from a 5-L fermenter. Our acetylated trypsin product demonstrated higher BAEE activity (30,100 BAEE unit/mg) than a commercial product (9500 BAEE unit/mg, Promega). It also demonstrated resistance to autolysis. This is the first report of production of acetylated recombinant trypsin that is stable and suitable for scale-up. Copyright © 2015 Elsevier Inc. All rights reserved.
Sabaawy, H E; Zhang, F; Nguyen, X; ElHosseiny, A; Nasjletti, A; Schwartzman, M; Dennery, P; Kappas, A; Abraham, N G
2001-08-01
Heme oxygenase (HO) catalyzes the conversion of heme to biliverdin, with release of free iron and carbon monoxide. Both heme and carbon monoxide have been implicated in the regulation of vascular tone. A retroviral vector containing human HO-1 cDNA (LSN-HHO-1) was constructed and subjected to purification and concentration of the viral particles to achieve 5x10(9) to 1x10(10) colony-forming units per milliliter. The ability of concentrated infectious viral particles to express human HO-1 (HHO-1) in vivo was tested. A single intracardiac injection of the concentrated infectious viral particles (expressing HHO-1) to 5-day-old spontaneously hypertensive rats resulted in functional expression of the HHO-1 gene and attenuation of the development of hypertension. Rats expressing HHO-1 showed a significant decrease in urinary excretion of a vasoconstrictor arachidonic acid metabolite and a reduction in myogenic responses to increased intraluminal pressure in isolated arterioles. Unexpectedly, HHO-1 chimeric rats showed a simultaneous significant proportionate increase in somatic growth. Thus, delivery of HHO-1 gene by retroviral vector attenuates the development of hypertension and promotes body growth in spontaneously hypertensive rats.
Yuan, Ziguo; Zhang, Shoufeng; Liu, Ye; Zhang, Fei; Fooks, Anthony R; Li, Qianxue; Hu, Rongliang
2008-03-04
Several recombinant vaccines expressing the rabies virus glycoprotein have been developed, particularly for the oral vaccination of wildlife. While these vaccines induce protective immunity in some animal species such as foxes, they are less effective in others. Pseudorabies virus (PRV) has been licensed for use as a live vaccine in pigs and possesses an excellent safety and efficacy record. We have used it to construct a recombinant virus, rPRV/eGFP/rgp, expressing the rabies virus glycoprotein. This recombinant virus has been shown to be safe for dogs by oral and intramuscular routes of inoculation and was demonstrated to induce immune responses against both pseudorabies and rabies in dogs after a single oral dose of 2 x 10(7.0) plaque forming units (PFU). Neutralizing antibody titers against rabies reached > 0.5 IU/ml and 1:64-1:128 against pseudorabies by 5 weeks post-vaccination in all dogs, indicating that the pseudorabies virus vector infected dogs and replicated in vivo, and that the rabies virus glycoprotein had been expressed and an effective immune response elicited. Antibody titers were maintained for over 6 months. This suggests that pseudorabies virus could be an effective live vector for recombinant rabies oral vaccination.
Cui, Xianlan; Zhao, Yan; Shi, Xingming; Li, Qiaoling; Yan, Shuai; Gao, Ming; Wang, Mei; Liu, Changjun; Wang, Yunfeng
2013-01-01
Background Herpesvirus of turkey (HVT) as a vector to express the haemagglutinin (HA) of avian influenza virus (AIV) H5 was developed and its protection against lethal Marek’s disease virus (MDV) and highly pathogenic AIV (HPAIV) challenges was evaluated previously. It is well-known that avirulemt MDV type 1 vaccines are more effective than HVT in prevention of lethal MDV infection. To further increase protective efficacy against HPAIV and lethal MDV, a recombinant MDV type 1 strain 814 was developed to express HA gene of HPAIV H5N1. Methodology/Principal Findings A recombinant MDV-1 strain 814 expressing HA gene of HPAIV H5N1 virus A/goose/Guangdong/3/96 at the US2 site (rMDV-HA) was developed under the control of a human CMV immediate-early promoter. The HA expression in the rMDV-HA was tested by immunofluorescence and Western blot analyses, and in vitro and in vivo growth properties of rMDV-HA were also analyzed. Furthermore, we evaluated and compared the protective immunity of rMDV-HA and previously constructed rHVT-HA against HPAIV and lethal MDV. Vaccination of chickens with rMDV-HA induced 80% protection against HPAIV, which was better than the protection rate by rHVT-HA (66.7%). In the animal study with MDV challenge, chickens immunized with rMDV-HA were completely protected against virulent MDV strain J-1 whereas rHVT-HA only induced 80% protection with the same challenge dose. Conclusions/Significance The rMDV-HA vaccine was more effective than rHVT-HA vaccine for protection against lethal MDV and HPAIV challenges. Therefore, avirulent MDV type 1 vaccine is a better vector than HVT for development of a recombinant live virus vaccine against virulent MDV and HPAIV in poultry. PMID:23301062
Effects of Notch2 and Notch3 on Cell Proliferation and Apoptosis of Trophoblast Cell Lines.
Zhao, Wei-Xiu; Zhuang, Xu; Huang, Tao-Tao; Feng, Ran; Lin, Jian-Hua
2015-01-01
To investigate the effect of Notch2 and Notch3 on cell proliferation and apoptosis of two trophoblast cell lines, BeWo and JAR. Notch2 and Notch3 expression in BeWo and JAR cells was upregulated or downregulated using lentivirus-mediated overexpression or RNA interference. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. The effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V-PE Apoptosis kit. Lentivirus-based overexpression vectors were constructed by cloning the full-length coding sequences of human Notch2 and Notch3 C-terminally tagged with GFP or GFP alone (control) into a lentivirus-based expression vector. Lentivirus-based gene silencing vectors were prepared by cloning small interfering sequences targeting human Notch2 and Notch3 and scrambled control RNA sequence into a lentivirus-based gene knockdown vector. The effect of Notch2 and Notch3 on cell proliferation was assessed by the CCK-8 assay. And the effect of Notch2 and Notch3 on the apoptosis of BeWo and JAR cells was evaluated by flow cytometry using the Annexin V PE Apoptosis kit. We found that the downregulation of Notch2 and Notch3 gene expression in BeWo and JAR cells resulted in an increase in cell proliferation, while upregulation of Notch3 and Notch2 expression led to a decrease in cell proliferation. Moreover, the overexpression of Notch3 and Notch2 in BeWo and JAR cells reduced apoptosis in these trophoblast cell lines, whereas apoptosis was increased in the cells in which the expression of Notch3 and Notch2 was downregulated. Notch2 and Notch3 inhibited both cell proliferation and cell apoptosis in BeWo and JAR trophoblast cell lines.
Genome-wide prediction and analysis of human tissue-selective genes using microarray expression data
2013-01-01
Background Understanding how genes are expressed specifically in particular tissues is a fundamental question in developmental biology. Many tissue-specific genes are involved in the pathogenesis of complex human diseases. However, experimental identification of tissue-specific genes is time consuming and difficult. The accurate predictions of tissue-specific gene targets could provide useful information for biomarker development and drug target identification. Results In this study, we have developed a machine learning approach for predicting the human tissue-specific genes using microarray expression data. The lists of known tissue-specific genes for different tissues were collected from UniProt database, and the expression data retrieved from the previously compiled dataset according to the lists were used for input vector encoding. Random Forests (RFs) and Support Vector Machines (SVMs) were used to construct accurate classifiers. The RF classifiers were found to outperform SVM models for tissue-specific gene prediction. The results suggest that the candidate genes for brain or liver specific expression can provide valuable information for further experimental studies. Our approach was also applied for identifying tissue-selective gene targets for different types of tissues. Conclusions A machine learning approach has been developed for accurately identifying the candidate genes for tissue specific/selective expression. The approach provides an efficient way to select some interesting genes for developing new biomedical markers and improve our knowledge of tissue-specific expression. PMID:23369200
Impact of age and vector construct on striatal and nigral transgene expression
Polinski, Nicole K; Manfredsson, Fredric P; Benskey, Matthew J; Fischer, D Luke; Kemp, Christopher J; Steece-Collier, Kathy; Sandoval, Ivette M; Paumier, Katrina L; Sortwell, Caryl E
2016-01-01
Therapeutic protein delivery using viral vectors has shown promise in preclinical models of Parkinson’s disease (PD) but clinical trial success remains elusive. This may partially be due to a failure to include advanced age as a covariate despite aging being the primary risk factor for PD. We investigated transgene expression following intracerebral injections of recombinant adeno-associated virus pseudotypes 2/2 (rAAV2/2), 2/5 (rAAV2/5), 2/9 (rAAV2/9), and lentivirus (LV) expressing green fluorescent protein (GFP) in aged versus young adult rats. Both rAAV2/2 and rAAV2/5 yielded lower GFP expression following injection to either the aged substantia nigra or striatum. rAAV2/9-mediated GFP expression was deficient in the aged striatonigral system but displayed identical transgene expression between ages in the nigrostriatal system. Young and aged rats displayed equivalent GFP levels following LV injection to the striatonigral system but LV-delivered GFP was deficient in delivering GFP to the aged nigrostriatal system. Notably, age-related transgene expression deficiencies revealed by protein quantitation were poorly predicted by GFP-immunoreactive cell counts. Further, in situ hybridization for the viral CβA promoter revealed surprisingly limited tropism for astrocytes compared to neurons. Our results demonstrate that aging is a critical covariate to consider when designing gene therapy approaches for PD. PMID:27933309
Tang, Zhiru; Zhang, Youming; Stewart, Adrian Francis; Geng, Meimei; Tang, Xiangsha; Tu, Qiang; Yin, Yulong
2010-10-01
Bovine lactoferricin (LFC) and bovine lactoferrampin (LFA) are two active fragments located in the N(1)-domain of bovine lactoferrin. Recent studies suggested that LFC and LFA have broad-spectrum activity against Gram-positive and Gram-negative bacteria. To date, LFC and LFA have usually been produced from milk. We report here the high-level expression, purification and characterization of LFC and LFA using the Photorhabdus luminescens expression system. After the cipA and cipB genes were deleted by ET recombination, the expression host P. luminescens TZR(001) was constructed. A synthetic LFC-LFA gene containing LFC and LFA was fused with the cipB gene to form a cipB-LFC-LFA gene. To obtain the expression vector pBAD-cipB-LFC-LFA, the cipB-LFC-LFA gene was cloned on the L-arabinose-inducible expression vector pBAD24. pBAD-cipB-LFC-LFA was transformed into P. luminescens TZR(001). The cipB-LFC-LFA fusion protein was expressed under the induction of L-arabinose and its yield reached 12 mg L(-1) bacterial culture. Recombinant LFC-LFA was released from cipB by pepsin. The MIC of recombinant LFC-LFA toward E. coli 0149, 0141 and 020 was 6.25, 12.5 and 3.175 microg ml(-1), respectively. Copyright 2010 Elsevier Inc. All rights reserved.
Ren, H; Stiles, G L
1994-01-01
The human A1 adenosine receptor gene contains six exons with exons 1, 2, 3, 4, and part of 5 representing 5' untranslated regions. Reverse transcription-PCR with exon-specific primers showed two distinct transcripts containing either exons 3, 5, and 6 or exons 4, 5, and 6, with exons 3 and 4 being mutually exclusive. No mature mRNAs containing exons 1 and 2 have been detected. All human tissues that express any A1 receptors contain mRNA with exons 4, 5, and 6. Tissues which express high levels of A1 receptors contain mRNA with exons 3, 5, and 6. Exon 4 contains two upstream ATG codons whereas exon 3 contains none. COS cells transfected with expression vectors containing exon 4 (exons 1-6, 3-6, or Ex4-6) express much lower levels of A1 receptors than vectors without exon 4 (exons 3, 5, and 6). Mutation of upstream ATG codons in exon 4 leads to 3- to 7-fold increased A1 receptor expression, up to the level seen with the construct containing exons 3, 5, and 6. Thus, in human tissues "basal" levels of A1 receptors can be expressed by use of mRNA containing exons 4, 5, and 6, but when high levels are needed, alternative transcripts with exons 3, 5, and 6 are produced. Images PMID:8197148
Zhang, Xiaoxiao; Truax, Agnieszka D.; Ma, Ruixue; Liu, Ziyu; Lei, Yingfeng; Zhang, Liang; Ye, Wei; Zhang, Fanglin; Xu, Zhikai; Shang, Lei; Liu, Rongrong; Wang, Fang; Wu, Xingan
2016-01-01
Infection of Hantaan virus (HTNV) usually causes hemorrhagic fever with renal syndrome (HFRS). China has the worst epidemic incidence of HFRS as well as high fatality. Inactivated whole virus has been used for HFRS vaccination, however there are still problems such as safety concerns. CD40 ligand (CD40L) and granulocyte macrophage colony-stimulating factor (GM-CSF) are well-known immune stimulating molecules that can enhance antigen presenting, lymphocytes activation and maturation, incorporation of CD40L and GM-CSF to the surface of virus like particles (VLPs) can greatly improve the vaccination effect. We constructed eukaryotic vectors expressing HTNV M segment and S segment, as well as vectors expressing HTNV M segment with CD40L or GM-CSF, our results showed successful production of CD40L or GM-CSF incorporated HTNV VLPs. In vitro stimulation with CD40L or GM-CSF anchored HTNV VLP showed enhanced activation of macrophages and DCs. CD40L/GM-CSF incorporated VLP can induce higher level of HTNV specific antibody and neutralizing antibody in mice. Immunized mice splenocytes showed higher ability of secreting IFN-γ and IL-2, as well as enhancing CTL activity. These results suggest CD40L/GM-CSF incorporated VLP can serve as prospective vaccine candidate. PMID:27542281
Kharazmi, Sara; Ataie Kachoie, Elham; Behjatnia, Seyed Ali Akbar
2016-05-01
The betasatellite DNA associated with Cotton leaf curl Multan virus (CLCuMB) contains a single complementary-sense ORF, βC1, which is a pathogenicity determinant. CLCuMB was able to replicate in plants in the presence of diverse helper geminiviruses, including Tomato leaf curl virus-Australia (TLCV-Au), Iranian isolate of Tomato yellow leaf curl virus (TYLCV-[Ab]), and Beet curly top virus (BCTV-Svr), and can be used as a plant gene delivery vector. To test the hypothesis that CLCuMB has the potential to act as an animal gene delivery vector, a specific insertion construct was produced by the introduction of a human B-cell lymphoma 2 (Bcl-2) cDNA into a mutant DNA of CLCuMB in which the βC1 was deleted (β∆C1). The recombinant βΔC1-Bcl-2 construct was successfully replicated in tomato and tobacco plants in the presence of TLCV-Au, BCTV-Svr and TYLCV-[Ab]. Real-time PCR and Western blot analyses of plants containing the replicative forms of recombinant βΔC1-Bcl-2 DNA showed that Bcl-2 gene was expressed in an acceptable level in these plants, indicating that β∆C1 can be used as a tool to deliver and express animal genes in plants. This CLCuMB-based system, having its own promoter activity, offers the possibility of production of animal recombinant proteins in plants.
NASA Astrophysics Data System (ADS)
Zeng, Xi; Mizuno, Yosuke; Nakamura, Kentaro
2017-12-01
The sound intensity vector provides useful information on the state of an ultrasonic field in water, since sound intensity is a vector quantity expressing the direction and magnitude of the sound field. In the previous studies on sound intensity measurement in water, conventional piezoelectric sensors and metal cables were used, and the transmission distance was limited. A new configuration of a sound intensity probe suitable for ultrasonic measurement in water is proposed and constructed for trial in this study. The probe consists of light-emitting diodes and piezoelectric elements, and the output signals are transmitted through fiber optic cables as intensity-modulated light. Sound intensity measurements of a 26 kHz ultrasonic field in water are demonstrated. The difference in the intensity vector state between the water tank with and without sound-absorbing material on its walls was successfully observed.
Efficient disruption of Zebrafish genes using a Gal4-containing gene trap
2013-01-01
Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702
Screening and large-scale expression of membrane proteins in mammalian cells for structural studies.
Goehring, April; Lee, Chia-Hsueh; Wang, Kevin H; Michel, Jennifer Carlisle; Claxton, Derek P; Baconguis, Isabelle; Althoff, Thorsten; Fischer, Suzanne; Garcia, K Christopher; Gouaux, Eric
2014-11-01
Structural, biochemical and biophysical studies of eukaryotic membrane proteins are often hampered by difficulties in overexpression of the candidate molecule. Baculovirus transduction of mammalian cells (BacMam), although a powerful method to heterologously express membrane proteins, can be cumbersome for screening and expression of multiple constructs. We therefore developed plasmid Eric Gouaux (pEG) BacMam, a vector optimized for use in screening assays, as well as for efficient production of baculovirus and robust expression of the target protein. In this protocol, we show how to use small-scale transient transfection and fluorescence-detection size-exclusion chromatography (FSEC) experiments using a GFP-His8-tagged candidate protein to screen for monodispersity and expression level. Once promising candidates are identified, we describe how to generate baculovirus, transduce HEK293S GnTI(-) (N-acetylglucosaminyltransferase I-negative) cells in suspension culture and overexpress the candidate protein. We have used these methods to prepare pure samples of chicken acid-sensing ion channel 1a (cASIC1) and Caenorhabditis elegans glutamate-gated chloride channel (GluCl) for X-ray crystallography, demonstrating how to rapidly and efficiently screen hundreds of constructs and accomplish large-scale expression in 4-6 weeks.
Schmitz, M; Graf, C; Gut, T; Sirena, D; Peter, I; Dummer, R; Greber, U F; Hemmi, S
2006-06-01
Replicating adenovirus (Ad) vectors with tumour tissue specificity hold great promise for treatment of cancer. We have recently constructed a conditionally replicating Ad5 AdDeltaEP-TETP inducing tumour regression in a xenograft mouse model. For further improvement of this vector, we introduced four genetic modifications and analysed the viral cytotoxicity in a large panel of melanoma cell lines and patient-derived melanoma cells. (1) The antiapoptotic gene E1B-19 kDa (Delta19 mutant) was deleted increasing the cytolytic activity in 18 of 21 melanoma cells. (2) Introduction of the E1A 122-129 deletion (Delta24 mutant), suggested to attenuate viral replication in cell cycle-arrested cells, did not abrogate this activity and increased the cytolytic activity in two of 21 melanoma cells. (3) We inserted an RGD sequence into the fiber to extend viral tropism to alphav integrin-expressing cells, and (4) swapped the fiber with the Ad35 fiber (F35) enhancing the tropism to malignant melanoma cells expressing CD46. The RGD-fiber modification strongly increased cytolysis in all of the 11 CAR-low melanoma cells. The F35 fiber-chimeric vector boosted the cytotoxicity in nine of 11 cells. Our results show that rational engineering additively enhances the cytolytic potential of Ad vectors, a prerequisite for the development of patient-customized viral therapies.
Gan, Hui; Zhou, Yong; Sun, Ping; Zhu, Xiao-Xia; Wang, Quan-Li; Zhan, Lin-Sheng
2007-08-01
This study was purposed to verify the binding part of human complement C3 to complement receptor III (CRIII) in monocytes, the peptide rC3B, including the binding-site, was expressed, purified and identified. rC3B, the binding part of human complement C3 to CRIII, was selected by computer-aided modeling and summarizing researches published. Then, rC3B gene fragment was amplified by PCR, and cloned into prokaryotic vector pQE30a. The fusion protein rC3B was expressed in E.coli M15 and purified by Ni(2+)-chelating affinity chromatography. The activity of rC3B was identified by Western blot and adherence assay with monocytes. The results showed that rC3B fragment was obtained, and a prokaryotic expression vector pQE30-rC3B was constructed. rC3B was efficiently expressed and purified. In Western blot, the target protein showed the activity of binding with C3 antibody, while the purified protein showed the activity of adherence with monocytes. It is concluded that the recombinant C3B was obtained and identified, and this study lay the basis for the further functional analysis of C3.
SUN, LIJUN; HAO, YUEWEN; NIE, XIAOWEI; ZHANG, XUEXIN; YANG, GUANGXIAO; WANG, QUANYING
2012-01-01
The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the immunohistochemical method and results showed that the expression was positive in the experimental group. Myocardium perfusion MRI displayed that the infracted area significantly decreased under the action of pSS-HRE-CMV-NT4-PR39-PolyA-AAV. The artificial minimal HRE in CRL-1730 cells effectively and rapidly regulates the expression of the downstream gene NT4-TAT-His-PR39 of the CMV promoter. Recombinant pSS-HRE-CMV-NT4-PR39-Poly-AAAV promotes neoangiogenesis in the ischemic area, reduces the area of infarction and improves heart function. PMID:23226731
Sun, Lijun; Hao, Yuewen; Nie, Xiaowei; Zhang, Xuexin; Yang, Guangxiao; Wang, Quanying
2012-11-01
The objective of this study was to investigate the effect of the PR39 recombinant adeno-associated virus (AAV) controlled by the hypoxia-responsive element (HRE) on gene therapy of ischemic heart disease. The minimal HRE was artificially synthesized and the AAV vector controlled by HRE was introduced with NT4-TAT-His-PR39 to investigate the expression of AAV-PR39 in hypoxic vascular endothelial cells (VEC) of human umbilical vein (CRL-1730 cell line) and the angiogenesis-promoting effect in pigs with acute myocardial infraction (AMI). The minimal HRE/CMV was designed and artificially synthesized using the PCR method and cloned with the T vector cloning method. The pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV plasmid was constructed. Using the calcium phosphate precipitation method, HEK-293 cells were co-transfected with three plasmids to produce the recombinant virus. An equal volume of pSS-HRE-CMV-NT4-6His-PR39-PolyAAAV and enterovirus (EV, blank virus) was transfected into CRL-1730 cell lines, respectively. The immunohistochemical method was used to assay the expression of 6xHis in CRL-1730 cell lines and the expression of PR39 under hypoxia. Eighteen AMI miniature pigs were randomized into the experimental group (HRE-AAV-PR39 group), control group 1 (physical saline group) and control group 2 (EV group). The area of ischemia was assessed with conventional MRI and myocardium perfusion MRI. Pigs were sacrificed at preset time-points to obtain samples of ischemic myocardium. Morphological and pathological data were collected. According to data in the literature and databases, the minimal HRE was designed and synthesized with the PCR method. A large number of HREs were connected to modified pSSHGAAV (pSSV9int-/XbaI) vector followed by insertion of the NT4-6His-PR39 gene segment and, thus, the recombinant plasmid pSS-HRE-CMV-NT4-6His-PR39-PolyA-AAV was successfully constructed. The expression of 6xHis in CRL-1730 cells under the regulation of HRE was assayed using the immunohistochemical method and results showed that the expression was positive in the experimental group. Myocardium perfusion MRI displayed that the infracted area significantly decreased under the action of pSS-HRE-CMV-NT4-PR39-PolyA-AAV. The artificial minimal HRE in CRL-1730 cells effectively and rapidly regulates the expression of the downstream gene NT4-TAT-His-PR39 of the CMV promoter. Recombinant pSS-HRE-CMV-NT4-PR39-Poly-AAAV promotes neoangiogenesis in the ischemic area, reduces the area of infarction and improves heart function.
Nishikawa, Y; Ikeda, H; Fukumoto, S; Xuan, X; Nagasawa, H; Otsuka, H; Mikami, T
2000-10-01
In order to develop a vaccine against Neospora caninum in dogs, we constructed recombinant canine herpesvirus (CHV) expressing N. caninum surface protein, NcSRS2. Indirect immunofluorescence indicated that the antigenic structure of the recombinant NcSRS2 was similar to the authentic parasite protein. The dogs immunised with recombinant virus produced IgG antibody to N. caninum, and their sera recognised the parasite protein on Western blot. The dogs inoculated with recombinant virus showed no clinical symptoms and infectious CHV was not recovered from the dogs, suggesting that recombinant CHV expressing N. caninum proteins may lead to a vaccine against neosporosis in dogs.
Zhang, Chao; Shan, Liwei; Su, Shuaikun; Nan, Yanni; Guo, Zhongyu; Fan, Sanhong
2012-07-01
Wheat grain peroxidase 1 (WP1) belonged to class III plant peroxidase with cofactor heme, which not only has antifungal activity, but also influences the processing quality of flour. In order to enhance functional expression of WP1 in prokaryotic system by increasing endogenous heme synthesis, we constructed a recombinant plasmid pACYC-A-L containing hemA and hemL of Esherichia coli. Then, we co-transformed it into host strain T7 Express with secretive expression vector (pMAL-p4x-WP1) or non-secretive expression vector (pET21a-MBP-WP1), respectively. The MBP-WP1 fusion protein was further purified by amylose affinity chromatography and its peroxidase activity was assayed using 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) as substrate. At 12 h after induction at 28 degree, the extracellular 5-aminolevulinic acid (5-ALA) production of T7 Express/pACYC-A-L was up to 146.73 mg/L, simultaneously the extracellular porphrins also increased dramatically. The peroxidase activity of functional MBP-WP1 obtained from T7 Express/ (pACYC-A-L + pMAL-p4x-WP1) was 14.6-folds of that purified from T7 Express/ pET21a-MBP-WP1. This study not only successfully enhanced functional expression of wheat peroxidase 1 in Esherichia coli, but also provided beneficial references for other important proteins with cofactor heme.
Malecki, Marek; LaVanne, Christine; Alhambra, Dominique; Dodivenaka, Chaitanya; Nagel, Sarah; Malecki, Raf
2014-01-01
Introduction The worst possible complication of using stem cells for regenerative therapy is iatrogenic cancerogenesis. The ultimate goal of our work is to develop a self-triggering feedback mechanism aimed at causing death of all stem cells, which resist directed differentiation, keep proliferating, and can grow into tumors. Specific aim The specific aim was threefold: (1) to genetically engineer the DNA constructs for the human, recombinant DNASE1, DNASE1L3, DNASE2, DFFB controlled by POLA promoter; (2) to bioengineer anti-SSEA-4 antibody guided vectors delivering transgenes to human undifferentiated and proliferating pluripotent stem cells; (3) to cause death of proliferating and directed differentiation resisting stem cells by transgenic expression of the human recombinant the DNases (hrDNases). Methods The DNA constructs for the human, recombinant DNASE1, DNASE1L3, DNASE2, DFFB controlled by POLA promoter were genetically engineered. The vectors targeting specifically SSEA-4 expressing stem cells were bioengineered. The healthy volunteers’ bone marrow mononuclear cells (BMMCs) were induced into human, autologous, pluripotent stem cells with non-integrating plasmids. Directed differentiation of the induced stem cells into endothelial cells was accomplished with EGF and BMP. The anti-SSEA 4 antibodies’ guided DNA vectors delivered the transgenes for the human recombinant DNases’ into proliferating stem cells. Results Differentiation of the pluripotent induced stem cells into the endothelial cells was verified by highlighting formation of tight and adherens junctions through transgenic expression of recombinant fluorescent fusion proteins: VE cadherin, claudin, zona occludens 1, and catenin. Proliferation of the stem cells was determined through highlighting transgenic expression of recombinant fluorescent proteins controlled by POLA promoter, while also reporting expression of the transgenes for the hrDNases. Expression of the transgenes for the DNases resulted in complete collapse of the chromatin architecture and degradation of the proliferating cells’ genomic DNA. The proliferating stem cells, but not the differentiating ones, were effectively induced to die. Conclusion Herein, we describe attaining the proof-of-concept for the strategy, whereby transgenic expression of the genetically engineered human recombinant DNases in proliferating and directed differentiation resisting stem cells leads to their death. This novel strategy reduces the risk of iatrogenic neoplasms in stem cell therapy. PMID:25045589
A simple method for construction of artificial microRNA vector in plant.
Li, Yang; Li, Yang; Zhao, Sunping; Zhong, Sheng; Wang, Zhaohai; Ding, Bo; Li, Yangsheng
2014-10-01
Artificial microRNA (amiRNA) is a powerful tool for silencing genes in many plant species. Here we provide an easy method to construct amiRNA vectors that reinvents the Golden Gate cloning approach and features a novel system called top speed amiRNA construction (TAC). This speedy approach accomplishes one restriction-ligation step in only 5 min, allowing easy and high-throughput vector construction. Three primers were annealed to be a specific adaptor, then digested and ligated on our novel vector pTAC. Importantly, this method allows the recombined amiRNA constructs to maintain the precursor of osa-miR528 with exception of the desired amiRNA/amiRNA* sequences. Using this method, our results showed the expected decrease of targeted genes in Nicotiana benthamiana and Oryza sativa.
Gene transfer of high-mobility group box 1 box-A domain in a rat acute liver failure model.
Tanaka, Masayuki; Shinoda, Masahiro; Takayanagi, Atsushi; Oshima, Go; Nishiyama, Ryo; Fukuda, Kazumasa; Yagi, Hiroshi; Hayashida, Tetsu; Masugi, Yohei; Suda, Koichi; Yamada, Shingo; Miyasho, Taku; Hibi, Taizo; Abe, Yuta; Kitago, Minoru; Obara, Hideaki; Itano, Osamu; Takeuchi, Hiroya; Sakamoto, Michiie; Tanabe, Minoru; Maruyama, Ikuro; Kitagawa, Yuko
2015-04-01
High-mobility group box 1 (HMGB1) has recently been identified as an important mediator of various kinds of acute and chronic inflammation. The protein encoded by the box-A domain of the HMGB1 gene is known to act as a competitive inhibitor of HMGB1. In this study, we investigated whether box-A gene transfer results in box-A protein production in rats and assessed therapeutic efficacy in vivo using an acute liver failure (ALF) model. Three types of adenovirus vectors were constructed-a wild type and two mutants-and a mutant vector was then selected based on the secretion from HeLa cells. The secreted protein was subjected to a tumor necrosis factor (TNF) production inhibition test in vitro. The vector was injected via the portal vein in healthy Wistar rats to confirm box-A protein production in the liver. The vector was then injected via the portal vein in rats with ALF. Western blot analysis showed enhanced expression of box-A protein in HeLa cells transfected with one of the mutant vectors. The culture supernatant from HeLa cells transfected with the vector inhibited TNF-α production from macrophages. Expression of box-A protein was confirmed in the transfected liver at 72 h after transfection. Transfected rats showed decreased hepatic enzymes, plasma HMGB1, and hepatic TNF-α messenger RNA levels, and histologic findings and survival were significantly improved. HMGB1 box-A gene transfer results in box-A protein production in the liver and appears to have a beneficial effect on ALF in rats. Copyright © 2015 Elsevier Inc. All rights reserved.
Kamensek, Urska; Tesic, Natasa; Sersa, Gregor; Kos, Spela; Cemazar, Maja
2017-01-01
Electrotransfer mediated delivery of interleukin-12 (IL-12) gene, encoded on a plasmid vector, has already been demonstrated to have a potent antitumor efficacy and great potential for clinical application. In the present study, our aim was to construct an optimized IL-12-encoding plasmid that is safe from the regulatory point of view. In light of previous studies demonstrating that IL-12 should be released in a tumor localized manner for optimal efficacy, the strong ubiquitous promoter was replaced with a weak endogenous promoter of the collagen 2 gene, which is specific for fibroblasts. Next, to comply with increasing regulatory demands for clinically used plasmids, the expression cassette was cloned in a plasmid lacking the antibiotic resistance gene. The constructed fibroblast-specific and antibiotic-free IL-12 plasmid was demonstrated to support low IL-12 expression after gene electrotransfer in selected cell lines. Furthermore, the removal of antibiotic resistance did not affect the plasmid expression profile and lowered its cytotoxicity. With optimal IL-12 expression and minimal transgene non-specific effects, i.e., low cytotoxicity, the constructed plasmid could be especially valuable for different modern immunological approaches to achieve localized boosting of the host's immune system. Copyright © 2016 Elsevier Inc. All rights reserved.
Genic insights from integrated human proteomics in GeneCards.
Fishilevich, Simon; Zimmerman, Shahar; Kohn, Asher; Iny Stein, Tsippi; Olender, Tsviya; Kolker, Eugene; Safran, Marilyn; Lancet, Doron
2016-01-01
GeneCards is a one-stop shop for searchable human gene annotations (http://www.genecards.org/). Data are automatically mined from ∼120 sources and presented in an integrated web card for every human gene. We report the application of recent advances in proteomics to enhance gene annotation and classification in GeneCards. First, we constructed the Human Integrated Protein Expression Database (HIPED), a unified database of protein abundance in human tissues, based on the publically available mass spectrometry (MS)-based proteomics sources ProteomicsDB, Multi-Omics Profiling Expression Database, Protein Abundance Across Organisms and The MaxQuant DataBase. The integrated database, residing within GeneCards, compares favourably with its individual sources, covering nearly 90% of human protein-coding genes. For gene annotation and comparisons, we first defined a protein expression vector for each gene, based on normalized abundances in 69 normal human tissues. This vector is portrayed in the GeneCards expression section as a bar graph, allowing visual inspection and comparison. These data are juxtaposed with transcriptome bar graphs. Using the protein expression vectors, we further defined a pairwise metric that helps assess expression-based pairwise proximity. This new metric for finding functional partners complements eight others, including sharing of pathways, gene ontology (GO) terms and domains, implemented in the GeneCards Suite. In parallel, we calculated proteome-based differential expression, highlighting a subset of tissues that overexpress a gene and subserving gene classification. This textual annotation allows users of VarElect, the suite's next-generation phenotyper, to more effectively discover causative disease variants. Finally, we define the protein-RNA expression ratio and correlation as yet another attribute of every gene in each tissue, adding further annotative information. The results constitute a significant enhancement of several GeneCards sections and help promote and organize the genome-wide structural and functional knowledge of the human proteome. Database URL:http://www.genecards.org/. © The Author(s) 2016. Published by Oxford University Press.
NASA Astrophysics Data System (ADS)
Wu, Jinxia; Hu, Zhangli; Wang, Chaogang; Li, Shuangfei; Lei, Anping
2008-08-01
To improve the expression efficiency of exogenous genes in Chlamydomonas reinhardtii, a high efficient expression vector was constructed. Green fluorescent protein (GFP) was expressed in C. reinhardtii under the control of promoters: RBCS2 and HSP70A-RBCS2. Efficiency of transformation and expression were compared between two transgenic algae: RBCS2 mediated strain Tran-I and HSP70A-RBCS2 mediated strain Tran-II. Results show that HSP70A-RBCS2 could improve greatly the transformation efficiency by approximately eightfold of RBCS2, and the expression efficiency of GFP in Tran-II was at least double of that in Tran-I. In addition, a threefold increase of GFP in Tran-II was induced by heat shock at 40°C. All of the results demonstrated that HSP70A-RBCS2 was more efficient than RBCS2 in expressing exogenous gene in C. reinhardtii.
Fukuzawa, Noriho; Ishihara, Takeaki; Itchoda, Noriko; Tabayashi, Noriko; Kataoka, Chiwa; Masuta, Chikara; Matsumura, Takeshi
2011-01-01
A plant viral vector has the potential to efficiently produce recombinant proteins at a low cost in a short period. Although recombinant proteins can be also produced by transgenic plants, a plant viral vector, if available, may be more convenient when urgent scale-up in production is needed. However, it is difficult to use a viral vector in open fields because of the risk of escape to the environment. In this study, we constructed a novel viral vector system using a movement-defective Cucumber mosaic virus (CMV) vector, which is theoretically localized in the inoculated cells but infects systemically only with the aid of the transgenic helper plant that complements viral movement, diminishing the risk of viral proliferation. Interestingly, the helper plant systemically infected with the vector gave strong cross-protection against challenge inoculation with wild-type CMVs. Using CMV strains belonging to two discrete CMV groups (subgroups I and II), we also improved the system to prevent recombination between the vector and the transgene transcript in the helper plant. We here demonstrate the expression of an anti-dioxin single chain variable fragment (DxscFv) and interleukin-1 receptor antagonist (IL1-Ra) in Nicotiana benthamiana by this viral vector confinement system, which is applicable for many useful high-quality recombinant proteins. © 2010 The Authors. Plant Biotechnology Journal © 2010 Society for Experimental Biology and Blackwell Publishing Ltd.
Zhang, Yan; Jiang, Qiang; Huang, Jinming; Ju, Zhihua; Wang, Xiuge; Zhong, Jifeng; Wang, Changfa
2016-01-01
Inner centromere protein (INCENP) plays an important role in mitosis and meiosis as the main member of chromosomal passenger protein complex (CPC). To investigate the functional markers of the INCENP gene associated with semen quality, the single nucleotide polymorphisms (SNPs) g.19970 A>G and g.34078 T>G were identified and analyzed. The new splice variant INCENP-TV is characterized by the deletion of exon 12. The g.19970 A>G in the exonic splicing enhancer (ESE) motif region results in an aberrant splice variant by constructing two minigene expression vectors using the pSPL3 exon capturing vector and transfecting vectors into MLTC-1 cells. INCENP-TV was more highly expressed than INCENP-reference in adult bull testes. The g.34078 T>G located in the binding region of bta-miR-378 could affect the expression of INCENP, which was verified by luciferase assay. To analyze comprehensively the correlation of SNPs with sperm quality, haplotype combinations constructed by g.19970 A>G and g.34078 T>G, as well as g.-692 C>T and g.-556 G>T reported in our previous studies, were analyzed. The bulls with H1H12 and H2H2 exhibited a higher ejaculate volume than those with H2H10 and H9H12, respectively (P < 0.05). Bulls with H11H11 and H2H10 exhibited higher initial sperm motility than those with H2H2 (P < 0.05). The expression levels of INCENP in bulls with H1H12 and H11H11 were significantly higher than those in bulls with H9H12 (P < 0.05), as determined by qRT-PCR. Findings suggest that g.19970 A>G and g.34078 T>G in INCENP both of which appear to change the molecular and biological characteristics of the mRNA transcribed from the locus may serve as a biomarkers of male bovine fertility by affecting alternative splicing mode and binding affinity with the target bta-miR-378. PMID:27669152
Wang, Yuchen; Sima, Linshan; Lv, Jie; Huang, Suiyuan; Liu, Ying; Wang, Jiao; Krupovic, Mart; Chen, Xiangdong
2016-07-15
The temperate haloarchaeal virus SNJ1 displays lytic and lysogenic life cycles. During the lysogenic cycle, the virus resides in its host, Natrinema sp. strain J7-1, in the form of an extrachromosomal circular plasmid, pHH205. In this study, a 3.9-kb region containing seven predicted genes organized in two operons was identified as the minimal replicon of SNJ1. Only RepA, encoded by open reading frame 11-12 (ORF11-12), was found to be essential for replication, and its expression increased during the lytic cycle. Sequence analysis suggested that RepA is a distant homolog of HUH endonucleases, a superfamily that includes rolling-circle replication initiation proteins from various viruses and plasmids. In addition to RepA, two genetic elements located within both termini of the 3.9-kb replicon were also required for SNJ1 replication. SNJ1 genome and SNJ1 replicon-based shuttle vectors were present at 1 to 3 copies per chromosome. However, the deletion of ORF4 significantly increased the SNJ1 copy number, suggesting that the product of ORF4 is a negative regulator of SNJ1 abundance. Shuttle vectors based on the SNJ1 replicon were constructed and validated for stable expression of heterologous proteins, both in J7 derivatives and in Natrinema pallidum JCM 8980(T), suggesting their broad applicability as genetic tools for Natrinema species. Archaeal viruses exhibit striking morphological diversity and unique gene content. In this study, the minimal replicon of the temperate haloarchaeal virus SNJ1 was identified. A number of ORFs and genetic elements controlling virus genome replication, maintenance, and copy number were characterized. In addition, based on the replicon, a novel expression shuttle vector has been constructed and validated for protein expression and purification in Natrinema sp. CJ7 and Natrinema pallidum JCM 8980(T) This study not only provided mechanistic and functional insights into SNJ1 replication but also led to the development of useful genetic tools to investigate SNJ1 and other viruses infecting Natrinema species as well as their hosts. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
Zhang, Xiaoguang; Yang, Ren; Wang, Jiao; Wang, Xuan; Hou, Mieling; An, Lina; Zhu, Ying; Cao, Yuxi; Zeng, Yi
2016-01-01
We used 293 cells to express the recombinant membrane protein of the Ebola virus. Then, the immunogenicity of the recombinant protein was studied by immunized BALB/c mice. According to the codon use frequency of humans, the gene encoding the extracellular domain of the Ebola virus membrane protein was optimized, synthesized, and inserted into the eukaryotic expression plasmid pXG-Fc to construct the human IgG Fc and Ebola GP fusion protein expression plasmid pXG-modGP-Fc. To achieve expression, the fusion protein expression vector was transfected into high-density 293 cells using transient transfection technology. The recombinant protein was purified by protein A affinity chromatography. BALB/c mice were immunized with the purified fusion protein, and serum antibody titers evaluated by an indirect enzyme-linked immunosorbent assay (ELISA). Purification and analyses of the protein revealed that the eukaryotic expression vector could express the recombinant protein GP-Fc effectively, and that the recombinant protein in the supernatant of the cell culture was present as a dimer. After immunization with the purified recombinant protein, a high titer of antigen-specific IgG could be detected in the serum of immunized mice by indirect ELISA, showing that the recombinant protein had good immunogenicity. These data suggest that we obtained a recombinant protein with good immunogenicity. Our study is the basis for development of a vaccine against the Ebola virus and for screening of monoclonal antibodies.
A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads
Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...
2018-02-01
In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less
A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka
In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less
NASA Astrophysics Data System (ADS)
Batmunkh, N.; Sannikova, T. N.; Kholshevnikov, K. V.
2018-04-01
The motion of a zero-mass point under the action of gravitation toward a central body and a perturbing acceleration P is considered. The magnitude of P is taken to be small compared to the main acceleration due to the gravitation of the central body, and the components of the vector P are taken to be constant in a reference frame with its origin at the central body and its axes directed along the velocity vector, normal to the velocity vector in the plane of the osculating orbit, and along the binormal. The equations in the mean elements were obtained in an earlier study. The algorithm used to solve these equations is given in this study. This algorithm is analogous to one constructed earlier for the case when P is constant in a reference frame tied to the radius vector. The properties of the solutions are similar. The main difference is that, in the most important cases, the quadratures to which the solution reduces lead to non-elementary functions. However, they can be expressed as series in powers of the eccentricity e that converge for e < 1, and often also for e = 1.
NASA Astrophysics Data System (ADS)
Jia, Rui-Sheng; Sun, Hong-Mei; Peng, Yan-Jun; Liang, Yong-Quan; Lu, Xin-Ming
2017-07-01
Microseismic monitoring is an effective means for providing early warning of rock or coal dynamical disasters, and its first step is microseismic event detection, although low SNR microseismic signals often cannot effectively be detected by routine methods. To solve this problem, this paper presents permutation entropy and a support vector machine to detect low SNR microseismic events. First, an extraction method of signal features based on multi-scale permutation entropy is proposed by studying the influence of the scale factor on the signal permutation entropy. Second, the detection model of low SNR microseismic events based on the least squares support vector machine is built by performing a multi-scale permutation entropy calculation for the collected vibration signals, constructing a feature vector set of signals. Finally, a comparative analysis of the microseismic events and noise signals in the experiment proves that the different characteristics of the two can be fully expressed by using multi-scale permutation entropy. The detection model of microseismic events combined with the support vector machine, which has the features of high classification accuracy and fast real-time algorithms, can meet the requirements of online, real-time extractions of microseismic events.
Cell-cell signaling controls Xylella fastidiosa interactions with both insects and plants
Newman, Karyn L.; Almeida, Rodrigo P. P.; Purcell, Alexander H.; Lindow, Steven E.
2004-01-01
Xylella fastidiosa, which causes Pierce's disease of grapevine and other important plant diseases, is a xylem-limited bacterium that depends on insect vectors for transmission. Although many studies have addressed disease symptom development and transmission of the pathogen by vectors, little is known about the bacterial mechanisms driving these processes. Recently available X. fastidiosa genomic sequences and molecular tools have provided new routes for investigation. Here, we show that a diffusible signal molecule is required for biofilm formation in the vector and for vector transmission to plants. We constructed strains of X. fastidiosa mutated in the rpfF gene and determined that they are unable to produce the signal activity. In addition, rpfF mutants are more virulent than the wild type when mechanically inoculated into plants. This signal therefore directs interaction of X. fastidiosa with both its insect vector and plant host. Interestingly, rpfF mutants can still form in planta biofilms, which differ architecturally from biofilms in insects, suggesting that biofilm architecture, rather than a passive response to the environment, is actively determined by X. fastidiosa gene expression. This article reports a cell-cell signaling requirement for vector transmission. Identification of the genes regulated by rpfF should elucidate bacterial factors involved in transmission and biofilm formation in the insect. PMID:14755059
Chen, Juan-Juan; Huang, Si-Yong; Ma, Peng-Fei; Wu, Bi-Jia; Zhou, Si-Lang; Zhao, Yong-Xing; Gong, Jun-Mei; Liang, Ying-Min
2018-04-01
To express and purify the mouse endothelial cell-targeted recombinant Notch ligand protein mD1R, and to investigate its effect on hematopoiesis after carbon tetrachloride damage. PCR was performed to clone and construct the expression vector pET22b(+)-mD1R. The mD1R successfully transformed into E. coli was induced by IPTG, and purified with Ni 2+ -beads affinity chromatography. The target protein was detected by SDS-PAGE. The fluorescence-activated cell sorting analysis (FACS), cell adhesion test, immunofluorescence staining and quantitative real-time PCR were employed to detect the endothelial cell-targeted and Notch signaling-activated biological characteristics of mD1R. The carbon tetrachloride mouse model was established to observe the effects of mD1R on the hematopoietic stem cell (HSC), myeloid cells and lymphoid cells by flow cytometry. The Lin - Scal-1 + c-Kit + cells were sorted by magnetic bead, FACS was performed to analyze the cell cycle, and RT-PCR was employed to observe the expression of interleukin (IL)-10. The prokaryotic expression vector was successfully cloned and constructed. The purity and the activity were confirmed in mD1R recombinant protein. The purified mD1R activated the Notch signaling pathway of hematopoietic stem cells in carbon tetrachloride damaged mouse, and internally elevated the number of HSC and long-term HSC to 2.96-fold and 6.18-fold. In addition, mD1R improved the amplification of the myeloid progenitor cells and the myeloid-derived suppressor cells, particularly the granulocyte/monocyte into blood. Mechanistically, the further analyses suggested that Notch pathway could increase the proliferation of HSC and enhance expression of IL-10 after stress injury. A new and activated recombinant Notch ligand protein has been obtained successfully to communicate hematopoietic stem cells and hematopoietic microenvironment. The Notch- mediated intrinsic hematopoiesis has been regulated by the anti-inflammatory factor after stress injury.
Optimization of Retinal Gene Therapy for X-Linked Retinitis Pigmentosa Due to RPGR Mutations.
Beltran, William A; Cideciyan, Artur V; Boye, Shannon E; Ye, Guo-Jie; Iwabe, Simone; Dufour, Valerie L; Marinho, Luis Felipe; Swider, Malgorzata; Kosyk, Mychajlo S; Sha, Jin; Boye, Sanford L; Peterson, James J; Witherspoon, C Douglas; Alexander, John J; Ying, Gui-Shuang; Shearman, Mark S; Chulay, Jeffrey D; Hauswirth, William W; Gamlin, Paul D; Jacobson, Samuel G; Aguirre, Gustavo D
2017-08-02
X-linked retinitis pigmentosa (XLRP) caused by mutations in the RPGR gene is an early onset and severe cause of blindness. Successful proof-of-concept studies in a canine model have recently shown that development of a corrective gene therapy for RPGR-XLRP may now be an attainable goal. In preparation for a future clinical trial, we have here optimized the therapeutic AAV vector construct by showing that GRK1 (rather than IRBP) is a more efficient promoter for targeting gene expression to both rods and cones in non-human primates. Two transgenes were used in RPGR mutant (XLPRA2) dogs under the control of the GRK1 promoter. First was the previously developed stabilized human RPGR (hRPGRstb). Second was a new full-length stabilized and codon-optimized human RPGR (hRPGRco). Long-term (>2 years) studies with an AAV2/5 vector carrying hRPGRstb under control of the GRK1 promoter showed rescue of rods and cones from degeneration and retention of vision. Shorter term (3 months) studies demonstrated comparable preservation of photoreceptors in canine eyes treated with an AAV2/5 vector carrying either transgene under the control of the GRK1 promoter. These results provide the critical molecular components (GRK1 promoter, hRPGRco transgene) to now construct a therapeutic viral vector optimized for RPGR-XLRP patients. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Nizampatnam, Narasimha Rao; Doodhi, Harinath; Kalinati Narasimhan, Yamini; Mulpuri, Sujatha; Viswanathaswamy, Dinesh Kumar
2009-03-01
Sterility in the universally exploited PET1-CMS system of sunflower is associated with the expression of orfH522, a novel mitochondrial gene. Definitive evidence that ORFH522 is directly responsible for male sterility is lacking. To test the hypothesis that ORFH522 is sufficient to induce male sterility, a set of chimeric constructs were developed. The cDNA of orfH522 was cloned in-frame with yeast coxIV pre-sequence, and was expressed under tapetum-specific promoter TA29 (construct designated as TCON). For developing control vectors, orfH522 was cloned without the transit peptide under TA29 promoter (TON) or orfH522 was cloned with or without transit peptide under the constitutive CaMV35S promoter (SCOP and SOP). Among several independent transformants obtained with each of the gene cassettes, one third of the transgenics (6/17) with TCON were completely male sterile while more than 10 independent transformants obtained with each of the control vectors were fertile. The male sterile plants were morphologically similar to fertile plants, but had anthers that remained below the stigmatic surface at anthesis. RT-PCR analysis of the sterile plants confirmed the anther-specific expression of orfH522 and bright-field microscopy demonstrated ablation of the tapetal cell layer. Premature DNA fragmentation and programmed cell death was observed at meiosis stage in the anthers of sterile plants. Stable transmission of induced male sterility trait was confirmed in test cross progeny. This constitutes the first report at demonstrating the induction of male sterility by introducing orfH522 gene that could be useful for genetic engineering of male sterility.
Development of Transcriptional Fusions to Assess Leptospira interrogans Promoter Activity
Cerqueira, Gustavo M.; Souza, Natalie M.; Araújo, Eduardo R.; Barros, Aline T.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Nascimento, Ana L. T. O.
2011-01-01
Background Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. Methodology and Principal Findings A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP) were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA) and Sphingomielynase 2 (sph2) promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. Conclusions The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa. PMID:21445252
Hong, Qi; Qian, Ping; Li, Xiang-Min; Yu, Xiao-Lan; Chen, Huan-Chun
2007-11-01
Pseudorabies (PR), foot-and-mouth disease (FMD), and porcine parvovirus disease are three important infectious diseases in swine worldwide. The gene-deleted pseudorabies virus (PRV) has been used as a live-viral vector to develop multivalent genetic engineering vaccine. In this study, a recombinant PRV, which could co-express protein precursor P1-2A of FMDV and VP2 protein of PPV, was constructed using PRV TK(-)/gE(-)/LacZ(+) mutant as the vector. After homologous recombination and plaque purification, recombinant virus PRV TK(-)/gE(-)/P1-2A-VP2 was acquired and identified. Immunogenicity, safety of the recombinant PRV and its protection against PRV were confirmed in a mouse model by indirect ELISA and serum neutralization test. The results show that the recombinant PRV is a candidate vaccine strain to develop a novel trivalent vaccine against PRV, FMDV and PPV in swine.
Sam, Mohammad Reza; Azadbakhsh, Azadeh Sadat; Farokhi, Farrah; Rezazadeh, Kobra; Sam, Sohrab; Zomorodipour, Alireza; Haddad-Mashadrizeh, Aliakbar; Delirezh, Nowruz; Mokarizadeh, Aram
2016-05-01
Ex-vivo gene therapy of hemophilias requires suitable bioreactors for secretion of hFIX into the circulation and stem cells hold great potentials in this regard. Viral vectors are widely manipulated and used to transfer hFIX gene into stem cells. However, little attention has been paid to the manipulation of hFIX transgene itself. Concurrently, the efficacy of such a therapeutic approach depends on determination of which vectors give maximal transgene expression. With this in mind, TF-1 (primary hematopoietic lineage) and rat-bone marrow mesenchymal stem cells (BMSCs) were transfected with five hFIX-expressing plasmids containing different combinations of two human β-globin (hBG) introns inside the hFIX-cDNA and Kozak element and hFIX expression was evaluated by different methods. In BMSCs and TF-1 cells, the highest hFIX level was obtained from the intron-less and hBG intron-I,II containing plasmids respectively. The highest hFIX activity was obtained from the cells that carrying the hBG intron-I,II containing plasmids. BMSCs were able to produce higher hFIX by 1.4 to 4.7-fold increase with activity by 2.4 to 4.4-fold increase compared to TF-1 cells transfected with the same constructs. BMSCs and TF-1 cells could be effectively bioengineered without the use of viral vectors and hFIX minigene containing hBG introns could represent a particular interest in stem cell-based gene therapy of hemophilias. Copyright © 2016 International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Transcript characteristic of myostatin in sheep fibroblasts.
Lu, Jian; Ren, Hangxing; Sheng, Xihui; Zhang, Xiaoning; Li, Shangang; Zhao, Fuping; Zhou, Xinlei; Zhang, Li; Wei, Caihong; Ding, Jiatong; Li, Bichun; Du, Lixin
2012-08-01
Myostatin, a secreted growth factor highly expressed in skeletal muscle, negatively regulates skeletal muscle growth and differentiation. Recently, myostatin is emerged as a potential target for anti-atrophy and anti-fibrotic therapies. Therefore, to investigate the regulation of myostatin in sheep adult fibroblasts, we used the RNA interference mediated by lentiviral vector to gene silence myostatin. Simultaneously, we also had constructed the sheep myostatin overexpression vector to further explore the function of myostatin in fibroblasts. The results here demonstrated that the lentiviral vector could significantly reduce myostatin gene both at mRNA and protein level by 71% and 67%, respectively (P < 0.01). Inhibition of myostatin also resulted in a remarkable increase of activin receptor 2B (ACV2B), p21, PPARγ, leptin, C/EBPβ, and MEF2A expression, and a decrease of Akt1, CDK2, MEF2C, and Myf5 expression. Ectopic myostatin mRNA and protein were also present in the fibroblasts transfection. Furthermore, we observed that overexpression of myostatin contributed to an increase of Akt1, CDK2, Myf5 and PPARγ, and a decrease of p21, C/EBPα and leptin at the transcript level. These results suggested that myostatin positively regulated Akt1, CDK2, Myf5, leptin, and C/EBPα, but negatively regulated p21 mRNA expression in adult fibroblasts, and it also expanded our understanding of the regulation mechanism of myostatin. Moreover, the lentiviral system inactivated myostatin gene in fibroblasts would be used to generate transgenic sheep and to ameliorate muscle fibrosis and atrophy by gene therapy in the future. Copyright © 2012 Wiley Periodicals, Inc.
Wang, Ping
2018-06-27
Cryptococcus neoformans and related species are encapsulated basidiomycetous fungi that cause meningoencephalitis in individuals with immune deficiency. This pathogen has a tractable genetic system; however, gene disruption via electroporation remains difficult, while biolistic transformation is often limited by lack of multiple genetic markers and the high initial cost of equipment. The approach using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) has become the technology of choice for gene editing in many organisms due to its simplicity, efficiency, and versatility. The technique has been successfully demonstrated in C. neoformans and Cryptococcus deneoformans in which two DNA plasmids expressing either the Streptococcus pyogenes CAS9 gene or the guide RNA (gRNA) were employed. However, potential adverse effects due to constitutive expression and the time-consuming process of constructing vectors to express each gRNA remain as a primary barrier for wide adaptation. This report describes the delivery of preassembled CRISPR-Cas9-gRNA ribonucleoproteins (RNPs) via electroporation that is able to generate edited mutant alleles. RNP-mediated CRISPR-Cas9 was used to replace the wild-type GIB2 gene encoding a Gβ-like/RACK1 Gib2 protein with a gib2 :: NAT allele via homologous recombination in both C. neoformans and C. deneoformans In addition, a DNA plasmid (pCnCas9:U6-gRNA) that expresses both Cas9 and gRNA, allowing for convenient yet low-cost DNA-mediated gene editing, is described. pCnCas9:U6-gRNA contains an endogenous U6 promoter for gRNA expression and restriction sites for one-step insertion of a gRNA. These approaches and resources provide new opportunities to accelerate genetic studies of Cryptococcus species. IMPORTANCE For genetic studies of the Cryptococcus genus, generation of mutant strains is often hampered by a limited number of selectable genetic markers, the tedious process of vector construction, side effects, and other limitations, such as the high cost of acquiring a particle delivery system. CRISPR-Cas9 technology has been demonstrated in Cryptococcus for genome editing. However, it remains labor-intensive and time-consuming since it requires the identification of a suitable type III RNA polymerase promoter for gRNA expression. In addition, there may be potential adverse effects caused by constitutive expressions of Cas9 and gRNA. Here, I report the use of a ribonucleoprotein-mediated CRISPR-Cas9 technique for genome editing of C. neoformans and related species. Together with the custom-constructed pCnCas9:U6-gRNA vector that allows low-cost and time-saving DNA-based CRISPR-Cas9, my approach adds to the molecular toolbox for dissecting the molecular mechanism of pathogenesis in this important group of fungal pathogens. Copyright © 2018 Wang.
Zhang, Jie; Deng, Yifeng; Ma, Huijie; Hou, Jiafa; Zhou, ZhenLei
2015-03-01
Ca2+ plays a major role in the regulation of signal transduction. Transient receptor potential vanilloid 6 is a Ca2+-selective channel that serves as an important rate-limiting step in the facilitation of Ca2+ entry into cells, but little is known about the regulation of transient receptor potential vanilloid 6 in chickens. In this study, we evaluated the effects of transient receptor potential vanilloid 6 gene interference on the expression of calbindin-D28K, Na+/Ca2+ exchangers, and plasma membrane Ca2+ ATPase 1b to investigate the mechanism underlying the regulation of transient receptor potential vanilloid 6. Three hairpin siRNA expression vectors targeting transient receptor potential vanilloid 6 (pSIREN- transient receptor potential vanilloid 6) and a negative control (pSIREN-control) were constructed and transfected into chicken osteoblasts. The mRNA and protein expression levels were evaluated by quantitative reverse transcription polymerase chain reaction and Western blot, respectively. The mRNA expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 45.7% (P<0.01) and 27.9% (P<0.01), respectively, 48 h after transfection with one of the three constructs (pSIREN- transient receptor potential vanilloid 6-3) compared with the level obtained in the untreated group. There was no significant difference in the mRNA expression levels of Na+/Ca2+ exchangers and plasma membrane Ca2+ ATPase 1b. The protein expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 40.2% (P<0.01) and 29.8% (P<0.01), respectively, 48 h after transfection with pSIREN-transient receptor potential vanilloid 6-3 compared with the level obtained in the untreated group. In conclusion, the vector-based transient receptor potential vanilloid 6-shRNA can efficiently suppress the mRNA and protein expression of transient receptor potential vanilloid 6 in chicken osteoblasts, and transient receptor potential vanilloid 6 regulates the expression of calbindin-D28K during Ca2+ transport. © 2015 Poultry Science Association Inc.
Mishra, Bhawana; Sangwan, Rajender Singh; Asha; Jadaun, Jyoti Singh; Sangwan, Neelam S.
2016-01-01
Withania somnifera Dunal, is one of the most commonly used medicinal plant in Ayurvedic and indigenous medicine traditionally owing to its therapeutic potential, because of major chemical constituents, withanolides. Withanolide biosynthesis requires the activities of several enzymes in vivo. Cycloartenol synthase (CAS) is an important enzyme in the withanolide biosynthetic pathway, catalyzing cyclization of 2, 3 oxidosqualene into cycloartenol. In the present study, we have cloned full-length WsCAS from Withania somnifera by homology-based PCR method. For gene function investigation, we constructed three RNAi gene-silencing constructs in backbone of RNAi vector pGSA and a full-length over-expression construct. These constructs were transformed in Agrobacterium strain GV3101 for plant transformation in W. somnifera. Molecular and metabolite analysis was performed in putative Withania transformants. The PCR and Southern blot results showed the genomic integration of these RNAi and overexpression construct(s) in Withania genome. The qRT-PCR analysis showed that the expression of WsCAS gene was considerably downregulated in stable transgenic silenced Withania lines compared with the non-transformed control and HPLC analysis showed that withanolide content was greatly reduced in silenced lines. Transgenic plants over expressing CAS gene displayed enhanced level of CAS transcript and withanolide content compared to non-transformed controls. This work is the first full proof report of functional validation of any metabolic pathway gene in W. somnifera at whole plant level as per our knowledge and it will be further useful to understand the regulatory role of different genes involved in the biosynthesis of withanolides. PMID:26919744
Adeno-associated virus vectors can be efficiently produced without helper virus.
Matsushita, T; Elliger, S; Elliger, C; Podsakoff, G; Villarreal, L; Kurtzman, G J; Iwaki, Y; Colosi, P
1998-07-01
The purpose of this work was to develop an efficient method for the production of adeno-associated virus (AAV) vectors in the absence of helper virus. The adenovirus regions that mediate AAV vector replication were identified and assembled into a helper plasmid. These included the VA, E2A and E4 regions. When this helper plasmid was cotransfected into 293 cells, along with plasmids encoding the AAV vector, and rep and cap genes, AAV vector was produced as efficiently as when using adenovirus infection as a source of help. CMV-driven constructs expressing the E4orf6 and the 72-M(r), E2A proteins were able to functionally replace the E4 and E2A regions, respectively. Therefore the minimum set of genes required to produce AAV helper activity equivalent to that provided by adenovirus infection consists of, or is a subset of, the following genes: the E4orf6 gene, the 72-M(r), E2A protein gene, the VA RNA genes and the E1 region. AAV vector preparations made with adenovirus and by the helper virus-free method were essentially indistinguishable with respect to particle density, particle to infectivity ratio, capsimer ratio and efficiency of muscle transduction in vivo. Only AAV vector preparations made by the helper virus-free method were not reactive with anti-adenovirus sera.
Wunderlich, Stephanie; Haase, Alexandra; Merkert, Sylvia; Beier, Jennifer; Schwanke, Kristin; Schambach, Axel; Glage, Silke; Göhring, Gudrun; Curnow, Eliza C; Martin, Ulrich
2012-12-01
Induced pluripotent stem cells (iPSCs) represent a novel cell source for regenerative therapies. Many emerging iPSC-based therapeutic concepts will require preclinical evaluation in suitable large animal models. Among the large animal species frequently used in preclinical efficacy and safety studies, macaques show the highest similarities to humans at physiological, cellular, and molecular levels. We have generated iPSCs from cynomolgus monkeys (Macaca fascicularis) as a segue to regenerative therapy model development in this species. Because typical human immunodeficiency virus type 1 (HIV-1)-based lentiviral vectors show poor transduction of simian cells, a simian immunodeficiency virus (SIV)-based vector was chosen for efficient transduction of cynomolgus skin fibroblasts. A corresponding polycistronic vector with codon-optimized reprogramming factors was constructed for reprogramming. Growth characteristics as well as cell and colony morphology of the resulting cynomolgus iPSCs (cyiPSCs) were demonstrated to be almost identical to cynomolgus embryonic stem cells (cyESCs), and cyiPSCs expressed typical pluripotency markers including OCT4, SOX2, and NANOG. Furthermore, differentiation in vivo and in vitro into derivatives of all three germ layers, as well as generation of functional cardiomyocytes, could be demonstrated. Finally, a highly efficient technique for generation of transgenic cyiPSC clones with stable reporter expression in undifferentiated cells as well as differentiated transgenic cyiPSC progeny was developed to enable cell tracking in recipient animals. In conclusion, our data indicate that cyiPSCs represent a valuable cell source for establishment of macaque-based allogeneic and autologous preclinical cell transplantation models for various fields of regenerative medicine.
Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.
2010-01-01
Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425
Zhang, Zhonghui; Wu, Elise; Qian, Zhijian; Wu, Wen-Shu
2014-01-01
Stable and efficient knockdown of multiple gene targets is highly desirable for dissection of molecular pathways. Because it allows sequence-specific DNA binding, transcription activator-like effector (TALE) offers a new genetic perturbation technique that allows for gene-specific repression. Here, we constructed a multicolor lentiviral TALE-Kruppel-associated box (KRAB) expression vector platform that enables knockdown of multiple gene targets. This platform is fully compatible with the Golden Gate TALEN and TAL Effector Kit 2.0, a widely used and efficient method for TALE assembly. We showed that this multicolor TALE-KRAB vector system when combined together with bone marrow transplantation could quickly knock down c-kit and PU.1 genes in hematopoietic stem and progenitor cells of recipient mice. Furthermore, our data demonstrated that this platform simultaneously knocked down both c-Kit and PU.1 genes in the same primary cell populations. Together, our results suggest that this multicolor TALE-KRAB vector platform is a promising and versatile tool for knockdown of multiple gene targets and could greatly facilitate dissection of molecular pathways. PMID:25475013
Zhang, Zhonghui; Wu, Elise; Qian, Zhijian; Wu, Wen-Shu
2014-12-05
Stable and efficient knockdown of multiple gene targets is highly desirable for dissection of molecular pathways. Because it allows sequence-specific DNA binding, transcription activator-like effector (TALE) offers a new genetic perturbation technique that allows for gene-specific repression. Here, we constructed a multicolor lentiviral TALE-Kruppel-associated box (KRAB) expression vector platform that enables knockdown of multiple gene targets. This platform is fully compatible with the Golden Gate TALEN and TAL Effector Kit 2.0, a widely used and efficient method for TALE assembly. We showed that this multicolor TALE-KRAB vector system when combined together with bone marrow transplantation could quickly knock down c-kit and PU.1 genes in hematopoietic stem and progenitor cells of recipient mice. Furthermore, our data demonstrated that this platform simultaneously knocked down both c-Kit and PU.1 genes in the same primary cell populations. Together, our results suggest that this multicolor TALE-KRAB vector platform is a promising and versatile tool for knockdown of multiple gene targets and could greatly facilitate dissection of molecular pathways.
Shang, Yonglei; Tesar, Devin; Hötzel, Isidro
2015-10-01
A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Nakamae, Kazuki; Nishimura, Yuki; Takenaga, Mitsumasa; Sakamoto, Naoaki; Ide, Hiroshi; Sakuma, Tetsushi; Yamamoto, Takashi
2017-01-01
ABSTRACT The emerging genome editing technology has enabled the creation of gene knock-in cells easily, efficiently, and rapidly, which has dramatically accelerated research in the field of mammalian functional genomics, including in humans. We recently developed a microhomology-mediated end-joining-based gene knock-in method, termed the PITCh system, and presented various examples of its application. Since the PITCh system only requires very short microhomologies (up to 40 bp) and single-guide RNA target sites on the donor vector, the targeting construct can be rapidly prepared compared with the conventional targeting vector for homologous recombination-based knock-in. Here, we established a streamlined pipeline to design and perform PITCh knock-in to further expand the availability of this method by creating web-based design software, PITCh designer (http://www.mls.sci.hiroshima-u.ac.jp/smg/PITChdesigner/index.html), as well as presenting an experimental example of versatile gene cassette knock-in. PITCh designer can automatically design not only the appropriate microhomologies but also the primers to construct locus-specific donor vectors for PITCh knock-in. By using our newly established pipeline, a reporter cell line for monitoring endogenous gene expression, and transgenesis (TG) or knock-in/knockout (KIKO) cell line can be produced systematically. Using these new variations of PITCh, an exogenous promoter-driven gene cassette expressing fluorescent protein gene and drug resistance gene can be integrated into a safe harbor or a specific gene locus to create transgenic reporter cells (PITCh-TG) or knockout cells with reporter knock-in (PITCh-KIKO), respectively. PMID:28453368
Katoh, Yohei; Michisaka, Saki; Nozaki, Shohei; Funabashi, Teruki; Hirano, Tomoaki; Takei, Ryota; Nakayama, Kazuhisa
2017-04-01
The CRISPR/Cas9 system has revolutionized genome editing in virtually all organisms. Although the CRISPR/Cas9 system enables the targeted cleavage of genomic DNA, its use for gene knock-in remains challenging because levels of homologous recombination activity vary among various cells. In contrast, the efficiency of homology-independent DNA repair is relatively high in most cell types. Therefore the use of a homology-independent repair mechanism is a possible alternative for efficient genome editing. Here we constructed a donor knock-in vector optimized for the CRISPR/Cas9 system and developed a practical system that enables efficient disruption of target genes by exploiting homology-independent repair. Using this practical knock-in system, we successfully disrupted genes encoding proteins involved in ciliary protein trafficking, including IFT88 and IFT20, in hTERT-RPE1 cells, which have low homologous recombination activity. The most critical concern using the CRISPR/Cas9 system is off-target cleavage. To reduce the off-target cleavage frequency and increase the versatility of our knock-in system, we constructed a universal donor vector and an expression vector containing Cas9 with enhanced specificity and tandem sgRNA expression cassettes. We demonstrated that the second version of our system has improved usability. © 2017 Katoh et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Nakamae, Kazuki; Nishimura, Yuki; Takenaga, Mitsumasa; Nakade, Shota; Sakamoto, Naoaki; Ide, Hiroshi; Sakuma, Tetsushi; Yamamoto, Takashi
2017-05-04
The emerging genome editing technology has enabled the creation of gene knock-in cells easily, efficiently, and rapidly, which has dramatically accelerated research in the field of mammalian functional genomics, including in humans. We recently developed a microhomology-mediated end-joining-based gene knock-in method, termed the PITCh system, and presented various examples of its application. Since the PITCh system only requires very short microhomologies (up to 40 bp) and single-guide RNA target sites on the donor vector, the targeting construct can be rapidly prepared compared with the conventional targeting vector for homologous recombination-based knock-in. Here, we established a streamlined pipeline to design and perform PITCh knock-in to further expand the availability of this method by creating web-based design software, PITCh designer ( http://www.mls.sci.hiroshima-u.ac.jp/smg/PITChdesigner/index.html ), as well as presenting an experimental example of versatile gene cassette knock-in. PITCh designer can automatically design not only the appropriate microhomologies but also the primers to construct locus-specific donor vectors for PITCh knock-in. By using our newly established pipeline, a reporter cell line for monitoring endogenous gene expression, and transgenesis (TG) or knock-in/knockout (KIKO) cell line can be produced systematically. Using these new variations of PITCh, an exogenous promoter-driven gene cassette expressing fluorescent protein gene and drug resistance gene can be integrated into a safe harbor or a specific gene locus to create transgenic reporter cells (PITCh-TG) or knockout cells with reporter knock-in (PITCh-KIKO), respectively.
Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard
1983-01-01
We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426