Expression of recombinant myostatin propeptide pPIC9K-Msp plasmid in Pichia pastoris.
Du, W; Xia, J; Zhang, Y; Liu, M J; Li, H B; Yan, X M; Zhang, J S; Li, N; Zhou, Z Y; Xie, W Z
2015-12-28
Myostatin propeptide can inhibit the biological activity of myostatin protein and promote muscle growth. To express myostatin propeptide in vitro with a higher biological activity, we performed codon optimization on the sheep myostatin propeptide gene sequence, and mutated aspartic acid-76 to alanine based on the codon usage bias of Pichia pastoris and the enhanced biological activity of myostatin propeptide mutant. Modified myostatin propeptide gene was cloned into the pPIC9K plasmid to form the recombinant plasmid pPIC9K-Msp. Recombinant plasmid pPIC9K-Msp was transformed into Pichia pastoris GS115 by electrotransformation. Transformed cells were screened, and methanol was used to induce expression. SDS-PAGE and western blotting were used to verify the successful expression of myostatin propeptide with biological activity in Pichia pastoris, providing the basis for characterization of this protein.
Li, Ren-Kuan; Fu, Cai-Li; Chen, Ping; Ng, Tzi Bun; Ye, Xiu-Yun
2013-03-01
Production of a sika deer Cu/Zn-SOD was achieved in Pichia pastoris after the reconstituted expression vector pPIC9K was transformed into the strain GS115. By employing Saccharomyces cerevisiae secretion signal peptide (α-factor) under the regulation of the methanol-inducible promoter of the gene of alcohol oxidase 1 (AOX1), sika deer Cu/Zn-SOD with a molecular mass of 16kDa was expressed while recombinant sika deer Cu/Zn-SOD with an activity of 3500U/mL was obtained from a 5L bioreactor. After two successive steps of chromatography on DEAE-650C and Superdex75, recombinant sika deer Cu/Zn-SOD was obtained with 13.8% yield, 14.5-fold purification, and a specific activity of 3447U/mg. Its optimum temperature and optimum pH were 40°C and 7.0, respectively. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.
Preparation of gentiooligosaccharides using Trichoderma viride β-glucosidase.
Wang, Fei; Wu, Jing; Chen, Sheng
2018-05-15
The recombinant plasmid pPIC9K-bgl1 containing β-glucosidase bgl1 from Trichoderma viride was constructed by overlapping PCR and integrated into Pichia pastoris KM71. In order to assist the formation of disulfide bonds and thus improve protein folding efficiency, protein disulfide isomerase pdi was co-expressed in the P. pastoris KM71/pPIC9K-bgl1/pPICZ-A-pdi strain, and fermentation in flasks resulted in enzyme activity of 143 U/ml. The enzyme activity of β-glucosidase reached 1402 U/ml following optimisation of fermentation conditions in a 3.6 l bioreactor. With 80% glucose as substrate, gentiooligosaccharides were synthesised by β-glucosidase-based reverse hydrolysis. A yield of 130 g/l was achieved with a conversion rate of 16.25%. With 20% glucose and 40% cellobiose as substrates, gentiooligosaccharides were synthesised by transglycosylation with a yield of 116 g/l and a conversion rate of 19.4%. Copyright © 2017 Elsevier Ltd. All rights reserved.
Banani, Houda; Spadaro, Davide; Zhang, Dianpeng; Matic, Slavica; Garibaldi, Angelo; Gullino, Maria Lodovica
2014-07-16
The yeast-like fungus Aureobasidium pullulans PL5 is a microbial antagonist against postharvest pathogens of fruits. The strain is able to produce hydrolases, including glucanases, chitinases and proteases. The alkaline serine protease gene ALP5 from A. pullulans was cloned, inserted into the vector pPIC9 to construct pPIC9/ALP5, and then expressed in Pichia pastoris strain KM71. ALP5 had a molecular mass of 42.9kDa after 5days growth with 1% methanol induction at 28°C. The recombinant protease expressed in P. pastoris showed its highest activity under alkaline conditions (at pH10) and a temperature of 50°C. The antifungal activity of the recombinant protease was investigated against Penicillium expansum, Botrytis cinerea, Monilinia fructicola and Alternaria alternata in vitro and on apple. The recombinant protease reduced significantly the spore germination and the germ tube length of the tested pathogens in PDB medium. The highest level of protease efficacy was observed against M. fructicola and B. cinerea, whereas a lower efficacy was observed against P. expansum and A. alternata indicating a possible effect of the pathogen cell wall composition on the proteolytic activity of the recombinant protease. The presence of protease was able to cause the swelling of the hyphae of B. cinerea, under an optical microscope. The recombinant protease expressed in P. pastoris was more active against the pathogens in vitro than the same enzyme expressed in E. coli in previous studies. The efficacy of ALP5 was also evaluated against the pathogens in vivo on cv Golden Delicious apples. The protease was more efficient in controlling M. fructicola, B. cinerea and P. expansum than A. alternata. However, the extent of the activity was dependent on the enzyme concentration and the length of fruit storage. This study demonstrated the capacity of the alkaline serine protease to keep its enzymatic activity for some days in the unfavorable environment of the fruit wounds. The alkaline serine protease could be developed as a postharvest treatment with antimicrobial activity for fruit undergoing a short storage period. Copyright © 2014 Elsevier B.V. All rights reserved.
Zhang, Jian-Xin; Wu, Yun-Feng; Wang, Xiu-Min
2007-11-01
HC-pro gene of Watermelon Mosaic virus was obtained by RT-PCR was 1371bp in length. It was cloned into pPI(9K, then the eucaryotic recombinant expression plasmid pPIC9K-WHC was constructed. After being linearized with restriction endonuclease Sal I , the recombinant plasmid was transformed into Pichia pastoris GS115 by electroporation. The high copy transformants with Mut+ /His+ phenotype were selected by RT-PCR and screening on G418, MD and MM medium. Induced by methanol for 5 days, the culture supernatant was analyzed by SDS-PAGE, the results showed that a specific protein with a molecular weight of about 66 kD was expressed. Western blot analysis proved that the expression protein could specifically bind to HC-Pro polyclonal antibody. Far western blot analysis proved that the expression protein could bind to coat protein, given support to "bridge" hypothesis that HC-Pro help aphid transmission of non-persistent viruses.
Hua, Chengwei; Yan, Qiaojuan; Jiang, Zhengqiang; Li, Yinan; Katrolia, Priti
2010-09-01
In this study, a novel beta-1,3-1,4-glucanase gene (designated as PtLic16A) from Paecilomyces thermophila was cloned and sequenced. PtLic16A has an open reading frame of 945 bp, encoding 314 amino acids. The deduced amino acid sequence shares the highest identity (61%) with the putative endo-1,3(4)-beta-glucanase from Neosartorya fischeri NRRL 181. PtLic16A was cloned into a vector pPIC9K and was expressed successfully in Pichia pastoris as active extracellular beta-1,3-1,4-glucanase. The recombinant beta-1,3-1,4-glucanase (PtLic16A) was secreted predominantly into the medium which comprised up to 85% of the total extracellular proteins and reached a protein concentration of 9.1 g l(-1) with an activity of 55,300 U ml(-1) in 5-l fermentor culture. The enzyme was then purified using two steps, ion exchange chromatography, and gel filtration chromatography. The purified enzyme had a molecular mass of 38.5 kDa on SDS-PAGE. It was optimally active at pH 7.0 and a temperature of 70 degrees C. Furthermore, the enzyme exhibited strict specificity for beta-1,3-1,4-D: -glucans. This is the first report on the cloning and expression of a beta-1,3-1,4-glucanase gene from Paecilomyces sp.
Expression, purification and characterization of a phyAm-phyCs fusion phytase*
Zou, Li-kou; Wang, Hong-ning; Pan, Xin; Tian, Guo-bao; Xie, Zi-wen; Wu, Qi; Chen, Hui; Xie, Tao; Yang, Zhi-rong
2008-01-01
The phyAm gene encoding acid phytase and optimized neutral phytase phyCs gene were inserted into expression vector pPIC9K in correct orientation and transformed into Pichia pastoris in order to expand the pH profile of phytase and decrease the cost of production. The fusion phytase phyAm-phyCs gene was successfully overexpressed in P. pastoris as an active and extracellular phytase. The yield of total extracellular fusion phytase activity is (25.4±0.53) U/ml at the flask scale and (159.1±2.92) U/ml for high cell-density fermentation, respectively. Purified fusion phytase exhibits an optimal temperature at 55 °C and an optimal pH at 5.5~6.0 and its relative activity remains at a relatively high level of above 70% in the range of pH 2.0 to 7.0. About 51% to 63% of its original activity remains after incubation at 75 °C to 95 °C for 10 min. Due to heavy glycosylation, the expressed fusion phytase shows a broad and diffuse band in SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After deglycosylation by endoglycosidase H (EndoHf), the enzyme has an apparent molecular size of 95 kDa. The characterization of the fusion phytase was compared with those of phyCs and phyAm. PMID:18600783
Lü, Ruihua; Zhao, Aichun; Li, Jun; Liu, Changying; Wang, Chuanhong; Wang, Xiling; Wang, Xiaohong; Pei, Ruichao; Lu, Cheng; Yu, Maode
2015-07-10
A cellulase gene (KJ700939, CsCelA) from Ciboria shiraiana that is highly expressed during the infection of mulberry fruit was screened by quantitative real-time PCR (qRT-PCR). Using cDNA isolated from infected mulberry fruits as template, the full-length 1170-bp sequence of CsCelA was obtained, which encodes a 390-amino acid protein with a putative signal peptide of 24 amino acids. The 998-bp fragment encoding the mature peptide of CsCelA was cloned into the multiple cloning site of the pPIC9K vector and overexpressed as an active protein of 55.3kDa in the methylotrophic yeast Pichia pastoris. The specific activity of induced supernatants of the recombinant cellulase (CsCelA) was 17.44U/ml and 135U/g for freeze-dried powder. The Kmax and Vmax of CsCelA for sodium carboxymethylcellulose (CMC) were 4.6mg/ml and 107.2U/mg, respectively. The supernatant and freeze-dried powder of the recombinant cellulase exhibited stable activity from pH4.0 to 9.0, and at temperatures ranging from 30°C to 55°C. Finally, the activity of the recombinant cellulase was assessed by enzymatic hydrolysis of the cell walls of mulberry leaves. CsCelA showed an endo-cellulase mode of cleavage, as assessed by thin layer chromatography (TLC). Copyright © 2015 Elsevier B.V. All rights reserved.
Ahmad Mazian, Mu'adz; Salleh, Abu Bakar; Basri, Mahiran; Rahman, Raja Noor Zaliha Raja Abd.
2014-01-01
Psychrophilic basidiomycete yeast, Glaciozyma antarctica strain PI12, was shown to be a protease-producer. Isolation of the PI12 protease gene from genomic and mRNA sequences allowed determination of 19 exons and 18 introns. Full-length cDNA of PI12 protease gene was amplified by rapid amplification of cDNA ends (RACE) strategy with an open reading frame (ORF) of 2892 bp, coded for 963 amino acids. PI12 protease showed low homology with the subtilisin-like protease from fungus Rhodosporidium toruloides (42% identity) and no homology to other psychrophilic proteases. The gene encoding mature PI12 protease was cloned into Pichia pastoris expression vector, pPIC9, and positioned under the induction of methanol-alcohol oxidase (AOX) promoter. The recombinant PI12 protease was efficiently secreted into the culture medium driven by the Saccharomyces cerevisiae α-factor signal sequence. The highest protease production (28.3 U/ml) was obtained from P. pastoris GS115 host (GpPro2) at 20°C after 72 hours of postinduction time with 0.5% (v/v) of methanol inducer. The expressed protein was detected by SDS-PAGE and activity staining with a molecular weight of 99 kDa. PMID:25093119
Yang, Hongyu; Zhu, Qiang; Zhou, Nandi; Tian, Yaping
2016-11-01
Prolyl aminopeptidases are specific exopeptidases that catalyze the hydrolysis of the N-terminus proline residue of peptides and proteins. In the present study, the prolyl aminopeptidase gene (pap) from Aspergillus oryzae JN-412 was optimized through the codon usage of Pichia pastoris. Both the native and optimized pap genes were inserted into the expression vector pPIC9 K and were successfully expressed in P. pastoris. Additionally, the activity of the intracellular enzyme expressed by the recombinant optimized pap gene reached 61.26 U mL(-1), an activity that is 2.1-fold higher than that of the native gene. The recombinant enzyme was purified by one-step elution through Ni-affinity chromatography. The optimal temperature and pH of the purified PAP were 60 °C and 7.5, respectively. Additionally, the recombinant PAP was recovered at a yield greater than 65 % at an extremely broad range of pH values from 6 to 10 after treatment at 50 °C for 6 h. The molecular weight of the recombinant PAP decreased from 50 kDa to 48 kDa after treatment with a deglycosylation enzyme, indicating that the recombinant PAP was completely glycosylated. The glycosylated PAP exhibited high thermo-stability. Half of the activity remained after incubation at 50 °C for 50 h, whereas the remaining activity of PAP expressed in E. coli was only 10 % after incubation at 50 °C for 1 h. PAP could be activated by the appropriate salt concentration and exhibited salt tolerance against NaCl at a concentration up to 5 mol L(-1).
Californians & Education. PPIC Statewide Survey
ERIC Educational Resources Information Center
Baldassare, Mark; Bonner, Dean; Petek, Sonja; Willcoxon, Nicole
2010-01-01
This edition of the PPIC (Public Policy Institute of California) Statewide Survey is the sixth in a series of surveys funded by The William and Flora Hewlett Foundation focusing on K-12 education issues. Its goal is to inform state policymakers, encourage discussion, and raise public awareness about a variety of K-12, higher education,…
Expression and characterization of camel chymosin in Pichia pastoris.
Wang, Nan; Wang, Kevin Yueju; Li, GangQiang; Guo, WenFang; Liu, DeHu
2015-07-01
Chymosin efficiently coagulates milk and so is widely used in commercial cheese production. Traditional chymosin production requires the slaughter of a large numbers of unweaned calves. In the present study, a full-length camel prochymosin gene was synthesized and cloned into the pPIC9K vector, which was then inserted into the yeast strain, Pichia pastoris GS115. Expression of the chymosin gene in yeast was under the control of an AOX1 inducible promoter. The yeast system produced approximately 37mg/L of recombinant enzyme under lab conditions. SDS-PAGE of the raw supernatant revealed two molecular bands, which were approximately 42kDa and 45kDa in size. The 45kDa band disappeared after treatment of the supernatant with N-glycosidase F (PNGase F), indicating that the recombinant protein was partially glycosylated. When subjected to a low pH, recombinant prochymosin was converted into mature and active chymosin. The active chymosin was capable of specifically hydrolyzing κ-casein. A pH of 5.04, and temperature range of 45-50°C, was optimum for milk clotting activity. Maximum milk clotting activity was detected with the inclusion of 20-40mM CaCl2. The recombinant enzyme was highly active and stable over a wide pH range (from 2.5 to 6.5) at 20°C for 8h. Thermostability of the recombinant enzyme was also analyzed. Pilot-scale production (300mg/L) was attained using a 5L fermenter. We demonstrated that expression of the camel chymosin gene in P. pastoris could represent an excellent system for producing active camel chymosin for potential use in the commercial production of cheese. Copyright © 2015 Elsevier Inc. All rights reserved.
Yang, Xiaoxue; Cong, Hua; Song, Jinzhu; Zhang, Junzheng
2013-11-01
Trichoderma asperellum parasitizes a large variety of phytopathogenic fungi. The mycoparasitic activity of T. asperellum depends on the secretion of complex mixtures of hydrolytic enzymes able to degrade the host cell wall and proteases which are a group of enzymes capable of degrading proteins from host. In this study, a full-length cDNA clone of aspartic protease gene, TaAsp, from T. asperellum was obtained and sequenced. The 1,185 bp long cDNA sequence was predicted to encode a 395 amino acid polypeptide with molecular mass of 42.3 kDa. The cDNA of TaAsp was inserted into the pPIC9K vector and transformed into yeast Pichia pastoris GS115 for heterologous expression. A clearly visible band with molecular mass about 42 kDa in the SDS-PAGE gel indicated that the transformant harboring the gene TaAsp had been successfully translated in P. pastoris and produced a recombinant protein. Enzyme characterization test showed that the optimum fermentation time for P. pastoris GS115 transformant was 72 h. Enzyme activity of the recombinant aspartic proteinase remained relatively stable at 25-60 °C and pH 3.0-9.0, which indicated its good prospect of application in biocontrol. The optimal pH value and temperature of the enzyme activity were pH 4.0 and 40 °C, and under this condition, with casein as the substrate, the recombinant protease activity was 18.5 U mL(-1). In order to evaluate antagonistic activity of the recombinant protease against pathogenic fungi, five pathogenic fungi, Fusarium oxysporum, Alternaria alternata, Cytospora chrysosperma, Sclerotinia sclerotiorum and Rhizoctonia solani, were applied to the test of in vitro inhibition of their mycelial growth by culture supernatant of P. pastoris GS115 transformant.
Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici
Feng, Bao Zhen; Li, Peiqian
2014-01-01
Laccases are blue copper oxidases (E.C. 1.10.3.2) that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2′-azino-di-(3-ethylbenzothialozin-6-sulfonic acid) (ABTS) as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 °C, respectively. The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes. PMID:24948955
Xu, Yanbing; Zheng, Zhaojuan; Xu, Qianqian; Yong, Qiang; Ouyang, Jia
2016-03-30
Inulooligosaccharides (IOS) represent an important class of oligosaccharides at industrial scale. An efficient conversion of inulin to IOS through endoinulinase from Aspergillus niger is presented. A 1482 bp codon optimized gene fragment encoding endoinulinase from A. niger DSM 2466 was cloned into pPIC9K vector and was transformed into Pichia pastoris KM71. Maximum activity of the recombinant endoinulinase, 858 U/mL, was obtained at 120 h of the high cell density fermentation process. The optimal conditions for inulin hydrolysis using the recombinant endoinulinase were investigated. IOS were harvested with a high concentration of 365.1 g/L and high yield up to 91.3%. IOS with different degrees of polymerization (DP, mainly DP 3-6) were distributed in the final reaction products.
Huang, Peng; Shi, Jinlei; Sun, Qingwen; Dong, Xianping; Zhang, Ning
2018-04-13
Lysozymes are known as ubiquitously distributed immune effectors with hydrolytic activity against peptidoglycan, the major bacterial cell wall polymer, to trigger cell lysis. In the present study, the full-length cDNA sequence of a novel sea urchin Strongylocentrotus purpuratus invertebrate-type lysozyme (sp-iLys) was synthesized according to the codon usage bias of Pichia pastoris and was cloned into a constitutive expression plasmid pPIC9K. The resulting plasmid, pPIC9K-sp-iLys, was integrated into the genome of P. pastoris strain GS115. The bioactive recombinant sp-iLys was successfully secreted into the culture broth by positive transformants. The highest lytic activity of 960 U/mL of culture supernatant was reached in fed-batch fermentation. Using chitin affinity chromatography and gel-filtration chromatography, recombinant sp-iLys was produced with a yield of 94.5 mg/L and purity of > 99%. Recombinant sp-iLys reached its peak lytic activity of 8560 U/mg at pH 6.0 and 30 °C and showed antimicrobial activities against Gram-negative bacteria (Vibrio vulnificus, Vibrio parahemolyticus, and Aeromonas hydrophila) and Gram-positive bacteria (Staphylococcus aureus and Bacillus subtilis). In addition, recombinant sp-iLys displayed isopeptidase activity which reached the peak at pH 7.5 and 37 °C with the presence of 0.05 M Na + . In conclusion, this report describes the heterologous expression of recombinant sp-iLys in P. pastoris on a preparative-scale, which possesses lytic activity and isopeptidase activity. This suggests that sp-iLys might play an important role in the innate immunity of S. purpuratus.
Liu, Z H; Yang, Q; Hu, S; Zhang, J D; Ma, J
2008-08-01
Chitinases play a major role in the defensive strategies of plants against fungal pathogens. In the current study, the gene for a 46-kDa endochitinase (chi46) was cloned from Chaetomium globosum, an important biocontrol fungus. The corresponding complementary deoxyribonucleic acid sequence was 1,350 bp in length, encoding 449 amino acid residues. The temporal expression of chi46, in response to the treatments of cell walls of six pathogens and confrontation against two fungal pathogens, was measured in C. globosum using real-time reverse transcription polymerase chain reaction. The expression of chi46 can be highly induced by exposure to the cell walls of plant pathogens and living pathogens, suggesting a role in plant disease resistance. The chi46 gene was inserted into the pPIC9 vector and transferred into the cells of Pichia pastoris GS115 for heterologous expression. The optimal reaction conditions for chitinase CHI46 activity were: 45 degrees C, pH of 5.0, and 5 mmol l(-1) of Cu2+. The maximum enzyme activity was 1.42 U ml(-1) following exposure to the cell wall chitin of Septoria tritici. The CHI46 enzyme can efficiently degrade cell walls of the phytopathogenic Rhizoctonia solani, Fusarium oxysporum, Sclerotinia sclerotiorum, Valsa sordida, S. tritici, and Phytophthora sojae, demonstrating that it may be involved in the biocontrol mechanism of C. globosum.
Wang, Jiaojiao; Zhang, Yuhong; Qin, Xing; Gao, Lingyu; Han, Bin; Zhang, Deqing; Li, Jinyang; Huang, He; Zhang, Wei
2017-04-05
An endo-polygalacturonase gene (pga-zj5a) was cloned by reverse transcription from cDNAs synthesized from Aspergillus niger ZJ5 total RNA. The open reading frame of pga-zj5a was 1089 base pairs encoding 362 amino acids. Pga-zj5a lacking a signal peptide sequence was successfully amplified using A. niger ZJ5 cDNA as the template and was ligated into the pPIC9 vector. The resulting plasmid was transformed into competent cells of Pichia pastoris GS115 for heterologous expression. The polygalacturonase showed a maximum activity level of 10436 U/mL in the culture supernatant from a 3 L fermenter. Assays of enzymatic properties showed that the optimal pH and temperature of the recombinant PGA-ZJ5A were 4.5 and 40 °C, respectively. PGA-ZJ5A was effective in pear juice clarification, increased the volume of pear juice by 41.8%, and improved its light transmittance 3-fold.
Kumar, Vidya Pradeep; Kolte, Atul P; Dhali, Arindam; Naik, Chandrashekar; Sridhar, Manpal
2018-04-25
Utilization of energy-rich crop residues by ruminants is restricted by the presence of lignin, which is recalcitrant to digestion. Application of lignin degrading enzymes on the lignocellulosic biomass exposes the cellulose for easy digestion by ruminants. Laccases have been found to be considerably effective in improving the digestibility by way of delignification. However, laccase yields from natural hosts are not sufficient for industrial scale applications, which restricts their use. A viable option would be to express the laccase gene in compatible hosts to achieve higher production yields. A codon-optimized synthetic variant of Schizophyllum commune laccase gene was cloned into a pPIC9K vector and expressed in P. pastoris GS115 (his4) under the control of an alcohol oxidase promoter. Colonies were screened for G418 resistance and the methanol utilization phenotype was established. The transformant yielded a laccase activity of 344 U·mL -1 after 5 days of growth at 30°C (0.019 g·mL -1 wet cell weight). The laccase protein produced by the recombinant Pichia clone was detected as two bands with apparent molecular weights of 55 kDa and 70 kDa on SDS-PAGE. Activity staining on native PAGE confirmed the presence of bioactive laccase. Treatment of five common crop residues with recombinant laccase recorded a lignin loss ranging between 1.64% in sorghum stover, to 4.83% in finger millet, with an enhancement in digestibility ranging between 8.71% in maize straw to 24.61% in finger millet straw. Treatment with recombinant laccase was effective in enhancing the digestibility of lignocellulosic biomass for ruminant feeding through delignification. To date, a number of hosts have been adventured to produce laccase in large quantities, but, to our knowledge, there are no reports of the expression of laccase protein from Schizophyllum commune in Pichia pastoris, and also on the treatment of crop residues using recombinant laccase for ruminant feeding.
Liu, Ben; Zhong, Mintao; Lun, Yongzhi; Wang, Xiaoli; Sun, Wenchang; Li, Xingyun; Ning, Anhong; Cao, Jing; Zhang, Wei; Liu, Lei; Huang, Min
2012-01-01
An apoptosis correlated molecule-protein Latcripin-1 of Lentinula edodes C(91-3)-was expressed and characterized in Pichia pastoris GS115. The total RNA was obtained from Lentinula edodes C(91-3). According to the transcriptome, the full-length gene of Latcripin-1 was isolated with 3'-Full Rapid Amplification of cDNA Ends (RACE) and 5'-Full RACE methods. The full-length gene was inserted into the secretory expression vector pPIC9K. The protein Latcripin-1 was expressed in Pichia pastoris GS115 and analyzed by Sodium Dodecylsulfonate Polyacrylate Gel Electrophoresis (SDS-PAGE) and Western blot. The Western blot showed that the protein was expressed successfully. The biological function of protein Latcripin-1 on A549 cells was studied with flow cytometry and the 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyl-tetrazolium Bromide (MTT) method. The toxic effect of protein Latcripin-1 was detected with the MTT method by co-culturing the characterized protein with chick embryo fibroblasts. The MTT assay results showed that there was a great difference between protein Latcripin-1 groups and the control group (p < 0.05). There was no toxic effect of the characterized protein on chick embryo fibroblasts. The flow cytometry showed that there was a significant difference between the protein groups of interest and the control group according to apoptosis function (p < 0.05). At the same time, cell ultrastructure observed by transmission electron microscopy supported the results of flow cytometry. The work demonstrates that protein Latcripin-1 can induce apoptosis of human lung cancer cells A549 and brings new insights into and advantages to finding anti-tumor proteins.
Liu, Ben; Zhong, Mintao; Lun, Yongzhi; Wang, Xiaoli; Sun, Wenchang; Li, Xingyun; Ning, Anhong; Cao, Jing; Zhang, Wei; Liu, Lei; Huang, Min
2012-01-01
An apoptosis correlated molecule—protein Latcripin-1 of Lentinula edodes C91–3—was expressed and characterized in Pichia pastoris GS115. The total RNA was obtained from Lentinula edodes C91–3. According to the transcriptome, the full-length gene of Latcripin-1 was isolated with 3′-Full Rapid Amplification of cDNA Ends (RACE) and 5′-Full RACE methods. The full-length gene was inserted into the secretory expression vector pPIC9K. The protein Latcripin-1 was expressed in Pichia pastoris GS115 and analyzed by Sodium Dodecylsulfonate Polyacrylate Gel Electrophoresis (SDS-PAGE) and Western blot. The Western blot showed that the protein was expressed successfully. The biological function of protein Latcripin-1 on A549 cells was studied with flow cytometry and the 3-(4,5-Dimethylthiazol-2-yl)-2,5-Diphenyl-tetrazolium Bromide (MTT) method. The toxic effect of protein Latcripin-1 was detected with the MTT method by co-culturing the characterized protein with chick embryo fibroblasts. The MTT assay results showed that there was a great difference between protein Latcripin-1 groups and the control group (p < 0.05). There was no toxic effect of the characterized protein on chick embryo fibroblasts. The flow cytometry showed that there was a significant difference between the protein groups of interest and the control group according to apoptosis function (p < 0.05). At the same time, cell ultrastructure observed by transmission electron microscopy supported the results of flow cytometry. The work demonstrates that protein Latcripin-1 can induce apoptosis of human lung cancer cells A549 and brings new insights into and advantages to finding anti-tumor proteins. PMID:22754362
Wang, Yun; Song, Jinzhu; Wu, Yingjie; Odeph, Margaret; Liu, Zhihua; Howlett, Barbara J; Wang, Shuang; Yang, Ping; Yao, Lin; Zhao, Lei; Yang, Qian
2013-02-01
A complementary DNA library was constructed from the mycelium of Trichoderma asperellum T4, and a highly expressed gene fragment named EplT4 was found. In order to find a more efficient and cost-effective way of obtaining EplT4, this study attempted to produce EplT4 using a Pichia pastoris expression system. The gene encoding EplT4, with an additional 6-His tag at the C-terminus, was cloned into the yeast vector pPIC9K and expressed in the P. pastoris strain GS115 to obtaining more protein for the further research. Transformants of P. pastoris were selected by PCR analysis, and the ability to secrete high levels of the EplT4 protein was determined. The optimal conditions for induction were assayed using the shake flask method and an enzyme-linked immunosorbent assay. The yield of purified EplT4 was approximately 20 mg/L by nickel affinity chromatography and gel-filtration chromatography. Western blot and matrix-assisted laser desorption/ionization time-of-flight mass spectrometer analysis revealed that the recombinant EplT4 was expressed in both its monomers and dimers. Soybean leaves treated with the EplT4 monomer demonstrated the induction of glucanase, chitinase III-A, cysteine proteinase inhibitor, and peroxidase genes. Early cellular events in plant defense response were also observed after incubation with EplT4. Soybean leaves protected by EplT4 against the pathogen Cercosporidium sofinum (Hara) indicated that EplT4 produced in P. pastoris was biologically active and would be potentially useful for improving food security.
Integrated compensatory network is activated in the absence of NCC phosphorylation.
Grimm, P Richard; Lazo-Fernandez, Yoskaly; Delpire, Eric; Wall, Susan M; Dorsey, Susan G; Weinman, Edward J; Coleman, Richard; Wade, James B; Welling, Paul A
2015-05-01
Thiazide diuretics are used to treat hypertension; however, compensatory processes in the kidney can limit antihypertensive responses to this class of drugs. Here, we evaluated compensatory pathways in SPAK kinase-deficient mice, which are unable to activate the thiazide-sensitive sodium chloride cotransporter NCC (encoded by Slc12a3). Global transcriptional profiling, combined with biochemical, cell biological, and physiological phenotyping, identified the gene expression signature of the response and revealed how it establishes an adaptive physiology. Salt reabsorption pathways were created by the coordinate induction of a multigene transport system, involving solute carriers (encoded by Slc26a4, Slc4a8, and Slc4a9), carbonic anhydrase isoforms, and V-type H⁺-ATPase subunits in pendrin-positive intercalated cells (PP-ICs) and ENaC subunits in principal cells (PCs). A distal nephron remodeling process and induction of jagged 1/NOTCH signaling, which expands the cortical connecting tubule with PCs and replaces acid-secreting α-ICs with PP-ICs, were partly responsible for the compensation. Salt reabsorption was also activated by induction of an α-ketoglutarate (α-KG) paracrine signaling system. Coordinate regulation of a multigene α-KG synthesis and transport pathway resulted in α-KG secretion into pro-urine, as the α-KG-activated GPCR (Oxgr1) increased on the PP-IC apical surface, allowing paracrine delivery of α-KG to stimulate salt transport. Identification of the integrated compensatory NaCl reabsorption mechanisms provides insight into thiazide diuretic efficacy.
Integrated compensatory network is activated in the absence of NCC phosphorylation
Grimm, P. Richard; Lazo-Fernandez, Yoskaly; Delpire, Eric; Wall, Susan M.; Dorsey, Susan G.; Weinman, Edward J.; Coleman, Richard; Wade, James B.; Welling, Paul A.
2015-01-01
Thiazide diuretics are used to treat hypertension; however, compensatory processes in the kidney can limit antihypertensive responses to this class of drugs. Here, we evaluated compensatory pathways in SPAK kinase–deficient mice, which are unable to activate the thiazide-sensitive sodium chloride cotransporter NCC (encoded by Slc12a3). Global transcriptional profiling, combined with biochemical, cell biological, and physiological phenotyping, identified the gene expression signature of the response and revealed how it establishes an adaptive physiology. Salt reabsorption pathways were created by the coordinate induction of a multigene transport system, involving solute carriers (encoded by Slc26a4, Slc4a8, and Slc4a9), carbonic anhydrase isoforms, and V-type H+-ATPase subunits in pendrin-positive intercalated cells (PP-ICs) and ENaC subunits in principal cells (PCs). A distal nephron remodeling process and induction of jagged 1/NOTCH signaling, which expands the cortical connecting tubule with PCs and replaces acid-secreting α-ICs with PP-ICs, were partly responsible for the compensation. Salt reabsorption was also activated by induction of an α-ketoglutarate (α-KG) paracrine signaling system. Coordinate regulation of a multigene α-KG synthesis and transport pathway resulted in α-KG secretion into pro-urine, as the α-KG–activated GPCR (Oxgr1) increased on the PP-IC apical surface, allowing paracrine delivery of α-KG to stimulate salt transport. Identification of the integrated compensatory NaCl reabsorption mechanisms provides insight into thiazide diuretic efficacy. PMID:25893600
ERIC Educational Resources Information Center
Warren, Paul
2016-01-01
This document presents the technical appendices that accompany the full report, "Strengthening Local K-12 Accountability: The Role of County Offices of Education." The appendices include: (1) Data Collection Methods; and (2) PPIC Survey of California County Superintendents of Education. [For the full report, see ED570941.
Californians & Education. PPIC Statewide Survey
ERIC Educational Resources Information Center
Baldassare, Mark; Bonner, Dean; Petek, Sonja; Shrestha, Jui
2011-01-01
The Public Policy Institute of California (PPIC) Statewide Survey series provides policymakers, the media, and the public with objective, advocacy-free information on the perceptions, opinions, and public policy preferences of California residents. Inaugurated in April 1998, this is the 116th PPIC Statewide Survey in a series that has generated a…
Jing, Weifang; Zhou, Jinrun; Wang, Chunyang; Qiu, Jianhua; Guo, Huijun; Li, Hongmei
2018-04-26
This study focuses on preparing the secretory recombinant J subgroup of avian leukosis virus (ALV-J) gp85 protein using Pichia pastoris and evaluating its immunoprotection as vaccine antigen combining with CpG-ODN adjuvant. The secretory recombinant plasmid pPIC9-gp85 containing ALV-J gp85 gene was designed and was transfected into the genome of P. pastoris (GS115) cells. The recombinant plasmid was expressed under the induction of methanol. The expressed products in the medium of the cells were purified and identified with endoglycosidase digestion assay and western blot mediated with monoclonal antibody (MAb) JE9. The purified product combining with CpG-ODN adjuvant was inoculated intramuscularly into 7-day-old chickens and three booster inoculations were performed on 21 days post first inoculation (dpfi), 42, and 56 dpfi. The antibody responses and cellular immune responses were detected, and the protective effects were analyzed after challenge with ALV-J. The results showed that the secretory pPIC9-gp85 plasmid was successfully constructed and could be stably expressed in GS115 cells. The expressed products were N-acetylglucosylated and could specifically combine with MAb (JE9). The secreted gp85 protein combining with CpG-ODN adjuvant could induce higher antibody response and spleen lymphocyte proliferation response and IFN-γ-inducing response, and could protect all the inoculated chickens against the viremia and the immunosuppressive lesions caused by ALV-J challenge. The results of neutralizing test in vitro suggested that the antisera with some ALV-J antibody titers could neutralize ALV-J strain and inhibit the growth of virus in vitro. The result of IFA showed that IgG antibody in the antisera could specifically combine with ALV-J strain in cells. It can be concluded that the secretory recombinant gp85 protein, as a new acetylglucosylated gp85 protein, was successfully prepared and combining with CpG-ODN adjuvant could protect the inoculated chickens against ALV-J infection. This study first reported the methods on preparing the secretory recombinant ALV-J gp85 protein using P. pastoris and evaluated its immunoprotection.
Kuddus, Md Ruhul; Rumi, Farhana; Tsutsumi, Motosuke; Takahashi, Rika; Yamano, Megumi; Kamiya, Masakatsu; Kikukawa, Takashi; Demura, Makoto; Aizawa, Tomoyasu
2016-06-01
Snakin-1 (SN-1) is a small cysteine-rich plant antimicrobial peptide with broad spectrum antimicrobial activity which was isolated from potato (Solanum tuberosum). Here, we carried out the expression of a recombinant SN-1 in the methylotrophic yeast Pichia pastoris, along with its purification and characterization. A DNA fragment encoding the mature SN-1 was cloned into pPIC9 vector and introduced into P. pastoris. A large amount of pure recombinant SN-1 (approximately 40 mg/1L culture) was obtained from a fed-batch fermentation culture after purification with a cation exchange column followed by RP-HPLC. The identity of the recombinant SN-1 was verified by MALDI-TOF MS, CD and (1)H NMR experiments. All these data strongly indicated that the recombinant SN-1 peptide had a folding with six disulfide bonds that was identical to the native SN-1. Our findings showed that SN-1 exhibited strong antimicrobial activity against test microorganisms and produced very weak hemolysis of mammalian erythrocytes. The mechanism of its antimicrobial action against Escherichia coli was investigated by both outer membrane permeability assay and cytoplasmic membrane depolarization assay. These assays demonstrated that SN-1 is a membrane-active antimicrobial peptide which can disrupt both outer and cytoplasmic membrane integrity. This is the first report on the recombinant expression and purification of a fully active SN-1 in P. pastoris. Copyright © 2016 Elsevier Inc. All rights reserved.
Optimisation of the expression of a Trametes versicolor laccase gene in Pichia pastoris.
O'Callaghan, J; O'Brien, M M; McClean, K; Dobson, A D W
2002-08-01
A cDNA encoding a laccase enzyme was isolated from a Trametes versicolor cDNA library. The gene was subcloned into the Pichia pastoris expression vector pPIC3.5 and transformed into the P. pastoris strains KM71 and GS115. Laccase-secreting transformants were selected by their ability to oxidise the substrate ABTS. No difference in laccase activity was observed between culture supernatants from GS115 (proteolytic) and KM71 (nonproteolytic) strains. The presence of at least 200 microM copper was necessary for optimal laccase activity in the culture supernatants. During growth of P. pastoris on minimal medium the pH of the medium was reduced to <3.0. If alanine was added to the medium the pH reduction was not as pronounced and at alanine concentrations >0.6% w/v the pH was kept constant for >7 days. Cultures in which the pH was maintained by alanine metabolism produced higher levels of laccase activity than those grown in the absence of alanine. This study describes the development of a medium that allows convenient pH control of P. pastoris without the need for continuous neutralisation.
Californians & Higher Education. PPIC Statewide Survey
ERIC Educational Resources Information Center
Baldassare, Mark; Bonner, Dean; Petek, Sonja; Willcoxon, Nicole
2010-01-01
This edition of the PPIC (Public Policy Institute of California) Statewide Survey is the fourth in a series of surveys funded by The William and Flora Hewlett Foundation focusing on higher education. This survey seeks to inform state policymakers, encourage discussion, and raise public awareness about the state's public higher education…
Song, Xiaomin; Wang, Jing; Wu, Fang; Li, Xu; Teng, Maikun; Gong, Weimin
2005-01-01
SPE10 is an antifungal protein isolated from the seeds of Pachyrrhizus erosus. cDNA encoding a 47 amino acid peptide was cloned by RT-PCR and the gene sequence proved SPE10 to be a new member of plant defensin family. The synthetic cDNA with codons preferred in yeast was cloned into the pPIC9 plasmid directly in-frame with the secretion signal alpha-mating factor, and highly expressed in methylotrophic Pichia pastoris. Activity assays showed the recombinant SPE10 inhibited specifically the growth of several pathogenic fungi as native SPE10. Circular dichroism and fluorescence spectroscopy analysis indicated that the native and recombinant protein should have same folding, though there are eight cystein residues in the sequence. Several evidence suggested SPE10 should be the first dimeric plant defensin reported so far.
Californians and Education: PPIC Statewide Survey
ERIC Educational Resources Information Center
Baldassare, Mark; Bonner, Dean; Paluch, Jennifer; Petek, Sonja
2007-01-01
This edition of the PPIC Statewide Survey is the third in a series of surveys funded by The William and Flora Hewlett Foundation focusing on education in California. This survey is intended to raise public awareness, inform decisionmakers, and stimulate public discussions about a variety of education issues facing the state. Findings are based on…
ERIC Educational Resources Information Center
Rose, Heather; Sonstelie, Jon; Weston, Margaret
2012-01-01
In his 2012-13 budget, Governor Brown proposed a new system for allocating state revenue among California school districts. In May the governor revised his proposal. Using the Public Policy Institute of California (PPIC) School Finance Model (available at www.ppic.org/main/dataSet.asp?i=1229), in this update the authors show how these proposals…
Gene Therapy Vectors with Enhanced Transfection Based on Hydrogels Modified with Affinity Peptides
Shepard, Jaclyn A.; Wesson, Paul J.; Wang, Christine E.; Stevans, Alyson C.; Holland, Samantha J.; Shikanov, Ariella; Grzybowski, Bartosz A.; Shea, Lonnie D.
2011-01-01
Regenerative strategies for damaged tissue aim to present biochemical cues that recruit and direct progenitor cell migration and differentiation. Hydrogels capable of localized gene delivery are being developed to provide a support for tissue growth, and as a versatile method to induce the expression of inductive proteins; however, the duration, level, and localization of expression isoften insufficient for regeneration. We thus investigated the modification of hydrogels with affinity peptides to enhance vector retention and increase transfection within the matrix. PEG hydrogels were modified with lysine-based repeats (K4, K8), which retained approximately 25% more vector than control peptides. Transfection increased 5- to 15-fold with K8 and K4 respectively, over the RDG control peptide. K8- and K4-modified hydrogels bound similar quantities of vector, yet the vector dissociation rate was reduced for K8, suggesting excessive binding that limited transfection. These hydrogels were subsequently applied to an in vitro co-culture model to induce NGF expression and promote neurite outgrowth. K4-modified hydrogels promoted maximal neurite outgrowth, likely due to retention of both the vector and the NGF. Thus, hydrogels modified with affinity peptides enhanced vector retention and increased gene delivery, and these hydrogels may provide a versatile scaffold for numerous regenerative medicine applications. PMID:21514659
Jackson, Kasey L.; Dayton, Robert D.; Deverman, Benjamin E.; Klein, Ronald L.
2016-01-01
Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats. PMID:27867348
Jackson, Kasey L; Dayton, Robert D; Deverman, Benjamin E; Klein, Ronald L
2016-01-01
Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats.
Tang, Cun-Duo; Shi, Hong-Ling; Tang, Qing-Hai; Zhou, Jun-Shi; Yao, Lun-Guang; Jiao, Zhu-Jin; Kan, Yun-Chao
2016-11-01
Two novel glycosyl hydrolase family 5 (GH5) β-mannanases (AoMan5A and AoMan5B) were identified from Aspergillus oryzae RIB40 by genome mining. The AoMan5A contains a predicted family 1 carbohydrate binding module (CBM-1), located at its N-terminal. The AoMan5A, AoMan5B and truncated mutant AoMan5AΔCL (truncating the N-terminal CBM and linker of AoMan5A) were expressed retaining the N-terminus of the native protein in Pichia pastoris GS115 by pPIC9K M . The specific enzyme activity of the purified reAoMan5A, reAoMan5B and reAoMan5AΔCL towards locust bean gum at pH 3.6 and 40°C for 10min, was 8.3, 104.2 and 15.8U/mg, respectively. The temperature properties of the reAoMan5AΔCL were improved by truncating CBM. They can degrade the pretreated konjac flour and produce prebiotics. In addition, they had excellent stability under simulative gastric fluid and simulative prilling process. All these properties make these recombinant β-mannanases potential additives for use in the food and feed industries. Copyright © 2016. Published by Elsevier Inc.
Dang, Yin-li; Yan, Yan; Zhang, Xiao-xiao; Li, Pu-yuan; Yu, Lan; Zhang, Lei; Zhang, Fang-lin; Xu, Zhi-kai; Wu, Xing-an
2011-05-01
To stably express herpes simplex virus type 1 (HSV-1) glycoprotein C (gC) in Chinese hamster ovary cells (CHO-K1). The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed and transfected into CHO-K1 cells by Lipofectamine 2000. The transfected cells were selected by G418 and methotrexate (MTX). The expression of HSV-1 gC was analyzed by Slot blot. HSV-1 gC proteins were purified with His-Ni Sepharose and then detected by Western blot. The eukaryotic expression vector pCI-mCMV-gC-1-IRES-DHFR-L22R was constructed successfully. CHO-K1 cells stably expressing HSV-1 gC proteins were established and confirmed by Western blot. The HSV-1 gC proteins have been expressed successfully and have good bioactivity. The results make it possible for further study and clinical use of HSV-1 gC.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rinaldi, I; Magallanes, L; Ludwig Maximilian University Munich
2014-06-15
Purpose: Ion beams exhibit a finite range and an inverted depth-dose profile, the Bragg peak. These favorable properties allow superior tumordose conformality, but introduce sensitivity to range uncertainties. Hence, imaging techniques play an increasingly important role to support the treatment planning and the in-vivo monitoring of the actual ion beam treatment. Methods: This work presents the experimental investigations carried out to address the feasibility of ion transmission imaging at the Heidelberg Ion Therapy center using an active raster scanning beam delivery system and a prototype range telescope set-up based on a stack of 61 parallel-plate ionization chambers (PPIC) interleaved withmore » 3 mm absorber plates of PMMA. Results: An extensive characterization of the set-up in terms of beam parameters and settings of the read-out electronics was performed and results will be presented. A data processing method to increase the range resolution (MIRR) of the PPIC stack was developed. In this approach, the position of the maximum of the Bragg curve is deduced from the ratio of measured signals in adjacent PPIC channels. MIRR evaluation is based on Bragg curves obtained from Monte Carlo simulations and validated with experimental data acquired with the PPIC stack using ion beams. MIRR was applied to the carbon ion radiography of an anthropomorphic Alderson head phantom yielding a resolution of 0.8 mm water equivalent thickness (WET) compared to the nominal value of 3.495 mm WET given by the thickness of the absorber slabs in the PPIC stack. An absolute comparison of the Alderson phantom carbon ion transmitted image with an X-ray digitally reconstructed radiography, both converted into WET, will also be shown. Conclusion: The obtained results are very promising and motivate further developments of the system towards an eventual clinical use.This work is supported by the German Research Foundation and the German Academic Exchange Service. This work is supported by the German Research Foundation (DFG) and the German Academic Exchange Service (DAAD)« less
Galectin-9 as a prognostic factor with antimetastatic potential in breast cancer.
Irie, Akemi; Yamauchi, Akira; Kontani, Keiichi; Kihara, Minoru; Liu, Dage; Shirato, Yukako; Seki, Masako; Nishi, Nozomu; Nakamura, Takanori; Yokomise, Hiroyasu; Hirashima, Mitsuomi
2005-04-15
Galectin-9, a member of the beta-galactoside-binding galectin family, induces aggregation of certain cell types. We assessed the contribution of galectin-9 to the aggregation of breast cancer cells as well as the relation between galectin-9 expression in tumor tissue and distant metastasis in patients with breast cancer. Subclones of MCF-7 breast cancer cells with high or low levels of galectin-9 expression were established and either cultured on plastic dishes or transplanted into nude mice. The tumors of 84 patients with breast cancer were tested for galectin-9 expression by immunohistochemistry. The patients were followed up for 14 years. MCF-7 subclones with a high level of galectin-9 expression formed tight clusters during proliferation in vitro, whereas a subclone (K10) with the lowest level of galectin-9 expression did not. However, K10 cells stably transfected with a galectin-9 expression vector aggregated in culture and in nude mice. Ectopic expression of galectin-9 also reduced MCF-7 cell adhesion to extracellular matrix proteins. Tumors of 42 of the 84 patients were galectin-9 positive, and those of 19 of the 21 patients with distant metastasis were galectin-9 negative. None of the 13 patients with galectin-9-positive tumors and lymph node metastasis up to level II manifested distant metastasis. The cumulative disease-free survival ratio for galectin-9-positive patients was more favorable than that for the galectin-9-negative group (P < 0.0001). Multivariate analysis revealed that galectin-9 status influenced distant metastasis independently of and to a greater extent than lymph node metastasis. Galectin-9 is a possible prognostic factor with antimetastatic potential in breast cancer.
Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.
Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu
2015-04-01
Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.
Gwiazda, Kamila S; Grier, Alexandra E; Sahni, Jaya; Burleigh, Stephen M; Martin, Unja; Yang, Julia G; Popp, Nicholas A; Krutein, Michelle C; Khan, Iram F; Jacoby, Kyle; Jensen, Michael C; Rawlings, David J; Scharenberg, Andrew M
2016-09-29
Many future therapeutic applications of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 and related RNA-guided nucleases are likely to require their use to promote gene targeting, thus necessitating development of methods that provide for delivery of three components-Cas9, guide RNAs and recombination templates-to primary cells rendered proficient for homology-directed repair. Here, we demonstrate an electroporation/transduction codelivery method that utilizes mRNA to express both Cas9 and mutant adenoviral E4orf6 and E1b55k helper proteins in association with adeno-associated virus (AAV) vectors expressing guide RNAs and recombination templates. By transiently enhancing target cell permissiveness to AAV transduction and gene editing efficiency, this novel approach promotes efficient gene disruption and/or gene targeting at multiple loci in primary human T-cells, illustrating its broad potential for application in translational gene editing.
Center for Coastline Security Technology, Year-2
2007-05-01
set to a constant value of n = 7.25 Hz (435 RPM) giving an advance ratio of J = U/nD = 0.31 (assuming a vehicle wake deficit of 0.9 UB∞ B), the yaw... noise characteristics (Case #4). Figures for Section 2.9 Figure 2.9.1: WETStar Fluorometer. Figure 2.9.2: Proposed design schematic no. 1...consecutives states and )(kw is the state noise [10]. F defines the relation between the state vector )(kX at time k and the state vector at time k
Sen, Dwaipayan; Gadkari, Rupali A; Sudha, Govindarajan; Gabriel, Nishanth; Kumar, Yesupatham Sathish; Selot, Ruchita; Samuel, Rekha; Rajalingam, Sumathi; Ramya, V.; Nair, Sukesh C.; Srinivasan, Narayanaswamy; Srivastava, Alok
2013-01-01
Abstract Recombinant adeno-associated virus vectors based on serotype 8 (AAV8) have shown significant promise for liver-directed gene therapy. However, to overcome the vector dose dependent immunotoxicity seen with AAV8 vectors, it is important to develop better AAV8 vectors that provide enhanced gene expression at significantly low vector doses. Since it is known that AAV vectors during intracellular trafficking are targeted for destruction in the cytoplasm by the host–cellular kinase/ubiquitination/proteasomal machinery, we modified specific serine/threonine kinase or ubiquitination targets on the AAV8 capsid to augment its transduction efficiency. Point mutations at specific serine (S)/threonine (T)/lysine (K) residues were introduced in the AAV8 capsid at the positions equivalent to that of the effective AAV2 mutants, generated successfully earlier. Extensive structure analysis was carried out subsequently to evaluate the structural equivalence between the two serotypes. scAAV8 vectors with the wild-type (WT) and each one of the S/T→Alanine (A) or K-Arginine (R) mutant capsids were evaluated for their liver transduction efficiency in C57BL/6 mice in vivo. Two of the AAV8-S→A mutants (S279A and S671A), and a K137R mutant vector, demonstrated significantly higher enhanced green fluorescent protein (EGFP) transcript levels (∼9- to 46-fold) in the liver compared to animals that received WT-AAV8 vectors alone. The best performing AAV8 mutant (K137R) vector also had significantly reduced ubiquitination of the viral capsid, reduced activation of markers of innate immune response, and a concomitant two-fold reduction in the levels of neutralizing antibody formation in comparison to WT-AAV8 vectors. Vector biodistribution studies revealed that the K137R mutant had a significantly higher and preferential transduction of the liver (106 vs. 7.7 vector copies/mouse diploid genome) when compared to WT-AAV8 vectors. To further study the utility of the K137R-AAV8 mutant in therapeutic gene transfer, we delivered human coagulation factor IX (h.FIX) under the control of liver-specific promoters (LP1 or hAAT) into C57BL/6 mice. The circulating levels of h.FIX:Ag were higher in all the K137R-AAV8 treated groups up to 8 weeks post-hepatic gene transfer. These studies demonstrate the feasibility of the use of this novel AAV8 vectors for potential gene therapy of hemophilia B. PMID:23442071
Zhang, Hong-Tao; Yang, Jia-Sen; Shan, Lei; Bi, Yu-Ping
2006-01-01
Alpha-linolenic acid(ALA, C18:3delta9,12,15 ) is an essential fatty acid which has many sanitary functions to human. However, its contents in diets are often not enough. In plants, omega-3 fatty acid desaturases(FAD) catalyze linoleic acid(LA, C18:2delta9,12) into ALA. The seed oil of Glycine max contains high level of ALA. To investigate the functions of Glycine max omega-3FAD, the cDNA of GmFAD3 C was amplified by RT-PCR from immature seeds, then cloned into the shuttle expression vector p416 to generate the recombinant vector p4GFAD3C. The resulting vector was transformed into Saccharomyces cerevisiae K601 throuth LiAc method. The positive clones were screened on the CM(Ura-) medium and identified by PCR, and then cultured in CM (Ura-) liquid medium with exogenous LA in 20 degrees C for three days. The intracellular fatty acid composition of the engineering strain Kp416 and Kp4GFAD3C was analyzed by gas chromatography (GC). A novel peak in strain Kp4GFAD3C was detected,which was not detectable in control, Comparison of the retention times of the newly yielded peak with that of authentic standard indicated that the fatty acid is ALA. The content of ALA reached to 3.1% of the total fatty acid in recombinant strain, the content of LA correspondingly decreased from 22% to 16.2% by contrast. It was suggested that the protein encoded by GmFAD3 C can specifically catalyze 18 carbon PUFA substrate of LA into ALA by taking off hydrogen atoms at delta15 location. In this study, we expressed a Glycine max omega-3 fatty acid desaturase gene in S. cerevisiae; An efficient and economical yeast expressing system(K601-p416 system) which is suitable for the expression of FAD was built.
Li, Fan; Li, Lisha; Cheng, Meijuan; Wang, Xiumin; Hao, Jun; Liu, Shuxia; Duan, Huijun
2017-01-22
Tubular interstitial extracellular matrix accumulation, which plays a key role in the pathogenesis and progression of diabetic kidney disease (DKD), is believed to be mediated by activation of PI3K/Akt signal pathway. However, it is still not clear whether SH2 domain-containing inositol 5'-phosphatase (SHIP), known as a negative regulator of PI3K/Akt pathway is also involved in extracellular matrix metabolism of diabetic kidney. In the present study, decreased SHIP and increased phospho-Akt (Ser 473, Thr 308) were found in renal tubular cells of diabetic mice accompanied by overexpression of connective tissue growth factor (CTGF) and extracellular matrix deposition versus normal mice. Again, high glucose attenuated SHIP expression in a time-dependent manner, concomitant with activation of PI3K/Akt signaling and extracellular matrix production in human renal proximal tubular epithelial cells (HK2) cultured in vitro, which was significantly prevented by transfection of M90-SHIP vector. Furthermore, in vivo delivery of rAd-INPP5D vector (SHIP expression vector) via intraperitoneal injection in diabetic mice increased SHIP expression by 3.36 times followed by 65.26%, 70.38% and 46.71% decreases of phospho-Akt (Ser 473), phospho-Akt (Thr 308) and CTGF expression versus diabetic mice receiving rAd-EGFP vector. Meanwhile, increased renal extracellular matrix accumulation of diabetic mice was also inhibited with intraperitoneal injection of rAd-INPP5D vector. These above data suggested that overexpression of SHIP might be a potent method to lessen renal extracellular matrix accumulation via inactivation of PI3K/Akt pathway and suppression of CTGF expression in DKD. Copyright © 2016 Elsevier Inc. All rights reserved.
USDA-ARS?s Scientific Manuscript database
A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...
Will, Elke; Bailey, Jeff; Schuesler, Todd; Modlich, Ute; Balcik, Brenden; Burzynski, Ben; Witte, David; Layh-Schmitt, Gerlinde; Rudolph, Cornelia; Schlegelberger, Brigitte; von Kalle, Christof; Baum, Christopher; Sorrentino, Brian P; Wagner, Lars M; Kelly, Patrick; Reeves, Lilith; Williams, David A
2007-04-01
Although retroviral vectors are one of the most widely used vehicles for gene transfer, there is no uniformly accepted pre-clinical model defined to assess their safety, in particular their risk related to insertional mutagenesis. In the murine pre-clinical study presented here, 40 test and 10 control mice were transplanted with ex vivo manipulated bone marrow cells to assess the long-term effects of the transduction of hematopoietic cells with the retroviral vector MSCV-MGMT(P140K)wc. Test mice had significant gene marking 8-12 months post-transplantation with an average of 0.93 vector copies per cell and 41.5% of peripheral blood cells expressing the transgene MGMT(P140K), thus confirming persistent vector expression. Unexpectedly, six test mice developed malignant lymphoma. No vector was detected in the tumor cells of five animals with malignancies, indicating that the malignancies were not caused by insertional mutagenesis or MGMT(P140K) expression. Mice from a concurrent study with a different transgene also revealed additional cases of vector-negative lymphomas of host origin. We conclude that the background tumor formation in this mouse model complicates safety determination of retroviral vectors and propose an improved study design that we predict will increase the relevance and accuracy of interpretation of pre-clinical mouse studies.
Chiu, Chun-Tang; Chen, Jing-Hsien; Chou, Fen-Pi; Lin, Hui-Hsuan
2015-06-24
Hibiscus sabdariffa leaf has been previously shown to possess hypoglycemic, hypolipidemic, and antioxidant effects, and induce tumor cell apoptosis. However, the molecular mechanisms involved in the anticancer activity of H. sabdariffa leaf extract (HLE) are poorly understood. The object of the study was to examine the anti-invasive potential of HLE. First, HLE was demonstrated to be rich in polyphenols. The results of wound-healing assay and in vitro transwell assay revealed that HLE dose-dependently inhibited the migration and invasion of human prostate cancer LNCaP (lymph node carcinoma of the prostate) cells under non-cytotoxic concentrations. Our results further showed that HLE exerted an inhibitory effect on the activity and expressions of matrix metalloproteinase-9 (MMP-9). The HLE-inhibited MMP-9 expression appeared to be a consequence of nuclear factor-kappaB (NF-κB) inactivation because its DNA-binding activity was suppressed by HLE. Molecular data showed all these influences of HLE might be mediated via inhibition of protein kinase B (PKB, also known as Akt)/NF-kB/MMP-9 cascade pathway, as demonstrated by the transfection of Akt1 overexpression vector. Finally, the inhibitory effect of HLE was proven by its inhibition on the growth of LNCaP cells and the expressions of metastasis-related molecular proteins in vivo. These findings suggested that the inhibition of MMP-9 expression by HLE may act through the suppression of the Akt/NF-kB signaling pathway, which in turn led to the reduced invasiveness of the cancer cells.
Tyrosine Mutation in AAV9 Capsid Improves Gene Transfer to the Mouse Lung.
Martini, Sabrina V; Silva, Adriana L; Ferreira, Debora; Rabelo, Rafael; Ornellas, Felipe M; Gomes, Karina; Rocco, Patricia R M; Petrs-Silva, Hilda; Morales, Marcelo M
2016-01-01
Adeno-associated virus (AAV) vectors are being increasingly used as the vector of choice for in vivo gene delivery and gene therapy for many pulmonary diseases. Recently, it was shown that phosphorylation of surface-exposed tyrosine residues from AAV capsid targets the viral particles for ubiquitination and proteasome-mediated degradation, and mutations of these tyrosine residues lead to highly efficient vector transduction in vitro and in vivo in different organs. In this study, we evaluated the pulmonary transgene expression efficacy of AAV9 vectors containing point mutations in surface-exposed capsid tyrosine residues. Eighteen C57BL/6 mice were randomly assigned into three groups: (1) a control group (CTRL) animals underwent intratracheal (i.t.) instillation of saline, (2) the wild-type AAV9 group (WT-AAV9, 1010 vg), and (3) the tyrosine-mutant Y731F AAV9 group (M-AAV9, 1010 vg), which received (i.t.) self-complementary AAV9 vectors containing the DNA sequence of enhanced green fluorescence protein (eGFP). Four weeks after instillation, lung mechanics, morphometry, tissue cellularity, gene expression, inflammatory cytokines, and growth factor expression were analyzed. No significant differences were observed in lung mechanics and morphometry among the experimental groups. However, the number of polymorphonuclear cells was higher in the WT-AAV9 group than in the CTRL and M-AAV9 groups, suggesting that the administration of tyrosine-mutant AAV9 vectors was better tolerated. Tyrosine-mutant AAV9 vectors significantly improved transgene delivery to the lung (30%) compared with their wild-type counterparts, without eliciting an inflammatory response. Our results provide the impetus for further studies to exploit the use of AAV9 vectors as a tool for pulmonary gene therapy. © 2016 The Author(s) Published by S. Karger AG, Basel.
Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Singh, Surender; Kumar, Sudarshan; Kaushik, Jai K; Mohanty, Ashok K; Malakar, Dhruba
2015-12-01
Oct4, pluripotency marker and transcription factor, expresses in embryonic stem cells. It plays a pivotal role in determination of stem cells fate. Up and down regulation of Oct4 causes differentiation of embryonic stem cells. It is one of the main transcription factors which remained concerned in every study related to induced pluripotent stem cell. Here, we report the production of goat Oct4 protein using plasmid and lentiviral based vectors. Firstly, Oct4 ORF was cloned in pAcGFP1-N1 plasmid vector and positive clones were screened with colony PCR. Oct4 was over-expressed in CHO-K1 cell line and expression was confirmed by observing green florescent protein expression in CHO-K1 cells. Secondly, Oct4 lentiviral expression construct has been prepared using pLenti-gw vector. Oct4 ORF was cloned into pLenti4/V5-DEST vector and viral particles were produced in 293FT cells. Oct4 viral particles were used to infect goat fibroblast cells. Oct4 expression was observed and confirmed in transfected goat fibroblast cells using RT-PCR. Detection of Oct4 protein in western blotting assay affirmed the capacity of over-expression of our Oct4 lentiviral vector. The lentiviral expression construct and recombinant Oct4 protein may be used for reprogramming of somatic cell into induced pluripotent stem cell.
Kohno, Ryosuke; Hotta, Kenji; Matsubara, Kana; Nishioka, Shie; Matsuura, Taeko; Kawashima, Mitsuhiko
2012-03-08
When in vivo proton dosimetry is performed with a metal-oxide semiconductor field-effect transistor (MOSFET) detector, the response of the detector depends strongly on the linear energy transfer. The present study reports a practical method to correct the MOSFET response for linear energy transfer dependence by using a simplified Monte Carlo dose calculation method (SMC). A depth-output curve for a mono-energetic proton beam in polyethylene was measured with the MOSFET detector. This curve was used to calculate MOSFET output distributions with the SMC (SMC(MOSFET)). The SMC(MOSFET) output value at an arbitrary point was compared with the value obtained by the conventional SMC(PPIC), which calculates proton dose distributions by using the depth-dose curve determined by a parallel-plate ionization chamber (PPIC). The ratio of the two values was used to calculate the correction factor of the MOSFET response at an arbitrary point. The dose obtained by the MOSFET detector was determined from the product of the correction factor and the MOSFET raw dose. When in vivo proton dosimetry was performed with the MOSFET detector in an anthropomorphic phantom, the corrected MOSFET doses agreed with the SMC(PPIC) results within the measurement error. To our knowledge, this is the first report of successful in vivo proton dosimetry with a MOSFET detector.
Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B
1997-01-01
We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population. PMID:9032306
Malik, P; McQuiston, S A; Yu, X J; Pepper, K A; Krall, W J; Podsakoff, G M; Kurtzman, G J; Kohn, D B
1997-03-01
We tested the ability of a recombinant adeno-associated virus (rAAV) vector to express and integrate exogenous DNA into human hematopoietic cells in the absence of selection. We developed an rAAV vector, AAV-tNGFR, carrying a truncated rat nerve growth factor receptor (tNGFR) cDNA as a cell surface reporter under the control of the Moloney murine leukemia virus (MoMuLV) long terminal repeat. An analogous MoMuLV-based retroviral vector (L-tNGFR) was used in parallel, and gene transfer and expression in human hematopoietic cells were assessed by flow cytometry and DNA analyses. Following gene transfer into K562 cells with AAV-tNGFR at a multiplicity of infection (MOI) of 13 infectious units (IU), 26 to 38% of cells expressed tNGFR on the surface early after transduction, but the proportion of tNGFR expressing cells steadily declined to 3.0 to 3.5% over 1 month of culture. At an MOI of 130 IU, nearly all cells expressed tNGFR immediately posttransduction, but the proportion of cells expressing tNGFR declined to 62% over 2 months of culture. The decline in the proportion of AAV-tNGFR-expressing cells was associated with ongoing losses of vector genomes. In contrast, K562 cells transduced with the retroviral vector L-tNGFR expressed tNGFR in a constant fraction. Integration analyses on clones showed that integration occurred at different sites. Integration frequencies were estimated at about 49% at an MOI of 130 and 2% at an MOI of 1.3. Transduction of primary human CD34+ progenitor cells by AAV-tNGFR was less efficient than with K562 cells and showed a declining percentage of cells expressing tNGFR over 2 weeks of culture. Thus, purified rAAV caused very high gene transfer and expression in human hematopoietic cells early after transduction, which steadily declined during cell passage in the absence of selection. Although the efficiency of integration was low, overall integration was markedly improved at a high MOI. While prolonged episomal persistence may be adequate for gene therapy of nondividing cells, a very high MOI or improvements in basic aspects of AAV-based vectors may be necessary to improve integration frequency in the rapidly dividing hematopoietic cell population.
Ghosh-Choudhury, N; Butcher, M; Ghosh, H P
1990-03-01
A DNA fragment of the herpes simplex virus type 1 genome encoding glycoprotein C (gC-1) has been cloned into different eukaryotic expression vectors for transient and stable expression of the glycoprotein in a number of cell lines. All of these expression vectors use a non-HSV promoter, such as the adenovirus major late promoter or murine leukemia virus long terminal repeat promoter to express gC-1 in COS and CHO cells or 3T3 cells. The gC-1 protein synthesized was fully glycosylated with both N- and O-linked oligosaccharides. Synthesis of the mature 120K gC-1 glycoprotein involved partially glycosylated 100K and 105K proteins and the non-glycosylated 70K protein as intermediate molecules. Immunofluorescence studies showed that the expressed gC-1 was localized intracellularly in the nuclear envelope as well as on the cell surface. The expressed gC-1 was biologically active and could act as a receptor for the complement component C3b in the absence of other HSV proteins.
Nephron segment-specific gene expression using AAV vectors.
Asico, Laureano D; Cuevas, Santiago; Ma, Xiaobo; Jose, Pedro A; Armando, Ines; Konkalmatt, Prasad R
2018-02-26
AAV9 vector provides efficient gene transfer in all segments of the renal nephron, with minimum expression in non-renal cells, when administered retrogradely via the ureter. It is important to restrict the transgene expression to the desired cell type within the kidney, so that the physiological endpoints represent the function of the transgene expressed in that specific cell type within kidney. We hypothesized that segment-specific gene expression within the kidney can be accomplished using the highly efficient AAV9 vectors carrying the promoters of genes that are expressed exclusively in the desired segment of the nephron in combination with administration by retrograde infusion into the kidney via the ureter. We constructed AAV vectors carrying eGFP under the control of: kidney-specific cadherin (KSPC) gene promoter for expression in the entire nephron; Na + /glucose co-transporter (SGLT2) gene promoter for expression in the S1 and S2 segments of the proximal tubule; sodium, potassium, 2 chloride co-transporter (NKCC2) gene promoter for expression in the thick ascending limb of Henle's loop (TALH); E-cadherin (ECAD) gene promoter for expression in the collecting duct (CD); and cytomegalovirus (CMV) early promoter that provides expression in most of the mammalian cells, as control. We tested the specificity of the promoter constructs in vitro for cell type-specific expression in mouse kidney cells in primary culture, followed by retrograde infusion of the AAV vectors via the ureter in the mouse. Our data show that AAV9 vector, in combination with the segment-specific promoters administered by retrograde infusion via the ureter, provides renal nephron segment-specific gene expression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Dayton, Robert D.; Wang, David B.; Cain, Cooper D.; Schrott, Lisa M.; Ramirez, Julio J.; King, Michael A.; Klein, Ronald L.
2011-01-01
Frontotemporal lobar degeneration (FTLD) is a neurodegenerative disease that involves cognitive decline and dementia. To model the hippocampal neurodegeneration and memory-related behavioral impairment that occurs in FTLD and other tau and TDP-43 proteinopathy diseases, we used an adeno-associated virus serotype 9 (AAV9) vector to induce bilateral expression of either microtubule-associated protein tau or transactive response DNA binding protein 43 kDa (TDP-43) in adult rat dorsal hippocampus. Human wild-type forms of tau or TDP-43 were expressed. The vectors/doses were designed for moderate expression levels within neurons. Rats were evaluated for acquisition and retention in the Morris water task over 12 weeks after gene transfer. Neither vector altered acquisition performance compared to controls. In measurements of retention, there was impairment in the TDP-43 group. Histological examination revealed specific loss of dentate gyrus granule cells and concomitant gliosis proximal to the injection site in the TDP-43 group, with shrinkage of the dorsal hippocampus. Despite specific tau pathology, the tau gene transfer surprisingly did not cause obvious neuronal loss or behavioral impairment. The data demonstrate that TDP-43 produced mild behavioral impairment and hippocampal neurodegeneration in rats, whereas tau did not. The models could be of value for studying mechanisms of FTLD and other diseases with tau and TDP-43 pathology in the hippocampus including Alzheimer's disease, with relevance to early stage mild impairment. PMID:22177996
Meseda, Clement A; Atukorale, Vajini; Soto, Jackeline; Eichelberger, Maryna C; Gao, Jin; Wang, Wei; Weiss, Carol D; Weir, Jerry P
2018-03-29
Influenza subtypes such as H7 have pandemic potential since they are able to infect humans with severe consequences, as evidenced by the ongoing H7N9 infections in China that began in 2013. The diversity of H7 viruses calls for a broadly cross-protective vaccine for protection. We describe the construction of recombinant modified vaccinia virus Ankara (MVA) vectors expressing the hemagglutinin (HA) or neuraminidase (NA) from three H7 viruses representing both Eurasian and North American H7 lineages - A/mallard/Netherlands/12/2000 (H7N3), A/Canada/rv444/2004 (H7N3), and A/Shanghai/02/2013 (H7N9). These vectors were evaluated for immunogenicity and protective efficacy against H7N3 virus in a murine model of intranasal challenge. High levels of H7-, N3-, and N9-specific antibodies, including neutralizing antibodies, were induced by the MVA-HA and MVA-NA vectors. Mice vaccinated with MVA vectors expressing any of the H7 antigens were protected, suggesting cross-protection among H7 viruses. In addition, MVA vectors expressing N3 but not N9 elicited protection against H7N3 virus challenge. Similar outcomes were obtained when immune sera from MVA vector-immunized mice were passively transferred to naïve mice prior to challenge with the H7N3 virus. The results support the further development of an MVA vector platform as a candidate vaccine for influenza strains with pandemic potential.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Geller, A.I.; Keyomarsi, K.; Bryan, J.
1990-11-01
The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli {beta}-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; tsmore » mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses {beta}-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system.« less
Fowl adenovirus serotype 9 vectored vaccine for protection of avian influenza virus
USDA-ARS?s Scientific Manuscript database
A fowl adenovirus serotype 9, a non-pathogenic large double stranded DNA virus, was developed as a viral vector to express influenza genes as a potential vaccine. Two separate constructs were developed that expressed either the hemagglutinin gene of A/Chicken/Jalisco/2012 (H7) or A/ Chicken/Iowa/20...
Zhang, Jie; Deng, Yifeng; Ma, Huijie; Hou, Jiafa; Zhou, ZhenLei
2015-03-01
Ca2+ plays a major role in the regulation of signal transduction. Transient receptor potential vanilloid 6 is a Ca2+-selective channel that serves as an important rate-limiting step in the facilitation of Ca2+ entry into cells, but little is known about the regulation of transient receptor potential vanilloid 6 in chickens. In this study, we evaluated the effects of transient receptor potential vanilloid 6 gene interference on the expression of calbindin-D28K, Na+/Ca2+ exchangers, and plasma membrane Ca2+ ATPase 1b to investigate the mechanism underlying the regulation of transient receptor potential vanilloid 6. Three hairpin siRNA expression vectors targeting transient receptor potential vanilloid 6 (pSIREN- transient receptor potential vanilloid 6) and a negative control (pSIREN-control) were constructed and transfected into chicken osteoblasts. The mRNA and protein expression levels were evaluated by quantitative reverse transcription polymerase chain reaction and Western blot, respectively. The mRNA expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 45.7% (P<0.01) and 27.9% (P<0.01), respectively, 48 h after transfection with one of the three constructs (pSIREN- transient receptor potential vanilloid 6-3) compared with the level obtained in the untreated group. There was no significant difference in the mRNA expression levels of Na+/Ca2+ exchangers and plasma membrane Ca2+ ATPase 1b. The protein expression levels of transient receptor potential vanilloid 6 and calbindin-D28K were reduced by 40.2% (P<0.01) and 29.8% (P<0.01), respectively, 48 h after transfection with pSIREN-transient receptor potential vanilloid 6-3 compared with the level obtained in the untreated group. In conclusion, the vector-based transient receptor potential vanilloid 6-shRNA can efficiently suppress the mRNA and protein expression of transient receptor potential vanilloid 6 in chicken osteoblasts, and transient receptor potential vanilloid 6 regulates the expression of calbindin-D28K during Ca2+ transport. © 2015 Poultry Science Association Inc.
Bengtsson, Niclas E.; Hall, John K.; Odom, Guy L.; Phelps, Michael P.; Andrus, Colin R.; Hawkins, R. David; Hauschka, Stephen D.; Chamberlain, Joel R.; Chamberlain, Jeffrey S.
2017-01-01
Gene replacement therapies utilizing adeno-associated viral (AAV) vectors hold great promise for treating Duchenne muscular dystrophy (DMD). A related approach uses AAV vectors to edit specific regions of the DMD gene using CRISPR/Cas9. Here we develop multiple approaches for editing the mutation in dystrophic mdx4cv mice using single and dual AAV vector delivery of a muscle-specific Cas9 cassette together with single-guide RNA cassettes and, in one approach, a dystrophin homology region to fully correct the mutation. Muscle-restricted Cas9 expression enables direct editing of the mutation, multi-exon deletion or complete gene correction via homologous recombination in myogenic cells. Treated muscles express dystrophin in up to 70% of the myogenic area and increased force generation following intramuscular delivery. Furthermore, systemic administration of the vectors results in widespread expression of dystrophin in both skeletal and cardiac muscles. Our results demonstrate that AAV-mediated muscle-specific gene editing has significant potential for therapy of neuromuscular disorders. PMID:28195574
Zhu, Lijuan; Liao, Wenjun; Zhu, Huifen; Lei, Ping; Wang, Zhihua; Shao, Jingfang; Zhang, Yue; Shen, Guanxin
2006-01-01
The expression vector of SmIg scFv fragment was constructed in patient with B cell chronic lymphocyte leukemia (B-CLL) and expressed in E. coli to obtain scFv fragment, and the effect of the protein on the proliferation of stimulated peripheral blood mononuclear cells (PBMC) was investigated in vitro. Two pairs of primers were designed, and variable region genes of light chain and heavy chain were amplified by PCR respectively from the pGEM-T vectors previously constructed in our laboratory which containing light chain gene or Fd fragment of heavy chain gene. The PCR product was digested, purified and inserted into pHEN2 vector to construct the soluble expression vector pHEN2-scFv. After the induction by IPTG, the scFv protein was identified by SDS-PAGE electrophoresis and purified by Ni-NTA-Chromatography. MTT was used to determine the effect of purified protein on the proliferation of stimulated PBMC in vitro. Plasmid PCR and restriction enzyme digestion of pHEN2-scFv revealed the pHEN2-scFv vector was constructed successfully. Id-scFv protein was expressed in positive clone after induced by IPTG. SDS-PAGE analysis showed that the relative molecular weight of fusion protein was about 30 kD (1 kD= 0.9921 ku), which was consistent with the theoretically predicted value. Proliferation of PBMC could be induced by purified Id-scFv. It was suggested that the expression vector of SmIg scFv fragment was constructed successfully, and scFv protein was expressed and secreted from E. coli, which could induce proliferation of PBMC. This may lay an experimental foundation for further research of Id-HSP complex vaccine for B-CLL.
Busch, Robert; Hobbs, Brian D; Zhou, Jin; Castaldi, Peter J; McGeachie, Michael J; Hardin, Megan E; Hawrylkiewicz, Iwona; Sliwinski, Pawel; Yim, Jae-Joon; Kim, Woo Jin; Kim, Deog K; Agusti, Alvar; Make, Barry J; Crapo, James D; Calverley, Peter M; Donner, Claudio F; Lomas, David A; Wouters, Emiel F; Vestbo, Jørgen; Tal-Singer, Ruth; Bakke, Per; Gulsvik, Amund; Litonjua, Augusto A; Sparrow, David; Paré, Peter D; Levy, Robert D; Rennard, Stephen I; Beaty, Terri H; Hokanson, John; Silverman, Edwin K; Cho, Michael H
2017-07-01
The heritability of chronic obstructive pulmonary disease (COPD) cannot be fully explained by recognized genetic risk factors identified as achieving genome-wide significance. In addition, the combined contribution of genetic variation to COPD risk has not been fully explored. We sought to determine: (1) whether studies of variants from previous studies of COPD or lung function in a larger sample could identify additional associated variants, particularly for severe COPD; and (2) the impact of genetic risk scores on COPD. We genotyped 3,346 single-nucleotide polymorphisms (SNPs) in 2,588 cases (1,803 severe COPD) and 1,782 control subjects from four cohorts, and performed association testing with COPD, combining these results with existing genotyping data from 6,633 cases (3,497 severe COPD) and 5,704 control subjects. In addition, we developed genetic risk scores from SNPs associated with lung function and COPD and tested their discriminatory power for COPD-related measures. We identified significant associations between SNPs near PPIC (P = 1.28 × 10 -8 ) and PPP4R4/SERPINA1 (P = 1.01 × 10 -8 ) and severe COPD; the latter association may be driven by recognized variants in SERPINA1. Genetic risk scores based on SNPs previously associated with COPD and lung function had a modest ability to discriminate COPD (area under the curve, ∼0.6), and accounted for a mean 0.9-1.9% lower forced expiratory volume in 1 second percent predicted for each additional risk allele. In a large genetic association analysis, we identified associations with severe COPD near PPIC and SERPINA1. A risk score based on combining genetic variants had modest, but significant, effects on risk of COPD and lung function.
Coronin 3 promotes gastric cancer metastasis via the up-regulation of MMP-9 and cathepsin K.
Ren, Gui; Tian, Qifei; An, Yanxin; Feng, Bin; Lu, Yuanyuan; Liang, Jie; Li, Kai; Shang, Yulong; Nie, Yongzhan; Wang, Xin; Fan, Daiming
2012-09-14
Coronins are a family of highly evolutionary conserved proteins reportedly involved in the regulation of actin cytoskeletal dynamics, although only coronin 3 has been shown to be related to cancer cell migration. In glioblastoma cells, the knockdown of coronin 3 inhibits cell proliferation and invasion. Coronin 3 is also associated with the aggression and metastasis of hepatocellular carcinoma. In this paper, we analyze the migration, invasion and metastasis abilities of gastric cancer cells after up- or down-regulation of coronin 3, and explore the mechanism of coronin 3 in the process of gastric cancer metastasis. The expression of coronin 3 was higher in the highly metastatic sub-cell line MKN28-M, which we established in our laboratory. We also demonstrated that the expression of coronin 3 was remarkably higher in lymph lode metastases than in primary gastric cancer tissues, and over-expression of coronin 3 was correlated with the increased clinical stage and lymph lode metastasis. Recombinant lentiviral vectors encoding shRNAs were designed to down-regulate coronin 3 expression in gastric cancer cell lines. Stable knockdown of coronin 3 by this lentiviral vector could efficiently inhibit the migration and invasion of MKN45 gastric cancer cells. In contrast, up-regulation of coronin 3 significantly enhanced migration and invasion of MKN28-NM cells. In addition, knockdown of coronin 3 significantly reduced liver metastasis in mice after tail vein injection of gastric cancer cells. The Human Tumor Metastasis PCR Array was used to screen the metastasis-associated genes identified by the down-regulation of coronin 3, and the results suggested that, following the knockdown of coronin 3, the tumor cell migration and invasion were inhibited by the reduced expression of MMP-9 and cathepsin K. Coronin 3 is highly expressed in gastric cancer metastases and can promote the metastatic behaviors of gastric cancer cells, including their migration and invasion.
Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei
2005-01-01
To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific immunoreactivity, which can be used as a potential antigen for developing a novel vaccine of L.interrogans.
Zhu, Mingyue; Li, Wei; Lu, Yan; Dong, Xu; Lin, Bo; Chen, Yi; Zhang, Xueer; Guo, Junli; Li, Mengsen
2017-03-15
Hepatitis B virus (HBV)-X protein (HBx) plays critical role in inducing the malignant transformation of liver cells. Alpha fetoprotein (AFP) expression is closely related to hepatocarcinogenesis. We report that Oct4, Klf4, Sox2 and c-myc expression positively associated with AFP(+)/HBV(+) hepatocellular carcinoma(HCC) tissues, and the expression of the stemness markers CD44, CD133 and EpCAM was significantly higher in AFP(+)/HBV(+) HCC tissues compared to normal liver tissues or AFP (-)/HBV(-) HCC tissues. AFP expression turned on prior to expression of Oct4, Klf4, Sox2 and c-myc, and the stemness markers CD44, CD133 and EpCAM in the normal human liver L-02 cell line or CHL cell lines upon transfection with MCV-HBx vectors. Stem-like cells generated more tumour colonies compared to primary cells, and xenografts induced tumourigenesis in nude mice. Expression of reprogramming-related proteins was significantly enhanced in HLE cells while transfected with pcDNA3.1-afp vectors. The specific PI3K inhibitor Ly294002 inhibited the effects of pcDNA3.1-afp vectors. AFP-siRNA vectors were able to inhibit tumour colony formation and reprogramming-related gene expression. Altogether, HBx stimulates AFP expression to induce natural reprogramming of liver cells, and AFP plays a critical role in promoting the initiation of HCC progenitor/stem cells. AFP may be a potential novel biotarget for combating HBV-induced hepatocarcinogenesis. © 2016 UICC.
CRISPR/Cas9 delivery with one single adenoviral vector devoid of all viral genes.
Ehrke-Schulz, Eric; Schiwon, Maren; Leitner, Theo; Dávid, Stephan; Bergmann, Thorsten; Liu, Jing; Ehrhardt, Anja
2017-12-07
The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system revolutionized the field of gene editing but viral delivery of the CRISPR/Cas9 system has not been fully explored. Here we adapted clinically relevant high-capacity adenoviral vectors (HCAdV) devoid of all viral genes for the delivery of the CRISPR/Cas9 machinery using a single viral vector. We present a platform enabling fast transfer of the Cas9 gene and gRNA expression units into the HCAdV genome including the option to choose between constitutive or inducible Cas9 expression and gRNA multiplexing. Efficacy and versatility of this pipeline was exemplified by producing different CRISPR/Cas9-HCAdV targeting the human papillomavirus (HPV) 18 oncogene E6, the dystrophin gene causing Duchenne muscular dystrophy (DMD) and the HIV co-receptor C-C chemokine receptor type 5 (CCR5). All CRISPR/Cas9-HCAdV proved to be efficient to deliver the respective CRISPR/Cas9 expression units and to introduce the desired DNA double strand breaks at their intended target sites in immortalized and primary cells.
Wang, Wan; Knosp, Engelbert; Tai, Guixiang; Zhao, Yuanzheng; Liang, Qianlei; Guo, Yongchuan
2014-01-01
To detect the effects of 17β-estradiol (E2) on the expression of calbindin-D9k (CaBP-9k) in pituitary GH3 cells, and to determine the antagonistic effect of a selective estrogen receptor (ER) antagonist (ICI 182 780) on CaBP-9k expression. A rat pituitary prolactinoma cell line (GH3 cells) was used in an in vitro model. The localization of CaBP-9k in GH3 cells was observed by immunofluorescence. GH3 cells were cultured with the addition of E2 medium for 24 hours. The levels of CaBP-9k mRNA and protein expression in different groups were analyzed by RT-PCR and Western blot analysis. The ER antagonist, ICI 182 780, was added to GH3 cells before E2 (10(-8) M) at a concentration of 10(-6) M to investigate the regulation of an ER-mediated pathway on CaBP-9k expression. E2 had a stimulatory effect on CaBP-9k expression of GH3 cells in a dose-dependent manner; the level of CaBP-9k expression was higher when treated with a higher concentration of E2. ICI 182 780 suppressed the stimulatory effect of E2 on CaBP-9k expression in GH3 cells. The level of CaBP-9k expression was significantly reduced by co-administration of E2 with ICI 182 780 in GH3 cells. The immunoprecipitation results confirmed that CaBP-9k interacts directly with ERα, and E2 increases the interaction between CaBP-9k and ERα. Estrogen induces CaBP-9k expression via an ERα-mediated pathway and CaBP-9k directly combines with ERα, suggesting that CaBP-9k is involved in the biological effects mediated by an ER pathway in GH3 cells.
Subpial Adeno-associated Virus 9 (AAV9) Vector Delivery in Adult Mice.
Tadokoro, Takahiro; Miyanohara, Atsushi; Navarro, Michael; Kamizato, Kota; Juhas, Stefan; Juhasova, Jana; Marsala, Silvia; Platoshyn, Oleksandr; Curtis, Erik; Gabel, Brandon; Ciacci, Joseph; Lukacova, Nada; Bimbova, Katarina; Marsala, Martin
2017-07-13
The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. Using subpially-placed polyethylene catheters (PE-10 or PE-5) for AAV9 delivery, potent transgene expression through the spinal parenchyma (white and gray matter) in subpially-injected spinal segments has been demonstrated. Because of the wide range of transgenic mouse models of neurodegenerative diseases, there is a strong desire for the development of a potent central nervous system (CNS)-targeted vector delivery technique in adult mice. Accordingly, the present study describes the development of a spinal subpial vector delivery device and technique to permit safe and effective spinal AAV9 delivery in adult C57BL/6J mice. In spinally immobilized and anesthetized mice, the pia mater (cervical 1 and lumbar 1-2 spinal segmental level) was incised with a sharp 34 G needle using an XYZ manipulator. A second XYZ manipulator was then used to advance a blunt 36G needle into the lumbar and/or cervical subpial space. The AAV9 vector (3-5 µL; 1.2 x 10 13 genome copies (gc)) encoding green fluorescent protein (GFP) was then injected subpially. After injections, neurological function (motor and sensory) was assessed periodically, and animals were perfusion-fixed 14 days after AAV9 delivery with 4% paraformaldehyde. Analysis of horizontal or transverse spinal cord sections showed transgene expression throughout the entire spinal cord, in both gray and white matter. In addition, intense retrogradely-mediated GFP expression was seen in the descending motor axons and neurons in the motor cortex, nucleus ruber, and formatio reticularis. No neurological dysfunction was noted in any animals. These data show that the subpial vector delivery technique can successfully be used in adult mice, without causing procedure-related spinal cord injury, and is associated with highly potent transgene expression throughout the spinal neuraxis.
Kishi, Luciano Takeshi; Carmona, Adriana Karaoglanovic; Alves, Marcio Fernando Madureira; Belasque-Júnior, Jose; Rosa, José César; Hunter, Wayne Brian; Henrique-Silva, Flávio; Soares-Costa, Andrea
2015-01-01
Huanglonbing (HLB) is one of the most destructive disease affecting citrus plants. The causal agent is associated with the phloem-limited bacterium Candidatus Liberibacter asiaticus (CLas) and the psyllid Diaphorina citri, vector of disease, that transmits the bacterium associated with HLB. The control of disease can be achieved by suppressing either the bacterium or the vector. Among the control strategies for HLB disease, one of the widely used consists in controlling the enzymes of the disease vector, Diaphorina citri. The insect Diaphorina citri belongs to the order Hemiptera, which frequently have cysteine peptidases in the gut. The importance of this class of enzymes led us to search for enzymes in the D. citri transcriptome for the establishment of alternatives strategies for HLB control. In this study, we reported the identification and characterization of a cathepsin B-like cysteine peptidase from D. citri (DCcathB). DCcathB was recombinantly expressed in Pichia pastoris, presenting a molecular mass of approximately 50 kDa. The enzyme hydrolyzed the fluorogenic substrate Z-F-R-AMC (K m = 23.5 μM) and the selective substrate for cathepsin B, Z-R-R-AMC (K m = 6.13 μM). The recombinant enzyme was inhibited by the cysteine protease inhibitors E64 (IC50 = 0.014 μM) and CaneCPI-4 (Ki = 0.05 nM) and by the selective cathepsin B inhibitor CA-074 (IC50 = 0.095 nM). RT-qPCR analysis revealed that the expression of the DCcathB in nymph and adult was approximately 9-fold greater than in egg. Moreover, the expression of this enzyme in the gut was 175-fold and 3333-fold higher than in the remaining tissues and in the head, respectively, suggesting that DCcathB can be a target for HLB control. PMID:26717484
Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dunn, J.J.; Barbour, A.G.
1996-11-05
A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface proteinmore » A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.« less
Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7
Dunn, John J.; Barbour, Alan G.
1996-11-05
A method is provided herein for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed.
Cloning and expression of soluble truncated variants of Borrelia OspA, OspB and Vmp7
Dunn, J.J.; Barbour, A.G.
1996-11-05
A method is provided for preparing soluble recombinant variations of Borrelia lipoproteins such as Borrelia burgdorferi outer surface protein A (OspA) and outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The method includes synthesizing a set of oligonucleotide primers, amplifying the template DNA utilizing the PCR, purifying the amplification products, cloning the amplification products into a suitable expression vector, transforming a suitable host utilizing the cloned expression vector, cultivating the transformed host for protein production and subsequently isolating and purifying the resulting protein. Also provided are soluble, recombinant variations of Borrelia burgdorferi outer surface protein A (OspA), outer surface protein B (OspB), and B. hermsii variable major protein 7 (Vmp7). The expression vectors harboring DNA encoding the recombinant variations, pET9-OspA, pET9-OspB and pET9-Vmp7, as well as the E. coli host BL21(DE3)/pLysS transformed with each of these vectors, are also disclosed. 38 figs.
Analysis of miRNA expression profile based on SVM algorithm
NASA Astrophysics Data System (ADS)
Ting-ting, Dai; Chang-ji, Shan; Yan-shou, Dong; Yi-duo, Bian
2018-05-01
Based on mirna expression spectrum data set, a new data mining algorithm - tSVM - KNN (t statistic with support vector machine - k nearest neighbor) is proposed. the idea of the algorithm is: firstly, the feature selection of the data set is carried out by the unified measurement method; Secondly, SVM - KNN algorithm, which combines support vector machine (SVM) and k - nearest neighbor (k - nearest neighbor) is used as classifier. Simulation results show that SVM - KNN algorithm has better classification ability than SVM and KNN alone. Tsvm - KNN algorithm only needs 5 mirnas to obtain 96.08 % classification accuracy in terms of the number of mirna " tags" and recognition accuracy. compared with similar algorithms, tsvm - KNN algorithm has obvious advantages.
Intracellular trehalose via transporter TRET1 as a method to cryoprotect CHO-K1 cells.
Uchida, Tsutomu; Furukawa, Maho; Kikawada, Takahiro; Yamazaki, Kenji; Gohara, Kazutoshi
2017-08-01
Trehalose is a promising natural cryoprotectant, but its cryoprotective effect is limited due to difficulties in transmembrane transport. Thus, expressing the trehalose transporter TRET1 on various mammalian cells may yield more trehalose applications. In this study, we ran comparative cryopreservation experiments between the TRET1-expressing CHO-K1 cells (CHO-TRET1) and the CHO-K1 cells transfected with an empty vector (CHO-vector). The experiments involve freezing under various trehalose concentrations in an extracellular medium. The freeze-thawing viabilities of CHO-TRET1 cells are higher than those of CHO-vector cells for most freezing conditions. This result differs from control experiments with a transmembrane type cryoprotectant, dimethyl sulfoxide (Me 2 SO), which had similar viabilities in each condition for both cell types. We conclude that the trehalose loaded into the cells with TRET1 significantly improves the cryoprotective effect. The higher viabilities occurred when the extracellular trehalose concentration exceeded 200 mM, with 250-500 mM being optimal, and a cooling rate below 30 K/min, with 5-20 K/min being optimal. Copyright © 2017 Elsevier Inc. All rights reserved.
Barese, Cecilia N.; Felizardo, Tania C.; Sellers, Stephanie E.; Keyvanfar, Keyvan; Di Stasi, Antonio; Metzger, Mark E.; Krouse, Allen E.; Donahue, Robert E.; Spencer, David M.; Dunbar, Cynthia E.
2014-01-01
The high risk of insertional oncogenesis reported in clinical trials utilizing integrating retroviral vectors to genetically-modify hematopoietic stem and progenitor cells (HSPC) requires the development of safety strategies to minimize risks associated with novel cell and gene therapies. The ability to ablate genetically modified cells in vivo is desirable, should an abnormal clone emerge. Inclusion of “suicide genes” in vectors to facilitate targeted ablation of vector-containing abnormal clones in vivo is one potential safety approach. We tested whether the inclusion of the “inducible Caspase-9” (iCasp9) suicide gene in a gamma-retroviral vector facilitated efficient elimination of vector-containing HSPCs and their hematopoietic progeny in vivo long-term, in an autologous non-human primate transplantation model. Following stable engraftment of iCasp9 expressing hematopoietic cells in rhesus macaques, administration of AP1903, a chemical inducer of dimerization able to activate iCasp9, specifically eliminated vector-containing cells in all hematopoietic lineages long-term, suggesting activity at the HSPC level. Between 75–94% of vector-containing cells were eliminated by well-tolerated AP1903 dosing, but lack of complete ablation was linked to lower iCasp9 expression in residual cells. Further investigation of resistance mechanisms demonstrated upregulation of Bcl-2 in hematopoietic cell lines transduced with the vector and resistant to AP1903 ablation. These results demonstrate both the potential and the limitations of safety approaches utilizing iCasp9 to HSPC-targeted gene therapy settings, in a model with great relevance to clinical development. PMID:25330775
Oh, Tae-Kyun; Oh, Sung; Kim, Seongdae; Park, Jae Sung; Vinod, Nagarajan; Jang, Kyung Min; Kim, Sei Chang; Choi, Chang Won; Ko, Suk-Min; Jeong, Dong Kee; Udayakumar, Rajangam
2014-01-01
A full-length phytase gene (phy) of Aspergillus nidulans was amplified from the cDNA library by polymerase chain reaction (PCR), and it was introduced into a bacterial expression vector, pET-28a. The recombinant protein (rPhy-E, 56 kDa) was overexpressed in the insoluble fraction of Escherichia coli culture, purified by Ni-NTA resin under denaturing conditions and injected into rats as an immunogen. To express A. nidulans phytase in a plant, the full-length of phy was cloned into a plant expression binary vector, pPZP212. The resultant construct was tested for its transient expression by Agrobacterium-infiltration into Nicotiana benthamiana leaves. Compared with a control, the agro-infiltrated leaf tissues showed the presence of phy mRNA and its high expression level in N. benthamiana. The recombinant phytase (rPhy-P, 62 kDa) was strongly reacted with the polyclonal antibody against the nonglycosylated rPhy-E. The rPhy-P showed glycosylation, two pH optima (pH 4.5 and pH 5.5), an optimum temperature at 45~55 °C, thermostability and broad substrate specificities. After deglycosylation by peptide-N-glycosidase F (PNGase-F), the rPhy-P significantly lost the phytase activity and retained 1/9 of the original activity after 10 min of incubation at 45 °C. Therefore, the deglycosylation caused a significant reduction in enzyme thermostability. In animal experiments, oral administration of the rPhy-P at 1500 U/kg body weight/day for seven days caused a significant reduction of phosphorus excretion by 16% in rat feces. Besides, the rPhy-P did not result in any toxicological changes and clinical signs. PMID:25192284
Li, Binbin; Li, Sisi; Yin, Juan; Zhong, Jiang
2013-01-01
Histone H3-lysine9 (H3K9) trimethyltransferase gene Su(var) 3-9 was cloned and identified in three Spodoptera insects, Spodoptera frugiperda ( S . frugiperda ), S . exigua and S . litura . Sequence analysis showed that Spodoptera Su(var) 3-9 is highly conserved evolutionarily. Su(var) 3-9 protein was found to be localized in the nucleus in Sf9 cells, and interact with histone H3, and the heterochromatin protein 1a (HP1a) and HP1b. A dose-dependent enzymatic activity was found at both 27 °C and 37 °C in vitro, with higher activity at 27 °C. Addition of specific inhibitor chaetocin resulted in decreased histone methylation level and host chromatin relaxation. In contrast, overexpression of Su(var) 3-9 caused increased histone methylation level and cellular genome compaction. In AcMNV-infected Sf9 cells, the transcription of Su(var) 3-9 increased at late time of infection, although the mRNA levels of most cellular genes decreased. Pre-treatment of Sf9 cells with chaetocin speeded up viral DNA replication, and increased the transcription level of a variety of virus genes, whereas in Sf9 cells pre-transformed with Su(var) 3-9 expression vector, viral DNA replication slow down slightly. These findings suggest that Su(var) 3-9 might participate in the viral genes expression an genome replication repression during AcMNPV infection. It provided a new insight for the understanding virus–host interaction mechanism. PMID:23894480
Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong
2014-01-01
To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.
Toda, Hiroshi; Itoh, Nobuya
2017-01-01
The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli - Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 ( rhsmo ) and alcohol dehydrogenase gene from Leifsonia sp. S749 ( lsadh ), in K . rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) promotor. The RhSMO-LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent-water biphasic reaction system to efficiently convert styrene into ( S )-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells.
Maia, Lucas de Lima; Peterle, Gabriela Tonini; Dos Santos, Marcelo; Trivilin, Leonardo Oliveira; Mendes, Suzanny Oliveira; de Oliveira, Mayara Mota; Dos Santos, Joaquim Gasparini; Stur, Elaine; Agostini, Lidiane Pignaton; Couto, Cinthia Vidal Monteiro da Silva; Dalbó, Juliana; de Assis, Aricia Leone Evangelista Monteiro; Archanjo, Anderson Barros; Mercante, Ana Maria Da Cunha; Lopez, Rossana Veronica Mendoza; Nunes, Fábio Daumas; de Carvalho, Marcos Brasilino; Tajara, Eloiza Helena; Louro, Iúri Drumond; Álvares-da-Silva, Adriana Madeira
2018-01-01
Jumonji Domain-Containing 1A (JMJD1A) protein promotes demethylation of histones, especially at lysin-9 of di-methylated histone H3 (H3K9me2) or mono-methylated (H3K9me1). Increased levels of H3 histone methylation at lysin-9 (H3K9) is related to tumor suppressor gene silencing. JMJD1A gene target Adrenomeduline (ADM) has shown to promote cell growth and tumorigenesis. JMJD1A and ADM expression, as well as H3K9 methylation level have been related with development risk and prognosis of several tumor types. We aimed to evaluate JMJD1A, ADM, H3K9me1 and H3K9me2expression in paraffin-embedded tissue microarrays from 84 oral and oropharyngeal squamous cell carcinoma samples through immunohistochemistry analysis. Our results showed that nuclear JMJD1A expression was related to lymph node metastasis risk. In addition, JMJD1A cytoplasmic expression was an independent risk marker for advanced tumor stages. H3K9me1 cytoplasmic expression was associated with reduced disease-specific death risk. Furthermore, high H3K9me2 nuclear expression was associated with worse specific-disease and disease-free survival. Finally, high ADM cytoplasmic expression was an independent marker of lymph node metastasis risk. JMJD1A, H3K9me1/2 and ADM expression may be predictor markers of progression and prognosis in oral and oropharynx cancer patients, as well as putative therapeutic targets.
Peterle, Gabriela Tonini; dos Santos, Marcelo; Trivilin, Leonardo Oliveira; Mendes, Suzanny Oliveira; de Oliveira, Mayara Mota; dos Santos, Joaquim Gasparini; Stur, Elaine; Agostini, Lidiane Pignaton; Couto, Cinthia Vidal Monteiro da Silva; Dalbó, Juliana; de Assis, Aricia Leone Evangelista Monteiro; Archanjo, Anderson Barros; Mercante, Ana Maria Da Cunha; Lopez, Rossana Veronica Mendoza; Nunes, Fábio Daumas; de Carvalho, Marcos Brasilino; Tajara, Eloiza Helena; Louro, Iúri Drumond; Álvares-da-Silva, Adriana Madeira
2018-01-01
Aims Jumonji Domain-Containing 1A (JMJD1A) protein promotes demethylation of histones, especially at lysin-9 of di-methylated histone H3 (H3K9me2) or mono-methylated (H3K9me1). Increased levels of H3 histone methylation at lysin-9 (H3K9) is related to tumor suppressor gene silencing. JMJD1A gene target Adrenomeduline (ADM) has shown to promote cell growth and tumorigenesis. JMJD1A and ADM expression, as well as H3K9 methylation level have been related with development risk and prognosis of several tumor types. Methods and results We aimed to evaluate JMJD1A, ADM, H3K9me1 and H3K9me2expression in paraffin-embedded tissue microarrays from 84 oral and oropharyngeal squamous cell carcinoma samples through immunohistochemistry analysis. Our results showed that nuclear JMJD1A expression was related to lymph node metastasis risk. In addition, JMJD1A cytoplasmic expression was an independent risk marker for advanced tumor stages. H3K9me1 cytoplasmic expression was associated with reduced disease-specific death risk. Furthermore, high H3K9me2 nuclear expression was associated with worse specific-disease and disease-free survival. Finally, high ADM cytoplasmic expression was an independent marker of lymph node metastasis risk. Conclusion JMJD1A, H3K9me1/2 and ADM expression may be predictor markers of progression and prognosis in oral and oropharynx cancer patients, as well as putative therapeutic targets. PMID:29590186
Kang, Shin-Young; Kim, Yeon-Gu; Kang, Seunghee; Lee, Hong Weon; Lee, Eun Gyo
2016-05-01
Vectors flanked by regulatory DNA elements have been used to generate stable cell lines with high productivity and transgene stability; however, regulatory elements in Chinese hamster ovary (CHO) cells, which are the most widely used mammalian cells in biopharmaceutical production, are still poorly understood. We isolated a novel gene regulatory element from CHO-K1 cells, designated E77, which was found to enhance the stable expression of a transgene. A genomic library was constructed by combining CHO-K1 genomic DNA fragments with a CMV promoter-driven GFP expression vector, and the E77 element was isolated by screening. The incorporation of the E77 regulatory element resulted in the generation of an increased number of clones with high expression, thereby enhancing the expression level of the transgene in the stable transfectant cell pool. Interestingly, the E77 element was found to consist of two distinct fragments derived from different locations in the CHO genome shotgun sequence. High and stable transgene expression was obtained in transfected CHO cells by combining these fragments. Additionally, the function of E77 was found to be dependent on its site of insertion and specific orientation in the vector construct. Our findings demonstrate that stable gene expression mediated by the CMV promoter in CHO cells may be improved by the isolated novel gene regulatory element E77 identified in the present study. © 2016 The Authors. Biotechnology Journal published by WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference
Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi
2018-01-01
Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933
Joglekar, Alok V; Stein, Libby; Ho, Michelle; Hoban, Megan D; Hollis, Roger P; Kohn, Donald B
2014-07-01
Integrase-defective lentiviral vectors (IDLVs) have been of limited success in the delivery of zinc finger nucleases (ZFNs) to human cells, due to low expression. A reason for reduced gene expression has been proposed to involve the epigenetic silencing of vector genomes, carried out primarily by histone deacetylases (HDACs). In this study, we tested valproic acid (VPA), a known HDAC inhibitor (HDACi), for its ability to increase transgene expression from IDLVs, especially in the context of ZFN delivery. Using ZFNs targeting the human adenosine deaminase (ADA) gene in K562 cells, we demonstrated that treatment with VPA enhanced ZFN expression by up to 3-fold, resulting in improved allelic disruption at the ADA locus. Furthermore, three other U.S. Food and Drug Administration-approved HDACis (vorinostat, givinostat, and trichostatin-A) exhibited a similar effect on the activity of ZFN-IDLVs in K562 cells. In primary human CD34(+) cells, VPA- and vorinostat-treated cells showed higher levels of expression of both green fluorescent protein (GFP) as well as ZFNs from IDLVs. A major mechanism for the effects of HDAC inhibitors on improving expression was from their modulation of the cell cycle, and the influence of heterochromatinization was determined to be a lesser contributing factor.
2014-01-01
Background Although the An. funestus group conceals one of the major malaria vectors in Africa, little is known about the dynamics of members of this group across the continent. Here, we investigated the species composition, infection rate and susceptibility to insecticides of this species group in Uganda. Methods Indoor resting blood-fed Anopheles adult female mosquitoes were collected from 3 districts in Uganda. Mosquitoes morphologically belonging to the An. funestus group were identified to species by PCR. The sporozoite infection rates were determined by TaqMan and a nested PCR. Susceptibility to major insecticides was assessed using WHO bioassays. The potential role of four candidate resistance genes was assessed using qRT-PCR. Results An. funestus s.s. and An. parensis, were the only members of the An. funestus group identified. Both species were sympatric in Masindi (North-West), whereas only An. parensis was present in Mityana (Central) and Ntungamo (South-West). The Plasmodium falciparum infection detected in An. parensis (4.2%) by TaqMan could not be confirmed by nested PCR, whereas the 5.3% infection in An. funestus s.s. was confirmed. An. parensis was susceptible to most insecticides, however, a moderate resistance was observed against deltamethrin and DDT. In the sympatric population of Masindi, resistance was observed to pyrethroids (permethrin and deltamethrin) and DDT, but all the resistant mosquitoes belonged to An. funestus s.s. No significant over-expression was observed for the four P450 candidate genes CYP6M7, CYP9K1, CYP6P9 and CYP6AA4 between deltamethrin resistant and control An. parensis. However, when compared with the susceptible FANG An. funestus s.s strain, the CYP9K1 is significantly over-expressed in An. parensis (15-fold change; P < 0.001), suggesting it could play a role in the deltamethrin resistance. Conclusion The contrasting infection rates and insecticide susceptibility profiles of both species highlights the importance of accurate species identification for successful vector control programs. PMID:24533773
K π vector form factor, dispersive constraints and τ→ ν τ K π decays
NASA Astrophysics Data System (ADS)
Boito, Diogo R.; Escribano, Rafel; Jamin, Matthias
2009-02-01
Recent experimental data for the differential decay distribution of the decay τ -→ ν τ K S π - by the Belle collaboration are described by a theoretical model which is composed of the contributing vector and scalar form factors F {+/ K π }( s) and F {0/ K π }( s). Both form factors are constructed such that they fulfil constraints posed by analyticity and unitarity. A good description of the experimental measurement is achieved by incorporating two vector resonances and working with a three-times-subtracted dispersion relation in order to suppress higher-energy contributions. The resonance parameters of the charged K *(892) meson, defined as the pole of F {+/ K π }( s) in the complex s-plane, can be extracted, with the result M_{K^{*}}=892.0± 0.9 MeV and \\varGamma_{K^{*}}=46.2± 0.4 MeV . Finally, employing a three-times-subtracted dispersion relation allows one to determine the slope and curvature parameters λ'+=(24.7±0.8)×10-3 and λ″+=(12.0±0.2)×10-4 of the vector form factor F {+/ K π }( s) directly from the data.
Enhancers Are Major Targets for Murine Leukemia Virus Vector Integration
De Ravin, Suk See; Su, Ling; Theobald, Narda; Choi, Uimook; Macpherson, Janet L.; Poidinger, Michael; Symonds, Geoff; Pond, Susan M.; Ferris, Andrea L.; Hughes, Stephen H.
2014-01-01
ABSTRACT Retroviral vectors have been used in successful gene therapies. However, in some patients, insertional mutagenesis led to leukemia or myelodysplasia. Both the strong promoter/enhancer elements in the long terminal repeats (LTRs) of murine leukemia virus (MLV)-based vectors and the vector-specific integration site preferences played an important role in these adverse clinical events. MLV integration is known to prefer regions in or near transcription start sites (TSS). Recently, BET family proteins were shown to be the major cellular proteins responsible for targeting MLV integration. Although MLV integration sites are significantly enriched at TSS, only a small fraction of the MLV integration sites (<15%) occur in this region. To resolve this apparent discrepancy, we created a high-resolution genome-wide integration map of more than one million integration sites from CD34+ hematopoietic stem cells transduced with a clinically relevant MLV-based vector. The integration sites form ∼60,000 tight clusters. These clusters comprise ∼1.9% of the genome. The vast majority (87%) of the integration sites are located within histone H3K4me1 islands, a hallmark of enhancers. The majority of these clusters also have H3K27ac histone modifications, which mark active enhancers. The enhancers of some oncogenes, including LMO2, are highly preferred targets for integration without in vivo selection. IMPORTANCE We show that active enhancer regions are the major targets for MLV integration; this means that MLV preferentially integrates in regions that are favorable for viral gene expression in a variety of cell types. The results provide insights for MLV integration target site selection and also explain the high risk of insertional mutagenesis that is associated with gene therapy trials using MLV vectors. PMID:24501411
Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S
2017-04-01
Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.
Jia, Yu; Wei, Yuan-Yu; Zhang, Fan; Li, Zhao-Bo; Liu, Shuai; Yue, Bao-Hong
2014-02-01
This study was purpose to explore the down-regulatory effect of nucleostemin (NS) expression on signal molecules of PI3K/AKT/mTOR pathway belonged to candidate ways of p53-independent signal pathway in the leukemia cells. The expression of NS was interfered by using recombinant lentivirus expression vector NS-RNAi-GV248 to transfect HL-60 cells of p53 deficiency. The expression of NS and signal molecules of PI3K/AKT/mTOR pathway were detected by using Real-time PCR. The results of showed that the HL-60 cells were transfected by recombinant lentivirus vector NS-RNAi-GV248 successfully and with transfection rate up to 80%. According to results of Real-time PCR detection, the inhibition rate of NS gene was 56.5% in HL-60 cells. And the expression levels of PI3K,AKT and GβL mRNA (0.491 ± 0.084,0.398 ± 0.164, 0.472 ± 0.097 respectively) were obviously down-regulated by silencing NS, and showed statistical difference (P < 0.05) in comparison with control (1.002 ± 0.171, 1.000 ± 0.411, 1.001 ± 0.206 respectively) . It is concluded that the changes of signal molecules of PI3K/AKT/mTOR pathway positively correlate with NS down-regulation, which provides evidence for confirming PI3K/AKT/mTOR signal pathway possible as a type of NS p53-independent pathway.
Krisinger, J; Jeung, E B; Simmen, R C; Leung, P C
1995-01-01
The expression of Calbindin-D9k (CaBP-9k) in the pig uterus and placenta was measured by Northern blot analysis and reverse transcription polymerase chain reaction (PCR), respectively. Progesterone (P4) administration to ovariectomized pigs decreased CaBP-9k mRNA levels. Expression of endometrial CaBP-9k mRNA was high on pregnancy Days 10-12 and below the detection limit on Days 15 and 18. On Day 60, expression could be detected at low levels. In myometrium and placenta, CaBP-9k mRNA expression was not detectable by Northern analysis using total RNA. Reverse-transcribed RNA from both tissues demonstrated the presence of CaBP-9k transcripts by means of PCR. The partial CaBP-9k gene was amplified by PCR and cloned to determine the sequence of intron A. In contrast to the rat CaBP-9k gene, the pig gene does not contain a functional estrogen response element (ERE) within this region. A similar ERE-like sequence located at the identical location was examined by gel retardation analysis and failed to bind the estradiol receptor. A similar disruption of this ERE-like sequence has been described in the human CaBP-9k gene, which is not expressed at any level in placenta, myometrium, or endometrium. It is concluded that the pig CaBP-9k gene is regulated in these reproductive tissues in a manner distinct from that in rat and human tissues. The regulation is probably due to a regulatory region outside of intron A, which in the rat gene contains the key cis element for uterine expression of the CaBP-9k gene.
Quasi Three-Body Decay of D Meson
NASA Astrophysics Data System (ADS)
Estabar, T.; Mehraban, H.
2018-04-01
The aim of this work is to provide a phenomenological analysis of the contribution of D 0 meson to {\\bar{K}}* {(892)}0{π }+{π }-({\\bar{K}}* {(892)}0\\to {π }+{K}-), K ‑ π + ω (ω → π + π ‑ π 0) and K ‑ π + ø (ø(1020) → K+ K ‑) quasi-three-body decays. The analysis of mentioned multi-body decays is such as to factorize into the three-body decay and several channels observed. Hadronic three-body decays receive both resonant and non-resonant contribution. Based on the factorization method, there are tree and emission annihilation diagrams for these decay modes. In the case of D 0 to vector pseudoscalar states appeared in factored terms, the matrix elements of the vector and axial vector currents between the D 0 and PV mesons can be computed by using D *+ pole. Considering the non-resonant and resonant amplitude in our computation, the theoretical values of the branching ratio are (9.78±0.46)×10‑3, (2.74±0.17)×10‑2, and (3.53±0.23)×10‑5, while the experimental results of them are (9.9±2.3)×10‑3, (2.7±0.5)×10‑2, and (4±1.7)×10‑5 respectively. Comparing computational analysis values with experimental values show that our results are in approximately agreement with them.
Chen, Bao-an; Mao, Pei-pei; Cheng, Jian; Gao, Feng; Xia, Guo-hua; Xu, Wen-lin; Shen, Hui-lin; Ding, Jia-hua; Gao, Chong; Sun, Qian; Chen, Wen-ji; Chen, Ning-na; Liu, Li-jie; Li, Xiao-mao; Wang, Xue-mei
2010-08-09
In many instances, multidrug resistance (MDR) is mediated by increasing the expression at the cell surface of the MDR1 gene product, P-glycoprotein (P-gp), a 170-kD energy-dependent efflux pump. The aim of this study was to investigate the potential benefit of combination therapy with magnetic Fe(3)O(4) nanoparticle [MNP (Fe(3)O(4))] and MDR1 shRNA expression vector in K562/A02 cells. For stable reversal of "classical" MDR by short hairpin RNA (shRNA) aiming directly at the target sequence (3491-3509, 1539-1557, and 3103-3121 nucleotide) of MDR1 mRNA. PGC silencer-U6-neo-GFP-shRNA/MDR1 called PGY1-1, PGY1-2, and PGY1-3 were constructed and transfected into K562/A02 cells by lipofectamine 2000. After transfected and incubated with or without MNP (Fe(3)O(4)) for 48 hours, the transcription of MDR1 mRNA and the expression of P-gp were detected by quantitative real-time PCR and Western-blot assay respectively. Meanwhile intracellular concentration of DNR in K562/A02 cells was detected by flow cytometry (FCM). PGC silencer-U6-neo-GFP-shRNA/MDR1 was successfully constructed, which was confirmed by sequencing and PGY1-2 had the greatest MDR1 gene inhibitory ratio. Analysis of the reversal ratio of MDR, the concentration of daunorubicin (DNR) and the transcription of MDR1 gene and expression of P-gp in K562/A02 showed that combination of DNR with either MNP (Fe(3)O(4)) or PGY1-2 exerted a potent cytotoxic effect on K562/A02 cells, while combination of MNP (Fe(3)O(4)) and PGY1-2 could synergistically reverse multidrug resistance. Thus our in vitro data strongly suggested that a combination of MNP (Fe(3)O(4)) and shRNA expression vector might be a more sufficient and less toxic anti-MDR method on leukemia.
Overexpression of SASH1 related to the decreased invasion ability of human glioma U251 cells.
Yang, Liu; Liu, Mei; Gu, Zhikai; Chen, Jianguo; Yan, Yaohua; Li, Jian
2012-12-01
The purpose of this study was to investigate the impact of SAM- and SH3-domain containing 1 (SASH1) on the biological behavior of glioma cells, including its effects on cellular growth, proliferation, apoptosis, invasion, and metastasis, and thereby to provide an experimental basis for future therapeutic treatments. A pcDNA3.1-SASH1 eukaryotic expression vector was constructed and transfected into the U251 human glioma cell line. Using the tetrazolium-based colorimetric (MTT) assay, flow cytometry analyses, transwell invasion chamber experiments, and other methods, we examined the impact of SASH1 on the biological behaviors of U251 cells, including effects on viability, cell cycle, apoptosis, and invasion. Furthermore, the effect of SASH1 on the expression of cyclin D1, caspase-3, matrix metalloproteinase (MMP)-2, MMP-9, and other proteins was observed. Compared to the empty vector and blank control groups, the pcDNA3.1-SASH1 group of U251 cells exhibited significantly reduced cell viability, proliferation, and invasion (p < 0.05), although there was no difference between the empty vector and blank control groups. The pcDNA3.1-SASH1 group demonstrated a significantly higher apoptotic index than did the empty vector and blank control groups (p < 0.05), and the percentage of apoptotic cells was similar between the empty vector and blank control groups. In addition, the pcDNA3.1-SASH1 group expressed significantly lower protein levels of cyclin D1 and MMP-2/9 compared to the control and empty vector groups (p < 0.05) and significantly higher protein levels of caspase-3 than the other two groups (p < 0.05). Cyclin D1, caspase-3, and MMP-2/9 expression was unchanged between the empty vector and blank control groups. SASH1 gene expression might be related to the inhibition of the growth, proliferation, and invasion of U251 cells and the promotion of U251 cells apoptosis.
Arsenic silences hepatic PDK4 expression through activation of histone H3K9 methylatransferase G9a
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Xi; Wu, Jianguo; Choiniere, Jonathan
It is well established that increased liver cancer incidence is strongly associated with epigenetic silencing of tumor suppressor genes; the latter is contributed by the environmental exposure to arsenic. Pyruvate dehydrogenase kinase 4 (PDK4) is a mitochondrial protein that regulates the TCA cycle. However, the epigenetic mechanisms mediated by arsenic to control PDK4 expression remain elusive. In the present study, we showed that histone methyltransferase G9a- and Suv39H-mediated histone H3 lysine 9 (H3K9) methylations contributed to PDK4 silencing in hepatic cells. The PDK4 expression was induced by G9a inhibitor BRD4770 (BRD) and Suv39H inhibitor Chaetocin (CHA). In contrast, arsenic exposuremore » decreased PDK4 expression by inducing G9a and increasing H3K9 di- and tri-methylations levels (H3K9me2/3). In addition, arsenic exposure antagonizes the effect of BRD by enhancing the enrichment of H3K9me2/3 in the PKD4 promoter. Moreover, knockdown of G9a using siRNA induced PDK4 expression in HCC cells. Furthermore, arsenic decreased hepatic PDK4 expression as well as diminished the induction of PDK4 by BRD in mouse liver and hepatocytes. Overall, the results suggest that arsenic causes aberrant repressive histone modification to silence PDK4 in both HCC cells and in mouse liver. - Graphical abstract: Schematic showing arsenic-mediated epigenetic pathway that inhibits PDK4 expression. (A) BRD induces PDK4 expression by decreasing G9a protein and histone H3K9me2 and H3K9me3 levels as well as diminishing their recruitment to the PDK4 promoter. (B) Arsenic counteracts the effect of BRD by increasing histone H3K9me2 and H3K9me3 levels as well as enhancing their enrichment to the PDK4 promoter. Display Omitted - Highlights: • Histone methyltrasferase G9a inhibitor BRD induces PDK4 expression. • Arsenic decreases PDK4 expression and increases H3K9me2 and me3 levels. • Arsenic enhances H3K9me2/me3 enrichment in the PDK4 promoter. • Arsenic antagonizes the activation of PDK4 by BRD.« less
Education for International Competence in Pennsylvania.
ERIC Educational Resources Information Center
Dinniman, Andrew, Ed.; Holzner, Burkart, Ed.
This book discusses international education and the emergence of Pennsylvania's Partnership for International Competence (PPIC), a partnership that evolved to guarantee that Pennsylvania remains a major actor in the world economy. Individuals from the corporate, labor, educational, and government sectors contributed articles to the areas of…
Gerits, Annelies; Vancraeyenest, Pascaline; Vreysen, Samme; Laramée, Marie-Eve; Michiels, Annelies; Gijsbers, Rik; Van den Haute, Chris; Moons, Lieve; Debyser, Zeger; Baekelandt, Veerle; Arckens, Lutgarde; Vanduffel, Wim
2015-01-01
Abstract. Viral vector-mediated expression of genes (e.g., coding for opsins and designer receptors) has grown increasingly popular. Cell-type specific expression is achieved by altering viral vector tropism through crosspackaging or by cell-specific promoters driving gene expression. Detailed information about transduction properties of most recombinant adeno-associated viral vector (rAAV) serotypes in macaque cortex is gradually becoming available. Here, we compare transduction efficiencies and expression patterns of reporter genes in two macaque neocortical areas employing different rAAV serotypes and promoters. A short version of the calmodulin-kinase-II (CaMKIIα0.4) promoter resulted in reporter gene expression in cortical neurons for all tested rAAVs, albeit with different efficiencies for spread: rAAV2/5>>rAAV2/7>rAAV2/8>rAAV2/9>>rAAV2/1 and proportion of transduced cells: rAAV2/1>rAAV2/5>rAAV2/7=rAAV2/9>rAAV2/8. In contrast to rodent studies, the cytomegalovirus (CMV) promoter appeared least efficient in macaque cortex. The human synapsin-1 promoter preceded by the CMV enhancer (enhSyn1) produced homogeneous reporter gene expression across all layers, while two variants of the CaMKIIα promoter resulted in different laminar transduction patterns and cell specificities. Finally, differences in expression patterns were observed when the same viral vector was injected in two neocortical areas. Our results corroborate previous findings that reporter-gene expression patterns and efficiency of rAAV transduction depend on serotype, promoter, cortical layer, and area. PMID:26839901
Toda, Hiroshi; Itoh, Nobuya
2017-01-01
The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli–Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 (rhsmo) and alcohol dehydrogenase gene from Leifsonia sp. S749 (lsadh), in K. rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase (gapdh) promotor. The RhSMO–LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent–water biphasic reaction system to efficiently convert styrene into (S)-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells. PMID:29230202
Lin, Kevin; Lu, Yue; Shen, Jianjun; Johanning, Gary L.; Wang-Johanning, Feng
2016-01-01
Human endogenous retrovirus type K (HERV-K) Env protein was previously demonstrated to be overexpressed in human breast cancer (BC) cells and tissues. However, the molecular pathways driving the specific alterations are unknown. We now show that knockdown of its expression with an shRNA (shRNAenv) blocked BC cell proliferation, migration, and invasion. shRNAenv transduction also attenuated the ability of BC cells to form tumors, and notably prevented metastasis. Mechanistically, downregulation of HERV-K blocked expression of tumor-associated genes that included Ras, p-RSK, and p-ERK. The major upstream regulators influenced by HERV-K knockdown were p53, TGF- β1, and MYC. Of interest, when the HERV-K env gene was overexpressed in shRNAenv-transduced BC cells using an HERV-K env expression vector, Ras/Raf/MEK/ERK pathway signaling was restored. CDK5, which alters p53 phosphorylation in some cancers, was upregulated and p53 was downregulated when HERV-K was overexpressed. CDK5 is also a mediator of TGF-β1-induced epithelial-mesenchymal transition and migration in cancer cells, and is involved in tumor formation. Importantly, reductions in migration, invasion, and transformation of BC cells stably transduced with shRNAenv was reversed after adding back a vector with a synonymous mutation of HERV-K env. Taken together, these results indicate that HERV-K Env protein plays an important role in tumorigenesis and metastasis of BC. PMID:27557521
Melman, A; Biggs, G; Davies, K; Zhao, W; Tar, M T; Christ, G J
2008-03-01
Previous reports have demonstrated that gene transfer with the alpha, or pore-forming, subunit of the human Maxi-K channel (hSlo) restores the decline in erectile capacity observed in established rat models of diabetes and aging. Preliminary data from a human clinical trial also showed safety and potential efficacy in 11 men treated with the same plasmid construct expressing the Maxi-K channel. In all instances, the original plasmid was driven by the heterologous cytomegalovirus promoter which is broadly active in a wide variety of cell and tissue types. To more precisely determine the contribution of the corporal myocyte to the observed physiological effects in vivo, we report here our initial work using a distinct vector (pSMAA-hSlo) in which hSlo gene expression was driven off the mouse smooth muscle alpha-actin (SMAA) promoter. Specifically, older rats, with diminished erectile capacity, were given a single intracorporal injection with either 100 mug pVAX-hSlo or 10, 100 or 1000 mug pSMAA-hSlo, or vector or vehicle alone. Significantly increased intracavernous pressure (ICP) responses to cavernous nerve stimulation were observed for all doses of both plasmids encoding hSlo, relative to control injections. These data confirm and extend previous observations to document that smooth muscle cell-specific expression of hSlo in corporal tissue is both necessary and sufficient to restore erectile function in aging rats.
Nagarajan, R; Hariharan, M; Satiyan, M
2012-08-01
Developing tools to assist physically disabled and immobilized people through facial expression is a challenging area of research and has attracted many researchers recently. In this paper, luminance stickers based facial expression recognition is proposed. Recognition of facial expression is carried out by employing Discrete Wavelet Transform (DWT) as a feature extraction method. Different wavelet families with their different orders (db1 to db20, Coif1 to Coif 5 and Sym2 to Sym8) are utilized to investigate their performance in recognizing facial expression and to evaluate their computational time. Standard deviation is computed for the coefficients of first level of wavelet decomposition for every order of wavelet family. This standard deviation is used to form a set of feature vectors for classification. In this study, conventional validation and cross validation are performed to evaluate the efficiency of the suggested feature vectors. Three different classifiers namely Artificial Neural Network (ANN), k-Nearest Neighborhood (kNN) and Linear Discriminant Analysis (LDA) are used to classify a set of eight facial expressions. The experimental results demonstrate that the proposed method gives very promising classification accuracies.
Metal Insulator transition in Vanadium Dioxide
NASA Astrophysics Data System (ADS)
Jovaini, Azita; Fujita, Shigeji; Suzuki, Akira; Godoy, Salvador
2012-02-01
MAR12-2011-000262 Abstract Submitted for the MAR12 Meeting of The American Physical Society Sorting Category: 03.9 (T) On the metal-insulator-transition in vanadium dioxide AZITA JOVAINI, SHIGEJI FUJITA, University at Buffalo, SALVADOR GODOY, UNAM, AKIRA SUZUKI, Tokyo University of Science --- Vanadium dioxide (VO2) undergoes a metal-insulator transition (MIT) at 340 K with the structural change from tetragonal to monoclinic crystal. The conductivity _/ drops at MIT by four orders of magnitude. The low temperature monoclinic phase is known to have a lower ground-state energy. The existence of the k-vector k is prerequisite for the conduction since the k appears in the semiclassical equation of motion for the conduction electron (wave packet). The tetragonal (VO2)3 unit is periodic along the crystal's x-, y-, and z-axes, and hence there is a three-dimensional k-vector. There is a one-dimensional k for a monoclinic crystal. We believe this difference in the dimensionality of the k-vector is the cause of the conductivity drop. Prefer Oral Session X Prefer .
Inhibition of hepatitis B virus replication via HBV DNA cleavage by Cas9 from Staphylococcus aureus.
Liu, Yu; Zhao, Miaoxian; Gong, Mingxing; Xu, Ying; Xie, Cantao; Deng, Haohui; Li, Xueying; Wu, Hongkai; Wang, Zhanhui
2018-04-01
Chronic hepatitis B virus (HBV) infection is difficult to cure due to the presence of covalently closed circular DNA (cccDNA). Accumulating evidence indicates that the CRISPR/Cas9 system effectively disrupts HBV genome, including cccDNA, in vitro and in vivo. However, efficient delivery of CRISPR/Cas9 system to the liver or hepatocytes using an adeno-associated virus (AAV) vector remains challenging due to the large size of Cas9 from Streptococcus pyogenes (Sp). The recently identified Cas9 protein from Staphylococcus aureus (Sa) is smaller than SpCas9 and thus is able to be packaged into the AAV vector. To examine the efficacy of SaCas9 system on HBV genome destruction, we designed 5 guide RNAs (gRNAs) that targeted different HBV genotypes, 3 of which were shown to be effective. The SaCas9 system significantly reduced HBV antigen expression, as well as pgRNA and cccDNA levels, in Huh7, HepG2.2.15 and HepAD38 cells. The dual expression of gRNAs/SaCas9 in these cell lines resulted in more efficient HBV genome cleavage. In the mouse model, hydrodynamic injection of gRNA/SaCas9 plasmids resulted in significantly lower levels of HBV protein expression. We also delivered the SaCas9 system into mice with persistent HBV replication using an AAV vector. Both the AAV vector and the mRNA of Cas9 could be detected in the C3H mouse liver cells. Decreased hepatitis B surface antigen (HBsAg), HBV DNA and pgRNA levels were observed when a higher titer of AAV was injected, although this decrease was not significantly different from the control. In summary, the SaCas9 system accurately and efficiently targeted the HBV genome and inhibited HBV replication both in vitro and in vivo. The system was delivered by an AAV vector and maybe used as a novel therapeutic strategy against chronic HBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.
Upgrading Technology Infrastructure in California's Schools
ERIC Educational Resources Information Center
Gao, Niu; Murphy, Patrick
2016-01-01
As California schools move into online testing and online learning, an adequate technology infrastructure is no longer an option, but a necessity. To fully benefit from digital learning, schools will require a comprehensive technology infrastructure that can support a range of administrative and instructional tools. An earlier PPIC report found…
Fann, Monchou; Godlove, Jason M.; Catalfamo, Marta; Wood, William H.; Chrest, Francis J.; Chun, Nicholas; Granger, Larry; Wersto, Robert; Madara, Karen; Becker, Kevin; Henkart, Pierre A.; Weng, Nan-ping
2006-01-01
To understand the molecular basis for the rapid and robust memory T-cell responses, we examined gene expression and chromatin modification by histone H3 lysine 9 (H3K9) acetylation in resting and activated human naive and memory CD8+ T cells. We found that, although overall gene expression patterns were similar, a number of genes are differentially expressed in either memory or naive cells in their resting and activated states. To further elucidate the basis for differential gene expression, we assessed the role of histone H3K9 acetylation in differential gene expression. Strikingly, higher H3K9 acetylation levels were detected in resting memory cells, prior to their activation, for those genes that were differentially expressed following activation, indicating that hyperacetylation of histone H3K9 may play a role in selective and rapid gene expression of memory CD8+ T cells. Consistent with this model, we showed that inducing high levels of H3K9 acetylation resulted in an increased expression in naive cells of those genes that are normally expressed differentially in memory cells. Together, these findings suggest that differential gene expression mediated at least in part by histone H3K9 hyperacetylation may be responsible for the rapid and robust memory CD8+ T-cell response. PMID:16868257
Fuzzy support vector machine: an efficient rule-based classification technique for microarrays.
Hajiloo, Mohsen; Rabiee, Hamid R; Anooshahpour, Mahdi
2013-01-01
The abundance of gene expression microarray data has led to the development of machine learning algorithms applicable for tackling disease diagnosis, disease prognosis, and treatment selection problems. However, these algorithms often produce classifiers with weaknesses in terms of accuracy, robustness, and interpretability. This paper introduces fuzzy support vector machine which is a learning algorithm based on combination of fuzzy classifiers and kernel machines for microarray classification. Experimental results on public leukemia, prostate, and colon cancer datasets show that fuzzy support vector machine applied in combination with filter or wrapper feature selection methods develops a robust model with higher accuracy than the conventional microarray classification models such as support vector machine, artificial neural network, decision trees, k nearest neighbors, and diagonal linear discriminant analysis. Furthermore, the interpretable rule-base inferred from fuzzy support vector machine helps extracting biological knowledge from microarray data. Fuzzy support vector machine as a new classification model with high generalization power, robustness, and good interpretability seems to be a promising tool for gene expression microarray classification.
Geisler, Anja; Schön, Christian; Größl, Tobias; Pinkert, Sandra; Stein, Elisabeth A; Kurreck, Jens; Vetter, Roland; Fechner, Henry
2013-01-01
Insertion of completely complementary microRNA (miR) target sites (miRTS) into a transgene has been shown to be a valuable approach to specifically repress transgene expression in non-targeted tissues. miR-122TS have been successfully used to silence transgene expression in the liver following systemic application of cardiotropic adeno-associated virus (AAV) 9 vectors. For miR-206–mediated skeletal muscle-specific silencing of miR-206TS–bearing AAV9 vectors, however, we found this approach failed due to the expression of another member (miR-1) of the same miR family in heart tissue, the intended target. We introduced single-nucleotide substitutions into the miR-206TS and searched for those which prevented miR-1–mediated cardiac repression. Several mutated miR-206TS (m206TS), in particular m206TS-3G, were resistant to miR-1, but remained fully sensitive to miR-206. All these variants had mismatches in the seed region of the miR/m206TS duplex in common. Furthermore, we found that some m206TS, containing mismatches within the seed region or within the 3′ portion of the miR-206, even enhanced the miR-206– mediated transgene repression. In vivo expression of m206TS-3G– and miR-122TS–containing transgene of systemically applied AAV9 vectors was strongly repressed in both skeletal muscle and the liver but remained high in the heart. Thus, site-directed mutagenesis of miRTS provides a new strategy to differentiate transgene de-targeting of related miRs. PMID:23439498
An efficient strategy for cell-based antibody library selection using an integrated vector system.
Yoon, Hyerim; Song, Jin Myung; Ryu, Chun Jeih; Kim, Yeon-Gu; Lee, Eun Kyo; Kang, Sunghyun; Kim, Sang Jick
2012-09-18
Cell panning of phage-displayed antibody library is a powerful tool for the development of therapeutic and imaging agents since disease-related cell surface proteins in native complex conformation can be directly targeted. Here, we employed a strategy taking advantage of an integrated vector system which allows rapid conversion of scFv-displaying phage into scFv-Fc format for efficient cell-based scFv library selection on a tetraspanin protein, CD9. A mouse scFv library constructed by using a phagemid vector, pDR-D1 was subjected to cell panning against stable CD9 transfectant, and the scFv repertoire from the enriched phage pool was directly transferred to a mammalian cassette vector, pDR-OriP-Fc1. The resulting constructs enabled transient expression of enough amounts of scFv-Fcs in HEK293E cells, and flow cytometric screening of binders for CD9 transfectant could be performed simply by using the culture supernatants. All three clones selected from the screening showed correct CD9-specificity. They could immunoprecipitate CD9 molecules out of the transfectant cell lysate and correctly stain endogenous CD9 expression on cancer cell membrane. Furthermore, competition assay with a known anti-CD9 monoclonal antibody (mAb) suggested that the binding epitopes of some of them overlap with that of the mAb which resides within the large extracellular loop of CD9. This study demonstrates that scFv-Fc from mammalian transient expression can be chosen as a reliable format for rapid screening and validation in cell-based scFv library selection, and the strategy described here will be applicable to efficient discovery of antibodies to diverse cell-surface targets.
Kyostio-Moore, Sirkka; Piraino, Susan; Berthelette, Patricia; Moran, Nance; Serriello, Joseph; Bendele, Alison; Sookdeo, Cathleen; Nambiar, Bindu; Ewing, Patty; Armentano, Donna; Matthews, Gloria L
2015-01-16
Cathepsin K (catK) expression is increased in cartilage, bone and synovium during osteoarthritis (OA). To study the role of catK expression and elevated cathepsin activity in the synovium on cartilage destruction in established OA, we overexpressed cystatin C (cysC), a natural cysteine protease inhibitor, in the synovium of rabbit OA joints. The ability of cysC to inhibit activity of cathepsins in rabbit OA synovium lysates was tested in vitro using protease activity assay. In vivo, the tissue localization of recombinant adeno-associated virus (rAAV) with LacZ gene after intra-articular injection was determined by β-galactosidase staining of rabbit joints 4 weeks later. To inhibit cathepsin activity in the synovium, a rAAV2-encoding cysC was delivered intra-articularly into rabbit joints 4 weeks after OA was induced by anterior cruciate ligament transection (ACLT). Seven weeks postinjection, endogenous catK and cysC levels as well as the vector-derived cysC expression in the synovium of normal and OA joints were examined by RNA quantification. Synovial cathepsin activity and catK, catB and catL protein levels were determined by activity and Western blot analyses, respectively. Synovitis and cartilage degradation were evaluated by histopathological scoring. In vitro, the ability of cysC to efficiently inhibit activity of purified catK and OA-induced cathepsins in rabbit synovial lysates was demonstrated. In vivo, the intra-articular delivery of rAAV2/LacZ showed transduction of mostly synovium. Induction of OA in rabbit joints resulted in fourfold increase in catK mRNA compared to sham controls while no change was detected in endogenous cysC mRNA levels in the synovium. Protein levels for catK, catB and catL were also increased in the synovium with a concomitant fourfold increase in cathepsin activity. Joints treated with rAAV2/cysC showed both detection of vector genomes and vector-derived cysC transcripts in the synovium. Production of functional cysC by the vector was demonstrated by complete block of cathepsin activity in the synovium. However, this did not decrease synovitis, bone sclerosis or progression of cartilage degradation. Increased production of natural cathepsin inhibitor, cysC, in OA synovium does not alleviate synovitis or cartilage pathology during a preexisting OA.
Cloning, expression and activation of a truncated 92-kDa gelatinase minienzyme.
Kröger, M; Tschesche, H
1997-09-01
The matrix metalloproteinases (MMPs) are a family of highly homologous zinc-endopeptidases that degrade extracellular matrix components. Human 92-kDa gelatinase (MMP-9) represents one of the MMPs that cleaves native collagen type IV. As a basis for structural investigations, the short form (catalytic domain, amino acid residues 113-450) of the 92-kDa gelatinase cDNA was cloned and expressed in E. coli as a minienzyme. By combination of reverse transcription (RT) and polymerase chain reaction (PCR), the truncated 92-kDa gelatinase-cDNA was amplified from the corresponding mRNA derived from ovarian carcinoma cells. The cDNA fragment obtained was cloned in E. coli and sequenced. With the exception of one nucleotide inversion at position 745 (gt-->tg) the cDNA sequence was identical to the nucleotide sequence of the 92-kDa gelatinase as has been previously reported. The protein was expressed in E. coli using the vector pET-12b. The recombinant protein was stored in inclusion bodies and extracted as a 38 kDa species from the inclusion bodies by solubilization in 8 M urea. The product was purified by affinity chromatography and gel filtration. Amino-terminal sequence analysis confirmed the identity with the catalytic domain of 92-kDa gelatinase. The recombinant protein was refolded in the presence of Ca2+ and Zn2+ and yielded an active minienzyme with gelatinolytic activity. It degrades the native substrate collagen type IV and the synthetic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 x AcOH like the full-length 92-kDa gelatinase. The catalytic activity could be inhibited by the specific MMP inhibitors TIMP-1 and TIMP-2.
Genetically modified pigs produced with a nonviral episomal vector
Manzini, Stefano; Vargiolu, Alessia; Stehle, Isa M; Bacci, Maria Laura; Cerrito, Maria Grazia; Giovannoni, Roberto; Zannoni, Augusta; Bianco, Maria Rosaria; Forni, Monica; Donini, Pierluigi; Papa, Michele; Lipps, Hans J; Lavitrano, Marialuisa
2006-01-01
Genetic modification of cells and animals is an invaluable tool for biotechnology and biomedicine. Currently, integrating vectors are used for this purpose. These vectors, however, may lead to insertional mutagenesis and variable transgene expression and can undergo silencing. Scaffold/matrix attachment region-based vectors are nonviral expression systems that replicate autonomously in mammalian cells, thereby making possible safe and reliable genetic modification of higher eukaryotic cells and organisms. In this study, genetically modified pig fetuses were produced with the scaffold/matrix attachment region-based vector pEPI, delivered to embryos by the sperm-mediated gene transfer method. The pEPI vector was detected in 12 of 18 fetuses in the different tissues analyzed and was shown to be retained as an episome. The reporter gene encoded by the pEPI vector was expressed in 9 of 12 genetically modified fetuses. In positive animals, all tissues analyzed expressed the reporter gene; moreover in these tissues, the positive cells were on the average 79%. The high percentage of EGFP-expressing cells and the absence of mosaicism have important implications for biotechnological and biomedical applications. These results are an important step forward in animal transgenesis and can provide the basis for the future development of germ-line gene therapy. PMID:17101993
Liu, Jingjing; Zhang, Di; Kimata, Jason T.; Zhou, Paul
2014-01-01
CCR5, a coreceptor for HIV-1 entry, is a major target for drug and genetic intervention against HIV-1. Genetic intervention strategies have knocked down CCR5 expression levels by shRNA or disrupted the CCR5 gene using zinc finger nucleases (ZFN) or Transcription activator-like effector nuclease (TALEN). In the present study, we silenced CCR5 via CRISPR associated protein 9 (Cas9) and single guided RNAs (sgRNAs). We constructed lentiviral vectors expressing Cas9 and CCR5 sgRNAs. We show that a single round transduction of lentiviral vectors expressing Cas9 and CCR5 sgRNAs into HIV-1 susceptible human CD4+ cells yields high frequencies of CCR5 gene disruption. CCR5 gene-disrupted cells are not only resistant to R5-tropic HIV-1, including transmitted/founder (T/F) HIV-1 isolates, but also have selective advantage over CCR5 gene-undisrupted cells during R5-tropic HIV-1 infection. Importantly, using T7 endonuclease I assay we did not detect genome mutations at potential off-target sites that are highly homologous to these CCR5 sgRNAs in stably transduced cells even at 84 days post transduction. Thus we conclude that silencing of CCR5 via Cas9 and CCR5-specific sgRNAs could be a viable alternative strategy for engineering resistance against HIV-1. PMID:25541967
Regulated expression of the rat recombinant P2X(3) receptor in stably transfected CHO-K1 tTA cells.
Lachnit, W G; Oglesby, I B; Gever, J R; Gever, M; Huang, C; Li, X C; Jin, H; McGivern, J G; Ford, A P
2000-07-03
In this report, the regulatable expression by tetracycline of the rat recombinant P2X(3) receptor in stably transfected Chinese hamster ovary (CHO-K1) expressing the tetracycline-controlled transactivator (tTA) is described. cDNA encoding the rat P2X(3)-receptor was subcloned into pTRE (a tetracycline-repressible expression vector) which was used to transfect stably CHO-K1 tTA cells. Using whole cell patch clamp techniques, 100 microM ATP evoked inward currents of 2.9+/-1.6 nA in transfected cells grown in the absence of tetracycline (tet-). The P2X(3) receptor protein was detectable by immunoblot as early as 24 h and protein expression levels continued to increase as much as 192 h following activation of tTA by the removal of the antibiotic. Saturation binding isotherms using [35S]ATP gamma S yielded a pK(d) of 8.2+/-0.1 and a B(max) of 31.9+/-3.5 pmol/mg protein in tet- cell membranes and a pK(d) of 8.1+/-0.1 and a B(max) of 5.8+/-0.8 pmol/mg protein in tet+ cell membranes. The agonist ligands 2MeSATP and alpha beta MeATP displaced the binding of [35S]ATP gamma S in tet- cell membranes with very high affinity, yielding pIC(50) values of 9.4+/-0.2 and 7.5+/-0. 2, respectively. In tet+ cell membrane, displacement of [35S]ATP gamma S by 2MeSATP and alpha beta MeATP was of much lower affinity (pIC(50) values of 7.8 and 6.2, respectively). ATP, ADP and UTP showed similar displacement of [35S]ATP gamma S binding in tet- and tet+ cell membranes. In other experiments, cytosolic Ca(2+) was monitored using the fluorescent indicator, fluo-3. Increases in cytosolic Ca(2+) were elicited by 100 nM alpha beta MeATP in tet- cells while no increases in cytosolic Ca(2+) were detected below 100 microM alpha beta MeATP in either tet+ cells or untransfected cells. These calcium responses to alpha beta MeATP had a pEC(50) of 6.7 and were transient, returning to baseline within 120 s. Suramin produced concentration-dependent, parallel, dextral shifts of E/[A] curves to alpha beta MeATP yielding a pK(B) of 5.6. PPADS produced non-parallel, dextral shifts of E/[A] curves to alpha beta MeATP which were insurmountable. These results show for the first time, expression of a functional, homomeric recombinant rat P2X(3) receptor which is under regulated expression in a stably transfected mammalian cell line.
Jiménez, Juan J; Borrero, Juan; Gútiez, Loreto; Arbulu, Sara; Herranz, Carmen; Cintas, Luis M; Hernández, Pablo E
2014-06-01
The use of synthetic genes may constitute a successful approach for the heterologous production and functional expression of bacterial antimicrobial peptides (bacteriocins) by recombinant yeasts. In this work, synthetic genes with adapted codon usage designed from the mature amino acid sequence of the bacteriocin enterocin A (EntA), produced by Enterococcus faecium T136, and the mature bacteriocin E 50-52 (BacE50-52), produced by E. faecium NRRL B-32746, were synthesized. The synthetic entA and bacE50-52 were cloned into the protein expression vectors pPICZαA and pKLAC2 for transformation of derived vectors into Pichia pastoris X-33 and Kluyveromyces lactis GG799, respectively. The recombinant vectors were linearized and transformed into competent cells selecting for P. pastoris X-33EAS (entA), P. pastoris X-33BE50-52S (bacE50-52), K. lactis GG799EAS (entA), and K. lactis GG799BE50-52S (bacE50-52). P. pastoris X-33EAS and K. lactis GG799EAS, but not P. pastoris X-33BE50-52S and K. lactis GG799BE50-52S, showed antimicrobial activity in their supernatants. However, purification of the supernatants of the producer yeasts permitted recovery of the bacteriocins EntA and BacE50-52. Both purified bacteriocins were active against Gram-positive bacteria such as Listeria monocytogenes but not against Gram-negative bacteria, including Campylobacter jejuni.
Forbes, Emily K.; de Cassan, Simone C.; Llewellyn, David; Biswas, Sumi; Goodman, Anna L.; Cottingham, Matthew G.; Long, Carole A.; Pleass, Richard J.; Hill, Adrian V. S.; Hill, Fergal; Draper, Simon J.
2012-01-01
Viral vectored vaccines have been shown to induce both T cell and antibody responses in animals and humans. However, the induction of even higher level T cell responses may be crucial in achieving vaccine efficacy against difficult disease targets, especially in humans. Here we investigate the oligomerization domain of the α-chain of C4b-binding protein (C4 bp) as a candidate T cell “molecular adjuvant” when fused to malaria antigens expressed by human adenovirus serotype 5 (AdHu5) vectored vaccines in BALB/c mice. We demonstrate that i) C-terminal fusion of an oligomerization domain can enhance the quantity of antigen-specific CD4+ and CD8+ T cell responses induced in mice after only a single immunization of recombinant AdHu5, and that the T cells maintain similar functional cytokine profiles; ii) an adjuvant effect is observed for AdHu5 vectors expressing either the 42 kDa C-terminal domain of Plasmodium yoelii merozoite surface protein 1 (PyMSP142) or the 83 kDa ectodomain of P. falciparum strain 3D7 apical membrane antigen 1 (PfAMA1), but not a candidate 128kDa P. falciparum MSP1 biallelic fusion antigen; iii) following two homologous immunizations of AdHu5 vaccines, antigen-specific T cell responses are further enhanced, however, in both BALB/c mice and New Zealand White rabbits no enhancement of functional antibody responses is observed; and iv) that the T cell adjuvant activity of C4 bp is not dependent on a functional Fc-receptor γ-chain in the host, but is associated with the oligomerization of small (<80 kDa) antigens expressed by recombinant AdHu5. The oligomerization domain of C4 bp can thus adjuvant T cell responses induced by AdHu5 vectors against selected antigens and its clinical utility as well as mechanism of action warrant further investigation. PMID:22984589
eXpression2Kinases (X2K) Web: linking expression signatures to upstream cell signaling networks.
Clarke, Daniel J B; Kuleshov, Maxim V; Schilder, Brian M; Torre, Denis; Duffy, Mary E; Keenan, Alexandra B; Lachmann, Alexander; Feldmann, Axel S; Gundersen, Gregory W; Silverstein, Moshe C; Wang, Zichen; Ma'ayan, Avi
2018-05-25
While gene expression data at the mRNA level can be globally and accurately measured, profiling the activity of cell signaling pathways is currently much more difficult. eXpression2Kinases (X2K) computationally predicts involvement of upstream cell signaling pathways, given a signature of differentially expressed genes. X2K first computes enrichment for transcription factors likely to regulate the expression of the differentially expressed genes. The next step of X2K connects these enriched transcription factors through known protein-protein interactions (PPIs) to construct a subnetwork. The final step performs kinase enrichment analysis on the members of the subnetwork. X2K Web is a new implementation of the original eXpression2Kinases algorithm with important enhancements. X2K Web includes many new transcription factor and kinase libraries, and PPI networks. For demonstration, thousands of gene expression signatures induced by kinase inhibitors, applied to six breast cancer cell lines, are provided for fetching directly into X2K Web. The results are displayed as interactive downloadable vector graphic network images and bar graphs. Benchmarking various settings via random permutations enabled the identification of an optimal set of parameters to be used as the default settings in X2K Web. X2K Web is freely available from http://X2K.cloud.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Alamdar, Ambreen; Xi, Guochen
Arsenic exposure has been associated with male reproductive dysfunction by disrupting steroidogenesis; however, the roles of epigenetic drivers, especially histone methylation in arsenic-induced steroidogenic toxicity remain not well documented. In this study, we investigated the role of histone H3 lysine 9 (H3K9) methylation in steroidogenesis disturbance in mouse Leydig cells (MLTC-1) due to arsenic exposure. Our results indicated that mRNA and protein expression levels of 3β-hydroxysteroid dehydrogenase (3β-HSD) were both significantly up-regulated while the rest of key genes involved in steroidogenesis were down-regulated. Moreover, arsenic exposure significantly decreased the histone H3K9 di- and tri-methylation (H3K9me2/3) levels in MLTC-1 cells. Sincemore » H3K9 demethylation leads to gene activation, we further investigated whether the induction of 3β-HSD expression was ascribed to reduced H3K9 methylation. The results showed that H3K9me2/3 demethylase (JMJD2A) inhibitor, quercetin (Que) significantly attenuated the decrease of H3K9me2/3 and increase of 3β-HSD expression induced by arsenic. To further elucidate the mechanism for the activation of 3β-HSD, we determined the histone H3K9 methylation levels in Hsd3b gene promoter, which also showed significant decrease of H3K9me2/3 in the investigated region after arsenic exposure. Considering these results, we conclude that arsenic exposure induced 3β-HSD up-regulation by suppressing H3K9me2/3 status, which is suggested as a compensatory mechanism for steroidogenic disturbance in MLTC-1 cells. - Highlights: • Epigenetic mechanisms of arsenic-induced male reproductive toxicity remain unclear. • Arsenic disturbs the expression of key steroidogenic genes in MLTC-1 cells. • Histone H3K9 di- and tri-methylation was suppressed in arsenic-exposed cells. • Arsenic activates 3β-HSD expression through repression of histone H3K9 methylation.« less
Cross-Cultural Validation of the Patient Perception of Integrated Care Survey.
Tietschert, Maike V; Angeli, Federica; van Raak, Arno J A; Ruwaard, Dirk; Singer, Sara J
2017-07-20
To test the cross-cultural validity of the U.S. Patient Perception of Integrated Care (PPIC) Survey in a Dutch sample using a standardized procedure. Primary data collected from patients of five primary care centers in the south of the Netherlands, through survey research from 2014 to 2015. Cross-sectional data collected from patients who saw multiple health care providers during 6 months preceding data collection. The PPIC survey includes 59 questions that measure patient perceived care integration across providers, settings, and time. Data analysis followed a standardized procedure guiding data preparation, psychometric analysis, and included invariance testing with the U.S. dataset. Latent scale structures of the Dutch and U.S. survey were highly comparable. Factor "Integration with specialist" had lower reliability scores and noninvariance. For the remaining factors, internal consistency and invariance estimates were strong. The standardized cross-cultural validation procedure produced strong support for comparable psychometric characteristics of the Dutch and U.S. surveys. Future research should examine the usability of the proposed procedure for contexts with greater cultural differences. © Health Research and Educational Trust.
Li, Ming; Bui, Michelle; Yang, Ting; Bowman, Christian S.; White, Bradley J.; Akbari, Omar S.
2017-01-01
The development of CRISPR/Cas9 technologies has dramatically increased the accessibility and efficiency of genome editing in many organisms. In general, in vivo germline expression of Cas9 results in substantially higher activity than embryonic injection. However, no transgenic lines expressing Cas9 have been developed for the major mosquito disease vector Aedes aegypti. Here, we describe the generation of multiple stable, transgenic Ae. aegypti strains expressing Cas9 in the germline, resulting in dramatic improvements in both the consistency and efficiency of genome modifications using CRISPR. Using these strains, we disrupted numerous genes important for normal morphological development, and even generated triple mutants from a single injection. We have also managed to increase the rates of homology-directed repair by more than an order of magnitude. Given the exceptional mutagenic efficiency and specificity of the Cas9 strains we engineered, they can be used for high-throughput reverse genetic screens to help functionally annotate the Ae. aegypti genome. Additionally, these strains represent a step toward the development of novel population control technologies targeting Ae. aegypti that rely on Cas9-based gene drives. PMID:29138316
Li, Ming; Bui, Michelle; Yang, Ting; Bowman, Christian S; White, Bradley J; Akbari, Omar S
2017-12-05
The development of CRISPR/Cas9 technologies has dramatically increased the accessibility and efficiency of genome editing in many organisms. In general, in vivo germline expression of Cas9 results in substantially higher activity than embryonic injection. However, no transgenic lines expressing Cas9 have been developed for the major mosquito disease vector Aedes aegypti Here, we describe the generation of multiple stable, transgenic Ae. aegypti strains expressing Cas9 in the germline, resulting in dramatic improvements in both the consistency and efficiency of genome modifications using CRISPR. Using these strains, we disrupted numerous genes important for normal morphological development, and even generated triple mutants from a single injection. We have also managed to increase the rates of homology-directed repair by more than an order of magnitude. Given the exceptional mutagenic efficiency and specificity of the Cas9 strains we engineered, they can be used for high-throughput reverse genetic screens to help functionally annotate the Ae. aegypti genome. Additionally, these strains represent a step toward the development of novel population control technologies targeting Ae. aegypti that rely on Cas9-based gene drives. Copyright © 2017 the Author(s). Published by PNAS.
Nakanishi, Tadashi; Goto, Chie; Kobayashi, Michihiro; Kang, Wonkyung; Suzuki, Takehiro; Dohmae, Naoshi; Matsumoto, Shogo; Shimada, Toru; Katsuma, Susumu
2010-05-01
Lepidopteran baculovirus-specific protein FP25K performs many roles during the infection cycle, including functions in the production of occlusion bodies (OBs) and budded viruses (BVs), oral infection, and postmortem host degradation. To explore the common and specific functions of FP25K proteins among lepidopteran baculoviruses, we performed comparative analyses of FP25K proteins from group I and group II nucleopolyhedroviruses (NPVs) and granulovirus (GV). Using recombinant Bombyx mori NPVs (BmNPVs), we showed that the FP25Ks from NPVs were able to eliminate all the phenotypic defects observed in an infection with a BmNPV mutant lacking functional fp25K but that FP25K from GV did not show abilities to recover oral infectivity and postmortem host degradation. We also observed that introduction of Autographa californica multiple NPV (AcMNPV) fp25K into the BmNPV genome enhanced OB and BV production. According to these results, we generated a novel BmNPV-based expression vector with AcMNPV fp25K and examined its potential in BmN cells and B. mori larvae. Our results showed that the introduction of AcMNPV fp25K significantly increases the expression of foreign gene products in cultured cells and shortens the time for obtaining the secreted recombinant proteins from larval hemolymph.
Cheng, Ching-Yi; Hsieh, Hsi-Lung; Hsiao, Li-Der; Yang, Chuen-Mao
2012-07-01
Matrix metalloproteinase-9 (MMP-9) plays an important role in the outgrowth of expanded human limbal epithelial cells on intact amniotic membranes (AM). The mechanisms of MMP-9 expression and cell outgrowth remain unknown. Here, we demonstrated that MMP-9 is preferentially expressed at the leading edge of limbal epithelial outgrowth. Treatment with the inhibitors of PI3-K (LY294002), Akt (SH-5), MEK1/2 (U0126), and JNK1/2 (SP600125) attenuated the outgrowth area, indicating that PI3-K/Akt, p42/p44 MAPK, and JNK1/2 are involved in the outgrowth of intact AM-expanded limbal epithelial cells. However, MMP-9 expression at both transcriptional and translational levels was attenuated by treatment with SP600125, LY294002, or SH-5, not by U0126 and SB202190, suggesting that JNK1/2 and PI3-K/Akt participate in MMP-9 expression. Moreover, NF-κB phosphorylation and nuclear translocation was especially noted at the leading edge, which was attenuated by treatment with SP600125 or LY294002. Helenalin, a selective NF-κB inhibitor, reduced both the limbal epithelial outgrowth and MMP-9 expression. Finally, the data reveal that PI3-K/Akt is an upstream component of the JNK1/2 pathway in MMP-9 expression. Thus, both MAPKs and PI3-K/Akt are required for limbal epithelial outgrowth on intact AM, only the PI3-K/Akt/JNK is essential for MMP-9 expression mediated through activation of transcriptional factor NF-κB in this model. Copyright © 2012 Elsevier B.V. All rights reserved.
Ghorai, Atanu; Sarma, Asitikantha; Chowdhury, Priyanka; Ghosh, Utpal
2016-09-22
Hadron therapy is an innovative technique where cancer cells are precisely killed leaving surrounding healthy cells least affected by high linear energy transfer (LET) radiation like carbon ion beam. Anti-metastatic effect of carbon ion exposure attracts investigators into the field of hadron biology, although details remain poor. Poly(ADP-ribose) polymerase-1 (PARP-1) inhibitors are well-known radiosensitizer and several PARP-1 inhibitors are in clinical trial. Our previous studies showed that PARP-1 depletion makes the cells more radiosensitive towards carbon ion than gamma. The purpose of the present study was to investigate combining effects of PARP-1 inhibition with carbon ion exposure to control metastatic properties in HeLa cells. Activities of matrix metalloproteinases-2, 9 (MMP-2, MMP-9) were measured using the gelatin zymography after 85 MeV carbon ion exposure or gamma irradiation (0- 4 Gy) to compare metastatic potential between PARP-1 knock down (HsiI) and control cells (H-vector - HeLa transfected with vector without shRNA construct). Expression of MMP-2, MMP-9, tissue inhibitor of MMPs such as TIMP-1, TIMP-2 and TIMP-3 were checked by immunofluorescence and western blot. Cell death by trypan blue, apoptosis and autophagy induction were studied after carbon ion exposure in each cell-type. The data was analyzed using one way ANOVA and 2-tailed paired-samples T-test. PARP-1 silencing significantly reduced MMP-2 and MMP-9 activities and carbon ion exposure further diminished their activities to less than 3 % of control H-vector. On the contrary, gamma radiation enhanced both MMP-2 and MMP-9 activities in H-vector but not in HsiI cells. The expression of MMP-2 and MMP-9 in H-vector and HsiI showed different pattern after carbon ion exposure. All three TIMPs were increased in HsiI, whereas only TIMP-1 was up-regulated in H-vector after irradiation. Notably, the expressions of all TIMPs were significantly higher in HsiI than H-vector at 4 Gy. Apoptosis was the predominant mode of cell death and no autophagic death was observed. Our study demonstrates for the first time that PARP-1 inhibition in combination with carbon ion synergistically decreases MMPs activity along with overall increase of TIMPs. These data open up the possibilities of improvement of carbon ion therapy with PARP-1 inhibition to control highly metastatic cancers.
[RS-1 enhanced the efficiency of CRISPR-Cas9 mediated knock-in of human lactoferrin].
Zhou, Wenjun; Guo, Rihong; Deng, Mingtian; Wang, Feng; Zhang, Yanli
2017-08-25
This study aims to knock out the goat β-lactoglobulin (BLG) gene using CRISPR-Cas9 system and knock in human lactoferrin (hLF) at the BLG locus, and further study the effect of RAD51 stimulatory compound (RS-1) on homologous recombination efficiency. First, we designed an sgRNA targeting the first exon of goat BLG gene and constructed a co-expression vector pCas9-sgBLG. This sgRNA vector was then transfected into goat ear fibroblasts (GEFs), and the target region was examined by T7EN1 assay and sequencing. Second, we constructed a targeting vector pBHA-hLF-NIE including NEO and EGFP genes based on BLG gene locus. This targeting vector together with pCas9-sgBLG expression vector was co-transfected into GEFs. Transfected cells were then treated with 0, 5, 10 and 20 μmol/L RS-1 for 72 h to analyse the EGFP expression efficiency. Next, we used 800 μg/mL G418 to screen G418-resistent cell clones, and studied hLF site-specific knock-in cell clones by PCR and sequencing. The editing efficiency of sgBLG was between 25% and 31%. The EGFP expression efficiency indicated that the gene knock-in efficiency was improved by RS-1 in a dose-dependent manner, which could reach 3.5-fold compared to the control group. The percentage of positive cells with hLF knock-in was increased to 32.61% when 10 μmol/L RS-1 was used. However, when the concentration of RS-1 increased to 20 μmol/L, the percentage of positive cells decreased to 22.22% and resulted in an increase of senescent cell clone number. These results suggested that hLF knock-in and BLG knock-out in GEFs were achieved by using CRISPR/Cas9 system, and optimum concentration of RS-1 could improve knock-in efficiency, which provides a reference for efficiently obtaining gene knock-in cells using CRISPR/Cas9 in the future.
Gouiaa, Sandra; Khoudi, Habib
2015-09-01
Potassium (K) deficiency is a worldwide problem. Thus, the K biofortification of crops is needed to enhance human nutrition. Tomato represents an ideal candidate for such biofortification programs thanks to its widespread distribution and its easy growth on a commercial scale. However, although tomato is moderately tolerant to abiotic stresses, the crop losses due to salinity can be severe. In this study, we generated transgenic tomato plants over-expressing a Na(+)-K(+)/H(+) exchanger gene (TNHXS1), singly or with H(+)-pyrophosphatase (H(+)-PPiase) gene using a bicistronic construct. Transgenic tomato lines co-expressing both genes (LNV) significantly showed higher salinity tolerance than the wild-type (WT) plans or those expressing the TNHXS1 gene alone (LN). Indeed, under salt stress conditions, double transgenic plants produced higher biomass and retained more chlorophyll and catalase (CAT) activity. In addition, they showed earlier flowering and produced more fruits. To address K deficiencies in humans, an increase of 50% in K content of vegetable products was proposed. In this study, ion content analysis revealed that, under salt stress, fruits from double transgenic plants accumulated 5 times more potassium and 9 times less sodium than WT counterparts. Interestingly, the ionomic analysis of tomato fruits also revealed that LNV had a distinct profile compared to WT and to LN plants. Indeed, LNV fruits accumulated less Fe(2+), Ca(2+), Mg(2+) and Zn(2+), but more Mn(2+). This study demonstrates the effectiveness of bicistronic constructs as an important tool for the enhancement of biofortification and salt stress tolerance in crops. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ramsingh, Arlene I.; Gray, Steven J.; Reilly, Andrew; Koday, Michael; Bratt, Debbie; Koday, Merika Treants; Murnane, Robert; Hu, Yuhui; Messer, Anne
2018-01-01
A critical issue in transgene delivery studies is immune reactivity to the transgene- encoded protein and its impact on sustained gene expression. Here, we test the hypothesis that immunomodulation by rapamycin can decrease immune reactivity after intrathecal AAV9 delivery of a transgene (GFP) in non-human primates, resulting in sustained GFP expression in the CNS. We show that rapamycin treatment clearly reduced the overall immunogenicity of the AAV9/GFP vector by lowering GFP- and AAV9-specific antibody responses, and decreasing T cell responses including cytokine and cytolytic effector responses. Spinal cord GFP protein expression was sustained for twelve weeks, with no toxicity. Immune correlates of robust transgene expression include negligible GFP-specific CD4 and CD8 T cell responses, absence of GFP-specific IFN-γ producing T cells, and absence of GFP-specific cytotoxic T cells, which support the hypothesis that decreased T cell reactivity results in sustained transgene expression. These data strongly support the use of modest doses of rapamycin to modulate immune responses for intrathecal gene therapies, and potentially a much wider range of viral vector-based therapeutics. PMID:29874260
Lai, Qingwei; Du, Wantong; Wu, Jian; Wang, Xiao; Li, Xinyu; Qu, Xuebin; Wu, Xiuxiang; Dong, Fuxing; Yao, Ruiqin; Fan, Hongbin
2017-01-01
Recently, it is reported that monocarboxylate transporter 1 (MCT1) plays crucial role in oligodendrocyte differentiation and myelination. We found that MCT1 is strongly expressed in oligodendrocyte but weakly expressed in oligodendrocyte precursors (OPCs), and the underlying mechanisms remain elusive. Histone deacetylases (HDACs) activity is required for induction of oligodendrocyte differentiation and maturation. We asked whether HDACs are involved in the regulation of MCT1 expression. This work revealed that the acetylation level of histone H3K9 (H3K9ac) was much higher in mct1 gene (Slc16a1) promoter in OPCs than that in oligodendrocyte. H3K9ac regulates MCT1 expression was confirmed by HDAC acetyltransferase inhibitors trichostatin A and curcumin. Of note, there was a negative correlation between H3K9ac and MCT1 expression in oligodendrocyte. Further, we found that the levels of HDAC1, 2, and 3 protein in oligodendrocyte were obviously higher than those in OPCs. However, specific knockdown of HDAC2 but not HDAC1 and HDAC3 significantly decreased the expression of MCT1 in oligodendrocyte. Conversely, overexpression of HDAC2 remarkably enhanced the expression of MCT1. The results imply that HDAC2 is involved in H3K9ac modification which regulates the expression of MCT1 during the development of oligodendrocyte. PMID:29184483
USDA-ARS?s Scientific Manuscript database
Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...
Construction of baculovirus expression vector of miRNAs and its expression in insect cells.
Huang, Yong; Zou, Quan; Shen, Xing Jia; Yu, Xue Li; Wang, Zhan Bin; Cheng, Xiang Chao
2012-01-01
MicroRNAs (miRNAs) are endogenous small non-protein coding RNAs that play important regulatory roles in animals and plants by binding to target transcripts for cleavage or translational repression. The miR-9a is very conservative in animals from flies to humans. Studies indicated that miR-9a is involved in the regulation of neurogenesis in animals. In our study, the baculovirus expression system was used to transcribe a recombinant vector containing miR-9a for further analysis the function ofmiR-9a. The sequence ofpre-miR-9a from silkworm DNA was first cloned into the donor pFastBac. The enhanced green fluorescent protein (EGFP) was used as reporter gene. The recombinant donor plasmid pFastBac-miR-9a was transformed into E.coli DH10Bac/AcNPV forming Bacmid-9a which was transfected into insect cells with cational lipofectin. The transcription of mature miR-9a was detected by Real-time PCR. The results show the recombinant Bacmid-9a was successfully constructed and effectively transcribed miR-9a in infected Sf21 insect cells.
Kelloniemi, Jani; Mäkinen, Kristiina; Valkonen, Jari P T
2006-05-01
Potato virus A (PVA), a potyvirus with a (+)ssRNA genome translated to a large polyprotein, was engineered and used as a gene vector for expression of heterologous proteins in plants. Foreign genes including jellyfish GFP (Aequorea victoria) encoding the green fluorescent protein (GFP, 27 kDa) and the genes of human origin (Homo sapiens) encoding a soluble resistance-related calcium-binding protein (sorcin, 22 kDa) and the catechol-O-methyltransferase (S-COMT; 25 kDa) were cloned between the cistrons for the viral replicase and coat protein (CP). The inserts caused no adverse effects on viral infectivity and virulence, and the inserted sequences remained intact in progeny viruses in the systemically infected leaves. The heterologous proteins were released from the viral polyprotein following cleavage by the main viral proteinase, NIa, at engineered proteolytic processing sites flanking the insert. Active GFP, as indicated by green fluorescence, and S-COMT with high levels of enzymatic activity were produced. In contrast, no sorcin was detected despite the expected equimolar amounts of the foreign and viral proteins being expressed as a polyprotein. These data reveal inherent differences between heterologous proteins in their suitability for production in plants.
Niu, Baolong; Huang, Yujian; Zhang, Suai; Wang, Dandan; Xu, Haijin; Kong, Deling; Qiao, Mingqiang
2012-05-01
The cell-specific peptide TPS (TPSLEQRTVYAK) has been proposed as a potential candidate for fabricating tissue engineering scaffolds based on its ability of binding to human endothelial progenitor cells (EPC) with high affinity and specificity. In this study, the class I hydrophobin hgfI gene from Grifola frondosa and the tps were fused and cloned into pPIC9. The fusion gene was expressed in Pichia pastoris under the control of alcohol oxidase 1 promoter. Tricine-SDS-PAGE and Western blotting confirmed that the fusion protein TPS-linker-HGFI (TLH) was successfully secreted into the culture medium. The fusion protein TLH was purified by ultrafiltration and reverse-phase high performance liquid chromatography (RP-HPLC). Water contact angle (WCA) demonstrated that similar to recombinant HGFI (rHGFI), the purified TLH could convert the surface wettability of polystyrene and mica. X-ray photoelectron spectroscopy (XPS) measurements indicated that the purified TLH could form stable films on the hydrophobic siliconized glass surface. The cell adhesion examination showed that the TLH modified poly(ε-caprolactone) (PCL) could specially facilitate the EPC (particularly EPC derived from human) binding, while rHGFI modified PCL could nonselectively enhance cells adhesion. To the best of our knowledge, this is the first report that demonstrates that the TPS peptide was immobilized on biomaterial-PCL surface by fusion with hydrophobin. The potential application of this finding in combination with biomedical devices for EPC culture, will facilitate the current techniques used for cell-based therapies. Copyright © 2012 Elsevier Inc. All rights reserved.
Evaluation of signal transduction pathways after transient cutaneous adenoviral gene delivery
2011-01-01
Background Adenoviral vectors have provided effective methods for in vivo gene delivery in therapeutic applications. However, these vectors can induce immune responses that may severely affect the ability of vector re-application. There is limited information about the mechanisms and signal transduction pathways involved in adenoviral recognition. For optimization of cutaneous gene therapy it is necessary to investigate molecular mechanisms of virus recognition in epidermal cells. The aim of this study was to investigate the signal transduction of the innate immunity after adenoviral DNA internalization in keratinocytes. Methods In vitro, keratinocytes were transfected with DNA, in the presence and absence of inhibitors for signalling molecules. In vivo, immunocompetent and athymic mice (n = 3 per group) were twice transduced with an Ad-vector. Results The results show an acute induction of type-I-interferon after in vitro transfection. Inhibition of PI3K, p38 MAPK, JNK and NFkappaB resulted in a decreased expression of type-I-interferon. In contrast to immunocompetent mice, athymic mice demonstrated a constant transgene expression and reduced inflammatory response in vivo. Conclusion The results suggest an induction of the innate immunity triggered by cytoplasm localised DNA which is mediated by PI3K-, p38 MAPK-, JNK-, NFkappaB-, JAK/STAT- and ERK1/2-dependent pathways. A stable transgene expression and a reduced inflammatory response in immunodeficient mice have been observed. These results provide potential for an effective adenoviral gene delivery into immunosupressed skin. PMID:21255430
Sawamura, Jitsuki; Morishita, Shigeru; Ishigooka, Jun
2016-02-09
Previously, we applied basic group theory and related concepts to scales of measurement of clinical disease states and clinical findings (including laboratory data). To gain a more concrete comprehension, we here apply the concept of matrix representation, which was not explicitly exploited in our previous work. Starting with a set of orthonormal vectors, called the basis, an operator Rj (an N-tuple patient disease state at the j-th session) was expressed as a set of stratified vectors representing plural operations on individual components, so as to satisfy the group matrix representation. The stratified vectors containing individual unit operations were combined into one-dimensional square matrices [Rj]s. The [Rj]s meet the matrix representation of a group (ring) as a K-algebra. Using the same-sized matrix of stratified vectors, we can also express changes in the plural set of [Rj]s. The method is demonstrated on simple examples. Despite the incompleteness of our model, the group matrix representation of stratified vectors offers a formal mathematical approach to clinical medicine, aligning it with other branches of natural science.
Oki, Hiroshi; Yazawa, Takuya; Baba, Yasuko; Kanegae, Yumi; Sato, Hanako; Sakamoto, Seiko; Goto, Takahisa; Saito, Izumu; Kurahashi, Kiyoyasu
2017-07-01
Pulmonary emphysema impairs quality of life and increases mortality. It has previously been shown that administration of adenovirus vector expressing murine keratinocyte growth factor (KGF) before elastase instillation prevents pulmonary emphysema in mice. We therefore hypothesized that therapeutic administration of KGF would restore damage to lungs caused by elastase instillation and thus improve pulmonary function in an animal model. KGF expressing adenovirus vector, which prevented bleomycin-induced pulmonary fibrosis in a previous study, was constructed. Adenovirus vector (1.0 × 10 9 plaque-forming units) was administered intratracheally one week after administration of elastase into mouse lungs. One week after administration of KGF-vector, exercise tolerance testing and blood gas analysis were performed, after which the lungs were removed under deep anesthesia. KGF-positive pneumocytes were more numerous, surfactant protein secretion in the airspace greater and mean linear intercept of lungs shorter in animals that had received KGF than in control animals. Unexpectedly, however, arterial blood oxygenation was worse in the KGF group and maximum running speed, an indicator of exercise capacity, had not improved after KGF in mice with elastase-induced emphysema, indicating that KGF-expressing adenovirus vector impaired pulmonary function in these mice. Notably, vector lacking KGF-expression unit did not induce such impairment, implying that the KGF expression unit itself may cause the damage to alveolar cells. Possible involvement of the CAG promoter used for KGF expression in impairing pulmonary function is discussed. © 2017 The Societies and John Wiley & Sons Australia, Ltd.
Photorefractive Tungsten Bronze Crystals for Optical Limiters and Filters.
1996-01-01
vector , X is the laser light wavelength, 0 is the half- angle between the two crossing laser beams, and k0 is the Debye screening wave vector given by...between the grating and the dielectric constant E’ = 950) such that the grating’ vector is interference pattern, the intensities of the output beams from...substituting Io, I, and Id into expression 0 ple d 2o0o 25i00 (8), we can calculate the phase shift between the grating and Applied Electric Feild in V
College Bound in Middle School & High School? How Math Course Sequences Matter
ERIC Educational Resources Information Center
Finkelstein, Neal; Fong, Anthony; Tiffany-Morales, Juliet; Shields, Patrick; Huang, Min
2012-01-01
As California competes for jobs in an increasingly competitive global economy, the state faces a looming shortage of highly educated workers (PPIC, 2012). For a variety of reasons, the need for individuals with degrees in science, technology, engineering, and mathematics (STEM) is of particular concern. Nowhere is this more true than in the…
Making College Possible for Low-Income Students: Grant and Scholarship Aid in California
ERIC Educational Resources Information Center
Johnson, Hans
2014-01-01
Improving college access and completion is vital to California's economic well-being. Public Policy Institute of California (PPIC) projections show that the state will need one million more college graduates with a bachelor's degree by 2025 in order to satisfy labor force demand. As the costs of attending college have grown, grant and scholarship…
Main, Bradley J; Everitt, Amanda; Cornel, Anthony J; Hormozdiari, Fereydoun; Lanzaro, Gregory C
2018-04-04
Malaria mortality rates in sub-Saharan Africa have declined significantly in recent years as a result of increased insecticide-treated bed net (ITN) usage. A major challenge to further progress is the emergence and spread of insecticide resistance alleles in the Anopheles mosquito vectors, like An. coluzzii. A non-synonymous mutation in the para voltage-gated sodium channel gene reduces pyrethroid-binding affinity, resulting in knockdown resistance (kdr). Metabolic mechanisms of insecticide resistance involving detoxification genes like cytochrome P450 genes, carboxylesterases, and glutathione S-transferases are also important. As some gene activity is tissue-specific and/or environmentally induced, gene regulatory variation may be overlooked when comparing expression from whole mosquito bodies under standard rearing conditions. We detected complex insecticide resistance in a 2014 An. coluzzii colony from southern Mali using bottle bioassays. Additional bioassays involving recombinant genotypes from a cross with a relatively susceptible 1995 An. coluzzii colony from Mali confirmed the importance of kdr and associated increased permethrin resistance to the CYP9K1 locus on the X chromosome. Significant differential expression of CYP9K1 was not observed among these colonies in Malpighian tubules. However, the P450 gene CYP6Z1 was overexpressed in resistant individuals following sublethal permethrin exposure and the carboxylesterase gene COEAE5G was constitutively overexpressed. The significant P450-related insecticide resistance observed in the 2014 An. coluzzii colony indicates that ITNs treated with the P450 inhibitor piperonyl butoxide (PBO) would be more effective in this region. The known insecticide resistance gene CYP6Z1 was differentially expressed exclusively in the context of sublethal permethrin exposure, highlighting the importance of tissue-specificity and environmental conditions in gene expression studies. The increased activity of the carboxylesterase COEAE5G in the resistant An. coluzzii colony suggests resistance to other insecticides like organophosphates. Additional gene expression studies involving other tissues (e.g. fat body) would provide a more comprehensive view of genes underlying metabolic insecticide resistance in An. coluzzii from Mali. Identifying genetic markers linked to these regulatory alleles is an important next step that would substantially improve insecticide resistance surveillance and population genetic studies in this important vector species.
2012-01-01
Background Transient receptor potential channel type 6 (TRPV6) and Calbindin-D9k (CaBP-9k) are involved in the active calcium (Ca2+) transport mechanism in many tissues including placenta and uterus, suggesting a role in the establishment and maintenance of pregnancy. Moreover, TRPV6 and CaBP-9k seem to support the materno-fetal Ca2+ transport that is crucial for fetal Ca2+ homeostasis, bone growth and development. However, it is unknown if these proteins are also involved in the aetiology of pathologies associated with parturition in cows, such as retained fetal membranes (RFM). The aim of the current study was to create an expression profile of uterine and placentomal TRPV6 and CaBP-9k mRNAs and proteins during pregnancy and postpartum in cows with and without fetal membrane release. Methods Uteri and placentomes of 27 cows in different stages of pregnancy and placentomes of cows with and without RFM were collected. Protein and mRNA expression of TRPV6 and CaBP-9k was investigated by real-time PCR, immunohistochemistry and Western blot. Results In the uterine endometrium, highest TRPV6 and CaBP-9k expression was found in the last trimester of pregnancy, with a particular increase of protein in the glandular epithelium. In the placentomes, a gradual increase in TRPV6 mRNA was detectable towards parturition, while protein expression did not change significantly. Placentomal CaBP-9k expression did not change significantly throughout pregnancy but immunohistochemistry revealed an increase in staining intensity in the maternal crypt epithelium. Immunohistochemical, stronger placental CaBP-9k signals were seen in animals with RFM compared to animals with an undisturbed fetal membrane release, while protein levels, measured by Western blot analyses did not change significantly. Conclusions The results of the present study demonstrate a dynamic expression of TRPV6 and CaBP-9k during pregnancy in the bovine uterine endometrium and placentomes, suggesting a functional role for these proteins in Ca2+ metabolism during pregnancy. The temporal and spatial expression patterns indicate that TRPV6 and CaBP-9k may be involved in materno-fetal Ca2+ transport, mainly through an interplacentomal transport, and that both proteins may participate in physiological processes that are crucial for fetal and placental development. However, neither TRPV6 nor CaBP-9k seem to be causative in the retention of fetal membranes. PMID:22931437
NASA Technical Reports Server (NTRS)
Sooy, K.; Schermerhorn, T.; Noda, M.; Surana, M.; Rhoten, W. B.; Meyer, M.; Fleischer, N.; Sharp, G. W.; Christakos, S.
1999-01-01
The role of the calcium-binding protein, calbindin-D(28k) in potassium/depolarization-stimulated increases in the cytosolic free Ca(2+) concentration ([Ca(2+)](i)) and insulin release was investigated in pancreatic islets from calbindin-D(28k) nullmutant mice (knockouts; KO) or wild type mice and beta cell lines stably transfected and overexpressing calbindin. Using single islets from KO mice and stimulation with 45 mM KCl, the peak of [Ca(2+)](i) was 3.5-fold greater in islets from KO mice compared with wild type islets (p < 0.01) and [Ca(2+)](i) remained higher during the plateau phase. In addition to the increase in [Ca(2+)](i) in response to KCl there was also a significant increase in insulin release in islets isolated from KO mice. Evidence for modulation by calbindin of [Ca(2+)](i) and insulin release was also noted using beta cell lines. Rat calbindin was stably expressed in betaTC-3 and betaHC-13 cells. In response to depolarizing concentrations of K(+), insulin release was decreased by 45-47% in calbindin expressing betaTC cells and was decreased by 70-80% in calbindin expressing betaHC cells compared with insulin release from vector transfected betaTC or betaHC cells (p < 0.01). In addition, the K(+)-stimulated intracellular calcium peak was markedly inhibited in calbindin expressing betaHC cells compared with vector transfected cells (225 nM versus 1,100 nM, respectively). Buffering of the depolarization-induced rise in [Ca(2+)](i) was also observed in calbindin expressing betaTC cells. In summary, our findings, using both isolated islets from calbindin-D(28k) KO mice and beta cell lines, establish a role for calbindin in the modulation of depolarization-stimulated insulin release and suggest that calbindin can control the rate of insulin release via regulation of [Ca(2+)](i).
Belkacemi, Louiza; Gariépy, Gilles; Mounier, Catherine; Simoneau, Lucie; Lafond, Julie
2004-01-01
During pregnancy, the calcium (Ca(2+)) transport machinery of the placenta is solely responsible for the nutrient supply to the developing fetus, where active Ca(2+) transport occurs from the mother to the fetus. As part of a larger study to determine the role of Ca(2+) in placental transport in vivo, we questioned whether calbindin-D9k (CaBP9k), which is mainly expressed in duodenum, uterus, and placenta of several mammals, is present in cytotrophoblast cells and syncytiotrophoblasts of human term placenta. We were interested in this protein because of its potential importance in serving as an indicator of Ca(2+) availability and utilization in the placenta. Here, we demonstrated that CaBP9k transcript is present in both cell types, with a lower expression in cytotrophoblast cells as compared to syncytiotrophoblasts. Moreover, we showed by immunochemistry that CaBP9k protein was present in cytotrophoblast and syncytiotrophoblast placental tissue sections as well as in cultured cells. The occurrence of CaBP9k protein in trophoblast cells was further confirmed by Western blot analysis. Thus, these results indicate for the first time that CaBP9k is unequivocally expressed by trophoblast cells from human term placenta.
Liu, Ying; Jiang, Yu-xin; Li, Chao-pin
2011-12-01
To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.
Zhang, Fan; Cheng, Joseph; Lam, George; Jin, David K.; Vincent, Loïc; Hackett, Neil R.; Wang, Shiyang; Young, Lauren M.; Hempstead, Barbara; Crystal, Ronald G.; Rafii, Shahin
2010-01-01
Connexins (Cxs) provide a means for intercellular communication and play important roles in the pathophysiology of vascular cardiac diseases. Infection of endothelial cells (ECs) with first-generation E1/E3-deleted E4+ adenovirus (AdE4+) selectively modulates the survival and angiogenic potential of ECs by as of yet unrecognized mechanisms. We show here that AdE4+ vectors potentiate Cx expression in ECs in vitro and in mouse heart tissue. Infection of ECs with AdE4+, but not AdE4−, resulted in a time- and dose-dependent induction of junctional Cx40 expression and suppression of Cx43 protein and mRNA expression. Treatment of ECs with PKA inhibitor H89 or PI3K inhibitor LY294002 prevented the AdE4+-mediated regulation of Cx40 and Cx43 that was associated with diminished AdE4+-mediated survival of ECs. Moreover, both PKA activity and cAMP-response element (CRE)-binding activity were enhanced by treatment of ECs with AdE4+. However, there is no causal evidence of a cross-talk between the 2 modulatory pathways, PKA and PI3K. Remarkably, Cx40 immunostaining was markedly increased and Cx43 was decreased in the heart tissue of mice treated with intratracheal AdE4+. Taken together, these results suggest that AdE4+ may play an important role in the regulation of Cx expression in ECs, and that these effects are mediated by both the PKA/CREB and PI3K signaling pathways. PMID:15831817
Alamdar, Ambreen; Xi, Guochen; Huang, Qingyu; Tian, Meiping; Eqani, Syed Ali Musstjab Akber Shah; Shen, Heqing
2017-07-01
Arsenic exposure has been associated with male reproductive dysfunction by disrupting steroidogenesis; however, the roles of epigenetic drivers, especially histone methylation in arsenic-induced steroidogenic toxicity remain not well documented. In this study, we investigated the role of histone H3 lysine 9 (H3K9) methylation in steroidogenesis disturbance in mouse Leydig cells (MLTC-1) due to arsenic exposure. Our results indicated that mRNA and protein expression levels of 3β-hydroxysteroid dehydrogenase (3β-HSD) were both significantly up-regulated while the rest of key genes involved in steroidogenesis were down-regulated. Moreover, arsenic exposure significantly decreased the histone H3K9 di- and tri-methylation (H3K9me2/3) levels in MLTC-1 cells. Since H3K9 demethylation leads to gene activation, we further investigated whether the induction of 3β-HSD expression was ascribed to reduced H3K9 methylation. The results showed that H3K9me2/3 demethylase (JMJD2A) inhibitor, quercetin (Que) significantly attenuated the decrease of H3K9me2/3 and increase of 3β-HSD expression induced by arsenic. To further elucidate the mechanism for the activation of 3β-HSD, we determined the histone H3K9 methylation levels in Hsd3b gene promoter, which also showed significant decrease of H3K9me2/3 in the investigated region after arsenic exposure. Considering these results, we conclude that arsenic exposure induced 3β-HSD up-regulation by suppressing H3K9me2/3 status, which is suggested as a compensatory mechanism for steroidogenic disturbance in MLTC-1 cells. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rossomme, S; Renaud, J; Sarfehnia, A
2014-06-01
Purpose: To reduce the uncertainty of the beam quality correction factor k Q,Q0, for scattered proton beams (SPB). This factor is used in dosimetry protocols, to determine absorbed dose-to-water with ionization chambers. For the Roos plane parallel chambers (RPPICs), the IAEA TRS-398 protocol estimates k Q,Q0-factor to be 1.004(for a beam quality Rres=2 g.cm{sup 2}), with an uncertainty of 2.1%. Methods: A graphite calorimeter (GCal), a water calorimeter (WCal) and RPPICs were exposed, in a single experiment, to a 60 MeV non-modulated SPB. RPPICs were calibrated in terms of absorbed dose-to-water in a 20 MeV electron beam. The calibration coefficientmore » is traceable to NPL's absorbed dose standards. Chamber measurements were corrected for environmental conditions, recombination and polarity. The WCal corrections include heat loss, heat defect and vessel perturbation. The GCal corrections include heat loss and absorbed dose conversion. Except for heat loss correction and its uncertainty in the WCal system, all major corrections were included in the analysis. Other minor corrections, such as beam profile non-uniformity, are still to be evaluated. Experimental k Q,Q0-factors were derived by comparing the results obtained with both calorimeters and ionometry. Results: The absorbed dose-to-water from both calorimeters was found to be within 1.3% with an uncertainty of 1.2%. k Q,Q0-factor for a RPPIC was found to be 0.998 and 1.011, with a standard uncertainty of 1.4% and 0.9% when the dose is based on the GCal and the WCal, respectively. Conclusion: Results suggest the possibility to determine k Q,Q0-values for PPICs in SPB with a lower uncertainty than specified in the TRS-398 thereby helping to reduce uncertainty on absorbed dose-to-water. The agreement between calorimeters confirms the possibility to use GCal or WCal as primary standard in SPB. Because of the dose conversion, the use of GCal may lead to slightly higher uncertainty, but is, at present, considerably easier to operate.« less
Sustained ELABELA Gene Therapy in High-salt Diet-induced Hypertensive Rats.
Schreiber, Claire A; Holditch, Sara J; Generous, Alex; Ikeda, Yasuhiro
2017-01-01
Elabela (ELA) is a recently identified apelin receptor agonist essential for cardiac development, but its biology and therapeutic potential are unclear. In humans, ELA transcripts are detected in embryonic stem cells, induced pluripotent stem cells, kidney, heart and blood vessels. ELA through the apelin (APJ) receptor promotes angiogenesis in vitro, relaxes murine aortic blood vessels and attenuates high blood pressure in vivo. The APJ receptor when bound to its original ligand, apelin, exerts peripheral vasodilatory and positive inotropic effects, conferring cardioprotection in vivo. This study initially assessed endogenous ELA expression in normal and diseased rats and then characterized the effects of long-term ELA gene delivery by adeno-associated virus serotype 9 (AAV9) vectors on cardiorenal function in Dahl salt-sensitive rats (DS) on a high-salt diet over 3 months. Endogenous ELA was predominantly expressed in the kidneys, especially in the renal collecting duct cells and was not affected by disease. Rat ELA was overexpressed in the heart via AAV9 vector by a single intravenous injection. ELA-treated animals showed delayed onset of blood pressure elevation. Prior to high-salt diet, a reduction in the fractional sodium and chloride excretion was observed in rats given the AAV9-ELA vector. After three months on a high-salt diet, ELA preserved glomerular architecture, decreased renal fibrosis and suppressed expression of fibrosis-associated genes in the kidneys. ELA is constitutively expressed in renal collecting ducts in rats. Sustained AAV-ELA expression may offer a potential long-term therapy for hypertension and renal remodeling. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
de Solis, Christopher A.; Ho, Anthony; Holehonnur, Roopashri; Ploski, Jonathan E.
2016-01-01
The RNA-guided Cas9 nuclease, from the type II prokaryotic Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) adaptive immune system, has been adapted and utilized by scientists to edit the genomes of eukaryotic cells. Here, we report the development of a viral mediated CRISPR/Cas9 system that can be rendered inducible utilizing doxycycline (Dox) and can be delivered to cells in vitro and in vivo utilizing adeno-associated virus (AAV). Specifically, we developed an inducible gRNA (gRNAi) AAV vector that is designed to express the gRNA from a H1/TO promoter. This AAV vector is also designed to express the Tet repressor (TetR) to regulate the expression of the gRNAi in a Dox dependent manner. We show that H1/TO promoters of varying length and a U6/TO promoter can edit DNA with similar efficiency in vitro, in a Dox dependent manner. We also demonstrate that our inducible gRNAi vector can be used to edit the genomes of neurons in vivo within the mouse brain in a Dox dependent manner. Genome editing can be induced in vivo with this system by supplying animals Dox containing food for as little as 1 day. This system might be cross compatible with many existing S. pyogenes Cas9 systems (i.e., Cas9 mouse, CRISPRi, etc.), and therefore it likely can be used to render these systems inducible as well. PMID:27587996
All-in-One CRISPR-Cas9/FokI-dCas9 Vector-Mediated Multiplex Genome Engineering in Cultured Cells.
Sakuma, Tetsushi; Sakamoto, Takuya; Yamamoto, Takashi
2017-01-01
CRISPR-Cas9 enables highly convenient multiplex genome engineering in cultured cells, because it utilizes generic Cas9 nuclease and an easily customizable single-guide RNA (sgRNA) for site-specific DNA double-strand break induction. We previously established a multiplex CRISPR-Cas9 assembly system for constructing an all-in-one vector simultaneously expressing multiple sgRNAs and Cas9 nuclease or other Cas9 variants including FokI-dCas9, which supersedes the wild-type Cas9 with regard to high specificity. In this chapter, we describe a streamlined protocol to design and construct multiplex CRISPR-Cas9 or FokI-dCas9 vectors, to introduce them into cultured cells by lipofection or electroporation, to enrich the genomically edited cells with a transient puromycin selection, to validate the mutation efficiency by Surveyor nuclease assay, and to perform off-target analyses. We show that our protocol enables highly efficient multiplex genome engineering even in hard-to-transfect HepG2 cells.
Ethylene induces combinatorial effects of histone H3 acetylation in gene expression in Arabidopsis.
Wang, Likai; Zhang, Fan; Rode, Siddharth; Chin, Kevin K; Ko, Eun Esther; Kim, Jonghwan; Iyer, Vishwanath R; Qiao, Hong
2017-07-17
Histone acetylation and deacetylation are essential for gene regulation and have been implicated in the regulation of plant hormone responses. Many studies have indicated the role of histone acetylation in ethylene signaling; however, few studies have investigated how ethylene signaling regulates the genomic landscape of chromatin states. Recently, we found that ethylene can specifically elevate histone H3K14 acetylation and the non-canonical histone H3K23 acetylation in etiolated seedlings and the gene activation is positively associated with the elevation of H3K14Ac and H3K23Ac in response to ethylene. To assess the role of H3K9, H3K14, and H3K23 histone modifications in the ethylene response, we examined how ethylene regulates histone acetylation and the transcriptome at global level and in ethylene regulated genes both in wild type (Col-0) and ein2-5 seedlings. Our results revealed that H3K9Ac, H3K14Ac, and H3K23Ac are preferentially enriched around the transcription start sites and are positively correlated with gene expression levels in Col-0 and ein2-5 seedlings both with and without ethylene treatment. In the absence of ethylene, no combinatorial effect of H3K9Ac, H3K14Ac, and H3K23Ac on gene expression was detected. In the presence of ethylene, however, combined enrichment of the three histone acetylation marks was associated with high gene expression levels, and this ethylene-induced change was EIN2 dependent. In addition, we found that ethylene-regulated genes are expressed at medium or high levels, and a group of ethylene regulated genes are marked by either one of H3K9Ac, H3K14Ac or H3K23Ac. In this group of genes, the levels of H3K9Ac were altered by ethylene, but in the absence of ethylene the levels of H3K9Ac and peak breadths are distinguished in up- and down- regulated genes. In the presence of ethylene, the changes in the peak breadths and levels of H3K14Ac and H3K23Ac are required for the alteration of gene expressions. Our study reveals that the plant hormone ethylene induces combinatorial effects of H3K9Ac, K14Ac and K23Ac histone acetylation in gene expression genome widely. Further, for a group of ethylene regulated genes, in the absence of ethylene the levels and the covered breadths of H3K9Ac are the preexist markers for distinguishing up- and down- regulated genes, the change in the peak breadths and levels of H3K14Ac and H3K23Ac are required for the alteration of gene expression in the presence of ethylene.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ding, Donglin; Qu, Xiying; Li, Lin
Understanding the mechanism of HIV-1 latency is crucial to eradication of the viral reservoir in HIV-1-infected individuals. However, the role of histone methyltransferase (HMT) G9a-like protein (GLP) in HIV-1 latency is still unclear. In the present work, we established four clonal cell lines containing HIV-1 vector. We found that the integration sites of most clonal cell lines favored active gene regions. However, we also observed hypomethylation of CpG of HIV 5′LTR in all four clonal cell lines. Additionally, 5′-deoxy-5′-methylthioadenosine (MTA), a broad-spectrum histone methyltransferase inhibitor, was used to examine the role of histone methylation in HIV-1 latency. MTA was foundmore » to decrease the level of H3K9 dimethylation, causing reactivation of latent HIV-1 in C11 cells. GLP knockdown by small interfering RNA clearly induced HIV-1 LTR expression. Results suggest that GLP may play a significant role in the maintenance of HIV-1 latency by catalyzing dimethylation of H3K9. - Highlights: ► We have established an in vitro model of HIV-1 latency. ► The integration sites of most clonal cell lines favor in active gene regions. ► Hypomethylation occurs in CpG islands of HIV 5′LTR in all four clonal cell lines. ► MTA can reactivate latent HIV-1 by decreasing the level of H3K9 me2 in C11 cells. ► HMT GLP may play a significant role in the maintenance of HIV-1 latency.« less
Langouet-Astrie, Christophe J; Yang, Zhiyong; Polisetti, Sraavya M; Welsbie, Derek S; Hauswirth, William W; Zack, Donald J; Merbs, Shannath L; Enke, Raymond A
2016-10-01
Targeted expression of Cre recombinase in murine retinal ganglion cells (RGCs) by viral vector is an effective strategy for creating tissue-specific gene knockouts for investigation of genetic contribution to RGC degeneration associated with optic neuropathies. Here we characterize dosage, efficacy and toxicity for sufficient intravitreal delivery of a capsid mutant Adeno-associated virus 2 (AAV2) vector encoding Cre recombinase. Wild type and Rosa26 (R26) LacZ mice were intravitreally injected with capsid mutant AAV2 viral vectors. Murine eyes were harvested at intervals ranging from 2 weeks to 15 weeks post-injection and were assayed for viral transduction, transgene expression and RGC survival. 10(9) vector genomes (vg) were sufficient for effective in vivo targeting of murine ganglion cell layer (GCL) retinal neurons. Transgene expression was observed as early as 2 weeks post-injection of viral vectors and persisted to 11 weeks. Early expression of Cre had no significant effect on RGC survival, while significant RGC loss was detected beginning 5 weeks post-injection. Early expression of viral Cre recombinase was robust, well-tolerated and predominantly found in GCL neurons suggesting this strategy can be effective in short-term RGC-specific mutation studies in experimental glaucoma models such as optic nerve crush and transection experiments. RGC degeneration with Cre expression for more than 4 weeks suggests that Cre toxicity is a limiting factor for targeted mutation strategies in RGCs. Copyright © 2016 Elsevier Ltd. All rights reserved.
Matassov, Demetrius; Marzi, Andrea; Latham, Terri; Xu, Rong; Ota-Setlik, Ayuko; Feldmann, Friederike; Geisbert, Joan B.; Mire, Chad E.; Hamm, Stefan; Nowak, Becky; Egan, Michael A.; Geisbert, Thomas W.; Eldridge, John H.; Feldmann, Heinz; Clarke, David K.
2015-01-01
Previously, recombinant vesicular stomatitis virus (rVSV) pseudotypes expressing Ebolavirus glycoproteins (GPs) in place of the VSV G protein demonstrated protection of nonhuman primates from lethal homologous Ebolavirus challenge. Those pseudotype vectors contained no additional attenuating mutations in the rVSV genome. Here we describe rVSV vectors containing a full complement of VSV genes and expressing the Ebola virus (EBOV) GP from an additional transcription unit. These rVSV vectors contain the same combination of attenuating mutations used previously in the clinical development pathway of an rVSV/human immunodeficiency virus type 1 vaccine. One of these rVSV vectors (N4CT1-EBOVGP1), which expresses membrane-anchored EBOV GP from the first position in the genome (GP1), elicited a balanced cellular and humoral GP-specific immune response in mice. Guinea pigs immunized with a single dose of this vector were protected from any signs of disease following lethal EBOV challenge, while control animals died in 7–9 days. Subsequently, N4CT1-EBOVGP1 demonstrated complete, single-dose protection of 2 macaques following lethal EBOV challenge. A single sham-vaccinated macaque died from disease due to EBOV infection. These results demonstrate that highly attenuated rVSV vectors expressing EBOV GP may provide safer alternatives to current EBOV vaccines. PMID:26109675
Gui, Tao; Zhang, Meiling; Chen, Jianwen; Zhang, Yuanliang; Zhou, Naru; Zhang, Yu; Tao, Jia; Sui, Liucai; Li, Yunsheng; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai
2012-08-01
A vector expressing human lysozyme (pBC1-hLYZ-GFP-Neo) was evaluated for gene and protein expression following liposome-mediated transformation of C-127 mouse mammary cancer cells. Cultures of G418-resistant clones were harvested 24-72 h after induction with prolactin, insulin and hydrocortisone. Target gene expression was analyzed by RT-PCR and Western blot and recombinant human lysozyme (rhLYZ) bacteriostatic activity was also evaluated. The hLYZ gene was correctly transcribed and translated in C-127 cells and hLYZ inhibited gram-positive bacterial growth, indicating the potential of this expression vector for development of a mammary gland bioreactor in goats. Guanzhong dairy goat skin fibroblasts transfected with pBC1-hLYZ-GFP-Neo were used to construct a goat embryo transgenically expressing rhLYZ by somatic nuclear transplantation with a blastocyst rate of 9.0 ± 2.8 %. These data establish the basis for cultivation of mastitis-resistant hLYZ transgenic goats.
Schuller, D J; Fetter, C H; Banaszak, L J; Grant, G A
1989-02-15
The serA gene of Escherichia coli strain K-12, which codes for the cooperative allosteric enzyme D-3-phosphoglycerate dehydrogenase, was inserted into an inducible expression vector which produced phosphoglycerate dehydrogenase as 8% of the soluble protein of E. coli. The purified protein was used to grow several different single crystal forms. One of these, with space group P2(1), appears to contain all four subunits of the tetrameric enzyme in the asymmetric unit and diffracts to sufficient resolution to allow determination of the structure of phosphoglycerate dehydrogenase.
A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants[OPEN
Gil-Humanes, Javier; Čegan, Radim; Kono, Thomas J.Y.; Konečná, Eva; Belanto, Joseph J.; Starker, Colby G.
2017-01-01
We report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A Web-based tool streamlines vector selection and construction. One advantage of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 (Csy4) and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing 12 gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare). PMID:28522548
A multi-purpose toolkit to enable advanced genome engineering in plants
Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier; ...
2017-05-18
Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less
A multi-purpose toolkit to enable advanced genome engineering in plants
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier
Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less
Chung, T; Huang, J S; Mukherjee, J J; Crilly, K S; Kiss, Z
2000-05-01
In mammalian cells, growth factors, oncogenes, and carcinogens stimulate phosphocholine (PCho) synthesis by choline kinase (CK), suggesting that PCho may regulate cell growth. To validate the role of PCho in mitogenesis, we determined the effects of insulin, insulin-like growth factor I (IGF-I), and other growth factors on DNA synthesis in NIH 3T3 fibroblast sublines highly expressing human choline kinase (CK) without increasing phosphatidylcholine synthesis. In serum-starved CK expressor cells, insulin and IGF-I stimulated DNA synthesis, p70 S6 kinase (p70 S6K) activity, phosphatidylinositol 3-kinase (PI3K) activity, and activating phosphorylation of p42/p44 mitogen-activated protein kinases (MAPK) to greater extents than in the corresponding vector control cells. Furthermore, the CK inhibitor hemicholinium-3 (HC-3) inhibited insulin- and IGF-I-induced DNA synthesis in the CK overexpressors, but not in the vector control cells. The results indicate that high cellular levels of PCho potentiate insulin- and IGF-I-induced DNA synthesis by MAPK- and p70 S6K-regulated mechanisms.
Yoneyama, T; Akatsuka, T; Miyamura, T
1988-08-01
The large BglII fragment (2.8 kilobases) of hepatitis B virus DNA including the transcription unit for the hepatitis B surface antigen (HBsAg) was inserted into a bovine papillomavirus vector containing the neomycin resistance gene. The recombinant DNA was transfected into mouse C127 cells. A stable transformed cell line (MS128) secreting a large amount of 22 nm HBsAg particles containing pre-S2 protein was established. The secreted HBsAg particles had the receptor for polymerized human serum albumin. Immunoprecipitation and Western blot analyses showed that HBsAg particles consisted of two major proteins of 22K and 26K encoded by the S gene and a minor protein of 35K encoded by the pre-S2 and S genes. Southern blot analysis revealed that the transfected plasmid was integrated into the host chromosomal DNA and that most of the plasmid sequences were present. These results suggest that the stable expression of the HBsAg in MS128 cells is related to the integrated state of the recombinant DNA.
Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).
Ken, C F; Lin, C T; Wu, J L; Shaw, J F
2000-06-01
A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.
A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.
Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu
2015-05-01
Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Li, Da; Ping, Yuan; Xu, Fujian; Yu, Hai; Pan, Hongming; Huang, Hongliang; Wang, Qingqing; Tang, Guping; Li, Jun
2010-09-13
The success of cancer gene therapy highly relies on the gene delivery vector with high transfection activity and low toxicity. In the present study, eight-armed polyethylene glycol (EAP) and low molecular weight (LMW) polyethylenimine (PEI) were used as basic units to construct the architecture of a new star-shaped EAP-PEI copolymer (EAPP). MC11, a peptide capable of selectively binding fibroblast growth factor receptor (FGFR) on tumor cell membranes, was further conjugated to EAPP to produce the vector EAPP-MC11 (EAPPM) to enhance tumor targetability. This tumor-targeting vector EAPPM was observed to retard the plasmids mobility at a nitrogen/phosphorus (N/P) ratio of 3. The vector could efficiently condense plasmids within 300 nm nanoparticles with a positive zeta potential at the N/P ratio of 20 or above. While the cytotoxicity of EAPPM polyplexes was similar to that of LMW PEI, it was significantly lower than that of PEI (25 kDa) in HepG2 and PC3 cell lines. In vitro gene transfection with pDNA mediated by EAPPM showed that the transfection efficiency increased 15 times in HepG2 cells but remained at a similar level in PC3 cells in comparison with that of EAPP. By systemic injection of EAPPM/pDNA complexes into a HepG2-bearing mice model, luciferase expression detected in lung, liver, and tumor tissues demonstrated EAPPM could deliver in a targeted manner a reporter gene into tumor tissues, where the luciferase expression of EAPPM was 4 times higher than that of EAPP and even 23 times higher than that of PEI (25 kDa). Furthermore, it was found that the systemic delivery of EAPPM/pCSK-α-interferon complexes in vivo were much more effective in inhibiting tumor growth than EAPP or PEI (25 kDa). These results clearly show that EAPPM is an efficient and safe vector for FGFR-mediated targeted gene delivery both in vitro and in vivo. With low cytotoxicity and high targetability, EAPPM may have great potential as a delivery vector for future cancer gene therapy applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hong, Gia-Ming; Present address: The University of Chicago, Section of Hematology/Oncology, 900 E. 57th Street, Room 7134, Chicago, IL 60637; Bain, Lisa J., E-mail: lbain@clemson.edu
2012-05-01
Arsenic is a toxicant commonly found in water systems and chronic exposure can result in adverse developmental effects including increased neonatal death, stillbirths, and miscarriages, low birth weight, and altered locomotor activity. Previous studies indicate that 20 nM sodium arsenite exposure to C2C12 mouse myocyte cells delayed myoblast differentiation due to reduced myogenin expression, the transcription factor that differentiates myoblasts into myotubes. In this study, several mechanisms by which arsenic could alter myogenin expression were examined. Exposing differentiating C2C12 cells to 20 nM arsenic increased H3K9 dimethylation (H3K9me2) and H3K9 trimethylation (H3K9me3) by 3-fold near the transcription start site ofmore » myogenin, which is indicative of increased repressive marks, and reduced H3K9 acetylation (H3K9Ac) by 0.5-fold, indicative of reduced permissive marks. Protein expression of Glp or Ehmt1, a H3-K9 methyltransferase, was also increased by 1.6-fold in arsenic-exposed cells. In addition to the altered histone remodeling status on the myogenin promoter, protein and mRNA levels of Igf-1, a myogenic growth factor, were significantly repressed by arsenic exposure. Moreover, a 2-fold induction of Ezh2 expression, and an increased recruitment of Ezh2 (3.3-fold) and Dnmt3a (∼ 2-fold) to the myogenin promoter at the transcription start site (− 40 to + 42), were detected in the arsenic-treated cells. Together, we conclude that the repressed myogenin expression in arsenic-exposed C2C12 cells was likely due to a combination of reduced expression of Igf-1, enhanced nuclear expression and promoter recruitment of Ezh2, and altered histone remodeling status on myogenin promoter (− 40 to + 42). -- Highlights: ► Igf-1 expression is decreased in C2C12 cells after 20 nM arsenite exposure. ► Arsenic exposure alters histone remodeling on the myogenin promoter. ► Glp expression, a H3–K9 methyltransferase, was increased in arsenic-exposed cells. ► Ezh2 and Dnmt3a localization to the myogenin promoter is induced by arsenic.« less
Roth, Justin C.; Ismail, Mourad; Reese, Jane S.; Lingas, Karen T.; Ferrari, Giuliana; Gerson, Stanton L.
2012-01-01
The P140K point mutant of MGMT allows robust hematopoietic stem cell (HSC) enrichment in vivo. Thus, dual-gene vectors that couple MGMT and therapeutic gene expression have allowed enrichment of gene-corrected HSCs in animal models. However, expression levels from dual-gene vectors are often reduced for one or both genes. Further, it may be desirable to express selection and therapeutic genes at distinct stages of cell differentiation. In this regard, we evaluated whether hematopoietic cells could be efficiently cotransduced using low MOIs of two separate single-gene lentiviruses, including MGMT for dual-positive cell enrichment. Cotransduction efficiencies were evaluated using a range of MGMT : GFP virus ratios, MOIs, and selection stringencies in vitro. Cotransduction was optimal when equal proportions of each virus were used, but low MGMT : GFP virus ratios resulted in the highest proportion of dual-positive cells after selection. This strategy was then evaluated in murine models for in vivo selection of HSCs cotransduced with a ubiquitous MGMT expression vector and an erythroid-specific GFP vector. Although the MGMT and GFP expression percentages were variable among engrafted recipients, drug selection enriched MGMT-positive leukocyte and GFP-positive erythroid cell populations. These data demonstrate cotransduction as a mean to rapidly enrich and evaluate therapeutic lentivectors in vivo. PMID:22888445
Chen, Jigang; Guo, Yanhong; Zeng, Wei; Huang, Li; Pang, Qi; Nie, Ling; Mu, Jiao; Yuan, Fahuan; Feng, Bing
2014-04-15
Epigenetics plays a key role in the pathogenesis of diabetic nephropathy (DN), although the precise regulatory mechanism is still unclear. Here, we examined the role of endoplasmic reticulum (ER) stress in histone H3 lysine 4 (H3K4) methyltransferase SET7/9-induced monocyte chemoattractant protein-1 (MCP-1) expression in the kidneys of db/db mice. Our results indicate that the expression of MCP-1 significantly increased in the kidneys of db/db mice in a time-dependent manner. An increased chromatin mark associated with an active gene (H3K4me1) at MCP-1 promoters accompanied this change in expression. The expression of SET7/9 and the recruitment to these promoters were also elevated. SET7/9 gene silencing with small interfering (si) RNAs significantly attenuated the expression of H3K4me1 and MCP-1. Furthermore, expression of signaling regulator glucose-regulated protein 78 (GRP78), a monitor of ER stress, significantly increased in the kidneys of db/db mice. The expression of spliced X-box binding protein 1 (XBP1s), an ER stress-inducible transcription factor, and recruitment to the SET7/9 promoters were also increased. XBP1s gene silencing with siRNAs significantly attenuated the expression of SET7/9, H3K4me1, and MCP-1. The chaperone betaine not only effectively downregulated the GRP78 and XBP1s expression levels but also markedly decreased the SET7/9, H3K4me1, and MCP-1 levels. Luciferase reporter assay demonstrated that XBP1s participated in ER stress-induced SET7/9 transcription, Taken together, these results reveal that ER stress can trigger the expression of MCP-1, in part through the XBP1s-mediated induction of SET7/9.
Jeong, Young-Hee; Kim, Yeong Ji; Kim, Eun Young; Kim, Se Eun; Kim, Jiwoo; Park, Min Jee; Lee, Hong-Gu; Park, Se Pill; Kang, Man-Jong
2016-06-01
Many transgenic domestic animals have been developed to produce therapeutic proteins in the mammary gland, and this approach is one of the most important methods for agricultural and biomedical applications. However, expression and secretion of a protein varies because transgenes are integrated at random sites in the genome. In addition, distal enhancers are very important for transcriptional gene regulation and tissue-specific gene expression. Development of a vector system regulated accurately in the genome is needed to improve production of therapeutic proteins. The objective of this study was to develop a knock-in system for expression of human fibroblast growth factor 2 (FGF2) in the bovine β-casein gene locus. The F2A sequence was fused to the human FGF2 gene and inserted into exon 3 of the β-casein gene. We detected expression of human FGF2 mRNA in the HC11 mouse mammary epithelial cells by RT-PCR and human FGF2 protein in the culture media using western blot analysis when the knock-in vector was introduced. We transfected the knock-in vector into bovine ear fibroblasts and produced knock-in fibroblasts using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. Moreover, the CRISPR/Cas9 system was more efficient than conventional methods. In addition, we produced knock-in blastocysts by somatic cell nuclear transfer using the knock-in fibroblasts. Our knock-in fibroblasts may help to create cloned embryos for development of transgenic dairy cattle expressing human FGF2 protein in the mammary gland via the expression system of the bovine β-casein gene.
Systemic AAV8-Mediated Gene Therapy Drives Whole-Body Correction of Myotubular Myopathy in Dogs.
Mack, David L; Poulard, Karine; Goddard, Melissa A; Latournerie, Virginie; Snyder, Jessica M; Grange, Robert W; Elverman, Matthew R; Denard, Jérôme; Veron, Philippe; Buscara, Laurine; Le Bec, Christine; Hogrel, Jean-Yves; Brezovec, Annie G; Meng, Hui; Yang, Lin; Liu, Fujun; O'Callaghan, Michael; Gopal, Nikhil; Kelly, Valerie E; Smith, Barbara K; Strande, Jennifer L; Mavilio, Fulvio; Beggs, Alan H; Mingozzi, Federico; Lawlor, Michael W; Buj-Bello, Ana; Childers, Martin K
2017-04-05
X-linked myotubular myopathy (XLMTM) results from MTM1 gene mutations and myotubularin deficiency. Most XLMTM patients develop severe muscle weakness leading to respiratory failure and death, typically within 2 years of age. Our objective was to evaluate the efficacy and safety of systemic gene therapy in the p.N155K canine model of XLMTM by performing a dose escalation study. A recombinant adeno-associated virus serotype 8 (rAAV8) vector expressing canine myotubularin (cMTM1) under the muscle-specific desmin promoter (rAAV8-cMTM1) was administered by simple peripheral venous infusion in XLMTM dogs at 10 weeks of age, when signs of the disease are already present. A comprehensive analysis of survival, limb strength, gait, respiratory function, neurological assessment, histology, vector biodistribution, transgene expression, and immune response was performed over a 9-month study period. Results indicate that systemic gene therapy was well tolerated, prolonged lifespan, and corrected the skeletal musculature throughout the body in a dose-dependent manner, defining an efficacious dose in this large-animal model of the disease. These results support the development of gene therapy clinical trials for XLMTM. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.
Schmitz, M; Graf, C; Gut, T; Sirena, D; Peter, I; Dummer, R; Greber, U F; Hemmi, S
2006-06-01
Replicating adenovirus (Ad) vectors with tumour tissue specificity hold great promise for treatment of cancer. We have recently constructed a conditionally replicating Ad5 AdDeltaEP-TETP inducing tumour regression in a xenograft mouse model. For further improvement of this vector, we introduced four genetic modifications and analysed the viral cytotoxicity in a large panel of melanoma cell lines and patient-derived melanoma cells. (1) The antiapoptotic gene E1B-19 kDa (Delta19 mutant) was deleted increasing the cytolytic activity in 18 of 21 melanoma cells. (2) Introduction of the E1A 122-129 deletion (Delta24 mutant), suggested to attenuate viral replication in cell cycle-arrested cells, did not abrogate this activity and increased the cytolytic activity in two of 21 melanoma cells. (3) We inserted an RGD sequence into the fiber to extend viral tropism to alphav integrin-expressing cells, and (4) swapped the fiber with the Ad35 fiber (F35) enhancing the tropism to malignant melanoma cells expressing CD46. The RGD-fiber modification strongly increased cytolysis in all of the 11 CAR-low melanoma cells. The F35 fiber-chimeric vector boosted the cytotoxicity in nine of 11 cells. Our results show that rational engineering additively enhances the cytolytic potential of Ad vectors, a prerequisite for the development of patient-customized viral therapies.
Yao, X; Yoshioka, Y; Morishige, T; Eto, Y; Watanabe, H; Okada, Y; Mizuguchi, H; Mukai, Y; Okada, N; Nakagawa, S
2009-12-01
Cancer gene therapy by adenovirus vectors (Advs) for metastatic cancer is limited because systemic administration of Adv produces low therapeutic effect and severe side effects. In this study, we generated a dual cancer-specific targeting vector system by using PEGylation and the telomere reverse transcriptase (TERT) promoter and attempted to treat experimental metastases through systemic administration of the vectors. We first optimized the molecular size of PEG and modification ratios used to create PEG-Ads. Systemic administration of PEG-Ad with 20-kDa PEG at a 45% modification ratio (PEG[20K/45%]-Ad) resulted in higher tumor-selective transgene expression than unmodified Adv. Next, we examined the effectiveness against metastases and side effects of a TERT promoter-driven PEG[20K/45%]-Ad containing the herpes simplex virus thymidine kinase (HSVtk) gene (PEG-Ad-TERT/HSVtk). Systemic administration of PEG-Ad-TERT/HSVtk showed superior antitumor effects against metastases with negligible side effects. A cytomegalovirus (CMV) promoter-driven PEG[20K/45%]-Ad also produced antimetastatic effects, but these were accompanied by side effects. Combining PEG-Ad-TERT/HSVtk with etoposide or 5-fluorouracil enhanced the therapeutic effects with negligible side effects. These results suggest that modification with 20-kDa PEG at a 45% modification ratio is the optimal condition for PEGylation of Adv, and PEG-Ad-TERT/HSVtk is a prototype Adv for systemic cancer gene therapy against metastases.
Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G; Corydon, Thomas J; Mikkelsen, Jacob Giehm; Aagaard, Lars
2015-08-01
Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo.
Jakobsen, Maria; Askou, Anne Louise; Stenderup, Karin; Rosada, Cecilia; Dagnæs-Hansen, Frederik; Jensen, Thomas G.; Corydon, Thomas J.; Mikkelsen, Jacob Giehm; Aagaard, Lars
2015-01-01
Skin is an easily accessible organ, and therapeutic gene transfer to skin remains an attractive alternative for the treatment of skin diseases. Although we have previously documented potent lentiviral gene delivery to human skin, vectors based on adeno-associated virus (AAV) rank among the most promising gene delivery tools for in vivo purposes. Thus, we compared the potential usefulness of various serotypes of recombinant AAV vectors and lentiviral vectors for gene transfer to human skin in a xenotransplanted mouse model. Vector constructs encoding firefly luciferase were packaged in AAV capsids of serotype 1, 2, 5, 6, 8, and 9 and separately administered by intradermal injection in human skin transplants. For all serotypes, live bioimaging demonstrated low levels of transgene expression in the human skin graft, and firefly luciferase expression was observed primarily in neighboring tissue outside of the graft. In contrast, gene delivery by intradermally injected lentiviral vectors was efficient and led to extensive and persistent firefly luciferase expression within the human skin graft only. The study demonstrates the limited capacity of single-stranded AAV vectors of six commonly used serotypes for gene delivery to human skin in vivo. PMID:26204415
Role for chondroitin sulfate glycosaminoglycan in NEDD9-mediated breast cancer cell growth.
Iida, Joji; Dorchak, Jesse; Clancy, Rebecca; Slavik, Juliana; Ellsworth, Rachel; Katagiri, Yasuhiro; Pugacheva, Elena N; van Kuppevelt, Toin H; Mural, Richard J; Cutler, Mary Lou; Shriver, Craig D
2015-01-15
There are lines of evidence demonstrating that NEDD9 (Cas-L, HEF-1) plays a key role in the development, progression, and metastasis of breast cancer cells. We previously reported that NEDD9 plays a critical role for promoting migration and growth of MDA-MB-231. In order to further characterize the mechanisms of NEDD9-mediated cancer migration and growth, stable cells overexpressing NEDD9 were generated using HCC38 as a parental cell line which expresses low level of endogenous NEDD9. Microarray studies demonstrated that core proteins of CD44 and Serglycin were markedly upregulated in HCC38(NEDD9) cells compared to HCC38(Vector) cells, while those of Syndecan-1, Syndecan-2, and Versican were downregulated in HCC38(NEDD9). Importantly, enzymes generating chondroitin sulfate glycosaminoglycans (CS) such as CHST11, CHST15, and CSGALNACT1 were upregulated in HCC38(NEDD9) compared to HCC38(Vector). Immunofluorescence studies using specific antibody, GD3G7, confirmed the enhanced expression of CS-E subunit in HCC38(NEDD9). Immunoprecipitation and western blotting analysis demonstrated that CS-E was attached to CD44 core protein. We demonstrated that removing CS by chondroitinase ABC significantly inhibited anchorage-independent colony formation of HCC38(NEDD9) in methylcellulose. Importantly, the fact that GD3G7 significantly inhibited colony formation of HCC38(NEDD9) cells suggests that CS-E subunit plays a key role in this process. Furthermore, treatment of HCC38(NEDD9) cells with chondroitinase ABC or GD3G7 significantly inhibited mammosphere formation. Exogenous addition of CS-E enhanced colony formation and mammosphere formation of HCC38 parental and HCC38(Vector) cells. These results suggest that NEDD9 regulates the synthesis and expression of tumor associated glycocalyx structures including CS-E, which plays a key role in promoting and regulating breast cancer progression and metastasis and possibly stem cell phenotypes. Copyright © 2014 Elsevier Inc. All rights reserved.
Bombyx mori nucleopolyhedrovirus orf25 encodes a 30kDa late protein in the infection cycle.
Wang, Haiyan; Chen, Keping; Guo, Zhongjian; Yao, Qin
2008-02-01
Bombyx mori nucleopolyhedrovirus (BmNPV) orf25 gene was characterized for the first time. The coding sequence of Bm25 was amplified and subcloned into the prokaryotic expression vector pGEX-4T-2 to produce glutathione S-transferase-tagged fusion protein in the BL21 (DE3) cells. The GST-Bm25 fusion protein was expressed efficiently after induction with IPTG. The purified fusion protein was used to immunize New Zealand white rabbits to prepare polyclonal antibody. Temporal expression analysis revealed a 30-kDa protein, which was detected beginning 24 hours post-infection using a polyclonal antibody against GST-Bm25 fusion protein. The transcript of Bm25 was detected by RT-PCR at 18-72 h p.i. In conclusion, the available data suggest that Bm25 encodes a 30kDa protein expressed in the late stage of infection cycle.
Sun, Li-Chun; Luo, Jing; Mackey, L Vienna; Fuselier, Joseph A; Coy, David H
2007-02-08
Camptothecin (CPT) was conjugated to the N-terminal of a somatostatin analog (SSA) directly via a carbamate group and a basic N-terminal linking motif, D-Lys-D-Tyr-Lys-D-Tyr-D-Lys. This new CPT-SSA conjugate termed JF-10-81 was evaluated as a receptor-specific delivery system for its anti-invasive and anti-angiogenic activities. It was found that, in addition to blocking migration and invasion of highly invasive prostate cancer PC-3 cells, this conjugate also inhibited in vitro capillary-like tube formation of endothelial cells and in vivo angiogenesis in C57B1/6N female mice. JF-10-81 was found to block PC-3 cell attachment to various extracellular matrix components, mainly to vitronectin, the ligand of cell surface receptors integrin alphaVbeta3 and alphaVbeta5. Additionally, JF-10-81 reduced expression of integrins alphaVbeta3 and alphaVbeta5 on PC-3 cell surfaces, without effects on beta1 or any alphabeta1 heterodimers. This conjugate also inactivated phosphorylation of protein kinase B (PKB/Akt), down-regulated the expression of latent matrix metalloproteinase (MMP) -2 and MMP-9, but had little effect on MMP-3/-10. Meanwhile, membrane type-1 matrix metalloproteinase (MT1-MMP) and the tissue inhibitor of matrix metalloproteinase-2 (TIMP-2) were not detectable in PC-3 cells. alphaVbeta3/alphaVbeta5 and MMP-2/-9 are known to be highly expressed in many tumor cells and play an important role in tumor progression. Our results support that this conjugate could possibly inhibit prostate cancer PC-3 cell invasion through a signaling pathway involving PI3K/Akt, alphaVbeta3/alphaVbeta5 and MMP-2/-9, and this SSA could be used as an efficient vector to deliver CPT or other cytotoxic agents to target sites for cancer therapy.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Minjgee, Minjmaa; Toulany, Mahmoud; Kehlbach, Rainer
2011-12-01
Purpose: It is known that postirradiation survival of tumor cells presenting mutated K-RAS is mediated through autocrine activation of epidermal growth factor receptor (EGFR). In this study the molecular mechanism of radioresistance of cells overexpressing mutated K-RAS(V12) was investigated. Methods and Materials: Head-and-neck cancer cells (FaDu) presenting wild-type K-RAS were transfected with empty vector or vector expressing mutated K-RAS(V12). The effect of K-RAS(V12) on autocrine production of EGFR ligands, activation of EGFR downstream pathways, DNA damage repair, and postirradiation survival was analyzed. Results: Conditioned medium collected from K-RAS(V12)-transfected cells enhanced activation of the phosphatidylinositol-3-kinase-Akt pathway and increased postirradiation survival ofmore » wild-type K-RAS parental cells when compared with controls. These effects were reversed by amphiregulin (AREG)-neutralizing antibody. In addition, secretion of the EGFR ligands AREG and transforming growth factor {alpha} was significantly increased upon overexpression of K-RAS(V12). Expression of mutated K-RAS(V12) resulted in an increase in radiation-induced DNA-dependent protein kinase catalytic subunit (DNA-PKcs) phosphorylation at S2056. This increase was accompanied by increased repair of DNA double-strand breaks. Abrogation of DNA-PKcs phosphorylation by serum depletion or AREG-neutralizing antibody underscored the role of autocrine production of EGFR ligands, namely, AREG, in regulating DNA-PKcs activation in K-RAS mutated cells. Conclusions: These data indicate that radioresistance of K-RAS mutated tumor cells is at least in part due to constitutive production of EGFR ligands, which mediate enhanced repair of DNA double-strand breaks through the EGFR-phosphatidylinositol-3-kinase-Akt cascade.« less
Novel Expressions of Equations of Relative Motion and Control in Keplerian Orbits
2009-04-01
Control, and Dynamics, Vol. 29, No. 2, March– April 2006, pp. 495–499. doi:10.2514/1.19148 [12] Singla, P., Subbarao , K ., and Junkins, J. L...negative orbit normal, and thex axis is defined as i j k , where i; j and k are the basis vector of the LVLH frame. Thus, in a circular orbit, the x...a. REPORT unclassified b . ABSTRACT unclassified c. THIS PAGE unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18
Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying
2018-05-02
The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.
Coherent state constructions of bases for some physically relevant group chains
NASA Technical Reports Server (NTRS)
Hecht, Karl T.
1995-01-01
Rotor coherent state constructions are given for the Wigner supermultiplet SU(4) contains SU(2)xSU(2) and for the special irreducible representations (N0) of the SO(5) contains SO(3) contains SO(2) group chain in exact parallel with the rotor coherent state construction for the SU(3) contains SO(3) contains SO(2) case given by Rowe, LeBlanc,, and Repka. Matrix elements of the coherent state realizations of the group generators are given in all cases by very simple expressions in terms of angular momentum Wigner coefficients involving intrinsic projection labels K. The K-matrix technique of vector coherent state theory is used to effectively elevate these K labels to the status of good quantum numbers. Analytic expressions are given for the (K K*)-matrices for many of the more important irreducible representations.
Washio, Tsubasa; Oikawa, Tadao
2018-01-01
We successfully expressed the L-aspartate oxidase homolog gene (accession no: OCC_06611) of Thermococcus litoralis DSM 5473 in the soluble fraction of Escherichia coli BL21 (DE3) using a pET21b vector with 6X His tag at its C-terminus. The gene product (Tl-LASPO) showed L-aspartate oxidase activity in the presence of FAD in vitro, and this report is the first that details an L-aspartate oxidase derived from a Thermococcus species. The homologs of Tl-LASPO existed mainly in archaea, especially in the genus of Thermococcus, Pyrococcus, Sulfolobus, and Halobacteria. The quaternary structure of Tl-LASPO was homotrimeric with a subunit molecular mass of 52 kDa. The enzyme activity of Tl-LASPO increased with temperature up to 70 °C. Tl-LASPO was active from pH 6.0 to 9.0, and its highest activity was at pH 8.0. Tl-LASPO was stable at 80 °C for 1 h. The highest k cat /K m value was observed in assays at 70 °C. Tl-LASPO was highly specific for L-aspartic acid. Tl-LASPO utilized fumaric acid, 2,6-dichlorophenolindophenol, and ferricyanide in addition to FAD as a cofactor under anaerobic conditions. The absorption spectrum of holo-Tl-LASPO exhibited maxima at 380 and 450 nm. The FAD dissociation constant, K d , of the FAD-Tl-LASPO complex was determined to be 5.9 × 10 -9 M.
Rincon, Melvin Y; de Vin, Filip; Duqué, Sandra I; Fripont, Shelly; Castaldo, Stephanie A; Bouhuijzen-Wenger, Jessica; Holt, Matthew G
2018-04-01
Until recently, adeno-associated virus 9 (AAV9) was considered the AAV serotype most effective in crossing the blood-brain barrier (BBB) and transducing cells of the central nervous system (CNS), following systemic injection. However, a newly engineered capsid, AAV-PHP.B, is reported to cross the BBB at even higher efficiency. We investigated how much we could boost CNS transgene expression by using AAV-PHP.B carrying a self-complementary (sc) genome. To allow comparison, 6 weeks old C57BL/6 mice received intravenous injections of scAAV2/9-GFP or scAAV2/PHP.B-GFP at equivalent doses. Three weeks postinjection, transgene expression was assessed in brain and spinal cord. We consistently observed more widespread CNS transduction and higher levels of transgene expression when using the scAAV2/PHP.B-GFP vector. In particular, we observed an unprecedented level of astrocyte transduction in the cortex, when using a ubiquitous CBA promoter. In comparison, neuronal transduction was much lower than previously reported. However, strong neuronal expression (including spinal motor neurons) was observed when the human synapsin promoter was used. These findings constitute the first reported use of an AAV-PHP.B capsid, encapsulating a scAAV genome, for gene transfer in adult mice. Our results underscore the potential of this AAV construct as a platform for safer and more efficacious gene therapy vectors for the CNS.
Hyperbolic-symmetry vector fields.
Gao, Xu-Zhen; Pan, Yue; Cai, Meng-Qiang; Li, Yongnan; Tu, Chenghou; Wang, Hui-Tian
2015-12-14
We present and construct a new kind of orthogonal coordinate system, hyperbolic coordinate system. We present and design a new kind of local linearly polarized vector fields, which is defined as the hyperbolic-symmetry vector fields because the points with the same polarization form a series of hyperbolae. We experimentally demonstrate the generation of such a kind of hyperbolic-symmetry vector optical fields. In particular, we also study the modified hyperbolic-symmetry vector optical fields with the twofold and fourfold symmetric states of polarization when introducing the mirror symmetry. The tight focusing behaviors of these vector fields are also investigated. In addition, we also fabricate micro-structures on the K9 glass surfaces by several tightly focused (modified) hyperbolic-symmetry vector fields patterns, which demonstrate that the simulated tightly focused fields are in good agreement with the fabricated micro-structures.
pKAMA-ITACHI Vectors for Highly Efficient CRISPR/Cas9-Mediated Gene Knockout in Arabidopsis thaliana
2017-01-01
The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. PMID:27856772
Dong, Yan; Zhang, Ying; Yi, Lang; Lai, Huili; Zhang, Yaming; Zhou, Lian; Wang, Peixun
2010-07-01
To transform the antimicrobial peptide fusion gene of cecropin B and rabbit NP-1(CN) into Houttuynia cordata to improve its antimicrobic capability. The fusion gene of CN designed and synthesized artificially was recombined with expression vector pBI121. The recombined vector was transformed to Agrobacterium tumefaciens LBA4404, by which CN gene was transformed to the explants of H. cordata. The transgenic regeneration plantlets were selected by kanamycin and rapid screening PCR. The transgenic plants were identified by PCR-Southern of genomic DNA and RT-PCR. The disease resistances were detected by antibacterial zone trail of leaf extracts to E. coli K12 and infection by Rhizoctonia solani. Gene of interesting CN was inserted into genomic DNA and expressed in transformed H, cordata, whose resistance to E. coli K12 and Rh. solani was stronger than that of the non-transformed control. The fusion gene CN can improve antimicrobic capability of transformed H. cordata.
Pedersen, Philip J; Thomsen, Kirsten B; Flak, Jon B; Tejada, Maria A; Hauser, Frank; Trachsel, Dagmar; Buhl, Rikke; Kalbfleisch, Theodore; DePriest, Michael Scott; MacLeod, James N; Calloe, Kirstine; Klaerke, Dan A
2017-08-01
The voltage-gated K + -channel K V 7.1 and the subunit KCNE1, encoded by the KCNQ1 and KCNE1 genes, respectively, are responsible for termination of the cardiac action potential. In humans, mutations in these genes can predispose patients to arrhythmias and sudden cardiac death (SCD). To characterize equine K V 7.1/KCNE1 currents and compare them to human K V 7.1/KCNE1 currents to determine whether K V 7.1/KCNE1 plays a similar role in equine and human hearts. mRNA encoding K V 7.1 and KCNE1 was isolated from equine hearts, sequenced, and cloned into expression vectors. The channel subunits were heterologously expressed in Xenopus laevis oocytes or CHO-K1 cells and characterized using voltage-clamp techniques. Equine K V 7.1/KCNE1 expressed in CHO-K1 cells exhibited electrophysiological properties that are overall similar to the human orthologs; however, a slower deactivation was found which could result in more open channels at fast rates. The results suggest that the equine K V 7.1/KCNE1 channel may be important for cardiac repolarization and this could indicate that horses are susceptible to SCD caused by mutations in KCNQ1 and KCNE1. Copyright © 2017 Elsevier Ltd. All rights reserved.
Kim, Jiyoung; Lee, Jae-Won; Kim, Song-In; Choi, Yong-Joon; Lee, Won-Ki; Jeong, Myung-Ja; Cha, Sang-Hoon; Lee, Hee Jae; Chun, Wanjoo
2011-01-01
Glioblastoma multiforme is one of the most common and aggressive tumors in central nervous system. It often possesses characteristic necrotic lesions with hemorrhages, which increase the chances of exposure to thrombin. Thrombin has been known as a regulator of MMP-9 expression and cancer cell migration. However, the effects of thrombin on glioma cells have not been clearly understood. In the present study, influences of thrombin on glioma cell migration were examined using Boyden chamber migration assay and thrombin-induced changes in MMP-9 expression were measured using zymography, semi-quantitative RT-PCR, and Western blotting. Furthermore, underlying signaling pathways by which thrombin induces MMP-9 expression were examined. Thrombin-induced migration and MMP-9 expression were significantly potentiated in the presence of wortmannin, a PI3K inhibitor, whereas MAPK inhibitors suppressed thrombin-induced migration and MMP-9 expression in C6 glioma cells. The present data strongly demonstrate that MAPK and PI3K pathways evidently regulate thrombin-induced migration and MMP-9 expression of C6 glioma cells. Therefore, the control of these pathways might be a beneficial therapeutic strategy for treatment of invasive glioblastoma multiforme. PMID:21994479
Wen, Yong; Lan, Jing; Huang, Haiyun; Yu, Meijiao; Cui, Jun; Liang, Jin; Jiang, Baoqi; Xu, Xin
2012-09-01
To establish human periodontal ligament stem cells (hPDLSC) with high and stable expression of enhanced green fluorescent protein (eGFP) and to obtain an ideal vector expression system that suitable for gene therapy in periodontal tissue engineering. hPDLSCs were transfected with eGFP for 48h via different MOI (25, 50, 100, 200 and 400) by lentiviral vector, the transfection efficiency was evaluated by fluorescent microscopy and flow cytometry, and transfected hPDLSCs proliferation was evaluated by MTT. Pluripotent, differentiation capacity and ALP expression status were determined further. Osteoblast-associated genes expressions for osteogenesis were evaluated by quantitative-PCR. In addition, rat molar periodontal fenestration defect model was used for evaluating periodontal tissue engineering. The transfection efficiency after 48h were 44.7%, 60.9%, 71.7%, 85.8%, and 86.9% respectively. There was no significant effect of transfection (at different MOI levels of 25, 50, 100, and 200) on the proliferation of hPDLSCs (designated as eGFP-hPDLSCs) compared with hPDLSCs (P>0.05). However, proliferation of eGFP hPDLSCs at MOI 400 became slower (P<0.05). Both eGFP hPDLSCs and hPDLSCs were able to differentiate into osteocytes and adipocytes under certain conditioned media. At 7 days, expression levels of COL-1, RUNX2 in hPDLSCS were higher than those in eGFP hPDLSCs (P<0.05); expression levels of ALP and OPN in eGFP hPDLSCs were similar to those in hPDLSCs (P>0.05). Newly regenerated bone formation was observed in the defect model used. Among the transfection conditions, 48h transfection at MOI 200 is optimal for labelling hPDLSCs with eGFP in a lentiviral vector. There is no change in capability of the eGFP hPDLSCs osteogenesis. The lentiviral vector with eGFP is an appropriate expression vector system and hPDLSCs are ideal seeding cells for gene therapy in periodontal tissue engineering. Copyright © 2012 Elsevier Ltd. All rights reserved.
Finch, Emma; Cornwell, Petrea; Copley, Anna; Doig, Emmah; Fleming, Jennifer
2017-01-01
To perform a pilot study to evaluate whether a novel metacognitive, goal-based intervention improved and maintained the social communication skills of adults with traumatic brain injury (TBI). Eight community-dwelling participants with TBI completed three study phases: (1) baseline, (2) eight-week intervention targeting social communication impairments and (3) follow-up. Participants completed the Profile of Pragmatic Impairment in Communication (PPIC), LaTrobe Communication Questionnaire (LCQ) and Goal Attainment Scaling (GAS) at the commencement of baseline phase, pre- and post-intervention and completion of the follow-up phase. During the intervention programme phase, participants attended two 1-hour therapy sessions (one individual; one group) per week focusing on remediating impaired social communication skills using metacognitive strategy intervention and goal-based therapy. Variable changes in PPIC feature-summary scores were observed post-intervention. A non-significant improvement in LCQ scores was also observed. There was a significant increase in GAS goal T-scores following the intervention, with six of the eight participants achieving or exceeding their expected level of performance on all goals. A goal-driven, metacognitive approach to intervention may assist individuals with TBI to achieve their personal social communication goals, with benefits reported by participants and observable during conversations. Further research is required.
Moghaieb, Reda E A; Sharaf, Ahmed N; Soliman, Mohamed H; El-Arabi, Nagwa I; Momtaz, Osama A
2014-01-01
We present an efficient method for the production of transgenic salt tolerant hexaploid wheat plants expressing the Arabidopsis AtNHX1 gene. Wheat mature zygotic embryos were isolated from two hexaploid bread wheat (Triticum aestivum) cultivars (namely: Gemmeiza 9 and Gemmeiza 10) and were transformed with the A. tumefaciens LBA4404 harboring the pBI-121 vector containing the AtNHX1 gene. Transgenic wheat lines that express the gus intron was obtained and used as control. The results confirmed that npt-II gene could be transmitted and expressed in the T2 following 3:1 Mendelian segregation while the control plant couldn't. The data indicate that, the AtNHX1 gene was integrated in a stable manner into the wheat genome and the corresponding transcripts were expressed. The transformation efficiency was 5.7 and 7.5% for cultivars Gemmeiza 10 and Gemmeiza 9, respectively. A greenhouse experiment was conducted to investigate the effect of AtNHX1 gene in wheat salt tolerance. The transgenic wheat lines could maintain high growth rate under salt stress condition (350 mM NaCl) while the control plant couldn't. The results confirmed that Na(+)/H(+) antiporter gene AtNHX1 increased salt tolerance by increasing Na(+) accumulation and keeping K+/Na(+) balance. Thus, transgenic plants showed high tolerance to salt stress and can be considered as a new genetic resource in breeding programs.
Impact of age and vector construct on striatal and nigral transgene expression
Polinski, Nicole K; Manfredsson, Fredric P; Benskey, Matthew J; Fischer, D Luke; Kemp, Christopher J; Steece-Collier, Kathy; Sandoval, Ivette M; Paumier, Katrina L; Sortwell, Caryl E
2016-01-01
Therapeutic protein delivery using viral vectors has shown promise in preclinical models of Parkinson’s disease (PD) but clinical trial success remains elusive. This may partially be due to a failure to include advanced age as a covariate despite aging being the primary risk factor for PD. We investigated transgene expression following intracerebral injections of recombinant adeno-associated virus pseudotypes 2/2 (rAAV2/2), 2/5 (rAAV2/5), 2/9 (rAAV2/9), and lentivirus (LV) expressing green fluorescent protein (GFP) in aged versus young adult rats. Both rAAV2/2 and rAAV2/5 yielded lower GFP expression following injection to either the aged substantia nigra or striatum. rAAV2/9-mediated GFP expression was deficient in the aged striatonigral system but displayed identical transgene expression between ages in the nigrostriatal system. Young and aged rats displayed equivalent GFP levels following LV injection to the striatonigral system but LV-delivered GFP was deficient in delivering GFP to the aged nigrostriatal system. Notably, age-related transgene expression deficiencies revealed by protein quantitation were poorly predicted by GFP-immunoreactive cell counts. Further, in situ hybridization for the viral CβA promoter revealed surprisingly limited tropism for astrocytes compared to neurons. Our results demonstrate that aging is a critical covariate to consider when designing gene therapy approaches for PD. PMID:27933309
Ishak, Intan H; Kamgang, Basile; Ibrahim, Sulaiman S; Riveron, Jacob M; Irving, Helen; Wondji, Charles S
2017-01-01
Dengue control and prevention rely heavily on insecticide-based interventions. However, insecticide resistance in the dengue vector Aedes aegypti, threatens the continued effectiveness of these tools. The molecular basis of the resistance remains uncharacterised in many endemic countries including Malaysia, preventing the design of evidence-based resistance management. Here, we investigated the underlying molecular basis of multiple insecticide resistance in Ae. aegypti populations across Malaysia detecting the major genes driving the metabolic resistance. Genome-wide microarray-based transcription analysis was carried out to detect the genes associated with metabolic resistance in these populations. Comparisons of the susceptible New Orleans strain to three non-exposed multiple insecticide resistant field strains; Penang, Kuala Lumpur and Kota Bharu detected 2605, 1480 and 425 differentially expressed transcripts respectively (fold-change>2 and p-value ≤ 0.05). 204 genes were commonly over-expressed with monooxygenase P450 genes (CYP9J27, CYP6CB1, CYP9J26 and CYP9M4) consistently the most up-regulated detoxification genes in all populations, indicating that they possibly play an important role in the resistance. In addition, glutathione S-transferases, carboxylesterases and other gene families commonly associated with insecticide resistance were also over-expressed. Gene Ontology (GO) enrichment analysis indicated an over-representation of GO terms linked to resistance such as monooxygenases, carboxylesterases, glutathione S-transferases and heme-binding. Polymorphism analysis of CYP9J27 sequences revealed a high level of polymorphism (except in Joho Bharu), suggesting a limited directional selection on this gene. In silico analysis of CYP9J27 activity through modelling and docking simulations suggested that this gene is involved in the multiple resistance in Malaysian populations as it is predicted to metabolise pyrethroids, DDT and bendiocarb. The predominant over-expression of cytochrome P450s suggests that synergist-based (PBO) control tools could be utilised to improve control of this major dengue vector across Malaysia.
Adenovirus E1B 19-Kilodalton Protein Modulates Innate Immunity through Apoptotic Mimicry
Grigera, Fernando; Ucker, David S.; Cook, James L.
2014-01-01
ABSTRACT Cells that undergo apoptosis in response to chemical or physical stimuli repress inflammatory reactions, but cells that undergo nonapoptotic death in response to such stimuli lack this activity. Whether cells dying from viral infection exhibit a cell death-type modulatory effect on inflammatory reactions is unknown. We compared the effects on macrophage inflammatory responses of cells dying an apoptotic or a nonapoptotic death as a result of adenoviral infection. The results were exactly opposite to the predictions from the conventional paradigm. Cells dying by apoptosis induced by infection with an adenovirus type 5 (Ad5) E1B 19-kilodalton (E1B 19K) gene deletion mutant did not repress macrophage NF-κB activation or cytokine responses to proinflammatory stimuli, whereas cells dying a nonapoptotic death from infection with E1B 19K-competent, wild-type Ad5 repressed these macrophage inflammatory responses as well as cells undergoing classical apoptosis in response to chemical injury. The immunorepressive, E1B 19K-related cell death activity depended upon direct contact of the virally infected corpses with responder macrophages. Replacement of the viral E1B 19K gene with the mammalian Bcl-2 gene in cis restored the nonapoptotic, immunorepressive cell death activity of virally infected cells. These results define a novel function of the antiapoptotic, adenoviral E1B 19K protein that may limit local host innate immune inflammation during accumulation of virally infected cells at sites of infection and suggest that E1B 19K-deleted, replicating adenoviral vectors might induce greater inflammatory responses to virally infected cells than E1B 19K-positive vectors, because of the net effect of their loss-of-function mutation. IMPORTANCE We observed that cells dying a nonapoptotic cell death induced by adenovirus infection repressed macrophage proinflammatory responses while cells dying by apoptosis induced by infection with an E1B 19K deletion mutant virus did not repress macrophage proinflammatory responses and enhanced some cytokine responses. Our results define a new function of the antiapoptotic, adenoviral protein E1B 19K, which we have termed “apoptotic mimicry.” Our studies suggest the possibility that the presence or absence of this E1B 19K function could alter the immunological outcome of both natural and therapeutic adenoviral infections. For example, emerging, highly immunopathogenic adenovirus serotypes might induce increased host inflammatory responses as a result of altered E1B 19K function or expression. It is also possible that engineered variations in E1B 19K expression/function could be created during adenovirus vector design that would increase the therapeutic efficacy of replicating adenovirus vectors for vaccines or oncolytic viral targeting of neoplastic cells. PMID:24352454
Guo, Mei; Lu, Fuping; Pu, Jun; Bai, Dongqing; Du, Lianxiang
2005-11-01
A cDNA encoding for laccase was isolated from the ligninolytic fungus Trametes versicolor by RNA-PCR. The cDNA corresponds to the gene Lcc1, which encodes a laccase isoenzyme of 498 amino acid residues preceded by a 22-residue signal peptide. The Lcc1 cDNA was cloned into the vectors pMETA and pMETalphaA and expressed in Pichia methanolica. The laccase activity obtained with the Saccharomyces cerevisiae alpha-factor signal peptide was found to be twofold higher than that obtained with the native secretion signal peptide. The extracellular laccase activity in recombinants with the alpha-factor signal peptide was 9.79 U ml(-1). The presence of 0.2 mM copper was necessary for optimal activity of laccase. The expression level was favoured by lower cultivation temperature. The identity of the recombinant protein was further confirmed by immunodetection using Western blot analysis. As expected, the molecular mass of the mature laccase was 64.0 kDa, similar to that of the native form.
Single-step purification and characterization of recombinant aspartase of Aeromonas media NFB-5.
Singh, Ram Sarup; Yadav, Mukesh
2012-07-01
Aspartase (L-aspartate ammonia-lyase; EC 4.3.1.1) catalyzes the reversible amination of fumaric acid to produce L-aspartic acid. Aspartase coding gene (aspA) of Aeromonas media NFB-5 was cloned, sequenced, and expressed with His tag using pET-21b⁺ expression vector in Escherichia coli BL21. Higher expression was obtained with IPTG (1.5 mM) induction for 5 h at 37 °C in LB medium supplemented with 0.3% K₂HPO₄ and 0.3% KH₂PO₄. Recombinant His tagged aspartase was purified using Ni-NTA affinity chromatography and characterized for various biochemical and kinetic parameters. The purified aspartase showed optimal activity at pH 8.5 and 8.0 in the presence and absence of magnesium ions, respectively. The optimum temperature was determined to be 35 °C. The enzyme showed apparent K(m) and V(max) values for L-aspartate as 2.01 mM and 114 U/mg, respectively. The enzyme was stable in pH range of 6.5-9.5 and temperature up to 45 °C. Divalent metal ion requirement of enzyme was efficiently fulfilled by Mg²⁺, Mn²⁺, and Ca²⁺ ions. The cloned gene (aspA) product showed molecular weight of approximately 51 kDa by SDS-PAGE, which is in agreement with the molecular weight calculated from putative amino acid sequence. This is the first report on expression and characterization of recombinant aspartase from A. media.
Suppressing tawny crazy ant (Nylanderia fulva) by RNAi technology.
Meng, Jia; Lei, Jiaxin; Davitt, Andrew; Holt, Jocelyn R; Huang, Jian; Gold, Roger; Vargo, Edward L; Tarone, Aaron M; Zhu-Salzman, Keyan
2018-05-22
The tawny crazy ant (Nylanderia fulva) is a new invasive pest in the United States. At present, its management mainly relies on the use of synthetic insecticides, which are generally ineffective at producing lasting control of the pest, necessitating alternative environmentally friendly measures. In this study, we evaluated the feasibility of gene silencing to control this ant species. Six housekeeping genes encoding actin (NfActin), coatomer subunit β (NfCOPβ), arginine kinase (NfArgK), and V-type proton ATPase subunits A (NfvATPaseA), B (NfvATPaseB) and E (NfvATPaseE) were cloned. Phylogenetic analysis revealed high sequence similarity to homologs from other ant species, particularly the Florida carpenter ant (Camponotus floridanus). To silence these genes, vector L4440 was used to generate 6 specific RNAi constructs for bacterial expression. Heat-inactivated, dsRNA-expressing Escherichia coli were incorporated into artificial diet. Worker ants exhibited reduced endogenous gene expression after feeding on such diet for 9 days. However, only ingestion of dsRNAs of NfCOPβ (a gene involved in protein trafficking) and NfArgK (a cellular energy reserve regulatory gene in invertebrates) caused modest but significantly higher ant mortality than the control. These results suggest that bacterially expressed dsRNA can be orally delivered to ant cells as a mean to target its vulnerabilities. Improved efficacy is necessary for the RNAi-based approach to be useful in tawny crazy ant management. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S
1987-07-01
Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.
Samoilov, M O; Churilova, A V; Glushchenko, T S; Rybnikova, E A
2017-04-01
We studied the effects of different modes of hypobaric hypoxia on the content of epigenetic factors acH3K24, meH3K9, and meDNA modulating conformational characteristics of chromatin and gene expression in neurons of associative complex of rat parietal neocortex. Severe destructive hypoxia dramatically reduced the level of acH3K24 in 3 h after the end of exposure and increased meH3K9 and meDNA content. By contrast, 3-fold (but not single) adaptive exposure to moderate hypobaric hypoxia that produced a neuroprotective effect enhanced neuronal acH3K24 expression and decreased both meH3K9 and meDNA levels. Elevated acH3K24 content facilitates, while increased content of meH3K9 hampers binding of transcription factors to the target genes. At the same time, increased expression of meDNA suppresses transcription. The role of modification of epigenetic mechanisms in the regulation of proadaptive genes under the effects of hypoxic exposure according to various protocols is discussed.
NASA Astrophysics Data System (ADS)
Trudeau, Karine; Dang Vu, Khanh; Shareck, François; Lacroix, Monique
2012-08-01
A capillary electrophoresis method with UV detection was developed to analyze protein composition of the foodborne pathogen Staphylococcus aureus. Bacterial samples containing 109 CFU/ml, obtained after two cycles of incubations of 24 h, were gamma irradiated at different doses of 1.2, 3.5 and 2.9 kGy to respectively create damage cells, to kill cells and to provoke viable but non cultivable cells (VBNC). It was observed that an irradiation at a sensitive dose of 1.2 kGy caused a significantly increase in the protein with molecular weight (MW) of 17.7 kDa (from 0.61% to 1.2%). This treatment also caused decreases in the expressed proteins with the MWs of 16.3 kDa (from 6.2% to 5.3%) and of 23.4 kDa (from 4.0% to 2.30%). Irradiation at a VBCN dose of 2.9 kGy caused increases in expressed proteins with the MWs of 17.7 kDa (from 0.61% to 3.43%), 18.7 kDa (from 1.04% to 4.30%), 19.5 kDa (from 0.71% to 2.30%), 21.1 kDa (from 1.20% to 3.80%). Moreover, this treatment (2.9 kGy) also caused significantly decreases (P≤0.05) in the expressed proteins with the MW of 30.7 kDa (from 8.6% to 5.15%), 36.3 kDa (from 3.1% to 2.7%) and 40.5 kDa (from 11.3% to 8.5%). Finally, for the irradiation at a lethal dose of 3.5 kGy, it can be found that the expressed proteins with the MW of 17.7 kDa, 18.7 kDa and 19.5 kDa were increased less than that of expressed proteins at the VCNC dose (2.9 kGy) and these might be the very important proteins which are responsible for the survival of the S. aureus. Further, there were also the decreases in expressed proteins with the MW of 30.7 kDa, 36.3 kDa and 75.1 kDa at this dose of treatment (3.5 kGy) which can be expected that these proteins are seriously affected at high dose of γ-irradiation treatment.
Yoon, Sang-Oh; Shin, Sejeong; Lee, Ho-Jae; Chun, Hyo-Kon; Chung, An-Sik
2006-11-01
Matrix metalloproteinase (MMP)-9 plays a key role in tumor invasion. Inhibitors of MMP-9 were screened from Metasequoia glyptostroboides (Dawn redwood) and one potent inhibitor, isoginkgetin, a biflavonoid, was identified. Noncytotoxic levels of isoginkgetin decreased MMP-9 production profoundly, but up-regulated the level of tissue inhibitor of metalloproteinase (TIMP)-1, an inhibitor of MMP-9, in HT1080 human fibrosarcoma cells. The major mechanism of Ras-dependent MMP-9 production in HT1080 cells was phosphatidylinositol 3-kinase (PI3K)/Akt/nuclear factor-kappaB (NF-kappaB) activation. Expression of dominant-active H-Ras and p85 (a subunit of PI3K) increased MMP-9 activity, whereas dominant-negative forms of these molecules decreased the level of MMP-9. H-Ras did not increase MMP-9 in the presence of a PI3K inhibitor, LY294002, and a NF-kappaB inhibitor, SN50. Further studies showed that isoginkgetin regulated MMP-9 production via PI3K/Akt/NF-kappaB pathway, as evidenced by the findings that isoginkgetin inhibited activities of both Akt and NF-kappaB. PI3K/Akt is a well-known key pathway for cell invasion, and isoginkgetin inhibited HT1080 tumor cell invasion substantially. Isoginkgetin was also quite effective in inhibiting the activities of Akt and MMP-9 in MDA-MB-231 breast carcinomas and B16F10 melanoma. Moreover, isoginkgetin treatment resulted in marked decrease in invasion of these cells. In summary, PI3K/Akt is a major pathway for MMP-9 expression and isoginkgetin markedly decreased MMP-9 expression and invasion through inhibition of this pathway. This suggests that isoginkgetin could be a potential candidate as a therapeutic agent against tumor invasion.
Jang, Min-Kyung; Kim, Ji-Hyun; Jung, Myeong Ho
2017-01-01
Previous studies have shown that tri- or di-methylation of histone H3 at lysine 9 (H3K9me3/me2) on the promoter of the peroxisome proliferator-activated receptor γ (PPARγ) and CCAAT/enhancer-binding protein α (C/EBPα) contribute to the repression of PPARγ and C/EBPα and inhibition of adipogenesis in 3T3-L1 preadipocytes. The balance of histone methylation is regulated by histone methyltransferases and demethylases. However, it is poorly understood which demethylases are responsible for removing H3K9me3/me2 on the promoter of PPARγ and C/EBPα. JMJD2B is a H3K9me3/me2 demethylase that was previously shown to activate adipogenesis by promoting mitotic clonal expansion. Nevertheless, it remains unclear whether JMJD2B plays a role in the regulation of adipogenesis by removing H3K9me3/me2 on the promoter of PPARγ and C/EBPα and subsequently activating PPARγ and C/EBPα expression. Here, we showed that JMJD2B decreased H3K9me3/me2 on the promoter of PPARγ and C/EBPα, which in turn stimulated the expression of PPARγ and C/EBPα. JMJD2B knockdown using siRNA in 3T3-L1 preadipocytes repressed the expression of PPARγ and C/EBPα, resulting in inhibition of adipogenesis. This was accompanied by increased enrichment of H3K9me3/me2 on the promoter of PPARγ and C/EBPα. In contrast, overexpression of JMJD2B increased the expression of PPARγ and C/EBPα, which was accompanied by decreased enrichment of H3K9me3/me2 on the promoter and activated adipogenesis. Together, these results indicate that JMJD2B regulates PPARγ and C/EBPα during adipogenesis. PMID:28060835
Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H
2016-01-01
The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.
The quest for epigenetic regulation underlying unisexual flower development in Cucumis melo.
Latrasse, David; Rodriguez-Granados, Natalia Y; Veluchamy, Alaguraj; Mariappan, Kiruthiga Gayathri; Bevilacqua, Claudia; Crapart, Nicolas; Camps, Celine; Sommard, Vivien; Raynaud, Cécile; Dogimont, Catherine; Boualem, Adnane; Benhamed, Moussa; Bendahmane, Abdelhafid
2017-01-01
Melon ( Cucumis melo ) is an important vegetable crop from the Cucurbitaceae family and a reference model specie for sex determination, fruit ripening and vascular fluxes studies. Nevertheless, the nature and role of its epigenome in gene expression regulation and more specifically in sex determination remains largely unknown. We have investigated genome wide H3K27me3 and H3K9ac histone modifications and gene expression dynamics, in five melon organs. H3K9ac and H3K27me3 were mainly distributed along gene-rich regions and constrained to gene bodies. H3K9ac was preferentially located at the TSS, whereas H3K27me3 distributed uniformly from TSS to TES. As observed in other species, H3K9ac and H3K27me3 correlated with high and low gene expression levels, respectively. Comparative analyses of unisexual flowers pointed out sex-specific epigenetic states of TFs involved in ethylene response and flower development. Chip-qPCR analysis of laser dissected carpel and stamina primordia, revealed sex-specific histone modification of MADS-box genes. Using sex transition mutants, we demonstrated that the female promoting gene, CmACS11 , represses the expression of the male promoting gene CmWIP1 via deposition of H3K27me3. Our findings reveal the organ-specific landscapes of H3K9ac and H3K27me3 in melon. Our results also provide evidence that the sex determination genes recruit histone modifiers to orchestrate unisexual flower development in monoecious species.
Wang, Zupeng; Wang, Shuaibin; Li, Dawei; Zhang, Qiong; Li, Li; Zhong, Caihong; Liu, Yifei; Huang, Hongwen
2018-01-13
Kiwifruit is an important fruit crop; however, technologies for its functional genomic and molecular improvement are limited. The clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system has been successfully applied to genetic improvement in many crops, but its editing capability is variable depending on the different combinations of the synthetic guide RNA (sgRNA) and Cas9 protein expression devices. Optimizing conditions for its use within a particular species is therefore needed to achieve highly efficient genome editing. In this study, we developed a new cloning strategy for generating paired-sgRNA/Cas9 vectors containing four sgRNAs targeting the kiwifruit phytoene desaturase gene (AcPDS). Comparing to the previous method of paired-sgRNA cloning, our strategy only requires the synthesis of two gRNA-containing primers which largely reduces the cost. We further compared efficiencies of paired-sgRNA/Cas9 vectors containing different sgRNA expression devices, including both the polycistronic tRNA-sgRNA cassette (PTG) and the traditional CRISPR expression cassette. We found the mutagenesis frequency of the PTG/Cas9 system was 10-fold higher than that of the CRISPR/Cas9 system, coinciding with the relative expressions of sgRNAs in two different expression cassettes. In particular, we identified large chromosomal fragment deletions induced by the paired-sgRNAs of the PTG/Cas9 system. Finally, as expected, we found both systems can successfully induce the albino phenotype of kiwifruit plantlets regenerated from the G418-resistance callus lines. We conclude that the PTG/Cas9 system is a more powerful system than the traditional CRISPR/Cas9 system for kiwifruit genome editing, which provides valuable clues for optimizing CRISPR/Cas9 editing system in other plants. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.
Tchetina, Elena V.; Demidova, Natalia V.; Karateev, Dmitry E.; Nasonov, Eugeny L.
2013-01-01
We evaluated changes in gene expression of mTOR, p21, caspase-3, ULK1, TNFα, matrix metalloproteinase (MMP)-9, and cathepsin K in the whole blood of rheumatoid arthritic (RA) patients treated with methotrexate (MTX) in relation to their rheumatoid factor status, clinical, immunological, and radiological parameters, and therapeutic response after a 24-month follow-up. The study group consisted of 35 control subjects and 33 RA patients without previous history of MTX treatment. Gene expression was measured using real-time RT-PCR. Decreased disease activity in patients at the end of the study was associated with significant downregulation of TNFα expression. Downregulation of mTOR was observed in seronegative patients, while no significant changes in the expression of p21, ULK1, or caspase-3 were noted in any RA patients at the end of the study. The increase in erosion numbers observed in the seropositive patients at the end of the follow-up was accompanied by upregulation of MMP-9 and cathepsin K, while seronegative patients demonstrated an absence of significant changes in MMP-9 and cathepsin K expression and no increase in the erosion score. Our results suggest that increased expression of MMP-9 and cathepsin K genes in the peripheral blood might indicate higher bone tissue destruction activity in RA patients treated with methotrexate. The clinical study registration number is 0120.0810610. PMID:24348567
Yao, Ya-Feng; Weng, Yih-Ming; Hu, Hui-Yu; Ku, Kuo-Lung; Lin, Long-Liu
2006-09-01
A truncated Escherichia coli Novablue gamma-glutamyltranspeptidase (EcGGT) gene lacking the first 48-bp coding sequence for part of the signal sequence was amplified by polymerase chain reaction and cloned into expression vector pQE-30 to generate pQE-EcGGT. The maximum production of His(6)-tagged enzyme by E. coli M15 (pQE-EcGGT) was achieved with 0.1 mM IPTG induction for 12 h at 20 degrees C. The overexpressed enzyme was purified to homogeneity by nickel-chelate chromatography to a specific transpeptidase activity of 4.25 U/mg protein and a final yield of 83%. The molecular masses of the subunits of the purified enzyme were estimated to be 41 and 21 kDa respectively by SDS-PAGE, indicating EcGGT still undergoes the post-translational cleavage even in the truncation of signal sequence. The optimum temperature and pH for the recombinant enzyme were 40 degrees C and 9, respectively. The apparent K (m) and V (max) values for gamma-glutamyl-p-nitroanilide as gamma-glutamyl donor in the transpeptidation reaction were 37.9 microM and 53.7 x 10(-3) mM min(-1), respectively. The synthesis of L -theanine was performed in a reaction mixture containing 10 mM L -Gln, 40 mM ethylamine, and 1.04 U His(6)-tagged EcGGT/ml, pH 10, and a conversion rate of 45% was obtained.
Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh
2015-01-01
Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441
Huang, Xinping; Hartley, Antja-Voy; Yin, Yishi; Herskowitz, Jeremy H; Lah, James J; Ressler, Kerry J
2013-11-01
The adeno-associated virus (AAV) is one of the most useful viral vectors for gene delivery for both in vivo and in vitro applications. A variety of methods have been established to produce and characterize recombinant AAV (rAAV) vectors; however most methods are quite cumbersome and obtaining consistently high titer can be problematic. This protocol describes a triple-plasmid co-transfection approach with 25 kDa linear polyethylenimine (PEI) in 293 T cells for the production of AAV serotype 2. Seventy-two hours post-transfection, supernatant and cells were harvested and purified by a discontinuous iodixanol density gradient ultracentrifugation, then dialyzed and concentrated with an Amicon 15 100,000 MWCO concentration unit. To optimize the protocol for AAV2 production using PEI, various N/P ratios and DNA amounts were compared. We found that an N/P ratio of 40 coupled with 1.05 μg DNA per ml of media (21 μg DNA/15 cm dish) was found to produce the highest yields for viral replication and assembly measured multiple ways. The infectious units, as determined by serial dilution, were between 1×10(8) and 2×10(9) IU/ml. The genomic titer of the viral stock was determined by qPCR and ranged from 2×10(12) to 6×10(13) VG/ml. These viral vectors showed high expression both in vivo within the brain and in vitro in cell culture. The use of linear 25 kDa polyethylenamine PEI as a transfection reagent is a simple, more cost-effective, and stable means of high-throughput production of high-titer AAV serotype 2. The use of PEI also eliminates the need to change cell medium post-transfection, lowering cost and workload, while producing high-titer, efficacious AAV2 vectors for routine gene transfer. Copyright © 2013 Elsevier B.V. All rights reserved.
A linear-dendritic cationic vector for efficient DNA grasp and delivery.
Yang, Bin; Sun, Yun-xia; Yi, Wen-jie; Yang, Juan; Liu, Chen-wei; Cheng, Han; Feng, Jun; Zhang, Xian-zheng; Zhuo, Ren-xi
2012-07-01
This paper presents an attempt to design an efficient and biocompatible cationic gene vector via structural optimization that favors the efficient utilization of amine groups for DNA condensation. To this end, a linear-dendritic block copolymer of methoxyl-poly(ethylene glycol)-dendritic polyglycerol-graft-tris(2-aminoethyl)amine (mPEG-DPG-g-TAEA) was prepared with specially designed multiple functions including strong DNA affinity, endosomal buffering and expected serum-tolerance. Based on the transfection in serum-free and serum-conditioned media, the influences of the polymer structures including the degree of polymerization of DPG and TAEA substitution degree were explored. As compared to polyethylenimine (M(w)=5 kDa) (PEI5k) with similar molecular weight and higher amine density, mPEG-DPG-g-TAEA displayed comparably high DNA affinity due to the special linear-dendritic architecture. Consequently, at very low N/P ratio, mPEG-DPG-g-TAEA vectors could mediate efficient in vitro luciferase expression at levels that are comparable with or even superior to the commercially available Lipofectamine™ 2000, while being apparently higher than PEI5k. The designed vectors exhibit considerably higher cell biocompatibility and better resistance against bovine serum albumin adsorption than PEI5k. The stability of the complexes on coincubation with heparin was found to be largely dependent on the polymer structure. As concluded from the comparative transfection study in the absence/presence of chloroquine, it is likely that the polycation itself could produce endosomal buffering. This linear-dendritic vector shows promising potential for the application of gene delivery. Copyright © 2012 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
Euler-Vector Clustering of GPS Velocities Defines Microplate Geometry in Southwest Japan
NASA Astrophysics Data System (ADS)
Savage, J. C.
2018-02-01
I have used Euler-vector clustering to assign 469 GEONET stations in southwest Japan to k clusters (k = 2, 3,..., 9) so that, for any k, the velocities of stations within each cluster are most consistent with rigid-block motion on a sphere. That is, I attempt to explain the raw (i.e., uncorrected for strain accumulation), 1996-2006 velocities of those 469 Global Positioning System stations by rigid motion of k clusters on the surface of a spherical Earth. Because block geometry is maintained as strain accumulates, Euler-vector clustering may better approximate the block geometry than the values of the associated Euler vectors. The microplate solution for each k is constructed by merging contiguous clusters that have closely similar Euler vectors. The best solution consists of three microplates arranged along the Nankaido Trough-Ryukyu Trench between the Amurian and Philippine Sea Plates. One of these microplates, the South Kyushu Microplate (an extension of the Ryukyu forearc into the southeast corner of Kyushu), had previously been identified from paleomagnetic rotations. Relative to ITRF2000 the three microplates rotate at different rates about neighboring poles located close to the northwest corner of Shikoku. The microplate model is identical to that proposed in the block model of Wallace et al. (2009, https://doi.org/10.1130/G2522A.1) except in southernmost Kyushu. On Shikoku and Honshu, but not Kyushu, the microplate model is consistent with that proposed in the block models of Nishimura and Hashimoto (2006, https://doi.org/10.1016/j.tecto.2006.04.017) and Loveless and Meade (2010, https://doi.org/10.1029/2008JB006248) without the low-slip-rate boundaries proposed in the latter.
Nogales-Bueno, Julio; Ayala, Fernando; Hernández-Hierro, José Miguel; Rodríguez-Pulido, Francisco José; Echávarri, José Federico; Heredia, Francisco José
2015-05-06
Characteristic vector analysis has been applied to near-infrared spectra to extract the main spectral information from hyperspectral images. For this purpose, 3, 6, 9, and 12 characteristic vectors have been used to reconstruct the spectra, and root-mean-square errors (RMSEs) have been calculated to measure the differences between characteristic vector reconstructed spectra (CVRS) and hyperspectral imaging spectra (HIS). RMSE values obtained were 0.0049, 0.0018, 0.0012, and 0.0012 [log(1/R) units] for spectra allocated into the validation set, for 3, 6, 9, and 12 characteristic vectors, respectively. After that, calibration models have been developed and validated using the different groups of CVRS to predict skin total phenolic concentration, sugar concentration, titratable acidity, and pH by modified partial least-squares (MPLS) regression. The obtained results have been compared to those previously obtained from HIS. The models developed from the CVRS reconstructed from 12 characteristic vectors present similar values of coefficients of determination (RSQ) and standard errors of prediction (SEP) than the models developed from HIS. RSQ and SEP were 0.84 and 1.13 mg g(-1) of skin grape (expressed as gallic acid equivalents), 0.93 and 2.26 °Brix, 0.97 and 3.87 g L(-1) (expressed as tartaric acid equivalents), and 0.91 and 0.14 for skin total phenolic concentration, sugar concentration, titratable acidity, and pH, respectively, for the models developed from the CVRS reconstructed from 12 characteristic vectors.
Tao, Zhi-Wei; Zou, Ping-An
2018-06-13
Osteosarcoma is a disease prone to recurrence and metastasis, and adenovirus expression vector is frequently studied as a therapeutic target of osteosarcoma in recent year. This study attempts to explore the effect of adenovirus-mediated small interfering RNA (siRNA) targeting ezrin on the proliferation, migration, invasion and apoptosis of human osteosarcoma MG-63 cells. Human osteosarcoma MG-63 cell line was selected for construction of recombinant adenovirus vector. The mRNA and protein levels of ezrin, Bcl2-associated X protein (Bax), B cell lymphoma-2 (Bcl-2), p21, p53, Caspase-3, matrix metalloproteinase 2 (MMP-2) and MMP-9, Cyclin D1, and cyclin-dependent kinase 4a (CDK4a) were determined. Through ELISA, the levels of Caspase-3, MMP-2 and MMP-9 were examined. Finally, human osteosarcoma MG-63 cell viability, growth, invasion, migration, and apoptosis were detected. Initially, adenovirus expression vector of ezrin was constructed by ezrin 2 siRNA sequence. Adenovirus-mediated siRNA targeting ezrin reduced expression of ezrin in MG-63 cells. The results revealed that adenovirus-mediated siRNA targeting ezrin elevated expression levels of Bax, P21, P53, and Caspase-3, Cyclin D1, and CDK4a and reduced expression levels of Bcl-2, MMP-2, and MMP-9. Furthermore, adenovirus-mediated siRNA targeting ezrin inhibited human osteosarcoma MG-63 cell viability, growth, invasion, and migration, and promoted apoptosis. Our study demonstrates that adenovirus-mediated siRNA targeting ezrin can induce apoptosis and inhibit the proliferation, migration and invasion of human osteosarcoma MG-63 cells. ©2018 The Author(s).
Inhibition of SET Domain–Containing Lysine Methyltransferase 7/9 Ameliorates Renal Fibrosis
Sasaki, Kensuke; Nakashima, Ayumu; Irifuku, Taisuke; Yamada, Kyoko; Kokoroishi, Keiko; Ueno, Toshinori; Doi, Toshiki; Hida, Eisuke; Arihiro, Koji; Kohno, Nobuoki
2016-01-01
TGF-β1 activity results in methylation of lysine 4 of histone H3 (H3K4) through SET domain–containing lysine methyltransferase 7/9 (SET7/9) induction, which is important for the transcriptional activation of fibrotic genes in vitro. However, in vivo studies utilizing an experimental model of renal fibrosis are required to develop therapeutic interventions that target SET7/9. In this study, we investigated the signaling pathway of TGF-β1-induced SET7/9 expression and whether inhibition of SET7/9 suppresses renal fibrosis in unilateral ureteral obstruction (UUO) mice and kidney cell lines. Among the SET family, SET7/9 was upregulated on days 3 and 7 in UUO mice, and the upregulation was suppressed by TGF-β1 neutralizing antibody. TGF-β1 induced SET7/9 expression via Smad3 in normal rat kidney (NRK)-52E cells. In human kidney biopsy specimens from patients diagnosed with IgA nephropathy and membranous nephropathy, SET7/9 expression was positively correlated with the degree of interstitial fibrosis (r=0.59, P=0.001 in patients with IgA nephropathy; and r=0.58, P<0.05 in patients with membranous nephropathy). In addition, small interfering RNA-mediated knockdown of SET7/9 expression significantly attenuated renal fibrosis in UUO mice. Sinefungin, an inhibitor of SET7/9, also suppressed the expression of mesenchymal markers and extracellular matrix proteins and inhibited H3K4 mono-methylation (H3K4me1) in kidneys of UUO mice. Moreover, sinefungin had an inhibitory effect on TGF-β1-induced α-smooth muscle actin expression and H3K4me1 in both NRK-52E and NRK-49F cells. In conclusion, sinefungin, a SET7/9 inhibitor, ameliorates renal fibrosis by inhibiting H3K4me1 and may be a candidate therapeutic agent. PMID:26045091
Horynová, Milada; Takahashi, Kazuo; Hall, Stacy; Renfrow, Matthew B; Novak, Jan; Raška, Milan
2012-02-01
The human UDP-N-acetyl-α-d-galactosamine:polypeptide N-acetylgalactosaminyl-transferase 2 (GalNAc-T2) is one of the key enzymes that initiate synthesis of hinge-region O-linked glycans of human immunoglobulin A1 (IgA1). We designed secreted soluble form of human GalNAc-T2 as a fusion protein containing mouse immunoglobulin light chain kappa secretory signal and expressed it using baculovirus and mammalian expression vectors. The recombinant protein was secreted by insect cells Sf9 and human HEK 293T cells in the culture medium. The protein was purified from the media using affinity Ni-NTA chromatography followed by stabilization of purified protein in 50mM Tris-HCl buffer at pH 7.4. Although the purity of recombinant GalNAc-T2 was comparable in both expression systems, the yield was higher in Sf9 insect expression system (2.5mg of GalNAc-T2 protein per 1L culture medium). The purified soluble recombinant GalNAc-T2 had an estimated molecular mass of 65.8kDa and its amino-acid sequence was confirmed by mass-spectrometric analysis. The enzymatic activity of Sf9-produced recombinant GalNAc-T2 was determined by the quantification of enzyme-mediated attachment of GalNAc to synthetic IgA1 hinge-region peptide as the acceptor and UDP-GalNAc as the donor. In conclusion, murine immunoglobulin kappa secretory signal was used for production of secreted enzymatically active GalNAc-T2 in insect baculovirus expression system. Copyright © 2011 Elsevier Inc. All rights reserved.
Effect of medium-chain triglycerides on calbindin-D9k expression in the intestine.
Devlin, A; Innis, S M; Wall, K; Krisinger, J
1996-05-01
These studies determined the effect of the saturated fat source in infant formula on the expression of calbindin-D9k (CaBP-9k). Piglets were fed from birth to 8 d with milk or formula containing saturated fatty acids as medium-chain triglycerides (MCT), coconut oil, palm oil (Palm 1), or synthesized triglycerides with 16:0 directed to the sn-2 position (Palm 2). Levels of intestinal CaBP-9k mRNA were significantly (P < 0.01) higher in piglets fed formula with MCT than in piglets fed the other formula or milk; and higher in piglets fed the Palm-1 than in piglets fed Palm-2 formula. This is the first evidence that MCT alter piglet intestinal CaBP-9k mRNA.
Burbank, Lindsey P; Stenger, Drake C
2016-08-01
The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacterial genetics but there are only a limited number of plasmid vectors available that replicate in X. fastidiosa, and even fewer that are retained without antibiotic selection. Two plasmids are described here that show stable replication in X. fastidiosa and are effective for gene complementation both in vitro and in planta. Plasmid maintenance is facilitated by incorporation of the PemI/PemK plasmid addiction system, consisting of PemK, an endoribonuclease toxin, and its cognate antitoxin, PemI. Vector pXf20pemIK utilizes a native X. fastidiosa replication origin as well as a high-copy-number pUC origin for propagation in Escherichia coli cloning strains. Broad-host-range vector pBBR5pemIK is a medium- to low-copy-number plasmid based on the pBBR1 backbone. Both plasmids are maintained for extended periods of time in the absence of antibiotic selection, as well as up to 14 weeks in grapevine, without affecting bacterial fitness. These plasmids present an alternative to traditional complementation and expression vectors which rely on antibiotic selection for plasmid retention.
Tsutsui, Hiroki; Higashiyama, Tetsuya
2017-01-01
The CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats/CRISPR-associated 9) system is widely used as a tool for genome engineering in various organisms. A complex consisting of Cas9 and single guide RNA (sgRNA) induces a DNA double-strand break in a sequence-specific manner, resulting in knockout. Some binary vectors for CRISPR/Cas9 in plants have been reported, but there is a problem with low efficiency. Here, we present a newly developed, highly efficient CRISPR/Cas9 vector for Arabidopsis thaliana, pKAMA-ITACHI Red (pKIR), harboring the RIBOSOMAL PROTEIN S5 A (RPS5A) promoter to drive Cas9. The RPS5A promoter maintains high constitutive expression at all developmental stages starting from the egg cell and including meristematic cells. Even in the T1 generation, pKIR induced null phenotypes in some genes: PHYTOENE DESATURASE 3 (PDS3), AGAMOUS (AG) and DUO POLLEN 1 (DUO1). Mutations induced by pKIR were carried in the germ cell line of the T1 generation. Surprisingly, in some lines, 100% of the T2 plants had the adh1 (ALCOHOL DEHYDROGENASE 1) null phenotype, indicating that pKIR strongly induced heritable mutations. Cas9-free T2 mutant plants were obtained by removing T2 seeds expressing a fluorescent marker in pKIR. Our results suggest that the pKIR system is a powerful molecular tool for genome engineering in Arabidopsis. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists.
The Role of Tim50 in Chemoresistance and Oncogenesis of Breast Cancer
2011-02-01
digested with Hind III and Kpn I and ligated into the pGL3 vector (Promega, Madison WI) upstream of the luciferase reporter gene. This construct was...expressing vector (HC5) or mutant p53-R273H (3 x 106) were cross-linked with 1% formaldehyde for 15 min and the reaction stopped by addition of glycine to...10 mg/ml) and treated with proteinase K (20 mg/ml). Proteins were removed by phenol – chloroform extraction and the DNA isolated by ethanol
2011-01-01
Background Plant lipoxygenases (LOXs) have been proposed to form biologically active compounds both during normal developmental stages such as germination or growth as well as during responses to environmental stress such as wounding or pathogen attack. In our previous study, we found that enzyme activity of endogenous 9-LOX in Nicotiana benthamiana was highly induced by agroinfiltration using a tobacco mosaic virus (TMV) based vector system. Results A LOX gene which is expressed after treatment of the viral vectors was isolated from Nicotiana benthamiana. As the encoded LOX has a high amino acid identity to other 9-LOX proteins, the gene was named as Nb-9-LOX. It was heterologously expressed in yeast cells and its enzymatic activity was characterized. The yeast cells expressed large quantities of stable 9-LOX (0.9 U ml-1 cell cultures) which can oxygenate linoleic acid resulting in high yields (18 μmol ml-1 cell cultures) of hydroperoxy fatty acid. The product specificity of Nb-9-LOX was examined by incubation of linoleic acid and Nb-9-LOX in combination with a 13-hydroperoxide lyase from watermelon (Cl-13-HPL) or a 9/13-hydroperoxide lyase from melon (Cm-9/13-HPL) and by LC-MS analysis. The result showed that Nb-9-LOX possesses both 9- and 13-LOX specificity, with high predominance for the 9-LOX function. The combination of recombinant Nb-9-LOX and recombinant Cm-9/13-HPL produced large amounts of C9-aldehydes (3.3 μmol mg-1 crude protein). The yield of C9-aldehydes from linoleic acid was 64%. Conclusion The yeast expressed Nb-9-LOX can be used to produce C9-aldehydes on a large scale in combination with a HPL gene with 9-HPL function, or to effectively produce 9-hydroxy-10(E),12(Z)-octadecadienoic acid in a biocatalytic process in combination with cysteine as a mild reducing agent. PMID:21450085
DOE Office of Scientific and Technical Information (OSTI.GOV)
Buarque, Diego S.; Spindola, Leticia M.N.; Martins, Rafael M.
2011-09-23
Highlights: {yields} Tigutcystatin inhibits Trypanosoma cruzi cysteine proteases with high specificity. {yields} Tigutcystatin expression is up-regulated in response to T. cruzi infection. {yields} It is the first cysteine proteases inhibitor characterized from a triatomine insect. -- Abstract: The insect Triatoma infestans is a vector of Trypanosoma cruzi, the etiological agent of Chagas disease. A cDNA library was constructed from T. infestans anterior midgut, and 244 clones were sequenced. Among the EST sequences, an open reading frame (ORF) with homology to a cystatin type 2 precursor was identified. Then, a 288-bp cDNA fragment encoding mature cystatin (lacking signal peptide) named Tigutcystatinmore » was cloned fused to a N-terminal His tag in pET-14b vector, and the protein expressed in Escherichia coli strain Rosetta gami. Tigutcystatin purified and cleaved by thrombin to remove His tag presented molecular mass of 11 kDa and 10,137 Da by SDS-PAGE and MALDI-TOF mass spectrometry, respectively. Purified Tigutcystatin was shown to be a tight inhibitor towards cruzain, a T. cruzi cathepsin L-like enzyme (K{sub i} = 3.29 nM) and human cathepsin L (K{sub i} = 3.78 nM). Tissue specific expression analysis showed that Tigutcystatin was mostly expressed in anterior midgut, although amplification in small intestine was also detected by semi quantitative RT-PCR. qReal time PCR confirmed that Tigutcystatin mRNA is significantly up-regulated in anterior midgut when T. infestans is infected with T. cruzi. Together, these results indicate that Tigutcystatin may be involved in modulation of T. cruzi in intestinal tract by inhibiting parasite cysteine proteases, which represent the virulence factors of this protozoan.« less
Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc
2017-07-25
Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.
Gene Editing Vectors for Studying Nicotinic Acetylcholine Receptors in Cholinergic Transmission.
Peng, Can; Yan, Yijin; Kim, Veronica J; Engle, Staci E; Berry, Jennifer N; McIntosh, J Michael; Neve, Rachael L; Drenan, Ryan M
2018-05-19
Nicotinic acetylcholine receptors (nAChRs), prototype members of the cys-loop ligand gated ion channel family, are key mediators of cholinergic transmission in the central nervous system. Despite their importance, technical gaps exist in our ability to dissect the function of individual subunits in the brain. To overcome these barriers, we designed CRISPR/Cas9 small guide RNA sequences (sgRNAs) for production of loss-of-function alleles in mouse nAChR genes. These sgRNAs were validated in vitro via deep sequencing. We subsequently targeted candidate nAChR genes in vivo by creating herpes simplex virus (HSV) vectors delivering sgRNAs and Cas9 expression to mouse brain. Production of loss-of-function insertions or deletions (indels) by these "all-in-one" HSV vectors was confirmed using brain slice patch clamp electrophysiology coupled with pharmacological analysis. Next, we developed a scheme for cell type-specific gene editing in mouse brain. Knockin mice expressing Cas9 in a Cre-dependent manner were validated using viral microinjections and genetic crosses to common Cre-driver mouse lines. We subsequently confirmed functional Cas9 activity by targeting the ubiquitous neuronal protein, NeuN, using adeno associated virus (AAV) delivery of sgRNAs. Finally, the mouse β2 nAChR gene was successfully targeted in dopamine transporter (DAT) positive neurons via CRISPR/Cas9. The sgRNA sequences and viral vectors, including our scheme for Cre-dependent gene editing, should be generally useful to the scientific research community. These tools could lead to new discoveries related to the function of nAChRs in neurotransmission and behavioral processes. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Wang, Ping
2018-06-27
Cryptococcus neoformans and related species are encapsulated basidiomycetous fungi that cause meningoencephalitis in individuals with immune deficiency. This pathogen has a tractable genetic system; however, gene disruption via electroporation remains difficult, while biolistic transformation is often limited by lack of multiple genetic markers and the high initial cost of equipment. The approach using clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated protein 9 (Cas9) has become the technology of choice for gene editing in many organisms due to its simplicity, efficiency, and versatility. The technique has been successfully demonstrated in C. neoformans and Cryptococcus deneoformans in which two DNA plasmids expressing either the Streptococcus pyogenes CAS9 gene or the guide RNA (gRNA) were employed. However, potential adverse effects due to constitutive expression and the time-consuming process of constructing vectors to express each gRNA remain as a primary barrier for wide adaptation. This report describes the delivery of preassembled CRISPR-Cas9-gRNA ribonucleoproteins (RNPs) via electroporation that is able to generate edited mutant alleles. RNP-mediated CRISPR-Cas9 was used to replace the wild-type GIB2 gene encoding a Gβ-like/RACK1 Gib2 protein with a gib2 :: NAT allele via homologous recombination in both C. neoformans and C. deneoformans In addition, a DNA plasmid (pCnCas9:U6-gRNA) that expresses both Cas9 and gRNA, allowing for convenient yet low-cost DNA-mediated gene editing, is described. pCnCas9:U6-gRNA contains an endogenous U6 promoter for gRNA expression and restriction sites for one-step insertion of a gRNA. These approaches and resources provide new opportunities to accelerate genetic studies of Cryptococcus species. IMPORTANCE For genetic studies of the Cryptococcus genus, generation of mutant strains is often hampered by a limited number of selectable genetic markers, the tedious process of vector construction, side effects, and other limitations, such as the high cost of acquiring a particle delivery system. CRISPR-Cas9 technology has been demonstrated in Cryptococcus for genome editing. However, it remains labor-intensive and time-consuming since it requires the identification of a suitable type III RNA polymerase promoter for gRNA expression. In addition, there may be potential adverse effects caused by constitutive expressions of Cas9 and gRNA. Here, I report the use of a ribonucleoprotein-mediated CRISPR-Cas9 technique for genome editing of C. neoformans and related species. Together with the custom-constructed pCnCas9:U6-gRNA vector that allows low-cost and time-saving DNA-based CRISPR-Cas9, my approach adds to the molecular toolbox for dissecting the molecular mechanism of pathogenesis in this important group of fungal pathogens. Copyright © 2018 Wang.
Machitani, Mitsuhiro; Sakurai, Fuminori; Wakabayashi, Keisaku; Nakatani, Kosuke; Takayama, Kazuo; Tachibana, Masashi; Mizuguchi, Hiroyuki
2017-01-01
Clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9-mediated genome engineering technology is a powerful tool for generation of cells and animals with engineered mutations in their genomes. In order to introduce the CRISPR/Cas9 system into target cells, nonviral and viral vectors are often used; however, such vectors trigger innate immune responses associated with production of type I interferons (IFNs). We have recently demonstrated that type I IFNs inhibit short-hairpin RNA-mediated gene silencing, which led us to hypothesize that type I IFNs may also inhibit CRISPR/Cas9-mediated genome mutagenesis. Here we investigated this hypothesis. A single-strand annealing assay using a reporter plasmid demonstrated that CRISPR/Cas9-mediated cleavage efficiencies of the target double-stranded DNA were significantly reduced by IFNα. A mismatch recognition nuclease-dependent genotyping assay also demonstrated that IFNα reduced insertion or deletion (indel) mutation levels by approximately half. Treatment with IFNα did not alter Cas9 protein expression levels, whereas the copy numbers of guide RNA (gRNA) were significantly reduced by IFNα stimulation. These results indicate that type I IFNs significantly reduce gRNA expression levels following introduction of the CRISPR/Cas9 system in the cells, leading to a reduction in the efficiencies of CRISPR/Cas9-mediated genome mutagenesis. Our findings provide important clues for the achievement of efficient genome engineering using the CRISPR/Cas9 system.
Ferrara, Taíse Fernanda da Silva; Schneider, Vanessa Karine; Kishi, Luciano Takeshi; Carmona, Adriana Karaoglanovic; Alves, Marcio Fernando Madureira; Belasque-Júnior, Jose; Rosa, José César; Hunter, Wayne Brian; Henrique-Silva, Flávio; Soares-Costa, Andrea
2015-01-01
Huanglonbing (HLB) is one of the most destructive disease affecting citrus plants. The causal agent is associated with the phloem-limited bacterium Candidatus Liberibacter asiaticus (CLas) and the psyllid Diaphorina citri, vector of disease, that transmits the bacterium associated with HLB. The control of disease can be achieved by suppressing either the bacterium or the vector. Among the control strategies for HLB disease, one of the widely used consists in controlling the enzymes of the disease vector, Diaphorina citri. The insect Diaphorina citri belongs to the order Hemiptera, which frequently have cysteine peptidases in the gut. The importance of this class of enzymes led us to search for enzymes in the D. citri transcriptome for the establishment of alternatives strategies for HLB control. In this study, we reported the identification and characterization of a cathepsin B-like cysteine peptidase from D. citri (DCcathB). DCcathB was recombinantly expressed in Pichia pastoris, presenting a molecular mass of approximately 50 kDa. The enzyme hydrolyzed the fluorogenic substrate Z-F-R-AMC (Km = 23.5 μM) and the selective substrate for cathepsin B, Z-R-R-AMC (Km = 6.13 μM). The recombinant enzyme was inhibited by the cysteine protease inhibitors E64 (IC50 = 0.014 μM) and CaneCPI-4 (Ki = 0.05 nM) and by the selective cathepsin B inhibitor CA-074 (IC50 = 0.095 nM). RT-qPCR analysis revealed that the expression of the DCcathB in nymph and adult was approximately 9-fold greater than in egg. Moreover, the expression of this enzyme in the gut was 175-fold and 3333-fold higher than in the remaining tissues and in the head, respectively, suggesting that DCcathB can be a target for HLB control.
Zhao, Chunnian; Sun, GuoQiang; Li, Shengxiu; Shi, Yanhong
2009-01-01
Summary MicroRNAs are important players in stem cell biology. Among them, microRNA-9 (miR-9) is expressed specifically in neurogenic areas of the brain. Whether miR-9 plays a role in neural stem cell self-renewal and differentiation is unknown. We showed previously that nuclear receptor TLX is an essential regulator of neural stem cell self-renewal. Here we show that miR-9 suppresses TLX expression to negatively regulate neural stem cell proliferation and accelerate neural differentiation. Introducing a TLX expression vector lacking the miR-9 recognition site rescued miR-9-induced proliferation deficiency and inhibited precocious differentiation. In utero electroporation of miR-9 in embryonic brains led to premature differentiation and outward migration of the transfected neural stem cells. Moreover, TLX represses miR-9 pri-miRNA expression. MiR-9, by forming a negative regulatory loop with TLX, establishes a model for controlling the balance between neural stem cell proliferation and differentiation. PMID:19330006
New formulation of the laws of reflection of light
NASA Astrophysics Data System (ADS)
Pérez, Ángel Luis; Martínez, Guadalupe; Suero, María. Isabel
2013-11-01
A new formulation of the laws of reflection of light based on the particle model is presented, and it is shown the equivalence between the new and the classic formulations. The proposed formulation has a significant educational value, as it allows drawing analogies between the phenomena of light reflection and elastic collisions, which are very well known by students. The proposed formulation is: "If at one point on a surface whose orientation in space is defined by a unit vector k, strikes an incident ray corresponding to a plane wave (propagating through a homogeneous and isotropic medium) whose direction of propagation coincides with that from a unit vector ui [expressed in terms of its components with respect to an orthonormal coordinate system, with one of its axis coinciding with the direction of k (ui = uix i + uiy j + uiz k)], it will be reflected so that the unit vector whose direction coincides with that from the reflected ray, ur, will only differ from the unit vector whose direction coincides with that from the incident ray, in the change of the sign of the component in the direction of k (ur = uix i + uiy j - uiz k)". Stated in everyday language, is equivalent of saying that the reflection of light occurs as if the photons underwent perfectly elastic collisions with the surface in question. As an example, this formulation is applied for the resolution of the classic reflection problem of the three plane mirrors forming a trirectangular trihedron.
Bish, Lawrence T.; Sleeper, Meg M.; Brainard, Benjamin; Cole, Stephen; Russell, Nicholas; Withnall, Elanor; Arndt, Jason; Reynolds, Caryn; Davison, Ellen; Sanmiguel, Julio; Wu, Di; Gao, Guangping; Wilson, James M.; Sweeney, H. Lee
2011-01-01
Achieving efficient cardiac gene transfer in a large animal model has proven to be technically challenging. Prior strategies have employed cardio-pulmonary bypass or dual catheterization with the aid of vasodilators to deliver vectors, such as adenovirus, adeno-associated virus or plasmid DNA. While single stranded adeno-associated virus vectors have shown the greatest promise, they suffer from delayed expression, which might be circumvented by using self-complementary vectors. We sought to optimize cardiac gene transfer using a percutaneous transendocardial injection catheter to deliver adeno-associated virus vectors to the canine myocardium. Four vectors were evaluated—single stranded adeno-associated virus 9, self-complementary adeno-associated virus 9, self-complementary adeno-associated virus 8, self-complementary adeno-associated virus 6—so that comparison could be made between single stranded and self complementary vectors as well as among serotypes 9, 8, and 6. We demonstrate that self-complementary adeno-associated virus is superior to single stranded adeno-associated virus and that adeno-associated virus 6 is superior to other serotypes evaluated. Biodistribution studies revealed that vector genome copies were 15 to 4000 times more abundant in the heart than in any other organ for self-complementary adeno-associated virus 6. Percutaneous transendocardial injection of self-complementary adeno-associated virus 6 is a safe, effective method for achieving efficient cardiac gene transfer. PMID:18813281
Chee Wei, T; Nurul Wahida, A G; Shaharum, S
2014-12-01
Malaysia first reported H5N1 poultry case in 2004 and subsequently outbreak in poultry population in 2007. Here, a recombinant gene encoding of peptide epitopes, consisting fragments of HA1, HA2 and a polybasic cleavage site of H5N1 strain Malaysia, was amplified and cloned into pET-47b(+) bacterial expression vector. DNA sequencing and alignment analysis confirmed that the gene had no alteration and in-frame to the vector. Then, His-tagged truncated HA protein was expressed in Escherichia coli BL21 (DE3) under 1 mM IPTG induction. The protein expression was optimized under a time-course induction study and further purified using Ni-NTA agarose under reducing condition. Migration size of protein was detected at 15 kDa by Western blot using anti-His tag monoclonal antibody and demonstrated no discrepancy compared to its calculated molecular weight.
Parodi, Stefano; Manneschi, Chiara; Verda, Damiano; Ferrari, Enrico; Muselli, Marco
2018-03-01
This study evaluates the performance of a set of machine learning techniques in predicting the prognosis of Hodgkin's lymphoma using clinical factors and gene expression data. Analysed samples from 130 Hodgkin's lymphoma patients included a small set of clinical variables and more than 54,000 gene features. Machine learning classifiers included three black-box algorithms ( k-nearest neighbour, Artificial Neural Network, and Support Vector Machine) and two methods based on intelligible rules (Decision Tree and the innovative Logic Learning Machine method). Support Vector Machine clearly outperformed any of the other methods. Among the two rule-based algorithms, Logic Learning Machine performed better and identified a set of simple intelligible rules based on a combination of clinical variables and gene expressions. Decision Tree identified a non-coding gene ( XIST) involved in the early phases of X chromosome inactivation that was overexpressed in females and in non-relapsed patients. XIST expression might be responsible for the better prognosis of female Hodgkin's lymphoma patients.
Human XPA and XRCC1 DNA repair proteins expressed in yeast, Saccharomyces cerevisiae.
Pushnova, E A; Ostanin, K; Thelen, M P
2001-11-01
Human XPA and XRCC1 DNA repair proteins have been expressed in a series of novel yeast episomal vectors. Expression of XPA cDNA resulted in synthesis of anti-XPA crossreacting polypeptides of 40 and 42 kDa, the status of the native protein found in human cells. Likewise, the majority of the recombinant XRCC1 found in the yeast intracellular fraction corresponded to the molecular mass of the full-length human protein. Recombinant XPA protein expressed as an NH(2)-terminal polyhistidine fusion could be affinity purified using Ni(2+) agarose. Copyright 2001 Academic Press.
Chen, Ting; Huang, Dangsheng; Chen, Guanghui; Yang, Tingshu; Yi, Jun; Tian, Miao
2015-02-01
The adipose tissue-derived stem cells (ADSCs) represent a significant area of the cell therapy. Genetic modification of ADSCs may further improve their therapeutic potential. Here, we aimed to generate a lentiviral vector expressing insulin-like growth factor-I (IGF-1) and investigate the impact of IGF-1 transduction on the properties of cultured ADSCs. Isolated rat ADSCs were assessed by flow cytometric analysis. IGF-1 was cloned and inserted into the pLenO-DCE plasmid to acquire pLenO-DCE-IGF-1 plasmid. Lentivirus was enveloped with pRsv-REV, pMDlg-pRRE and pMD2G plasmids in 293T cells. The ADSCs were transfected with the vectors. And then IGF-1-induced anti-apoptosis was evaluated by annexin V-FITC. Besides, proliferation of cells was detected by MTT assay and EdU. Moreover, Akt phosphorylation was evaluated by Western blotting analysis. Stable expression of IGF-1 in ADSCs was confirmed. ADSCs were positive for CD90 and CD29, but negative for CD31, CD34 and CD45. The transduction of IGF-1 to the ADSCs caused a dramatic increase in P-Akt expression. Over-expression of IGF-1 in ADSCs could improve the paracine of IGF-1 in a time-dependent manner, but could not promote the proliferation of ADSCs. This study indicated that lentiviral vectors offered a promising mean of delivering IGF-1 to the ADSCs. Lentiviral-mediated over-expression of therapeutic IGF-1 gene in ADSCs could prolong the anti-apoptosis effect of IGF-1, which might be induced by the activation of the PI3K/Akt pathway. And our data would improve the efficacy of ADSC-based therapies.
AAV-CRISPR/Cas9-Mediated Depletion of VEGFR2 Blocks Angiogenesis In Vitro.
Wu, Wenyi; Duan, Yajian; Ma, Gaoen; Zhou, Guohong; Park-Windhol, Cindy; D'Amore, Patricia A; Lei, Hetian
2017-12-01
Pathologic angiogenesis is a component of many diseases, including neovascular age-related macular degeneration, proliferation diabetic retinopathy, as well as tumor growth and metastasis. The purpose of this project was to examine whether the system of adeno-associated viral (AAV)-mediated CRISPR (clustered regularly interspaced short palindromic repeats)-associated endonuclease (Cas)9 can be used to deplete expression of VEGF receptor 2 (VEGFR2) in human vascular endothelial cells in vitro and thus suppress its downstream signaling events. The dual AAV system of CRISPR/Cas9 from Streptococcus pyogenes (AAV-SpGuide and -SpCas9) was adapted to edit genomic VEGFR2 in primary human retinal microvascular endothelial cells (HRECs). In this system, the endothelial-specific promoter for intercellular adhesion molecule 2 (ICAM2) was cloned into the dual AAV vectors of SpGuide and SpCas9 for driving expression of green fluorescence protein (GFP) and SpCas9, respectively. These two AAV vectors were applied to production of recombinant AAV serotype 5 (rAAV5), which were used to infect HRECs for depletion of VEGFR2. Protein expression was determined by Western blot; and cell proliferation, migration, as well as tube formation were examined. AAV5 effectively infected vascular endothelial cells (ECs) and retinal pigment epithelial (RPE) cells; the ICAM2 promoter drove expression of GFP and SpCas9 in HRECs, but not in RPE cells. The results showed that the rAAV5-CRISPR/Cas9 depleted VEGFR2 by 80% and completely blocked VEGF-induced activation of Akt, and proliferation, migration as well as tube formation of HRECs. AAV-CRISRP/Cas9-mediated depletion of VEGFR2 is a potential therapeutic strategy for pathologic angiogenesis.
Li, Qing-Lan; Lei, Pin-Ji; Zhao, Quan-Yi; Li, Lianyun; Wei, Gang; Wu, Min
2017-08-01
Epigenetic marks are critical regulators of chromatin and gene activity. Their roles in normal physiology and disease states, including cancer development, still remain elusive. Herein, the epigenomic change of H3K9me3, as well as its potential impacts on gene activity and genome stability, was investigated in an in vitro breast cancer transformation model. The global H3K9me3 level was studied with western blotting. The distribution of H3K9me3 on chromatin and gene expression was studied with ChIP-Seq and RNA-Seq, respectively. The global H3K9me3 level decreases during transformation and its distribution on chromatin is reprogrammed. By combining with TCGA data, we identified 67 candidate oncogenes, among which five genes are totally novel. Our analysis further links H3K9me3 with transposon activity, and suggests H3K9me3 reduction increases the cell's sensitivity to DNA damage reagents. H3K9me3 reduction is possibly related with breast cancer transformation by regulating gene expression and chromatin stability during transformation.
In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering
Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang
2017-01-01
Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5′ untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3′UTR from the E. coli ribosomal RNA operon rrnB. Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids. PMID:28871270
In vivo Assembly in Escherichia coli of Transformation Vectors for Plastid Genome Engineering.
Wu, Yuyong; You, Lili; Li, Shengchun; Ma, Meiqi; Wu, Mengting; Ma, Lixin; Bock, Ralph; Chang, Ling; Zhang, Jiang
2017-01-01
Plastid transformation for the expression of recombinant proteins and entire metabolic pathways has become a promising tool for plant biotechnology. However, large-scale application of this technology has been hindered by some technical bottlenecks, including lack of routine transformation protocols for agronomically important crop plants like rice or maize. Currently, there are no standard or commercial plastid transformation vectors available for the scientific community. Construction of a plastid transformation vector usually requires tedious and time-consuming cloning steps. In this study, we describe the adoption of an in vivo Escherichia coli cloning (iVEC) technology to quickly assemble a plastid transformation vector. The method enables simple and seamless build-up of a complete plastid transformation vector from five DNA fragments in a single step. The vector assembled for demonstration purposes contains an enhanced green fluorescent protein (GFP) expression cassette, in which the gfp transgene is driven by the tobacco plastid ribosomal RNA operon promoter fused to the 5' untranslated region (UTR) from gene10 of bacteriophage T7 and the transcript-stabilizing 3'UTR from the E. coli ribosomal RNA operon rrnB . Successful transformation of the tobacco plastid genome was verified by Southern blot analysis and seed assays. High-level expression of the GFP reporter in the transplastomic plants was visualized by confocal microscopy and Coomassie staining, and GFP accumulation was ~9% of the total soluble protein. The iVEC method represents a simple and efficient approach for construction of plastid transformation vector, and offers great potential for the assembly of increasingly complex vectors for synthetic biology applications in plastids.
Zhao, Chunnian; Sun, GuoQiang; Li, Shengxiu; Shi, Yanhong
2009-04-01
MicroRNAs have been implicated as having important roles in stem cell biology. MicroRNA-9 (miR-9) is expressed specifically in neurogenic areas of the brain and may be involved in neural stem cell self-renewal and differentiation. We showed previously that the nuclear receptor TLX is an essential regulator of neural stem cell self-renewal. Here we show that miR-9 suppresses TLX expression to negatively regulate neural stem cell proliferation and accelerate neural differentiation. Introducing a TLX expression vector that is not prone to miR-9 regulation rescued miR-9-induced proliferation deficiency and inhibited precocious differentiation. In utero electroporation of miR-9 in embryonic brains led to premature differentiation and outward migration of the transfected neural stem cells. Moreover, TLX represses expression of the miR-9 pri-miRNA. By forming a negative regulatory loop with TLX, miR-9 provides a model for controlling the balance between neural stem cell proliferation and differentiation.
Birchenough, George M. H.; Johansson, Malin E. V.; Stabler, Richard A.; Dalgakiran, Fatma; Hansson, Gunnar C.; Wren, Brendan W.; Luzio, J. Paul
2013-01-01
Two-day-old (P2), but not 9-day-old (P9), rat pups are susceptible to systemic infection following gastrointestinal colonization by Escherichia coli K1. Age dependency reflects the capacity of colonizing K1 to translocate from gastrointestinal (GI) tract to blood. A complex GI microbiota developed by P2, showed little variation over P2 to P9, and did not prevent stable K1 colonization. Substantial developmental expression was observed over P2 to P9, including upregulation of genes encoding components of the small intestinal (α-defensins Defa24 and Defa-rs1) and colonic (trefoil factor Tff2) mucus barrier. K1 colonization modulated expression of these peptides: developmental expression of Tff2 was dysregulated in P2 tissues and was accompanied by a decrease in mucin Muc2. Conversely, α-defensin genes were upregulated in P9 tissues. We propose that incomplete development of the mucus barrier during early neonatal life and the capacity of colonizing K1 to interfere with mucus barrier maturation provide opportunities for neuropathogen translocation into the bloodstream. PMID:23798529
Paschall, Amy V.; Yang, Dafeng; Lu, Chunwan; Choi, Jeong-Hyeon; Li, Xia; Liu, Feiyan; Figueroa, Mario; Oberlies, Nicholas H.; Pearce, Cedric; Bollag, Wendy B.; Nayak-Kapoor, Asha; Liu, Kebin
2015-01-01
The Fas-FasL effector mechanism plays a key role in cancer immune surveillance by host T cells, but metastatic human colon carcinoma often uses silencing Fas expression as a mechanism of immune evasion. The molecular mechanism under FAS transcriptional silencing in human colon carcinoma is unknown. We performed genome-wide ChIP-Sequencing analysis and identified that the FAS promoter is enriched with H3K9me3 in metastatic human colon carcinoma cells. H3K9me3 level in the FAS promoter region is significantly higher in metastatic than in primary cancer cells, and is inversely correlated with Fas expression level. We discovered that verticillin A is a selective inhibitor of histone methyltransferases SUV39H1, SUV39H2 and G9a/GLP that exhibit redundant functions in H3K9 trimethylation and FAS transcriptional silencing. Genome-wide gene expression analysis identified FAS as one of the verticillin A target genes. Verticillin A treatment decreased H3K9me3 level in the FAS promoter and restored Fas expression. Furthermore, verticillin A exhibited greater efficacy than Decitabine and Vorinostat in overcoming colon carcinoma resistance to FasL-induced apoptosis. Verticillin A also increased DR5 expression and overcame colon carcinoma resistance to DR5 agonist drozitumab-induced apoptosis. Interestingly, verticillin A overcame metastatic colon carcinoma resistance to 5-Fluouracil in vitro and in vivo. Using an orthotopic colon cancer mouse model, we demonstrated that tumor-infiltrating cytotoxic T lymphocytes are FasL+ and FasL-mediated cancer immune surveillance is essential for colon carcinoma growth control in vivo. Our findings determine that H3K9me3 of the FAS promoter is a dominant mechanism underlying FAS silencing and resultant colon carcinoma immune evasion and progression. PMID:26136424
Xu, Yong-Nan; Uhm, Sang-Jun; Koo, Bon-Chul; Kwon, Mo-Sun; Roh, Ji-Yeol; Yang, Jung-Seok; Choi, Hyun-Yong; Heo, Young-Tae; Cui, Xiang-Shun; Yoon, Joon-Ho; Ko, Dae-Hwan; Kim, Teoan; Kim, Nam-Hyung
2013-01-20
The potential benefits of generating and using transgenic cattle range from improvements in agriculture to the production of large quantities of pharmaceutically relevant proteins. Previous studies have attempted to produce transgenic cattle and other livestock by pronuclear injection and somatic cell nuclear transfer, but these approaches have been largely ineffective; however, a third approach, lentivirus-mediated transgenesis, has successfully produced transgenic livestock. In this study, we generated transgenic (TG) Korean native cattle using perivitelline space injection of viral vectors, which expressed enhanced green fluorescent protein (EGFP) systemically. Two different types of lentiviral vectors derived from feline immunodeficiency virus (FIV) and human immunodeficiency virus (HIV) carrying EGFP were injected into the perivitelline space of MII oocytes. EGFP expression at 8-cell stage was significantly higher in the FIV group compared to the HIV group (47.5%±2.2% v.s. 22.9%±2.9%). Eight-cell embryos that expressed EGFP were cultured into blastocysts and then transferred into 40 heifers. Ten heifers were successfully impregnated and delivered 10 healthy calves. All of these calves expressed EGFP as detected by in vivo imaging, PCR and Southern blotting. In addition, we established an EGFP-expressing cell line from TG calves, which was followed by nuclear transfer (NT). Recloned 8-cell embryos also expressed EGFP, and there were no differences in the rates of fusion, cleavage and development between cells derived from TG and non-TG calves, which were subsequently used for NT. These results illustrate that FIV-based lentiviruses are useful for the production of TG cattle. Moreover, our established EGFP cell line can be used for additional studies that involve induced pluripotent stem cells. Copyright © 2013. Published by Elsevier Ltd.
Expression of an Aspergillus niger Phytase Gene (phyA) in Saccharomyces cerevisiae
Han, Yanming; Wilson, David B.; Lei, Xin gen
1999-01-01
Phytase improves the bioavailability of phytate phosphorus in plant foods to humans and animals and reduces phosphorus pollution of animal waste. Our objectives were to express an Aspergillus niger phytase gene (phyA) in Saccharomyces cerevisiae and to determine the effects of glycosylation on the phytase’s activity and thermostability. A 1.4-kb DNA fragment containing the coding region of the phyA gene was inserted into the expression vector pYES2 and was expressed in S. cerevisiae as an active, extracellular phytase. The yield of total extracellular phytase activity was affected by the signal peptide and the medium composition. The expressed phytase had two pH optima (2 to 2.5 and 5 to 5.5) and a temperature optimum between 55 and 60°C, and it cross-reacted with a rabbit polyclonal antibody against the wild-type enzyme. Due to the heavy glycosylation, the expressed phytase had a molecular size of approximately 120 kDa and appeared to be more thermostable than the commercial enzyme. Deglycosylation of the phytase resulted in losses of 9% of its activity and 40% of its thermostability. The recombinant phytase was effective in hydrolyzing phytate phosphorus from corn or soybean meal in vitro. In conclusion, the phyA gene was expressed as an active, extracellular phytase in S. cerevisiae, and its thermostability was affected by glycosylation. PMID:10223979
Stiefelhagen, Marius; Sellner, Leopold; Kleinschmidt, Jürgen A; Jauch, Anna; Laufs, Stephanie; Wenz, Frederik; Zeller, W Jens; Fruehauf, Stefan; Veldwijk, Marlon R
2008-01-01
Background For many promising target cells (e.g.: haematopoeitic progenitors), the susceptibility to standard adeno-associated viral (AAV) vectors is low. Advancements in vector development now allows the generation of target cell-selected AAV capsid mutants. Methods To determine its suitability, the method was applied on a chronic myelogenous leukaemia (CML) cell line (K562) to obtain a CML-targeted vector and the resulting vectors tested on leukaemia, non-leukaemia, primary human CML and CD34+ peripheral blood progenitor cells (PBPC); standard AAV2 and a random capsid mutant vector served as controls. Results Transduction of CML (BV173, EM3, K562 and Lama84) and AML (HL60 and KG1a) cell lines with the capsid mutants resulted in an up to 36-fold increase in CML transduction efficiency (K562: 2-fold, 60% ± 2% green fluorescent protein (GFP)+ cells; BV173: 9-fold, 37% ± 2% GFP+ cells; Lama84: 36-fold, 29% ± 2% GFP+ cells) compared to controls. For AML (KG1a, HL60) and one CML cell line (EM3), no significant transduction (<1% GFP+ cells) was observed for any vector. Although the capsid mutant clone was established on a cell line, proof-of-principle experiments using primary human cells were performed. For CML (3.2-fold, mutant: 1.75% ± 0.45% GFP+ cells, p = 0.03) and PBPC (3.5-fold, mutant: 4.21% ± 3.40% GFP+ cells) a moderate increase in gene transfer of the capsid mutant compared to control vectors was observed. Conclusion Using an AAV random peptide library on a CML cell line, we were able to generate a capsid mutant, which transduced CML cell lines and primary human haematopoietic progenitor cells with higher efficiency than standard recombinant AAV vectors. PMID:18789140
Franceschi, Valentina; Capocefalo, Antonio; Calvo-Pinilla, Eva; Redaelli, Marco; Mucignat-Caretta, Carla; Mertens, Peter; Ortego, Javier; Donofrio, Gaetano
2011-04-05
New effective tools for vaccine strategies are necessary to limit the spread of bluetongue, an insect-transmitted viral disease of domestic and wild ruminants. In the present study, BoHV-4-based vector cloned as a bacterial artificial chromosome (BAC) was engineered to express the bluetongue virus (BTV) immune-dominant glycoprotein VP2 provided of a heterologous signal peptide to its amino terminal and a trans-membrane domain to its carboxyl terminal (IgK-VP2gDtm), to allow the VP2 expression targeting to the cell membrane fraction. Based on adult α/β interferon receptor knockout (IFNAR(-/-)) mice, a newly generated bluetongue laboratory animal model, a pre-challenge experiment was performed to test BoHV-4 safety on such immune-compromised animal. BoHV-4 infected IFNAR(-/-) mice did not show clinical signs even following the inoculation of BoHV-4 intra-cerebrally, although many areas of the brain got transduced. IFNAR(-/-) mice intraperitoneally inoculated twice with BoHV-4-A-IgK-VP2gDtm at different time points developed serum neutralizing antibodies against BTV and showed a strongly reduced viremia and a longer survival time when challenged with a lethal dose of BTV-8. The data acquired in this pilot study validate BoHV-4-based vector as a safe and effective heterologous antigen carrier/producer for the formulation of enhanced recombinant immunogens for the vaccination against lethal bluetongue. Copyright © 2011 Elsevier Ltd. All rights reserved.
Jiang, Xiu Xiu; Fei, Xiang Wei; Zhao, Li; Ye, Xiao Lei; Xin, Liao Bin; Qu, Yang; Xu, Kai Hong; Wu, Rui Jin; Lin, Jun
2015-01-01
Aquaporin 5 (AQP5) participates in the migration of endometrial cells. Elucidation of the molecular mechanisms associated with AQP5-mediated, migration of endometrial cells may contribute to a better understanding of endometriosis. Our objectives included identifying the estrogen-response element (ERE) in the promoter region of the AQP5 gene, and, investigating the effects of AQP5 on ectopic implantation of endometrial cells. Luciferase reporter assays and electrophoretic mobility shift assay (EMSA) identified the ERE-like motif in the promoter region of the AQP5 gene. After blocking and up-regulating estradiol (E2) levels, we analysed the expression of AQP5 in endometrial stromal (ES) cells. After blocking E2 /or phosphatidylinositol 3 kinase(PI3K), we analysed the role of AQP5 in signaling pathways. We constructed an AQP5, shRNA, lentiviral vector to knock out the AQP5 gene in ES cells. After knock-out of the AQP5 gene, we studied the role of AQP5 in cell invasion, proliferation, and the formation of ectopic endometrial implants in female mice. We identified an estrogen-response element in the promoter region of the AQP5 gene. Estradiol (E2) increased AQP5 expression in a dose-dependent fashion, that was blocked by ICI182,780(an estrogen receptor inhibitor). E2 activated PI3K /protein kinase B(AKT) pathway (PI3K/AKT), that, in turn, increased AQP5 expression. LY294002(PI3K inhibitor) attenuated estrogen-enhanced, AQP5 expression. Knock-out of the AQP5 gene with AQP5 shRNA lentiviral vector significantly inhibited E2-enhanced invasion, proliferation of ES cells and formation of ectopic implants. Estrogen induces AQP5 expression by activating ERE in the promoter region of the AQP5gene, activates the PI3K/AKT pathway, and, promotes endometrial cell invasion and proliferation. These results provide new insights into some of the mechanisms that may underpin the development of deposits of ectopic endometrium. PMID:26679484
Ultramicroscopy as a novel tool to unravel the tropism of AAV gene therapy vectors in the brain.
Alves, Sandro; Bode, Julia; Bemelmans, Alexis-Pierre; von Kalle, Christof; Cartier, Nathalie; Tews, Björn
2016-06-20
Recombinant adeno-associated viral (AAV) vectors have advanced to the vanguard of gene therapy. Numerous naturally occurring serotypes have been used to target cells in various tissues. There is a strong need for fast and dynamic methods which efficiently unravel viral tropism in whole organs. Ultramicroscopy (UM) is a novel fluorescence microscopy technique that images optically cleared undissected specimens, achieving good resolutions at high penetration depths while being non-destructive. UM was applied to obtain high-resolution 3D analysis of AAV transduction in adult mouse brains, especially in the hippocampus, a region of interest for Alzheimer's disease therapy. We separately or simultaneously compared transduction efficacies for commonly used serotypes (AAV9 and AAVrh10) using fluorescent reporter expression. We provide a detailed comparative and quantitative analysis of the transduction profiles. UM allowed a rapid analysis of marker fluorescence expression in neurons with intact projections deep inside the brain, in defined anatomical structures. Major hippocampal neuronal transduction was observed with both vectors, with slightly better efficacy for AAV9 in UM. Glial response and synaptic marker expression did not change post transduction.We propose UM as a novel valuable complementary tool to efficiently and simultaneously unravel tropism of different viruses in a single non-dissected adult rodent brain.
Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María
2018-04-01
Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9 vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.
Targeted genome editing in a quail cell line using a customized CRISPR/Cas9 system.
Ahn, Jinsoo; Lee, Joonbum; Park, Ju Yeon; Oh, Keon Bong; Hwang, Seongsoo; Lee, Chang-Won; Lee, Kichoon
2017-05-01
Soon after RNA-guided Cas9 (CRISPR-associated protein 9) endonuclease opened a new era of targeted genome editing, the CRISPR/Cas9 platform began to be extensively used to modify genes in various types of cells and organisms. However, successful CRISPR/Cas9-mediated insertion/deletion (indel) mutation remains to be demonstrated in avian cell lines. The objective of this study was to design a poultry-specific CRISPR/Cas9 system to efficiently introduce targeted deletion mutation in chromosomes of the quail muscle clone 7 (QM7) cell line using a customized quail CRISPR vector. In this study, two avian-specific promoters, quail 7SK (q7SK) promoter and CBh promoter, the hybrid form of cytomegalovirus and chicken β-actin promoters, were cloned into a CRISPR vector for the expression of guide RNA and Cas9 protein, respectively. Then, guide RNA, which was designed to target 20-base pair (bp) nucleotides in the quail melanophilin (MLPH) locus, was ligated to the modified CRISPR vector and transfected to QM7 cells. Our results showed multiple indel mutations in the quail MLPH locus in nearly half of the alleles being tested, suggesting the high efficiency of the system for targeted gene modification. The new CRISPR vector developed from this study has the potential application to generate knockout avian cell lines and knockout poultry. © 2016 Poultry Science Association Inc.
Genetic Validation of Cell Proliferation via Ras-Independent Activation of the Raf/Mek/Erk Pathway.
Lechuga, Carmen G; Simón-Carrasco, Lucía; Jacob, Harrys K C; Drosten, Matthias
2017-01-01
Signaling transmitted by the Ras family of small GTPases (H-, N-, and K-Ras) is essential for proliferation of mouse embryonic fibroblasts (MEFs). However, constitutive activation of the downstream Raf/Mek/Erk pathway can bypass the requirement for Ras proteins and allow cells to proliferate in the absence of the three Ras isoforms. Here we describe a protocol for a colony formation assay that permits evaluating the role of candidate proteins that are positive or negative regulators of cell proliferation mediated via Ras-independent Raf/Mek/Erk pathway activation. K-Ras lox (H-Ras -/- , N-Ras -/- , K-Ras lox/lox , RERT ert/ert ) MEFs are infected with retro- or lentiviral vectors expressing wild-type or constitutively activated candidate cDNAs, shRNAs, or sgRNAs in combination with Cas9 to ascertain the possibility of candidate proteins to function either as an activator or inhibitor of Ras-independent Raf/Mek/Erk activation. These cells are then seeded in the absence or presence of 4-Hydroxytamoxifen (4-OHT), which activates the resident CreERT2 alleles resulting in elimination of the conditional K-Ras alleles and ultimately generating Rasless cells. Colony formation in the presence of 4-OHT indicates cell proliferation via Ras-independent Raf/Mek/Erk activation.
Zhao, Yao; Kang, Lin; Gao, Shan; Zhou, Yang; Su, Libo; Xin, Wenwen; Su, Yuxin; Wang, Jinglin
2011-06-01
The alpha and epsilon toxins are 2 of the 4 major lethal toxins of the pathogen Clostridium perfringens. In this study, the expression of the epsilon toxin (etx) gene of C. perfringens was optimized by replacing rare codons with high-frequency codons, and the optimized gene was synthesized using overlapping PCR. Then, the etx gene or the alpha-toxin gene (cpa) was individually inserted into the pTIG-Trx expression vector with a hexahistidine tag and a thioredoxin (Trx) to facilitate their purification and induce the expression of soluble proteins. The recombinant alpha toxin (rCPA) and epsilon toxin (rETX) were highly expressed as soluble forms in the recipient Escherichia coli BL21 strain, respectively. The rCPA and rETX were purified using Ni(2+)-chelating chromatography and size-exclusion chromatography. And the entire purification process recovered about 40% of each target protein from the starting materials. The purified target toxins formed single band at about 42kDa (rCPA) or 31kDa (rETX) in sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and their functional activity was confirmed by bioactivity assays. We have shown that the production of large amounts of soluble and functional proteins by using the pTIG-Trx vector in E. coli is a good alternative for the production of native alpha and epsilon toxins and could also be useful for the production of other toxic proteins with soluble forms. Copyright © 2011 Elsevier Inc. All rights reserved.
Efficacy and safety of a modified vaccinia Ankara (MVA) vectored plague vaccine in mice
Brewoo, Joseph N.; Powell, Tim D.; Stinchcomb, Dan T.; Osorio, Jorge E.
2010-01-01
The efficacy and safety of plague vaccines based on the modified vaccinia Ankara (MVA) viral vector was evaluated. MVA recombinants were constructed expressing Yersinia pestis antigens under the translational control of the encephalomyocarditis virus (EMCV) internal ribosomal entry site (IRES) and/or fused to the tissue plasminogen activator (tPA) secretory signal. A MVA/Y. pestis recombinant that expressed a truncated version of the low-calcium response V antigen (MVA/IRES/tPA/V307), conferred significant protection (87.5%–100%) against intranasal or intraperitoneal challenge with CO92 (encapsulated) or Java 9 (non-encapsulated) strains of Y pestis, respectively. In contrast, a MVA/Y. pestis recombinant that expressed the full-length V antigen provided only 37.5% protection against challenge with CO92 or Java 9 strains, respectively. Interestingly, a MVA/Y. pestis recombinant that expressed the capsular protein (F1) did not elicit significant antibody titers but still conferred 50% and 25% protection against CO92 or Java 9 challenge, respectively. The MVA/Y. pestis recombinant viruses did not demonstrate any mortality or morbidity in SCID mice. Based on their safety and efficacy in mice, these MVA/Y. pestis recombinants are candidates for further development as biodefense and public health vaccines. PMID:20638759
TGF-beta1 expression in EL4 lymphoma cells overexpressing growth hormone.
Farmer, John T; Weigent, Douglas A
2006-03-01
Our previous studies show that growth hormone overexpression (GHo) upregulates the expression of the IGF-1R and IGF-2R resulting in the protection of the EL4 lymphoma cell line from apoptosis. In this study, we report that GHo also increases TGF-beta1 protein expression measured by luciferase promoter assay, Western analysis, and ELISA. Further, the data show that antibody to TGF-betaR2 decreases TGF-beta1 promoter activity to the level of vector alone control cells. GHo cells treated with (125)I-rh-latent TGF-beta1 showed increased activation of latent TGF-beta1 as measured by an increase in the active 24kDa, TGF-beta1 compared to vector alone control cells. The ability of endogenous GH to increase TGF-beta1 expression is blocked in EL4 cells by antisense but not sense oligodeoxynucleotides or in cells cultured with antibody to growth hormone (GH). The data suggest that endogenous GH may protect from apoptosis through the IGF-1R receptor while limiting cellular growth through increased expression and activation of TGF-beta1.
Alternation of histone and DNA methylation in human atherosclerotic carotid plaques.
Greißel, A; Culmes, M; Napieralski, R; Wagner, E; Gebhard, H; Schmitt, M; Zimmermann, A; Eckstein, H-H; Zernecke, A; Pelisek, J
2015-08-01
Little is known about epigenetics and its possible role in atherosclerosis. We here analysed histone and DNA methylation and the expression of corresponding methyltransferases in early and advanced human atherosclerotic carotid lesions in comparison to healthy carotid arteries. Western Blotting was performed on carotid plaques from our biobank with early (n=60) or advanced (n=60) stages of atherosclerosis and healthy carotid arteries (n=12) to analyse di-methylation patterns of histone H3 at positions K4, K9 and K27. In atherosclerotic lesions, di-methylation of H3K4 was unaltered and that of H3K9 and H3K27 significantly decreased compared to control arteries. Immunohistochemistry revealed an increased appearance of di-methylated H3K4 in smooth muscle cells (SMCs), a decreased expression of di-methylated H3K9 in SMCs and inflammatory cells, and reduced di-methylated H3K27 in inflammatory cells in advanced versus early atherosclerosis. Expression of corresponding histone methyltransferases MLL2 and G9a was increased in advanced versus early atherosclerosis. Genomic DNA hypomethylation, as determined by PCR for methylated LINE1 and SAT-alpha, was observed in early and advanced plaques compared to control arteries and in cell-free serum of patients with high-grade carotid stenosis compared to healthy volunteers. In contrast, no differences in DNA methylation were observed in blood cells. Expression of DNA-methyltransferase DNMT1 was reduced in atherosclerotic plaques versus controls, DNMT3A was undetectable, and DNMT3B not altered. DNA-demethylase TET1 was increased in atherosclerosisc plaques. The extent of histone and DNA methylation and expression of some corresponding methyltransferases are significantly altered in atherosclerosis, suggesting a possible contribution of epigenetics in disease development.
Tang, Wing Chun; Tang, Ying Yung; Lam, Carly S Y
2014-01-01
The aim of the study was to evaluate the level of agreement between the 'Representative Value' (RV) of refraction obtained from the Shin-Nippon NVision-K 5001 instrument with values calculated from individual measurement readings using standard algebraic methods. Cycloplegic autorefraction readings for 101 myopic children aged 8-13 years (10.9 ± 1.42 years) were obtained using the Shin-Nippon NVision-K 5001. Ten autorefractor measurements were taken for each eye. The spherical equivalent (SE), sphere (Sph) and cylindrical component (Cyl) power of each eye were calculated, firstly, by averaging the 10 repeated measurements (Mean SE, Mean Sph and Mean Cyl), and secondly, by the vector representation method (Vector SE, Vector Sph and Vector Cyl). These calculated values were then compared with those of RV (RV SE, RV Sph and RV Cyl) provided by the proprietary software of the NVision-K 5001 using one-way analysis of variance (anova). The agreement between the methods was also assessed. The SE of the subjects ranged from -5.37 to -0.62 D (mean ± SD, = -2.89 ± 1.01 D). The Mean SE was in exact agreement with the Vector SE. There were no significant differences between the RV readings and those calculated using non-vectorial or vectorial methods for any of the refractive powers (SE, p = 0.99; Sph, p = 0.93; Cyl, p = 0.24). The (mean ± SD) differences were: RV SE vs Mean SE (and also RV SE vs Vector SE) -0.01 ± 0.06 D; RV Sph vs Mean Sph, -0.01 ± 0.05 D; RV Sph vs Vector Sph, -0.04 ± 0.06 D; RV Cyl vs Mean Cyl, 0.01 ± 0.07 D; RV Cyl vs Vector Cyl, 0.06 ± 0.09 D. Ninety-eight percent of RV reading differed from their non-vectorial or vectorial counterparts by less than 0.25 D. The RV values showed good agreement to the results calculated using conventional methods. Although the formula used to calculate RV by the NVision-K 5001 autorefractor is proprietary, our results provide validation for the use of RV measurements in clinical practice and vision science research. © 2013 The Authors Ophthalmic & Physiological Optics © 2013 The College of Optometrists.
Accelerated Modeling and New Ferroelectric Materials for Naval SONAR
2004-06-01
AN other platforms was achieved. As expected, proper into BZ leads to a development of small polarization, vectorization and optimal memory usage were...polarization is due to a combination code was fully vectorized , a speed-up of 9.2 times over of large Ag off-centering and small displacements by the Pentium 4... Xeon and 6.6 times over the SGI 03K was other cations. The large Ag displacements are due to a achieved. We are currently using the X1 in production
Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich
2005-12-01
Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.
GeneGuard: A modular plasmid system designed for biosafety.
Wright, Oliver; Delmans, Mihails; Stan, Guy-Bart; Ellis, Tom
2015-03-20
Synthetic biology applications in biosensing, bioremediation, and biomining envision the use of engineered microbes beyond a contained laboratory. Deployment of such microbes in the environment raises concerns of unchecked cellular proliferation or unwanted spread of synthetic genes. While antibiotic-resistant plasmids are the most utilized vectors for introducing synthetic genes into bacteria, they are also inherently insecure, acting naturally to propagate DNA from one cell to another. To introduce security into bacterial synthetic biology, we here took on the task of completely reformatting plasmids to be dependent on their intended host strain and inherently disadvantageous for others. Using conditional origins of replication, rich-media compatible auxotrophies, and toxin-antitoxin pairs we constructed a mutually dependent host-plasmid platform, called GeneGuard. In this, replication initiators for the R6K or ColE2-P9 origins are provided in trans by a specified host, whose essential thyA or dapA gene is translocated from a genomic to a plasmid location. This reciprocal arrangement is stable for at least 100 generations without antibiotic selection and is compatible for use in LB medium and soil. Toxin genes ζ or Kid are also employed in an auxiliary manner to make the vector disadvantageous for strains not expressing their antitoxins. These devices, in isolation and in concert, severely reduce unintentional plasmid propagation in E. coli and B. subtilis and do not disrupt the intended E. coli host's growth dynamics. Our GeneGuard system comprises several versions of modular cargo-ready vectors, along with their requisite genomic integration cassettes, and is demonstrated here as an efficient vector for heavy-metal biosensors.
Pollex, Erika K; Anger, Gregory; Hutson, Janine; Koren, Gideon; Piquette-Miller, Micheline
2010-05-01
The antidiabetic agent glyburide (glibenclamide) is frequently used for the treatment of type II diabetes and is increasingly being used for the treatment of gestational diabetes. Evidence suggests that breast cancer resistance protein/ATP-binding cassette, subfamily G, member 2 (ABCG2) expressed in the placenta protects the fetus against the accumulation of glyburide. A number of studies have investigated the significance of several single-nucleotide polymorphisms (SNPs) in the ABCG2 gene. Associations between the Q141K (C421A) SNP and ABCG2 protein expression, membrane surface translocation, efflux activity, or ATPase activity have been shown. Therefore, alterations in glyburide transport across the placenta, resulting in increased fetal glyburide exposure, may be seen in individuals carrying the C421A allele. The purpose of this study is to investigate whether the Q141K SNP causes alterations in ABCG2-mediated glyburide transport. Glyburide accumulation assays were carried out with stably transfected human embryonic kidney (HEK)-293 cells expressing wild-type ABCG2 (Arg482) and polymorphic ABCG2 (Q141K). Glyburide kinetic parameters were determined for comparison of wild-type and SNP ABCG2 activity by simultaneously fitting data for ABCG2-expressing cells (saturable transport) and empty vector-expressing cells (nonsaturable transport) by nonlinear regression analysis. The apparent K(t) and V(max) values for the transfected HEK-293 cells expressing the polymorphic variant (Q141K) of ABCG2 were significantly higher than those values determined for the wild-type ABCG2-expressing cells (p < 0.05). Our results indicate that the Q141K variant of ABCG2 may have the potential to alter the placental pharmacokinetics of glyburide used in pregnancy.
Duisit, G; Salvetti, A; Moullier, P; Cosset, F L
1999-01-20
We have generated three different E1-deleted replication-defective adenoviral vectors expressing either Moloney murine leukemia virus (Mo-MuLV) Gag-Pol core particle proteins, gibbon ape leukemia virus (GALV) envelope glycoproteins, or an MuLV-derived retroviral vector genome encoding mCD2 antigen, a murine cell surface marker easily detectable by flow cytometry. Each of the three vectors was first characterized individually by infection of cells providing the complementary retroviral function(s) and able to induce the production of retroviral vectors with an efficiency similar to or higher than that of FLY stable retroviral packaging cells [Cosset, F.-L., Takeuchi, Y., Battini, J.-L., Weiss, R.A., and Collins, M.K.L., (1995). J. Virol. 69, 7430-7436]. In small-scale pilot experiments, TE671 cells simultaneously coinfected with the three adenoviral vectors efficiently released helper-free retroviral vectors in their supernatant, with titers greater than 10(6) infectious particles per milliliter by end-point titrations. Our results also indicated that in contrast to retroviral vector-packageable RNAs, the adenovirus-mediated overexpression of both Gag-Pol and Env packaging functions had limited impact on retroviral titers. The primary mechanism suspected is the premature intracellular cleavage of the Pr65gag precursor that we found in gag-pol-expressing cells, which in turn may impair the normal incorporation of high loads of functional Env. Last, the characterization of the adenoviral/retroviral chimeric vectors allowed the screening of various primate cells for retroviral production and we found that three hepatocyte-derived cell lines were highly efficient in the assembly and release of infectious retroviral particles.
1987-08-01
be found using the general soluticn to the Poissca equation; at any instant in time, this solution is ui(x) = - f G(x,x’)ei,w,,& (x’)d~x’ (1.9.6) where...any instant of time is 1(X) = •j(kI)e-ik’’x (3.3.2a) k’ I where k = (kl,k 2 , k3 ) is the three-dimensional wavenumber vector, and k "x = kzn. Since the...strain rate. And algebraic models predict instant restoration of isotropy after the removal of an applied mean strain-rate. Hence, if one wants to have
Electroweak penguin amplitudes and constraints on γ in charmless B-->VP decays
NASA Astrophysics Data System (ADS)
Gronau, Michael
2000-07-01
Electroweak penguin (EWP) amplitudes are studied model independently in B meson decays to charmless final states consisting of a vector meson (V) and a pseudoscalar meson (P). A set of SU(3) relations is derived between EWP contributions and tree amplitudes, in the approximation of retaining only the dominant EWP operators Q9 and Q10. Two applications are described for constraining the weak phase γ, in B+/--->ρ+/-K0 and B+/--->ρ0K+/- (or B+/--->K*+/-π0 and B+/--->K*0π+/-), and in B0-->K*+/-π-/+ and B+/--->φK+/-. Theoretical uncertainties are discussed.
Ishak, Intan H.; Kamgang, Basile; Ibrahim, Sulaiman S.; Riveron, Jacob M.; Irving, Helen
2017-01-01
Background Dengue control and prevention rely heavily on insecticide-based interventions. However, insecticide resistance in the dengue vector Aedes aegypti, threatens the continued effectiveness of these tools. The molecular basis of the resistance remains uncharacterised in many endemic countries including Malaysia, preventing the design of evidence-based resistance management. Here, we investigated the underlying molecular basis of multiple insecticide resistance in Ae. aegypti populations across Malaysia detecting the major genes driving the metabolic resistance. Methodology/Principal Findings Genome-wide microarray-based transcription analysis was carried out to detect the genes associated with metabolic resistance in these populations. Comparisons of the susceptible New Orleans strain to three non-exposed multiple insecticide resistant field strains; Penang, Kuala Lumpur and Kota Bharu detected 2605, 1480 and 425 differentially expressed transcripts respectively (fold-change>2 and p-value ≤ 0.05). 204 genes were commonly over-expressed with monooxygenase P450 genes (CYP9J27, CYP6CB1, CYP9J26 and CYP9M4) consistently the most up-regulated detoxification genes in all populations, indicating that they possibly play an important role in the resistance. In addition, glutathione S-transferases, carboxylesterases and other gene families commonly associated with insecticide resistance were also over-expressed. Gene Ontology (GO) enrichment analysis indicated an over-representation of GO terms linked to resistance such as monooxygenases, carboxylesterases, glutathione S-transferases and heme-binding. Polymorphism analysis of CYP9J27 sequences revealed a high level of polymorphism (except in Joho Bharu), suggesting a limited directional selection on this gene. In silico analysis of CYP9J27 activity through modelling and docking simulations suggested that this gene is involved in the multiple resistance in Malaysian populations as it is predicted to metabolise pyrethroids, DDT and bendiocarb. Conclusion/significance The predominant over-expression of cytochrome P450s suggests that synergist-based (PBO) control tools could be utilised to improve control of this major dengue vector across Malaysia. PMID:28114328
Rothermel, Markus; Brunert, Daniela; Zabawa, Christine; Díaz-Quesada, Marta; Wachowiak, Matt
2013-09-18
Tools enabling the manipulation of well defined neuronal subpopulations are critical for probing complex neuronal networks. Cre recombinase (Cre) mouse driver lines in combination with the Cre-dependent expression of proteins using viral vectors--in particular, recombinant adeno-associated viral vectors (rAAVs)--have emerged as a widely used platform for achieving transgene expression in specified neural populations. However, the ability of rAAVs to further specify neuronal subsets on the basis of their anatomical connectivity has been reported as limited or inconsistent. Here, we systematically tested a variety of widely used neurotropic rAAVs for their ability to mediate retrograde gene transduction in the mouse brain. We tested pseudotyped rAAVs of several common serotypes (rAAV 2/1, 2/5, and 2/9) as well as constructs both with and without Cre-dependent expression switches. Many of the rAAVs tested--in particular, though not exclusively, Cre-dependent vectors--showed a robust capacity for retrograde infection and transgene expression. Retrograde expression was successful over distances as large as 6 mm and in multiple neuron types, including olfactory projection neurons, neocortical pyramidal cells projecting to distinct targets, and corticofugal and modulatory projection neurons. Retrograde infection using transgenes such as ChR2 allowed for optical control or optically assisted electrophysiological identification of neurons defined genetically as well as by their projection target. These results establish a widely accessible tool for achieving combinatorial specificity and stable, long-term transgene expression to isolate precisely defined neuron populations in the intact animal.
Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M; Yue, Junming
2017-01-01
CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells.
Huo, Wenying; Zhao, Guannan; Yin, Jinggang; Ouyang, Xuan; Wang, Yinan; Yang, Chuanhe; Wang, Baojing; Dong, Peixin; Wang, Zhixiang; Watari, Hidemichi; Chaum, Edward; Pfeffer, Lawrence M.; Yue, Junming
2017-01-01
CRISPR/Cas9 (clustered regularly interspaced short palindromic repeats) mediated genome editing is a powerful approach for loss of function studies. Here we report that lentiviral CRISPR/Cas9 vectors are highly efficient in introducing mutations in the precursor miRNA sequence, thus leading to the loss of miRNA expression and function. We constructed four different lentiviral CRISPR/Cas9 vectors that target different regions of the precursor miR-21 sequence and found that these lentiviral CRISPR/Cas9 miR-21 gRNA vectors induced mutations in the precursor sequences as shown by DNA surveyor mutation assay and Sanger sequencing. Two miR-21 lentiviral CRISPR/Cas9 gRNA vectors were selected to probe miR-21 function in ovarian cancer SKOV3 and OVCAR3 cell lines. Our data demonstrate that disruption of pre-miR-21 sequences leads to reduced cell proliferation, migration and invasion. Moreover, CRISPR/Cas9-mediated miR-21 gene editing sensitizes both SKOV3 and OVCAR3 cells to chemotherapeutic drug treatment. Disruption of miR-21 leads to the inhibition of epithelial to mesenchymal transition (EMT) in both SKOV3 and OVCAR3 cells as evidenced by the upregulation of epithelial cell marker E-cadherin and downregulation of mesenchymal marker genes, vimentin and Snai2. The miR-21 target genes PDCD4 and SPRY2 were upregulated in cells transduced with miR-21gRNAs compared to controls. Our study indicates that lentiviral CRISPR/Cas9-mediated miRNA gene editing is an effective approach to address miRNA function, and disruption of miR-21 inhibits EMT in ovarian cancer cells. PMID:28123598
Alnoch, Robson Carlos; Stefanello, Adriano Alves; Paula Martini, Viviane; Richter, Jeferson Luiz; Mateo, Cesar; Souza, Emanuel Maltempi de; Mitchell, David Alexander; Muller-Santos, Marcelo; Krieger, Nadia
2018-05-30
Genes encoding lipase LipBC (lipA) and foldase LifBC (lipB) were identified in the genome of Burkholderia contaminans LTEB11. Analysis of the predicted amino acid sequence of lipA showed its high identity with lipases from Pseudomonas luteola (91%), Burkholderia cepacia (96%) and Burkholderia lata (97%), and classified LipBC lipase in the lipase subfamily I.2. The genes lipA and lipB were amplified and cloned into expression vectors pET28a(+) and pT7-7, respectively. His-tagged LipBC and native LifBC were co-expressed in Escherichia coli and purified. LipBC and LifBC have molecular weights of 35.9 kDa and 37 kDa, respectively, and remain complexed after purification. The Lip-LifBC complex was active and stable over a wide range of pH values (6.5-10) and temperatures (25-45 °C), with the highest specific activity (1426 U mg -1 ) being against tributyrin. The Lip-LifBC complex immobilized on Sepabeads was able to catalyze the synthesis of ethyl-oleate in n‑hexane with an activity of 4 U g -1 , maintaining high conversion (>80%) over 5 reaction cycles of 6 h at 45 °C. The results obtained in this work provide a basis for the development of applications of recombinant LipBC in biocatalysis. Copyright © 2018 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Puntel, Mariana; Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689; Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048
2013-05-01
Adenoviral vectors (Ads) are promising gene delivery vehicles due to their high transduction efficiency; however, their clinical usefulness has been hampered by their immunogenicity and the presence of anti-Ad immunity in humans. We reported the efficacy of a gene therapy approach for glioma consisting of intratumoral injection of Ads encoding conditionally cytotoxic herpes simplex type 1 thymidine kinase (Ad-TK) and the immunostimulatory cytokine fms-like tyrosine kinase ligand 3 (Ad-Flt3L). Herein, we report the biodistribution, efficacy, and neurological and systemic effects of a bicistronic high-capacity Ad, i.e., HC-Ad-TK/TetOn-Flt3L. HC-Ads elicit sustained transgene expression, even in the presence of anti-Ad immunity, andmore » can encode large therapeutic cassettes, including regulatory elements to enable turning gene expression “on” or “off” according to clinical need. The inclusion of two therapeutic transgenes within a single vector enables a reduction of the total vector load without adversely impacting efficacy. Because clinically the vectors will be delivered into the surgical cavity, normal regions of the brain parenchyma are likely to be transduced. Thus, we assessed any potential toxicities elicited by escalating doses of HC-Ad-TK/TetOn-Flt3L (1 × 10{sup 8}, 1 × 10{sup 9}, or 1 × 10{sup 10} viral particles [vp]) delivered into the rat brain parenchyma. We assessed neuropathology, biodistribution, transgene expression, systemic toxicity, and behavioral impact at acute and chronic time points. The results indicate that doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered into the normal rat brain and underpin further developments for its implementation in a phase I clinical trial for glioma. - Highlights: ► High capacity Ad vectors elicit sustained therapeutic gene expression in the brain. ► HC-Ad-TK/TetOn-Flt3L encodes two therapeutic genes and a transcriptional switch. ► We performed a dose escalation study at acute and chronic time points. ► Doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered in the brain. ► Efficacy and safety of HC-Ad-TK/TetOn-Flt3L merits its use in a GBM Phase I trial.« less
The histone methyltransferase G9a: a new therapeutic target in biliary tract cancer.
Mayr, Christian; Helm, Katharina; Jakab, Martin; Ritter, Markus; Shrestha, Rajeev; Makaju, Ramesh; Wagner, Andrej; Pichler, Martin; Beyreis, Marlena; Staettner, Stefan; Jaeger, Tarkan; Klieser, Eckhard; Kiesslich, Tobias; Neureiter, Daniel
2018-02-01
The histone methyltransferase G9a (EHMT2) is a key enzyme for dimethylation of lysine 9 at histone 3 (H3K9me2), a suppressive epigenetic mark. G9a is over-expressed in tumor cells and contributes to cancer aggressiveness. Biliary tract cancer (BTC) is a rare cancer with dismal prognosis due to a lack of effective therapies. Currently, there are no data on the role of G9a in BTC carcinogenesis. We analyzed G9a expression in n=68 BTC patient specimens and correlated the data with clinicopathological and survival data. Moreover, we measured G9a expression in a panel of BTC cell lines and evaluated the cytotoxic effect of G9a inhibition in BTC cells using established small-molecule G9a inhibitors. G9a was considerably expressed in about half of BTC cases and was significantly associated with grading and tumor size. Additionally, we observed significant differences of G9a expression between growth type and tumor localization groups. G9a expression diametrically correlated with Vimentin (positive) and E-Cadherin (negative) expression. Importantly, survival analysis revealed G9a as a significant prognostic factor of poor survival in patients with BTC. In BTC cells, G9a and H3K9me2 were detectable in a cell line-dependent manner on mRNA and/or protein level, respectively. Treatment of BTC cells with established small-molecule G9a inhibitors resulted in reduction of cell viability as well as reduced G9a and H3K9me2 protein levels. The present study strongly suggests that G9a contributes to BTC carcinogenesis and may represent a potential prognostic factor as well as a therapeutic target. Copyright © 2017 Elsevier Inc. All rights reserved.
Kianmehr, Anvarsadat; Golavar, Raziyeh; Rouintan, Mandana; Mahrooz, Abdolkarim; Fard-Esfahani, Pezhman; Oladnabi, Morteza; Khajeniazi, Safoura; Mostafavi, Seyede Samaneh; Omidinia, Eskandar
2016-02-01
Darbepoetin alfa is an engineered and hyperglycosylated analog of recombinant human erythropoietin (EPO) which is used as a drug in treating anemia in patients with chronic kidney failure and cancer. This study desribes the secretory expression of a codon-optimized recombinant form of darbepoetin alfa in Leishmania tarentolae T7-TR. Synthetic codon-optimized gene was amplified by PCR and cloned into the pLEXSY-I-blecherry3 vector. The resultant expression vector, pLEXSYDarbo, was purified, digested, and electroporated into the L. tarentolae. Expression of recombinant darbepoetin alfa was evaluated by ELISA, reverse-transcription PCR (RT-PCR), Western blotting, and biological activity. After codon optimization, codon adaptation index (CAI) of the gene raised from 0.50 to 0.99 and its GC% content changed from 56% to 58%. Expression analysis confirmed the presence of a protein band at 40 kDa. Furthermore, reticulocyte experiment results revealed that the activity of expressed darbepoetin alfa was similar to that of its equivalent expressed in Chinese hamster ovary (CHO) cells. These data suggested that the codon optimization and expression in L. tarentolae host provided an efficient approach for high level expression of darbepoetin alfa. Copyright © 2015 Elsevier Inc. All rights reserved.
Cross, Jane L; Boulos, Sherif; Shepherd, Kate L; Craig, Amanda J; Lee, Sharon; Bakker, Anthony J; Knuckey, Neville W; Meloni, Bruno P
2012-07-01
In this study we have assessed sodium-calcium exchanger (NCX) protein over-expression on cell viability in primary rat cortical neuronal and HEK293 cell cultures when subjected to oxygen-glucose deprivation (OGD). In cortical neuronal cultures, NCX2 and NCX3 over-expression was achieved using adenoviral vectors, and following OGD increased neuronal survival from ≈20% for control vector treated cultures to ≈80% for both NCX isoforms. In addition, we demonstrated that NCX2 and NCX3 over-expression in cortical neuronal cultures enables neurons to maintain intracellular calcium at significantly lower levels than control vector treated cultures when exposed to high (9mM) extracellular calcium challenge. Further assessment of NCX activity during OGD was performed using HEK293 cell lines generated to over-express NCX1, NCX2 or NCX3 isoforms. While it was shown that NCX isoform expression differed considerably in the different HEK293 cell lines, high levels of NCX over-expression was associated with increased resistance to OGD. Taken together, our findings show that high levels of NCX over-expression increases neuronal and HEK293 cell survival following OGD, improves calcium management in neuronal cultures and provides additional support for NCX as a therapeutic target to reduce ischemic brain injury. Copyright © 2012 Elsevier Ireland Ltd and the Japan Neuroscience Society. All rights reserved.
Li, L; Yang, L; Scudiero, D A; Miller, S A; Yu, Z-X; Stukenberg, P T; Shoemaker, R H; Kotin, R M
2007-05-01
Transcript depletion using small interfering RNA (siRNA) technology represents a potentially valuable technique for the treatment of cancer. However, delivering therapeutic quantities of siRNA into solid tumors by chemical transfection is not feasible, whereas viral vectors efficiently transduce many human tumor cell lines. Yet producing sufficient quantities of viral vectors that elicit acute and selective cytotoxicity remains a major obstacle for preclinical and clinical trials. Using the invertebrate Spodoptera frugiperda (Sf9) cell line, we were able to produce high titer stocks of cytotoxic recombinant adeno-associated virus (rAAV) that express short hairpin RNA (shRNA) and that efficiently deplete Hec1 (highly expressed in cancer 1), or Kntc2 (kinetochore-associated protein 2), a kinetochore protein directly involved in kinetochore microtubule interactions, chromosome congression and spindle checkpoint signaling. Depletion of Hec1 protein results in persistent spindle checkpoint activation followed by cell death. Because Hec1 expression and activity are only present in mitotic cells, non-dividing cells were not affected by rAAV treatment. On the basis of the results of screening 56 human tumor cell lines with three different serotype vectors, we used a tumor xenograft model to test the effects in vivo. The effects of the shHec1 vector were evident in sectioned and stained tumors. The experiments with rAAV-shRNA vectors demonstrate the utility of producing vectors in invertebrate cells to obtain sufficient concentrations and quantities for solid tumor therapy. This addresses an important requirement for cancer gene therapy, to produce cytotoxic vectors in sufficient quantities and concentrations to enable quantitative transduction and selective killing of solid tumor cells.
Ritter, C; Provino, A; Manfrinetti, P; Pecharsky, V K; Gschneidner, K A; Dhar, S K
2015-12-02
The magnetic properties and magnetic structures of the R 5Ni2In4 and the microfibrous R 11Ni4In9 compounds with R = Tb and Ho have been examined using magnetization, heat capacity, and neutron diffraction data. Rare earth atoms occupy three and five symmetrically inequivalent rare earth sites in R 5Ni2In4 and R 11Ni4In9 compounds, respectively. As a result of the intra- and inter-magnetic sublattice interactions, the magnetic exchange interactions are different for various rare earth sites; this leads to a cascade of magnetic transitions with a strong hierarchy in the temperature dependence of the magnetic orderings. A transition at T C = 125 K in Tb5Ni2In4 [κ 1 = (0, 0, 0)] leads to a ferro/ferrimagnetic order where the magnetic ordering in one of the three R-sublattices leads to the ordering of another one; the third sublattice stays non-magnetic. New magnetic Bragg peaks appearing below T N = 20 K can be indexed with the incommensurate magnetic propagation vector κ 2 = (0, 0.636, ½); at T N = 20 K a cycloidal spin order, which acts mostly upon the third R-sublattice, occurs. Ho5Ni2In4 establishes first antiferromagnetism [κ = (0, 0, 0)] at T N = 31 K on two R-sublattices; then the system becomes ferro/ferrimagnetic at T C = 25 K with the third sublattice ordering as well. Tb11Ni4In9 has three magnetic transitions at T C = 135 K, T N1 = 35 K and at T N2 = 20 K; they are respectively coupled to the appearance of different propagation vectors [κ 1 = (0, 0, 0), κ 2 = (0, 0, ½), κ 3 = (0, 1, ½)], which themselves are operating differently on the five different R-sublattices. Two sublattices remain mostly ferromagnetic down to lowest temperature while the three others are predominantly coupled antiferromagnetically. In Ho11Ni4In9 a purely antiferromagnetic order, described by four different magnetic propagation vectors [κ 1 = (0, 0.62, 0), κ 2 = (0, 1, 0), κ 3 = (0, 0, ½), κ 4 = (0, 1, ½)], succeedingly includes all five different sublattices on cooling through transitions at T N1 = 22 K, T N2 = 12 K, T N3 = 8 K and T N4 = 7 K. The strength of the magnetic interactions of the different sublattices can be linked to structural details for both R 5Ni2In4 and R 11Ni4In9 compounds.
Riveron, Jacob M.; Ibrahim, Sulaiman S.; Mulamba, Charles; Djouaka, Rousseau; Irving, Helen; Wondji, Murielle J.; Ishak, Intan H.; Wondji, Charles S.
2017-01-01
Pyrethroid resistance in malaria vector, An. funestus is increasingly reported across Africa, threatening the sustainability of pyrethroid-based control interventions, including long lasting insecticidal nets (LLINs). Managing this problem requires understanding of the molecular basis of the resistance from different regions of the continent, to establish whether it is being driven by a single or independent selective events. Here, using a genome-wide transcription profiling of pyrethroid resistant populations from southern (Malawi), East (Uganda), and West Africa (Benin), we investigated the molecular basis of resistance, revealing strong differences between the different African regions. The duplicated cytochrome P450 genes (CYP6P9a and CYP6P9b) which were highly overexpressed in southern Africa are not the most upregulated in other regions, where other genes are more overexpressed, including GSTe2 in West (Benin) and CYP9K1 in East (Uganda). The lack of directional selection on both CYP6P9a and CYP6P9b in Uganda in contrast to southern Africa further supports the limited role of these genes outside southern Africa. However, other genes such as the P450 CYP9J11 are commonly overexpressed in all countries across Africa. Here, CYP9J11 is functionally characterized and shown to confer resistance to pyrethroids and moderate cross-resistance to carbamates (bendiocarb). The consistent overexpression of GSTe2 in Benin is coupled with a role of allelic variation at this gene as GAL4-UAS transgenic expression in Drosophila flies showed that the resistant 119F allele is highly efficient in conferring both DDT and permethrin resistance than the L119. The heterogeneity in the molecular basis of resistance and cross-resistance to insecticides in An. funestus populations throughout sub-Saharan African should be taken into account in designing resistance management strategies. PMID:28428243
Riveron, Jacob M; Ibrahim, Sulaiman S; Mulamba, Charles; Djouaka, Rousseau; Irving, Helen; Wondji, Murielle J; Ishak, Intan H; Wondji, Charles S
2017-06-07
Pyrethroid resistance in malaria vector, An. funestus is increasingly reported across Africa, threatening the sustainability of pyrethroid-based control interventions, including long lasting insecticidal nets (LLINs). Managing this problem requires understanding of the molecular basis of the resistance from different regions of the continent, to establish whether it is being driven by a single or independent selective events. Here, using a genome-wide transcription profiling of pyrethroid resistant populations from southern (Malawi), East (Uganda), and West Africa (Benin), we investigated the molecular basis of resistance, revealing strong differences between the different African regions. The duplicated cytochrome P450 genes ( CYP6P9a and CYP6P9b ) which were highly overexpressed in southern Africa are not the most upregulated in other regions, where other genes are more overexpressed, including GSTe2 in West (Benin) and CYP9K1 in East (Uganda). The lack of directional selection on both CYP6P9a and CYP6P9b in Uganda in contrast to southern Africa further supports the limited role of these genes outside southern Africa. However, other genes such as the P450 CYP9J11 are commonly overexpressed in all countries across Africa. Here, CYP9J11 is functionally characterized and shown to confer resistance to pyrethroids and moderate cross-resistance to carbamates (bendiocarb). The consistent overexpression of GSTe2 in Benin is coupled with a role of allelic variation at this gene as GAL4-UAS transgenic expression in Drosophila flies showed that the resistant 119F allele is highly efficient in conferring both DDT and permethrin resistance than the L119. The heterogeneity in the molecular basis of resistance and cross-resistance to insecticides in An. funestus populations throughout sub-Saharan African should be taken into account in designing resistance management strategies. Copyright © 2017 Riveron et al.
Multiplex CRISPR/Cas9-based genome engineering from a single lentiviral vector
Kabadi, Ami M.; Ousterout, David G.; Hilton, Isaac B.; Gersbach, Charles A.
2014-01-01
Engineered DNA-binding proteins that manipulate the human genome and transcriptome have enabled rapid advances in biomedical research. In particular, the RNA-guided CRISPR/Cas9 system has recently been engineered to create site-specific double-strand breaks for genome editing or to direct targeted transcriptional regulation. A unique capability of the CRISPR/Cas9 system is multiplex genome engineering by delivering a single Cas9 enzyme and two or more single guide RNAs (sgRNAs) targeted to distinct genomic sites. This approach can be used to simultaneously create multiple DNA breaks or to target multiple transcriptional activators to a single promoter for synergistic enhancement of gene induction. To address the need for uniform and sustained delivery of multiplex CRISPR/Cas9-based genome engineering tools, we developed a single lentiviral system to express a Cas9 variant, a reporter gene and up to four sgRNAs from independent RNA polymerase III promoters that are incorporated into the vector by a convenient Golden Gate cloning method. Each sgRNA is efficiently expressed and can mediate multiplex gene editing and sustained transcriptional activation in immortalized and primary human cells. This delivery system will be significant to enabling the potential of CRISPR/Cas9-based multiplex genome engineering in diverse cell types. PMID:25122746
KCl cotransport regulation and protein kinase G in cultured vascular smooth muscle cells.
Adragna, N C; Zhang, J; Di Fulvio, M; Lincoln, T M; Lauf, P K
2002-05-15
K-Cl cotransport is activated by vasodilators in erythrocytes and vascular smooth muscle cells and its regulation involves putative kinase/phosphatase cascades. N-ethylmaleimide (NEM) activates the system presumably by inhibiting a protein kinase. Nitrovasodilators relax smooth muscle via cGMP-dependent activation of protein kinase G (PKG), a regulator of membrane channels and transporters. We investigated whether PKG regulates K-Cl cotransport activity or mRNA expression in normal, PKG-deficient-vector-only-transfected (PKG-) and PKG-catalytic-domain-transfected (PKG+) rat aortic smooth muscle cells. K-Cl cotransport was calculated as the Cl-dependent Rb influx, and mRNA was determined by semiquantitative RT-PCR. Baseline K-Cl cotransport was higher in PKG+ than in PKG- cells (p <0.01). At 0.5 mM, NEM stimulated K-Cl cotransport by 5-fold in PKG- but not in PKG+ cells. However, NEM was more potent although less effective to activate K-Cl cotransport in normal (passage 1-3) and PKG+ than in PKG- cells. In PKG- cells, [(dihydroindenyl) oxy] alkanoic acid (300 mM) but not furosemide (1 mM) inhibited K-Cl cotransport. Furthermore, no difference in K-Cl cotransport mRNA expression was observed between these cells. In conclusion, this study shows that manipulation of PKG expression in vascular smooth muscle cells affects K-Cl cotransport activity and its activation by NEM.
Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi
2012-01-01
TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.
Taniguchi, H; Ohta, H; Ogawa, M; Mizuguchi, Y
1985-05-01
Two hemolysin genes of Vibrio parahaemolyticus WP1, a thermostable direct (TSD) hemolysin gene and a thermolabile hemolysin gene, were cloned into the pBR322 vector in Escherichia coli K-12 C600. A large amount of the TSD hemolysin produced in E. coli K-12 accumulated in the periplasmic space. The TSD hemolysin gene was localized on a 0.9-kilobase HindIII-BamHI fragment by identifying qualitatively the production of the TSD hemolysin by a reverse passive hemagglutination assay in the osmotic shock fluid. The thermolabile hemolysin gene was isolated on a 1.3-kilobase HindIII-PstI fragment by selection with the hemolysin on blood agar. Southern blot hybridization and colony hybridization experiments indicated that the TSD hemolysin gene was present in the chromosomal DNA of 15 Kanagawa phenomenon-positive strains but not in 14 negative strains, whereas the thermolabile hemolysin gene was detected in all strains. No homologous DNA sequences to TSD and thermolabile hemolysin genes were detected in the chromosomes of Vibrio cholerae, Vibrio vulnificus, non-O1 V. cholerae, and Vibrio anguillarum.
Liu, Yu-Ying; Yang, Wen-Tao; Shi, Shao-Hua; Li, Ya-Jie; Zhao, Liang; Shi, Chun-Wei; Zhou, Fang-Yu; Jiang, Yan-Long; Hu, Jing-Tao; Gu, Wei; Yang, Gui-Lian; Wang, Chun-Feng
2017-06-30
Goose parvovirus (GPV) continues to be a threat to goose farms and has significant economic effects on the production of geese. Current commercially available vaccines only rarely prevent GPV infection. In our study, Lactobacillus (L.) plantarum NC8 was selected as a vector to express the VP2 gene of GPV, and recombinant L. plantarum pSIP409-VP2/NC8 was successfully constructed. The molecular weight of the expressed recombinant protein was approximately 70 kDa. Mice were immunized with a 2 × 10 9 colony-forming unit/200 μL dose of the recombinant L. plantarum strain, and the ratios and numbers of CD11c + , CD3 + CD4 + , CD3 + CD8 + , and interferon gamma- and tumor necrosis factor alpha-expressing spleen lymphocytes in the pSIP409-VP2/NC8 group were higher than those in the control groups. In addition, we assessed the capacity of L. plantarum SIP409-VP2/NC8 to induce secretory IgA production. We conclude that administered pSIP409-VP2/NC8 leads to relatively extensive cellular responses. This study provides information on GPV infection and offers a clear framework of options available for GPV control strategies.
Repressive histone methylation regulates cardiac myocyte cell cycle exit.
El-Nachef, Danny; Oyama, Kyohei; Wu, Yun-Yu; Freeman, Miles; Zhang, Yiqiang; Robb MacLellan, W
2018-05-22
Mammalian cardiac myocytes (CMs) stop proliferating soon after birth and subsequent heart growth comes from hypertrophy, limiting the adult heart's regenerative potential after injury. The molecular events that mediate CM cell cycle exit are poorly understood. To determine the epigenetic mechanisms limiting CM cycling in adult CMs (ACMs) and whether trimethylation of lysine 9 of histone H3 (H3K9me3), a histone modification associated with repressed chromatin, is required for the silencing of cell cycle genes, we developed a transgenic mouse model where H3K9me3 is specifically removed in CMs by overexpression of histone demethylase, KDM4D. Although H3K9me3 is found across the genome, its loss in CMs preferentially disrupts cell cycle gene silencing. KDM4D binds directly to cell cycle genes and reduces H3K9me3 levels at these promotors. Loss of H3K9me3 preferentially leads to increased cell cycle gene expression resulting in enhanced CM cycling. Heart mass was increased in KDM4D overexpressing mice by postnatal day 14 (P14) and continued to increase until 9-weeks of age. ACM number, but not size, was significantly increased in KDM4D expressing hearts, suggesting CM hyperplasia accounts for the increased heart mass. Inducing KDM4D after normal development specifically in ACMs resulted in increased cell cycle gene expression and cycling. We demonstrated that H3K9me3 is required for CM cell cycle exit and terminal differentiation in ACMs. Depletion of H3K9me3 in adult hearts prevents and reverses permanent cell cycle exit and allows hyperplastic growth in adult hearts in vivo. Copyright © 2017. Published by Elsevier Ltd.
Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto
2015-01-01
Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. PMID:26342260
Hammond, Sean L.; Leek, Ashley N.; Richman, Evan H.
2017-01-01
The non-pathogenic parvovirus, adeno-associated virus (AAV), is an efficient vector for transgene expression in vivo and shows promise for treatment of brain disorders in clinical trials. Currently, there are more than 100 AAV serotypes identified that differ in the binding capacity of capsid proteins to specific cell surface receptors that can transduce different cell types and brain regions in the CNS. In the current study, multiple AAV serotypes expressing a GFP reporter (AAV1, AAV2/1, AAVDJ, AAV8, AAVDJ8, AAV9, AAVDJ9) were screened for their infectivity in both primary murine astrocyte and neuronal cell cultures. AAV2/1, AAVDJ8 and AAV9 were selected for further investigation of their tropism throughout different brain regions and cell types. Each AAV was administered to P0-neonatal mice via intracerebroventricular injections (ICV). Brains were then systematically analyzed for GFP expression at 3 or 6 weeks post-infection in various regions, including the olfactory bulb, striatum, cortex, hippocampus, substantia nigra (SN) and cerebellum. Cell counting data revealed that AAV2/1 infections were more prevalent in the cortical layers but penetrated to the midbrain less than AAVDJ8 and AAV9. Additionally, there were differences in the persistence of viral transgene expression amongst the three serotypes examined in vivo at 3 and 6 weeks post-infection. Because AAV-mediated transgene expression is of interest in neurodegenerative diseases such as Parkinson’s Disease, we examined the SN with microscopy techniques, such as CLARITY tissue transmutation, to identify AAV serotypes that resulted in optimal transgene expression in either astrocytes or dopaminergic neurons. AAVDJ8 displayed more tropism in astrocytes compared to AAV9 in the SN region. We conclude that ICV injection results in lasting expression of virally encoded transgene when using AAV vectors and that specific AAV serotypes are required to selectively deliver transgenes of interest to different brain regions in both astrocytes and neurons. PMID:29244806
A Cancer Gene Selection Algorithm Based on the K-S Test and CFS.
Su, Qiang; Wang, Yina; Jiang, Xiaobing; Chen, Fuxue; Lu, Wen-Cong
2017-01-01
To address the challenging problem of selecting distinguished genes from cancer gene expression datasets, this paper presents a gene subset selection algorithm based on the Kolmogorov-Smirnov (K-S) test and correlation-based feature selection (CFS) principles. The algorithm selects distinguished genes first using the K-S test, and then, it uses CFS to select genes from those selected by the K-S test. We adopted support vector machines (SVM) as the classification tool and used the criteria of accuracy to evaluate the performance of the classifiers on the selected gene subsets. This approach compared the proposed gene subset selection algorithm with the K-S test, CFS, minimum-redundancy maximum-relevancy (mRMR), and ReliefF algorithms. The average experimental results of the aforementioned gene selection algorithms for 5 gene expression datasets demonstrate that, based on accuracy, the performance of the new K-S and CFS-based algorithm is better than those of the K-S test, CFS, mRMR, and ReliefF algorithms. The experimental results show that the K-S test-CFS gene selection algorithm is a very effective and promising approach compared to the K-S test, CFS, mRMR, and ReliefF algorithms.
Han, Sung-Woong; Nakamura, Chikashi; Imai, Yosuke; Nakamura, Noriyuki; Miyake, Jun
2009-01-01
In this study, we have evaluated a sensor system for a hormonal drug effect in a single cell level using a novel low invasive single cell DNA delivery technology using a nanoneedle. An estrogen responsive GFP reporter vector (pEREGFP9) was constructed and its estrogenic response activity was confirmed in breast cancer cells (MCF-7) using lipofection as the means of transferring the vector to the cells. The pEREGFP9 vector was delivered to a single MCF-7 using a nanoneedle and the effect of ICI 182,780, which is an antagonist of estrogen, was observed using the GFP expression level. By ICI 182,780 treatment, the fluorescence intensity of the GFP was decreased by 30-50% within 24h. This technology is the very first trial of single cell diagnosis and we are looking forward to applying it to precious single cell diagnosis in medical fields.
Ren, Wei; Liu, Yuehong; Wan, Shaoheng; Fei, Chang; Wang, Wei; Chen, Yingying; Zhang, Zhihui; Wang, Ting; Wang, Jinshu; Zhou, Lan; Weng, Yaguang; He, Tongchuan; Zhang, Yan
2014-01-01
Bone morphogenetic protein 9 (BMP9), a member of TGF-β superfamily, is reported to inhibit the growth and migration of prostate cancer, osteosarcoma and triple-negative MDA-MB-231 breast cancer cells. However, little is known about the effect of on the biological behaviors of HER2-positive SK-BR-3 breast cancer cells and the underlying mechanisms. This study aimed to investigate the effects of BMP9 on the proliferation and metastasis of SK-BR-3 cells with BMP9 over-expression or BMP9 down-regulated expression. Results indicated that exogenously expressed BMP9 inhibited the proliferation and metastasis of SK-BR-3 cells while decreased endogenous BMP9 expression in SK-BR-3 cells promoted the proliferation and migration of breast cancer cells in vitro and in vivo. In SK-BR-3 cells with BMP9 over-expression, the phosphorylation of HER2, ERK1/2 and AKT was markedly suppressed and the HER2 expression decreased at both mRNA and protein levels, while opposite results were observed in SK-BR-3 cells with BMP9 knock down. When the phosphorylation of ERK1/2 and PI3K/AKT was inhibited by PD98059 and LY294002, respectively, the decreased proliferation and invasion induced by BMP9 knock down were eliminated. These findings suggest that BMP9 can inhibit the proliferation and metastasis of SK-BR-3 cells via inactivating ERK1/2 and PI3K/AKT signaling pathways. Thus, BMP9 may serve as a useful agent in the treatment of HER-2 positive breast cancer. PMID:24805814
Ren, Wei; Liu, Yuehong; Wan, Shaoheng; Fei, Chang; Wang, Wei; Chen, Yingying; Zhang, Zhihui; Wang, Ting; Wang, Jinshu; Zhou, Lan; Weng, Yaguang; He, Tongchuan; Zhang, Yan
2014-01-01
Bone morphogenetic protein 9 (BMP9), a member of TGF-β superfamily, is reported to inhibit the growth and migration of prostate cancer, osteosarcoma and triple-negative MDA-MB-231 breast cancer cells. However, little is known about the effect of on the biological behaviors of HER2-positive SK-BR-3 breast cancer cells and the underlying mechanisms. This study aimed to investigate the effects of BMP9 on the proliferation and metastasis of SK-BR-3 cells with BMP9 over-expression or BMP9 down-regulated expression. Results indicated that exogenously expressed BMP9 inhibited the proliferation and metastasis of SK-BR-3 cells while decreased endogenous BMP9 expression in SK-BR-3 cells promoted the proliferation and migration of breast cancer cells in vitro and in vivo. In SK-BR-3 cells with BMP9 over-expression, the phosphorylation of HER2, ERK1/2 and AKT was markedly suppressed and the HER2 expression decreased at both mRNA and protein levels, while opposite results were observed in SK-BR-3 cells with BMP9 knock down. When the phosphorylation of ERK1/2 and PI3K/AKT was inhibited by PD98059 and LY294002, respectively, the decreased proliferation and invasion induced by BMP9 knock down were eliminated. These findings suggest that BMP9 can inhibit the proliferation and metastasis of SK-BR-3 cells via inactivating ERK1/2 and PI3K/AKT signaling pathways. Thus, BMP9 may serve as a useful agent in the treatment of HER-2 positive breast cancer.
Hen, Gideon; Yosefi, Sara; Shinder, Dmitry; Or, Adi; Mygdal, Sivan; Condiotti, Reba; Galun, Eithan; Bor, Amir; Sela-Donenfeld, Dalit; Friedman-Einat, Miriam
2012-01-01
The lack of affordable techniques for gene transfer in birds has inhibited the advancement of molecular studies in avian species. Here we demonstrate a new approach for introducing genes into chicken somatic tissues by administration of a lentiviral vector, derived from the feline immunodeficiency virus (FIV), into the chorioallantoic membrane (CAM) of chick embryos on embryonic day 11. The FIV-derived vectors carried yellow fluorescent protein (YFP) or recombinant alpha-melanocyte-stimulating hormone (α-MSH) genes, driven by the cytomegalovirus (CMV) promoter. Transgene expression, detected in chicks 2 days after hatch by quantitative real-time PCR, was mostly observed in the liver and spleen. Lower expression levels were also detected in the brain, kidney, heart and breast muscle. Immunofluorescence and flow cytometry analyses confirmed transgene expression in chick tissues at the protein level, demonstrating a transduction efficiency of ∼0.46% of liver cells. Integration of the viral vector into the chicken genome was demonstrated using genomic repetitive (CR1)-PCR amplification. Viability and stability of the transduced cells was confirmed using terminal deoxynucleotidyl transferase (dUTP) nick end labeling (TUNEL) assay, immunostaining with anti-proliferating cell nuclear antigen (anti-PCNA), and detection of transgene expression 51 days post transduction. Our approach led to only 9% drop in hatching efficiency compared to non-injected embryos, and all of the hatched chicks expressed the transgenes. We suggest that the transduction efficiency of FIV vectors combined with the accessibility of the CAM vasculature as a delivery route comprise a new powerful and practical approach for gene delivery into somatic tissues of chickens. Most relevant is the efficient transduction of the liver, which specializes in the production and secretion of proteins, thereby providing an optimal target for prolonged study of secreted hormones and peptides. PMID:22606269
Cathepsin K expression is increased in oral lichen planus.
Siponen, Maria; Bitu, Carolina Cavalcante; Al-Samadi, Ahmed; Nieminen, Pentti; Salo, Tuula
2016-11-01
Oral lichen planus (OLP) is an idiopathic T-cell-mediated mucosal inflammatory disease. Cathepsin K (Cat K) is one of the lysosomal cysteine proteases. It is involved in many pathological conditions, including osteoporosis and cancer. The expression and role of Cat K in OLP are unknown. Twenty-five oral mucosal specimens diagnosed histopathologically as OLP and fourteen healthy controls (HC) were used to study the immunohistochemical (IHC) expression of Cat K. Colocalization of Cat K with CD1a, Melan-A, CD68, CD45, mast cell tryptase (MCT), and Toll-like receptors (TLRs) 4 and 9 were studied using double IHC and/or immunofluorescence (IF) staining. Expression of Cat K was also evaluated in OLP tissue samples before and after topical tacrolimus treatment. Cat K was expressed in a higher percentage of cells in the epithelial zone, and the staining intensity was stronger in the stroma in OLP compared to controls (P < 0.001). In OLP, Cat K was present mostly in melanocytes and macrophages and sporadically in basal keratinocytes, endothelial cells, and extracellularly. Cat K was found also in some fibroblasts in HC and OLP samples. Coexpression of Cat K and TLRs 4 and 9 was seen in some dendritic cells (presumably melanocytes) and macrophages. In OLP, tacrolimus treatment reduced the expression of Cat K in the epithelium but increased it in the stroma. These results suggest that Cat K is involved in the pathogenesis of OLP. Cat K possibly takes part in the modulation of matrix molecules and cellular receptors. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Pal, Gargi; Srivastava, Sheela
2014-02-01
Plantaricin gene-specific primers were used to obtain plnE, -F, -J and -K structural gene amplicons from soil metagenome. These amplicons were cloned and expressed in pET32a (+) vector in Escherichia coli BL21 (DE3). PlnE, -F, -J and -K peptides were expressed as His-tagged-fusion proteins and were separated by Ni(2+) -chelating affinity chromatography. The peptides were released from the fusion by enterokinase cleavage and separated from the carrier thioredoxin. The cleaved peptides were further analysed for antimicrobial activity and found to be active against Listeria innocua NRRL B33314, Micrococcus luteus MTCC 106 and lactic acid bacteria, such as Enterococcus casseliflavus NRRL B3502, Lactococcus lactis lactis NRRL 1821, Lactobacillus curvatus NRRL B4562 and Lactobacillus plantarum NRRL B4496. E. coli has been successfully exploited as a host for heterologous expression with a significant yield of fused and cleaved peptides in the range of 8-12 and 1-1.5 mg/l of the culture, respectively. Heterologous expression, therefore, can be used to overcome the constraints of low yield often reported from a native strain.
A k-Vector Approach to Sampling, Interpolation, and Approximation
NASA Astrophysics Data System (ADS)
Mortari, Daniele; Rogers, Jonathan
2013-12-01
The k-vector search technique is a method designed to perform extremely fast range searching of large databases at computational cost independent of the size of the database. k-vector search algorithms have historically found application in satellite star-tracker navigation systems which index very large star catalogues repeatedly in the process of attitude estimation. Recently, the k-vector search algorithm has been applied to numerous other problem areas including non-uniform random variate sampling, interpolation of 1-D or 2-D tables, nonlinear function inversion, and solution of systems of nonlinear equations. This paper presents algorithms in which the k-vector search technique is used to solve each of these problems in a computationally-efficient manner. In instances where these tasks must be performed repeatedly on a static (or nearly-static) data set, the proposed k-vector-based algorithms offer an extremely fast solution technique that outperforms standard methods.
Regha, Kakkad; Sloane, Mathew A.; Huang, Ru; Pauler, Florian M.; Warczok, Katarzyna E.; Melikant, Balázs; Radolf, Martin; Martens, Joost H.A.; Schotta, Gunnar; Jenuwein, Thomas; Barlow, Denise P.
2010-01-01
SUMMARY The Igf2r imprinted cluster is an epigenetic silencing model in which expression of a ncRNA silences multiple genes in cis. Here, we map a 250 kb region in mouse embryonic fibroblast cells to show that histone modifications associated with expressed and silent genes are mutually exclusive and localized to discrete regions. Expressed genes were modified at promoter regions by H3K4me3 + H3K4me2 + H3K9Ac and on putative regulatory elements flanking active promoters by H3K4me2 + H3K9Ac. Silent genes showed two types of nonoverlapping profile. One type spread over large domains of tissue-specific silent genes and contained H3K27me3 alone. A second type formed localized foci on silent imprinted gene promoters and a nonexpressed pseudogene and contained H3K9me3 + H4K20me3 ± HP1. Thus, mammalian chromosome arms contain active chromatin interspersed with repressive chromatin resembling the type of heterochromatin previously considered a feature of centromeres, telomeres, and the inactive X chromosome. PMID:17679087
Cox, Robert H; Fromme, Samantha
2016-12-01
We have shown that three components contribute to functional voltage gated K + (K v ) currents in rat small mesenteric artery myocytes: (1) Kv1.2 plus Kv1.5 with Kvβ1.2 subunits, (2) Kv2.1 probably associated with Kv9.3 subunits, and (3) Kv7.4 subunits. To confirm and address subunit stoichiometry of the first two, we have compared the biophysical properties of K v currents in small mesenteric artery myocytes with those of K v subunits heterologously expressed in HEK293 cells using whole cell voltage clamp methods. Selective inhibitors of Kv1 (correolide, COR) and Kv2 (stromatoxin, ScTx) channels were used to separate these K v current components. Conductance-voltage and steady state inactivation data along with time constants of activation, inactivation, and deactivation of native K v components were generally well represented by those of Kv1.2-1.5-β1.2 and Kv2.1-9.3 channels. The slope of the steady state inactivation-voltage curve (availability slope) proved to be the most sensitive measure of accessory subunit presence. The availability slope curves exhibited a single peak for both native K v components. Availability slope curves for Kv1.2-1.5-β1.2 and Kv2.1-9.3 channels expressed in human embryonic kidney cells also exhibited a single peak that shifted to more depolarized voltages with increasing accessory to α subunit transfection ratio. Availability slope curves for SxTc-insensitive currents were similar to those of Kv1.2-1.5 expressed with Kvβ1.2 at a 1:5 molar ratio while curves for COR-insensitive currents closely resembled those of Kv2.1 expressed with Kv9.3 at a 1:1 molar ratio. These results support the suggested K v subunit combinations in small mesenteric artery, and further suggest that Kv1 α and Kvβ1.2 but not Kv2.1 and Kv9.3 subunits are present in a saturated (4:4) stoichiometry.
NASA Astrophysics Data System (ADS)
Han, Sheng; Xi, Shi-qiong; Geng, Wei-dong
2017-11-01
In order to solve the problem of low recognition rate of traditional feature extraction operators under low-resolution images, a novel algorithm of expression recognition is proposed, named central oblique average center-symmetric local binary pattern (CS-LBP) with adaptive threshold (ATCS-LBP). Firstly, the features of face images can be extracted by the proposed operator after pretreatment. Secondly, the obtained feature image is divided into blocks. Thirdly, the histogram of each block is computed independently and all histograms can be connected serially to create a final feature vector. Finally, expression classification is achieved by using support vector machine (SVM) classifier. Experimental results on Japanese female facial expression (JAFFE) database show that the proposed algorithm can achieve a recognition rate of 81.9% when the resolution is as low as 16×16, which is much better than that of the traditional feature extraction operators.
Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C
1990-01-01
Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285
Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C
1990-01-01
Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.
Cottingham, Matthew G; van Maurik, Andre; Zago, Manola; Newton, Angela T; Anderson, Richard J; Howard, M Keith; Schneider, Jörg; Skinner, Michael A
2006-07-01
The FP9 strain of F has been described as a more immunogenic recombinant vaccine vector than the Webster FPV-M (FPW) strain (R. J. Anderson et al., J. Immunol. 172:3094-3100, 2004). This study expands the comparison to include two separate recombinant antigens and multiple, rather than single, independent viral clones derived from the two strains. Dual-poxvirus heterologous prime-boost vaccination regimens using individual clones of recombinant FP9 or FPW in combination with recombinant modified V Ankara expressing the same antigen were evaluated for their ability to elicit T-cell responses against recombinant antigens from Plasmodium berghei (circumsporozoite protein) or human immunodeficiency virus type 1 (a Gag-Pol-Nef fusion protein). Gamma interferon enzyme-linked immunospot assay and fluorescence-activated cell sorting assays of the responses to specific epitopes confirmed the approximately twofold-greater cellular immunogenicity of FP9 compared to FPW, when given as the priming or boosting immunization. Equality of transgene expression in mouse cells infected with the two strains in vitro was verified by Western blotting. Directed partial sequence analysis and PCR analysis of FPW and comparison to available whole-genome sequences revealed that many loci that are mutated in the highly attenuated and culture-adapted FP9 strain are wild type in FPW, including the seven multikilobase deletions. These "passage-specific" alterations are hypothesized to be involved in determining the immunogenicity of fowlpox virus as a recombinant vaccine vector.
REQUEST: A Recursive QUEST Algorithm for Sequential Attitude Determination
NASA Technical Reports Server (NTRS)
Bar-Itzhack, Itzhack Y.
1996-01-01
In order to find the attitude of a spacecraft with respect to a reference coordinate system, vector measurements are taken. The vectors are pairs of measurements of the same generalized vector, taken in the spacecraft body coordinates, as well as in the reference coordinate system. We are interested in finding the best estimate of the transformation between these coordinate system.s The algorithm called QUEST yields that estimate where attitude is expressed by a quarternion. Quest is an efficient algorithm which provides a least squares fit of the quaternion of rotation to the vector measurements. Quest however, is a single time point (single frame) batch algorithm, thus measurements that were taken at previous time points are discarded. The algorithm presented in this work provides a recursive routine which considers all past measurements. The algorithm is based on on the fact that the, so called, K matrix, one of whose eigenvectors is the sought quaternion, is linerly related to the measured pairs, and on the ability to propagate K. The extraction of the appropriate eigenvector is done according to the classical QUEST algorithm. This stage, however, can be eliminated, and the computation simplified, if a standard eigenvalue-eigenvector solver algorithm is used. The development of the recursive algorithm is presented and illustrated via a numerical example.
Austruy, E; Bagnis, C; Carbuccia, N; Maroc, C; Birg, F; Dubreuil, P; Mannoni, P; Chabannon, C
1998-01-01
Using the LXSN backbone, a defective retroviral vector (LISN) was constructed that encodes the human interferon (IFN)-alpha2 (hIFN-alpha2) gene and the neomycin resistance gene; the hIFN-alpha2 gene was cloned from human placental genomic DNA. High titers of the LISN retrovirus were produced by the amphotropic packaging cell line GP+envAM12. LISN is able to infect three human hematopoietic and leukemic cell lines: K562, LAMA-84, and TF-1. G418-resistant cells were detected in a similar proportion after infection with either the LISN retroviral vector or the LnLSN retroviral vector (encoding the nlsLacZ gene instead of hIFN-alpha2), suggesting that hIFN-alpha2 does not inhibit (or only partially inhibits) the production of retroviral particles by the packaging cell line and the infection of human cells. LISN-infected cells express and secrete hIFN-alpha2 as demonstrated by Northern blot analysis of poly(A)+ RNA, detection of the intracellular protein by fluorescence-activated cell sorter analysis, and detection of secreted hIFN-alpha in cell supernatants using an enzyme-linked immunosorbent assay. Retrovirally produced hIFN-alpha2 is biologically active, as demonstrated by the partial inhibition of the growth of K562 and TF-1, the modulation of the expression of cell surface antigens, the induction of the (2'-5') oligoadenylate synthetase, and, for LAMA-84, the down-modulation of the BCR-ABL protein. We conclude that the infection of human leukemic cell lines with a retroviral vector encoding hIFN-alpha2 is feasible and induces the expected biological effects. This experimental model will be useful in investigating the possibility of transducing normal and leukemic cells and hematopoietic progenitors and in determining the consequences of the autocrine production of hIFN-alpha2 on the behavior of these cells.
2017-01-01
ABSTRACT Strong viral enhancers in gammaretrovirus vectors have caused cellular proto-oncogene activation and leukemia, necessitating the use of cellular promoters in “enhancerless” self-inactivating integrating vectors. However, cellular promoters result in relatively low transgene expression, often leading to inadequate disease phenotype correction. Vectors derived from foamy virus, a nonpathogenic retrovirus, show higher preference for nongenic integrations than gammaretroviruses/lentiviruses and preferential integration near transcriptional start sites, like gammaretroviruses. We found that strong viral enhancers/promoters placed in foamy viral vectors caused extremely low immortalization of primary mouse hematopoietic stem/progenitor cells compared to analogous gammaretrovirus/lentivirus vectors carrying the same enhancers/promoters, an effect not explained solely by foamy virus' modest insertional site preference for nongenic regions compared to gammaretrovirus/lentivirus vectors. Using CRISPR/Cas9-mediated targeted insertion of analogous proviral sequences into the LMO2 gene and then measuring LMO2 expression, we demonstrate a sequence-specific effect of foamy virus, independent of insertional bias, contributing to reduced genotoxicity. We show that this effect is mediated by a 36-bp insulator located in the foamy virus long terminal repeat (LTR) that has high-affinity binding to the CCCTC-binding factor. Using our LMO2 activation assay, LMO2 expression was significantly increased when this insulator was removed from foamy virus and significantly reduced when the insulator was inserted into the lentiviral LTR. Our results elucidate a mechanism underlying the low genotoxicity of foamy virus, identify a novel insulator, and support the use of foamy virus as a vector for gene therapy, especially when strong enhancers/promoters are required. IMPORTANCE Understanding the genotoxic potential of viral vectors is important in designing safe and efficacious vectors for gene therapy. Self-inactivating vectors devoid of viral long-terminal-repeat enhancers have proven safe; however, transgene expression from cellular promoters is often insufficient for full phenotypic correction. Foamy virus is an attractive vector for gene therapy. We found foamy virus vectors to be remarkably less genotoxic, well below what was expected from their integration site preferences. We demonstrate that the foamy virus long terminal repeats contain an insulator element that binds CCCTC-binding factor and reduces its insertional genotoxicity. Our study elucidates a mechanism behind the low genotoxic potential of foamy virus, identifies a unique insulator, and supports the use of foamy virus as a vector for gene therapy. PMID:29046446
Yue, Chen-Li; Shi, Jie-Ran; Shi, Chang-Hong; Zhang, Hai; Zhao, Lei; Zhang, Ting-Fen; Zhao, Yong; Xi, Li
2008-10-01
To express Micrococcus luteus resuscitation promoting factor (Rpf) domain and its mutants in prokaryotic cells, and to investigate their bioactivity. The gene of Rpf domain and its mutants (E54K, E54A) were amplified by polymerase chain reaction (PCR) from the genome of Micrococcus luteus and cloned into pMD18-T vector. After sequenced, the Rpf domain and its mutant gene were subcloned into expression vector PGEX-4T-1, and transfected into E. coli DH5alpha. The expressed product was purified by affinity chromatography using GST Fusion Protein Purification bead. The aim proteins were identified by SDS-PAGE analysis and by Western blot with monoclonal antibodies against Rpf domain (mAb). The bioactivity of the proteins was analyzed by stimulating the resuscitation of Mycobacterium smegmatis. The sequences of the PCR products were identical to those of the Rpf domain and its mutant gene in GenBank. The relative molecular mass identified by SDS-PAGE analysis was consistent with that had been reported, which was also confirmed by Western blot analysis that there were specific bindings at 32 000 with Rpf domain mAb. The purified GST-Rpf domain could stimulate resuscitation of Mycobacterium smegmatis. Replacements E54A and especially E54K resulted in inhibition of Rpf resuscitation activity. Rpf domain and two kinds of its mutant protein were obtained, and its effects on the resuscitation of dormant Mycobacterium smegmatis were clarified.
Stading, Benjamin; Osorio, Jorge E.; Velasco-Villa, Andres; Smotherman, Michael; Kingstad-Bakke, Brock; Rocke, Tonie E.
2016-01-01
Bats (Order Chiroptera) are an abundant group of mammals with tremendous ecological value as insectivores and plant dispersers, but their role as reservoirs of zoonotic diseases has received more attention in the last decade. With the goal of managing disease in free-ranging bats, we tested modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN) as potential vaccine vectors in the Brazilian Free-tailed bat (Tadarida brasiliensis), using biophotonic in vivo imaging and immunogenicity studies. Animals were administered recombinant poxviral vectors expressing the luciferase gene (MVA-luc, RCN-luc) through oronasal (ON) or intramuscular (IM) routes and subsequently monitored for bioluminescent signal indicative of viral infection. No clinical illness was noted after exposure to any of the vectors, and limited luciferase expression was observed. Higher and longer levels of expression were observed with the RCN-luc construct. When given IM, luciferase expression was limited to the site of injection, while ON exposure led to initial expression in the oral cavity, often followed by secondary replication at another location, likely the gastric mucosa or gastric associated lymphatic tissue. Viral DNA was detected in oral swabs up to 7 and 9 days post infection (dpi) for MVA and RCN, respectively. While no live virus was detected in oral swabs from MVA-infected bats, titers up to 3.88 x 104 PFU/ml were recovered from oral swabs of RCN-infected bats. Viral DNA was also detected in fecal samples from two bats inoculated IM with RCN, but no live virus was recovered. Finally, we examined the immunogenicity of a RCN based rabies vaccine (RCN-G) following ON administration. Significant rabies neutralizing antibody titers were detected in the serum of immunized bats using the rapid fluorescence focus inhibition test (RFFIT). These studies highlight the safety and immunogenicity of attenuated poxviruses and their potential use as vaccine vectors in bats.
Stading, Ben R.; Osorio, Jorge E.; Velasco-Villa, Andres; Smotherman, Michael; Kingstad-Bakke, Brock
2017-01-01
Bats (Order Chiroptera) are an abundant group of mammals with tremendous ecological value as insectivores and plant dispersers, but their role as reservoirs of zoonotic diseases has received more attention in the last decade. With the goal of managing disease in free-ranging bats, we tested modified vaccinia Ankara (MVA) and raccoon poxvirus (RCN) as potential vaccine vectors in the Brazilian Free-tailed bat (Tadarida brasiliensis), using biophotonic in vivo imaging and immunogenicity studies. Animals were administered recombinant poxviral vectors expressing the luciferase gene (MVA-luc, RCN-luc) through oronasal (ON) or intramuscular (IM) routes and subsequently monitored for bioluminescent signal indicative of viral infection. No clinical illness was noted after exposure to any of the vectors, and limited luciferase expression was observed. Higher and longer levels of expression were observed with the RCN-luc construct. When given IM, luciferase expression was limited to the site of injection, while ON exposure led to initial expression in the oral cavity, often followed by secondary replication at another location, likely the gastric mucosa or gastric associated lymphatic tissue. Viral DNA was detected in oral swabs up to 7 and 9 days post infection (dpi) for MVA and RCN, respectively. While no live virus was detected in oral swabs from MVA-infected bats, titers up to 3.88 × 104 PFU/ml were recovered from oral swabs of RCN-infected bats. Viral DNA was also detected in fecal samples from two bats inoculated IM with RCN, but no live virus was recovered. Finally, we examined the immunogenicity of a RCN based rabies vaccine (RCN-G) following ON administration. Significant rabies neutralizing antibody titers were detected in the serum of immunized bats using the rapid fluorescence focus inhibition test (RFFIT). These studies highlight the safety and immunogenicity of attenuated poxviruses and their potential use as vaccine vectors in bats. PMID:27650872
Davey, Marcus G.; Riley, John S.; Andrews, Abigail; Tyminski, Alec; Limberis, Maria; Pogoriler, Jennifer E.; Partridge, Emily; Olive, Aliza; Hedrick, Holly L.; Flake, Alan W.; Peranteau, William H.
2017-01-01
A major limitation to adeno-associated virus (AAV) gene therapy is the generation of host immune responses to viral vector antigens and the transgene product. The ability to induce immune tolerance to foreign protein has the potential to overcome this host immunity. Acquisition and maintenance of tolerance to viral vector antigens and transgene products may also permit repeat administration thereby enhancing therapeutic efficacy. In utero gene transfer (IUGT) takes advantage of the immunologic immaturity of the fetus to induce immune tolerance to foreign antigens. In this large animal study, in utero administration of AAV6.2, AAV8 and AAV9 expressing green fluorescent protein (GFP) to ~60 day fetal sheep (term: ~150 days) was performed. Transgene expression and postnatal immune tolerance to GFP and viral antigens were assessed. We demonstrate 1) hepatic expression of GFP 1 month following in utero administration of AAV6.2.GFP and AAV8.GFP, 2) in utero recipients of either AAV6.2.GFP or AAV8.GFP fail to mount an anti-GFP antibody response following postnatal GFP challenge and lack inflammatory cellular infiltrates at the intramuscular site of immunization, 3) a serotype specific anti-AAV neutralizing antibody response is elicited following postnatal challenge of in utero recipients of AAV6.2 or AAV8 with the corresponding AAV serotype, and 4) durable hepatic GFP expression was observed up to 6 months after birth in recipients of AAV8.GFP but expression was lost between 1 and 6 months of age in recipients of AAV6.2.GFP. The current study demonstrates, in a preclinical large animal model, the potential of IUGT to achieve host immune tolerance to the viral vector transgene product but also suggests that a single exposure to the vector capsid proteins at the time of IUGT is inadequate to induce tolerance to viral vector antigens. PMID:28141818
Ogada, Pamella Akoth; Kiirika, Leonard Muriithi; Lorenz, Christin; Senkler, Jennifer; Braun, Hans-Peter; Poehling, Hans-Michael
2017-02-01
Tomato spotted wilt virus (TSWV) is mainly vectored by Frankliniella occidentalis Pergande, and it potentially activates the vector's immune response. However, molecular background of the altered immune response is not clearly understood. Therefore, using a proteomic approach, we investigated the immune pathways that are activated in F. occidentalis larvae after 24 h exposure to TSWV. Two-dimensional isoelectric focusing/sodium dodecyl sulfate polyacrylamide gel electrophoresis (2D-IEF/SDS/PAGE) combined with mass spectrometry (MS), were used to identify proteins that were differentially expressed upon viral infection. High numbers of proteins were abundantly expressed in F. occidentalis exposed to TSWV (73%) compared to the non-exposed (27%), with the majority functionally linked to the innate immune system such as: signaling, stress response, defense response, translation, cellular lipids and nucleotide metabolism. Key proteins included: 70 kDa heat shock proteins, Ubiquitin and Dermcidin, among others, indicative of a responsive pattern of the vector's innate immune system to viral infection. Copyright © 2016 Elsevier Ltd. All rights reserved.
Pollock, W B; Loutfi, M; Bruschi, M; Rapp-Giles, B J; Wall, J D; Voordouw, G
1991-01-01
By using a synthetic deoxyoligonucleotide probe designed to recognize the structural gene for cytochrome cc3 from Desulfovibrio vulgaris Hildenborough, a 3.7-kb XhoI genomic DNA fragment containing the cc3 gene was isolated. The gene encodes a precursor polypeptide of 58.9 kDa, with an NH2-terminal signal sequence of 31 residues. The mature polypeptide (55.7 kDa) has 16 heme binding sites of the form C-X-X-C-H. Covalent binding of heme to these 16 sites gives a holoprotein of 65.5 kDa with properties similar to those of the high-molecular-weight cytochrome c (Hmc) isolated from the same strain by Higuchi et al. (Y. Higuchi, K. Inaka, N. Yasuoka, and T. Yagi, Biochim. Biophys. Acta 911:341-348, 1987). Since the data indicate that cytochrome cc3 and Hmc are the same protein, the gene has been named hmc. The Hmc polypeptide contains 31 histidinyl residues, 16 of which are integral to heme binding sites. Thus, only 15 of the 16 hemes can have bis-histidinyl coordination. A comparison of the arrangement of heme binding sites and coordinated histidines in the amino acid sequences of cytochrome c3 and Hmc from D. vulgaris Hildenborough suggests that the latter contains three cytochrome c3-like domains. Cloning of the D. vulgaris Hildenborough hmc gene into the broad-host-range vector pJRD215 and subsequent conjugational transfer of the recombinant plasmid into D. desulfuricans G200 led to expression of a periplasmic Hmc gene product with covalently bound hemes. Images PMID:1846136
Suthangkornkul, Rungarun; Sirichaiyakul, Phanthila; Sungvornyothin, Sungsit; Thepouyporn, Apanchanid; Svasti, Jisnuson; Arthan, Dumrongkiet
2015-06-01
Salivary α-glucosidases (MalI) have been much less characterized when compared with midgut α-glucosidases, which have been studied in depth. Few studies have been reported on the partial characterization of MalI, but no clear function has been ascribed. The aim of this study is to purify and characterize the recombinant Culex quinquefasciatus (CQ) α-glucosidase expressed in Pichia pastoris. The cDNA encoding mature Cx. quinquefasciatus α-glucosidase gene with polyhistidine tag (rCQMalIHis) was successfully cloned into the expression vector, pPICZαB, designated as pPICZαB/CQMalIHis. The activity of recombinant rCQMalIHis expressed in P. pastoris could be detected at 3.75U/ml, under optimal culture conditions. The purified rCQMalIHis showed a single band of molecular weight of approximately 92kDa on SDS-PAGE. After Endoglycosidase H digestion, a single band at 69kDa was found on SDS-PAGE analysis, suggesting that rCQMalIHis is a glycoprotein. Additionally, tryptic digestion and LC-MALDI MS/MS analysis suggested that the 69kDa band corresponds to the Cx. quinquefasciatus α-glucosidase. Thus, rCQMalIHis is a glycoprotein. The rCQMalIHis exhibited optimum pH and temperature at 5.5 and 35°C, respectively. The catalytic efficiency (kcat/Km) of the purified rCQMalIHis for maltotriose is higher than those for sucrose, maltotetraose, maltose and p-nitrophenyl-α-glucoside, indicating that the enzyme prefers maltotriose. Additionally, the rCQMalIHis is significantly inhibited by d-gluconic acid δ-lactone, but not by Mg(2+), Ca(2+) and EDTA. The rCQMalIHis is strongly inhibited by acarbose with IC50 67.8±5.6nM, but weakly inhibited by glucose with IC50 115.9±7.3mM. Copyright © 2015 Elsevier Inc. All rights reserved.
Xiao, W; Li, C Q; Xiao, X P; Lin, F Z
2013-12-16
Human coagulation factor VII (FVII) plays an important role in the blood coagulation process and exists in micro amounts in human plasma; therefore, any attempt at the large-scale production of FVII in significant quantities is challenging. The purpose of this study was to express and obtain biologically active recombinant FVII (rFVII) from Chinese hamster ovary K1 (CHO-K1) cells. The full-length FVII cDNA was isolated from a HepG2 cell line and then subcloned in pcDNA3.1 to construct an expression vector, pcDNA-FVII. CHO-K1 cells were transfected with 1 µg pcDNA-FVII. The cell line that stably expressed secretory FVII was screened using 900 µg/mL G418. The FVII copy number in CHO-K1 cells was detected by quantitative polymerase chain reaction (qPCR). The rFVII was purified in ligand affinity chromatography medium. The purified protein was detected by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blot analysis. The biological activity of the purified FVII protein was determined by a prothrombin time assay. Three cell lines that permanently expressed rFVII were screened. The qPCR results demonstrated that each CHO-K1 cell harbored two FVII DNA copies. The SDS-PAGE and Western blot analysis showed that the purified protein was about 50 kDa. The purity of the target protein was 95%. The prothrombin time assay indicated that the FVII-specific activity of rFVII was 2573 ± 75 IU/mg. This method enabled the fast preparation of high-purity rFVII from CHO-K1 cells, and the purified protein had good biological activity.
Mason, J B; Gurda, B L; Van Wettere, A; Engiles, J B; Wilson, J M; Richardson, D W
2017-01-01
Our long-term aim is to develop a gene therapy approach for the prevention of laminitis in the contralateral foot of horses with major musculoskeletal injuries and non-weightbearing lameness. The goal of this study was to develop a practical method to efficiently deliver therapeutic proteins deep within the equine foot. Randomised in vivo experiment. We used recombinant adeno-associated viral vectors (rAAVs) to deliver marker genes using regional limb perfusion through the palmar digital artery of the horse. Vector serotypes rAAV2/1, 2/8 and 2/9 all successfully transduced equine foot tissues and displayed similar levels and patterns of transduction. The regional distribution of transduction within the foot decreased with decreasing vector dose. The highest transduction values were seen in the sole and coronary regions and the lowest transduction values were detected in the dorsal hoof-wall region. The use of a surfactant-enriched vector diluent increased regional distribution of the vector and improved the transduction in the hoof-wall region. The hoof-wall region of the foot, which exhibited the lowest levels of transduction using saline as the vector diluent, displayed a dramatic increase in transduction when surfactant was included in the vector diluent (9- to 81-fold increase). In transduced tissues, no significant difference was observed between promoters (chicken β-actin vs. cytomegalovirus) for gene expression. All horses tested for vector-neutralising antibodies were positive for serotype-specific neutralising antibodies to rAAV2/5. The current experiments demonstrate that transgenes can be successfully delivered to the equine distal extremity using rAAV vectors and that serotypes 2/8, 2/9 and 2/1 can successfully transduce tissues of the equine foot. When the vector was diluted with surfactant-containing saline, the level of transduction increased dramatically. The increased level of transduction due to the addition of surfactant also improved the distribution pattern of transduction. © 2015 EVJ Ltd.
Tacheau, Charlotte; Fontaine, Juliette; Loy, Jennifer; Mauviel, Alain; Verrecchia, Franck
2008-12-01
One of the shared physiological roles between TGF-beta and connexin family members is to inhibit epithelial cell cycle progression and consequently, to provide protection against malignant transformation. Herein, we demonstrated that TGF-beta1 induces the expression of connexin43 (Cx43) in normal murine mammary gland (NMuMG) cell lines at the protein and mRNA levels, and transcriptionally. Using overexpression of a truncated dominant-negative form of Cx43, we determined that the modulation of gap junctional communication by TGF-beta1 plays a key role in the control of NMuMG cells proliferation by TGF-beta1. In addition, using overexpression of truncated dominant-negative forms of either Smad2 or Smad3, and MDA-MB-468 human breast carcinoma cells deficient for Smad4, we determined that the Smad cascade is not implicated in TGF-beta1 effect on Cx43 expression. Using specific pharmacologic inhibitors for JNK, ERK, p38, and PI3K/AKT signaling pathways, we demonstrated the cooperative role of p38 and PI3K/AKT signaling in TGF-beta1-induced Cx43 expression and gap junctional communication. Furthermore, transfection of a c-jun antisense expression vector significantly prevented TGF-beta1-induced Cx43 gene expression demonstrating the involvement of c-Jun/AP-1 pathway together with p38 and PI3K/AKT pathways in mediating TGF-beta1-induced Cx43 gene expression.
Katoh, Yohei; Michisaka, Saki; Nozaki, Shohei; Funabashi, Teruki; Hirano, Tomoaki; Takei, Ryota; Nakayama, Kazuhisa
2017-04-01
The CRISPR/Cas9 system has revolutionized genome editing in virtually all organisms. Although the CRISPR/Cas9 system enables the targeted cleavage of genomic DNA, its use for gene knock-in remains challenging because levels of homologous recombination activity vary among various cells. In contrast, the efficiency of homology-independent DNA repair is relatively high in most cell types. Therefore the use of a homology-independent repair mechanism is a possible alternative for efficient genome editing. Here we constructed a donor knock-in vector optimized for the CRISPR/Cas9 system and developed a practical system that enables efficient disruption of target genes by exploiting homology-independent repair. Using this practical knock-in system, we successfully disrupted genes encoding proteins involved in ciliary protein trafficking, including IFT88 and IFT20, in hTERT-RPE1 cells, which have low homologous recombination activity. The most critical concern using the CRISPR/Cas9 system is off-target cleavage. To reduce the off-target cleavage frequency and increase the versatility of our knock-in system, we constructed a universal donor vector and an expression vector containing Cas9 with enhanced specificity and tandem sgRNA expression cassettes. We demonstrated that the second version of our system has improved usability. © 2017 Katoh et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won
2014-11-01
Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.
Song, Chun-Li; Wang, Jin-Peng; Xue, Xin; Liu, Ning; Zhang, Xiao-Hao; Zhao, Zhuo; Liu, Jian-Gen; Zhang, Chun-Peng; Piao, Zhe-Hao; Liu, Yang; Yang, Yi-Bo
2017-01-01
This study aims to investigate the role of circular antisense non-coding RNA at the INK4 locus (cANRIL) in the inflammatory response of vascular endothelial cells (ECs) in a rat model of coronary atherosclerosis (AS). A rat model of AS was established with rats that were injected with a large dose of vitamin D3 and fed a high-fat diet. Sixty Wistar rats were randomly assigned into control, model, empty vector, over-expressed cANRIL and low-expressed cANRIL groups (12 rats in each group). Sixteen weeks later, the ultrastructure of their coronary arteries was observed via transmission electron microscopy. Rat serum lipid levels were analyzed using an automatic biochemical analyzer, and their atherogenic index (AI) values were calculated. Hematoxylin and eosin staining was used to observe the endothelial morphology of rats. Additionally, rat EC apoptosis was tested via a TUNEL assay. Enzyme-linked immunosorbent assays (ELISAs) were applied to measure serum levels of interleukin-1 (IL-1), IL-6, matrix metalloproteinase-9 (MMP-9) and C-reactive protein (CRP). The cANRIL, Bax, bcl-2 and caspase-3 mRNA expression levels were measured with a quantitative real-time polymerase chain reaction (qRT-PCR). The protein expression levels of Bax, bcl-2 and caspase-3 were detected using immunohistochemistry. In the control group, ECs were closely arranged with normal structures, and there was no proliferation. In the model, empty vector and over-expressed cANRIL groups, some cells were not present, and atherosclerotic plaques and thrombi appeared. However, in the under-expressed cANRIL group, the cells had a normal structure. Compared with the model and empty vector groups, the levels of total cholesterol (CHOL), triglycerides (TGs), low density lipoprotein (LDL), IL-1, IL-6, MMP-9, CRP, cANRIL, Bax, and caspase-3, AI values, and rates of EC apoptosis decreased in the low-expressed cANRIL group, while HDL (high density lipoprotein) levels and mRNA and protein expression levels of bcl-2 were increased. The changes in expression levels in the over-expressed cANRIL group were the opposite of those in the low-expressed cANRIL group. Our study provides evidence that reduced cANRIL expression could prevent coronary AS by reducing vascular EC apoptosis and inflammatory factor expression. © 2017 The Author(s). Published by S. Karger AG, Basel.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hau, L.-N.; Department of Physics, National Central University, Jhongli, Taiwan; Lai, Y.-T.
Harris-type current sheets with the magnetic field model of B-vector=B{sub x}(z)x-caret+B{sub y}(z)y-caret have many important applications to space, astrophysical, and laboratory plasmas for which the temperature or pressure usually exhibits the gyrotropic form of p{r_reversible}=p{sub Parallel-To }b-caretb-caret+p{sub Up-Tack }(I{r_reversible}-b-caretb-caret). Here, p{sub Parallel-To} and p{sub Up-Tack} are, respectively, to be the pressure component along and perpendicular to the local magnetic field, b-caret=B-vector/B. This study presents the general formulation for magnetohydrodynamic (MHD) wave propagation, fire-hose, and mirror instabilities in general Harris-type current sheets. The wave equations are expressed in terms of the four MHD characteristic speeds of fast, intermediate, slow, and cuspmore » waves, and in the local (k{sub Parallel-To },k{sub Up-Tack },z) coordinates. Here, k{sub Parallel-To} and k{sub Up-Tack} are, respectively, to be the wave vector along and perpendicular to the local magnetic field. The parameter regimes for the existence of discrete and resonant modes are identified, which may become unstable at the local fire-hose and mirror instability thresholds. Numerical solutions for discrete eigenmodes are shown for stable and unstable cases. The results have important implications for the anomalous heating and stability of thin current sheets.« less
A rapid generation of adenovirus vector with a genetic modification in hexon protein.
Di, Bingyan; Mao, Qinwen; Zhao, Junli; Li, Xing; Wang, Dongyang; Xia, Haibin
2012-02-10
The generation of hexon-modified adenovirus vector has proven difficult. In this paper, we developed a novel method for rapid generation of hexon-modified adenoviral vector via one step ligation in vitro followed by quick white/blue color screening. The new system has the following features. First, eGFP expression driven by the CMV promoter in E1 region functions as a reporter to evaluate the tropism of hexon-modified adenovirus in vitro. Second, it has two unique restriction enzyme sites with sticky ends located in the hexon HVR5 region. Third, a lacZ expression cassette under the control of plac promoter is placed between the two restriction enzyme sites, which allows recombinants to be selected using blue/white screening. To prove the principle of the method, genetically modified adenoviruses were successfully produced by insertion of NGR, RGD or Tat PTD peptide into hexon HVR5. Furthermore, the transduction efficiency of the Tat PTD modified virus was shown to be a significant enhancement in A172 and CHO-K1 cells. In conclusion, the novel system makes the production of truly retargeted vectors more promising, which would be of substantial benefit for cancer gene therapy. Copyright © 2012 Elsevier B.V. All rights reserved.
Nagahashi, Kotomi; Umemura, Kazuo; Kanayama, Naohiro; Iwaki, Takayuki
2017-04-01
Mammalian gamma-glutamyl carboxylase and reduced vitamin K are indispensable for synthesis of mature mammalian vitamin K dependent proteins including some of blood coagulation factors (factors II, VII, IX, and X). It was well known that Drosophila melanogaster expressed gamma-glutamyl carboxylase and possessed a vit.K cycle although native substrates for them have not been identified yet. Despite the potential capability of gamma carboxylation in D. melanogaster derived cells such as S2 cells, Drosophila gamma-glutamyl carboxylase failed to gamma carboxylate a peptide fused to the human coagulation factor IX propeptide. Thus, it had been believed that the Drosophila system was not adequate to synthesize mammalian vit.K dependent proteins. Indeed, we previously attempted to synthesize biologically active factor VII in S2 cells although we were not able to obtain it. However, recently, a successful transient expression of biologically active human factor IX from S2 cells was reported. In the present study, several expression vectors which enable expressing mammalian GGCX, VKORC1, and/or PDIA2 along with F7 were developed. S2 cells transfected with pMKA85, pMAK86, and pMAK219 successfully synthesized active FVII. Thus, mammalian GGCX was indispensable to synthesize active FVII while mammalian VKORC1 and PDIA2 were not critical but supportive factors for S2 cells.
Hayashita-Kinoh, Hiromi; Yugeta, Naoko; Okada, Hironori; Nitahara-Kasahara, Yuko; Chiyo, Tomoko; Okada, Takashi; Takeda, Shin'ichi
2015-01-01
Duchenne muscular dystrophy (DMD) is a severe congenital disease due to mutations in the dystrophin gene. Supplementation of dystrophin using recombinant adenoassociated virus vector has promise as a treatment of DMD, although therapeutic benefit of the truncated dystrophin still remains to be elucidated. Besides, host immune responses against the vector as well as transgene products have been denoted in the clinical gene therapy studies. Here, we transduced dystrophic dogs fetuses to investigate the therapeutic effects of an AAV vector expressing microdystrophin under conditions of immune tolerance. rAAV-CMV-microdystrophin and a rAAV-CAG-luciferase were injected into the amniotic fluid surrounding fetuses. We also reinjected rAAV9-CMV-microdystrophin into the jugular vein of an infant dystrophic dog to induce systemic expression of microdystrophin. Gait and cardiac function significantly improved in the rAAV-microdystrophin-injected dystrophic dog, suggesting that an adequate treatment of rAAV-microdystrophin with immune modulation induces successful long-term transgene expression to analyze improved dystrophic phenotype. PMID:25586688
Matoba, Shogo; Liu, Yuting; Lu, Falong; Iwabuchi, Kumiko A.; Shen, Li; Inoue, Azusa; Zhang, Yi
2014-01-01
SUMMARY Mammalian oocytes can reprogram somatic cells into a totipotent state enabling animal cloning through somatic cell nuclear transfer (SCNT). However, the majority of SCNT embryos fail to develop to term due to undefined reprogramming defects. Here we identify histone H3 lysine 9 trimethylation (H3K9me3) of donor cell genome as a major epigenetic barrier for efficient reprogramming by SCNT. Comparative transcriptome analysis identified reprogramming resistant regions (RRRs) that are expressed normally at 2-cell mouse embryos generated by IVF but not SCNT. RRRs are enriched for H3K9me3 in donor somatic cells, and its removal by ectopic expression of the H3K9me3 demethylase Kdm4d not only reactivates the majority of RRRs, but also greatly improves SCNT efficiency. Furthermore, use of donor somatic nuclei depleted of H3K9 methyltransferases markedly improves SCNT efficiency. Our study thus identifies H3K9me3 as a critical epigenetic barrier in SCNT-mediated reprogramming and provides a promising approach for improving mammalian cloning efficiency. PMID:25417163
CRISPR/Cas9 mediates efficient conditional mutagenesis in Drosophila.
Xue, Zhaoyu; Wu, Menghua; Wen, Kejia; Ren, Menda; Long, Li; Zhang, Xuedi; Gao, Guanjun
2014-09-05
Existing transgenic RNA interference (RNAi) methods greatly facilitate functional genome studies via controlled silencing of targeted mRNA in Drosophila. Although the RNAi approach is extremely powerful, concerns still linger about its low efficiency. Here, we developed a CRISPR/Cas9-mediated conditional mutagenesis system by combining tissue-specific expression of Cas9 driven by the Gal4/upstream activating site system with various ubiquitously expressed guide RNA transgenes to effectively inactivate gene expression in a temporally and spatially controlled manner. Furthermore, by including multiple guide RNAs in a transgenic vector to target a single gene, we achieved a high degree of gene mutagenesis in specific tissues. The CRISPR/Cas9-mediated conditional mutagenesis system provides a simple and effective tool for gene function analysis, and complements the existing RNAi approach. Copyright © 2014 Xue et al.
Sreenivasa, B P; Mohapatra, J K; Pauszek, S J; Koster, M; Dhanya, V C; Tamil Selvan, R P; Hosamani, M; Saravanan, P; Basagoudanavar, Suresh H; de Los Santos, T; Venkataramanan, R; Rodriguez, L L; Grubman, M J
2017-05-01
Recombinant adenovirus-5 vectored foot-and-mouth disease constructs (Ad5- FMD) were made for three Indian vaccine virus serotypes O, A and Asia 1. Constructs co-expressing foot-and- mouth disease virus (FMDV) capsid and viral 3C protease sequences, were evaluated for their ability to induce a neutralizing antibody response in indigenous cattle (Bos indicus). Purified Ad5-FMD viruses were inoculated in cattle as monovalent (5×10 9 pfu/animal) or trivalent (5×10 9 pfu/animal per serotype) vaccines. Animals vaccinated with monovalent Ad5-FMD vaccines were boosted 63days later with the same dose. After primary immunization, virus neutralization tests (VNT) showed seroconversion in 83, 67 and 33% of animals vaccinated with Ad5-FMD O, A and Asia 1, respectively. Booster immunization elicited seroconversion in all of the animals (100%) in the monovalent groups. When used in a trivalent form, the Ad5-FMD vaccine induced neutralizing antibodies in only 33, 50 and 16% of animals against serotypes O, A and Asia 1, respectively on primo-vaccination, and titers were significantly lower than when the same vectors were used in monovalent form. Neutralizing antibody titers differed by serotype for both Ad5-FMD monovalent and trivalent vaccines, with Asia 1 serotype inducing the lowest titers. Antibody response to Ad5 vector in immunized cattle was also assessed by VNT. It appeared that the vector immunity did not impact the recall responses to expressed FMDV antigens on booster immunization. In summary, the study suggested that the recombinant Ad5-FMD vaccine has a potential use in monovalent form, while its application in multivalent form is not currently encouraging. Copyright © 2017 Elsevier B.V. All rights reserved.
Systemic Gene Delivery Transduces the Enteric Nervous System of Guinea Pigs and Cynomolgus Macaques
Gombash, Sara E; Cowley, Christopher J; Fitzgerald, Julie A; Lepak, Christina A; Neides, Mitchell G; Hook, Kathryn; Todd, Levi J; Wang, Guo-Du; Mueller, Christian; Kaspar, Brian K; Bielefeld, Eric C; Fischer, Andrew J; Wood, Jackie D; Foust, Kevin D
2017-01-01
Characterization of adeno-associated viral vector (AAV) mediated gene delivery to the enteric nervous system (ENS) was recently described in mice and rats. In these proof-of-concept experiments, we show that intravenous injections of clinically relevant AAVs can transduce the ENS in guinea pigs and non-human primates. Neonatal guinea pigs were given intravenous injections of either AAV8 or AAV9 vectors that contained a green fluorescent protein (GFP) expression cassette or PBS. Piglets were euthanized three weeks post-injection and tissues were harvested for immunofluorescent analysis. GFP expression was detected in myenteric and submucosal neurons along the length of the gastrointestinal tract in AAV8 injected guinea pigs. GFP positive neurons were found in dorsal motor nucleus of the vagus and dorsal root ganglia. Less transduction occurred in AAV9 treated tissues. Gastrointestinal tissues were analyzed from young cynomolgus macaques that received systemic injection of AAV9 GFP. GFP expression was detected in myenteric neurons of the stomach, small and large intestine. These data demonstrate that ENS gene delivery translates to larger species. This work develops tools for the field of neurogastroenterology to explore gut physiology and anatomy using emerging technologies such as optogenetics and gene editing. It also provides a basis to develop novel therapies for chronic gut disorders. PMID:28771235
Systemic gene delivery transduces the enteric nervous system of guinea pigs and cynomolgus macaques.
Gombash, S E; Cowley, C J; Fitzgerald, J A; Lepak, C A; Neides, M G; Hook, K; Todd, L J; Wang, G-D; Mueller, C; Kaspar, B K; Bielefeld, E C; Fischer, A J; Wood, J D; Foust, K D
2017-10-01
Characterization of adeno-associated viral vector (AAV) mediated gene delivery to the enteric nervous system (ENS) was recently described in mice and rats. In these proof-of-concept experiments, we show that intravenous injections of clinically relevant AAVs can transduce the ENS in guinea pigs and non-human primates. Neonatal guinea pigs were given intravenous injections of either AAV8 or AAV9 vectors that contained a green fluorescent protein (GFP) expression cassette or phosphate-buffered saline. Piglets were euthanized three weeks post injection and tissues were harvested for immunofluorescent analysis. GFP expression was detected in myenteric and submucosal neurons along the length of the gastrointestinal tract in AAV8 injected guinea pigs. GFP-positive neurons were found in dorsal motor nucleus of the vagus and dorsal root ganglia. Less transduction occurred in AAV9-treated tissues. Gastrointestinal tissues were analyzed from young cynomolgus macaques that received systemic injection of AAV9 GFP. GFP expression was detected in myenteric neurons of the stomach, small and large intestine. These data demonstrate that ENS gene delivery translates to larger species. This work develops tools for the field of neurogastroenterology to explore gut physiology and anatomy using emerging technologies such as optogenetics and gene editing. It also provides a basis to develop novel therapies for chronic gut disorders.
Comparison of CRISPR/Cas9 expression constructs for efficient targeted mutagenesis in rice.
Mikami, Masafumi; Toki, Seiichi; Endo, Masaki
2015-08-01
The CRISPR/Cas9 system is an efficient tool used for genome editing in a variety of organisms. Despite several recent reports of successful targeted mutagenesis using the CRISPR/Cas9 system in plants, in each case the target gene of interest, the Cas9 expression system and guide-RNA (gRNA) used, and the tissues used for transformation and subsequent mutagenesis differed, hence the reported frequencies of targeted mutagenesis cannot be compared directly. Here, we evaluated mutation frequency in rice using different Cas9 and/or gRNA expression cassettes under standardized experimental conditions. We introduced Cas9 and gRNA expression cassettes separately or sequentially into rice calli, and assessed the frequency of mutagenesis at the same endogenous targeted sequences. Mutation frequencies differed significantly depending on the Cas9 expression cassette used. In addition, a gRNA driven by the OsU6 promoter was superior to one driven by the OsU3 promoter. Using an all-in-one expression vector harboring the best combined Cas9/gRNA expression cassette resulted in a much improved frequency of targeted mutagenesis in rice calli, and bi-allelic mutant plants were produced in the T0 generation. The approach presented here could be adapted to optimize the construction of Cas9/gRNA cassettes for genome editing in a variety of plants.
NASA Astrophysics Data System (ADS)
Gaydecki, Patrick; Fernandes, Bosco
2003-11-01
A fast digital signal processing (DSP) system is described that can perform real-time emulation of a wide variety of linear audio-bandwidth systems and networks, such as reverberant spaces, musical instrument bodies and very high order filter networks. The hardware design is based upon a Motorola DSP56309 operating at 110 million multiplication-accumulations per second and a dual-channel 24 bit codec with a maximum sampling frequency of 192 kHz. High level software has been developed to express complex vector frequency responses as both infinite impulse response (IIR) and finite impulse response (FIR) coefficients, in a form suitable for real-time convolution by the firmware installed in the DSP system memory. An algorithm has also been devised to express IIR filters as equivalent FIR structures, thereby obviating the potential instabilities associated with recursive equations and negating the traditional deficiencies of FIR filters respecting equivalent analogue designs. The speed and dynamic range of the system is such that, when sampling at 48 kHz, the frequency response can be specified to a spectral precision of 22 Hz when sampling at 10 kHz, this resolution increases to 0.9 Hz. Moreover, it is also possible to control the phase of any frequency band with a theoretical precision of 10-5 degrees in all cases. The system has been applied in the study of analogue filter networks, real-time Hilbert transformation, phase-shift systems and musical instrument body emulation, where it is providing valuable new insights into the understanding of psychoacoustic mechanisms.
HP1α is highly expressed in glioma cells and facilitates cell proliferation and survival.
Lai, Xianliang; Deng, Zhifeng; Guo, Hua; Zhu, Xingen; Tu, Wei
2017-08-19
Epigenetic alteration plays critical roles in gliomagenesis by regulating gene expression through modifications of Histones and DNA. Trimethylation of H3K9, an essential repressed transcription mark, and one of its methyltransferase, SUV39H1, are implicated in glioma pathogenesis and progression. We find that the protein level of HP1α, a reader of H3K9me3 is elevated in cultured glioma cell lines and glioma tissues. H3K9me3 is also upregulated. Depletion of HP1α and SUV39H1 weakens glioma cell proliferation capacity and results in apoptosis of cells. Furthermore, we find that HP1α and H3K9me3 are enriched in the FAS and PUMA promoters, which suggests that upregulated HP1α and H3K9me3 contribute to cell survival by suppressing apoptotic activators. These data suggests that up-regulated HP1α and H3K9me3 in glioma cells are functionally associated with glioma pathogenesis and progression and may serve as novel biomarkers for diagnostic and therapeutic targeting of brain tumors. Copyright © 2017 Elsevier Inc. All rights reserved.
Bragança, Caio Roberto Soares; Colombo, Lívia Tavares; Roberti, Alvaro Soares; Alvim, Mariana Caroline Tocantins; Cardoso, Silvia Almeida; Reis, Kledna Constancio Portes; de Paula, Sérgio Oliveira; da Silveira, Wendel Batista; Passos, Flavia Maria Lopes
2015-02-01
The yeast Kluyveromyces marxianus is a convenient host for industrial synthesis of biomolecules. However, despite its potential, there are few studies reporting the expression of heterologous proteins using this yeast. Here, we report expression of a dengue virus protein in K. marxianus for the first time. The dengue virus type 1 nonstructural protein 1 (NS1) was integrated into the K. marxianus UFV-3 genome at the LAC4 locus using an adapted integrative vector designed for high-level expression of recombinant protein in Kluyveromyces lactis. The NS1 gene sequence was codon-optimized to increase the level of protein expression in yeast. The synthetic gene was cloned in frame with K. lactis α-mating factor signal peptide, and the recombinant plasmid obtained was used to transform K. marxianus UFV-3 by electroporation. The transformed cells, selected in yeast extract peptone dextrose containing 200 μg mL(-1) Geneticin, were mitotically stable. Analysis of recombinant strains by RT-PCR and protein detection using blot analysis confirmed both transcription and expression of extracellular NS1 polypeptide. After induction with galactose, the NS1 protein was analyzed by sodium dodecyl sulfate-PAGE and immunogenic detection. Protein production was investigated under two conditions: with galactose and biotin pulses at 24-h intervals during 96 h of induction and without galactose and biotin supplementation. Protease activity was not detected in post-growth medium. Our results indicate that recombinant K. marxianus is a good host for the production of dengue virus NS1 protein, which has potential for diagnostic applications.
ABORDO-ADESIDA, EVELYN; FOLLENZI, ANTONIA; BARCIA, CARLOS; SCIASCIA, SANDRA; CASTRO, MARIA G.; NALDINI, LUIGI; LOWENSTEIN, PEDRO R.
2009-01-01
Lentiviral vectors are promising tools for gene therapy in the CNS. It is therefore important to characterize their interactions with the immune system in the CNS. This work characterizes transgene expression and brain inflammation in the presence or absence of immune responses generated after systemic immunization with lentiviral vectors. We characterized transduction with SIN-LV vectors in the CNS. A dose—response curve using SIN-LV-GFP demonstrated detectable transgene expression in the striatum at a dose of 102, and maximum expression at 106, transducing units of lentiviral vector, with minimal increase in inflammatory markers between the lowest and highest dose of vector injected. Our studies demonstrate that injection of a lentiviral vector into the CNS did not cause a measurable inflammatory response. Systemic immunization after CNS injection, with the lentiviral vector expressing the same transgene as a vector injected into the CNS, caused a decrease in transgene expression in the CNS, concomitantly with an infiltration of inflammatory cells into the CNS parenchyma at the injection site. However, peripheral immunization with a lentiviral vector carrying a different transgene did not diminish transgene expression, or cause CNS inflammation. Systemic immunization preceding injection of lentiviral vectors into the CNS determined that preexisting antilentiviral immunity, regardless of the transgene, did not affect transgene expression. Furthermore, we showed that the transgene, but not the virion or vector components, is responsible for providing antigenic epitopes to the activated immune system, on systemic immunization with lentivirus. Low immunogenicity and prolonged transgene expression in the presence of preexisting lentiviral immunity are encouraging data for the future use of lentiviral vectors in CNS gene therapy. In summary, the lentiviral vectors tested induced undetectable activation of innate immune responses, and stimulation of adaptive immune responses against lentiviral vectors was effective in causing a decrease in transgene expression only if the immune response was directed against the transgene. A systemic immune response against vector components alone did not cause brain inflammation, possibly because vector-derived epitopes were not being presented in the CNS. PMID:15960605
Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun; Shin, Ho-Joon
2013-07-01
Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection.
Kim, Jong-Hyun; Sohn, Hae-Jin; Lee, Jinyoung; Yang, Hee-Jong; Chwae, Yong-Joon; Kim, Kyongmin; Park, Sun
2013-01-01
Naegleria fowleri, a pathogenic free-living amoeba, causes fatal primary amoebic meningoencephalitis (PAM) in humans and animals. The nfa1 gene (360 bp), cloned from a cDNA library of N. fowleri, produces a 13.1-kDa recombinant protein which is located on pseudopodia, particularly the food cup structure. The nfa1 gene plays an important role in the pathogenesis of N. fowleri infection. To examine the effect of nfa1 DNA vaccination against N. fowleri infection, we constructed a lentiviral vector (pCDH) expressing the nfa1 gene. For the in vivo mouse study, BALB/c mice were intranasally vaccinated with viral particles of a viral vector expressing the nfa1 gene. To evaluate the effect of vaccination and immune responses of mice, we analyzed the IgG levels (IgG, IgG1, and IgG2a), cytokine induction (interleukin-4 [IL-4] and gamma interferon [IFN-γ]), and survival rates of mice that developed PAM. The levels of both IgG and IgG subclasses (IgG1 and IgG2a) in vaccinated mice were significantly increased. The cytokine analysis showed that vaccinated mice exhibited greater IL-4 and IFN-γ production than the other control groups, suggesting a Th1/Th2 mixed-type immune response. In vaccinated mice, high levels of Nfa1-specific IgG antibodies continued until 12 weeks postvaccination. The mice vaccinated with viral vector expressing the nfa1 gene also exhibited significantly higher survival rates (90%) after challenge with N. fowleri trophozoites. Finally, the nfa1 vaccination effectively induced protective immunity by humoral and cellular immune responses in N. fowleri-infected mice. These results suggest that DNA vaccination using a viral vector may be a potential tool against N. fowleri infection. PMID:23677321
Zuo, Qisheng; Jin, Kai; Wang, Yingjie; Song, Jiuzhou; Zhang, Yani; Li, Bichun
2017-08-01
We previously found that C1EIS is preferentially expressed in Chicken spermatogonial stem cells (SSCs) by RNA sequencing (RNA-seq), so our current study focused on C1EIS's role in Chicken embryonic stem cells (ESCs) differentiation into male germ cells. We constructed a CRISPR/Cas9 vector targeting C1EIS. T7 endonuclease I (T7EI) digestion method and sequencing of TA cloning were used to detect the knock-out efficiency of the Single guide RNA (sgRNA) after the cas9/gRNA vector transfected into D fibroblasts 1(DF-1), ESCs, and Chicken embryos. The results showed that CRISPR/Cas9 gene knockout efficiency is about 40%. Differentiation of the targeted ESCs into SSCs was inhibited at the embryoid body stage due to C1EIS deficiency. Immunofluorescent staining revealed that the mutagenized ESCs (RA (Retinoic Acid) with C1EIS Knock out) expressed lower levels of integrin α6 and integrin β1 compared to wild type cells. Quantitative real-time PCR (QRT-PCR) revealed Oct4 and Sox2 expression significantly increased, contrarily integrin β1 and Stra8 expression significantly decreased than RA induced group and RA with C1EIS Overexpression. During retinoic acid-induced differentiation, knockout of C1EIS in ESCs inhibited formation of SSC-like cells, suggesting C1EIS plays a vital role in promoting differentiation of avian ESCs to SSCs by regulating expression of multiple pluripotency-related genes. J. Cell. Biochem. 118: 2380-2386, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Increased expression of CYP4Z1 promotes tumor angiogenesis and growth in human breast cancer
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu, Wei; Chai, Hongyan; Li, Ying
2012-10-01
Cytochrome P450 (CYP) 4Z1, a novel CYP4 family member, is over-expressed in human mammary carcinoma and associated with high-grade tumors and poor prognosis. However, the precise role of CYP4Z1 in tumor progression is unknown. Here, we demonstrate that CYP4Z1 overexpression promotes tumor angiogenesis and growth in breast cancer. Stable expression of CYP4Z1 in T47D and BT-474 human breast cancer cells significantly increased mRNA expression and production of vascular endothelial growth factor (VEGF)-A, and decreased mRNA levels and secretion of tissue inhibitor of metalloproteinase-2 (TIMP-2), without affecting cell proliferation and anchorage-independent cell growth in vitro. Notably, the conditioned medium from CYP4Z1-expressingmore » cells enhanced proliferation, migration and tube formation of human umbilical vein endothelial cells, and promoted angiogenesis in the zebrafish embryo and chorioallantoic membrane of the chick embryo. In addition, there were lower levels of myristic acid and lauric acid, and higher contents of 20-hydroxyeicosatetraenoic acid (20-HETE) in CYP4Z1-expressing T47D cells compared with vector control. CYP4Z1 overexpression significantly increased tumor weight and microvessel density by 2.6-fold and 1.9-fold in human tumor xenograft models, respectively. Moreover, CYP4Z1 transfection increased the phosphorylation of ERK1/2 and PI3K/Akt, while PI3K or ERK inhibitors and siRNA silencing reversed CYP4Z1-mediated changes in VEGF-A and TIMP-2 expression. Conversely, HET0016, an inhibitor of the CYP4 family, potently inhibited the tumor-induced angiogenesis with associated changes in the intracellular levels of myristic acid, lauric acid and 20-HETE. Collectively, these data suggest that increased CYP4Z1 expression promotes tumor angiogenesis and growth in breast cancer partly via PI3K/Akt and ERK1/2 activation. -- Highlights: ► CYP4Z1 overexpression promotes human breast cancer growth and angiogenesis. ► The pro-angiogenic effects of CYP4Z1 have been studied in vitro and in vivo. ► CYP4Z1 regulates expression and production of VEGF-A and TIMP-2. ► CYP4Z1-induced angiogenesis is associated with PI3K and ERK1/2 activation. ► CYP4Z1 may be an attractive target for anti-cancer therapy.« less
Jayasooriya, Rajapaksha Gedara Prasad Tharanga; Dilshara, Matharage Gayani; Park, Sang Rul; Choi, Yung Hyun; Hyun, Jin-Won; Chang, Weon-Young; Kim, Gi-Young
2014-08-01
Little is known about the molecular mechanism through which 18β-glycyrrhetinic acid (GA) inhibits metastasis and invasion of cancer cells. Therefore, this study aimed to investigate the effects of GA on the expression of matrix metalloproteinase-9 (MMP-9) and vascular endothelial growth factor (VEGF) in various types of cancer cells. We found that treatment with GA reduces tumor necrosis factor-α (TNF-α)-induced Matrigel invasion with few cytotoxic effects. Our findings also showed that MMP-9 and VEGF expression increases in response to TNF-α; however, GA reverses their expression. In addition, GA inhibited inhibitory factor kappa B degradation, sustained nuclear factor-kappa B (NF-κB) subunits, p65 and p50, in the cytosol compartments, and consequently suppressed the TNF-α-induced DNA-binding activity and luciferase activity of NF-κB. Specific NF-κB inhibitors, pyrrolidine dithiocarbamate, MG132, and PS-1145, also attenuated TNF-α-mediated MMP-9 and VEGF expression as well as activity by suppressing their regulatory genes. Furthermore, phosphorylation of TNF-α-induced phosphatidyl-inositol 3 kinase (PI3K)/Akt was significantly downregulated in the presence of GA accompanying with the inhibition of NF-κB activity, and as presumed, the specific PI3K/Akt inhibitor LY294002 significantly decreased MMP-9 and VEGF expression as well as activity. These results suggest that GA operates as a potential anti-invasive agent by downregulating MMP-9 and VEGF via inhibition of PI3K/Akt-dependent NF-κB activity. Taken together, GA might be an effective anti-invasive agent by suppressing PI3K/Akt-mediated NF-κB activity. Copyright © 2014 Elsevier Ltd. All rights reserved.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-01-31
... Vector Engine Corp. (n/k/a Avec Corporation), and Exploration Drilling International, Inc.; Order of... securities of Axial Vector Engine Corp. (n/k/a Avec Corporation) because it has not filed any periodic...(k) of the Securities Exchange Act of 1934, that trading in the securities of the above-listed...
Yamashita, Satoshi; Tsujino, Yoshimi; Moriguchi, Kazuki; Tatematsu, Masae; Ushijima, Toshikazu
2006-01-01
To identify novel methylation-silenced genes in gastric cancers, we carried out a chemical genomic screening, a genome-wide search for genes upregulated by treatment with a demethylating agent, 5-aza-2'-deoxycytidine (5-aza-dC). After 5-aza-dC treatment of a gastric cancer cell line (AGS) 579 genes were upregulated 16-fold or more, using an oligonucleotide microarray with 39,000 genes. From these genes, we selected 44 known genes on autosomes whose silencing in gastric cancer has not been reported. Thirty-two of these had CpG islands (CGI) in their putative promoter regions, and all of the CGI were methylated in AGS, giving an estimated number of 421+/-75 (95% confidence interval) methylation-silenced genes. Additionally, we analyzed the methylation status of 16 potential tumor-related genes with promoter CGI that were upregulated four-fold or more, and 14 of these were methylated in AGS. Methylation status of the 32 randomly selected and 16 potential tumor-related genes was analyzed in 10 primary gastric cancers, and 42 genes (ABHD9, ADFP, ALDH1A3, ANXA5, AREG, BDNF, BMP7, CAV1, CDH2, CLDN3, CTSL, EEF1A2, F2R, FADS1, FSD1, FST, FYN, GPR54, GREM1, IGFBP3, IGFBP7, IRS2, KISS1, MARK1, MLF1, MSX1, MTSS1, NT5E, PAX6, PLAGL1, PLAU, PPIC, RBP4, RORA, SCRN1, TBX3, TFAP2C, TNFSF9, ULBP2, WIF1, ZNF177 and ZNF559) were methylated in at least one primary gastric cancer. A metastasis suppressor gene, MTSS1, was located in a genomic region with frequent loss of heterozygosity (8q22), and was expressed abundantly in the normal gastric mucosa, suggesting its role in gastric carcinogenesis. (Cancer Sci 2006; 97: 64 -71). (Cancer Sci 2006; 97: 64 -71).
Keresztessy, Z; Brown, K; Dunn, M A; Hughes, M A
2001-01-01
The coding sequence of the mature cyanogenic beta-glucosidase (beta-glucoside glucohydrolase, EC 3.2.1.21; linamarase) was cloned into the vector pYX243 modified to contain the SUC2 yeast secretion signal sequence and expressed in Saccharomyces cerevisiae. The recombinant enzyme is active, glycosylated and showed similar stability to the plant protein. Michaelis constants for hydrolysis of the natural substrate, linamarin (K(m)=1.06 mM) and the synthetic p-nitrophenyl beta-D-glucopyranoside (PNP-Glc; K(m)=0.36 mM), as well as apparent pK(a) values of the free enzyme and the enzyme-substrate complexes (pK(E)(1)=4.4-4.8, pK(E)(2)=6.7-7.2, pK(ES)(1)=3.9-4.4, pK(ES)(2)=8.3) were very similar to those of the plant enzyme. Site-directed mutagenesis was carried out to study the function of active-site residues based on a homology model generated for the enzyme using the MODELLER program. Changing Glu-413 to Gly destroyed enzyme activity, consistent with it being the catalytic nucleophile. The Gln-339Glu mutation also abolished activity, confirming a function in positioning the catalytic diad. The Ala-201Val mutation shifted the pK(a) of the acid/base catalyst Glu-198 from 7.22 to 7.44, reflecting a change in its hydrophobic environment. A Phe-269Asn change increased K(m) for linamarin hydrolysis 16-fold (16.1 mM) and that for PNP-Glc only 2.5-fold (0.84 mM), demonstrating that Phe-269 contributes to the cyanogenic specificity of the cassava beta-glucosidase. PMID:11139381
Morral, Núria; O’Neal, Wanda; Rice, Karen; Leland, Michele; Kaplan, Johanne; Piedra, Pedro A.; Zhou, Heshan; Parks, Robin J.; Velji, Rizwan; Aguilar-Córdova, Estuardo; Wadsworth, Samuel; Graham, Frank L.; Kochanek, Stefan; Carey, K. Dee; Beaudet, Arthur L.
1999-01-01
The efficiency of first-generation adenoviral vectors as gene delivery tools is often limited by the short duration of transgene expression, which can be related to immune responses and to toxic effects of viral proteins. In addition, readministration is usually ineffective unless the animals are immunocompromised or a different adenovirus serotype is used. Recently, adenoviral vectors devoid of all viral coding sequences (helper-dependent or gutless vectors) have been developed to avoid expression of viral proteins. In mice, liver-directed gene transfer with AdSTK109, a helper-dependent adenoviral (Ad) vector containing the human α1-antitrypsin (hAAT) gene, resulted in sustained expression for longer than 10 months with negligible toxicity to the liver. In the present report, we have examined the duration of expression of AdSTK109 in the liver of baboons and compared it to first-generation vectors expressing hAAT. Transgene expression was limited to approximately 3–5 months with the first-generation vectors. In contrast, administration of AdSTK109 resulted in transgene expression for longer than a year in two of three baboons. We have also investigated the feasibility of circumventing the humoral response to the virus by sequential administration of vectors of different serotypes. We found that the ineffectiveness of readministration due to the humoral response to an Ad5 first-generation vector was overcome by use of an Ad2-based vector expressing hAAT. These data suggest that long-term expression of transgenes should be possible by combining the reduced immunogenicity and toxicity of helper-dependent vectors with sequential delivery of vectors of different serotypes. PMID:10536005
Wess-Zumino current and the structure of the decay tau- -->K- pi- K+ nu tau.
Coan, T E; Gao, Y S; Liu, F; Stroynowski, R; Artuso, M; Boulahouache, C; Blusk, S; Butt, J; Dambasuren, E; Dorjkhaidav, O; Haynes, J; Menaa, N; Mountain, R; Muramatsu, H; Nandakumar, R; Redjimi, R; Sia, R; Skwarnicki, T; Stone, S; Wang, J C; Zhang, Kevin; Mahmood, A H; Csorna, S E; Bonvicini, G; Cinabro, D; Dubrovin, M; Bornheim, A; Lipeles, E; Pappas, S P; Shapiro, A; Weinstein, A J; Briere, R A; Chen, G P; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Adam, N E; Alexander, J P; Berkelman, K; Boisvert, V; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Galik, R S; Gibbons, L; Gittelman, B; Gray, S W; Hartill, D L; Heltsley, B K; Hsu, L; Jones, C D; Kandaswamy, J; Kreinick, D L; Kuznetsov, V E; Magerkurth, A; Mahlke-Krüger, H; Meyer, T O; Patterson, J R; Pedlar, T K; Peterson, D; Pivarski, J; Riley, D; Sadoff, A J; Schwarthoff, H; Shepherd, M R; Sun, W M; Thayer, J G; Urner, D; Wilksen, T; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Potlia, V; Stoeck, H; Yelton, J; Eisenstein, B I; Gollin, G D; Karliner, I; Lowrey, N; Naik, P; Sedlack, C; Selen, M; Thaler, J J; Williams, J; Edwards, K W; Besson, D; Gao, K Y; Gong, D T; Kubota, Y; Li, S Z; Poling, R; Scott, A W; Smith, A; Stepaniak, C J; Urheim, J; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Arms, K; Eckhart, E; Gan, K K; Gwon, C; Severini, H; Skubic, P; Asner, D M; Dytman, S A; Mehrabyan, S; Mueller, J A; Nam, S; Savinov, V; Huang, G S; Miller, D H; Pavlunin, V; Sanghi, B; Shibata, E I; Shipsey, I P J; Adams, G S; Chasse, M; Cummings, J P; Danko, I; Napolitano, J; Cronin-Hennessy, D; Park, C S; Park, W; Thayer, J B; Thorndike, E H
2004-06-11
We present the first study of the vector (Wess-Zumino) current in tau(-)-->K-pi-K+nu(tau) decay using data collected with the CLEO III detector at the Cornell Electron Storage Ring. We determine the quantitative contributions to the decay width from the vector and axial vector currents. Within the framework of a model by Kühn and Mirkes, we identify the quantitative contributions to the total decay rate from the intermediate states omegapi, rho(')pi, and K*K.
Scientific Presentations on Superconductivity from 2002-2005
2006-01-01
00 Dark-field reflection, using 211 diffraction vector Bright-field transmission (2111.6nm/1236.6nm)x35, ~ 80 sec interval • 211 Density ~ 3x1011...1.8.1 2b.1.9 High Resolution SEM Figure 2b.1.9.1 Y211/YBCO film on LAO (PV43D) At 77K and at 3T magnetic feild 0 0.2 0.4 0.6 0.8 1 1.2
NASA Astrophysics Data System (ADS)
Rodríguez, Yeinzon; Beltrán Almeida, Juan P.; Valenzuela-Toledo, César A.
2013-04-01
We present the different consistency relations that can be seen as variations of the well known Suyama-Yamaguchi (SY) consistency relation τNL>=((6/5)fNL)2, the latter involving the levels of non-gaussianity fNL and τNL in the primordial curvature perturbation ζ. It has been (implicitly) claimed that the following variation: τNL(k1,k3)>=((6/5))2fNL(k1)fNL(k3), which we call ``the fourth variety'', in the collapsed (for τNL) and squeezed (for fNL) limits is always satisfied independently of any physics; however, the proof depends sensitively on the assumption of scale-invariance (expressing this way the fourth variety of the SY consistency relation as τNL>=((6/5)fNL)2) which only applies for cosmological models involving Lorentz-invariant scalar fields (at least at tree level), leaving room for a strong violation of this variety of the consistency relation when non-trivial degrees of freedom, for instance vector fields, are in charge of the generation of the primordial curvature perturbation. With this in mind as a motivation, we explicitly state, in the first part of this work, under which conditions the SY consistency relation has been claimed to hold in its different varieties (implicitly) presented in the literature since its inception back in 2008; as a result, we show for the first time that the variety τNL(k1,k1)>=((6/5)fNL(k1))2, which we call ``the fifth variety'', is always satisfied even when there is strong scale-dependence and high levels of statistical anisotropy as long as statistical homogeneity holds: thus, an observed violation of this specific variety would prevent the comparison between theory and observation, shaking this way the foundations of cosmology as a science. In the second part, we concern about the existence of non-trivial degrees of freedom, concretely vector fields for which the levels of non-gaussianity have been calculated for very few models; among them, and by making use of the δN formalism at tree level, we study a class of models that includes the vector curvaton scenario, vector inflation, and the hybrid inflation with coupled vector and scalar ``waterfall field'' where ζ is generated at the end of inflation, finding that the fourth variety of the SY consistency relation is indeed strongly violated for some specific wavevector configurations while the fifth variety continues to be well satisfied. Finally, as a byproduct of our investigation, we draw attention to a quite recently demonstrated variety of the SY consistency relation: τisoNL>=((6/5)fisoNL)2, in scenarios where scalar and vector fields contribute to the generation of the primordial curvature perturbation; this variety of the SY consistency relation is satisfied although the isotropic pieces of the non-gaussianity parameters receive contributions from the vector fields. We discuss further implications for observational cosmology.
Muthusamy, R; Shivakumar, M S
2015-01-01
Mosquitoes serve as vector for transmitting diseases. Among mosquitoes, Culex quinquefasciatus transmits lymphatic filariasis, yellow fever Japanese encephalitis etc. Application of chemical insecticides is still the best option for vector control programmes. Continuous use of these chemicals on mosquito reduces its effects. The present study determined the baseline susceptibility of Cx. quinquefasciatus in response to λ-cyhalothrin and temephos treatments. In addition, the biochemical mechanisms and zymogram analysis involved in insecticide detoxification among larval mosquitoes were studied. The larval bioassay indicated high LC50 value for λ-cyhalothrin (0.1484ppm) as compared to temephos (0.01092ppm). While AChE assay showed increased activity in temephos treatments, glutathione reductase (GR) and esterase levels were increased at both the treatments. Esterase quantitative analysis revealed the expression of three bands at 43kDa, 67kDa and 245kDa. The findings suggest that insensitivity of AChE, esterase and high GR activity may play an important role in developing resistance to synthetic pyrethroid and organophosphate insecticides in Cx. quinquefasciatus population.
Finotti, Alessia; Gasparello, Jessica; Breveglieri, Giulia; Cosenza, Lucia Carmela; Montagner, Giulia; Bresciani, Alberto; Altamura, Sergio; Bianchi, Nicoletta; Martini, Elisa; Gallerani, Eleonora; Borgatti, Monica; Gambari, Roberto
2015-12-01
Induction of fetal hemoglobin (HbF) is considered a promising strategy in the treatment of β-thalassemia, in which production of adult hemoglobin (HbA) is impaired by mutations affecting the β-globin gene. Recent results indicate that B-cell lymphoma/leukemia 11A (BCL11A) is a major repressor of γ-globin gene expression. Therefore, disrupting the binding of the BCL11A transcriptional repressor complex to the γ-globin gene promoter provides a novel approach for inducing expression of the γ-globin genes. To develop a cellular screening system for the identification of BCL11A inhibitors, we produced K562 cell clones with integrated copies of a BCL11A-XL expressing vector. We characterized 12 K562 clones expressing different levels of BCL11A-XL and found that a clear inverse relationship does exist between the levels of BCL11A-XL and the extent of hemoglobinization induced by a panel of HbF inducers. Using mithramycin as an inducer, we found that this molecule was the only HbF inducer efficient in rescuing the ability to differentiate along the erythroid program, even in K562 cell clones expressing high levels of BCL11A-XL, suggesting that BCL11A-XL activity is counteracted by mithramycin. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.
Mathison, Megumi; Singh, Vivek P; Gersch, Robert P; Ramirez, Maricela O; Cooney, Austin; Kaminsky, Stephen M; Chiuchiolo, Maria J; Nasser, Ahmed; Yang, Jianchang; Crystal, Ronald G; Rosengart, Todd K
2014-10-01
The in situ reprogramming of cardiac fibroblasts into induced cardiomyocytes by the administration of gene transfer vectors encoding Gata4 (G), Mef2c (M), and Tbx5 (T) has been shown to improve ventricular function in myocardial infarction models. The efficacy of this strategy could, however, be limited by the need for fibroblast targets to be infected 3 times--once by each of the 3 transgene vectors. We hypothesized that a polycistronic "triplet" vector encoding all 3 transgenes would enhance postinfarct ventricular function compared with use of "singlet" vectors. After validation of the polycistronic vector expression in vitro, adult male Fischer 344 rats (n=6) underwent coronary ligation with or without intramyocardial administration of an adenovirus encoding all 3 major vascular endothelial growth factor (VEGF) isoforms (AdVEGF-All6A positive), followed 3 weeks later by the administration to AdVEGF-All6A-positive treated rats of singlet lentivirus encoding G, M, or T (1×10(5) transducing units each) or the same total dose of a GMT "triplet" lentivirus vector. Western blots demonstrated that triplet and singlet vectors yielded equivalent GMT transgene expression, and fluorescence activated cell sorting demonstrated that triplet vectors were nearly twice as potent as singlet vectors in generating induced cardiomyocytes from cardiac fibroblasts. Echocardiography demonstrated that GMT triplet vectors were more effective than the 3 combined singlet vectors in enhancing ventricular function from postinfarct baselines (triplet, 37%±10%; singlet, 13%±7%; negative control, 9%±5%; P<.05). These data have confirmed that the in situ administration of G, M, and T induces postinfarct ventricular functional improvement and that GMT polycistronic vectors enhance the efficacy of this strategy. Copyright © 2014 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.
Neutron diffraction study of antiferromagnetic ErNi3Ga9 in magnetic fields
NASA Astrophysics Data System (ADS)
Ninomiya, Hiroki; Sato, Takaaki; Matsumoto, Yuji; Moyoshi, Taketo; Nakao, Akiko; Ohishi, Kazuki; Kousaka, Yusuke; Akimitsu, Jun; Inoue, Katsuya; Ohara, Shigeo
2018-05-01
We report specific heat, magnetization, magnetoresistance, and neutron diffraction measurements of single crystals of ErNi3Ga9. This compound crystalizes in a chiral structure with space group R 32 . The erbium ions form a two-dimensional honeycomb structure. ErNi3Ga9 displays antiferromagnetic order below 6.4 K. We determined that the magnetic structure is slightly amplitude-modulated as well as antiferromagnetic with q = (0 , 0 , 0.5) . The magnetic properties are described by an Ising-like model in which the magnetic moment is always along the c-axis owing to the large uniaxial anisotropy caused by the crystalline electric field effect in the low temperature region. When the magnetic field is applied along the c-axis, a metamagnetic transition is observed around 12 kOe at 2 K. ErNi3Ga9 possesses crystal chirality, but the antisymmetric magnetic interaction, the so-called Dzyaloshinskii-Moriya (DM) interaction, does not contribute to the magnetic structure, because the magnetic moments are parallel to the DM-vector.
Ibrahim, Sulaiman S; Riveron, Jacob M; Bibby, Jaclyn; Irving, Helen; Yunta, Cristina; Paine, Mark J I; Wondji, Charles S
2015-10-01
Scale up of Long Lasting Insecticide Nets (LLINs) has massively contributed to reduce malaria mortality across Africa. However, resistance to pyrethroid insecticides in malaria vectors threatens its continued effectiveness. Deciphering the detailed molecular basis of such resistance and designing diagnostic tools is critical to implement suitable resistance management strategies. Here, we demonstrated that allelic variation in two cytochrome P450 genes is the most important driver of pyrethroid resistance in the major African malaria vector Anopheles funestus and detected key mutations controlling this resistance. An Africa-wide polymorphism analysis of the duplicated genes CYP6P9a and CYP6P9b revealed that both genes are directionally selected with alleles segregating according to resistance phenotypes. Modelling and docking simulations predicted that resistant alleles were better metabolizers of pyrethroids than susceptible alleles. Metabolism assays performed with recombinant enzymes of various alleles confirmed that alleles from resistant mosquitoes had significantly higher activities toward pyrethroids. Additionally, transgenic expression in Drosophila showed that flies expressing resistant alleles of both genes were significantly more resistant to pyrethroids compared with those expressing the susceptible alleles, indicating that allelic variation is the key resistance mechanism. Furthermore, site-directed mutagenesis and functional analyses demonstrated that three amino acid changes (Val109Ile, Asp335Glu and Asn384Ser) from the resistant allele of CYP6P9b were key pyrethroid resistance mutations inducing high metabolic efficiency. The detection of these first DNA markers of metabolic resistance to pyrethroids allows the design of DNA-based diagnostic tools to detect and track resistance associated with bednets scale up, which will improve the design of evidence-based resistance management strategies.
Ibrahim, Sulaiman S.; Riveron, Jacob M.; Bibby, Jaclyn; Irving, Helen; Yunta, Cristina; Paine, Mark J. I.; Wondji, Charles S.
2015-01-01
Scale up of Long Lasting Insecticide Nets (LLINs) has massively contributed to reduce malaria mortality across Africa. However, resistance to pyrethroid insecticides in malaria vectors threatens its continued effectiveness. Deciphering the detailed molecular basis of such resistance and designing diagnostic tools is critical to implement suitable resistance management strategies. Here, we demonstrated that allelic variation in two cytochrome P450 genes is the most important driver of pyrethroid resistance in the major African malaria vector Anopheles funestus and detected key mutations controlling this resistance. An Africa-wide polymorphism analysis of the duplicated genes CYP6P9a and CYP6P9b revealed that both genes are directionally selected with alleles segregating according to resistance phenotypes. Modelling and docking simulations predicted that resistant alleles were better metabolizers of pyrethroids than susceptible alleles. Metabolism assays performed with recombinant enzymes of various alleles confirmed that alleles from resistant mosquitoes had significantly higher activities toward pyrethroids. Additionally, transgenic expression in Drosophila showed that flies expressing resistant alleles of both genes were significantly more resistant to pyrethroids compared with those expressing the susceptible alleles, indicating that allelic variation is the key resistance mechanism. Furthermore, site-directed mutagenesis and functional analyses demonstrated that three amino acid changes (Val109Ile, Asp335Glu and Asn384Ser) from the resistant allele of CYP6P9b were key pyrethroid resistance mutations inducing high metabolic efficiency. The detection of these first DNA markers of metabolic resistance to pyrethroids allows the design of DNA-based diagnostic tools to detect and track resistance associated with bednets scale up, which will improve the design of evidence-based resistance management strategies. PMID:26517127
Transduction of rat pancreatic islets with pseudotyped adeno-associated virus vectors
Craig, Anthony T; Gavrilova, Oksana; Dwyer, Nancy K; Jou, William; Pack, Stephanie; Liu, Eric; Pechhold, Klaus; Schmidt, Michael; McAlister, Victor J; Chiorini, John A; Blanchette-Mackie, E Joan; Harlan, David M; Owens, Roland A
2009-01-01
Background Pancreatic islet transplantation is a promising treatment for type I diabetes mellitus, but current immunosuppressive strategies do not consistently provide long-term survival of transplanted islets. We are therefore investigating the use of adeno-associated viruses (AAVs) as gene therapy vectors to transduce rat islets with immunosuppressive genes prior to transplantation into diabetic mice. Results We compared the transduction efficiency of AAV2 vectors with an AAV2 capsid (AAV2/2) to AAV2 vectors pseudotyped with AAV5 (AAV2/5), AAV8 (AAV2/8) or bovine adeno-associated virus (BAAV) capsids, or an AAV2 capsid with an insertion of the low density lipoprotein receptor ligand from apolipoprotein E (AAV2apoE), on cultured islets, in the presence of helper adenovirus infection to speed expression of a GFP transgene. Confocal microscopy and flow cytometry were used. The AAV2/5 vector was superior to AAV2/2 and AAV2/8 in rat islets. Flow cytometry indicated AAV2/5-mediated gene expression in approximately 9% of rat islet cells and almost 12% of insulin-positive cells. The AAV2/8 vector had a higher dependence on the helper virus multiplicity of infection than the AAV 2/5 vector. In addition, the BAAV and AAV2apoE vectors were superior to AAV2/2 for transducing rat islets. Rat islets (300 per mouse) transduced with an AAV2/5 vector harboring the immunosuppressive transgene, tgfβ1, retain the ability to correct hyperglycemia when transplanted into immune-deficient diabetic mice. Conclusion AAV2/5 vectors may therefore be useful for pre-treating donor islets prior to transplantation. PMID:19450275
The histone deacetylase SIRT6 suppresses the expression of the RNA-binding protein PCBP2 in glioma
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Xin; Hao, Bin; Liu, Ying
Highlights: • PCBP2 expression is over-expressed in human glioma tissues and cell lines. • SIRT6 is decreased in glioma and correlated with PCBP2. • SIRT6 inhibits PCBP2 expression by deacetylating H3K9. • SIRT6 inhibits glioma growth in vitro and in vivo. - Abstract: More than 80% of tumors that occur in the brain are malignant gliomas. The prognosis of glioma patients is still poor, which makes glioma an urgent subject of cancer research. Previous evidence and our present data show that PCBP2 is over-expressed in human glioma tissues and predicts poor outcome. However, the mechanism by which PCBP2 is regulatedmore » in glioma remains elusive. We find that SIRT6, one of the NAD{sup +}-dependent class III deacetylase SIRTUINs, is down-regulated in human glioma tissues and that the level of SIRT6 is negatively correlated with PCBP2 level while H3K9ac enrichment on the promoter of PCBP2 is positively correlated with PCBP2 expression. Furthermore, we identify PCBP2 as a target of SIRT6. We demonstrate that PCBP2 expression is inhibited by SIRT6, which depends upon deacetylating H3K9ac. Finally, our results reveal that SIRT6 inhibits glioma cell proliferation and colony formation in vitro and glioma cell growth in vivo in a PCBP2 dependent manner. In summary, our findings implicate that SIRT6 inhibits PCBP2 expression through deacetylating H3K9ac and SIRT6 acts as a tumor suppressor in human glioma.« less
EMP-1 promotes tumorigenesis of NSCLC through PI3K/AKT pathway.
Lai, Senyan; Wang, Guihua; Cao, Xiaonian; Li, Zhaoming; Hu, Junbo; Wang, Jing
2012-12-01
This study examined the role of EMP-1 in tumorigenesis of non-small cell lung carcinoma (NSCLC) and the possible mechanism. Specimens were collected from 28 patients with benign lung diseases and 28 with NSCLC, and immunohistochemically detected to evaluate the correlation of EMP-1 expression to the clinical features of NSCLC. Recombinant adenovirus was constructed to over-express EMP-1 and then infect PC9 cells. Cell proliferation was measured by Ki67 staining. Western blotting was performed to examine the effect of EMP-1 on the PI3K/AKT signaling. Moreover, tumor xenografts were established by subcutaneous injection of PC9 cell suspension (about 5×10(7)/mL in 100 μL of PBS) into the right hind limbs of athymic nude mice. The results showed EMP-1 was significantly up-regulated in NSCLC patients as compared with those with benign lung diseases. Over-expression of EMP-1 promoted proliferation of PC9 cells, which coincided with the activation of the PI3K/AKT pathway. EMP-1 promoted the growth of xenografts of PC9 cells in athymic nude mice. It was concluded that EMP-1 expression may contribute to the development and progress of NSCLC by activating PI3K/AKT pathway.
Terova, Genciana; Rimoldi, Simona; Bernardini, Giovanni; Saroglia, Marco
2013-06-01
Myostatin (MSTN), previously referred to as growth differentiation factor 8 (GDF8), is a negative regulator of skeletal muscle growth. In accordance with this role, natural mutations that inactivate the gene disrupting the function of the protein are associated with excessive muscle growth and double-muscling phenotype in several mammalian species. Recent studies using transgenic MSTN deficient zebrafish and medaka support the idea that this gene inhibits skeletal muscle growth even in fish. If the atrophic actions of mammalian MSTN are indeed conserved in fish, strategies capable of inhibiting the expression of this gene could be applied to enhance growth performance in livestock production. Gene silencing by RNA interference has emerged as a promising new method of inhibiting the expression of targeted genes and inducing knockdown of associated proteins both in vitro and in vivo. Accordingly, we investigated here whether double-stranded RNA (dsRNA) or different plasmids expressing short-hairpin interfering RNAs (shRNAs) against myostatin and transduced by in vivo electroporation would increase skeletal muscle mass in reared European sea bass. After 7 weeks of intramuscular injections on a weekly basis followed by in vivo electrically mediated dsRNA delivery, no increase in the condition factor (K) of fish was observed as compared to the controls. Analogously, mean body weight and K of sea bass injected with three shRNAs were not higher than those of the control fish. On the other hand, MSTN transcript quantification via real-time RT-PCR revealed a significant inhibition of gene expression in the muscle of the dsRNA-injected fish and in the muscle of fish injected with one of the three tested shRNA-expressing vector constructs. In conclusion, in vivo electric-mediated delivery of dsRNA- or shRNA-expressing vectors against MSTN inhibits MSTN gene expression in adult sea bass muscle, but this is associated with an inconsistent double-muscle phenotype.
The p40 Subunit of Interleukin (IL)-12 Promotes Stabilization and Export of the p35 Subunit
Jalah, Rashmi; Rosati, Margherita; Ganneru, Brunda; Pilkington, Guy R.; Valentin, Antonio; Kulkarni, Viraj; Bergamaschi, Cristina; Chowdhury, Bhabadeb; Zhang, Gen-Mu; Beach, Rachel Kelly; Alicea, Candido; Broderick, Kate E.; Sardesai, Niranjan Y.; Pavlakis, George N.; Felber, Barbara K.
2013-01-01
IL-12 is a 70-kDa heterodimeric cytokine composed of the p35 and p40 subunits. To maximize cytokine production from plasmid DNA, molecular steps controlling IL-12p70 biosynthesis at the posttranscriptional and posttranslational levels were investigated. We show that the combination of RNA/codon-optimized gene sequences and fine-tuning of the relative expression levels of the two subunits within a cell resulted in increased production of the IL-12p70 heterodimer. We found that the p40 subunit plays a critical role in enhancing the stability, intracellular trafficking, and export of the p35 subunit. This posttranslational regulation mediated by the p40 subunit is conserved in mammals. Based on these findings, dual gene expression vectors were generated, producing an optimal ratio of the two subunits, resulting in a ∼1 log increase in human, rhesus, and murine IL-12p70 production compared with vectors expressing the wild type sequences. Such optimized DNA plasmids also produced significantly higher levels of systemic bioactive IL-12 upon in vivo DNA delivery in mice compared with plasmids expressing the wild type sequences. A single therapeutic injection of an optimized murine IL-12 DNA plasmid showed significantly more potent control of tumor development in the B16 melanoma cancer model in mice. Therefore, the improved IL-12p70 DNA vectors have promising potential for in vivo use as molecular vaccine adjuvants and in cancer immunotherapy. PMID:23297419
Papanikolaou, Eleni; Georgomanoli, Maria; Stamateris, Evangelos; Panetsos, Fottes; Karagiorga, Markisia; Tsaftaridis, Panagiotis; Graphakos, Stelios
2012-01-01
Abstract To address how low titer, variable expression, and gene silencing affect gene therapy vectors for hemoglobinopathies, in a previous study we successfully used the HPFH (hereditary persistence of fetal hemoglobin)-2 enhancer in a series of oncoretroviral vectors. On the basis of these data, we generated a novel insulated self-inactivating (SIN) lentiviral vector, termed GGHI, carrying the Aγ-globin gene with the −117 HPFH point mutation and the HPFH-2 enhancer and exhibiting a pancellular pattern of Aγ-globin gene expression in MEL-585 clones. To assess the eventual clinical feasibility of this vector, GGHI was tested on CD34+ hematopoietic stem cells from nonmobilized peripheral blood or bone marrow from 20 patients with β-thalassemia. Our results show that GGHI increased the production of γ-globin by 32.9% as measured by high-performance liquid chromatography (p=0.001), with a mean vector copy number per cell of 1.1 and a mean transduction efficiency of 40.3%. Transduced populations also exhibited a lower rate of apoptosis and resulted in improvement of erythropoiesis with a higher percentage of orthochromatic erythroblasts. This is the first report of a locus control region (LCR)-free SIN insulated lentiviral vector that can be used to efficiently produce the anticipated therapeutic levels of γ-globin protein in the erythroid progeny of primary human thalassemic hematopoietic stem cells in vitro. PMID:21875313
Systemic Correction of Murine Glycogen Storage Disease Type IV by an AAV-Mediated Gene Therapy.
Yi, Haiqing; Zhang, Quan; Brooks, Elizabeth D; Yang, Chunyu; Thurberg, Beth L; Kishnani, Priya S; Sun, Baodong
2017-03-01
Deficiency of glycogen branching enzyme (GBE) causes glycogen storage disease type IV (GSD IV), which is characterized by the accumulation of a less branched, poorly soluble form of glycogen called polyglucosan (PG) in multiple tissues. This study evaluates the efficacy of gene therapy with an adeno-associated viral (AAV) vector in a mouse model of adult form of GSD IV (Gbe1 ys/ys ). An AAV serotype 9 (AAV9) vector containing a human GBE expression cassette (AAV-GBE) was intravenously injected into 14-day-old Gbe1 ys/ys mice at a dose of 5 × 10 11 vector genomes per mouse. Mice were euthanized at 3 and 9 months of age. In the AAV-treated mice at 3 months of age, GBE enzyme activity was highly elevated in heart, which is consistent with the high copy number of the viral vector genome detected. GBE activity also increased significantly in skeletal muscles and the brain, but not in the liver. The glycogen content was reduced to wild-type levels in muscles and significantly reduced in the liver and brain. At 9 months of age, though GBE activity was only significantly elevated in the heart, glycogen levels were significantly reduced in the liver, brain, and skeletal muscles of the AAV-treated mice. In addition, the AAV treatment resulted in an overall decrease in plasma activities of alanine transaminase, aspartate transaminase, and creatine kinase, and a significant increase in fasting plasma glucose concentration at 9 months of age. This suggests an alleviation of damage and improvement of function in the liver and muscles by the AAV treatment. This study demonstrated a long-term benefit of a systemic injection of an AAV-GBE vector in Gbe1 ys/ys mice.
Functional polycarbonates and their self-assemblies as promising non-viral vectors.
Seow, Wei Yang; Yang, Yi Yan
2009-10-01
Polycarbonates are promising biomaterials due to their biocompatibility, degradability and low toxicity. In this study, a series of COOH-functionalized polycarbonates was synthesized via an organocatalytic ring opening polymerization pathway under mild conditions. The polymers displayed a range of molecular weights (M(w): 3.1, 5.5 and 9.7 kDa) and were very narrowly distributed (polydispersity index: 1.07, 1.07 and 1.15 respectively). Aliphatic amines with different chain lengths (triethylenetetramine, tetraethylenepentamine or pentaethylenehexamine) were then conjugated onto the polycarbonate backbone using DIC/NHS chemistry. These amine-functionalized polycarbonates could form nanoparticles upon simple dissolution in water and had CMC values ranging from 22 to 45 mg/L. It was found that a longer amine chain resulted in greater buffering capacity, more positive zeta potential and smaller hydrodynamic size of the polymeric nanoparticles. Results from gel retardation assays indicated that the polymers were able to condense DNA. In-vitro studies further demonstrated that selected amine-functionalized polycarbonates could mediate efficient luciferase expression in HEK293, HepG2 and 4T1 cell lines at levels that were comparable, or even superior, to the polyethylenimine (PEI) standard. Importantly, minimal cytotoxicty was induced in the cells. These functional polycarbonates therefore have the potential to be a useful non-viral vector for gene therapy.
Gomaa, Lamis; Loscar, Michael E; Zein, Haggag S; Abdel-Ghaffar, Nahed; Abdelhadi, Abdelhadi A; Abdelaal, Ali S; Abdallah, Naglaa A
2017-08-08
Isoprene represents a key building block for the production of valuable materials such as latex, synthetic rubber or pharmaceutical precursors and serves as basis for advanced biofuel production. To enhance the production of the volatile natural hydrocarbon isoprene, released by plants, animals and bacteria, the Kudzu isoprene synthase (kIspS) gene has been heterologously expressed in Bacillus subtilis DSM 402 and Bacillus licheniformis DSM 13 using the pHT01 vector. As control, the heterologous expression of KIspS in E. coli BL21 (DE3) with the pET28b vector was used. Isoprene production was analyzed using Gas Chromatography Flame Ionization Detector. The highest isoprene production was observed by recombinant B. subtilis harboring the pHT01-kIspS plasmid which produced 1434.3 μg/L (1275 µg/L/OD) isoprene. This is threefold higher than the wild type which produced 388 μg/L (370 μg/L/OD) isoprene, when both incubated at 30 °C for 48 h and induced with 0.1 mM IPTG. Additionally, recombinant B. subtilis produced fivefold higher than the recombinant B. licheniformis, which produced 437.2 μg/L (249 μg/L/OD) isoprene when incubated at 37 °C for 48 h induced with 0.1 mM IPTG. This is the first report of optimized isoprene production in B. licheniformis. However, recombinant B. licheniformis showed less isoprene production. Therefore, recombinant B. subtilis is considered as a versatile host for heterologous production of isoprene.
The additive effects of the TM6SF2 E167K and PNPLA3 I148M polymorphisms on lipid metabolism
Chen, Lizhen; Du, Shuixian; Lu, Linlin; Lin, Zhonghua; Jin, Wenwen; Hu, Doudou; Jiang, Xiangjun; Xin, Yongning; Xuan, Shiying
2017-01-01
There is a genetic susceptibility for nonalcoholic fatty liver disease (NAFLD). To examine the role of genetic factors in the disease, a Bayesian analysis was performed to model gene relationships in NAFLD pathogenesis. The Bayesian analysis indicated a potential gene interaction between the TM6SF2 and PNPLA3 genes. Next, to explore the underlying mechanism at the cellular level, we evaluated the additive effects between the TM6SF2 E167K and PNPLA3 I148M polymorphisms on lipid metabolism. Hepa 1-6 cells were transfected with a control vector or with overexpression vectors for TM6SF2/PNPLA3-wild type, TM6SF2-mutant type, PNPLA3-mutant type, or TM6SF2/PNPLA3-mutant type. Commercial kits were used to measure triglyceride and total cholesterol levels in each of the five groups. The mRNA and protein expression levels of sterol regulatory element-binding transcription factor 1c and fatty acid synthase were analyzed using real-time PCR and western blotting. The triglyceride and total cholesterol contents were significantly different among the groups. The triglyceride and total cholesterol contents and the sterol regulatory element-binding transcription factor 1c and fatty acid synthase mRNA and protein expression levels were significantly higher in the TM6SF2/PNPLA3-mutant type group than in the TM6SF2-mutant type group or the PNPLA3-mutant type group. The TM6SF2 E167K and PNPLA3 I148M polymorphisms may have additive effects on lipid metabolism by increasing the expression of sterol regulatory element-binding transcription factor 1c and fatty acid synthase. PMID:29088779
The additive effects of the TM6SF2 E167K and PNPLA3 I148M polymorphisms on lipid metabolism.
Chen, Lizhen; Du, Shuixian; Lu, Linlin; Lin, Zhonghua; Jin, Wenwen; Hu, Doudou; Jiang, Xiangjun; Xin, Yongning; Xuan, Shiying
2017-09-26
There is a genetic susceptibility for nonalcoholic fatty liver disease (NAFLD). To examine the role of genetic factors in the disease, a Bayesian analysis was performed to model gene relationships in NAFLD pathogenesis. The Bayesian analysis indicated a potential gene interaction between the TM6SF2 and PNPLA3 genes. Next, to explore the underlying mechanism at the cellular level, we evaluated the additive effects between the TM6SF2 E167K and PNPLA3 I148M polymorphisms on lipid metabolism. Hepa 1-6 cells were transfected with a control vector or with overexpression vectors for TM6SF2/PNPLA3-wild type, TM6SF2-mutant type, PNPLA3-mutant type, or TM6SF2/PNPLA3-mutant type. Commercial kits were used to measure triglyceride and total cholesterol levels in each of the five groups. The mRNA and protein expression levels of sterol regulatory element-binding transcription factor 1c and fatty acid synthase were analyzed using real-time PCR and western blotting. The triglyceride and total cholesterol contents were significantly different among the groups. The triglyceride and total cholesterol contents and the sterol regulatory element-binding transcription factor 1c and fatty acid synthase mRNA and protein expression levels were significantly higher in the TM6SF2/PNPLA3-mutant type group than in the TM6SF2-mutant type group or the PNPLA3-mutant type group. The TM6SF2 E167K and PNPLA3 I148M polymorphisms may have additive effects on lipid metabolism by increasing the expression of sterol regulatory element-binding transcription factor 1c and fatty acid synthase.
Veiseth, Silje V.; Rahman, Mohummad A.; Yap, Kyoko L.; Fischer, Andreas; Egge-Jacobsen, Wolfgang; Reuter, Gunter; Zhou, Ming-Ming; Aalen, Reidunn B.; Thorstensen, Tage
2011-01-01
Chromatin structure and gene expression are regulated by posttranslational modifications (PTMs) on the N-terminal tails of histones. Mono-, di-, or trimethylation of lysine residues by histone lysine methyltransferases (HKMTases) can have activating or repressive functions depending on the position and context of the modified lysine. In Arabidopsis, trimethylation of lysine 9 on histone H3 (H3K9me3) is mainly associated with euchromatin and transcribed genes, although low levels of this mark are also detected at transposons and repeat sequences. Besides the evolutionarily conserved SET domain which is responsible for enzyme activity, most HKMTases also contain additional domains which enable them to respond to other PTMs or cellular signals. Here we show that the N-terminal WIYLD domain of the Arabidopsis SUVR4 HKMTase binds ubiquitin and that the SUVR4 product specificity shifts from di- to trimethylation in the presence of free ubiquitin, enabling conversion of H3K9me1 to H3K9me3 in vitro. Chromatin immunoprecipitation and immunocytological analysis showed that SUVR4 in vivo specifically converts H3K9me1 to H3K9me3 at transposons and pseudogenes and has a locus-specific repressive effect on the expression of such elements. Bisulfite sequencing indicates that this repression involves both DNA methylation–dependent and –independent mechanisms. Transcribed genes with high endogenous levels of H3K4me3, H3K9me3, and H2Bub1, but low H3K9me1, are generally unaffected by SUVR4 activity. Our results imply that SUVR4 is involved in the epigenetic defense mechanism by trimethylating H3K9 to suppress potentially harmful transposon activity. PMID:21423664
Molecular cloning, sequencing, and expression of Eimeria tenella HSP70 partial gene.
Bogado, A L G; Martins, G F; Sasse, J P; Guimarães, J da S; Garcia, J L
2017-03-15
Members of the Eimeria genus are protozoan parasites of the subphylum Apicomplexa (Eimeriidae family), and belong to the coccidia group. Eimeria tenella is one of the most pathogenic species owing to its ability to penetrate the mucosa, and cause inflammation and damage. It is an obligate intracellular parasite that causes disease by destroying the host cells during multiplication. Heat shock protein 70 (HSP70) is a molecular chaperone that prevents cellular stress. The objective of this study was to clone, sequence, and express E. tenella HSP70 protein. After selecting the region of highest hydrophilicity in the hsp70 gene, we cloned complementary DNA (cDNA) into a pTrcHis2-TOPO vector and transformed it into TOP10 Escherichia coli cells; after induction, the bacteria expressed a 23-kDa protein with insoluble expression levels of approximately 5 mg/L. In summary, the partial hsp70 gene was successfully expressed in E. coli, producing a 23-kDa protein under insoluble conditions, and the antigen characteristics predicted by hydrophilicity analysis suggest the development of a vaccine for use in avian coccidiosis.
Zheng, W Y; Wang, Y; Zhang, Z C; Yan, F
2015-10-05
We examined the immunological characteristics of outer membrane protein omp31 of goat Brucella and its monoclonal antibody. Genomic DNA from the M5 strain of goat Brucella was amplified by polymerase chain reaction and cloned into the prokaryotic expression vector pGEX-4T-1. The expression and immunological characteristics of the fusion protein GST-omp31 were subjected to preliminary western blot detection with goat Brucella rabbit immune serum. The Brucella immunized BALB/c mouse serum was detected using purified protein. The high-potency mouse splenocytes and myeloma Sp2/0 cells were fused. Positive clones were screened by enzyme-linked immunosorbent assay to establish a hybridoma cell line. Mice were inoculated intraperitoneally with hybridoma cells to prepare ascites. The mAb was purified using the n-caprylic acid-ammonium sulfate method. The characteristics of mAb were examined using western blotting and enzyme-linked immunosorbent assay. A 680-base pair band was observed after polymerase chain reaction. Enzyme digestion identification and sequencing showed that the pGEX-4T-1-omp31 prokaryotic expression vector was successfully established; a target band of approximately 57 kDa with an apparent molecular weight consistent with the size of the target fusion protein. At 25°C, the expression of soluble expression increased significantly; the fusion protein GST-omp31 was detected by western blotting. Anti-omp31 protein mAb was obtained from 2 strains of Brucella. The antibody showed strong specificity and sensitivity and did not cross-react with Escherichia coli, Staphylococcus aureus, Bacillus subtilis, Mycobacterium tuberculosis, or Bacillus pyocyaneus. The pGEX-4T-1-omp31 prokaryotic expression vector was successfully established and showed good immunogenicity. The antibody also showed strong specificity and good sensitivity.
Alvarez, R; Checa, M; Brun, S; Viñas, O; Mampel, T; Iglesias, R; Giralt, M; Villarroya, F
2000-01-01
The intracellular pathways and receptors mediating the effects of retinoic acid (RA) on the brown-fat-uncoupling-protein-1 gene (ucp-1) have been analysed. RA activates transcription of ucp-1 and the RA receptor (RAR) is known to be involved in this effect. However, co-transfection of an expression vector for retinoid-X receptor (RXR) increases the action of 9-cis RA but not the effects of all-trans RA on the ucp-1 promoter in brown adipocytes. Either RAR-specific ¿p-[(E)-2-(5,6,7,8,-tetrahydro-5,5,8, 8-tetramethyl-2-naphthalenyl)-1-propenyl]benzoic acid¿ or RXR-specific [isopropyl-(E,E)-(R,S)-11-methoxy-3,7, 11-trimethyldodeca-2,4-dienoate, or methoprene] synthetic compounds increase the expression of UCP-1 mRNA and the activity of chloramphenicol acetyltransferase expression vectors driven by the ucp-1 promoter. The RXR-mediated action of 9-cis RA requires the upstream enhancer region at -2469/-2318 in ucp-1. During brown-adipocyte differentiation RXRalpha and RXRgamma mRNA expression is induced in parallel with UCP-1 mRNA, whereas the mRNA for the three RAR subtypes, alpha, beta and gamma, decreases. Co-transfection of murine expression vectors for the different RAR and RXR subtypes indicates that RARalpha and RARbeta as well as RXRalpha are the major retinoid-receptor subtypes capable of mediating the responsiveness of ucp-1 to retinoids. It is concluded that the effects of retinoids on ucp-1 transcription involve both RAR- and RXR-dependent signalling pathways. The responsiveness of brown adipose tissue to retinoids in vivo relies on a complex combination of the capacity of RAR and RXR subtypes to mediate ucp-1 induction and their distinct expression in the differentiated brown adipocyte. PMID:10600643
Singh, Rajvinder; Dhawan, Samriti; Singh, Kashmir; Kaur, Jagdeep
2012-08-01
The gene encoding a thermostable pectinase was isolated from a soil metagenome sample. The gene sequence corresponded to an open reading frame of 1,311 bp encoding a translation product of 47.9 kDa. It showed maximum (93 %) identity to a Bacillus licheniformis glycoside hydrolase. Deduced amino acid analysis showed an absence of highly conserved cysteine residues in the N-terminal region at positions 24 and 42, and in the C-terminal region at positions 389, 394, 413 and 424. pQpecJKR01 (pQE30 expression vector containing the pectinase gene) was expressed in Escherichia coli strain M15 as a recombinant fusion protein containing an N-terminal 6× His tag. Biochemical properties of this pectinase were novel. The enzyme had temperature and pH optima of 70 °C and 7.0, respectively, but was active over a broad temperature and pH range. The enzyme was stable at 60 °C with a half-life of 5 h and the enzyme activity was inhibited by 0.1 % diethyl pyrocarbonate and 5 mM dicyclohexyl carbodiimide. The enzyme could be of great use in industrial processes due to its activity over a broad pH range and at high temperature.
Kaur, Gagandeep; Singh, Amninder; Sharma, Rohit; Sharma, Vinay; Verma, Swati; Sharma, Pushpender K
2016-06-01
In the present investigation, a gene encoding extracellular lipase was cloned from a Bacillus licheniformis. The recombinant protein containing His-tag was expressed as inclusion bodies in Esherichia coli BL21DE3 cells, using pET-23a as expression vector. Expressed protein purified from the inclusion bodies demonstrated ~22 kDa protein band on 12 % SDS-PAGE. It exhibited specific activity of 0.49 U mg -1 and % yield of 8.58. Interestingly, the lipase displayed activity at wide range of pH and temperature, i.e., 9.0-14.0 pH and 30-80 °C, respectively. It further demonstrated ~100 % enzyme activity in presence of various organic solvents. Enzyme activity was strongly inhibited in the presence of β-ME. Additionally, the serine and histidine modifiers also inhibited the enzyme activities strongly at all concentrations that suggest their role in the catalytic center. Enzyme could retain its activity in presence of various detergents (Triton X-100, Tween 20, Tween 40, SDS). Sequence and structural analysis employing in silico tools revealed that the lipase contained two highly conserved sequences consisting of ITITGCGNDL and NLYNP, arranged as parallel β-sheet in the core of the 3D structure. The function of these conserve sequences have not fully understood.
Molino, Yves; David, Marion; Varini, Karine; Jabès, Françoise; Gaudin, Nicolas; Fortoul, Aude; Bakloul, Karima; Masse, Maxime; Bernard, Anne; Drobecq, Lucile; Lécorché, Pascaline; Temsamani, Jamal; Jacquot, Guillaume; Khrestchatisky, Michel
2017-05-01
The blood-brain barrier (BBB) prevents the entry of many drugs into the brain and, thus, is a major obstacle in the treatment of CNS diseases. There is some evidence that the LDL receptor (LDLR) is expressed at the BBB and may participate in the transport of endogenous ligands from blood to brain, a process referred to as receptor-mediated transcytosis. We previously described a family of peptide vectors that were developed to target the LDLR. In the present study, in vitro BBB models that were derived from wild-type and LDLR-knockout animals ( ldlr -/- ) were used to validate the specific LDLR-dependent transcytosis of LDL via a nondegradative route. We next showed that LDLR-targeting peptide vectors, whether in fusion or chemically conjugated to an Ab Fc fragment, promote binding to apical LDLR and transendothelial transfer of the Fc fragment across BBB monolayers via the same route as LDL. Finally, we demonstrated in vivo that LDLR significantly contributes to the brain uptake of vectorized Fc. We thus provide further evidence that LDLR is a relevant receptor for CNS drug delivery via receptor-mediated transcytosis and that the peptide vectors we developed have the potential to transport drugs, including proteins or Ab based, across the BBB.-Molino, Y., David, M., Varini, K., Jabès, F., Gaudin, N., Fortoul, A., Bakloul, K., Masse, M., Bernard, A., Drobecq, L., Lécorché, P., Temsamani, J., Jacquot, G., Khrestchatisky, M. Use of LDL receptor-targeting peptide vectors for in vitro and in vivo cargo transport across the blood-brain barrier. © FASEB.
Bekdash, Rola A.; Zhang, Changqing; Sarkar, Dipak K.
2013-01-01
Background Prenatal exposure to ethanol reduces the expression of hypothalamic proopiomelanocortin (POMC) gene, known to control various physiological functions including the organismal stress response. In this study, we determined whether the changes in POMC neuronal functions are associated with altered expressions of histone-modifying and DNA-methylating enzymes in POMC-producing neurons, since these enzymes are known to be involved in regulation of gene expression. In addition, we tested whether gestational choline supplementation prevents the adverse effects of ethanol on these neurons. Methods Pregnant rat dams were fed with alcohol-containing liquid diet or control diet during gestational days 7 and 21 with or without choline, and their male offspring rats were used during the adult period. Using double-immunohistochemistry, real-time reverse transcription polymerase chain reaction (RT-PCR) and methylation specific RT-PCR, we determined protein and mRNA levels of histone-modifying and DNA-methylating enzymes, and the changes in POMC gene methylation and expression in the hypothalamus of adult male offspring rats. Additionally, we measured the basal and lipopolysaccharide (LPS)-induced corticosterone levels in plasma by enzyme-linked immunoabsorbent assay. Results Prenatal ethanol treatment suppressed hypothalamic levels of protein and mRNA of histone activation marks (H3K4me3, Set7/9, acetylated H3K9, phosphorylated H3S10) increased the repressive marks (H3K9me2, G9a, Setdb1) and DNA methylating enzyme (Dnmt1) and the methyl-CpG-binding protein (MeCP2). The treatment also elevated the level of POMC gene methylation, while it reduced levels of POMC mRNA and β-EP, and elevated corticosterone response to LPS. Gestational choline normalized the ethanol-altered protein and the mRNA levels of H3K4me3, Set7/9, H3K9me2, G9a, Setdb1, Dnmt1 and MeCP2. It also normalizes the changes in POMC gene methylation and gene expression, β-EP production and the corticosterone response to LPS. Conclusions These data suggest that prenatal ethanol modulates histone and DNA methylation in POMC neurons that may be resulting in hypermethylation of POMC gene and reduction of POMC gene expression. Gestational choline supplementation prevents the adverse effects of ethanol on these neurons. PMID:23413810
Matsunaga, Toshiyuki; Endo, Satoshi; Maeda, Satoshi; Ishikura, Shuhei; Tajima, Kazuo; Tanaka, Nobutada; Nakamura, Kazuo T; Imamura, Yorishige; Hara, Akira
2008-09-15
Human DHRS4 is a peroxisomal member of the short-chain dehydrogenase/reductase superfamily, but its enzymatic properties, except for displaying NADP(H)-dependent retinol dehydrogenase/reductase activity, are unknown. We show that the human enzyme, a tetramer composed of 27kDa subunits, is inactivated at low temperature without dissociation into subunits. The cold inactivation was prevented by a mutation of Thr177 with the corresponding residue, Asn, in cold-stable pig DHRS4, where this residue is hydrogen-bonded to Asn165 in a substrate-binding loop of other subunit. Human DHRS4 reduced various aromatic ketones and alpha-dicarbonyl compounds including cytotoxic 9,10-phenanthrenequinone. The overexpression of the peroxisomal enzyme in cultured cells did not increase the cytotoxicity of 9,10-phenanthrenequinone. While its activity towards all-trans-retinal was low, human DHRS4 efficiently reduced 3-keto-C(19)/C(21)-steroids into 3beta-hydroxysteroids. The stereospecific conversion to 3beta-hydroxysteroids was observed in endothelial cells transfected with vectors expressing the enzyme. The mRNA for the enzyme was ubiquitously expressed in human tissues and several cancer cells, and the enzyme in HepG2 cells was induced by peroxisome-proliferator-activated receptor alpha ligands. The results suggest a novel mechanism of cold inactivation and role of the inducible human DHRS4 in 3beta-hydroxysteroid synthesis and xenobiotic carbonyl metabolism.
CRISPR/Cas9 Based Genome Editing of Penicillium chrysogenum.
Pohl, C; Kiel, J A K W; Driessen, A J M; Bovenberg, R A L; Nygård, Y
2016-07-15
CRISPR/Cas9 based systems have emerged as versatile platforms for precision genome editing in a wide range of organisms. Here we have developed powerful CRISPR/Cas9 tools for marker-based and marker-free genome modifications in Penicillium chrysogenum, a model filamentous fungus and industrially relevant cell factory. The developed CRISPR/Cas9 toolbox is highly flexible and allows editing of new targets with minimal cloning efforts. The Cas9 protein and the sgRNA can be either delivered during transformation, as preassembled CRISPR-Cas9 ribonucleoproteins (RNPs) or expressed from an AMA1 based plasmid within the cell. The direct delivery of the Cas9 protein with in vitro synthesized sgRNA to the cells allows for a transient method for genome engineering that may rapidly be applicable for other filamentous fungi. The expression of Cas9 from an AMA1 based vector was shown to be highly efficient for marker-free gene deletions.
Zhang, Hua; Cao, Yumei; Chen, Yuru; Li, Guangxi; Yu, Hanshu
2018-04-01
The present study investigated the inhibitory effects of apatinib on the proliferation of the SMMC-7721 hepatocellular carcinoma cell line to explore the possible mechanism. The MTT assay was used to detect the inhibitory effects of the different concentrations of apatinib on the proliferation of SMMC-7721 cells. Annexin V/PI double staining was performed to investigate the effects of apatinib on the apoptosis of SMMC-7721 cells. Expression of the apoptosis-related genes Bcl-2, Bax and caspase-9 after apatinib treatment was detected by reverse transcription-quantitative PCR (RT-qPCR) and western blot analysis. Expression of the PI3K, p-PI3K, Akt and p-Akt proteins after apatinib treatment was detected using western blot analysis. The MTT results showed that apatinib inhibited the in vitro proliferation of SMMC-7721 cells. Annexin V/PI double staining showed that apatinib induced the apoptosis of SMMC-7721 cells in a concentration-dependent manner. Results of RT-qPCR and western blot analysis showed that apatinib was able to induce the expression of pro-apoptotic genes Bax and caspase-9 and inhibited the expression of anti-apoptotic gene Bcl-2 . In addition, the western blot analysis revealed that p-PI3K and p-Akt was significantly decreased following apatinib treatment, while no significant differences were found in the total protein levels of PI3K and Akt. The results of the present show that apatinib is capable of promoting the apoptosis of SMMC-7721 cells by inhibiting the PI3K/Akt signal transduction pathway, upregulating the expression of pro-apoptotic genes Bax and caspase-9 , and downregulating the expression level of the anti-apoptotic gene Bcl-2 .
Qu, Changfeng; He, Yingying; Zheng, Zhou; An, Meiling; Li, Lulu; Wang, Xixi; He, Xiaodong; Wang, Yibin; Liu, Fangming; Miao, Jinlai
2018-01-01
The α-carbonic anhydrase (α-CA) is a zinc ion-containing enzyme that catalyzes the hydration of carbon dioxide. In this paper, a full-length α-CA gene was cloned from Chlamydomonas sp. ICE-L using RT-PCR and RACE-PCR for bioinformatic analysis. The α-CA open reading frame obtained by PCR was cloned into a vector and transformed into Escherichia coli to generate α-CA-producing bacteria. The α-CA was highly expressed upon induction with isopropyl-β-d-thiogalactoside (IPTG) at a final concentration of 0.8 mM. A single band with a molecular weight of approximate 40 kDa expressed in the recombinant E. coli strain harboring the α-CA vector was observed in SDS-PAGE analysis. The carbon dioxide hydration activity and esterase activity of α-CA expressed by the recombinant strain were 0.404 U/mg and 0.319 U, respectively. In addition, three conditions, temperature, salinity and UVB radiation exposure, were selected to analyze α-CA transcription levels by qRT-PCR. The results suggested UVB exposure increased the expression of relative mRNA; meanwhile, the α-CA mRNA expression was rapidly induced by temperature and salinity stress, indicating that Chlamydomonas sp. ICE-L might modulate the α-CA mRNA expression to adapt to the extreme environments.
WANG, DONGDONG; SAGA, YASUSHI; SATO, NAOTO; NAKAMURA, TOSHIKAZU; TAKIKAWA, OSAMU; MIZUKAMI, HIROAKI; MATSUBARA, SHIGEKI; FUJIWARA, HIROYUKI
2016-01-01
Indoleamine-2,3-dioxygenase (IDO) is an immunosuppressive enzyme involved in tumor malignancy. However, the regulatory mechanism underlying its involvement remains largely uncharacterized. The present study aimed to investigate the hypothesis that NK4, an antagonist of hepatocyte growth factor (HGF), can regulate IDO and to characterize the signaling mechanism involved. Following successful transfection of the human ovarian cancer cell line SKOV-3 (which constitutively expresses IDO) with an NK4 expression vector, we observed that NK4 expression suppressed IDO expression; furthermore, NK4 expression did not suppress cancer cell growth in vitro [in the absence of natural killer (NK) cells], but did influence tumor growth in vivo. In addition, NK4 enhanced the sensitivity of cancer cells to NK cells in vitro and promoted NK cell accumulation in the tumor stroma in vivo. In an effort to clarify the mechanisms by which NK4 interacts with IDO, we performed investigations utilizing various biochemical inhibitors. The results of these investigations were as follows. First, c-Met (a receptor of HGF) tyrosine kinase inhibitor PHA-665752, and phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 both suppress IDO expression. Second, enhanced expression of PTEN (a known tumor suppressor) via negative regulation within a PI3K-AKT pathway, inhibits IDO expression. Conversely, neither the MEK1/2 inhibitor U0126 nor the STAT3 inhibitor WP1066 affects IDO expression. These results suggest that NK4 inhibits IDO expression via a c-Met-PI3K-AKT signaling pathway. PMID:27082119
Du, Yanhua; Liu, Zhenping; Cao, Xinkai; Chen, Xiaolong; Chen, Zhenyu; Zhang, Xiaobai; Zhang, Xiaoqing; Jiang, Cizhong
2017-01-01
Neuroectoderm is an important neural precursor. However, chromatin remodeling and its epigenetic regulatory roles during the differentiation of human neuroectodermal cells (hNECs) from human embryonic stem cells (hESCs) remain largely unexplored. Here, we obtained hNECs through directed differentiation from hESCs, and determined chromatin states in the two cell types. Upon differentiation, H2A.Z-mediated nucleosome depletion leads to an open chromatin structure in promoters and upregulates expression of neuroectodermal genes. Increase in H3K9ac signals and decrease in H3K27me3 signals in promoters result in an active chromatin state and activate neuroectodermal genes. Conversely, decrease in H3K9ac signals and increase in H3K27me3 signals in promoters repress pluripotency genes. Moreover, H3K9ac signals facilitate the pluripotency factor Sox2 binding to target sites unique to hNECs. Knockdown of the acetyltransferase Kat2b erases H3K9ac signals, disrupts Sox2 binding, and fails the differentiation. Our results demonstrate a hierarchy of epigenetic regulation of gene expression during the differentiation of hNECs from hESCs through chromatin remodeling. PMID:28475175
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shin, Ki-Hyuk, E-mail: kshin@dentistry.ucla.edu; Dental Research Institute, University of California, Los Angeles, CA 90095; Jonsson Comprehensive Cancer Center, University of California, Los Angeles, CA 90095
2011-01-28
Research highlights: {yields} MicroRNA-181a (miR-181a) was frequently downregulated in oral squamous cell carcinoma (OSCC). {yields} Overexpression of miR-181a suppressed OSCC growth. {yields} K-ras is a novel target of miR-181a. {yields} Decreased miR-181a expression is attributed to its lower promoter activity in OSCC. -- Abstract: MicroRNAs (miRNAs) are epigenetic regulators of gene expression, and their deregulation plays an important role in human cancer, including oral squamous cell carcinoma (OSCC). Recently, we found that miRNA-181a (miR-181a) was upregulated during replicative senescence of normal human oral keratinocytes. Since senescence is considered as a tumor suppressive mechanism, we thus investigated the expression and biologicalmore » role of miR-181a in OSCC. We found that miR-181a was frequently downregulated in OSCC. Ectopic expression of miR-181a suppressed proliferation and anchorage independent growth ability of OSCC. Moreover, miR-181a dramatically reduces the growth of OSCC on three dimensional organotypic raft culture. We also identified K-ras as a novel target of miR-181a. miR-181a decreased K-ras protein level as well as the luciferase activity of reporter vectors containing the 3'-untranslated region of K-ras gene. Finally, we defined a minimal regulatory region of miR-181a and found a positive correlation between its promoter activity and the level of miR-181a expression. In conclusion, miR-181a may function as an OSCC suppressor by targeting on K-ras oncogene. Thus, miR-181a should be considered for therapeutic application for OSCC.« less
NASA Astrophysics Data System (ADS)
Karsi, Redouane; Zaim, Mounia; El Alami, Jamila
2017-07-01
Thanks to the development of the internet, a large community now has the possibility to communicate and express its opinions and preferences through multiple media such as blogs, forums, social networks and e-commerce sites. Today, it becomes clearer that opinions published on the web are a very valuable source for decision-making, so a rapidly growing field of research called “sentiment analysis” is born to address the problem of automatically determining the polarity (Positive, negative, neutral,…) of textual opinions. People expressing themselves in a particular domain often use specific domain language expressions, thus, building a classifier, which performs well in different domains is a challenging problem. The purpose of this paper is to evaluate the impact of domain for sentiment classification when using machine learning techniques. In our study three popular machine learning techniques: Support Vector Machines (SVM), Naive Bayes and K nearest neighbors(KNN) were applied on datasets collected from different domains. Experimental results show that Support Vector Machines outperforms other classifiers in all domains, since it achieved at least 74.75% accuracy with a standard deviation of 4,08.
Lungu, Gina; Covaleda, Lina; Mendes, Odete; Martini-Stoica, Heidi; Stoica, George
2008-06-01
Matrix metalloproteinase-9 (MMP-9) plays a critical role in tumor invasion and metastasis. Here, we investigate the effect of fibroblast growth factor-1 (FGF-1) on the expression of MMP-9 in ENU1564, an ethyl-N-nitrosourea-induced rat mammary adenocarcinoma cell line. We observed that FGF-1 induces a dose-dependent increase in MMP-9 mRNA, protein, and activity in ENU1564 cells. To gain insight into the molecular mechanism of MMP-9 regulation by FGF-1, we investigated the role of components of PI3K-Akt and MEK1/2-ERK signaling pathways in our system since NF-kappaB and AP-1 transcription factor binding sites have been characterized in the upstream region of the MMP-9 gene. We demonstrated that FGF-1 increases Akt phosphorylation, triggers nuclear translocation of NF-kappaBp65, and enhances degradation of cytoplasmic IkappaBalpha. Pretreatment of cells with LY294002, a PI3K inhibitor, significantly inhibited MMP-9 protein expression in FGF-1-treated cells. Conversely, our data show that FGF-1 increases ERK phosphorylation in ENU1564 cells, increases c-jun and c-fos mRNA expression in a time-dependent manner, and triggers nuclear translocation of c-jun. Pretreatment of cells with PD98059, a MEK1/2 inhibitor significantly inhibited MMP-9 protein expression in FGF-1 treated cells. Finally, we observed increased DNA binding of NF-kappaB and AP-1 in FGF-1-treated cells and that mutation of either NF-kappaB or AP-1 response elements prevented MMP-9 promoter activation by FGF-1. Taken together, these results demonstrated that FGF-1-induced MMP-9 expression in ENU1564 cells is associated with increasing DNA binding activities of NF-kappaB and AP-1 and involve activation of a dual signaling pathway, PI3K-Akt and MEK1/2-ERK. (c) 2007 Wiley-Liss, Inc.
Stevenson, S C; Rollence, M; Marshall-Neff, J; McClelland, A
1997-01-01
The adenovirus fiber protein is responsible for attachment of the virion to unidentified cell surface receptors. There are at least two distinct adenovirus fiber receptors which interact with the group B (Ad3) and group C (Ad5) adenoviruses. We have previously shown by using expressed adenovirus fiber proteins that it is possible to change the specificity of the fiber protein by exchanging the head domain with another serotype which recognizes a different receptor (S. C. Stevenson et al., J. Virol. 69:2850-2857, 1995). A chimeric fiber cDNA containing the Ad3 fiber head domain fused to the Ad5 fiber tail and shaft was incorporated into the genome of an adenovirus vector with E1 and E3 deleted encoding beta-galactosidase to generate Av9LacZ4, an adenovirus particle which contains a chimeric fiber protein. Western blot analysis of the chimeric fiber vector confirmed expression of the chimeric fiber protein and its association with the adenovirus capsid. Transduction experiments with fiber protein competitors demonstrated the altered receptor tropism of the chimeric fiber vector compared to that of the parental Av1LacZ4 vector. Transduction of a panel of human cell lines with the chimeric and parental vectors provided evidence for a different cellular distribution of the Ad5 and Ad3 receptors. Three cell lines (THP-1, MRC-5, and FaDu) were more efficiently transduced by the vector containing the Ad3 fiber head than by the Ad5 fiber vector. In contrast, human coronary artery endothelial cells were transduced more readily with the vector containing the Ad5 fiber than with the chimeric fiber vector. HeLa and human umbilical vein endothelial cells were transduced at equivalent levels compared with human diploid fibroblasts, which were refractory to transduction with both vectors. These results provide evidence for the differential expression of the Ad5 and Ad3 receptors on human cell lines derived from clinically relevant target tissues. Furthermore, we show that exchange of the fiber head domain is a viable approach to the production of adenovirus vectors with cell-type-selective transduction properties. It may be possible to extend this approach to the use of ligands for a range of different cellular receptors in order to target gene transfer to specific cell types at the level of transduction. PMID:9151872
Fibroblast growth factor 9 is a novel modulator of negative affect
Aurbach, Elyse L.; Inui, Edny Gula; Turner, Cortney A.; Hagenauer, Megan H.; Prater, Katherine E.; Li, Jun Z.; Absher, Devin; Shah, Najmul; Blandino, Peter; Bunney, William E.; Myers, Richard M.; Barchas, Jack D.; Schatzberg, Alan F.; Watson, Stanley J.; Akil, Huda
2015-01-01
Both gene expression profiling in postmortem human brain and studies using animal models have implicated the fibroblast growth factor (FGF) family in affect regulation and suggest a potential role in the pathophysiology of major depressive disorder (MDD). FGF2, the most widely characterized family member, is down-regulated in the depressed brain and plays a protective role in rodent models of affective disorders. By contrast, using three microarray analyses followed by quantitative RT-PCR confirmation, we show that FGF9 expression is up-regulated in the hippocampus of individuals with MDD, and that FGF9 expression is inversely related to the expression of FGF2. Because little is known about FGF9’s function in emotion regulation, we used animal models to shed light on its potential role in affective function. We found that chronic social defeat stress, an animal model recapitulating some aspects of MDD, leads to a significant increase in hippocampal FGF9 expression, paralleling the elevations seen in postmortem human brain tissue. Chronic intracerebroventricular administration of FGF9 increased both anxiety- and depression-like behaviors. In contrast, knocking down FGF9 expression in the dentate gyrus of the hippocampus using a lentiviral vector produced a decrease in FGF9 expression and ameliorated anxiety-like behavior. Collectively, these results suggest that high levels of hippocampal FGF9 play an important role in the development or expression of mood and anxiety disorders. We propose that the relative levels of FGF9 in relation to other members of the FGF family may prove key to understanding vulnerability or resilience in affective disorders. PMID:26351673
Interplay between EZH2 and G9a Regulates CXCL10 Gene Repression in Idiopathic Pulmonary Fibrosis.
Coward, William R; Brand, Oliver J; Pasini, Alice; Jenkins, Gisli; Knox, Alan J; Pang, Linhua
2018-04-01
Selective repression of the antifibrotic gene CXCL10 contributes to tissue remodeling in idiopathic pulmonary fibrosis (IPF). We have previously reported that histone deacetylation and histone H3 lysine 9 (H3K9) methylation are involved in CXCL10 repression. In this study, we explored the role of H3K27 methylation and the interplay between the two histone lysine methyltransferases enhancer of zest homolog 2 (EZH2) and G9a in CXCL10 repression in IPF. By applying chromatin immunoprecipitation, Re-ChIP, and proximity ligation assays, we demonstrated that, like G9a-mediated H3K9 methylation, EZH2-mediated histone H3 lysine 27 trimethylation (H3K27me3) was significantly enriched at the CXCL10 promoter in fibroblasts from IPF lungs (F-IPF) compared with fibroblasts from nonfibrotic lungs, and we also found that EZH2 and G9a physically interacted with each other. EZH2 knockdown reduced not only EZH2 and H3K27me3 but also G9a and H3K9me3, and G9a knockdown reduced not only G9 and H3K9me3 but also EZH2 and H3K27me3. Depletion and inhibition of EZH2 and G9a also reversed histone deacetylation and restored CXCL10 expression in F-IPF. Furthermore, treatment of fibroblasts from nonfibrotic lungs with the profibrotic cytokine transforming growth factor-β1 increased EZH2, G9a, H3K27me3, H3K9me3, and histone deacetylation at the CXCL10 promoter, similar to that observed in F-IPF, which was correlated with CXCL10 repression and was prevented by EZH2 and G9a knockdown. These findings suggest that a novel and functionally interdependent interplay between EZH2 and G9a regulates histone methylation-mediated epigenetic repression of the antifibrotic CXCL10 gene in IPF. This interdependent interplay may prove to be a target for epigenetic intervention to restore the expression of CXCL10 and other antifibrotic genes in IPF.
Chen, Haoming; Yao, Hengmei; Huang, Lu; Shen, Qi; Jia, William; Xue, Jinglun
2006-12-01
1. Haematopoietic stem cells (HSC) are an attractive target for gene therapy. Gene transfer to HSC can provide a potential cure for many inherited diseases. Moreover, recombinant lentiviral vectors can transfer genes efficiently to HSC. In the present study, we used the recombinant lentiviruses FUGW (Flip, ubiquitin promoter, GFP and WRE vector) and FUXW (Flip, ubiquitin promoter, F IX and WRE vector), which carry the enhanced green fluorescent protein (EGFP) and human factor IX (hFIX) gene, respectively, to infect HSC. 2. High titres of recombinant lentivirus were prepared from 293T cells by calcium phosphate-mediated transient cotransfection. Murine mononuclear cells (MNC) separated from murine bone marrow and HSC separated by magnetic cell sorting were cultured in vitro. Cells they were infected by the recombinant lentiviruses FUGW and FUXW. The expression of EGFP was observed under a fluorescent microscope and was analysed by fluorescence-activated cell sorting, whereas the expression of hFIX was detected by ELISA. 3. The results show that the lentiviral vectors can efficiently infect murine HSC in vitro and that transduction was more efficient following cytokine treatment with interleukin (IL)-3, IL-6 and stem cell factor. 4. Haematopoietic stem cells infected with lentivirus FUXW were transplanted into [(60)Co]-irradiated non-obese diabetic/severe combined immunodeficiency (NOD-SCID) mice. The expression of hFIX in the blood plasma of the transplanted mice reached a peak of 44.9 +/- 7.6 ng/mL on Day 7. An assay of transaminase levels and a histological study of the liver showed that there was no significant damage following HSC transplantation to mice. 5. The results of the present study suggest that transplantation of HSC results in the persistant expression of hFIX in mice, which may be useful in haemophilia B gene therapy.
Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu
2008-06-01
This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.
NASA Astrophysics Data System (ADS)
Zeng, Xi; Mizuno, Yosuke; Nakamura, Kentaro
2017-12-01
The sound intensity vector provides useful information on the state of an ultrasonic field in water, since sound intensity is a vector quantity expressing the direction and magnitude of the sound field. In the previous studies on sound intensity measurement in water, conventional piezoelectric sensors and metal cables were used, and the transmission distance was limited. A new configuration of a sound intensity probe suitable for ultrasonic measurement in water is proposed and constructed for trial in this study. The probe consists of light-emitting diodes and piezoelectric elements, and the output signals are transmitted through fiber optic cables as intensity-modulated light. Sound intensity measurements of a 26 kHz ultrasonic field in water are demonstrated. The difference in the intensity vector state between the water tank with and without sound-absorbing material on its walls was successfully observed.
Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker
2016-09-01
Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.
Characterization of an In Vivo Z-DNA Detection Probe Based on a Cell Nucleus Accumulating Intrabody.
Gulis, Galina; Silva, Izabel Cristina Rodrigues; Sousa, Herdson Renney; Sousa, Isabel Garcia; Bezerra, Maryani Andressa Gomes; Quilici, Luana Salgado; Maranhao, Andrea Queiroz; Brigido, Marcelo Macedo
2016-09-01
Left-handed Z-DNA is a physiologically unstable DNA conformation, and its existence in vivo can be attributed to localized torsional distress. Despite evidence for the existence of Z-DNA in vivo, its precise role in the control of gene expression is not fully understood. Here, an in vivo probe based on an anti-Z-DNA intrabody is proposed for native Z-DNA detection. The probe was used for chromatin immunoprecipitation of potential Z-DNA-forming sequences in the human genome. One of the isolated putative Z-DNA-forming sequences was cloned upstream of a reporter gene expression cassette under control of the CMV promoter. The reporter gene encoded an antibody fragment fused to GFP. Transient co-transfection of this vector along with the Z-probe coding vector improved reporter gene expression. This improvement was demonstrated by measuring reporter gene mRNA and protein levels and the amount of fluorescence in co-transfected CHO-K1 cells. These results suggest that the presence of the anti-Z-DNA intrabody can interfere with a Z-DNA-containing reporter gene expression. Therefore, this in vivo probe for the detection of Z-DNA could be used for global correlation of Z-DNA-forming sequences and gene expression regulation.
Penguin b → sℓ‧+ℓ‧- and B-meson anomalies in a gauged Lμ - Lτ
NASA Astrophysics Data System (ADS)
Chen, Chuan-Hung; Nomura, Takaaki
2018-02-01
The Z‧-gauge boson in an U(1) Lμ -Lτ gauge symmetry has two interesting features: one is its vector couplings to the charged leptons, and the other is the decoupling from the electron. Based on these properties, we investigate the feasibility to simultaneously resolve the R K (*) = BR (B →K (*)μ+μ-) / BR (B →K (*)e+e-) and R D (*) = BR (B bar →D (*) τνbarτ) / BR (B bar →D (*) ℓνbarℓ) anomalies in an U(1) Lμ -Lτ model, where the former is expected to arise from the Z‧-penguin-induced b → sμ+μ- process and the latter from the tree-level b → cτνbarτ decay. In order to achieve the intended purpose, we employ one vector-like doublet lepton and one singlet scalar leptoquark (LQ), in which the new particles all carry the U(1) Lμ -Lτ charges; the b → sZ‧ effective interaction is generated from the vector-like lepton and LQ loop, and the b → cτνbarτ decay is induced from the LQ. When the constraints from the b → sγ, B+ →K+ ν ν bar , Bc- → τνbarτ, ΔF = 2, and τ → μℓ ℓ bar processes are included, it is found that RD and RD* can be enhanced to fit the experimental data, and the Wilson coefficient C9 from the LQ-loop can reach C9LQ, μ ∼ - 1, which can explain the RK and RK* anomalies. In addition, in this simple model, the Higgs lepton-flavor violating h → μτ decay can occur at the tree level, and its branching ratio can be as large as the current experimental upper limit.
Guo, Yuxing; Li, Xiangyue; Yang, Yao; Wu, Zhen; Zeng, Xiaoqun; Nadari, Fawze; Pan, Daodong
2018-06-23
The slpB gene of Lactobacillus acidophilus NCFM, which differs from the slpA gene and is silent under normal conditions, was successfully amplified and ligated to the corresponding available sites on a recombinant pET-28a vector. Then the pET-28a-slpB vector was transformed into Escherichia coli DH (DE3) and the fusion His-slpB protein was expressed by induction with 1 mM IPTG for 14 h at 37 °C. The resulting His-slpB protein (S B ) had a relative molecular weight of 48 kDa. It was purified using a Ni-NTA column and was confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blot contrastive analysis. The slpA protein (S A ) from L. acidophilus NCFM was extracted and purified. It had a relative molecular weight of 46 kDa. Circular dichroism measurements suggested that the two S-layer proteins had a high β-sheet content and a low α-helix structure content. In an adhesion experiment, S A displayed higher adhesive capability towards Caco-2 cells than did S B . The results suggest that these two S-layer proteins could have biotechnological applications.
Increased H3K9me3 drives dedifferentiated phenotype via KLF6 repression in liposarcoma
Keung, Emily Z.; Akdemir, Kadir C.; Al Sannaa, Ghadah A.; Garnett, Jeannine; Lev, Dina; Torres, Keila E.; Lazar, Alexander J.; Rai, Kunal; Chin, Lynda
2015-01-01
Liposarcoma (LPS) can be divided into 4 different subtypes, of which well-differentiated LPS (WDLPS) and dedifferentiated LPS (DDLPS) are the most common. WDLPS is typically low grade, whereas DDLPS is high grade, aggressive, and carries a worse prognosis. WDLPS and DDLPS frequently co-occur in patients. However, it is not clear whether DDLPS arises independently from WDLPS, or whether epigenomic alterations underly the histopathological differences of these subtypes. Here, we profiled 9 epigenetic marks in tumor samples from 151 patients with LPS and showed elevated trimethylation of histone H3 at Lys9 (H3K9me3) levels in DDLPS tumors. Integrated ChIP-seq and gene expression analyses of patient-derived cell lines revealed that H3K9me3 mediates differential regulation of genes involved in cellular differentiation and migration. Among these, Kruppel-like factor 6 (KLF6) was reduced in DDLPS, with increased H3K9me3 at associated regulatory regions. Pharmacologic inhibition of H3K9me3 with chaetocin decreased DDLPS proliferation and increased expression of the adipogenesis-associated factors PPARγ, CEBPα, and CEBPβ, suggesting that increased H3K9me3 may mediate DDLPS-associated aggressiveness and dedifferentiation properties. KLF6 overexpression partially phenocopied chaetocin treatment in DDLPS cells and induced phenotypic changes that were consistent with adipocytic differentiation, suggesting that the effects of increased H3K9me3 may be mediated through KLF6. In conclusion, we provide evidence of an epigenetic basis for the transition between WDLPS and DDLPS. PMID:26193637
Increased H3K9me3 drives dedifferentiated phenotype via KLF6 repression in liposarcoma.
Keung, Emily Z; Akdemir, Kadir C; Al Sannaa, Ghadah A; Garnett, Jeannine; Lev, Dina; Torres, Keila E; Lazar, Alexander J; Rai, Kunal; Chin, Lynda
2015-08-03
Liposarcoma (LPS) can be divided into 4 different subtypes, of which well-differentiated LPS (WDLPS) and dedifferentiated LPS (DDLPS) are the most common. WDLPS is typically low grade, whereas DDLPS is high grade, aggressive, and carries a worse prognosis. WDLPS and DDLPS frequently co-occur in patients. However, it is not clear whether DDLPS arises independently from WDLPS, or whether epigenomic alterations underly the histopathological differences of these subtypes. Here, we profiled 9 epigenetic marks in tumor samples from 151 patients with LPS and showed elevated trimethylation of histone H3 at Lys9 (H3K9me3) levels in DDLPS tumors. Integrated ChIP-seq and gene expression analyses of patient-derived cell lines revealed that H3K9me3 mediates differential regulation of genes involved in cellular differentiation and migration. Among these, Kruppel-like factor 6 (KLF6) was reduced in DDLPS, with increased H3K9me3 at associated regulatory regions. Pharmacologic inhibition of H3K9me3 with chaetocin decreased DDLPS proliferation and increased expression of the adipogenesis-associated factors PPARγ, CEBPα, and CEBPβ, suggesting that increased H3K9me3 may mediate DDLPS-associated aggressiveness and dedifferentiation properties. KLF6 overexpression partially phenocopied chaetocin treatment in DDLPS cells and induced phenotypic changes that were consistent with adipocytic differentiation, suggesting that the effects of increased H3K9me3 may be mediated through KLF6. In conclusion, we provide evidence of an epigenetic basis for the transition between WDLPS and DDLPS.
Liu, Min; Chen, Biao; Pei, Linguo; Zhang, Qi; Zou, Yunfei; Xiao, Hao; Zhou, Jin; Chen, Liaobin; Wang, Hui
2018-06-11
Prenatal dexamethasone exposure (PDE) could induce testicular developmental toxicity in adults. The present study aims to confirm its intrauterine origination, and to explore its potential intrauterine programming mechanism. The pregnant rats were respectively injected subcutaneously with 0.2 and 0.8 mg/kg⋅d dexamethasone during gestational days (GD) 9 to 20. The testes and serum of offspring rats were collected on GD20 and postnatal week (PW) 12. In vivo, PDE significantly induced the abnormal testicular morphology in offspring from GD20 to PW12. Moreover, the serum and intratesticular testosterone levels and the expression of testicular steroidogenic acute regulatory protein (StAR) were reduced by PDE. The expression levels of glucocorticoid receptor (GR) and histone deacetylase 7 (HDAC7) were increased in fetal testes. Furthermore, the histone 3 lysine 9 acetylation (H3K9ac) level in the StAR promoter was decreased by PDE from GD20 to PW12. In vitro, mouse Leydig tumour cell line (MLTC-1) cells were treated with dexamethasone (20, 100 and 500 nM), and the testosterone production and StAR expression were reduced. Moreover, dexamethasone increased the expression of HDAC7 by activating GR, which decreased the H3K9ac level in the StAR promoter. Taken together, PDE caused testicular dysplasia before and after birth in male offspring rats, and its mechanism was related to the low-expressional programming of StAR mediated by decreasing H3K9ac level. Copyright © 2018. Published by Elsevier B.V.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, B.; Laouar, A.; Huberman, E.
1998-05-08
Induction of the 92-kDa gelatinase (MMP-9) gene expression is associated with macrophage differentiation. In this study, we explored the regulatory mechanisms underlying this differentiation-associated MMP-9 gene expression in human HL-60 myeloid leukemia cells and human peripheral blood monocytes. Phorbol 12-myristate 13-acetate (PMA) markedly induced MMP-9 gene expression in HL-60 cells; the induction closely paralleled the timing and extent of PMA-induced cell adhesion and spreading, a hallmark of macrophage differentiation. Similarly, treatment with PMA or macrophage-colony stimulating factor stimulated adherence and spreading of blood monocytes with a concurrent 7- or 5-fold increase in MMP-9 production, respectively. In protein kinase C (PKC)-betamore » -deficient HL-60 variant cells (HL-525), PMA failed to induce cell adhesion and MMP-9 gene expression. Transfecting HL-525 cells with a PKC-beta expression plasmid restored PKC-beta levels and PMA inducibility of cell adhesion and spreading as well as MMP-9 gene expression. Induction of cell adhesion and MMP-9 gene expression in HL-60 cells and blood monocytes was strongly inhibited by neutralizing monoclonal antibodies to fibronectin (FN) and its receptor {alpha}5{beta}1 integrin. HL-525 cells, which constitutively display high levels of surface {alpha}5{beta}1 integrin, adhered and spread on immobilized FN with concomitant induction of MMP-9 gene expression. Cytochalasins B and D were each a potent inhibitor of MMP-9 production. Our results suggest that {alpha}5{beta}1 integrin-mediated interaction of immature hematopoietic cells with FN plays a critical role in modulating matrix-degrading activities during macrophage differentiation.« less
TWIST1-WDR5-Hottip regulates Hoxa9 chromatin to facilitate prostate cancer metastasis
Malek, Reem; Gajula, Rajendra P.; Williams, Russell D.; Nghiem, Belinda; Simons, Brian W.; Nugent, Katriana; Wang, Hailun; Taparra, Kekoa; Lemtiri-Chlieh, Ghali; Yoon, Arum R.; True, Lawrence; An, Steven S.; DeWeese, Theodore L.; Ross, Ashley E.; Schaeffer, Edward M.; Pienta, Kenneth J.; Hurley, Paula J.; Morrissey, Colm; Tran, Phuoc T.
2017-01-01
TWIST1 is a transcription factor critical for development which can promote prostate cancer metastasis. During embryonic development, TWIST1 and HOXA9 are co-expressed in mouse prostate and then silenced post-natally. Here we report that TWIST1 and HOXA9 co-expression are re-activated in mouse and human primary prostate tumors and are further enriched in human metastases, correlating with survival. TWIST1 formed a complex with WDR5 and the lncRNA Hottip/HOTTIP, members of the MLL/COMPASS-like H3K4 methylases, which regulate chromatin in the Hox/HOX cluster during development. TWIST1 overexpression led to co-enrichment of TWIST1 and WDR5 as well increased H3K4me3 chromatin at the Hoxa9/HOXA9 promoter which was dependent on WDR5. Expression of WDR5 and Hottip/HOTTIP was also required for TWIST1-induced upregulation of HOXA9 and aggressive cellular phenotypes such as invasion and migration. Pharmacological inhibition of HOXA9 prevented TWIST1-induced aggressive prostate cancer cellular phenotypes in vitro and metastasis in vivo. This study demonstrates a novel mechanism by which TWIST1 regulates chromatin and gene expression by cooperating with the COMPASS-like complex to increase H3K4 trimethylation at target gene promoters. Our findings highlight a TWIST1-HOXA9 embryonic prostate developmental program that is reactivated during prostate cancer metastasis and is therapeutically targetable. PMID:28484075
Amigo-Jiménez, Irene; Bailón, Elvira; Ugarte-Berzal, Estefanía; Aguilera-Montilla, Noemí; García-Marco, José A; García-Pardo, Angeles
2014-01-01
Matrix metalloproteinase-9 (MMP-9) contributes to chronic lymphocytic leukemia (CLL) pathology by regulating cell migration and preventing spontaneous apoptosis. It is not known if MMP-9 is involved in CLL cell response to chemotherapy and we address this in the present study, using arsenic trioxide (ATO) and fludarabine as examples of cytotoxic drugs. We used primary cells from the peripheral blood of CLL patients and MEC-1 cells stably transfected with an empty vector or a vector containing MMP-9. The effect of ATO and fludarabine was determined by flow cytometry and by the MTT assay. Expression of mRNA was measured by RT-PCR and qPCR. Secreted and cell-bound MMP-9 was analyzed by gelatin zymography and flow cytometry, respectively. Protein expression was analyzed by Western blotting and immunoprecipitation. Statistical analyses were performed using the two-tailed Student's t-test. In response to ATO or fludarabine, CLL cells transcriptionally upregulated MMP-9, preceding the onset of apoptosis. Upregulated MMP-9 primarily localized to the membrane of early apoptotic cells and blocking apoptosis with Z-VAD prevented MMP-9 upregulation, thus linking MMP-9 to the apoptotic process. Culturing CLL cells on MMP-9 or stromal cells induced drug resistance, which was overcome by anti-MMP-9 antibodies. Accordingly, MMP-9-MEC-1 transfectants showed higher viability upon drug treatment than Mock-MEC-1 cells, and this effect was blocked by silencing MMP-9 with specific siRNAs. Following drug exposure, expression of anti-apoptotic proteins (Mcl-1, Bcl-xL, Bcl-2) and the Mcl-1/Bim, Mcl-1/Noxa, Bcl-2/Bax ratios were higher in MMP-9-cells than in Mock-cells. Similar results were obtained upon culturing primary CLL cells on MMP-9. Our study describes for the first time that MMP-9 induces drug resistance by modulating proteins of the Bcl-2 family and upregulating the corresponding anti-apoptotic/pro-apoptotic ratios. This is a novel role for MMP-9 contributing to CLL progression. Targeting MMP-9 in combined therapies may thus improve CLL response to treatment.
Amigo-Jiménez, Irene; Bailón, Elvira; Ugarte-Berzal, Estefanía; Aguilera-Montilla, Noemí; García-Marco, José A.; García-Pardo, Angeles
2014-01-01
Background Matrix metalloproteinase-9 (MMP-9) contributes to chronic lymphocytic leukemia (CLL) pathology by regulating cell migration and preventing spontaneous apoptosis. It is not known if MMP-9 is involved in CLL cell response to chemotherapy and we address this in the present study, using arsenic trioxide (ATO) and fludarabine as examples of cytotoxic drugs. Methods We used primary cells from the peripheral blood of CLL patients and MEC-1 cells stably transfected with an empty vector or a vector containing MMP-9. The effect of ATO and fludarabine was determined by flow cytometry and by the MTT assay. Expression of mRNA was measured by RT-PCR and qPCR. Secreted and cell-bound MMP-9 was analyzed by gelatin zymography and flow cytometry, respectively. Protein expression was analyzed by Western blotting and immunoprecipitation. Statistical analyses were performed using the two-tailed Student's t-test. Results In response to ATO or fludarabine, CLL cells transcriptionally upregulated MMP-9, preceding the onset of apoptosis. Upregulated MMP-9 primarily localized to the membrane of early apoptotic cells and blocking apoptosis with Z-VAD prevented MMP-9 upregulation, thus linking MMP-9 to the apoptotic process. Culturing CLL cells on MMP-9 or stromal cells induced drug resistance, which was overcome by anti-MMP-9 antibodies. Accordingly, MMP-9-MEC-1 transfectants showed higher viability upon drug treatment than Mock-MEC-1 cells, and this effect was blocked by silencing MMP-9 with specific siRNAs. Following drug exposure, expression of anti-apoptotic proteins (Mcl-1, Bcl-xL, Bcl-2) and the Mcl-1/Bim, Mcl-1/Noxa, Bcl-2/Bax ratios were higher in MMP-9-cells than in Mock-cells. Similar results were obtained upon culturing primary CLL cells on MMP-9. Conclusions Our study describes for the first time that MMP-9 induces drug resistance by modulating proteins of the Bcl-2 family and upregulating the corresponding anti-apoptotic/pro-apoptotic ratios. This is a novel role for MMP-9 contributing to CLL progression. Targeting MMP-9 in combined therapies may thus improve CLL response to treatment. PMID:24956101
The putative protein methyltransferase LAE1 controls cellulase gene expression in Trichoderma reesei
Seiboth, Bernhard; Karimi, Razieh Aghcheh; Phatale, Pallavi A; Linke, Rita; Hartl, Lukas; Sauer, Dominik G; Smith, Kristina M; Baker, Scott E; Freitag, Michael; Kubicek, Christian P
2012-01-01
Summary Trichoderma reesei is an industrial producer of enzymes that degrade lignocellulosic polysaccharides to soluble monomers, which can be fermented to biofuels. Here we show that the expression of genes for lignocellulose degradation are controlled by the orthologous T. reesei protein methyltransferase LAE1. In a lae1 deletion mutant we observed a complete loss of expression of all seven cellulases, auxiliary factors for cellulose degradation, β-glucosidases and xylanases were no longer expressed. Conversely, enhanced expression of lae1 resulted in significantly increased cellulase gene transcription. Lae1-modulated cellulase gene expression was dependent on the function of the general cellulase regulator XYR1, but also xyr1 expression was LAE1-dependent. LAE1 was also essential for conidiation of T. reesei. Chromatin immunoprecipitation followed by high-throughput sequencing (‘ChIP-seq’) showed that lae1 expression was not obviously correlated with H3K4 di- or trimethylation (indicative of active transcription) or H3K9 trimethylation (typical for heterochromatin regions) in CAZyme coding regions, suggesting that LAE1 does not affect CAZyme gene expression by directly modulating H3K4 or H3K9 methylation. Our data demonstrate that the putative protein methyltransferase LAE1 is essential for cellulase gene expression in T. reesei through mechanisms that remain to be identified. PMID:22554051
Huang, Jiaojiao; Zhang, Hongyong; Yao, Jing; Qin, Guosong; Wang, Feng; Wang, Xianlong; Luo, Ailing; Zheng, Qiantao; Cao, Chunwei; Zhao, Jianguo
2016-01-01
Accumulating evidence suggests that faulty epigenetic reprogramming leads to the abnormal development of cloned embryos and results in the low success rates observed in all mammals produced through somatic cell nuclear transfer (SCNT). The aberrant methylation status of H3K9me and H3K9me2 has been reported in cloned mouse embryos. To explore the role of H3K9me2 and H3K9me in the porcine somatic cell nuclear reprogramming, BIX-01294, known as a specific inhibitor of G9A (histone-lysine methyltransferase of H3K9), was used to treat the nuclear-transferred (NT) oocytes for 14-16 h after activation. The results showed that the developmental competence of porcine SCNT embryos was significantly enhanced both in vitro (blastocyst rate 16.4% vs 23.2%, P<0.05) and in vivo (cloning rate 1.59% vs 2.96%) after 50 nm BIX-01294 treatment. BIX-01294 treatment significantly decreased the levels of H3K9me2 and H3K9me at the 2- and 4-cell stages, which are associated with embryo genetic activation, and increased the transcriptional expression of the pluripotency genes SOX2, NANOG and OCT4 in cloned blastocysts. Furthermore, the histone acetylation levels of H3K9, H4K8 and H4K12 in cloned embryos were decreased after BIX-01294 treatment. However, co-treatment of activated NT oocytes with BIX-01294 and Scriptaid rescued donor nuclear chromatin from decreased histone acetylation of H4K8 that resulted from exposure to BIX-01294 only and consequently improved the preimplantation development of SCNT embryos (blastocyst formation rates of 23.7% vs 21.5%). These results indicated that treatment with BIX-01294 enhanced the developmental competence of porcine SCNT embryos through improvements in epigenetic reprogramming and gene expression. © 2016 Society for Reproduction and Fertility.
Cloning, expression and purification of d-tagatose 3-epimerase gene from Escherichia coli JM109.
He, Xiaoliang; Zhou, Xiaohui; Yang, Zi; Xu, Le; Yu, Yuxiu; Jia, Lingling; Li, Guoqing
2015-10-01
An unknown d-tagatose 3-epimerase (DTE) containing a IoIE domain was identified and cloned from Escherichia coli. This gene was subcloned into the prokaryotic expression vector pET-15b, and induced by IPTG in E. coli BL21 expression system. Through His-select gel column purification and fast-protein liquid chromatography, highly purified and stable DTE protein was produced. The molecular weight of the DTE protein was estimated to be 29.8kDa. The latest 83 DTE sequences from public database were selected and analyzed by molecular clustering, multi-sequence alignment. DTEs were roughly divided into five categories. Copyright © 2015 Elsevier Inc. All rights reserved.
2008-01-01
expression vector. The purified bacoluvirus DNA, containing PSG11, was purified and used to transfect Spodoptera frugiperda (Sf-9) cells (Invitrogen) to...proteins in Spodoptera frugiperda cells using biotin acceptor peptides. Anal Biochem, 1998. 262(2): p. 122-8. 175. Hirt, B., Selective extraction of
Geminivirus vectors for high-level expression of foreign proteins in plant cells.
Mor, Tsafrir S; Moon, Yong-Sun; Palmer, Kenneth E; Mason, Hugh S
2003-02-20
Bean yellow dwarf virus (BeYDV) is a monopartite geminivirus that can infect dicotyledonous plants. We have developed a high-level expression system that utilizes elements of the replication machinery of this single-stranded DNA virus. The replication initiator protein (Rep) mediates release and replication of a replicon from a DNA construct ("LSL vector") that contains an expression cassette for a gene of interest flanked by cis-acting elements of the virus. We used tobacco NT1 cells and biolistic delivery of plasmid DNA for evaluation of replication and expression of reporter genes contained within an LSL vector. By codelivery of a GUS reporter-LSL vector and a Rep-supplying vector, we obtained up to 40-fold increase in expression levels compared to delivery of the reporter-LSL vectors alone. High-copy replication of the LSL vector was correlated with enhanced expression of GUS. Rep expression using a whole BeYDV clone, a cauliflower mosaic virus 35S promoter driving either genomic rep or an intron-deleted rep gene, or 35S-rep contained in the LSL vector all achieved efficient replication and enhancement of GUS expression. We anticipate that this system can be adapted for use in transgenic plants or plant cell cultures with appropriately regulated expression of Rep, with the potential to greatly increase yield of recombinant proteins. Copyright 2003 Wiley Periodicals, Inc. Biotechnol Bioeng 81: 430-437, 2003.
Li, Bin; Cheung, Pak Yan; Wang, Xianghong; Tsao, Sai Wah; Ling, Ming Tat; Wong, Yong Chuan; Cheung, Annie L M
2007-11-01
Inhibitor of differentiation or DNA binding (Id-1) is a helix-loop-helix protein that is over-expressed in many types of cancer including esophageal cancer. This study aims to investigate its effects on the phosphatidylinositol-3-kinase (PI3K)/Akt/ nuclear factor kappa B (NFkappaB) signaling pathway and the significance in protecting esophageal cancer cells against apoptosis. We found elevated expression of phosphorylated forms of Akt, glycogen synthase kinase 3beta and inhibitor of kappa B, as well as increased nuclear translocation of NFkappaB subunit p65 and NFkappaB DNA-binding activity, in esophageal cancer cells with stable ectopic Id-1 expression. Transient transfection of Id-1 into HEK293 cells confirmed activation of PI3K/Akt/NFkappaB signaling and the effects were counteracted by the PI3K inhibitor LY294002. Treatment with tumor necrosis factor-alpha (TNF-alpha) elicited a significantly weaker apoptotic response, following a marked and sustained activation of Akt and NFkappaB in the Id-1-over-expressing cells, compared with the vector control. The effects of Id-1 on the PI3K/Akt/NFkappaB signaling pathway and apoptosis were reversed in esophageal cancer cells transfected with siRNA against Id-1. In addition, inhibition of PI3K or NFkappaB signaling using the PI3K inhibitor LY294002 or the NFkappaB inhibitor Bay11-7082 increased the sensitivity of Id-1-over-expressing esophageal cancer cells to TNF-alpha-induced apoptosis. Our results provide the first evidence that Id-1 induces the activation of PI3K/Akt/NFkappaB signaling pathway, and protects esophageal cancer cells from TNF-alpha-induced apoptosis in vitro. Inactivation of Id-1 may provide us with a novel strategy to improve the treatment and survival of patients with esophageal cancer.
Congdon, Lauren M; Sims, Jennifer K; Tuzon, Creighton T; Rice, Judd C
2014-04-01
PR-Set7/Set8/KMT5a is the sole histone H4 lysine 20 monomethyltransferase (H4K20me1) in metazoans and is essential for proper cell division and genomic stability. We unexpectedly discovered that normal cellular levels of monomethylated histone H3 lysine 9 (H3K9me1) were also dependent on PR-Set7, but independent of its catalytic activity. This observation suggested that PR-Set7 interacts with an H3K9 monomethyltransferase to establish the previously reported H4K20me1-H3K9me1 trans-tail 'histone code'. Here we show that PR-Set7 specifically and directly binds the C-terminus of the Riz1/PRDM2/KMT8 tumor suppressor and demonstrate that the N-terminal PR/SET domain of Riz1 preferentially monomethylates H3K9. The PR-Set7 binding domain was required for Riz1 nuclear localization and maintenance of the H4K20me1-H3K9me1 trans-tail 'histone code'. Although Riz1 can function as a repressor, Riz1/H3K9me1 was dispensable for the repression of genes regulated by PR-Set7/H4K20me1. Frameshift mutations resulting in a truncated Riz1 incapable of binding PR-Set7 occur frequently in various aggressive cancers. In these cancer cells, expression of wild-type Riz1 restored tumor suppression by decreasing proliferation and increasing apoptosis. These phenotypes were not observed in cells expressing either the Riz1 PR/SET domain or PR-Set7 binding domain indicating that Riz1 methyltransferase activity and PR-Set7 binding domain are both essential for Riz1 tumor suppressor function.
Anisotropic Surface State Mediated RKKY Interaction Between Adatoms on a Hexagonal Lattice
NASA Astrophysics Data System (ADS)
Einstein, Theodore; Patrone, Paul
2012-02-01
Motivated by recent numerical studies of Ag on Pt(111), we derive a far-field expression for the RKKY interaction mediated by surface states on a (111) FCC surface, considering the effect of anisotropy in the Fermi edge. The main contribution to the interaction comes from electrons whose Fermi velocity vF is parallel to the vector R connecting the interacting adatoms; we show that in general, the corresponding Fermi wave-vector kF is not parallel to R. The interaction is oscillatory; the amplitude and wavelength of oscillations have angular dependence arising from the anisotropy of the surface state band structure. The wavelength, in particular, is determined by the component of the aforementioned kF that is parallel to R. Our analysis is easily generalized to other systems. For Ag on Pt(111), our results indicate that the RKKY interaction between pairs of adatoms should be nearly isotropic and so cannot account for the anisotropy found in the studies motivating our work.
Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.
2010-01-01
Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425
The HRSC on Mars Express: Mert Davies' Involvement in a Novel Planetary Cartography Experiment
NASA Astrophysics Data System (ADS)
Oberst, J.; Waehlisch, M.; Giese, B.; Scholten, F.; Hoffmann, H.; Jaumann, R.; Neukum, G.
2002-12-01
Mert Davies was a team member of the HRSC (High Resolution Stereo Camera) imaging experiment (PI: Gerhard Neukum) on ESA's Mars Express mission. This pushbroom camera is equipped with 9 forward- and backward-looking CCD lines, 5184 samples each, mounted in parallel, perpendicular to the spacecraft velocity vector. Flight image data with resolutions of up to 10m/pix (from an altitude of 250 km) will be acquired line by line as the spacecraft moves. This acquisition strategy will result in 9 separate almost completely overlapping image strips, each of them having more than 27,000 image lines, typically. [HRSC is also equipped with a superresolution channel for imaging of selected targets at up to 2.3 m/pixel]. The combined operation of the nadir and off-nadir CCD lines (+18.9°, 0°, -18.9°) gives HRSC a triple-stereo capability for precision mapping of surface topography and for modelling of spacecraft orbit- and camera pointing errors. The goals of the camera are to obtain accurate control point networks, Digital Elevation Models (DEMs) in Mars-fixed coordinates, and color orthoimages at global (100% of the surface will be covered with resolutions better than 30m/pixel) and local scales. With his long experience in all aspects of planetary geodesy and cartography, Mert Davies was involved in the preparations of this novel Mars imaging experiment which included: (a) development of a ground data system for the analysis of triple-stereo images, (b) camera testing during airborne imaging campaigns, (c) re-analysis of the Mars control point network, and generation of global topographic orthoimage maps on the basis of MOC images and MOLA data, (d) definition of the quadrangle scheme for a new topographic image map series 1:200K, (e) simulation of synthetic HRSC imaging sequences and their photogrammetric analysis. Mars Express is scheduled for launch in May of 2003. We miss Mert very much!
Estimating Energy Expenditure with ActiGraph GT9X Inertial Measurement Unit.
Hibbing, Paul R; Lamunion, Samuel R; Kaplan, Andrew S; Crouter, Scott E
2018-05-01
The purpose of this study was to explore whether gyroscope and magnetometer data from the ActiGraph GT9X improved accelerometer-based predictions of energy expenditure (EE). Thirty participants (mean ± SD: age, 23.0 ± 2.3 yr; body mass index, 25.2 ± 3.9 kg·m) volunteered to complete the study. Participants wore five GT9X monitors (right hip, both wrists, and both ankles) while performing 10 activities ranging from rest to running. A Cosmed K4b was worn during the trial, as a criterion measure of EE (30-s averages) expressed in METs. Triaxial accelerometer data (80 Hz) were converted to milli-G using Euclidean norm minus one (ENMO; 1-s epochs). Gyroscope data (100 Hz) were expressed as a vector magnitude (GVM) in degrees per second (1-s epochs) and magnetometer data (100 Hz) were expressed as direction changes per 5 s. Minutes 4-6 of each activity were used for analysis. Three two-regression algorithms were developed for each wear location: 1) ENMO, 2) ENMO and GVM, and 3) ENMO, GVM, and direction changes. Leave-one-participant-out cross-validation was used to evaluate the root mean square error (RMSE) and mean absolute percent error (MAPE) of each algorithm. Adding gyroscope to accelerometer-only algorithms resulted in RMSE reductions between 0.0 METs (right wrist) and 0.17 METs (right ankle), and MAPE reductions between 0.1% (right wrist) and 6.0% (hip). When direction changes were added, RMSE changed by ≤0.03 METs and MAPE by ≤0.21%. The combined use of gyroscope and accelerometer at the hip and ankles improved individual-level prediction of EE compared with accelerometer only. For the wrists, adding gyroscope produced negligible changes. The magnetometer did not meaningfully improve estimates for any algorithms.
Expression and function of K(V)2-containing channels in human urinary bladder smooth muscle.
Hristov, Kiril L; Chen, Muyan; Afeli, Serge A Y; Cheng, Qiuping; Rovner, Eric S; Petkov, Georgi V
2012-06-01
The functional role of the voltage-gated K(+) (K(V)) channels in human detrusor smooth muscle (DSM) is largely unexplored. Here, we provide molecular, electrophysiological, and functional evidence for the expression of K(V)2.1, K(V)2.2, and the electrically silent K(V)9.3 subunits in human DSM. Stromatoxin-1 (ScTx1), a selective inhibitor of K(V)2.1, K(V)2.2, and K(V)4.2 homotetrameric channels and of K(V)2.1/9.3 heterotetrameric channels, was used to examine the role of these channels in human DSM function. Human DSM tissues were obtained during open bladder surgeries from patients without a history of overactive bladder. Freshly isolated human DSM cells were studied using RT-PCR, immunocytochemistry, live-cell Ca(2+) imaging, and the perforated whole cell patch-clamp technique. Isometric DSM tension recordings of human DSM isolated strips were conducted using tissue baths. RT-PCR experiments showed mRNA expression of K(V)2.1, K(V)2.2, and K(V)9.3 (but not K(V)4.2) channel subunits in human isolated DSM cells. K(V)2.1 and K(V)2.2 protein expression was confirmed by Western blot analysis and immunocytochemistry. Perforated whole cell patch-clamp experiments revealed that ScTx1 (100 nM) inhibited the amplitude of the voltage step-induced K(V) current in freshly isolated human DSM cells. ScTx1 (100 nM) significantly increased the intracellular Ca(2+) level in DSM cells. In human DSM isolated strips, ScTx1 (100 nM) increased the spontaneous phasic contraction amplitude and muscle force, and enhanced the amplitude of the electrical field stimulation-induced contractions within the range of 3.5-30 Hz stimulation frequencies. These findings reveal that ScTx1-sensitive K(V)2-containing channels are key regulators of human DSM excitability and contractility and may represent new targets for pharmacological or genetic intervention for bladder dysfunction.
Shang, Yonglei; Tesar, Devin; Hötzel, Isidro
2015-10-01
A recently described dual-host phage display vector that allows expression of immunoglobulin G (IgG) in mammalian cells bypasses the need for subcloning of phage display clone inserts to mammalian vectors for IgG expression in large antibody discovery and optimization campaigns. However, antibody discovery and optimization campaigns usually need different antibody formats for screening, requiring reformatting of the clones in the dual-host phage display vector to an alternative vector. We developed a modular protein expression system mediated by RNA trans-splicing to enable the expression of different antibody formats from the same phage display vector. The heavy-chain region encoded by the phage display vector is directly and precisely fused to different downstream heavy-chain sequences encoded by complementing plasmids simply by joining exons in different pre-mRNAs by trans-splicing. The modular expression system can be used to efficiently express structurally correct IgG and Fab fragments or other antibody formats from the same phage display clone in mammalian cells without clone reformatting. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Vasilatos, Shauna N.; Boric, Lamia; Shaw, Patrick G.; Davidson, Nancy E.
2013-01-01
Abnormal activities of histone lysine demethylases (KDMs) and lysine deacetylases (HDACs) are associated with aberrant gene expression in breast cancer development. However, the precise molecular mechanisms underlying the crosstalk between KDMs and HDACs in chromatin remodeling and regulation of gene transcription are still elusive. In this study, we showed that treatment of human breast cancer cells with inhibitors targeting the zinc cofactor dependent class I/II HDAC, but not NAD+ dependent class III HDAC, led to significant increase of H3K4me2 which is a specific substrate of histone lysine-specific demethylase 1 (LSD1) and a key chromatin mark promoting transcriptional activation. We also demonstrated that inhibition of LSD1 activity by a pharmacological inhibitor, pargyline, or siRNA resulted in increased acetylation of H3K9 (AcH3K9). However, siRNA knockdown of LSD2, a homolog of LSD1, failed to alter the level of AcH3K9, suggesting that LSD2 activity may not be functionally connected with HDAC activity. Combined treatment with LSD1 and HDAC inhibitors resulted in enhanced levels of H3K4me2 and AcH3K9, and exhibited synergistic growth inhibition of breast cancer cells. Finally, microarray screening identified a unique subset of genes whose expression was significantly changed by combination treatment with inhibitors of LSD1 and HDAC. Our study suggests that LSD1 intimately interacts with histone deacetylases in human breast cancer cells. Inhibition of histone demethylation and deacetylation exhibits cooperation and synergy in regulating gene expression and growth inhibition, and may represent a promising and novel approach for epigenetic therapy of breast cancer. PMID:21452019
Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.
Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige
2007-07-26
Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Beckett, Travis; Bonneau, Laura; Howard, Alan; Blanchard, James; Borda, Juan; Weiner, Daniel J.; Wang, Lili; Gao, Guang Ping; Kolls, Jay K.; Bohm, Rudolf; Liggitt, Denny
2012-01-01
Abstract Use of perfluorochemical liquids during intratracheal vector administration enhances recombinant adenovirus and adeno-associated virus (AAV)-mediated lung epithelial gene expression. We hypothesized that inhalation of nebulized perfluorochemical vapor would also enhance epithelial gene expression after subsequent intratracheal vector administration. Freely breathing adult C57BL/6 mice were exposed for selected times to nebulized perflubron or sterile saline in a sealed Plexiglas chamber. Recombinant adenoviral vector was administered by transtracheal puncture at selected times afterward and mice were killed 3 days after vector administration to assess transgene expression. Mice tolerated the nebulized perflubron without obvious ill effects. Vector administration 6 hr after nebulized perflubron exposure resulted in an average 540% increase in gene expression in airway and alveolar epithelium, compared with that with vector alone or saline plus vector control (p<0.05). However, vector administration 1 hr, 1 day, or 3 days after perflubron exposure was not different from either nebulized saline with vector or vector alone and a 60-min exposure to nebulized perflubron is required. In parallel pilot studies in macaques, inhalation of nebulized perflubron enhanced recombinant AAV2/5 vector expression throughout the lung. Serial chest radiographs, bronchoalveolar lavages, and results of complete blood counts and serum biochemistries demonstrated no obvious adverse effects of nebulized perflubron. Further, one macaque receiving nebulized perflubron only was monitored for 1 year with no obvious adverse effects of exposure. These results demonstrate that inhalation of nebulized perflubron, a simple, clinically more feasible technique than intratracheal administration of liquid perflubron, safely enhances lung gene expression. PMID:22568624
Tao, Ke; Frisch, Janina; Rey-Rico, Ana; Venkatesan, Jagadeesh K; Schmitt, Gertrud; Madry, Henning; Lin, Jianhao; Cucchiarini, Magali
2016-02-01
Articular cartilage has a limited potential for self-healing. Transplantation of genetically modified progenitor cells like bone marrow-derived mesenchymal stem cells (MSCs) is an attractive strategy to improve the intrinsic repair capacities of damaged articular cartilage. In this study, we examined the potential benefits of co-overexpressing the pleiotropic transformation growth factor beta (TGF-β) with the cartilage-specific transcription factor SOX9 via gene transfer with recombinant adeno-associated virus (rAAV) vectors upon the biological activities of human MSCs (hMSCs). Freshly isolated hMSCs were transduced over time with separate rAAV vectors carrying either TGF-β or sox9 in chondrogenically-induced aggregate cultures to evaluate the efficacy and duration of transgene expression and to monitor the effects of rAAV-mediated genetic modification upon the cellular activities (proliferation, matrix synthesis) and chondrogenic differentiation potency compared with control conditions (lacZ treatment, sequential transductions). Significant, prolonged TGF-β/sox9 co-overexpression was achieved in chondrogenically-induced hMSCs upon co-transduction via rAAV for up to 21 days, leading to enhanced proliferative, biosynthetic, and chondrogenic activities relative to control treatments, especially when co-applying the candidate vectors at the highest vector doses tested. Optimal co-administration of TGF-β with sox9 also advantageously reduced hypertrophic differentiation of the cells in the conditions applied here. The present findings demonstrate the possibility of modifying MSCs by combined therapeutic gene transfer as potent future strategies for implantation in clinically relevant animal models of cartilage defects in vivo.
MDC9, a widely expressed cellular disintegrin containing cytoplasmic SH3 ligand domains
1996-01-01
Cellular disintegrins are a family of proteins that are related to snake venom integrin ligands and metalloproteases. We have cloned and sequenced the mouse and human homologue of a widely expressed cellular disintegrin, which we have termed MDC9 (for metalloprotease/disintegrin/cysteine-rich protein 9). The deduced mouse and human protein sequences are 82% identical. MDC9 contains several distinct protein domains: a signal sequence is followed by a prodomain and a domain with sequence similarity to snake venom metalloproteases, a disintegrin domain, a cysteine-rich region, an EGF repeat, a membrane anchor, and a cytoplasmic tail. The cytoplasmic tail of MDC9 has two proline-rich sequences which can bind the SH3 domain of Src, and may therefore function as SH3 ligand domains. Western blot analysis shows that MDC9 is an approximately 84-kD glycoprotein in all mouse tissues examined, and in NIH 3T3 fibroblast and C2C12 myoblast mouse cell lines. MDC9 can be both cell surface biotinylated and 125I-labeled in NIH 3T3 mouse fibroblasts, indicating that the protein is present on the plasma membrane. Expression of MDC9 in COS-7 cells yields an 84-kD protein, and immunofluorescence analysis of COS-7 cells expressing MDC9 shows a staining pattern that is consistent with a plasma membrane localization. The apparent molecular mass of 84 kD suggests that MDC9 contains a membrane-anchored metalloprotease and disintegrin domain. We propose that MDC9 might function as a membrane-anchored integrin ligand or metalloprotease, or that MDC9 may combine both activities in one protein. PMID:8647900
Chiang, Victor; Chalfie, Martin
2013-01-01
Although epigenetic control of stem cell fate choice is well established, little is known about epigenetic regulation of terminal neuronal differentiation. We found that some differences among the subtypes of Caenorhabditis elegans VC neurons, particularly the expression of the transcription factor gene unc-4, require histone modification, most likely H3K9 methylation. An EGF signal from the vulva alleviated the epigenetic repression of unc-4 in vulval VC neurons but not the more distant nonvulval VC cells, which kept unc-4 silenced. Loss of the H3K9 methyltransferase MET-2 or H3K9me2/3 binding proteins HPL-2 and LIN-61 or a novel chromodomain protein CEC-3 caused ectopic unc-4 expression in all VC neurons. Downstream of the EGF signaling in vulval VC neurons, the transcription factor LIN-11 and histone demethylases removed the suppressive histone marks and derepressed unc-4. Behaviorally, expression of UNC-4 in all the VC neurons caused an imbalance in the egg-laying circuit. Thus, epigenetic mechanisms help establish subtype-specific gene expression, which are needed for optimal activity of a neural circuit. PMID:24348272
Human granulocyte colony-stimulating factor (hG-CSF) expression in plastids of Lactuca sativa.
Sharifi Tabar, Mehdi; Habashi, Ali Akbar; Rajabi Memari, Hamid
2013-01-01
Human granulocyte colony-stimulating factor (hG-CSF) can serve as valuable biopharmaceutical for research and treatment of the human blood cancer. Transplastomic plants have been emerged as a new and high potential candidate for production of recombinant biopharmaceutical proteins in comparison with transgenic plants due to extremely high level expression, biosafety and many other advantages. hG-CSF gene was cloned into pCL vector between prrn16S promoter and TpsbA terminator. The recombinant vector was coated on nanogold particles and transformed to lettuce chloroplasts through biolistic method. Callogenesis and regeneration of cotyledonary explants were obtained by Murashige and Skoog media containing 6-benzylaminopurine and 1-naphthaleneacetic acid hormones. The presence of hG-CSF gene in plastome was studied with four specific PCR primers and expression by Western immunoblotting. hG-CSF gene cloning was confirmed by digestion and sequencing. Transplastomic lettuce lines were regenerated and subjected to molecular analysis. The presence of hG-CSF in plastome was confirmed by PCR using specific primers designed from the plastid genome. Western immunoblotting of extracted protein from transplastomic plants showed a 20-kDa band, which verified the expression of recombinant protein in lettuce chloroplasts. This study is the first report that successfully express hG-CSF gene in lettuce chloroplast. The lettuce plastome can provide a cheap and safe expression platform for producing valuable biopharmaceuticals for research and treatment.
Definition of Contravariant Velocity Components
NASA Technical Reports Server (NTRS)
Hung, Ching-moa; Kwak, Dochan (Technical Monitor)
2002-01-01
In this paper we have reviewed the basics of tensor analysis in an attempt to clarify some misconceptions regarding contravariant and covariant vector components as used in fluid dynamics. We have indicated that contravariant components are components of a given vector expressed as a unique combination of the covariant base vector system and, vice versa, that the covariant components are components of a vector expressed with the contravariant base vector system. Mathematically, expressing a vector with a combination of base vector is a decomposition process for a specific base vector system. Hence, the contravariant velocity components are decomposed components of velocity vector along the directions of coordinate lines, with respect to the covariant base vector system. However, the contravariant (and covariant) components are not physical quantities. Their magnitudes and dimensions are controlled by their corresponding covariant (and contravariant) base vectors.
Strategy to approach stable production of recombinant nattokinase in Bacillus subtilis.
Chen, Po Ting; Chiang, Chung-Jen; Chao, Yun-Peng
2007-01-01
Bacillus subtilis (B. subtilis) is widely accepted as an excellent host cell for the secretory production of recombinant proteins. In this study, a shuttle vector was constructed by fusion of Staphylococcus aureus (S. aureus) plasmid pUB110 with Escherichia coli (E. coli) plasmid pUC18 and used for the expression of nattokinase in B. subtilis. The pUB110/pUC-based plasmid was found to exhibit high structural instability with the identification of a DNA deletion between two repeated regions. An initial attempt was made to eliminate the homologous site in the plasmid, whereas the stability of the resulting plasmid was not improved. In an alternative way, the pUC18-derived region in this hybrid vector was replaced by the suicidal R6K plasmid origin of E. coli. As a consequence, the pUB110/R6K-based plasmid displayed full structural stability, leading to a high-level production of recombinant nattokinase in the culture broth. This was mirrored by the detection of a very low level of high molecular weight DNAs generated by the plasmid. Moreover, 2-fold higher nattokinase production was obtained by B. subtilis strain carrying the pUB110/R6K-based plasmid as compared to the cell with the pAMbeta1-derived vector, a plasmid known to have high structural stability. Overall, it indicates the feasibility of the approach by fusing two compatible plasmid origins for stable and efficient production of recombinant nattokinase in B. subtilis.
Osipiuk, J; Joachimiak, A
1997-09-12
We propose that the dnaK operon of Thermus thermophilus HB8 is composed of three functionally linked genes: dnaK, grpE, and dnaJ. The dnaK and dnaJ gene products are most closely related to their cyanobacterial homologs. The DnaK protein sequence places T. thermophilus in the plastid Hsp70 subfamily. In contrast, the grpE translated sequence is most similar to GrpE from Clostridium acetobutylicum, a Gram-positive anaerobic bacterium. A single promoter region, with homology to the Escherichia coli consensus promoter sequences recognized by the sigma70 and sigma32 transcription factors, precedes the postulated operon. This promoter is heat-shock inducible. The dnaK mRNA level increased more than 30 times upon 10 min of heat shock (from 70 degrees C to 85 degrees C). A strong transcription terminating sequence was found between the dnaK and grpE genes. The individual genes were cloned into pET expression vectors and the thermophilic proteins were overproduced at high levels in E. coli and purified to homogeneity. The recombinant T. thermophilus DnaK protein was shown to have a weak ATP-hydrolytic activity, with an optimum at 90 degrees C. The ATPase was stimulated by the presence of GrpE and DnaJ. Another open reading frame, coding for ClpB heat-shock protein, was found downstream of the dnaK operon.
Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong
2010-01-01
In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.
Sun, Yuan; Li, Hong-Yu; Tian, Da-Yong; Han, Qiu-Ying; Zhang, Xin; Li, Na; Qiu, Hua-Ji
2011-10-26
Low efficacy of gene-based vaccines due to inefficient gene delivery and expression has been major bottleneck of their applications. Efforts have been made to improve the efficacy, such as gene gun and electroporation, but the strategies are difficult to put into practical use. In this study, we developed and evaluated an adenovirus-delivered, alphavirus replicon-vectored vaccine (chimeric vector-based vaccine) expressing the E2 gene of classical swine fever virus (CSFV) (rAdV-SFV-E2). Rabbits immunized with rAdV-SFV-E2 developed CSFV-specific antibodies as early as 9 days and as long as 189 days and completely protected from challenge with C-strain. Pigs immunized with rAdV-SFV-E2 (n=5) developed robust humoral and cell-mediated responses to CSFV and were completely protected from subsequent lethal CSFV infection clinically and virologically. The level of immunity and protection induced by rAdV-SFV-E2 was comparable to that provided by the currently used live attenuated vaccine, C-strain. In contrast, both the conventional alphavirus replicon-vectored vaccine pSFV1CS-E2 and conventional adenovirus-vectored vaccine rAdV-E2 provided incomplete protection. The chimeric vector-based vaccine represents the first gene-based vaccine that is able to confer sterile immunity and complete protection against CSFV. The new-concept vaccination strategy may also be valuable in vaccine development against other pathogens. Copyright © 2011 Elsevier Ltd. All rights reserved.
Frietze, Kathryn M.; Campos, Samuel K.; Kajon, Adriana E.
2010-01-01
Subspecies B1 human adenoviruses (HAdV-B1s) are important causative agents of acute respiratory disease, but the molecular bases of their distinct pathobiology are still poorly understood. Marked differences in genetic content between HAdV-B1s and the well-characterized HAdV-Cs that may contribute to distinct pathogenic properties map to the E3 region. Between the highly conserved E3-19K and E3-10.4K/RIDα open reading frames (ORFs), and in the same location as the HAdV-C ADP/E3-11.6K ORF, HAdV-B1s carry ORFs E3-20.1K and E3-20.5K and a polymorphic third ORF, designated E3-10.9K, that varies in the size of its predicted product among HAdV-B1 serotypes and genomic variants. As an initial effort to define the function of the E3-10.9K ORF, we carried out a biochemical characterization of E3-10.9K-encoded orthologous proteins and investigated their expression in infected cells. Sequence-based predictions suggested that E3-10.9K orthologs with a hydrophobic domain are integral membrane proteins. Ectopically expressed, C-terminally tagged (with enhanced green fluorescent protein [EGFP]) E3-10.9K and E3-9K localized primarily to the plasma membrane, while E3-7.7K localized primarily to a juxtanuclear compartment that could not be identified. EGFP fusion proteins with a hydrophobic domain were N and O glycosylated. EGFP-tagged E3-4.8K, which lacked the hydrophobic domain, displayed diffuse cellular localization similar to that of the EGFP control. E3-10.9K transcripts from the major late promoter were detected at late time points postinfection. A C-terminally hemagglutinin-tagged version of E3-9K was detected by immunoprecipitation at late times postinfection in the membrane fraction of mutant virus-infected cells. These data suggest a role for ORF E3-10.9K-encoded proteins at late stages of HAdV-B1 replication, with potentially important functional implications for the documented ORF polymorphism. PMID:20739542
Interferon regulatory factor 1 and histone H4 acetylation in systemic lupus erythematosus
Leung, Yiu Tak; Shi, Lihua; Maurer, Kelly; Song, Li; Zhang, Zhe; Petri, Michelle; Sullivan, Kathleen E
2015-01-01
Histone acetylation modulates gene expression and has been described as increased in systemic lupus erythematosus (SLE). We investigated interferon regulatory factor 1 (IRF1) interactions that influence H4 acetylation (H4ac) in SLE. Intracellular flow cytometry for H4 acetylated lysine (K) 5, K8, K12, and K16 was performed. Histone acetylation was defined in monocytes and T cells from controls and SLE patients. RNA-Seq studies were performed on monocytes to look for an imbalance in histone acetyltransferases and histone deacetylase enzyme expression. Expression levels were validated using real-time quantitative RT-PCR. IRF1 induction of H4ac was evaluated using D54MG cells overexpressing IRF1. IRF1 protein interactions were studied using co-immunoprecipitation assays. IRF1-dependent recruitment of histone acetyltransferases to target genes was examined by ChIP assays using p300 antibody. Flow cytometry data showed significantly increased H4K5, H4K8, H4K12, and H4K16 acetylation in SLE monocytes. HDAC3 and HDAC11 gene expression were decreased in SLE monocytes. PCAF showed significantly higher gene expression in SLE than controls. IRF1-overexpressing D54MG cells were associated with significantly increased H4K5, H4K8, and H4K12 acetylation compared to vector-control D54MG cells both globally and at specific target genes. Co-immunoprecipitation studies using D54MG cells revealed IRF1 protein-protein interactions with PCAF, P300, CBP, GCN5, ATF2, and HDAC3. ChIP experiments demonstrated increased p300 recruitment to known IRF1 targets in D54MG cells overexpressing IRF1. In contrast, p300 binding to IRF1 targets decreased in D54MG cells with IRF1 knockdown. SLE appears to be associated with an imbalance in histone acetyltransferases and histone deacetylase enzymes favoring pathologic H4 acetylation. Furthermore, IRF1 directly interacts with chromatin modifying enzymes, supporting a model where recruitment to specific target genes is mediated in part by IRF1. PMID:25611806
Golden Gate Assembly of CRISPR gRNA expression array for simultaneously targeting multiple genes.
Vad-Nielsen, Johan; Lin, Lin; Bolund, Lars; Nielsen, Anders Lade; Luo, Yonglun
2016-11-01
The engineered CRISPR/Cas9 technology has developed as the most efficient and broadly used genome editing tool. However, simultaneously targeting multiple genes (or genomic loci) in the same individual cells using CRISPR/Cas9 remain one technical challenge. In this article, we have developed a Golden Gate Assembly method for the generation of CRISPR gRNA expression arrays, thus enabling simultaneous gene targeting. Using this method, the generation of CRISPR gRNA expression array can be accomplished in 2 weeks, and contains up to 30 gRNA expression cassettes. We demonstrated in the study that simultaneously targeting 10 genomic loci or simultaneously inhibition of multiple endogenous genes could be achieved using the multiplexed gRNA expression array vector in human cells. The complete set of plasmids is available through the non-profit plasmid repository Addgene.
Wyatt, Linda S; Xiao, Wei; Americo, Jeffrey L; Earl, Patricia L; Moss, Bernard
2017-06-06
Viruses are used as expression vectors for protein synthesis, immunology research, vaccines, and therapeutics. Advantages of poxvirus vectors include the accommodation of large amounts of heterologous DNA, the presence of a cytoplasmic site of transcription, and high expression levels. On the other hand, competition of approximately 200 viral genes with the target gene for expression and immune recognition may be disadvantageous. We describe a vaccinia virus (VACV) vector that uses an early promoter to express the bacteriophage T7 RNA polymerase; has the A23R intermediate transcription factor gene deleted, thereby restricting virus replication to complementing cells; and has a heterologous gene regulated by a T7 promoter. In noncomplementing cells, viral early gene expression and DNA replication occurred normally but synthesis of intermediate and late proteins was prevented. Nevertheless, the progeny viral DNA provided templates for abundant expression of heterologous genes regulated by a T7 promoter. Selective expression of the Escherichia coli lac repressor gene from an intermediate promoter reduced transcription of the heterologous gene specifically in complementing cells, where large amounts might adversely impact VACV replication. Expression of heterologous proteins mediated by the A23R deletion vector equaled that of a replicating VACV, was higher than that of a nonreplicating modified vaccinia virus Ankara (MVA) vector used for candidate vaccines in vitro and in vivo , and was similarly immunogenic in mice. Unlike the MVA vector, the A23R deletion vector still expresses numerous early genes that can restrict immunogenicity as demonstrated here by the failure of the prototype vector to induce interferon alpha. By deleting immunomodulatory genes, we anticipate further improvements in the system. IMPORTANCE Vaccines provide an efficient and effective way of preventing infectious diseases. Nevertheless, new and better vaccines are needed. Vaccinia virus, which was used successfully as a live vaccine to eradicate smallpox, has been further attenuated and adapted as a recombinant vector for immunization against other pathogens. However, since the initial description of this vector system, only incremental improvements largely related to safety have been implemented. Here we described novel modifications of the platform that increased expression of the heterologous target gene and decreased expression of endogenous vaccinia virus genes while providing safety by preventing replication of the candidate vaccine except in complementing cells used for vector propagation. Copyright © 2017 Wyatt et al.
Beyond linear fields: the Lie–Taylor expansion
2017-01-01
The work extends the linear fields’ solution of compressible nonlinear magnetohydrodynamics (MHD) to the case where the magnetic field depends on superlinear powers of position vector, usually, but not always, expressed in Cartesian components. Implications of the resulting Lie–Taylor series expansion for physical applicability of the Dolzhansky–Kirchhoff (D–K) equations are found to be positive. It is demonstrated how resistivity may be included in the D–K model. Arguments are put forward that the D–K equations may be regarded as illustrating properties of nonlinear MHD in the same sense that the Lorenz equations inform about the onset of convective turbulence. It is suggested that the Lie–Taylor series approach may lead to valuable insights into other fluid models. PMID:28265187
Li, W; Chen, Y-T; Hayashida, Y; Blanco, G; Kheirkah, A; He, H; Chen, S-Y; Liu, C-Y; Tseng, SCG
2010-01-01
Pax6 is the universal master control gene for eye morphogenesis. Other than retina and lens, Pax6 also expressed in the ocular surface epithelium from early gestation until the postnatal stage, in which little is known about the function of Pax6. In this study, corneal pannus tissues from patients with ocular surface diseases such as Stevens–Johnson syndrome (SJS), chemical burn, aniridia and recurrent pterygium were investigated. Our results showed that normal ocular surface epithelial cells expressed Pax6. However, corneal pannus epithelial cells from the above patients showed a decline or absence of Pax6 expression, accompanied by a decline or absence of K12 keratin but an increase of K10 keratin and filaggrin expression. Pannus basal epithelial cells maintained nuclear p63 expression and showed activated proliferation, evidenced by positive Ki67 and K16 keratin staining. On 3T3 fibroblast feeder layers, Pax6 immunostaining was negative in clones generated from epithelial cells harvested from corneal pannus from SJS or aniridia, but positive in those from the normal limbal epithelium; whereas western blots showed that some epithelial clones expanded from pannus retained Pax6 expression. Transient transfection of an adenoviral vector carrying EGFP–Pax6 transgenes into these Pax6− clones increased both Pax6 and K12 keratin expression. These results indicate that Pax6 helps to maintain the normal corneal epithelial phenotype postnatally, and that down-regulation of Pax6 is associated with abnormal epidermal differentiation in severe ocular surface diseases. Reintroduction of activation of the Pax6 gene might be useful in treating squamous metaplasia of the ocular surface epithelium. PMID:18027901
Characterization of a novel Aspergillus oryzae tannase expressed in Pichia pastoris.
Koseki, Takuya; Ichikawa, Kyotaro; Sasaki, Katsuto; Shiono, Yoshihito
2018-05-31
We report the characterization of tannase-encoding gene, AotanB, from Aspergillus oryzae and its recombinant enzyme expressed in Pichia pastoris. The gene except for the signal sequence was cloned into a vector pPICZαA and the recombinant protein was secreted into the medium as an active enzyme. Recombinant AoTanB highly expressed in the incubation at 18°C compared to 30°C. Purified recombinant protein exhibited smeared band with molecular mass of approximately 90-120 kDa by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The recombinant protein yielded molecular mass of 65 kDa after N-deglycosylation. Purified recombinant enzyme had a pH and a temperature optima of 6.0 and 30-35°C, respectively, and was stable up to 40°C. Recombinant AoTanB was able to release gallic acid from natural substrates, such as (-)-catechin gallate, (-)-epicatechin gallate, (-)-gallochatechin gallate, and (-)-epigallocatechin gallate. The enzyme also hydrolyzed ethyl protocatechuate. Meanwhile, no activity was detected toward ethyl 4-hydroxybenzoate. The activity of recombinant AoTanB was lower toward natural substrates compared to that of AoTanA from A. oryzae. The lower catalytic efficiency (k cat /K m value) toward ethyl protocatechuate was due to a combination of increased K m and considerably decreased k cat . Kinetic analysis of the recombinant AoTanB showed that k cat values toward natural substrates decreased compared to those of recombinant AoTanA. Therefore, recombinant AoTanB showed a decrease in catalytic efficiency (k cat /K m value) compared to recombinant AoTanA was due to considerably lower k cat value. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L
2011-12-01
The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.
Kagale, Sateesh; Uzuhashi, Shihomi; Wigness, Merek; Bender, Tricia; Yang, Wen; Borhan, M. Hossein; Rozwadowski, Kevin
2012-01-01
Plant viral expression vectors are advantageous for high-throughput functional characterization studies of genes due to their capability for rapid, high-level transient expression of proteins. We have constructed a series of tobacco mosaic virus (TMV) based vectors that are compatible with Gateway technology to enable rapid assembly of expression constructs and exploitation of ORFeome collections. In addition to the potential of producing recombinant protein at grams per kilogram FW of leaf tissue, these vectors facilitate either N- or C-terminal fusions to a broad series of epitope tag(s) and fluorescent proteins. We demonstrate the utility of these vectors in affinity purification, immunodetection and subcellular localisation studies. We also apply the vectors to characterize protein-protein interactions and demonstrate their utility in screening plant pathogen effectors. Given its broad utility in defining protein properties, this vector series will serve as a useful resource to expedite gene characterization efforts. PMID:23166857
Purification and properties of insulin receptor ectodomain from large-scale mammalian cell culture.
Cosgrove, L; Lovrecz, G O; Verkuylen, A; Cavaleri, L; Black, L A; Bentley, J D; Howlett, G J; Gray, P P; Ward, C W; McKern, N M
1995-12-01
Ectodomain of the exon 11+ form of the human insulin receptor (hIR) was expressed in the mammalian cell secretion vector pEE6.HCMV-GS, containing the glutamine synthetase gene. Following transfection of the hIR ectodomain gene into Chinese hamster ovary (CHO-K1) cells, clones were isolated by selecting for glutamine synthetase expression with methionine sulphoximine. The expression levels of ectodomain were subsequently increased by gene amplification. Production was scaled up using a 40-liter airlift fermenter in which the transfected CHO-K1 cells were cultured on microcarrier beads, initially in medium containing 10% fetal calf serum (FCS). By continuous perfusion of serum-free medium into the bioreactor, cell viability was maintained during reduction of FCS, which enabled soluble hIR ectodomain to be harvested for at least 22 days. Harvests were concentrated 20-fold by anion-exchange chromatography. Optimal recovery of ectodomain from early harvests containing large quantities of serum proteins was achieved by insulin-affinity chromatography, whereas in later harvests purification was achieved by multistep chromatography. Analysis of the purified hIR ectodomain showed that it had a molecular weight by sedimentation equilibrium analysis of 269,500. Amino-terminal amino acid sequence analysis showed that the ectodomain was correctly processed to alpha and beta chains and that glycosylation characteristics were similar to those of native hIR. The integrity of the ectodomain was demonstrated by the recognition of conformation-dependent anti-hIR antibodies and by its binding of insulin (Kd approximately 2 x 10(-9) M). These results demonstrate the successful production and purification of hIR ectodomain by processes amenable to scale-up and in a form appropriate for structure/function studies of the ligand-binding domain of the receptor.
Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi
2017-07-21
Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.
Miklík, Dalibor; Šenigl, Filip; Hejnar, Jiří
2018-01-01
Individual groups of retroviruses and retroviral vectors differ in their integration site preference and interaction with the host genome. Hence, immediately after infection genome-wide distribution of integrated proviruses is non-random. During long-term in vitro or persistent in vivo infection, the genomic position and chromatin environment of the provirus affects its transcriptional activity. Thus, a selection of long-term stably expressed proviruses and elimination of proviruses, which have been gradually silenced by epigenetic mechanisms, helps in the identification of genomic compartments permissive for proviral transcription. We compare here the extent and time course of provirus silencing in single cell clones of the K562 human myeloid lymphoblastoma cell line that have been infected with retroviral reporter vectors derived from avian sarcoma/leukosis virus (ASLV), human immunodeficiency virus type 1 (HIV) and murine leukaemia virus (MLV). While MLV proviruses remain transcriptionally active, ASLV proviruses are prone to rapid silencing. The HIV provirus displays gradual silencing only after an extended time period in culture. The analysis of integration sites of long-term stably expressed proviruses shows a strong bias for some genomic features—especially integration close to the transcription start sites of active transcription units. Furthermore, complex analysis of histone modifications enriched at the site of integration points to the accumulation of proviruses of all three groups in gene regulatory segments, particularly close to the enhancer loci. We conclude that the proximity to active regulatory chromatin segments correlates with stable provirus expression in various retroviral species. PMID:29517993
SASH1 regulates proliferation, apoptosis, and invasion of osteosarcoma cell.
Meng, Qingbing; Zheng, Minqian; Liu, Hongbing; Song, Changzhi; Zhang, Wensheng; Yan, Juan; Qin, Ling; Liu, Xiaolan
2013-01-01
SASH1, a member of the SLY-family of signal adapter proteins, is a candidate tumor suppressor in breast and colon cancer. The SASH1 protein possesses both the SH3 and SAM domains, indicating that it may play an important role in intracellular signal transduction. Reduced expression of SASH1 is closely related to tumor growth, invasion, metastasis, and poor prognosis. However, the biological role of SASH1 remains unknown in osteosarcoma. To unravel the function of SASH1, we explored the expression of SASH1 in osteosarcoma tissues and its correlation to the clinical pathology of osteosarcoma and analyzed the relationship between SASH1 expression and cell cycle, apoptosis and invasion of osteosarcoma MG-63 cells, using the flow cytometry analysis and transwell invasion chamber experiments. Furthermore, the effect of SASH1 on the expression of cyclin D1, caspase-3, matrix metalloproteinase (MMP)-9 were observed by western blot. Our results showed that the expression rate of SASH1 mRNA in osteosarcoma tissues was significantly lower than that in normal bone tissue (p = 0.000), that the expression rate of SASH1 mRNA in the carcinoma tissues from patients with lung metastasis was significantly lower than that from patients without lung metastasis (p = 0.041), and that the expression rate of SASH1 mRNA also decreased with increasing Enneking stage (p = 0.032). However, the mRNA expression of SASH1 in osteosarcoma was independent of the patient's gender, age, and tumor size (p = 0.983, 0.343, 0.517, respectively). The SASH1 protein displayed a down-regulation in osteosarcoma tissues compared to normal bone tissue (p = 0.000), displayed a down-regulation in osteosarcoma tissues from patients with lung metastasis compared to from patients without lung metastasis (p = 0.000), and displayed a gradual decrease with increasing Enneking stage (p = 0.000). In addition, the MG-63 cells from pcDNA3.1-SASH1 group exhibited significantly reduced cell viability, proliferation, and invasive ability compared to the empty vector group and blank control group (p = 0.023, 0.001, respectively), and there was no difference between the empty vector group and blank control group. The pcDNA3.1-SASH1 group displayed significantly more apoptotic cells than the empty vector group and blank control group (p = 0.004). The expression of cyclin D1, MMP-9 displayed a down-regulation in MG-63 cells from pcDNA3.1-SASH1 group compared to the empty vector group and blank control group (p = 0.000, 0.001, respectively) and the expression levels of caspase-3 displayed an up-regulation in MG-63 cells from pcDNA3.1-SASH1 group compared to the empty vector group and blank control group (p = 0.000). Taken together, these data indicated that the overexpression of SASH1 might be associated with the inhibition of growth, proliferation, and invasion of MG-63 cells and the promotion of apoptosis of MG-63 cells.
Heating Parameter Estimation Using Coaxial Thermocouple Gages in Wind Tunnel Test Articles.
1984-12-01
Attack a Emissivity G Parameter Vector Pn Measurement Vector at nth Time Point p Density 0 Stefan-Boltzmann Constant 6 Transition Matrix APc Scaling...for. The radiation is modeled using the Stefan-Boltzmann Law, q = 60(U 4 - U, 4 ) (A-9) where 8 radiative emissivity a Stefan-Bol tzmann constant U...w00 I- 000 0 0111c :0 i zZ Z-4lwr I- E . - t J K - IL HHO "W 6i 0WZWZWO&000OW *0 . 0 - .- - -4 4 1"- 1 Lii w LiiU Li LI Li Lij Liw w ~ o 0 0wm ~wW6~w d
Nakashima, N; Tamura, T
2013-06-01
Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.
Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M
2001-04-01
Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.
Van Ba, Hoa; Hwang, Inho
2014-02-01
Caspase-9 has been reported as the key regulator of apoptosis, however, its role in skeletal myoblast development and molecular involvements during cell growth still remains unknown. The current study aimed to present the key role of caspase-9 in the expressions of apoptotic caspases and genome, and cell viability during myoblast growth using RNA interference mediated silencing. Three small interference RNA sequences (siRNAs) targeting caspase-9 gene was designed and ligated into pSilencer plasmid vector to construct shRNA expression constructs. Cells were transfected with the constructs for 48 h. Results indicated that all three siRNAs could silence the caspase-9 mRNA expression significantly. Particularly, the mRNA expression level of caspase-9 in the cells transfected by shRNA1, shRNA2 and shRNA3 constructs were reduced by 37.85%, 68.20% and 58.14%, respectively. Suppression of caspase-9 led to the significant increases in the mRNA and protein expressions of effector caspase-3, whereas the reduction in mRNA and protein expressions of caspase-7. The microarray results showed that the suppression of caspase-9 resulted in significant upregulations of cell proliferation-, adhesion-, growth-, development- and division-regulating genes, whereas the reduction in the expressions of cell death program- and stress response-regulating genes. Furthermore, cell viability was significantly increased following the transfection. These data suggest that caspase-9 could play an important role in the control of cell growth, and knockdown of caspase-9 may have genuine potential in the treatment of skeletal muscle atrophy. © 2013 The Authors Development, Growth & Differentiation © 2013 Japanese Society of Developmental Biologists.
Recent Advances in Preclinical Developments Using Adenovirus Hybrid Vectors.
Ehrke-Schulz, Eric; Zhang, Wenli; Gao, Jian; Ehrhardt, Anja
2017-10-01
Adenovirus (Ad)-based vectors are efficient gene-transfer vehicles to deliver foreign DNA into living organisms, offering large cargo capacity and low immunogenicity and genotoxicity. As Ad shows low integration rates of their genomes into host chromosomes, vector-derived gene expression decreases due to continuous cell cycling in regenerating tissues and dividing cell populations. To overcome this hurdle, adenoviral delivery can be combined with mechanisms leading to maintenance of therapeutic DNA and long-term effects of the desired treatment. Several hybrid Ad vectors (AdV) exploiting various strategies for long-term treatment have been developed and characterized. This review summarizes recent developments of preclinical approaches using hybrid AdVs utilizing either the Sleeping Beauty transposase system for somatic integration into host chromosomes or designer nucleases, including transcription activator-like effector nucleases and clustered regularly interspaced short palindromic repeats/CRISPR-associated protein-9 nuclease for permanent gene editing. Further options on how to optimize these vectors further are discussed, which may lead to future clinical applications of these versatile gene-therapy tools.
Characterization of the Eimeria maxima sporozoite surface protein IMP1.
Jenkins, M C; Fetterer, R; Miska, K; Tuo, W; Kwok, O; Dubey, J P
2015-07-30
The purpose of this study was to characterize Eimeria maxima immune-mapped protein 1 (IMP1) that is hypothesized to play a role in eliciting protective immunity against E. maxima infection in chickens. RT-PCR analysis of RNA from unsporulated and sporulating E. maxima oocysts revealed highest transcription levels at 6-12h of sporulation with a considerable downregulation thereafter. Alignment of IMP1 coding sequence from Houghton, Weybridge, and APU-1 strains of E. maxima revealed single nucleotide polymorphisms that in some instances led to amino acid changes in the encoded protein sequence. The E. maxima (APU-1) IMP1 cDNA sequence was cloned and expressed in 2 different polyHis Escherichia coli expression vectors. Regardless of expression vector, recombinant E. maxima IMP1 (rEmaxIMP1) was fairly unstable in non-denaturing buffer, which is consistent with stability analysis of the primary amino acid sequence. Antisera specific for rEmaxIMP1 identified a single 72 kDa protein or a 61 kDa protein by non-reducing or reducing SDS-PAGE/immunoblotting. Immunofluorescence staining with anti-rEmaxIMP1, revealed intense surface staining of E. maxima sporozoites, with negligible staining of merozoite stages. Immuno-histochemical staining of E. maxima-infected chicken intestinal tissue revealed staining of E. maxima developmental stages in the lamnia propia and crypts at both 24 and 48 h post-infection, and negligible staining thereafter. The expression of IMP1 during early stages of in vivo development and its location on the sporozoite surface may explain in part the immunoprotective effect of this protein against E. maxima infection. Published by Elsevier B.V.
Development of a novel set of Gateway-compatible vectors for live imaging in insect cells.
Maroniche, G A; Mongelli, V C; Alfonso, V; Llauger, G; Taboga, O; del Vas, Mariana
2011-10-01
Insect genomics is a growing area of research. To exploit fully the genomic data that are being generated, high-throughput systems for the functional characterization of insect proteins and their interactomes are required. In this work, a Gateway-compatible vector set for expression of fluorescent fusion proteins in insect cells was developed. The vector set was designed to express a protein of interest fused to any of four different fluorescent proteins [green fluorescent protein (GFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP) and mCherry] by either the C-terminal or the N-terminal ends. Additionally, a collection of organelle-specific fluorescent markers was assembled for colocalization with fluorescent recombinant proteins of interest. Moreover, the vector set was proven to be suitable for simultaneously detecting up to three proteins by multiple labelling. The use of the vector set was exemplified by defining the subcellular distribution of Mal de Río Cuarto virus (MRCV) outer coat protein P10 and by analysing the in vivo self-interaction of the MRCV viroplasm matrix protein P9-1 in Förster resonance energy transfer (FRET) experiments. In conclusion, we have developed a valuable tool for high-throughput studies of protein subcellular localization that will aid in the elucidation of the function of newly described insect and virus proteins. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.
Gidlöf, Olof; Johnstone, Andrea L; Bader, Kerstin; Khomtchouk, Bohdan B; O'Reilly, Jiaqi J; Celik, Selvi; Van Booven, Derek J; Wahlestedt, Claes; Metzler, Bernhard; Erlinge, David
2016-12-22
Ischemic preconditioning (IPC) protects the heart from prolonged ischemic insult and reperfusion injury through a poorly understood mechanism. Post-translational modifications of histone residues can confer rapid and drastic switches in gene expression in response to various stimuli, including ischemia. The aim of this study was to investigate the effect of histone methylation in the response to cardiac ischemic preconditioning. We used cardiac biopsies from mice subjected to IPC to quantify global levels of 3 of the most well-studied histone methylation marks (H3K9me2, H3K27me3, and H3K4me3) with Western blot and found that H3K9me2 levels were significantly increased in the area at risk compared to remote myocardium. In order to assess which genes were affected by the increase in H3K9me2 levels, we performed ChIP-Seq and transcriptome profiling using microarray. Two hundred thirty-seven genes were both transcriptionally repressed and enriched in H3K9me2 in the area at risk of IPC mice. Of these, Mtor (Mechanistic target of rapamycin) was chosen for mechanistic studies. Knockdown of the major H3K9 methyltransferase G9a resulted in a significant decrease in H3K9me2 levels across Mtor, increased Mtor expression, as well as decreased autophagic activity in response to rapamycin and serum starvation. IPC confers an increase of H3K9me2 levels throughout the Mtor gene-a master regulator of cellular metabolism and a key player in the cardioprotective effect of IPC-leading to transcriptional repression via the methyltransferase G9a. The results of this study indicate that G9a has an important role in regulating cardiac autophagy and the cardioprotective effect of IPC. © 2016 The Authors and University of Miami Miller School of Medicine. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.
Jung, Inuk; Jo, Kyuri; Kang, Hyejin; Ahn, Hongryul; Yu, Youngjae; Kim, Sun
2017-12-01
Identifying biologically meaningful gene expression patterns from time series gene expression data is important to understand the underlying biological mechanisms. To identify significantly perturbed gene sets between different phenotypes, analysis of time series transcriptome data requires consideration of time and sample dimensions. Thus, the analysis of such time series data seeks to search gene sets that exhibit similar or different expression patterns between two or more sample conditions, constituting the three-dimensional data, i.e. gene-time-condition. Computational complexity for analyzing such data is very high, compared to the already difficult NP-hard two dimensional biclustering algorithms. Because of this challenge, traditional time series clustering algorithms are designed to capture co-expressed genes with similar expression pattern in two sample conditions. We present a triclustering algorithm, TimesVector, specifically designed for clustering three-dimensional time series data to capture distinctively similar or different gene expression patterns between two or more sample conditions. TimesVector identifies clusters with distinctive expression patterns in three steps: (i) dimension reduction and clustering of time-condition concatenated vectors, (ii) post-processing clusters for detecting similar and distinct expression patterns and (iii) rescuing genes from unclassified clusters. Using four sets of time series gene expression data, generated by both microarray and high throughput sequencing platforms, we demonstrated that TimesVector successfully detected biologically meaningful clusters of high quality. TimesVector improved the clustering quality compared to existing triclustering tools and only TimesVector detected clusters with differential expression patterns across conditions successfully. The TimesVector software is available at http://biohealth.snu.ac.kr/software/TimesVector/. sunkim.bioinfo@snu.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com
Shi, Weimin; Zhang, Xiaoya; Shen, Qi
2010-01-01
Quantitative structure-activity relationship (QSAR) study of chemokine receptor 5 (CCR5) binding affinity of substituted 1-(3,3-diphenylpropyl)-piperidinyl amides and ureas and toxicity of aromatic compounds have been performed. The gene expression programming (GEP) was used to select variables and produce nonlinear QSAR models simultaneously using the selected variables. In our GEP implementation, a simple and convenient method was proposed to infer the K-expression from the number of arguments of the function in a gene, without building the expression tree. The results were compared to those obtained by artificial neural network (ANN) and support vector machine (SVM). It has been demonstrated that the GEP is a useful tool for QSAR modeling. Copyright 2009 Elsevier Masson SAS. All rights reserved.
Bekdash, Rola A; Zhang, Changqing; Sarkar, Dipak K
2013-07-01
Prenatal exposure to ethanol (EtOH) reduces the expression of hypothalamic proopiomelanocortin (POMC) gene, known to control various physiological functions including the organismal stress response. In this study, we determined whether the changes in POMC neuronal functions are associated with altered expressions of histone-modifying and DNA-methylating enzymes in POMC-producing neurons, because these enzymes are known to be involved in regulation of gene expression. In addition, we tested whether gestational choline supplementation prevents the adverse effects of EtOH on these neurons. Pregnant rat dams were fed with alcohol-containing liquid diet or control diet during gestational days 7 and 21 with or without choline, and their male offspring rats were used during the adult period. Using double-immunohistochemistry, real-time reverse transcription polymerase chain reaction (RT-PCR) and methylation-specific RT-PCR, we determined protein and mRNA levels of histone-modifying and DNA-methylating enzymes and the changes in POMC gene methylation and expression in the hypothalamus of adult male offspring rats. Additionally, we measured the basal- and lipopolysaccharide (LPS)-induced corticosterone levels in plasma by enzyme-linked immunosorbent assay. Prenatal EtOH treatment suppressed hypothalamic levels of protein and mRNA of histone activation marks (H3K4me3, Set7/9, acetylated H3K9, phosphorylated H3S10), and increased the repressive marks (H3K9me2, G9a, Setdb1), DNA-methylating enzyme (Dnmt1), and the methyl-CpG-binding protein (MeCP2). The treatment also elevated the level of POMC gene methylation, while it reduced levels of POMC mRNA and β-EP and elevated corticosterone response to LPS. Gestational choline normalized the EtOH-altered protein and the mRNA levels of H3K4me3, Set7/9, H3K9me2, G9a, Setdb1, Dnmt1, and MeCP2. It also normalizes the changes in POMC gene methylation and gene expression, β-EP production, and the corticosterone response to LPS. These data suggest that prenatal EtOH modulates histone and DNA methylation in POMC neurons that may be resulting in hypermethylation of POMC gene and reduction in POMC gene expression. Gestational choline supplementation prevents the adverse effects of EtOH on these neurons. Copyright © 2013 by the Research Society on Alcoholism.
Multi-q crystal and magnetic structure in TbMnO3: Evidence for a Soliton-lattice
NASA Astrophysics Data System (ADS)
Aliouane, N.; Strempfer, J.; Caliebe, W.
2005-03-01
In TbMnO3, Mn-spins order with a sinusoidal antiferromagnetic (AF) propagation wave vector QMn=[0,k+/-q,l] (q˜0.288b^*) at TN(Mn)=41K. The propagation vector QMn varies with temperature on cooling until TLock(Mn) ˜30K, which coincides with a ferroelectric transition. In addition to QMn reflections we find magnetic reflections at 3QMn. Our X-ray measurements show that the magneto-elastic coupling gives rise to a structural modulation at twice the magnetic wavevector (2QMn). Field cooling the sample under a magnetic field oriented along the a-direction with H>9T shows that all magnetic wavevectors for Mn and Tb collapse to a single q structure with Q=[0,1/4,0], an up-up, down-down phase, and coincide with anomalies in the polarization. We argue that the temperature and field dependence of the magnetic and superlattice reflections are consistent with a soliton formalism which predicts a stable commensurate single q=1/4 phase [1]. [1] Kimura et al., PRB 68, 60403(2003).
Adenovirus-mediated p53 gene delivery inhibits 9L glioma growth in rats.
Badie, B; Drazan, K E; Kramar, M H; Shaked, A; Black, K L
1995-06-01
Adenoviral vectors have recently been shown to effectively deliver genes into a variety of tissues. Since these vectors have some advantages over the more extensively investigated retroviruses, we studied the effect of two replication-defective adenovectors bearing human wild type tumor suppressor gene p53 (Adp53) and Escherichia coli beta-galactosidase gene (AdLacZ) on 9L glioma cells. Successful in vitro gene transfer was shown by DNA polymerase chain reaction (PCR), and expression was confirmed by reverse transcriptase RNA PCR and Western blot analyses. Transduction of 9L cells with the Adp53 inhibited cell growth and induced phenotypic changes consistent with cell death at low titers, while AdLacZ caused cytopathic changes only at high titers. Stereotactic injection of AdLacZ (10(7) plaque forming units) into tumor bed stained 25 to 30% of tumor cells at the site of vector delivery. Injection of Adp53 (10(7) plaque forming units), but not AdLacZ (controls), into established 4-day old 9L glioma brain tumors decreased tumor volume by 40% after 14 days. As a step toward gene therapy of brain tumors using replication-defective adenoviruses, these data support the use of tumor suppressor gene transfer for in vivo treatment of whole animal brain tumor models.
Quantized Vector Potential and the Photon Wave-function
NASA Astrophysics Data System (ADS)
Meis, C.; Dahoo, P. R.
2017-12-01
The vector potential function {\\overrightarrow{α }}kλ (\\overrightarrow{r},t) for a k-mode and λ-polarization photon, with the quantized amplitude α 0k (ω k ) = ξω k , satisfies the classical wave propagation equation as well as the Schrodinger’s equation with the relativistic massless Hamiltonian \\mathop{H}\\limits∼ =-i\\hslash c\\overrightarrow{\
Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A
2009-12-30
Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.
2012-01-01
Background Histone H3 lysine 27 tri-methylation and lysine 9 di-methylation are independent repressive chromatin modifications in Arabidopsis thaliana. H3K27me3 is established and maintained by Polycomb repressive complexes whereas H3K9me2 is catalyzed by SUVH histone methyltransferases. Both modifications can spread to flanking regions after initialization and were shown to be mutually exclusive in Arabidopsis. Results We analyzed the extent of natural variation of H3K27me3 in the two accessions Landsberg erecta (Ler) and Columbia (Col) and their F1 hybrids. The majority of H3K27me3 target genes in Col were unchanged in Ler and F1 hybrids. A small number of Ler-specific targets were detected and confirmed. Consistent with a cis-regulatory mechanism for establishing H3K27me3, differential targets showed allele-specific H3K27me3 in hybrids. Five Ler-specific targets showed the active mark H3K4me3 in Col and for this group, differential H3K27me3 enrichment accorded to expression variation. On the other hand, the majority of Ler-specific targets were not expressed in Col, Ler or 17 other accessions. Instead of H3K27me3, the antagonistic mark H3K9me2 and other heterochromatic features were observed at these loci in Col. These loci were frequently flanked by transposable elements, which were often missing in the Ler genome assembly. Conclusion There is little variation in H3K27me3 occupancy within the species, although H3K27me3 targets were previously shown as overrepresented among differentially expressed genes. The existing variation in H3K27me3 seems mostly explained by flanking polymorphic transposable elements. These could nucleate heterochromatin, which then spreads into neighboring H3K27me3 genes, thus converting them to H3K9me2 targets. PMID:23253144
Characterization of arginine decarboxylase from Dianthus caryophyllus.
Ha, Byung Hak; Cho, Ki Joon; Choi, Yu Jin; Park, Ky Young; Kim, Kyung Hyun
2004-04-01
Arginine decarboxylase (ADC, EC 4.1.1.9) is a key enzyme in the biosynthesis of polyamines in higher plants, whereas ornithine decarboxylase represents the sole pathway of polyamine biosynthesis in animals. Previously, we characterized a genomic clone from Dianthus caryophyllus, in which the deduced polypeptide of ADC was 725 amino acids with a molecular mass of 78 kDa. In the present study, the ADC gene was subcloned into the pGEX4T1 expression vector in combination with glutathione S-transferase (GST). The fusion protein GST-ADC was water-soluble and thus was purified by sequential GSTrap-arginine affinity chromatography. A thrombin-mediated on-column cleavage reaction was employed to release free ADC from GST. Hiload superdex gel filtration FPLC was then used to obtain a highly purified ADC. The identity of the ADC was confirmed by immunoblot analysis, and its specific activity with respect to (14)C-arginine decarboxylation reaction was determined to be 0.9 CO(2) pkat mg(-1) protein. K(m) and V(max) of the reaction between ADC and the substrate were 0.077 +/- 0.001 mM and 6.0 +/- 0.6 pkat mg(-1) protein, respectively. ADC activity was reduced by 70% in the presence of 0.1 mM Cu(2+) or CO(2+), but was only marginally affected by Mg(2+), or Ca(2+) at the same concentration. Moreover, spermine at 1 mM significantly reduced its activity by 30%.
Weak localization of magnons in chiral magnets
NASA Astrophysics Data System (ADS)
Evers, Martin; Müller, Cord A.; Nowak, Ulrich
2018-05-01
We report on the impact of the Dzyaloshinskii-Moriya interaction on the coherent backscattering of spin waves in a disordered magnetic material. This interaction breaks the inversion symmetry of the spin-wave dispersion relation, such that ωk=ω2 KI-k≠ω-k , where KI is related to the Dzyaloshinskii-Moriya vectors. The nonequivalence of k and -k also means that time-reversal symmetry is broken. As a result of numerical investigations we find that the backscattering peak of a wave packet with initial wave vector k0 shifts from -k0 to 2 KI-k0 , such that the backscattering wave vector and the initial wave vector are in general no longer antiparallel. The shifted coherence condition is explained by a diagrammatic approach and opens up an avenue to measure sign and magnitude of the Dzyaloshinskii-Moriya interaction in weakly disordered chiral magnets. Surprisingly, although time-reversal symmetry is broken, our system shows coherent backscattering as a manifestation of weak localization, which is due to the fact that reciprocity is still preserved.
A Framework for Event Prioritization in Cyber Network Defense
2014-07-15
U.S.," Reuters (US online Edition), pp. http://www.reuters.com/article/2013/11/06/net-us-usa-china- hacking - idUSBRE9A51AN20131106, 6 Nov 2013. [2...expressed individually, or as a single vector by using the magnitude of these three factors (cell J5 in Table 5
Zeng, Juan; Yang, Shumei; Wang, Xiaorui; Gao, Yan; Zhang, Mei
2017-01-01
The aim of the present study was to investigate the effects of human papillomavirus (HPV) infection on the gynecological disease of vaginitis and to demonstrate how the small interfering RNA (siRNA) method may be used for HPV prevention in the clinic. Human vaginal epithelial cells were transfected with HPV-11 L1 expression vector and siRNA-HPV-11 L1 vectors and a control group was transfected with scrambled siRNA. Cell proliferation in each group was analyzed using the MTT assay and the expression of apoptosis-associated proteins was measured by western blot analysis. Compared with the control group, HPV-11 L1 mRNA and protein levels were significantly increased following transfection with the HPV-11 L1 expression vector in cells (P<0.05), but this result was significantly reversed by silencing of HPV-11 L1 (P<0.05). In addition, cell proliferation in the HPV-11 group was lower than that in the control group; however, cell proliferation was significantly increased in cells transfected with silenced L1 compared with that in the control group (P<0.05). Furthermore, silencing of HPV-11 L1 significantly decreased caspase-3 and caspase-9 expressions in cells, whereas the expression was increased in the HPV-11 L1 group (P<0.05). The present study suggested that siRNA-mediated silencing of HPV-11 L1 may have potential therapeutic applications for treating gynecological diseases associated with HPV-11 infection. PMID:28413509
Venkatesan, Jagadeesh Kumar; Moutos, Franklin T; Rey-Rico, Ana; Estes, Bradley T; Frisch, Janina; Schmitt, Gertrud; Madry, Henning; Guilak, Farshid; Cucchiarini, Magali
2018-05-02
Combining gene therapy approaches with tissue engineering procedures is an active area of translational research for the effective treatment of articular cartilage lesions, especially to target chondrogenic progenitor cells such as those derived from the bone marrow. Here, we evaluated the effect of genetically modifying concentrated human mesenchymal stem cells from bone marrow to induce chondrogenesis by recombinant adeno-associated viral (rAAV) vector gene transfer of the sex-determining region Y-type high-mobility group box 9 (SOX9) factor upon seeding in three-dimensional (3D) woven poly(ε-caprolactone) (PCL) scaffolds that provide mechanical properties mimicking those of native articular cartilage. Prolonged, effective SOX9 expression was reported in the constructs for at least 21 days, the longest time point evaluated, leading to enhanced metabolic and chondrogenic activities relative to the control conditions (reporter lacZ gene transfer or absence of vector treatment) but without affecting the proliferative activities in the samples. The application of the rAAV SOX9 vector also prevented undesirable hypertrophic and terminal differentiation in the seeded concentrates. As bone marrow is readily accessible during surgery, such findings reveal the therapeutic potential of providing rAAV-modified marrow concentrates within 3D woven PCL scaffolds for repair of focal cartilage lesions.
Zhang, Yadong; Yue, Yongping; Li, Liang; Hakim, Chady H; Zhang, Keqing; Thomas, Gail D; Duan, Dongsheng
2013-09-15
Neuronal nitric oxide synthase (nNOS) membrane delocalization contributes to the pathogenesis of Duchenne muscular dystrophy (DMD) by promoting functional muscle ischemia and exacerbating muscle injury during exercise. We have previously shown that supra-physiological expression of nNOS-binding mini-dystrophin restores normal blood flow regulation and prevents functional ischemia in transgenic mdx mice, a DMD model. A critical next issue is whether systemic dual adeno-associated virus (AAV) gene therapy can restore nNOS-binding mini-dystrophin expression and mitigate muscle activity-related functional ischemia and injury. Here, we performed systemic gene transfer in mdx and mdx4cv mice using a pair of dual AAV vectors that expressed a 6 kb nNOS-binding mini-dystrophin gene. Vectors were packaged in tyrosine mutant AAV-9 and co-injected (5 × 10(12) viral genome particles/vector/mouse) via the tail vein to 1-month-old dystrophin-null mice. Four months later, we observed 30-50% mini-dystrophin positive myofibers in limb muscles. Treatment ameliorated histopathology, increased muscle force and protected against eccentric contraction-induced injury. Importantly, dual AAV therapy successfully prevented chronic exercise-induced muscle force drop. Doppler hemodynamic assay further showed that therapy attenuated adrenergic vasoconstriction in contracting muscle. Our results suggest that partial transduction can still ameliorate nNOS delocalization-associated functional deficiency. Further evaluation of nNOS binding mini-dystrophin dual AAV vectors is warranted in dystrophic dogs and eventually in human patients.
NASA Astrophysics Data System (ADS)
von Allwörden, Henning; Eich, Andreas; Knol, Elze J.; Hermenau, Jan; Sonntag, Andreas; Gerritsen, Jan W.; Wegner, Daniel; Khajetoorians, Alexander A.
2018-03-01
We describe the design and performance of a scanning tunneling microscope (STM) that operates at a base temperature of 30 mK in a vector magnetic field. The cryogenics is based on an ultra-high vacuum (UHV) top-loading wet dilution refrigerator that contains a vector magnet allowing for fields up to 9 T perpendicular and 4 T parallel to the sample. The STM is placed in a multi-chamber UHV system, which allows in situ preparation and exchange of samples and tips. The entire system rests on a 150-ton concrete block suspended by pneumatic isolators, which is housed in an acoustically isolated and electromagnetically shielded laboratory optimized for extremely low noise scanning probe measurements. We demonstrate the overall performance by illustrating atomic resolution and quasiparticle interference imaging and detail the vibrational noise of both the laboratory and microscope. We also determine the electron temperature via measurement of the superconducting gap of Re(0001) and illustrate magnetic field-dependent measurements of the spin excitations of individual Fe atoms on Pt(111). Finally, we demonstrate spin resolution by imaging the magnetic structure of the Fe double layer on W(110).
von Allwörden, Henning; Eich, Andreas; Knol, Elze J; Hermenau, Jan; Sonntag, Andreas; Gerritsen, Jan W; Wegner, Daniel; Khajetoorians, Alexander A
2018-03-01
We describe the design and performance of a scanning tunneling microscope (STM) that operates at a base temperature of 30 mK in a vector magnetic field. The cryogenics is based on an ultra-high vacuum (UHV) top-loading wet dilution refrigerator that contains a vector magnet allowing for fields up to 9 T perpendicular and 4 T parallel to the sample. The STM is placed in a multi-chamber UHV system, which allows in situ preparation and exchange of samples and tips. The entire system rests on a 150-ton concrete block suspended by pneumatic isolators, which is housed in an acoustically isolated and electromagnetically shielded laboratory optimized for extremely low noise scanning probe measurements. We demonstrate the overall performance by illustrating atomic resolution and quasiparticle interference imaging and detail the vibrational noise of both the laboratory and microscope. We also determine the electron temperature via measurement of the superconducting gap of Re(0001) and illustrate magnetic field-dependent measurements of the spin excitations of individual Fe atoms on Pt(111). Finally, we demonstrate spin resolution by imaging the magnetic structure of the Fe double layer on W(110).
Lausberg, Frank; Chattopadhyay, Ava Rebecca; Heyer, Antonia; Eggeling, Lothar; Freudl, Roland
2012-09-01
Here we report on the construction of a tetracycline inducible expression vector that allows a tightly regulable gene expression in Corynebacterium glutamicum which is used in industry for production of small molecules such as amino acids. Using the green fluorescent protein (GFP) as a reporter protein we show that this vector, named pCLTON1, is characterized by tight repression under non-induced conditions as compared to a conventional IPTG inducible expression vector, and that it allows gradual GFP synthesis upon gradual increase of anhydrotetracycline addition. Copyright © 2012 Elsevier Inc. All rights reserved.
Silencing Intersectin 1 Slows Orthotopic Neuroblastoma Growth in Mice.
Harris, Jamie; Herrero-Garcia, Erika; Russo, Angela; Kajdacsy-Balla, Andre; O'Bryan, John P; Chiu, Bill
2017-11-01
Neuroblastoma accounts for 15% of all pediatric cancer deaths. Intersectin 1 (ITSN1), a scaffold protein involved in phosphoinositide 3-kinase (PI3K) signaling, regulates neuroblastoma cells independent of MYCN status. We hypothesize that by silencing ITSN1 in neuroblastoma cells, tumor growth will be decreased in an orthotopic mouse tumor model. SK-N-AS neuroblastoma cells transfected with empty vector (pSR), vectors expressing scrambled shRNA (pSCR), or shRNAs targeting ITSN1 (sh#1 and sh#2) were used to create orthotopic neuroblastoma tumors in mice. Volume was monitored weekly with ultrasound. End-point was tumor volume >1000 mm. Tumor cell lysates were analyzed with anti-ITSN1 antibody by Western blot. Orthotopic tumors were created in all cell lines. Twenty-five days post injection, pSR tumor size was 917.6±247.7 mm, pSCR was 1180±159.9 mm, sh#1 was 526.3±212.8 mm, and sh#2 was 589.2±74.91 mm. sh#1-tumors and sh#2-tumors were smaller than pSCR (P=0.02), no difference between sh#1 and sh#2. Survival was superior in sh#2-tumors (P=0.02), trended towards improved survival in sh#1-tumors (P=0.09), compared with pSCR-tumors, no difference in pSR tumors. Western blot showed decreased ITSN1 expression in sh#1 and sh#2 compared with pSR and pSCR. Silencing ITSN1 in neuroblastoma cells led to decreased tumor growth in an orthotopic mouse model. Orthotopic animal models can provide insight into the role of ITSN1 pathways in neuroblastoma tumorigenesis.
NASA Astrophysics Data System (ADS)
Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.
2015-09-01
A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.
Sun, Han; Luo, Liqun; Lal, Bachchu; Ma, Xinrong; Chen, Lieping; Hann, Christine L; Fulton, Amy M; Leahy, Daniel J; Laterra, John; Li, Min
2016-02-04
Two-pore domain potassium (K2P) channels act to maintain cell resting membrane potential--a prerequisite for many biological processes. KCNK9, a member of K2P family, is implicated in cancer, owing to its overexpression in human tumours and its ability to promote neoplastic cell survival and growth. However, KCNK9's underlying contributions to malignancy remain elusive due to the absence of specific modulators. Here we describe the development of monoclonal antibodies against the KCNK9 extracellular domain and their functional effects. We show that one antibody (Y4) with the highest affinity binding induces channel internalization. The addition of Y4 to KCNK9-expressing carcinoma cells reduces cell viability and increases cell death. Systemic administration of Y4 effectively inhibits growth of human lung cancer xenografts and murine breast cancer metastasis in mice. Evidence for Y4-mediated carcinoma cell autonomous and immune-dependent cytotoxicity is presented. Our study reveals that antibody-based KCNK9 targeting is a promising therapeutic strategy in KCNK9-expressing malignancies.
Wong, Wing Yee; Su, Ping; Allison, Gwen E.; Liu, Chun-Qiang; Dunn, Noel W.
2003-01-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cdr phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus. PMID:14532023
Wong, Wing Yee; Su, Ping; Allison, Gwen E; Liu, Chun-Qiang; Dunn, Noel W
2003-10-01
A potential food-grade cloning vector, pND919, was constructed and transformed into S. thermophilus ST3-1, a plasmid-free strain. The vector contains DNAs from two different food-approved organisms, Streptococcus thermophilus and Lactococcus lactis. The 5.0-kb pND919 is a derivative of the cloning vector pND918 (9.3 kb) and was constructed by deletion of the 4.3-kb region of pND918 which contained DNA from non-food-approved organisms. pND919 carries a heterologous native cadmium resistance selectable marker from L. lactis M71 and expresses the Cd(r) phenotype in S. thermophilus transformants. With the S. thermophilus replicon derived from the shuttle vector pND913, pND919 is able to replicate in the two S. thermophilus industrial strains tested, ST3-1 and ST4-1. Its relatively high retention rate in S. thermophilus further indicates its usefulness as a potential food-grade cloning vector. To our knowledge, this is the first report of a replicative potential food-grade vector for the industrially important organism S. thermophilus.
[Effects of SREBP-1 over-expression on fatty acid metabolism related genes expression in goats].
Xu, Huifen; Luo, Jun; Li, Fang; Yu, Kang; Shi, Hengbo; Li, Jun; Lin, Xianzi; Zhu, Jiangjiang
2012-11-01
The aim of the study was to construct a recombinant adenovirus overexpression vector for Sterol Regulatory Element Binding Protein-1 (SREBP-1) of Xinong Saanen dairy goat, and to detect its effect on genes related to fatty acid metabolism in goat mammary epithelial cells, to establish foundation for further study of its roles in metabolism of fatty acid synthesis and lactation. First, we designed primers based on the SREBP-1 gene sequence in GenBank for PCR amplification and inserted the sequence into shuttle vector pAdTrack-CMV. The recombinant plasmid pAdTrack-CMV-SREBP-1 linearized by Pme I was transformed into E. coli BJ5183 competence cell containing the backbone vector pAdEasy-1 to obtain recombinant vector pAd-SREBP-1 by homologous recombination. pAd-SREBP-1 was linearized by Pac I and transfected into HEK 293 cell. Then we infected goat mammary epithelial cells with recombinant adenovirus which was packaged in HEK 293 cell line. The results showed that the recombinant adenovirus vector containing SREBP-1 was successfully constructed, and the titer of virus was 10(9) U/mL. Compared with the control group, mRNA level of SREBP-1 increased by about 15 times after infected for 48 h and 30 times after infected for 72 h. Fatty acid synthase (FASN) and Acetyl-CoA carboxylase (ACC) was upregulated by almost 2 times. The expression level of Peroxisome proliferator activated receptorgamma (PPARgamma) increased by 1.5 times. Liver X receptoralpha (LXRalpha) and Adipose triglyceride lipase (ATGL) upregulated by 1.2 times compared with that of control. But Stearoyl-coenzyme A desaturase (SCD) had no obvious change. In conclusion, SREBP-1 can activate the expression of genes related to fatty acid synthesis in mammary epithelial cells of Xinong Saanen dairy goat, demonstrated a regulatory function on the fatty acid metabolism in goat mammary gland.
Yi, Ying-Jie; Jia, Xiu-Hong; Wang, Jian-Yong; Li, You-Jie; Wang, Hong; Xie, Shu-Yang
2016-05-01
Multidrug resistance (MDR) of leukemia cells is a major obstacle in chemotherapeutic treatment. The high expression and constitutive activation of P-glycoprotein (P-gp) and multidrug resistance protein-1 (MRP-1) have been reported to play a vital role in enhancing cell resistance to anticancer drugs in many tumors. The present study aimed to investigate the reversal of MDR by silencing homeobox A10 (HOXA10) in adriamycin (ADR)-resistant human chronic myelogenous leukemia (CML) K562/ADM cells by modulating the expression of P-gp and MRP-1. K562/ADM cells were stably transfected with HOXA10-targeted short hairpin RNA (shRNA). The results of reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and western blot analysis showed that the mRNA and protein expression of HOXA10 was markedly suppressed following transfection with a shRNA-containing vector. The sensitivity of the K562/ADM cells to ADR was enhanced by the silencing of HOXA10, due to the increased intracellular accumulation of ADR. The accumulation of ADR induced by the silencing of HOXA10 may be due to the downregulation of P-gp and MRP-1. Western blot analysis revealed that downregulating HOXA10 inhibited the protein expression of P-gp and MRP-1. Taken together, these results suggest that knockdown of HOXA10 combats resistance and that HOXA10 is a potential target for resistant human CML.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li Hongwei; Department of Neurological Surgery, University of Virginia Health System, Charlottesville, VA 22908; Li Jinzhong
PSA promoter has been demonstrated the utility for tissue-specific toxic gene therapy in prostate cancer models. Characterization of foreign gene overexpression in normal animals elicited by PSA promoter should help evaluate therapy safety. Here we constructed an adenovirus vector (AdPSA-Luc), containing firefly luciferase gene under the control of the 5837 bp long prostate-specific antigen promoter. A charge coupled device video camera was used to non-invasively image expression of firefly luciferase in nude mice on days 3, 7, 11 after injection of 2 x 10{sup 9} PFU of AdPSA-Luc virus via tail vein. The result showed highly specific expression of themore » luciferase gene in lungs of mice from day 7. The finding indicates the potential limitations of the suicide gene therapy of prostate cancer based on selectivity of PSA promoter. By contrary, it has encouraging implications for further development of vectors via PSA promoter to enable gene therapy for pulmonary diseases.« less
Zhou, Yu-Xun; Cao, Wei; Luo, Qing-Ping; Ma, Yu-Shu; Wang, Jin-Zhi; Wei, Dong-Zhi
2005-05-01
Adenoregulin is a member of dermaseptin family which are vertebrate antibiotic peptides having lethal effects against a broad spectrum of bacteria, fungi and protozoa. The 99 bp adenoregulin gene was cloned in the expression vector pET32a and transformed into Escherichia coli BL21(DE3). In fed-batch cultivation of BL21(DE3)/pET32a-adr, an exponential feeding strategy was applied to gain 60 g dry cells l-1. The recombinant fusion protein Trx-ADR was expressed in a soluble form. The fusion protein was isolated by Ni2+-chelating chromatography, cleaved with CNBr and purified to homogeneity through reverse phase-HPLC and size exclusion-HPLC. The purified recombinant adenoregulin had antibacterial activity against Escherichia coli K12D31 with apparent Mr of 3.4 kDa, identical to the anticipated value.
NASA Technical Reports Server (NTRS)
Crouch, P. E.; Grossman, Robert
1992-01-01
This note is concerned with the explicit symbolic computation of expressions involving differential operators and their actions on functions. The derivation of specialized numerical algorithms, the explicit symbolic computation of integrals of motion, and the explicit computation of normal forms for nonlinear systems all require such computations. More precisely, if R = k(x(sub 1),...,x(sub N)), where k = R or C, F denotes a differential operator with coefficients from R, and g member of R, we describe data structures and algorithms for efficiently computing g. The basic idea is to impose a multiplicative structure on the vector space with basis the set of finite rooted trees and whose nodes are labeled with the coefficients of the differential operators. Cancellations of two trees with r + 1 nodes translates into cancellation of O(N(exp r)) expressions involving the coefficient functions and their derivatives.
Wada, Takeshi; Gando, Satoshi; Mizugaki, Asumi; Yanagida, Yuichiro; Jesmin, Subrina; Yokota, Hiroyuki; Ieko, Masahiro
2013-07-01
Post-cardiac arrest syndrome (PCAS) is often associated with disseminated intravascular coagulation (DIC), thus leading to the development of multiple organ dysfunction syndrome (MODS). The aim of this study was to examine the pathophysiological relationships between coagulation, fibrinolysis and fibrinolytic shutdown by evaluating the levels of coagulofibrinolytic markers, including soluble fibrin, thrombin-activatable fibrinolysis inhibitor (TAFI), tissue plasminogen activator-plasminogen activator inhibitor-1 complex (tPAIC), plasmin-alpha2 plasmin inhibitor complex (PPIC), neutrophil elastase and fibrin degradation product by neutrophil elastase (EXDP). Fifty-two resuscitated patients were divided into two groups: 22 DIC and 30 non-DIC patients. The levels of soluble fibrin, PPIC, tPAIC, EXDP and neutrophil elastase in the DIC patients with PCAS were significantly higher than those observed in the non-DIC patients. The values of the tPAIC and JAAM DIC scores were found to be independent predictors of increased SOFA scores in the DIC patients. The MODS patients demonstrated significantly higher levels of soluble fibrin and tPAIC; however, the levels of TAFI and EXDP were identical between the patients with and without MODS. In addition, positive correlations were observed between the levels of tPAIC and EXDP in the patients with non-MODS; however, no correlations were observed between these markers in the MODS patients. Thrombin activation and fibrinolytic shutdown play important roles in the development of organ dysfunction in PCAS patients. Neutrophil elastase-mediated fibrinolysis cannot overcome the fibrinolytic shutdown that occurs in DIC patients with PCAS, thus resulting in the development of MODS. Copyright © 2013 Elsevier Ltd. All rights reserved.
van Hecke, Oliver; Kamerman, Peter R.; Attal, Nadine; Baron, Ralf; Bjornsdottir, Gyda; Bennett, David L.H.; Bennett, Michael I.; Bouhassira, Didier; Diatchenko, Luda; Freeman, Roy; Freynhagen, Rainer; Haanpää, Maija; Jensen, Troels S.; Raja, Srinivasa N.; Rice, Andrew S.C.; Seltzer, Ze'ev; Thorgeirsson, Thorgeir E.; Yarnitsky, David; Smith, Blair H.
2015-01-01
Abstract For genetic research to contribute more fully to furthering our knowledge of neuropathic pain, we require an agreed, valid, and feasible approach to phenotyping, to allow collaboration and replication in samples of sufficient size. Results from genetic studies on neuropathic pain have been inconsistent and have met with replication difficulties, in part because of differences in phenotypes used for case ascertainment. Because there is no consensus on the nature of these phenotypes, nor on the methods of collecting them, this study aimed to provide guidelines on collecting and reporting phenotypes in cases and controls for genetic studies. Consensus was achieved through a staged approach: (1) systematic literature review to identify all neuropathic pain phenotypes used in previous genetic studies; (2) Delphi survey to identify the most useful neuropathic pain phenotypes and their validity and feasibility; and (3) meeting of experts to reach consensus on the optimal phenotype(s) to be collected from patients with neuropathic pain for genetic studies. A basic “entry level” set of phenotypes was identified for any genetic study of neuropathic pain. This set identifies cases of “possible” neuropathic pain, and controls, and includes: (1) a validated symptom-based questionnaire to determine whether any pain is likely to be neuropathic; (2) body chart or checklist to identify whether the area of pain distribution is neuroanatomically logical; and (3) details of pain history (intensity, duration, any formal diagnosis). This NeuroPPIC “entry level” set of phenotypes can be expanded by more extensive and specific measures, as determined by scientific requirements and resource availability. PMID:26469320
Ma, Benjiang; Hang, Changshou; Zhao, Yun; Wang, Shiwen; Xie, Yanxiang
2002-09-01
To construct a novel baculovirus vector which is capable of promoting the high-yield expression of foreign gene in mammalian cells and to express by this vector the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV) Chinese isolate (Xinjiang hemorrhagic fever virus, XHFV) BA88166 in insect and Vero cells. Human cytomegalovirus (CMV) immediate early (IE) promoter was ligated to the baculovirus vector pFastBac1 downstream of the polyhedrin promoter to give rise to the novel vector pCB1. XHFV NP gene was cloned to this vector and was well expressed in COS-7 cells and Vero cells by means of recombinant plasmid transfection and baculovirus infection. The XHFV NP gene in vector pCB1 could be well expressed in mammalian cells. Vero cells infected with recombinant baculovirus harboring NP gene could be employed as antigens to detect XHF serum specimens whose results were in good correlation with those of ELISA and in parallel with clinical diagnoses. This novel baculovirus vector is able to express the foreign gene efficiently in both insect and mammalian cells, which provides not only the convenient diagnostic antigens but also the potential for developing recombinant virus vaccines and gene therapies.
Wang, Mingxing; Tucker, Jay D; Lu, Peijuan; Wu, Bo; Cloer, Caryn; Lu, Qilong
2012-04-18
Hyperbranched poly(ester amine)s (PEAs) were successfully synthesized by Michael addition reaction between tris[2-(acryloyloxy)ethyl]isocyanurate (TAEI) and low-molecular-weight polyethylenimine (LPEI, M(w) 0.8k, 1.2k, and 2.0k) and evaluated in vitro and in vivo as gene carriers. PEAs effectively condensed plasmid DNA with particle sizes below 200 nm and surface charges between 11.5 and 33.5 mV under tested doses [at the ratios 2-10:1 of polymer/pDNA(w/w)]. The PEAs showed significantly lower cytotoxicities when compared with PEI 25k in two different cell lines. The PEAs (C series) composed of PEI 2k showed higher transgene expression compared to PEAs of PEI 0.8k (A series) or 1.2k (B series). Highest gene transfection efficiency in CHO, C2C12 myoblast, and human skeletal muscle (HSK) cell lines was obtained with TAEI/PEI-2K (C12) at a ratio of 1:2. Both C12, C14(TAEI/PEI-2K at a ratio of 1:4) demonstrated 5-8-fold higher gene expression as compared with PEI 25k in mdx mice in vivo through intramuscular administration. No obvious muscle damage was observed with these new polymers. Higher transfection efficiency and lower toxicity indicate the potential of the biodegradable PEAs as safe and efficient transgene delivery vectors. © 2012 American Chemical Society
Protein sequence comparison based on K-string dictionary.
Yu, Chenglong; He, Rong L; Yau, Stephen S-T
2013-10-25
The current K-string-based protein sequence comparisons require large amounts of computer memory because the dimension of the protein vector representation grows exponentially with K. In this paper, we propose a novel concept, the "K-string dictionary", to solve this high-dimensional problem. It allows us to use a much lower dimensional K-string-based frequency or probability vector to represent a protein, and thus significantly reduce the computer memory requirements for their implementation. Furthermore, based on this new concept, we use Singular Value Decomposition to analyze real protein datasets, and the improved protein vector representation allows us to obtain accurate gene trees. © 2013.
Kimura, Tetsuya; Nakao, Akihide; Murata, Sachiko; Kobayashi, Yasuyuki; Tanaka, Yuji; Shibahara, Kenta; Kawazu, Tetsu; Nakagawa, Tsuyoshi
2013-01-01
We developed the Gateway recycling cloning system, which allows multiple linking of expression cassettes by multiple rounds of the Gateway LR reaction. Employing this system, the recycling donor vector pRED419 was subjected to the first LR reaction with an attR1-attR2 type destination vector. Then conversion vector pCON was subjected to an LR reaction to restore the attR1-attR2 site on the destination vector for the next cloning cycle. By repetition of these two simple steps, we linked four expression cassettes of a reporter gene in Gateway binary vector pGWB1, introduced the constructs into tobacco BY-2 cells, and observed the expression of transgenes.
Jiang, Xu-pin; Zhang, Dong-xia; Teng, Miao; Zhang, Qiong; Zhang, Jia-ping; Huang, Yue-sheng
2013-01-01
Tetraspanin CD9 has been implicated in various cellular and physiological processes, including cell migration. In our previous study, we found that wound repair is delayed in CD9-null mice, suggesting that CD9 is critical for cutaneous wound healing. However, many cell types, including immune cells, endothelial cells, keratinocytes and fibroblasts undergo marked changes in gene expression and phenotype, leading to cell proliferation, migration and differentiation during wound repair, whether CD9 regulates kerationcytes migration directly remains unclear. In this study, we showed that the expression of CD9 was downregulated in migrating keratinocytes during wound repair in vivo and in vitro. Recombinant adenovirus vector for CD9 silencing or overexpressing was constructed and used to infect HaCaT cells. Using cell scratch wound assay and cell migration assay, we have also demonstrated that downregulation of CD9 promoted keratinocyte migration in vitro, whereas CD9 overexpression inhibited cell migration. Moreover, CD9 inversely regulated the activity and expression of MMP-9 in keratinocytes, which was involved in CD9-regulated keratinocyte migration. Importantly, CD9 silencing-activated JNK signaling was accompanied by the upregulation of MMP-9 activity and expression. Coincidentally, we found that SP600125, a JNK pathway inhibitor, decreased the activity and expression of MMP-9 of CD9-silenced HaCaT cells. Thus, our results suggest that CD9 is downregulated in migrating keratinocytes in vivo and in vitro, and a low level of CD9 promotes keratinocyte migration in vitro, in which the regulation of MMP-9 through the JNK pathway plays an important role. PMID:24147081
Chen, Jing; Chen, Xianghua; Dai, Jun; Xie, Guangrong; Yan, Luying; Lu, Lina; Chen, Jianhua
2015-09-01
A Bacillus strain with high productivity of α-amylase isolated from a starch farm was identified as Bacillus amyloliquefaciens. The α-amylase encoding gene amy1 was cloned into pMD18-T vector and amplified in E. coli DH5α. Shuttle vector pP43MNX was reconstructed to obtain vector pP43X for heterologous expression of the α-amylase in B. subtilis WB800. Recombinant enzyme was sufficiently purified by precipitation, gel filtration and anion exchange with a specific activity of 5566 U/mg. The α-amylase sequence contains an open reading frame of 1545 bp, which encodes a protein of 514 amino acid residues with a predicted molecular mass of 58.4 kDa. The enzyme exhibited maximal activity at pH 6.0 and 60 °C. Catalytic efficiency of the recombinant α-amylase was inhibited by Hg(2+), Pb(2+) and Cu(2+), but stimulated by Li(+), Mn(2+) and Ca(2+). The purified enzyme showed decreased activity toward detergents (SDS, Tween 20 and Triton X-100). Compared with production by the wild strain, there was a 1.48-fold increase in the productivity of α-amylase in recombinant B. subtilis WB800. Copyright © 2015 Elsevier B.V. All rights reserved.
Targeting a CAR to the TRAC locus with CRISPR/Cas9 enhances tumour rejection
Eyquem, Justin; Mansilla-Soto, Jorge; Giavridis, Theodoros; van der Stegen, Sjoukje J. C.; Hamieh, Mohamad; Cunanan, Kristen M.; Odak, Ashlesha; Gönen, Mithat; Sadelain, Michel
2017-01-01
Chimeric antigen receptors (CARs) are synthetic receptors that redirect and reprogram T cells to mediate tumour rejection1. The most successful CARs used to date are those targeting CD19 (ref. 2), which offer the prospect of complete remission in patients with chemorefractory or relapsed B-cell malignancies3. CARs are typically transduced into the T cells of a patient using γ-retroviral4 vectors or other randomly integrating vectors5, which may result in clonal expansion, oncogenic transformation, variegated transgene expression and transcriptional silencing6–8. Recent advances in genome editing enable efficient sequence-specific interventions in human cells9,10, including targeted gene delivery to the CCR5 and AAVS1 loci11,12. Here we show that directing a CD19-specific CAR to the T-cell receptor α constant (TRAC) locus not only results in uniform CAR expression in human peripheral blood T cells, but also enhances T-cell potency, with edited cells vastly outperforming conventionally generated CAR T cells in a mouse model of acute lymphoblastic leukaemia. We further demonstrate that targeting the CAR to the TRAC locus averts tonic CAR signalling and establishes effective internalization and re-expression of the CAR following single or repeated exposure to antigen, delaying effector T-cell differentiation and exhaustion. These findings uncover facets of CAR immunobiology and underscore the potential of CRISPR/Cas9 genome editing to advance immunotherapies. PMID:28225754
Meloni, Marco; Descamps, Betty; Caporali, Andrea; Zentilin, Lorena; Floris, Ilaria; Giacca, Mauro; Emanueli, Costanza
2012-01-01
Diabetes is a cause of cardiac dysfunction, reduced myocardial perfusion, and ultimately heart failure. Nerve growth factor (NGF) exerts protective effects on the cardiovascular system. This study investigated whether NGF gene transfer can prevent diabetic cardiomyopathy in mice. We worked with mice with streptozotocin-induced type 1 diabetes and with nondiabetic control mice. After having established that diabetes reduces cardiac NGF mRNA expression, we tested NGF gene therapies with adeno-associated viral vectors (AAVs) for the capacity to protect the diabetic mouse heart. To this aim, after 2 weeks of diabetes, cardiac expression of human NGF or β-Gal (control) genes was induced by either intramyocardial injection of AAV serotype 2 (AAV2) or systemic delivery of AAV serotype 9 (AAV9). Nondiabetic mice were given AAV2–β-Gal or AAV9–β-Gal. We found that the diabetic mice receiving NGF gene transfer via either AAV2 or AAV9 were spared the progressive deterioration of cardiac function and left ventricular chamber dilatation observed in β-Gal–injected diabetic mice. Moreover, they were additionally protected from myocardial microvascular rarefaction, hypoperfusion, increased deposition of interstitial fibrosis, and increased apoptosis of endothelial cells and cardiomyocytes, which afflicted the β-Gal–injected diabetic control mice. Our data suggest therapeutic potential of NGF for the prevention of cardiomyopathy in diabetic subjects. PMID:22187379
2009-11-01
Culicidae), a primary vector of dengue and yellow fever viruses, has not been explored. By using real- time quantitative polymerase chain reaction (qPCR...pesticide) on AeaCytB gene expression. Taken together, these results suggest thatAeaCytB gene plays an important role in the development of Ae. aegypti...2and 9 d old) were exposed to three temperatures (24, 37, and 40C) and 56 1.5% RH in an environmental chamber (L-C incubator, Lab-Line Instruments
BMP8B Is a Tumor Suppressor Gene Regulated by Histone Acetylation in Gastric Cancer.
Wisnieski, Fernanda; Leal, Mariana Ferreira; Calcagno, Danielle Queiroz; Santos, Leonardo Caires; Gigek, Carolina Oliveira; Chen, Elizabeth Suchi; Artigiani, Ricardo; Demachki, Sâmia; Assumpção, Paulo Pimentel; Lourenço, Laércio Gomes; Burbano, Rommel Rodríguez; Smith, Marília Cardoso
2017-04-01
Different from genetic alterations, the reversible nature of epigenetic modifications provides an interesting opportunity for the development of clinically relevant therapeutics in different tumors. In this study, we aimed to screen and validate candidate genes regulated by the epigenetic marker associated with transcriptional activation, histone acetylation, in gastric cancer (GC). We first compared gene expression profile of trichostatin A-treated and control GC cell lines using microarray assay. Among the 55 differentially expressed genes identified in this analysis, we chose the up-regulated genes BMP8B and BAMBI for further analyses, that included mRNA and histone acetylation quantification in paired GC and nontumor tissue samples. BMP8B expression was reduced in GC compared to nontumor samples (P < 0.01). In addition, reduced BMP8B expression was associated with poorly differentiated GC (P = 0.02). No differences or histopathological associations were identified concerning BAMBI expression. Furthermore, acetylated H3K9 and H4K16 levels at BMP8B were increased in GC compared to nontumors (P < 0.05). However, reduced levels of acetylated H3K9 and H4K16 were associated with poorly differentiated GC (P < 0.05). Reduced levels of acetylated H3K9 was also associated with diffuse-type histological GC (P < 0.05). Notably, reduced BMP8B mRNA and acetylated H4K16 levels were positively correlated in poorly differentiated GC (P < 0.05). Our study demonstrated that BMP8B seems to be a tumor suppressor gene regulated by H4K16 acetylation in poorly differentiated GC. Therefore, BMP8B may be a potential target for TSA-based therapies in this GC sample subset. J. Cell. Biochem. 118: 869-877, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
AAVPG: A vigilant vector where transgene expression is induced by p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.
2013-12-15
Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kang, Myoung Hee; Oh, Sang Cheul; Lee, Hyun Joo
2011-07-15
Bone morphogenetic proteins (BMPs) have been implicated in tumorigenesis and metastatic progression in various types of cancer cells, but the role and cellular mechanism in the invasive phenotype of gastric cancer cells is not known. Herein, we determined the roles of phosphoinositide 3-kinase (PI3K)/AKT, extracellular signal-regulated protein kinase (ERK), nuclear factor (NF)-{kappa}B, and matrix metalloproteinase (MMP) expression in BMP-2-mediated metastatic function in gastric cancer. We found that stimulation of BMP-2 in gastric cancer cells enhanced the phosphorylation of AKT and ERK. Accompanying activation of AKT and ERK kinase, BMP-2 also enhanced phosphorylation/degradation of I{kappa}B{alpha} and the nuclear translocation/activation of NF-{kappa}B.more » Interestingly, blockade of PI3K/AKT and ERK signaling using LY294002 and PD98059, respectively, significantly inhibited BMP-2-induced motility and invasiveness in association with the activation of NF-{kappa}B. Furthermore, BMP-2-induced MMP-9 expression and enzymatic activity was also significantly blocked by treatment with PI3K/AKT, ERK, or NF-{kappa}B inhibitors. Immunohistochemistry staining of 178 gastric tumor biopsies indicated that expression of BMP-2 and MMP-9 had a significant positive correlation with lymph node metastasis and a poor prognosis. These results indicate that the BMP-2 signaling pathway enhances tumor metastasis in gastric cancer by sequential activation of the PI3K/AKT or MAPK pathway followed by the induction of NF-{kappa}B and MMP-9 activity, indicating that BMP-2 has the potential to be a therapeutic molecular target to decrease metastasis.« less
Construction of two vectors for gene expression in Trichoderma reesei.
Lv, Dandan; Wang, Wei; Wei, Dongzhi
2012-01-01
We report the construction of two filamentous fungi Trichoderma reesei expression vectors, pWEF31 and pWEF32. Both vectors possess the hygromycin phosphotransferase B gene expression cassette and the strong promoter and terminator of the cellobiohydrolase 1 gene (cbh1) from T. reesei. The two newly constructed vectors can be efficiently transformed into T. reesei with Agrobacterium-mediated transformation. The difference between pWEF31 and pWEF32 is that pWEF32 has two longer homologous arms. As a result, pWEF32 easily undergoes homologous recombination. On the other hand, pWEF31 undergoes random recombination. The applicability of both vectors was tested by first generating the expression vectors pWEF31-red and pWEF32-red and then detecting the expression of the DsRed2 gene in T. reesei Rut C30. Additionally, we measured the exo-1,4-β-glucanase activity of the recombinant cells. Our work provides an effective transformation system for homologous and heterologous gene expression and gene knockout in T. reesei. It also provides a method for recombination at a specific chromosomal location. Finally, both vectors will be useful for the large-scale gene expression industry. Copyright © 2011 Elsevier Inc. All rights reserved.
Ito, Emiko; Miyagawa, Shigeru; Fukushima, Satsuki; Yoshikawa, Yasushi; Saito, Shunsuke; Saito, Tetsuya; Harada, Akima; Takeda, Maki; Kashiyama, Noriyuki; Nakamura, Yuki; Shiozaki, Motoko; Toda, Koichi; Sawa, Yoshiki
2017-11-01
Although implantation of a left ventricular assist device (LVAD) induces reverse remodeling of the left ventricle in end-stage nonischemic dilated cardiomyopathy (DCM), the underlying mechanism is not fully understood. It has been shown that epigenetic modification, such as methylation or acetylation of the histone, is one of the most important upstream signals in cardiac failure. This study hypothesized that histone profiles may be modified by LVAD implantation for end-stage nonischemic DCM, in association with reverse left ventricular remodeling. Hemodynamic changes associated with histone modification profiles in the left ventricle were comprehensively assessed in 14 patients with a diagnosis of end-stage nonischemic DCM. These patients underwent LVAD implantation and subsequent cardiac transplantation in our institution (Osaka University Hospital, Osaka, Japan). Samples of normal left ventricle from 3 different people were used as a control. After LVAD support for 2.5 ± 1.2 years, the study cohort showed a significant reverse remodeling of left ventricular function associated with histopathologic changes in the left ventricle, such as reduction of myocyte size. Although the left ventricle of the cohort histologically expressed less 3 histone methylation-related molecules (eg, H3 lysine 4 trimethylation [H3K4me3], H3 lysine 9 dimethylation [H3K9me2], and H3 lysine 9 trimethylation [H3K9me3]) compared with normal left ventricle, LVAD support reversed expression of these molecules, associated with up-regulation of H3 lysine 9 [H3K9] methyltransferase and suppressor of variegation 3-9 homologue 1 [SUV39H1] and with down-regulation of H3K9 demethylase and jumonji domains [JMJDs] in the LVAD-supported left ventricle. Moreover, expression of atrial natriuretic peptide and brain natriuretic peptide (ANP and BNP) was negatively correlated with that of H3K9me2 and H3K9me3. The epigenetic state of cardiac myocytes (eg, as histone methylation) was substantially modulated in end-stage nonischemic DCM. LVAD support partially reversed the epigenetic state and its upstream signals, in association with pathologic and functional reverse remodeling. Copyright © 2017 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.
Wang, Qi-Ming; Wang, Hao; Li, Ya-Fei; Xie, Zhi-Yong; Ma, Yao; Yan, Jian-Jun; Gao, Yi Fan Wei; Wang, Ze-Mu; Wang, Lian-Sheng
2016-01-01
It is well documented that overexpression of EMMPRIN (extracellular matrix metalloproteinase inducer) and MMPs (matrix metalloproteinases) by monocytes/macrophages plays an important role in atherosclerotic plaque rupture. Green tea polyphenol epigallocatechin-3-gallate (EGCG) has a variety of pharmacological properties and exerts cardiovascular protective effects. Recently, the 67-kD laminin receptor (67LR) has been identified as a cell surface receptor of EGCG. The aim of the present study was to evaluate the effects of EGCG on the expression of EMMPRIN and MMP-9 in PMA-induced macrophages, and the potential mechanisms underlying its effects. Human monocytic THP-1 cells were induced to differentiate into macrophages with phorbol 12-myristate 13-acetate (PMA). Protein expression and MMP-9 activity were assayed by Western blot and Gelatin zymography, respectively. Real-time PCR was used to examine EMMPRIN and MMP-9 mRNA expression. We showed that EGCG (10-50µmol/L) significantly inhibited the expression of EMMPRIN and MMP-9 and activation of extracellular signal-regulated kinase 1/2 (ERK1/2), p38 and c-Jun N-terminal kinase (JNK) in PMA-induced macrophages. Downregulation of EMMPRIN by gene silencing hindered PMA-induced MMP-9 secretion and expression, indicating an important role of EMMPRIN in the inhibition of MMP-9 by EGCG. Moreover, 67LR was involved in EGCG-mediated suppression of EMMPRIN and MMP-9 expression. Anti-67LR antibody treatment led to abrogation of the inhibitory action of EGCG on the expression of EMMPRIN and MMP-9 and activation of ERK1/2, p38, and JNK. Our results indicate that EGCG restrains EMMPRIN and MMP-9 expression via 67LR in PMA-induced macrophages, which also suggests that EGCG may be a possible therapeutic agent for stabilizing atherosclerotic plaque. © 2016 The Author(s) Published by S. Karger AG, Basel.
Sang, Haiquan; Li, Tingting; Li, Hangyu; Liu, Jingang
2015-11-01
Intrahepatic cholangiocarcinoma is the second most common primary malignant tumor of the liver, and it originates from the intrahepatic biliary duct epithelium. Prognosis is poor due to lack of effective comprehensive treatments. In this study, we assessed the expression of Gab1, VEGFR-2, and MMP-9 in intrahepatic cholangiocarcinoma solid tumors by immunohistochemistry and determined whether their expression was associated with clinical and pathological features. We found that expression of Gab1, VEGFR-2, and MMP-9 was highly and positively correlated with each other and with lymph node metastasis and TNM stage in intrahepatic cholangiocarcinoma tissues. Interference of Gab1 and VEGFR-2 expression via siRNA in the intrahepatic cholangiocarcinoma cell line RBE resulted in decreased PI3K/Akt pathway activity. Inhibition of Gab1 and VEGFR-2 expression also caused decreased cell proliferation, cell cycle arrested in G1 phase, increased apoptosis, and decreased invasion in RBE cells. These results suggest that Gab1, VEGFR-2, and MMP-9 contribute significantly to the highly malignant behavior of intrahepatic cholangiocarcinoma. The regulation of growth, apoptosis, and invasion by Gab1 through the VEGFR-2/Gab1/PI3K/Akt signaling pathway may represent potential targets for improving the treatment of intrahepatic cholangiocarcinoma.
NASA Astrophysics Data System (ADS)
Sharaf, M. A.; Saad, A. S.
2017-10-01
In this paper, a novel analysis was established to prove how Hansen's inferior and superior partial anomalies k and k_1 can divide the elliptic orbit into two segments. The analysis depends on the departures of r (for k) and 1/r (for k1) from their minima. By these departures, we can find: (i) Transformations relating the eccentric anomaly to k and the true anomaly to k1. (ii) Expressions for k and k_1 in terms of the orbital elements. (iii) The interpretation and the intervals of definition of two moduli (X, S) related to k and k_1. (iv) The extreme values of r and the elliptic equations in terms of k and k1. (v) For r' and r'', the modulus X as a measure of the asymmetry of r' (or r'') from r'' (or r'), and the modulus S12 as a measure of the asymmetry of r' and r'' from the minimum value of r. (vi) A description of the segments represented by k and k1. (vii) The relative position of the radius vector at k0° and k1=180°.
Sato, M; Figueiredo, ML; Burton, JB; Johnson, M; Chen, M; Powell, R; Gambhir, SS; Carey, M; Wu, L
2009-01-01
Effective treatment for recurrent, disseminated prostate cancer is notably limited. We have developed adenoviral vectors with a prostate-specific two-step transcriptional amplification (TSTA) system that would express therapeutic genes at a robust level to target metastatic disease. The TSTA system employs the prostate-specific antigen (PSA) promoter/enhancer to drive a potent synthetic activator, which in turn activates the expression of the therapeutic gene. In this study, we explored different configurations of this bipartite system and discovered that physical separation of the two TSTA components into E1 and E3 regions of adenovirus was able to enhance androgen regulation and cell-discriminatory expression. The TSTA vectors that express imaging reporter genes were assessed by noninvasive imaging technologies in animal models. The improved selectivity of the E1E3 configured vector was reflected in silenced ectopic expression in the lung. Significantly, the enhanced specificity of the E1E3 vector enabled the detection of lung metastasis of prostate cancer. An E1E3 TSTA vector that expresses the herpes simplex virus thymidine kinase gene can effectively direct positron emission tomography (PET) imaging of the tumor. The prostate-targeted gene delivery vectors with robust and cell-specific expression capability will advance the development of safe and effective imaging guided therapy for recurrent metastatic stages of prostate cancer. PMID:18305574
Mizutani, Naoki; Omori, Yukari; Kawamoto, Yoshiyuki; Sobue, Sayaka; Ichihara, Masatoshi; Suzuki, Motoshi; Kyogashima, Mamoru; Nakamura, Mitsuhiro; Tamiya-Koizumi, Keiko; Nozawa, Yoshinori; Murate, Takashi
2016-02-19
Resveratrol (RSV) is a plant-derived phytoalexin present in plants, whose pleiotropic effects for health benefits have been previously reported. Its anti-cancer activity is among the current topics for novel cancer treatment. Here, effects of RSV on cell proliferation and the sphingolipid metabolism of K562, a human leukemia cell line, were analyzed. Some experiments were also performed in HCT116, a human colon cancer cell line. RSV inhibited cell proliferation of both cell lines. Increased cellular ceramide and decreased sphingomyelin and S1P by RSV were observed in RSV-treated K562 cells. Further analysis revealed that acid sphingomyelinase mRNA and enzyme activity levels were increased by RSV. Desipramine, a functional ASMase inhibitor, prevented RSV-induced ceramide increase. RSV increased ATF3, EGR1, EGR3 proteins and phosphorylated c-Jun and FOXO3. However, co-transfection using these transcription factor expression vectors and ASMase promoter reporter vector revealed positive effects of EGR1 and EGR3 but not others. Electrophoresis mobility shift assay (EMSA) and Chromatin immunoprecipitation (ChIP) assay demonstrated the direct binding of EGR1/3 transcription factors with ASMase 5'-promoter. These results indicate that increased EGR1/3 and ASMase expression play an important role in cellular ceramide increase by RSV treatment. Copyright © 2016 Elsevier Inc. All rights reserved.
García-Arriaza, Juan; Perdiguero, Beatriz; Heeney, Jonathan L.; Seaman, Michael S.; Montefiori, David C.; Yates, Nicole L.; Tomaras, Georgia D.; Ferrari, Guido; Foulds, Kathryn E.; Roederer, Mario; Self, Steven G.; Borate, Bhavesh; Gottardo, Raphael; Phogat, Sanjay; Tartaglia, Jim; Barnett, Susan W.; Burke, Brian; Cristillo, Anthony D.; Weiss, Deborah E.; Lee, Carter; Kibler, Karen V.; Jacobs, Bertram L.; Wagner, Ralf; Ding, Song; Pantaleo, Giuseppe
2017-01-01
ABSTRACT The nonreplicating attenuated poxvirus vector NYVAC expressing clade C(CN54) HIV-1 Env(gp120) and Gag-Pol-Nef antigens (NYVAC-C) showed limited immunogenicity in phase I clinical trials. To enhance the capacity of the NYVAC vector to trigger broad humoral responses and a more balanced activation of CD4+ and CD8+ T cells, here we compared the HIV-1-specific immunogenicity elicited in nonhuman primates immunized with two replicating NYVAC vectors that have been modified by the insertion of the K1L and C7L vaccinia virus host range genes and express the clade C(ZM96) trimeric HIV-1 gp140 protein or a Gag(ZM96)-Pol-Nef(CN54) polyprotein as Gag-derived virus-like particles (termed NYVAC-C-KC). Additionally, one NYVAC-C-KC vector was generated by deleting the viral gene B19R, an inhibitor of the type I interferon response (NYVAC-C-KC-ΔB19R). An immunization protocol mimicking that of the RV144 phase III clinical trial was used. Two groups of macaques received two doses of the corresponding NYVAC-C-KC vectors (weeks 0 and 4) and booster doses with NYVAC-C-KC vectors plus the clade C HIV-1 gp120 protein (weeks 12 and 24). The two replicating NYVAC-C-KC vectors induced enhanced and similar HIV-1-specific CD4+ and CD8+ T cell responses, similar levels of binding IgG antibodies, low levels of IgA antibodies, and high levels of antibody-dependent cellular cytotoxicity responses and HIV-1-neutralizing antibodies. Small differences within the NYVAC-C-KC-ΔB19R group were seen in the magnitude of CD4+ and CD8+ T cells, the induction of some cytokines, and the neutralization of some HIV-1 isolates. Thus, replication-competent NYVAC-C-KC vectors acquired relevant immunological properties as vaccine candidates against HIV/AIDS, and the viral B19 molecule exerts some control of immune functions. IMPORTANCE It is of special importance to find a safe and effective HIV/AIDS vaccine that can induce strong and broad T cell and humoral immune responses correlating with HIV-1 protection. Here we developed novel replicating poxvirus NYVAC-based HIV/AIDS vaccine candidates expressing clade C HIV-1 antigens, with one of them lacking the vaccinia virus B19 protein, an inhibitor of the type I interferon response. Immunization of nonhuman primates with these novel NYVAC-C-KC vectors and the protein component gp120 elicited high levels of T cell and humoral immune responses, with the vector containing a deletion in B19R inducing a trend toward a higher magnitude of CD4+ and CD8+ T cell responses and neutralization of some HIV-1 strains. These poxvirus vectors could be considered HIV/AIDS vaccine candidates based on their activation of potential immune correlates of protection. PMID:28179536
Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong
2003-02-01
To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.
Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh; Mahboudi, Fereidoun
2017-01-01
Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios.
Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh
2017-01-01
Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios. PMID:28662065
The effects of blueberry anthocyanins on histone acetylation in rat liver fibrosis
Zhan, Wei; Liao, Xin; Xie, Ru-Jia; Tian, Tian; Yu, Lei; Liu, Xing; Liu, Jing; Li, Po; Han, Bing; Yang, Ting; Zhang, Bei; Cai, Li-Jun; Li, Rui; Yang, Qin
2017-01-01
To determine the effects ofanthocyanins from blueberries on hepatic stellate cell (HSCs-T6) and on histone acetylation during liver fibrosis induced by CCl4 in rats. Fifty male SD rats weighing 180 ± 20g were randomly placed into a control group, a hepatic fibrosis group, a blueberry treatment group, a blueberry intervention group, and a natural recovery group. After the rats were sacrificed, the livers and the liver indexes were measured, and the pathological changes were observed by HE staining and Masson staining. The blood was analyzed for the four indexes of liver fibrosis and liver function; nucleoprotein from liver tissues and karyoplasm were isolated to determine the expression of acH3K9, acH3K14, and acH3K18 by Western blotting. Compared with the lethal rate of the control group, the median lethal rate of HSCs-T6 cells treated with a the 50μmol/L concentration was 66.94% (P < 0.05). The protein expression on α-SMA, type I collagen, TIMP1 significantly decreased (P < 0.05) following treatment with 50 ug/ml of anthocyanin for 36 h; moreover, the expression of acH3K9, acH3K14 and acH3K18 modification were up-regulated (P < 0.05). Furthermore, compared with the liver in the model group, the liver in the intervention group showed the most obvious improvement (P < 0.01), and its karyoplasm had increased expression of acH3K9, acH3K14 and acH3K18 (P<0.01). Regulating histone acetylation could improve liver function and liver fibrosis indexes in rats with hepatic fibrosis. The mechanism might be related to certain genes that promote apoptosis, so as to inhibit the effect of anti hepatic fibrosis. PMID:29228569
Pionnier, Nicolas; Vallarino-Lhermitte, Nathaly; Lefoulon, Emilie; Nieguitsila, Adélaïde; Specht, Sabine; Carlin, Leo M.; Martin, Coralie
2017-01-01
Filarial infections are tropical diseases caused by nematodes of the Onchocercidae family such as Mansonella perstans. The infective larvae (L3) are transmitted into the skin of vertebrate hosts by blood-feeding vectors. Many filarial species settle in the serous cavities including M. perstans in humans and L. sigmodontis, a well-established model of filariasis in mice. L. sigmodontis L3 migrate to the pleural cavity where they moult into L4 around day 9 and into male and female adult worms around day 30. Little is known of the early phase of the parasite life cycle, after the L3 is inoculated in the dermis by the vector and enters the afferent lymphatic vessels and before the moulting processes in the pleural cavity. Here we reveal a pulmonary phase associated with lung damage characterized by haemorrhages and granulomas suggesting L3 reach the lung via pulmonary capillaries and damage the endothelium and parenchyma by crossing them to enter the pleural cavity. This study also provides evidence for a transient inflammation in the lung characterized by a very early recruitment of neutrophils associated with high expression levels of S100A8 and S100A9 proteins. PMID:28486498
Rajulapati, Vikky; Goyal, Arun
2017-05-01
Many phytopathogenic micro-organisms such as bacteria and fungi produce pectin methylesterases (PME) during plant invasion. Plants and insects also produce PME to degrade plant cell wall. In the present study, a thermostable pectin methylesterase (CtPME) from Clostridium thermocellum belonging to family 8 carbohydrate esterase (CE8) was cloned, expressed and purified. The amino acid sequence of CtPME exhibited similarity with pectin methylesterase from Erwinia chrysanthemi with 38% identity. The gene encoding CtPME was cloned into pET28a(+) vector and expressed using Escherichia coli BL21(DE3) cells. The recombinant CtPME expressed as a soluble protein and exhibited a single band of molecular mass approximately 35.2 kDa on SDS-PAGE gels. The molecular mass, 35.5 kDa of the enzyme, was also confirmed by MALDI-TOF MS analysis. Notably, highest protein concentration (11.4 mg/mL) of CtPME was achieved in auto-induction medium, as compared with LB medium (1.5 mg/mL). CtPME showed maximum activity (18.1 U/mg) against citrus pectin with >85% methyl esterification. The optimum pH and temperature for activity of CtPME were 8.5 and 50 °C, respectively. The enzyme was stable in pH range 8.0-9.0 and thermostable between 45 and 70 °C. CtPME activity was increased by 40% by 5 mM Ca 2+ or Mg 2+ ions. Protein melting curve of CtPME gave a peak at 80 °C. The peak was shifted to 85 °C in the presence of 5 mM Ca 2+ ions, and the addition of 5 mM EDTA shifted back the melting peak to 80 °C. CtPME can be potentially used in food and textile industry applications.
Yang, Muhua; Adla, Shalini; Temburni, Murali K; Patel, Vivek P; Lagow, Errin L; Brady, Owen A; Tian, Jing; Boulos, Magdy I; Galileo, Deni S
2009-10-29
Malignant glioma cells are particularly motile and can travel diffusely through the brain parenchyma, apparently without following anatomical structures to guide their migration. The neural adhesion/recognition protein L1 (L1CAM; CD171) has been implicated in contributing to stimulation of motility and metastasis of several non-neural cancer types. We explored the expression and function of L1 protein as a stimulator of glioma cell motility using human high-grade glioma surgical specimens and established rat and human glioma cell lines. L1 protein expression was found in 17 out of 18 human high-grade glioma surgical specimens by western blotting. L1 mRNA was found to be present in human U-87/LacZ and rat C6 and 9L glioma cell lines. The glioma cell lines were negative for surface full length L1 by flow cytometry and high resolution immunocytochemistry of live cells. However, fixed and permeablized cells exhibited positive staining as numerous intracellular puncta. Western blots of cell line extracts revealed L1 proteolysis into a large soluble ectodomain (~180 kDa) and a smaller transmembrane proteolytic fragment (~32 kDa). Exosomal vesicles released by the glioma cell lines were purified and contained both full-length L1 and the proteolyzed transmembrane fragment. Glioma cell lines expressed L1-binding alphavbeta5 integrin cell surface receptors. Quantitative time-lapse analyses showed that motility was reduced significantly in glioma cell lines by 1) infection with an antisense-L1 retroviral vector and 2) L1 ectodomain-binding antibodies. Our novel results support a model of autocrine/paracrine stimulation of cell motility in glioma cells by a cleaved L1 ectodomain and/or released exosomal vesicles containing L1. This mechanism could explain the diffuse migratory behavior of high-grade glioma cancer cells within the brain.
Yang, Muhua; Adla, Shalini; Temburni, Murali K; Patel, Vivek P; Lagow, Errin L; Brady, Owen A; Tian, Jing; Boulos, Magdy I; Galileo, Deni S
2009-01-01
Background Malignant glioma cells are particularly motile and can travel diffusely through the brain parenchyma, apparently without following anatomical structures to guide their migration. The neural adhesion/recognition protein L1 (L1CAM; CD171) has been implicated in contributing to stimulation of motility and metastasis of several non-neural cancer types. We explored the expression and function of L1 protein as a stimulator of glioma cell motility using human high-grade glioma surgical specimens and established rat and human glioma cell lines. Results L1 protein expression was found in 17 out of 18 human high-grade glioma surgical specimens by western blotting. L1 mRNA was found to be present in human U-87/LacZ and rat C6 and 9L glioma cell lines. The glioma cell lines were negative for surface full length L1 by flow cytometry and high resolution immunocytochemistry of live cells. However, fixed and permeablized cells exhibited positive staining as numerous intracellular puncta. Western blots of cell line extracts revealed L1 proteolysis into a large soluble ectodomain (~180 kDa) and a smaller transmembrane proteolytic fragment (~32 kDa). Exosomal vesicles released by the glioma cell lines were purified and contained both full-length L1 and the proteolyzed transmembrane fragment. Glioma cell lines expressed L1-binding αvβ5 integrin cell surface receptors. Quantitative time-lapse analyses showed that motility was reduced significantly in glioma cell lines by 1) infection with an antisense-L1 retroviral vector and 2) L1 ectodomain-binding antibodies. Conclusion Our novel results support a model of autocrine/paracrine stimulation of cell motility in glioma cells by a cleaved L1 ectodomain and/or released exosomal vesicles containing L1. This mechanism could explain the diffuse migratory behavior of high-grade glioma cancer cells within the brain. PMID:19874583
Kapczynski, Darrell R; Esaki, Motoyuki; Dorsey, Kristi M; Jiang, Haijun; Jackwood, Mark; Moraes, Mauro; Gardin, Yannick
2015-02-25
Vaccination is an important tool in the protection of poultry against avian influenza (AI). For field use, the overwhelming majority of AI vaccines produced are inactivated whole virus formulated into an oil emulsion. However, recombinant vectored vaccines are gaining use for their ability to induce protection against heterologous isolates and ability to overcome maternal antibody interference. In these studies, we compared protection of chickens provided by a turkey herpesvirus (HVT) vector vaccine expressing the hemagglutinin (HA) gene from a clade 2.2 H5N1 strain (A/swan/Hungary/4999/2006) against homologous H5N1 as well as heterologous H5N1 and H5N2 highly pathogenic (HP) AI challenge. The results demonstrated all vaccinated birds were protected from clinical signs of disease and mortality following homologous challenge. In addition, oral and cloacal swabs taken from challenged birds demonstrated that vaccinated birds had lower incidence and titers of viral shedding compared to sham-vaccinated birds. Following heterologous H5N1 or H5N2 HPAI challenge, 80-95% of birds receiving the HVT vector AI vaccine at day of age survived challenge with fewer birds shedding virus after challenge than sham vaccinated birds. In vitro cytotoxicity analysis demonstrated that splenic T lymphocytes from HVT-vector-AI vaccinated chickens recognized MHC-matched target cells infected with H5, as well as H6, H7, or H9 AI virus. Taken together, these studies provide support for the use of HVT vector vaccines expressing HA to protect poultry against multiple lineages of HPAI, and that both humoral and cellular immunity induced by live vaccines likely contributes to protection. Published by Elsevier Ltd.
Manzine, Livia Regina; Cassago, Alexandre; da Silva, Marco Túlio Alves; Thiemann, Otavio Henrique
2013-03-01
Selenocysteine Synthase (SELA, E.C. 2.9.1.1) from Escherichia coli is a homodecamer pyridoxal-5'-phosphate containing enzyme responsible for the conversion of seryl-tRNA(sec) into selenocysteyl-tRNA(sec) in the biosynthesis of the 21th amino acid, selenocysteine (Sec or U). This paper describes the cloning of the E. coli selA gene into a modified pET29a(+) vector and its expression in E. coli strain WL81460, a crucial modification allowing SELA expression without bound endogenous tRNA(sec). This expression strategy enabled the purification and additional biochemical and biophysical characterization of the SELA decamer. The homogeneous SELA protein was obtained using three chromatographic steps. Size Exclusion Chromatography and Native Gel Electrophoresis showed that SELA maintains a decameric state with molecular mass of approximately 500 kDa with an isoelectric point of 6,03. A predominance of α-helix structures was detected by circular dichroism with thermal stability up to 45 °C. The oligomeric assemblage of SELA was investigated by glutaraldehyde crosslinking experiments indicate that SELA homodecameric structure is the result of a stepwise addition of intermediate oligomeric states and not a direct monomer to homodecamer transition. Our results have contributed to the establishment of a robust expression model for the enzyme free of bound RNA and are of general interest to be taken into consideration in all cases of heterologous/homologous expressions of RNA-binding proteins avoiding the carryover of endogenous RNAs, which may interfere with further biochemical characterizations. Copyright © 2012 Elsevier Inc. All rights reserved.
On the metal-insulator-transition in vanadium dioxide
NASA Astrophysics Data System (ADS)
Jovaini, Azita; Fujita, Shigeji; Godoy, Salvador; Suzuki, Akira
2012-02-01
Vanadium dioxide (VO2) undergoes a metal-insulator transition (MIT) at 340 K with the structural change from tetragonal to monoclinic crystal. The conductivity σ drops at MIT by four orders of magnitude. The low temperature monoclinic phase is known to have a lower ground-state energy. The existence of the k-vector k is prerequisite for the conduction since the k appears in the semiclassical equation of motion for the conduction electron (wave packet). The tetragonal (VO2)3 unit is periodic along the crystal's x-, y-, and z-axes, and hence there is a three-dimensional k-vector. There is a one-dimensional k for a monoclinic crystal. We believe this difference in the dimensionality of the k-vector is the cause of the conductivity drop.
2009-01-01
Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112
On the classification techniques in data mining for microarray data classification
NASA Astrophysics Data System (ADS)
Aydadenta, Husna; Adiwijaya
2018-03-01
Cancer is one of the deadly diseases, according to data from WHO by 2015 there are 8.8 million more deaths caused by cancer, and this will increase every year if not resolved earlier. Microarray data has become one of the most popular cancer-identification studies in the field of health, since microarray data can be used to look at levels of gene expression in certain cell samples that serve to analyze thousands of genes simultaneously. By using data mining technique, we can classify the sample of microarray data thus it can be identified with cancer or not. In this paper we will discuss some research using some data mining techniques using microarray data, such as Support Vector Machine (SVM), Artificial Neural Network (ANN), Naive Bayes, k-Nearest Neighbor (kNN), and C4.5, and simulation of Random Forest algorithm with technique of reduction dimension using Relief. The result of this paper show performance measure (accuracy) from classification algorithm (SVM, ANN, Naive Bayes, kNN, C4.5, and Random Forets).The results in this paper show the accuracy of Random Forest algorithm higher than other classification algorithms (Support Vector Machine (SVM), Artificial Neural Network (ANN), Naive Bayes, k-Nearest Neighbor (kNN), and C4.5). It is hoped that this paper can provide some information about the speed, accuracy, performance and computational cost generated from each Data Mining Classification Technique based on microarray data.
Induction of humoral responses to BHV-1 glycoprotein D expressed by HSV-1 amplicon vectors
Blanc, Andrea Maria; Berois, Mabel Beatriz; Tomé, Lorena Magalí; Epstein, Alberto L.
2012-01-01
Herpes simplex virus type-1 (HSV-1) amplicon vectors are versatile and useful tools for transferring genes into cells that are capable of stimulating a specific immune response to their expressed antigens. In this work, two HSV-1-derived amplicon vectors were generated. One of these expressed the full-length glycoprotein D (gD) of bovine herpesvirus 1 while the second expressed the truncated form of gD (gDtr) which lacked the trans-membrane region. After evaluating gD expression in the infected cells, the ability of both vectors to induce a specific gD immune response was tested in BALB/c mice that were intramuscularly immunized. Specific serum antibody responses were detected in mice inoculated with both vectors, and the response against truncated gD was higher than the response against full-length gD. These results reinforce previous findings that HSV-1 amplicon vectors can potentially deliver antigens to animals and highlight the prospective use of these vectors for treating infectious bovine rhinotracheitis disease. PMID:22437537
Sidler-Lauff, K; Boos, A; Kraenzlin, M; Liesegang, A
2010-11-01
The purpose of this study was to investigate whether diets differing in Ca concentration would have an influence on vitamin D (VitD) receptor (VDR) and calbindin D9k (Calb9k) immunoreactivities in the gastrointestinal tract of growing goats. In addition, the effect of a single VitD injection was studied, to clarify whether exogenous VitD would further increase the active Ca absorption mechanisms. The hypothesis of the study was that reduced Ca intake would lead to greater active Ca absorption, and with that, to greater amounts of VDR and Calb9k immunoreactivities. The normal Ca kid group (according to age requirements) received 2.5 to 6 g of Ca/d, whereas the lesser Ca kid group (less than requirements) received 1.5 to 4 g of Ca/d from wk 6 (weaning) to 15 (slaughter). In addition, 5 and 6 goat kids, respectively, of each group (normal Ca kid group, lesser Ca kid group), were injected with VitD (0.05 mg of cholecalciferol/kg of BW) in wk 14 of life. Blood samples were taken in wk 14 and 15. Calcium and VitD (25-hydroxyvitamin D and 1,25-dihydroxyvitamin D) concentrations were determined in serum. Immediately after slaughter, the duodenum (DD) and rumen (RU) were mounted in conventional Ussing chambers. Unidirectional flux rates of Ca across gastrointestinal tissues were measured. Additionally, tissue specimens of the gastrointestinal tract were collected, and formaldehyde-fixed paraffin sections were used for VDR and Calb9k immunohistochemistry. In all kid groups, a net absorption in the RU and a net secretion of Ca in the DD were observed. Immunoreactions of VDR were greatest in the duodenal mucosa, whereas Calb9k immunoreactions were observed in the forestomach and intestinal tissues. The greatest expression was observed in the duodenal surface epithelium. Additionally, in the VitD-injected groups, an immunoreaction occurred in the jejunal superficial and basal glands and the ileal superficial epithelium. In contrast, the other groups showed no Calb9k immunoreactions at these sites. In conclusion, there is clear evidence for the RU as a main site for Ca absorption. The results of this study also indicate that VDR and Calb9k are highly expressed in the duodenal mucosa. The active absorption may not have such an important role in the DD because active transport was also evident in the RU. However, Calb9k expression seems to be stimulated by VitD administration.
Re-engineering adenovirus vector systems to enable high-throughput analyses of gene function.
Stanton, Richard J; McSharry, Brian P; Armstrong, Melanie; Tomasec, Peter; Wilkinson, Gavin W G
2008-12-01
With the enhanced capacity of bioinformatics to interrogate extensive banks of sequence data, more efficient technologies are needed to test gene function predictions. Replication-deficient recombinant adenovirus (Ad) vectors are widely used in expression analysis since they provide for extremely efficient expression of transgenes in a wide range of cell types. To facilitate rapid, high-throughput generation of recombinant viruses, we have re-engineered an adenovirus vector (designated AdZ) to allow single-step, directional gene insertion using recombineering technology. Recombineering allows for direct insertion into the Ad vector of PCR products, synthesized sequences, or oligonucleotides encoding shRNAs without requirement for a transfer vector Vectors were optimized for high-throughput applications by making them "self-excising" through incorporating the I-SceI homing endonuclease into the vector removing the need to linearize vectors prior to transfection into packaging cells. AdZ vectors allow genes to be expressed in their native form or with strep, V5, or GFP tags. Insertion of tetracycline operators downstream of the human cytomegalovirus major immediate early (HCMV MIE) promoter permits silencing of transgenes in helper cells expressing the tet repressor thus making the vector compatible with the cloning of toxic gene products. The AdZ vector system is robust, straightforward, and suited to both sporadic and high-throughput applications.
Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.
2003-01-01
In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432
[In vitro function of outer membrane protease T of Escherichia coli K1 pathogenic strain].
Hui, Changye; Guo, Yan; Wu, Shuchi; Peng, Liang; Cao, Hong; Huang, Shenghe
2010-01-01
Plasminogen activation and antimicrobial peptide hydrolysis contribute to pathogens invasion and survival in vivo. To demonstrate the expression of outer membrane protease T in E. coli K1 pathogenic strain E44, its activity of plasminogen activator and protamine hydrolysis. After Benzamidine Sepharose Fast Flow and SOURCE 30Q chromatography, we got E44 outer membrane mixed fraction, and examined its activity of plasminogen activation with chromogenic substrate S-2251 method. An ompT deletion mutant of E44 was constructed by using the suicide vector pCVD442, termed as E44ompT. We examined 0.1 mg/mL cationic antimicrobial peptide protamine susceptibility of E44, ompT mutant strain E44ompT and E44ompT harboring pUCT, which was constructed by inserting complete ompT open reading frame into pUC13. We got about 37 kDa E44 membrane extract, which could activate plasminogen, and activation was membrane extract dose dependent. This confirmed the expression of outer membrane protease T in the outer membrane of E44. E44ompT was, more susceptible to 0.1 mg/mL protamine than E44, and E440mpT was partially complemented by pUCT. Outer membrane protease T is expressed in E. coli K1 pathogenic strain E44, and can activate plasminogen and hydrolyze protamine.