Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

PubMed

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

A novel intranuclear RNA vector system for long-term stem cell modification

PubMed Central

Ikeda, Yasuhiro; Makino, Akiko; Matchett, William E.; Holditch, Sara J.; Lu, Brian; Dietz, Allan B.; Tomonaga, Keizo

2015-01-01

Genetically modified stem and progenitor cells have emerged as a promising regenerative platform in the treatment of genetic and degenerative disorders, highlighted by their successful therapeutic use in inherent immunodeficiencies. However, biosafety concerns over insertional mutagenesis resulting from integrating recombinant viral vectors have overshadowed the widespread clinical applications of genetically modified stem cells. Here, we report an RNA-based episomal vector system, amenable for long-term transgene expression in stem cells. Specifically, we used a unique intranuclear RNA virus, Borna disease virus (BDV), as the gene transfer vehicle, capable of persistent infections in various cell types. BDV-based vectors allowed for long-term transgene expression in mesenchymal stem cells (MSCs) without affecting cellular morphology, cell surface CD105 expression, or the adipogenicity of MSCs. Similarly, replication-defective BDV vectors achieved long-term transduction of human induced pluripotent stem cells (iPSCs), while maintaining the ability to differentiate into three embryonic germ layers. Thus, the BDV-based vectors offer a genomic modification-free, episomal RNA delivery system for sustained stem cell transduction. PMID:26632671

A CGMMV genome-replicon vector with partial sequences of coat protein gene efficiently expresses GFP in Nicotiana benthamiana.

PubMed

Jailani, A Abdul Kader; Solanki, Vikas; Roy, Anirban; Sivasudha, T; Mandal, Bikash

2017-04-02

A highly infectious clone of Cucumber green mottle mosaic virus (CGMMV), a cucurbit-infecting tobamovirus was utilized for designing of gene expression vectors. Two versions of vector were examined for their efficacy in expressing the green fluorescent protein (GFP) in Nicotiana benthamiana. When the GFP gene was inserted at the stop codon of coat protein (CP) gene of the CGMMV genome without any read-through codon, systemic expression of GFP, as well as virion formation and systemic symptoms expression were obtained in N. benthamiana. The qRT-PCR analysis showed 23 fold increase of GFP over actin at 10days post inoculation (dpi), which increased to 45 fold at 14dpi and thereafter the GFP expression was significantly declined. Further, we show that when the most of the CP sequence is deleted retaining only the first 105 nucleotides, the shortened vector containing GFP in frame of original CP open reading frame (ORF) resulted in 234 fold increase of GFP expression over actin at 5dpi in N. benthamiana without the formation of virions and disease symptoms. Our study demonstrated that a simple manipulation of CP gene in the CGMMV genome while preserving the translational frame of CP resulted in developing a virus-free, rapid and efficient foreign protein expression system in the plant. The CGMMV based vectors developed in this study may be potentially useful for the production of edible vaccines in cucurbits. Copyright © 2017 Elsevier B.V. All rights reserved.

Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

PubMed

Nakashima, N; Tamura, T

2013-06-01

Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

Sleeping Beauty-baculovirus hybrid vectors for long-term gene expression in the eye.

PubMed

Turunen, Tytteli Anni Kaarina; Laakkonen, Johanna Päivikki; Alasaarela, Laura; Airenne, Kari Juhani; Ylä-Herttuala, Seppo

2014-01-01

A baculovirus vector is capable of efficiently transducing many nondiving and diving cell types. However, the potential of baculovirus is restricted for many gene delivery applications as a result of the transient gene expression that it mediates. The plasmid-based Sleeping Beauty (SB) transposon system integrates transgenes into target cell genome efficiently with a genomic integration pattern that is generally considered safer than the integration of many other integrating vectors; yet efficient delivery of therapeutic genes into cells of target tissues in vivo is a major challenge for nonviral gene therapy. In the present study, SB was introduced into baculovirus to obtain novel hybrid vectors that would combine the best features of the two vector systems (i.e. effective gene delivery and efficient integration into the genome), thus circumventing the major limitations of these vectors. We constructed and optimized SB-baculovirus hybrid vectors that bear either SB100x transposase or SB transposon in the forward or reverse orientations with respect to the viral backbone The functionality of the novel hybrid vectors was investigated in cell cultures and in a proof-of-concept study in the mouse eye. The hybrid vectors showed high and sustained transgene expression that remained stable and demonstrated no signs of decline during the 2 months follow-up in vitro. These results were verified in the mouse eye where persistent transgene expression was detected two months after intravitreal injection. Our results confirm that (i) SB-baculovirus hybrid vectors mediate long-term gene expression in vitro and in vivo, and (ii) the hybrid vectors are potential new tools for the treatment of ocular diseases. Copyright © 2014 John Wiley & Sons, Ltd.

Regulated Expression of Adenoviral Vectors-Based Gene Therapies

PubMed Central

Curtin, James F.; Candolfi, Marianela; Puntel, Mariana; Xiong, Weidong; Muhammad, A. K. M.; Kroeger, Kurt; Mondkar, Sonali; Liu, Chunyan; Bondale, Niyati; Lowenstein, Pedro R.; Castro, Maria G.

2008-01-01

Summary Regulatable promoter systems allow gene expression to be tightly controlled in vivo. This is highly desirable for the development of safe, efficacious adenoviral vectors that can be used to treat human diseases in the clinic. Ideally, regulatable cassettes should have minimal gene expression in the “OFF” state, and expression should quickly reach therapeutic levels in the “ON” state. In addition, the components of regulatable cassettes should be non-toxic at physiological concentrations and should not be immunogenic, especially when treating chronic illness that requires long-lasting gene expression. In this chapter, we will describe in detail protocols to develop and validate first generation (Ad) and high-capacity adenoviral (HC-Ad) vectors that express therapeutic genes under the control of the TetON regulatable system. Our laboratory has successfully used these protocols to regulate the expression of marker genes, immune stimulatory genes, and toxins for cancer gene therapeutics, i.e., glioma that is a deadly form of brain cancer. We have shown that this third generation TetON regulatable system, incorporating a doxycycline (DOX)-sensitive rtTA2S-M2 inducer and tTSKid silencer, is non-toxic, relatively non-immunogenic, and can tightly regulate reporter transgene expression downstream of a TRE promoter from adenoviral vectors in vitro and also in vivo. PMID:18470649

Systems and methods for the secretion of recombinant proteins in gram negative bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Withers, III, Sydnor T.; Dominguez, Miguel A.; DeLisa, Matthew P.

Disclosed herein are systems and methods for producing recombinant proteins utilizing mutant E. coli strains containing expression vectors carrying nucleic acids encoding the proteins, and secretory signal sequences to direct the secretion of the proteins to the culture medium. Host cells transformed with the expression vectors are also provided.

Systems and methods for the secretion of recombinant proteins in gram negative bacteria

DOEpatents

Withers, III, Sydnor T.; Dominguez, Miguel A; DeLisa, Matthew P.; Haitjema, Charles H.

2016-08-09

Disclosed herein are systems and methods for producing recombinant proteins utilizing mutant E. coli strains containing expression vectors carrying nucleic acids encoding the proteins, and secretory signal sequences to direct the secretion of the proteins to the culture medium. Host cells transformed with the expression vectors are also provided.

Engineered Saccharomyces cerevisiae strain for improved xylose utilization with a three-plasmid SUMO yeast expression system

USDA-ARS?s Scientific Manuscript database

A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...

EMMA: An Extensible Mammalian Modular Assembly Toolkit for the Rapid Design and Production of Diverse Expression Vectors.

PubMed

Martella, Andrea; Matjusaitis, Mantas; Auxillos, Jamie; Pollard, Steven M; Cai, Yizhi

2017-07-21

Mammalian plasmid expression vectors are critical reagents underpinning many facets of research across biology, biomedical research, and the biotechnology industry. Traditional cloning methods often require laborious manual design and assembly of plasmids using tailored sequential cloning steps. This process can be protracted, complicated, expensive, and error-prone. New tools and strategies that facilitate the efficient design and production of bespoke vectors would help relieve a current bottleneck for researchers. To address this, we have developed an extensible mammalian modular assembly kit (EMMA). This enables rapid and efficient modular assembly of mammalian expression vectors in a one-tube, one-step golden-gate cloning reaction, using a standardized library of compatible genetic parts. The high modularity, flexibility, and extensibility of EMMA provide a simple method for the production of functionally diverse mammalian expression vectors. We demonstrate the value of this toolkit by constructing and validating a range of representative vectors, such as transient and stable expression vectors (transposon based vectors), targeting vectors, inducible systems, polycistronic expression cassettes, fusion proteins, and fluorescent reporters. The method also supports simple assembly combinatorial libraries and hierarchical assembly for production of larger multigenetic cargos. In summary, EMMA is compatible with automated production, and novel genetic parts can be easily incorporated, providing new opportunities for mammalian synthetic biology.

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

Retrovirus-based vectors for transient and permanent cell modification.

PubMed

Schott, Juliane W; Hoffmann, Dirk; Schambach, Axel

2015-10-01

Retroviral vectors are commonly employed for long-term transgene expression via integrating vector technology. However, three alternative retrovirus-based platforms are currently available that allow transient cell modification. Gene expression can be mediated from either episomal DNA or RNA templates, or selected proteins can be directly transferred through retroviral nanoparticles. The different technologies are functionally graded with respect to safety, expression magnitude and expression duration. Improvement of the initial technologies, including modification of vector designs, targeted increase in expression strength and duration as well as improved safety characteristics, has allowed maturation of retroviral systems into efficient and promising tools that meet the technological demands of a wide variety of potential application areas. Copyright © 2015 Elsevier Ltd. All rights reserved.

Using rabies virus vaccine strain SRV9 as viral vector to express exogenous gene.

PubMed

Wang, Hualei; Jin, Hongli; Feng, Na; Zheng, Xuexing; Li, Ling; Qi, Yinglin; Liang, Meng; Zhao, Yongkun; Wang, Tiecheng; Gao, Yuwei; Tu, Changchun; Jin, Ningyi; Yang, Songtao; Xia, Xianzhu

2015-04-01

Rabies virus (RABV) can cause a fatal neurological disease in human and animals, and vaccines were generally applied for the immunoprophylaxis of rabies. Here, a recombinant viral vector carrying the exogenous gene expression component between phosphoprotein (P) and matrix protein (M) genes of RABV was constructed based on the vaccine strain SRV9 used in China. To develop a reverse genetic system, the full-length cDNA plasmids of SRV9 were constructed using the eukaryotic expression vector pCI or pcDNA3.1(+). However, recovery efficiency based on the pcDNA3.1 vector was significantly higher than that of the pCI vector. The exogenous gene expression component PE-PS-BsiWI-PmeI or PS-BsiWI-PmeI-PE was introduced in different locations between the P and M genes of SRV9. When the enhanced green fluorescent protein (eGFP) was used as a reporter gene, both locations could rescue recombinant RABV (rRABV) expressing eGFP with high efficiency. Characterization of rRABV expressing eGFP in vitro revealed that its growth was similar to that of the parental virus. Animal experiments showed that rRABV expressing eGFP could replicate and express eGFP in the brains of suckling mice. Furthermore, rRABV of SRV9 was nonpathogenic for 3-week-old mice and could be cleared from the central nervous system at 5 days post-inoculation. Our results showed that the recombinant SRV9 virus could be used as a useful viral vector for exogenous gene expression.

Expression of the core antigen gene of hepatitis B virus (HBV) in Acetobacter methanolicus using broad-host-range vectors.

PubMed

Schröder, R; Maassen, A; Lippoldt, A; Börner, T; von Baehr, R; Dobrowolski, P

1991-08-01

Using the broad-host-range promoter probe vector pRS201 for cloning of phage Acm1 promoters, we established a convenient vector system for expression of heterologous genes in different Gram-negative bacteria. The usefulness of this system was demonstrated by expression of the HBV core gene in Acetobacter methanolicus. Plasmids carrying the HBV core gene downstream of different Acm1-phage promoters were transferred to A. methanolicus, a new potential host for recombinant DNA expression. Using enzyme immunoassay and immunoblot techniques, the amount and composition of core antigen produced in A. methanolicus were compared with that derived from Escherichia coli. The expression of immunoreactive core antigen in A. methanolicus exceeds by sevenfold that in E. coli using an expression system with tandemly arranged promoters. Morphological observations by electron microscopy show that the HBV core gene products isolated from both hosts are assembled into regular spherical particles with a diameter of about 28 nm that are comparable to original viral nucleocapsids.

The impact of cHS4 insulators on DNA transposon vector mobilization and silencing in retinal pigment epithelium cells.

PubMed

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5'-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells.

The Impact of cHS4 Insulators on DNA Transposon Vector Mobilization and Silencing in Retinal Pigment Epithelium Cells

PubMed Central

Sharma, Nynne; Hollensen, Anne Kruse; Bak, Rasmus O.; Staunstrup, Nicklas Heine; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2012-01-01

DNA transposons have become important vectors for efficient non-viral integration of transgenes into genomic DNA. The Sleeping Beauty (SB), piggyBac (PB), and Tol2 transposable elements have distinct biological properties and currently represent the most promising transposon systems for animal transgenesis and gene therapy. A potential obstacle, however, for persistent function of integrating vectors is transcriptional repression of the element and its genetic cargo. In this study we analyze the insulating effect of the 1.2-kb 5′-HS4 chicken β-globin (cHS4) insulator element in the context of SB, PB, and Tol2 transposon vectors. By examining transgene expression from genomically inserted transposon vectors encoding a marker gene driven by a silencing-prone promoter, we detect variable levels of transcriptional silencing for the three transposon systems in retinal pigment epithelium cells. Notably, the PB system seems less vulnerable to silencing. Incorporation of cHS4 insulator sequences into the transposon vectors results in 2.2-fold and 1.5-fold increased transgene expression levels for insulated SB and PB vectors, respectively, but an improved persistency of expression was not obtained for insulated transgenes. Colony formation assays and quantitative excision assays unveil enhanced SB transposition efficiencies by the inclusion of the cHS4 element, resulting in a significant increase in the stable transfection rate for insulated SB transposon vectors in human cell lines. Our findings reveal a positive impact of cHS4 insulator inclusion for SB and PB vectors in terms of increased transgene expression levels and improved SB stable transfection rates, but also the lack of a long-term protective effect of the cHS4 insulator against progressive transgene silencing in retinal pigment epithelium cells. PMID:23110238

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System

PubMed Central

Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M.

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health. PMID:26458221

Improved Production Efficiency of Virus-Like Particles by the Baculovirus Expression Vector System.

PubMed

López-Vidal, Javier; Gómez-Sebastián, Silvia; Bárcena, Juan; Nuñez, Maria del Carmen; Martínez-Alonso, Diego; Dudognon, Benoit; Guijarro, Eva; Escribano, José M

2015-01-01

Vaccines based on virus-like particles (VLPs) have proven effective in humans and animals. In this regard, the baculovirus expression vector system (BEVS) is one of the technologies of choice to generate such highly immunogenic vaccines. The extended use of these vaccines for human and animal populations is constrained because of high production costs, therefore a significant improvement in productivity is crucial to ensure their commercial viability. Here we describe the use of the previously described baculovirus expression cassette, called TB, to model the production of two VLP-forming vaccine antigens in insect cells. Capsid proteins from porcine circovirus type 2 (PCV2 Cap) and from the calicivirus that causes rabbit hemorrhagic disease (RHDV VP60) were expressed in insect cells using baculoviruses genetically engineered with the TB expression cassette. Productivity was compared to that obtained using standard counterpart vectors expressing the same proteins under the control of the polyhedrin promoter. Our results demonstrate that the use of the TB expression cassette increased the production yields of these vaccine antigens by around 300% with respect to the standard vectors. The recombinant proteins produced by TB-modified vectors were fully functional, forming VLPs identical in size and shape to those generated by the standard baculoviruses, as determined by electron microscopy analysis. The use of the TB expression cassette implies a simple modification of the baculovirus vectors that significantly improves the cost efficiency of VLP-based vaccine production, thereby facilitating the commercial viability and broad application of these vaccines for human and animal health.

Construction of two vectors for gene expression in Trichoderma reesei.

PubMed

Lv, Dandan; Wang, Wei; Wei, Dongzhi

2012-01-01

We report the construction of two filamentous fungi Trichoderma reesei expression vectors, pWEF31 and pWEF32. Both vectors possess the hygromycin phosphotransferase B gene expression cassette and the strong promoter and terminator of the cellobiohydrolase 1 gene (cbh1) from T. reesei. The two newly constructed vectors can be efficiently transformed into T. reesei with Agrobacterium-mediated transformation. The difference between pWEF31 and pWEF32 is that pWEF32 has two longer homologous arms. As a result, pWEF32 easily undergoes homologous recombination. On the other hand, pWEF31 undergoes random recombination. The applicability of both vectors was tested by first generating the expression vectors pWEF31-red and pWEF32-red and then detecting the expression of the DsRed2 gene in T. reesei Rut C30. Additionally, we measured the exo-1,4-β-glucanase activity of the recombinant cells. Our work provides an effective transformation system for homologous and heterologous gene expression and gene knockout in T. reesei. It also provides a method for recombination at a specific chromosomal location. Finally, both vectors will be useful for the large-scale gene expression industry. Copyright © 2011 Elsevier Inc. All rights reserved.

A simple and robust vector-based shRNA expression system used for RNA interference.

PubMed

Wang, Xue-jun; Li, Ying; Huang, Hai; Zhang, Xiu-juan; Xie, Pei-wen; Hu, Wei; Li, Dan-dan; Wang, Sheng-qi

2013-01-01

RNA interference (RNAi) mediated by small interfering RNAs (siRNAs) or short hairpin RNAs (shRNAs) has become a powerful genetic tool for conducting functional studies. Previously, vector-based shRNA-expression strategies capable of inducing RNAi in viable cells have been developed, however, these vector systems have some disadvantages, either because they were error-prone or cost prohibitive. In this report we described the development of a simple, robust shRNA expression system utilizing 1 long oligonucleotide or 2 short oligonucleotides for half the cost of conventional shRNA construction methods and with a >95% cloning success rate. The shRNA loop sequence and stem structure were also compared and carefully selected for better RNAi efficiency. Furthermore, an easier strategy was developed based on isocaudomers which permit rapid combination of the most efficient promoter-shRNA cassettes. Finally, using this method, the conservative target sites for hepatitis B virus (HBV) knockdown were systemically screened and HBV antigen expression shown to be successfully suppressed in the presence of connected multiple shRNAs both in vitro and in vivo. This novel design describes an inexpensive and effective way to clone and express single or multiple shRNAs from the same vector with the capacity for potent and effective silencing of target genes.

An efficient deletion mutant packaging system for defective herpes simplex virus vectors: Potential applications to human gene therapy and neuronal physiology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Geller, A.I.; Keyomarsi, K.; Bryan, J.

1990-11-01

The authors have previously described a defective herpes simplex virus (HSV-1) vector system that permits that introduction of virtually any gene into nonmitotic cells. pHSVlac, the prototype vector, stably expresses Escherichia coli {beta}-galactosidase from a constitutive promoter in many human cell lines, in cultured rat neurons from throughout the nervous system, and in cells in the adult rat brain. HSV-1 vectors expressing other genes may prove useful for studying neuronal physiology or performing human gene therapy for neurological diseases, such as Parkinson disease or brain tumors. A HSV-1 temperature-sensitive (ts) mutant, ts K, has been used as helper virus; tsmore » mutants revert to wild type. In contrast, HSV-1 deletion mutants essentially cannot revert to wild type; therefore, use of a deletion mutant as helper virus might permit human gene therapy with HSV-1 vectors. They now report an efficient packaging system for HSV-1 VECTORS USING A DELETION MUTANT, d30EBA, as helper virus; virus is grown on the complementing cell line M64A. pHSVlac virus prepared using the deletion mutant packaging system stably expresses {beta}-galactosidase in cultured rat sympathetic neurons and glia. Both D30EBA and ts K contain a mutation in the IE3 gene of HSV-1 strain 17 and have the same phenotype; therefore, changing the helper virus from ts K to D30EBA does not alter the host range or other properties of the HSV-1 vector system.« less

An efficient Foxtail mosaic virus vector system with reduced environmental risk

PubMed Central

2010-01-01

Background Plant viral vectors offer high-yield expression of pharmaceutical and commercially important proteins with a minimum of cost and preparation time. The use of Agrobacterium tumefaciens has been introduced to deliver the viral vector as a transgene to each plant cell via a simple, nonsterile infiltration technique called "agroinoculation". With agroinoculation, a full length, systemically moving virus is no longer necessary for excellent protein yield, since the viral transgene is transcribed and replicates in every infiltrated cell. Viral genes may therefore be deleted to decrease the potential for accidental spread and persistence of the viral vector in the environment. Results In this study, both the coat protein (CP) and triple gene block (TGB) genetic segments were eliminated from Foxtail mosaic virus to create the "FECT" vector series, comprising a deletion of 29% of the genome. This viral vector is highly crippled and expresses little or no marker gene within the inoculated leaf. However, when co-agroinoculated with a silencing suppressor (p19 or HcPro), FECT expressed GFP at 40% total soluble protein in the tobacco host, Nicotiana benthamiana. The modified FoMV vector retained the full-length replicase ORF, the TGB1 subgenomic RNA leader sequence and either 0, 22 or 40 bases of TGB1 ORF (in vectors FECT0, FECT22 and FECT40, respectively). As well as N. benthamiana, infection of legumes was demonstrated. Despite many attempts, expression of GFP via syringe agroinoculation of various grass species was very low, reflecting the low Agrobacterium-mediated transformation rate of monocots. Conclusions The FECT/40 vector expresses foreign genes at a very high level, and yet has a greatly reduced biohazard potential. It can form no virions and can effectively replicate only in a plant with suppressed silencing. PMID:21162736

Development of nonhuman adenoviruses as vaccine vectors

PubMed Central

Bangari, Dinesh S.; Mittal, Suresh K.

2006-01-01

Human adenoviral (HAd) vectors have demonstrated great potential as vaccine vectors. Preclinical and clinical studies have demonstrated the feasibility of vector design, robust antigen expression and protective immunity using this system. However, clinical use of adenoviral vectors for vaccine purposes is anticipated to be limited by vector immunity that is either preexisting or develops rapidly following the first inoculation with adenoviral vectors. Vector immunity inactivates the vector particles and rapidly removes the transduced cells, thereby limiting the duration of transgene expression. Due to strong vector immunity, subsequent use of the same vector is usually less efficient. In order to circumvent this limitation, nonhuman adenoviral vectors have been proposed as alternative vectors. In addition to eluding HAd immunity, these vectors possess most of the attractive features of HAd vectors. Several replication-competent or replication-defective nonhuman adenoviral vectors have been developed and investigated for their potential as vaccine delivery vectors. Here, we review recent advances in the design and characterization of various nonhuman adenoviral vectors, and discuss their potential applications for human and animal vaccination. PMID:16297508

The Function of Herpes Simplex Virus Genes: A Primer for Genetic Engineering of Novel Vectors

NASA Astrophysics Data System (ADS)

Roizman, Bernard

1996-10-01

Herpes simplex virus vectors are being developed for delivery and expression of human genes to the central nervous system, selective destruction of cancer cells, and as carriers for genes encoding antigens that induce protective immunity against infectious agents. Vectors constructed to meet these objectives must differ from wild-type virus with respect to host range, reactivation from latency, and expression of viral genes. The vectors currently being developed are (i) helper free amplicons, (ii) replication defective viruses, and (iii) genetically engineered replication competent viruses with restricted host range. Whereas the former two types of vectors require stable, continuous cell lines expressing viral genes for their replication, the replication competent viruses will replicate on approved primary human cell strains.

Transgene Expression and Host Cell Responses to Replication-Defective, Single-Cycle, and Replication-Competent Adenovirus Vectors.

PubMed

Crosby, Catherine M; Barry, Michael A

2017-02-18

Most adenovirus (Ad) vectors are E1 gene deleted replication defective (RD-Ad) vectors that deliver one transgene to the cell and all expression is based on that one gene. In contrast, E1-intact replication-competent Ad (RC-Ad) vectors replicate their DNA and their transgenes up to 10,000-fold, amplifying transgene expression markedly higher than RD-Ad vectors. While RC-Ad are more potent, they run the real risk of causing adenovirus infections in vector recipients and those that administer them. To gain the benefits of transgene amplification, but avoid the risk of Ad infections, we developed "single cycle" Ad (SC-Ad) vectors. SC-Ads amplify transgene expression and generated markedly stronger and more persistent immune responses than RD-Ad as expected. However, they also unexpectedly generated stronger immune responses than RC-Ad vectors. To explore the basis of this potency here, we compared gene expression and the cellular responses to infection to these vectors in vitro and in vivo. In vitro, in primary human lung epithelial cells, SC- and RC-Ad amplified their genomes more than 400-fold relative to RD-Ad with higher replication by SC-Ad. This replication translated into higher green fluorescent protein (GFP) expression for 48 h by SC- and RC-Ad than by RD-Ad. In vitro, in the absence of an immune system, RD-Ad expression became higher by 72 h coincident with cell death mediated by SC- and RC-Ad and release of transgene product from the dying cells. When the vectors were compared in human THP-1 Lucia- interferon-stimulated gene (ISG) cells, which are a human monocyte cell line that have been modified to quantify ISG activity, RC-Ad6 provoked significantly stronger ISG responses than RD- or SC-Ad. In mice, intravenous or intranasal injection produced up to 100-fold genome replication. Under these in vivo conditions in the presence of the immune system, luciferase expression by RC and SC-Ad was markedly higher than that by RD-Ad. In immunodeficient mice, SC-Ad drove stronger luciferase expression than RC- or RD-Ad. These data demonstrate better transgene expression by SC- and RC-Ad in vitro and in vivo than RD-Ad. This higher expression by the replicating vectors results in a peak of expression within 1 to 2 days followed by cell death of infected cells and release of transgene products. While SC- and RC-Ad expression were similar in mice and in Syrian hamsters, RC-Ad provoked much stronger ISG induction which may explain in part SC-Ad's ability to generate stronger and more persistent immune responses than RC-Ad in Ad permissive hamsters.

A universal expression/silencing vector in plants.

PubMed

Peretz, Yuval; Mozes-Koch, Rita; Akad, Fuad; Tanne, Edna; Czosnek, Henryk; Sela, Ilan

2007-12-01

A universal vector (IL-60 and auxiliary constructs), expressing or silencing genes in every plant tested to date, is described. Plants that have been successfully manipulated by the IL-60 system include hard-to-manipulate species such as wheat (Triticum duram), pepper (Capsicum annuum), grapevine (Vitis vinifera), citrus, and olive (Olea europaea). Expression or silencing develops within a few days in tomato (Solanum lycopersicum), wheat, and most herbaceous plants and in up to 3 weeks in woody trees. Expression, as tested in tomato, is durable and persists throughout the life span of the plant. The vector is, in fact, a disarmed form of Tomato yellow leaf curl virus, which is applied as a double-stranded DNA and replicates as such. However, the disarmed virus does not support rolling-circle replication, and therefore viral progeny single-stranded DNA is not produced. IL-60 does not integrate into the plant's genome, and the construct, including the expressed gene, is not heritable. IL-60 is not transmitted by the Tomato yellow leaf curl virus's natural insect vector. In addition, artificial satellites were constructed that require a helper virus for replication, movement, and expression. With IL-60 as the disarmed helper "virus," transactivation occurs, resulting in an inducible expressing/silencing system. The system's potential is demonstrated by IL-60-derived suppression of a viral-silencing suppressor of Grapevine virus A, resulting in Grapevine virus A-resistant/tolerant plants.

The establishment of Saccharomyces boulardii surface display system using a single expression vector.

PubMed

Wang, Tiantian; Sun, Hui; Zhang, Jie; Liu, Qing; Wang, Longjiang; Chen, Peipei; Wang, Fangkun; Li, Hongmei; Xiao, Yihong; Zhao, Xiaomin

2014-03-01

In the present study, an a-agglutinin-based Saccharomyces boulardii surface display system was successfully established using a single expression vector. Based on the two protein co-expression vector pSP-G1 built by Partow et al., a S. boulardii surface display vector-pSDSb containing all the display elements was constructed. The display results of heterologous proteins were confirmed by successfully displaying enhanced green fluorescent protein (EGFP) and chicken Eimeria tenella Microneme-2 proteins (EtMic2) on the S. boulardii cell surface. The DNA sequence of AGA1 gene from S. boulardii (SbAGA1) was determined and used as the cell wall anchor partner. This is the first time heterologous proteins have been displayed on the cell surface of S. boulardii. Because S. boulardii is probiotic and eukaryotic, its surface display system would be very valuable, particularly in the development of a live vaccine against various pathogenic organisms especially eukaryotic pathogens such as protistan parasites. Copyright © 2013 Elsevier Inc. All rights reserved.

Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.

PubMed

Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W

2001-06-01

A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.

Applications of lentiviral vectors in molecular imaging.

PubMed

Chatterjee, Sushmita; De, Abhijit

2014-06-01

Molecular imaging provides the ability of simultaneous visual and quantitative estimation of long term gene expression directly from living organisms. To reveal the kinetics of gene expression by imaging method, often sustained expression of the transgene is required. Lentiviral vectors have been extensively used over last fifteen years for delivery of a transgene in a wide variety of cell types. Lentiviral vectors have the well known advantages such as sustained transgene delivery through stable integration into the host genome, the capability of infecting non-dividing and dividing cells, broad tissue tropism, a reasonably large carrying capacity for delivering therapeutic and reporter gene combinations. Additionally, they do not express viral proteins during transduction, have a potentially safe integration site profile, and a relatively easy system for vector manipulation and infective viral particle production. As a result, lentiviral vector mediated therapeutic and imaging reporter gene delivery to various target organs holds promise for the future treatment. In this review, we have conducted a brief survey of important lentiviral vector developments in diverse biomedical fields including reproductive biology.

[Construction and expression of fusion protein TRX-hJagged1 in E.coli BL21].

PubMed

Li, Guo-Hui; Fan, Yu-Zhen; Huang, Si-Yong; Liu, Qiang; Yin, Dan-Dan; Liu, Li; Chen, Ren-An; Hao, Miao-Wang; Liang, Ying-Min

2014-06-01

This study was purposed to construct prokaryotic expression vector and to investigate the expression of Notch ligand Jagged1 in E.coli. An expression vector pET-hJagged1 was constructed, which can be inserted in Jagged1 with different lengths, but the DSL domain of human Jagged1 should be contained. Then the recombinant plasmids were transformed into the competent cell of E.coli BL21, and the expression of the fusion protein was induced by IPTG. Fusion protein was purified from the supernatant of cell lysates via the Nickel affinity chromatography. The results showed that prokaryotic expression vectors pET-hJagged1 (Bgl II), pET-hJagged1 (Hind I) and pET-hJagged1 (Stu I) were successfully constructed, but only pET-hJagged1 (Stu I) could express the soluble TRX-hJagged1. The purified TRX-Jagged1 protein could be obtained via the Nickel affinity chromatography, and then confirmed by Western Blot. It is concluded that prokaryotic expression vector pET-hJagged1 is successfully constructed, but only pET-hJagged1 (Stu I) can express the soluble TRX-hJagged1 and the TRX-Jagged1 fusion protein is obtained through the prokaryotic expression system, which laid a solid foundation for further to explore the effects of Jagged1 in hematopoietic and lymphoid system.

A limited innate immune response is induced by a replication-defective herpes simplex virus vector following delivery to the murine central nervous system

PubMed Central

Zeier, Zane; Aguilar, J Santiago; Lopez, Cecilia M; Devi-Rao, G B; Watson, Zachary L; Baker, Henry V; Wagner, Edward K; Bloom, David C

2010-01-01

Herpes simplex virus type 1 (HSV-1)–based vectors readily transduce neurons and have a large payload capacity, making them particularly amenable to gene therapy applications within the central nervous system (CNS). Because aspects of the host responses to HSV-1 vectors in the CNS are largely unknown, we compared the host response of a nonreplicating HSV-1 vector to that of a replication-competent HSV-1 virus using microarray analysis. In parallel, HSV-1 gene expression was tracked using HSV-specific oligonucleotide-based arrays in order to correlate viral gene expression with observed changes in host response. Microarray analysis was performed following stereotactic injection into the right hippocampal formation of mice with either a replication-competent HSV-1 or a nonreplicating recombinant of HSV-1, lacking the ICP4 gene (ICP4−). Genes that demonstrated a significant change (P < .001) in expression in response to the replicating HSV-1 outnumbered those that changed in response to mock or nonreplicating vector by approximately 3-fold. Pathway analysis revealed that both the replicating and nonreplicating vectors induced robust antigen presentation but only mild interferon, chemokine, and cytokine signaling responses. The ICP4− vector was restricted in several of the Toll-like receptor-signaling pathways, indicating reduced stimulation of the innate immune response. These array analyses suggest that although the nonreplicating vector induces detectable activation of immune response pathways, the number and magnitude of the induced response is dramatically restricted compared to the replicating vector, and with the exception of antigen presentation, host gene expression induced by the non-replicating vector largely resembles mock infection. PMID:20095947

Immunological thresholds in neurological gene therapy: highly efficient elimination of transduced cells might be related to the specific formation of immunological synapses between T cells and virus-infected brain cells

PubMed Central

Barcia, Carlos; Gerdes, Christian; Xiong, Wei-Dong; Thomas, Clare E.; Liu, Chunyan; Kroeger, Kurt M.; Castro, Maria G.; Lowenstein, Pedro R.

2007-01-01

First-generation adenovirus can be engineered with powerful promoters to drive expression of therapeutic transgenes. Numerous clinical trials for glioblastoma multiforme using first generation adenoviral vectors have either been performed or are ongoing, including an ongoing, Phase III, multicenter trial in Europe and Israel (Ark Therapeutics, Inc.). Although in the absence of anti-adenovirus immune responses expression in the brain lasts 6–18 months, systemic infection with adenovirus induces immune responses that inhibit dramatically therapeutic transgene expression from first generation adenoviral vectors, thus, potentially compromising therapeutic efficacy. Here, we show evidence of an immunization threshold for the dose that generates an immune response strong enough to eliminate transgene expression from the CNS. For the systemic immunization to eliminate transgene expression from the brain, ≥1 × 107 infectious units (iu) of adenovirus need to be used as immunogen. Furthermore, this immune response eliminates >90% of transgene expression from 1 × 107–1 × 10³ iu of vector injected into the striatum 60 days earlier. Importantly, elimination of transgene expression is independent of the nature of the promoter that drives transgene expression and is accompanied by brain infiltration of CD8+ T cells and macrophages. In conclusion, once the threshold for systemic immunization (i.e. 1 × 107 iu) is crossed, the immune response eliminates transgene expression by >90% even from brains that receive as little as 1000 iu of adenoviral vectors, independently of the type of promoter that drives expression. PMID:18084640

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

Firewalls Prevent Systemic Dissemination of Vectors Derived from Human Adenovirus Type 5 and Suppress Production of Transgene-Encoded Antigen in a Murine Model of Oral Vaccination

PubMed Central

Revaud, Julien; Unterfinger, Yves; Rol, Nicolas; Suleman, Muhammad; Shaw, Julia; Galea, Sandra; Gavard, Françoise; Lacour, Sandrine A.; Coulpier, Muriel; Versillé, Nicolas; Havenga, Menzo; Klonjkowski, Bernard; Zanella, Gina; Biacchesi, Stéphane; Cordonnier, Nathalie; Corthésy, Blaise; Ben Arous, Juliette; Richardson, Jennifer P.

2018-01-01

To define the bottlenecks that restrict antigen expression after oral administration of viral-vectored vaccines, we tracked vectors derived from the human adenovirus type 5 at whole body, tissue, and cellular scales throughout the digestive tract in a murine model of oral delivery. After intragastric administration of vectors encoding firefly luciferase or a model antigen, detectable levels of transgene-encoded protein or mRNA were confined to the intestine, and restricted to delimited anatomical zones. Expression of luciferase in the form of multiple small bioluminescent foci in the distal ileum, cecum, and proximal colon suggested multiple crossing points. Many foci were unassociated with visible Peyer's patches, implying that transduced cells lay in proximity to villous rather than follicle-associated epithelium, as supported by detection of transgene-encoded antigen in villous epithelial cells. Transgene-encoded mRNA but not protein was readily detected in Peyer's patches, suggesting that post-transcriptional regulation of viral gene expression might limit expression of transgene-encoded antigen in this tissue. To characterize the pathways by which the vector crossed the intestinal epithelium and encountered sentinel cells, a fluorescent-labeled vector was administered to mice by the intragastric route or inoculated into ligated intestinal loops comprising a Peyer's patch. The vector adhered selectively to microfold cells in the follicle-associated epithelium, and, after translocation to the subepithelial dome region, was captured by phagocytes that expressed CD11c and lysozyme. In conclusion, although a large number of crossing events took place throughout the intestine within and without Peyer's patches, multiple firewalls prevented systemic dissemination of vector and suppressed production of transgene-encoded protein in Peyer's patches. PMID:29423380

Facial Expression Recognition using Multiclass Ensemble Least-Square Support Vector Machine

NASA Astrophysics Data System (ADS)

Lawi, Armin; Sya'Rani Machrizzandi, M.

2018-03-01

Facial expression is one of behavior characteristics of human-being. The use of biometrics technology system with facial expression characteristics makes it possible to recognize a person’s mood or emotion. The basic components of facial expression analysis system are face detection, face image extraction, facial classification and facial expressions recognition. This paper uses Principal Component Analysis (PCA) algorithm to extract facial features with expression parameters, i.e., happy, sad, neutral, angry, fear, and disgusted. Then Multiclass Ensemble Least-Squares Support Vector Machine (MELS-SVM) is used for the classification process of facial expression. The result of MELS-SVM model obtained from our 185 different expression images of 10 persons showed high accuracy level of 99.998% using RBF kernel.

Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein.

PubMed

Kessler, P D; Podsakoff, G M; Chen, X; McQuiston, S A; Colosi, P C; Matelis, L A; Kurtzman, G J; Byrne, B J

1996-11-26

Somatic gene therapy has been proposed as a means to achieve systemic delivery of therapeutic proteins. However, there is limited evidence that current methods of gene delivery can practically achieve this goal. In this study, we demonstrate that, following a single intramuscular administration of a recombinant adeno-associated virus (rAAV) vector containing the beta-galactosidase (AAV-lacZ) gene into adult BALB/c mice, protein expression was detected in myofibers for at least 32 weeks. A single intramuscular administration of an AAV vector containing a gene for human erythropoietin (AAV-Epo) into mice resulted in dose-dependent secretion of erythropoietin and corresponding increases in red blood cell production that persisted for up to 40 weeks. Primary human myotubes transduced in vitro with the AAV-Epo vector also showed dose-dependent production of Epo. These results demonstrate that rAAV vectors are able to transduce skeletal muscle and are capable of achieving sustained expression and systemic delivery of a therapeutic protein following a single intramuscular administration. Gene therapy using AAV vectors may provide a practical strategy for the treatment of inherited and acquired protein deficiencies.

Gene delivery to skeletal muscle results in sustained expression and systemic delivery of a therapeutic protein

PubMed Central

Kessler, Paul D.; Podsakoff, Gregory M.; Chen, Xiaojuan; McQuiston, Susan A.; Colosi, Peter C.; Matelis, Laura A.; Kurtzman, Gary J.; Byrne, Barry J.

1996-01-01

Somatic gene therapy has been proposed as a means to achieve systemic delivery of therapeutic proteins. However, there is limited evidence that current methods of gene delivery can practically achieve this goal. In this study, we demonstrate that, following a single intramuscular administration of a recombinant adeno-associated virus (rAAV) vector containing the β-galactosidase (AAV-lacZ) gene into adult BALB/c mice, protein expression was detected in myofibers for at least 32 weeks. A single intramuscular administration of an AAV vector containing a gene for human erythropoietin (AAV-Epo) into mice resulted in dose-dependent secretion of erythropoietin and corresponding increases in red blood cell production that persisted for up to 40 weeks. Primary human myotubes transduced in vitro with the AAV-Epo vector also showed dose-dependent production of Epo. These results demonstrate that rAAV vectors are able to transduce skeletal muscle and are capable of achieving sustained expression and systemic delivery of a therapeutic protein following a single intramuscular administration. Gene therapy using AAV vectors may provide a practical strategy for the treatment of inherited and acquired protein deficiencies. PMID:8943064

Support vector machine for automatic pain recognition

NASA Astrophysics Data System (ADS)

Monwar, Md Maruf; Rezaei, Siamak

2009-02-01

Facial expressions are a key index of emotion and the interpretation of such expressions of emotion is critical to everyday social functioning. In this paper, we present an efficient video analysis technique for recognition of a specific expression, pain, from human faces. We employ an automatic face detector which detects face from the stored video frame using skin color modeling technique. For pain recognition, location and shape features of the detected faces are computed. These features are then used as inputs to a support vector machine (SVM) for classification. We compare the results with neural network based and eigenimage based automatic pain recognition systems. The experiment results indicate that using support vector machine as classifier can certainly improve the performance of automatic pain recognition system.

A Novel System for Simultaneous or Sequential Integration of Multiple Gene-Loading Vectors into a Defined Site of a Human Artificial Chromosome

PubMed Central

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming. PMID:25303219

A novel system for simultaneous or sequential integration of multiple gene-loading vectors into a defined site of a human artificial chromosome.

PubMed

Suzuki, Teruhiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Hara, Takahiko

2014-01-01

Human artificial chromosomes (HACs) are gene-delivery vectors suitable for introducing large DNA fragments into mammalian cells. Although a HAC theoretically incorporates multiple gene expression cassettes of unlimited DNA size, its application has been limited because the conventional gene-loading system accepts only one gene-loading vector (GLV) into a HAC. We report a novel method for the simultaneous or sequential integration of multiple GLVs into a HAC vector (designated as the SIM system) via combined usage of Cre, FLP, Bxb1, and φC31 recombinase/integrase. As a proof of principle, we first attempted simultaneous integration of three GLVs encoding EGFP, Venus, and TdTomato into a gene-loading site of a HAC in CHO cells. These cells successfully expressed all three fluorescent proteins. Furthermore, microcell-mediated transfer of HACs enabled the expression of those fluorescent proteins in recipient cells. We next demonstrated that GLVs could be introduced into a HAC one-by-one via reciprocal usage of recombinase/integrase. Lastly, we introduced a fourth GLV into a HAC after simultaneous integration of three GLVs by FLP-mediated DNA recombination. The SIM system expands the applicability of HAC vectors and is useful for various biomedical studies, including cell reprogramming.

Hypoxia-inducible vascular endothelial growth factor gene therapy using the oxygen-dependent degradation domain in myocardial ischemia.

PubMed

Kim, Hyun Ah; Lim, Soyeon; Moon, Hyung-Ho; Kim, Sung Wan; Hwang, Ki-Chul; Lee, Minhyung; Kim, Sun Hwa; Choi, Donghoon

2010-10-01

A hypoxia-inducible VEGF expression system with the oxygen-dependent degradation (ODD) domain was constructed and tested to be used in gene therapy for ischemic myocardial disease. Luciferase and VEGF expression vector systems were constructed with or without the ODD domain: pEpo-SV-Luc (or pEpo-SV-VEGF) and pEpo-SV-Luc-ODD (or pEpo-SV-VEGF-ODD). In vitro gene expression efficiency of each vector type was evaluated in HEK 293 cells under both hypoxic and normoxic conditions. The amount of VEGF protein was estimated by ELISA. The VEGF expression vectors with or without the ODD domain were injected into ischemic rat myocardium. Fibrosis, neovascularization, and cardiomyocyte apoptosis were assessed using Masson's trichrome staining, α-smooth muscle actin (α-SMA) immunostaining, and the TUNEL assay, respectively. The plasmid vectors containing ODD significantly improved the expression level of VEGF protein in hypoxic conditions. The enhancement of VEGF protein production was attributed to increased protein stability due to oxygen deficiency. In a rat model of myocardial ischemia, the pEpo-SV-VEGF-ODD group exhibited less myocardial fibrosis, higher microvessel density, and less cardiomyocyte apoptosis compared to the control groups (saline and pEpo-SV-VEGF treatments). An ODD-mediated VEGF expression system that facilitates VEGF-production under hypoxia may be useful in the treatment of ischemic heart disease.

Neonatal Systemic AAV Induces Tolerance to CNS Gene Therapy in MPS I Dogs and Nonhuman Primates

PubMed Central

Hinderer, Christian; Bell, Peter; Louboutin, Jean-Pierre; Zhu, Yanqing; Yu, Hongwei; Lin, Gloria; Choa, Ruth; Gurda, Brittney L; Bagel, Jessica; O'Donnell, Patricia; Sikora, Tracey; Ruane, Therese; Wang, Ping; Tarantal, Alice F; Casal, Margret L; Haskins, Mark E; Wilson, James M

2015-01-01

The potential host immune response to a nonself protein poses a fundamental challenge for gene therapies targeting recessive diseases. We demonstrate in both dogs and nonhuman primates that liver-directed gene transfer using an adeno-associated virus (AAV) vector in neonates induces a persistent state of immunological tolerance to the transgene product, substantially improving the efficacy of subsequent vector administration targeting the central nervous system (CNS). We applied this approach to a canine model of mucopolysaccharidosis type I (MPS I), a progressive neuropathic lysosomal storage disease caused by deficient activity of the enzyme α-l-iduronidase (IDUA). MPS I dogs treated systemically in the first week of life with a vector expressing canine IDUA did not develop antibodies against the enzyme and exhibited robust expression in the CNS upon intrathecal AAV delivery at 1 month of age, resulting in complete correction of brain storage lesions. Newborn rhesus monkeys treated systemically with AAV vector expressing human IDUA developed tolerance to the transgene, resulting in high cerebrospinal fluid (CSF) IDUA expression and no antibody induction after subsequent CNS gene therapy. These findings suggest that inducing tolerance to the transgene product during a critical period in immunological development can improve the efficacy and safety of gene therapy. PMID:26022732

Neonatal Systemic AAV Induces Tolerance to CNS Gene Therapy in MPS I Dogs and Nonhuman Primates.

PubMed

Hinderer, Christian; Bell, Peter; Louboutin, Jean-Pierre; Zhu, Yanqing; Yu, Hongwei; Lin, Gloria; Choa, Ruth; Gurda, Brittney L; Bagel, Jessica; O'Donnell, Patricia; Sikora, Tracey; Ruane, Therese; Wang, Ping; Tarantal, Alice F; Casal, Margret L; Haskins, Mark E; Wilson, James M

2015-08-01

The potential host immune response to a nonself protein poses a fundamental challenge for gene therapies targeting recessive diseases. We demonstrate in both dogs and nonhuman primates that liver-directed gene transfer using an adeno-associated virus (AAV) vector in neonates induces a persistent state of immunological tolerance to the transgene product, substantially improving the efficacy of subsequent vector administration targeting the central nervous system (CNS). We applied this approach to a canine model of mucopolysaccharidosis type I (MPS I), a progressive neuropathic lysosomal storage disease caused by deficient activity of the enzyme α-l-iduronidase (IDUA). MPS I dogs treated systemically in the first week of life with a vector expressing canine IDUA did not develop antibodies against the enzyme and exhibited robust expression in the CNS upon intrathecal AAV delivery at 1 month of age, resulting in complete correction of brain storage lesions. Newborn rhesus monkeys treated systemically with AAV vector expressing human IDUA developed tolerance to the transgene, resulting in high cerebrospinal fluid (CSF) IDUA expression and no antibody induction after subsequent CNS gene therapy. These findings suggest that inducing tolerance to the transgene product during a critical period in immunological development can improve the efficacy and safety of gene therapy.

A Tupaia paramyxovirus vector system for targeting and transgene expression.

PubMed

Engeland, Christine E; Bossow, Sascha; Hudacek, Andrew W; Hoyler, Birgit; Förster, Judith; Veinalde, Rūta; Jäger, Dirk; Cattaneo, Roberto; Ungerechts, Guy; Springfeld, Christoph

2017-09-01

Viruses from the diverse family of Paramyxoviridae include important pathogens and are applied in gene therapy and for cancer treatment. The Tupaia paramyxovirus (TPMV), isolated from the kidney of a tree shrew, does not infect human cells and neutralizing antibodies against other Paramyxoviridae do not cross-react with TPMV. Here, we present a vector system for de novo generation of infectious TPMV that allows for insertion of additional genes as well as targeting using antibody single-chain variable fragments. We show that the recombinant TPMV specifically infect cells expressing the targeted receptor and replicate in human cells. This vector system provides a valuable tool for both basic research and therapeutic applications.

Noise-induced drift in two-dimensional anisotropic systems

NASA Astrophysics Data System (ADS)

Farago, Oded

2017-10-01

We study the isothermal Brownian dynamics of a particle in a system with spatially varying diffusivity. Due to the heterogeneity of the system, the particle's mean displacement does not vanish even if it does not experience any physical force. This phenomenon has been termed "noise-induced drift," and has been extensively studied for one-dimensional systems. Here, we examine the noise-induced drift in a two-dimensional anisotropic system, characterized by a symmetric diffusion tensor with unequal diagonal elements. A general expression for the mean displacement vector is derived and presented as a sum of two vectors, depicting two distinct drifting effects. The first vector describes the tendency of the particle to drift toward the high diffusivity side in each orthogonal principal diffusion direction. This is a generalization of the well-known expression for the noise-induced drift in one-dimensional systems. The second vector represents a novel drifting effect, not found in one-dimensional systems, originating from the spatial rotation in the directions of the principal axes. The validity of the derived expressions is verified by using Langevin dynamics simulations. As a specific example, we consider the relative diffusion of two transmembrane proteins, and demonstrate that the average distance between them increases at a surprisingly fast rate of several tens of micrometers per second.

A novel system for the production of high levels of functional human therapeutic proteins in stable cells with a Semliki Forest virus noncytopathic vector.

PubMed

Casales, Erkuden; Aranda, Alejandro; Quetglas, Jose I; Ruiz-Guillen, Marta; Rodriguez-Madoz, Juan R; Prieto, Jesus; Smerdou, Cristian

2010-05-31

Semliki Forest virus (SFV) vectors lead to high protein expression in mammalian cells, but expression is transient due to vector cytopathic effects, inhibition of host cell proteins and RNA-based expression. We have used a noncytopathic SFV mutant (ncSFV) RNA vector to generate stable cell lines expressing two human therapeutic proteins: insulin-like growth factor I (IGF-I) and cardiotrophin-1 (CT-1). Therapeutic genes were fused at the carboxy-terminal end of Puromycin N-acetyl-transferase gene by using as a linker the sequence coding for foot-and-mouth disease virus (FMDV) 2A autoprotease. These cassettes were cloned into the ncSFV vector. Recombinant ncSFV vectors allowed rapid and efficient selection of stable BHK cell lines with puromycin. These cells expressed IGF-I and CT-1 in supernatants at levels reaching 1.4 and 8.6 microg/10(6)cells/24 hours, respectively. Two cell lines generated with each vector were passaged ten times during 30 days, showing constant levels of protein expression. Recombinant proteins expressed at different passages were functional by in vitro signaling assays. Stability at RNA level was unexpectedly high, showing a very low mutation rate in the CT-1 sequence, which did not increase at high passages. CT-1 was efficiently purified from supernatants of ncSFV cell lines, obtaining a yield of approximately 2mg/L/24 hours. These results indicate that the ncSFV vector has a great potential for the production of recombinant proteins in mammalian cells. 2010 Elsevier B.V. All rights reserved.

Genetically modified pigs produced with a nonviral episomal vector

PubMed Central

Manzini, Stefano; Vargiolu, Alessia; Stehle, Isa M; Bacci, Maria Laura; Cerrito, Maria Grazia; Giovannoni, Roberto; Zannoni, Augusta; Bianco, Maria Rosaria; Forni, Monica; Donini, Pierluigi; Papa, Michele; Lipps, Hans J; Lavitrano, Marialuisa

2006-01-01

Genetic modification of cells and animals is an invaluable tool for biotechnology and biomedicine. Currently, integrating vectors are used for this purpose. These vectors, however, may lead to insertional mutagenesis and variable transgene expression and can undergo silencing. Scaffold/matrix attachment region-based vectors are nonviral expression systems that replicate autonomously in mammalian cells, thereby making possible safe and reliable genetic modification of higher eukaryotic cells and organisms. In this study, genetically modified pig fetuses were produced with the scaffold/matrix attachment region-based vector pEPI, delivered to embryos by the sperm-mediated gene transfer method. The pEPI vector was detected in 12 of 18 fetuses in the different tissues analyzed and was shown to be retained as an episome. The reporter gene encoded by the pEPI vector was expressed in 9 of 12 genetically modified fetuses. In positive animals, all tissues analyzed expressed the reporter gene; moreover in these tissues, the positive cells were on the average 79%. The high percentage of EGFP-expressing cells and the absence of mosaicism have important implications for biotechnological and biomedical applications. These results are an important step forward in animal transgenesis and can provide the basis for the future development of germ-line gene therapy. PMID:17101993

A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.

PubMed

Brandenburger, A; Russell, S

1996-10-01

MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.

Definition of Contravariant Velocity Components

NASA Technical Reports Server (NTRS)

Hung, Ching-Mao; Kwak, Dochan (Technical Monitor)

2002-01-01

This is an old issue in computational fluid dynamics (CFD). What is the so-called contravariant velocity or contravariant velocity component? In the article, we review the basics of tensor analysis and give the contravariant velocity component a rigorous explanation. For a given coordinate system, there exist two uniquely determined sets of base vector systems - one is the covariant and another is the contravariant base vector system. The two base vector systems are reciprocal. The so-called contravariant velocity component is really the contravariant component of a velocity vector for a time-independent coordinate system, or the contravariant component of a relative velocity between fluid and coordinates, for a time-dependent coordinate system. The contravariant velocity components are not physical quantities of the velocity vector. Their magnitudes, dimensions, and associated directions are controlled by their corresponding covariant base vectors. Several 2-D (two-dimensional) linear examples and 2-D mass-conservation equation are used to illustrate the details of expressing a vector with respect to the covariant and contravariant base vector systems, respectively.

Lack of Humoral Immune Response to the Tetracycline (Tet) Activator in Rats Injected Intracranially with Tet-off rAAV Vectors

PubMed Central

Han, Ye; Chang, Qin A.; Virag, Tamas; West, Neva C.; George, David; Castro, Maria G.; Bohn, Martha C.

2010-01-01

The ability to safely control transgene expression from viral vectors is a long-term goal in the gene therapy field. We have previously reported tight regulation of GFP expression in rat brain using a self-regulating tet-off rAAV vector. The immune responses against tet regulatory elements observed by other groups in nonhuman primates after intramuscular injection of tet-on encoding vectors raise concerns about the clinical value of tet-regulated vectors. However, previous studies have not examined immune responses following injection of AAV vectors into brain. Therefore, rat striatum was injected with tet-off rAAV harboring a therapeutic gene for Parkinson's disease, either hAADC or hGDNF. The expression of each gene was tightly controlled by the tet-off regulatory system. Using an ELISA developed with purified GST-tTA protein, no detectable immunogenicity against tTA was observed in sera of rats that received an intrastriatal injection of either vector. In contrast, sera from rats intradermally injected with an adenovirus containing either tTA or rtTA, as positive controls, had readily detectable antibodies. These observations suggest that tet-off rAAV vectors do not elicit an immune response when injected into rat brain and that these may offer safer vectors for Parkinson's disease than vectors with constitutive expression. PMID:20164859

VEST: Abstract Vector Calculus Simplification in Mathematica

DOE Office of Scientific and Technical Information (OSTI.GOV)

J. Squire, J. Burby and H. Qin

2013-03-12

We present a new package, VEST (Vector Einstein Summation Tools), that performs abstract vector calculus computations in Mathematica. Through the use of index notation, VEST is able to reduce scalar and vector expressions of a very general type using a systematic canonicalization procedure. In addition, utilizing properties of the Levi-Civita symbol, the program can derive types of multi-term vector identities that are not recognized by canonicalization, subsequently applying these to simplify large expressions. In a companion paper [1], we employ VEST in the automation of the calculation of Lagrangians for the single particle guiding center system in plasma physics, amore » computation which illustrates its ability to handle very large expressions. VEST has been designed to be simple and intuitive to use, both for basic checking of work and more involved computations. __________________________________________________« less

VEST: Abstract vector calculus simplification in Mathematica

NASA Astrophysics Data System (ADS)

Squire, J.; Burby, J.; Qin, H.

2014-01-01

We present a new package, VEST (Vector Einstein Summation Tools), that performs abstract vector calculus computations in Mathematica. Through the use of index notation, VEST is able to reduce three-dimensional scalar and vector expressions of a very general type to a well defined standard form. In addition, utilizing properties of the Levi-Civita symbol, the program can derive types of multi-term vector identities that are not recognized by reduction, subsequently applying these to simplify large expressions. In a companion paper Burby et al. (2013) [12], we employ VEST in the automation of the calculation of high-order Lagrangians for the single particle guiding center system in plasma physics, a computation which illustrates its ability to handle very large expressions. VEST has been designed to be simple and intuitive to use, both for basic checking of work and more involved computations.

Efficiency of VIGS and gene expression in a novel bipartite potexvirus vector delivery system as a function of strength of TGB1 silencing suppression.

PubMed

Lim, Hyoun-Sub; Vaira, Anna Maria; Domier, Leslie L; Lee, Sung Chul; Kim, Hong Gi; Hammond, John

2010-06-20

We have developed plant virus-based vectors for virus-induced gene silencing (VIGS) and protein expression, based on Alternanthera mosaic virus (AltMV), for infection of a wide range of host plants including Nicotiana benthamiana and Arabidopsis thaliana by either mechanical inoculation of in vitro transcripts or via agroinfiltration. In vivo transcripts produced by co-agroinfiltration of bacteriophage T7 RNA polymerase resulted in T7-driven AltMV infection from a binary vector in the absence of the Cauliflower mosaic virus 35S promoter. An artificial bipartite viral vector delivery system was created by separating the AltMV RNA-dependent RNA polymerase and Triple Gene Block (TGB)123-Coat protein (CP) coding regions into two constructs each bearing the AltMV 5' and 3' non-coding regions, which recombined in planta to generate a full-length AltMV genome. Substitution of TGB1 L(88)P, and equivalent changes in other potexvirus TGB1 proteins, affected RNA silencing suppression efficacy and suitability of the vectors from protein expression to VIGS. Published by Elsevier Inc.

The prospect of gene therapy for prostate cancer: update on theory and status.

PubMed

Koeneman, K S; Hsieh, J T

2001-09-01

Molecularly based novel therapeutic agents are needed to address the problem of locally recurrent, or metastatic, advanced hormone-refractory prostate cancer. Recent basic science advances in mechanisms of gene expression, vector delivery, and targeting have rendered clinically relevant gene therapy to the prostatic fossa and distant sites feasible in the near future. Current research and clinical investigative efforts involving methods for more effective vector delivery and targeting, with enhanced gene expression to selected (specific) sites, are reviewed. These areas of research involve tissue-specific promoters, transgene exploration, vector design and delivery, and selective vector targeting. The 'vectorology' involved mainly addresses selective tissue homing with ligands, mechanisms of innate immune system evasion for durable transgene expression, and the possibility of repeat administration.

A modular toolset for recombination transgenesis and neurogenetic analysis of Drosophila.

PubMed

Wang, Ji-Wu; Beck, Erin S; McCabe, Brian D

2012-01-01

Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues.

Simple cloning strategy using GFPuv gene as positive/negative indicator.

PubMed

Miura, Hiromi; Inoko, Hidetoshi; Inoue, Ituro; Tanaka, Masafumi; Sato, Masahiro; Ohtsuka, Masato

2011-09-15

Because construction of expression vectors is the first requisite in the functional analysis of genes, development of simple cloning systems is a major requirement during the postgenomic era. In the current study, we developed cloning vectors for gain- or loss-of-function studies by using the GFPuv gene as a positive/negative indicator of cloning. These vectors allow us to easily detect correct clones and obtain expression vectors from a simple procedure by means of the combined use of the GFPuv gene and a type IIS restriction enzyme. Copyright © 2011 Elsevier Inc. All rights reserved.

A Simple And Rapid Minicircle DNA Vector Manufacturing System

PubMed Central

Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying

2010-01-01

Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455

Alphavirus replicon approach to promoterless analysis of IRES elements.

PubMed

Kamrud, K I; Custer, M; Dudek, J M; Owens, G; Alterson, K D; Lee, J S; Groebner, J L; Smith, J F

2007-04-10

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced >95% compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development.

Alphavirus Replicon Approach to Promoterless Analysis of IRES Elements

PubMed Central

Kamrud, K.I.; Custer, M.; Dudek, J.M.; Owens, G.; Alterson, K.D.; Lee, J.S.; Groebner, J.L.; Smith, J.F.

2007-01-01

Here we describe a system for promoterless analysis of putative internal ribosome entry site (IRES) elements using an alphavirus (Family Togaviridae) replicon vector. The system uses the alphavirus subgenomic promoter to produce transcripts that, when modified to contain a spacer region upstream of an IRES element, allow analysis of cap-independent translation of genes of interest (GOI). If the IRES element is removed, translation of the subgenomic transcript can be reduced > 95 % compared to the same transcript containing a functional IRES element. Alphavirus replicons, used in this manner, offer an alternative to standard dicistronic DNA vectors or in-vitro translation systems currently used to analyze putative IRES elements. In addition, protein expression levels varied depending on the spacer element located upstream of each IRES. The ability to modulate the level of expression from alphavirus vectors should extend the utility of these vectors in vaccine development. PMID:17156813

Viral Paratransgenesis in the Malaria Vector Anopheles gambiae

PubMed Central

Ren, Xiaoxia; Hoiczyk, Egbert; Rasgon, Jason L.

2008-01-01

Paratransgenesis, the genetic manipulation of insect symbiotic microorganisms, is being considered as a potential method to control vector-borne diseases such as malaria. The feasibility of paratransgenic malaria control has been hampered by the lack of candidate symbiotic microorganisms for the major vector Anopheles gambiae. In other systems, densonucleosis viruses (DNVs) are attractive agents for viral paratransgenesis because they infect important vector insects, can be genetically manipulated and are transmitted to subsequent generations. However, An. gambiae has been shown to be refractory to DNV dissemination. We discovered, cloned and characterized the first known DNV (AgDNV) capable of infection and dissemination in An. gambiae. We developed a flexible AgDNV-based expression vector to express any gene of interest in An. gambiae using a two-plasmid helper-transducer system. To demonstrate proof-of-concept of the viral paratransgenesis strategy, we used this system to transduce expression of an exogenous gene (enhanced green fluorescent protein; EGFP) in An. gambiae mosquitoes. Wild-type and EGFP-transducing AgDNV virions were highly infectious to An. gambiae larvae, disseminated to and expressed EGFP in epidemiologically relevant adult tissues such as midgut, fat body and ovaries and were transmitted to subsequent mosquito generations. These proof-of-principle data suggest that AgDNV could be used as part of a paratransgenic malaria control strategy by transduction of anti-Plasmodium peptides or insect-specific toxins in Anopheles mosquitoes. AgDNV will also be extremely valuable as an effective and easy-to-use laboratory tool for transient gene expression or RNAi in An. gambiae. PMID:18725926

Akt/protein kinase B activation by adenovirus vectors contributes to NFkappaB-dependent CXCL10 expression.

PubMed

Liu, Qiang; White, Lindsay R; Clark, Sharon A; Heffner, Daniel J; Winston, Brent W; Tibbles, Lee Anne; Muruve, Daniel A

2005-12-01

In gene therapy, the innate immune system is a significant barrier to the effective application of adenovirus (Ad) vectors. In kidney epithelium-derived (REC) cells, serotype 5 Ad vectors induce the expression of the chemokine CXCL10 (IP-10), a response that is dependent on NFkappaB. Compared to the parental vector AdLuc, transduction with the RGD-deleted vector AdL.PB resulted in reduced CXCL10 activation despite increasing titers, implying that RGD-alpha(V) integrin interactions contribute to adenovirus induction of inflammatory genes. Akt, a downstream effector of integrin signaling, was activated within 10 min of transduction with Ad vectors in a dose-dependent manner. Akt activation was not present following transduction with AdL.PB, confirming the importance of capsid-alpha(V) integrin interactions in Ad vector Akt activation. Inhibition of the phosphoinositide-3-OH kinase/Akt pathway by Wortmannin or Ly294002 compounds decreased Ad vector induction of CXCL10 mRNA. Similarly, adenovirus-mediated overexpression of the dominant negative AktAAA decreased CXCL10 mRNA expression compared to the reporter vector AdLacZ alone. The effect of Akt on CXCL10 mRNA expression occurred via NFkappaB-dependent transcriptional activation, since AktAAA overexpression and Ly294002 both inhibited CXCL10 and NFkappaB promoter activation in luciferase reporter experiments. These results show that Akt plays a role in the Ad vector activation of NFkappaB and CXCL10 expression. Understanding the mechanism underlying the regulation of host immunomodulatory genes by adenovirus vectors will lead to strategies that will improve the efficacy and safety of these agents for clinical use.

Back to basics: pBR322 and protein expression systems in E. coli.

PubMed

Balbás, Paulina; Bolívar, Francisco

2004-01-01

The extensive variety of plasmid-based expression systems in E. coli resulted from the fact that there is no single strategy for achieving maximal expression of every cloned gene. Although a number of strategies have been implemented to deal with problems associated to gene transcription and translation, protein folding, secretion, location, posttranslational modifications, particularities of different strains, and the like and more integrated processes have been developed, the basic plasmid-borne elements and their interaction with the particular host strain will influence the overall expression system and final productivity. Plasmid vector pBR322 is a well-established multipurpose cloning vector in laboratories worldwide, and a large number of derivatives have been created for specific applications and research purposes, including gene expression in its natural host, E. coli, and few other bacteria. The early characterization of the molecule, including its nucleotide sequence, replication and maintenance mechanisms, and determination of its coding regions, accounted for its success, not only as a universal cloning vector, but also as a provider of genes and an origin of replication for other intraspecies vectors. Since the publication of the aforementioned reviews, novel discoveries pertaining to these issues have appeared in the literature that deepen the understanding of the plasmid's features, behavior, and impact in gene expression systems, as well as some important strain characteristics that affect plasmid replication and stability. The objectives of this review include updating and discussing the new information about (1) the replication and maintenance of pBR322; (2) the host-related modulation mechanisms of plasmid replication; (3) the effects of growth rate on replication control, stability, and recombinant gene expression; (4) ways for plasmid amplification and elimination. Finally, (5) a summary of novel ancillary studies about pBR322 is presented.

Identification of Essential Genetic Baculoviral Elements for Recombinant Protein Expression by Transactivation in Sf21 Insect Cells.

PubMed

Bleckmann, Maren; Schürig, Margitta; Chen, Fang-Fang; Yen, Zen-Zen; Lindemann, Nils; Meyer, Steffen; Spehr, Johannes; van den Heuvel, Joop

2016-01-01

The Baculovirus Expression Vector System (BEVS) is widely used to produce high amounts of recombinant proteins. Nevertheless, generating recombinant baculovirus in high quality is rather time-consuming and labor-intensive. Alternatively, virus-free expression in insect cells did not achieve similar expression levels for most proteins so far. The transactivation method is a promising approach for protein expression in Sf21 cells. It combines advantages of BEVS and plasmid-based expression by activating strong virus-dependent promoters on a transfected plasmid by baculoviral coinfection. Here, we identified expression elements required for transactivation. Therefore, we designed several vectors comprising different viral promoters or promoter combinations and tested them for eGFP expression using the automated BioLector microcultivation system. Remarkably, only the combination of the very late promoter p10 together with the homologous region 5 (hr5) could boost expression during transactivation. Other elements, like p10 alone or the late viral promoter polH, did not respond to transactivation. A new combination of hr5 and p10 with the strongest immediate early OpMNPV viral promoter OpIE2 improved the yield of eGFP by ~25% in comparison to the previous applied hr5-IE1-p10 expression cassette. Furthermore, we observed a strong influence of the transcription termination sequence and vector backbone on the level of expression. Finally, the expression levels for transactivation, BEVS and solely plasmid-based expression were compared for the marker protein eGFP, underlining the potential of transactivation for fast recombinant protein expression in Sf21 cells. In conclusion, essential elements for transactivation could be identified. The optimal elements were applied to generate an improved vector applicable in virus-free plasmid-based expression, transactivation and BEVS.

Modification and identification of a vector for making a large phage antibody library.

PubMed

Zhang, Guo-min; Chen, Yü-ping; Guan, Yuan-zhi; Wang, Yan; An, Yun-qing

2007-11-20

The large phage antibody library is used to obtain high-affinity human antibody, and the Loxp/cre site-specific recombination system is a potential method for constructing a large phage antibody library. In the present study, a phage antibody library vector pDF was reconstructed to construct diabody more quickly and conveniently without injury to homologous recombination and the expression function of the vector and thus to integrate construction of the large phage antibody library with the preparation of diabodies. scFv was obtained by overlap polymerase chain reaction (PCR) amplification with the newly designed VL and VH extension primers. loxp511 was flanked by VL and VH and the endonuclease ACC III encoding sequences were introduced on both sides of loxp511. scFv was cloned into the vector pDF to obtain the vector pDscFv. The vector expression function was identified and the feasibility of diabody preparation was evaluated. A large phage antibody library was constructed in pDscFv. Several antigens were used to screen the antibody library and the quality of the antibody library was evaluated. The phage antibody library expression vector pDscFv was successfully constructed and confirmed to express functional scFv. The large phage antibody library constructed using this vector was of high diversity. Screening of the library on 6 antigens confirmed the generation of specific antibodies to these antigens. Two antibodies were subjected to enzymatic digestion and were prepared into diabody with functional expression. The reconstructed vector pDscFv retains its recombination capability and expression function and can be used to construct large phage antibody libraries. It can be used as a convenient and quick method for preparing diabodies after simple enzymatic digestion, which facilitates clinical trials and application of antibody therapy.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production.

PubMed

Irla, Marta; Heggeset, Tonje M B; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B; Brautaset, Trygve; Wendisch, Volker F

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium.

Genome-Based Genetic Tool Development for Bacillus methanolicus: Theta- and Rolling Circle-Replicating Plasmids for Inducible Gene Expression and Application to Methanol-Based Cadaverine Production

PubMed Central

Irla, Marta; Heggeset, Tonje M. B.; Nærdal, Ingemar; Paul, Lidia; Haugen, Tone; Le, Simone B.; Brautaset, Trygve; Wendisch, Volker F.

2016-01-01

Bacillus methanolicus is a thermophilic methylotroph able to overproduce amino acids from methanol, a substrate not used for human or animal nutrition. Based on our previous RNA-seq analysis a mannitol inducible promoter and a putative mannitol activator gene mtlR were identified. The mannitol inducible promoter was applied for controlled gene expression using fluorescent reporter proteins and a flow cytometry analysis, and improved by changing the -35 promoter region and by co-expression of the mtlR regulator gene. For independent complementary gene expression control, the heterologous xylose-inducible system from B. megaterium was employed and a two-plasmid gene expression system was developed. Four different replicons for expression vectors were compared with respect to their copy number and stability. As an application example, methanol-based production of cadaverine was shown to be improved from 11.3 to 17.5 g/L when a heterologous lysine decarboxylase gene cadA was expressed from a theta-replicating rather than a rolling-circle replicating vector. The current work on inducible promoter systems and compatible theta- or rolling circle-replicating vectors is an important extension of the poorly developed B. methanolicus genetic toolbox, valuable for genetic engineering and further exploration of this bacterium. PMID:27713731

A high-level prokaryotic expression system: synthesis of human interleukin 1 alpha and its receptor antagonist.

PubMed

Birikh, K R; Lebedenko, E N; Boni, I V; Berlin, Y A

1995-10-27

Synthetic intronless genes, coding for human interleukin 1 alpha (IL 1 alpha) and interleukin 1 receptor antagonist (IL1ra), have been expressed efficiently in a specially designed prokaryotic vector, pGMCE (a pGEM1 derivative), where the target gene forms the second part of a two-cistron system. The first part of the system is a translation enhancer-containing mini-cistron, whose termination codon overlaps the start codon of the target gene. In the case of the IL1 alpha gene, the high expression level is largely due to the direct efficient translation initiation at the second cistron, whereas with the IL1ra gene in the same system, the proximal translation initiation region (TIR) provides a high level of coupled expression of the target gene. Thus, pGMCE is a potentially versatile vector for direct prokaryotic expression.

Laboratory formulated magnetic nanoparticles for enhancement of viral gene expression in suspension cell line.

PubMed

Bhattarai, Shanta Raj; Kim, Sun Young; Jang, Kyu Yun; Lee, Ki Chang; Yi, Ho Keun; Lee, Dae Yeol; Kim, Hak Yong; Hwang, Pyoung Han

2008-02-01

One factor critical to successful gene therapy is the development of efficient delivery systems. Although advances in gene transfer technology including viral and non-viral vectors have been made, an ideal vector system has not yet been constructed. Due to the growing concerns over the toxicity and immunogenicity of viral DNA delivery systems, DNA delivery via improve viral routes has become more desirable and advantageous. The ideal improve viral DNA delivery system should be a synthetic materials plus viral vectors. The materials should also be biocompatible, efficient, and modular so that it is tunable to various applications in both research and clinical settings. The successful steps towards this improve viral DNA delivery system is demonstrated: a magnetofection system mediated by modified cationic chitosan-coated iron oxide nanoparticles. Dense colloidal cationic iron oxide nanoparticles serve as an uptake-enhancing component by physical concentration at the cell surface in presence of external magnetic fields; enhanced viral gene expression (3-100-fold) due to the particles is seen as compared to virus vector alone with little virus dose.

A stable RNA virus-based vector for citrus trees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Folimonov, Alexey S.; Folimonova, Svetlana Y.; Bar-Joseph, Moshe

Virus-based vectors are important tools in plant molecular biology and plant genomics. A number of vectors based on viruses that infect herbaceous plants are in use for expression or silencing of genes in plants as well as screening unknown sequences for function. Yet there is a need for useful virus-based vectors for woody plants, which demand much greater stability because of the longer time required for systemic infection and analysis. We examined several strategies to develop a Citrus tristeza virus (CTV)-based vector for transient expression of foreign genes in citrus trees using a green fluorescent protein (GFP) as a reporter.more » These strategies included substitution of the p13 open reading frame (ORF) by the ORF of GFP, construction of a self-processing fusion of GFP in-frame with the major coat protein (CP), or expression of the GFP ORF as an extra gene from a subgenomic (sg) mRNA controlled either by a duplicated CTV CP sgRNA controller element (CE) or an introduced heterologous CE of Beet yellows virus. Engineered vector constructs were examined for replication, encapsidation, GFP expression during multiple passages in protoplasts, and for their ability to infect, move, express GFP, and be maintained in citrus plants. The most successful vectors based on the 'add-a-gene' strategy have been unusually stable, continuing to produce GFP fluorescence after more than 4 years in citrus trees.« less

Symbolic computer vector analysis

NASA Technical Reports Server (NTRS)

Stoutemyer, D. R.

1977-01-01

A MACSYMA program is described which performs symbolic vector algebra and vector calculus. The program can combine and simplify symbolic expressions including dot products and cross products, together with the gradient, divergence, curl, and Laplacian operators. The distribution of these operators over sums or products is under user control, as are various other expansions, including expansion into components in any specific orthogonal coordinate system. There is also a capability for deriving the scalar or vector potential of a vector field. Examples include derivation of the partial differential equations describing fluid flow and magnetohydrodynamics, for 12 different classic orthogonal curvilinear coordinate systems.

A DNA replicon system for rapid high-level production of virus-like particles in plants.

PubMed

Huang, Zhong; Chen, Qiang; Hjelm, Brooke; Arntzen, Charles; Mason, Hugh

2009-07-01

Recombinant virus-like particles (VLPs) represent a safe and effective vaccine strategy. We previously described a stable transgenic plant system for inexpensive production and oral delivery of VLP vaccines. However, the relatively low-level antigen accumulation and long-time frame to produce transgenic plants are the two major roadblocks in the practical development of plant-based VLP production. In this article, we describe the optimization of geminivirus-derived DNA replicon vectors for rapid, high-yield plant-based production of VLPs. Co-delivery of bean yellow dwarf virus (BeYDV)-derived vector and Rep/RepA-supplying vector by agroinfiltration of Nicotiana benthamiana leaves resulted in efficient replicon amplification and robust protein production within 5 days. Co-expression of the P19 protein of tomato bush stunt virus, a gene silencing inhibitor, further enhanced VLP accumulation by stabilizing the mRNA. With this system, hepatitis B core antigen (HBc) and Norwalk virus capsid protein (NVCP) were produced at 0.80 and 0.34 mg/g leaf fresh weight, respectively. Sedimentation analysis and electron microscopy of transiently expressed antigens verified the efficient assembly of VLPs. Furthermore, a single replicon vector containing a built-in Rep/RepA cassette without P19 drove protein expression at similar levels as the three-component system. These results demonstrate the advantages of fast and high-level production of VLP-based vaccines using the BeYDV-derived DNA replicon system for transient expression in plants. (c) 2009 Wiley Periodicals, Inc.

A DNA replicon system for rapid high-level production of virus-like particles in plants

PubMed Central

Huang, Zhong; Chen, Qiang; Hjelm, Brooke; Arntzen, Charles

2009-01-01

Recombinant virus-like particles (VLPs) represent a safe and effective vaccine strategy. We previously described a stable transgenic plant system for inexpensive production and oral delivery of VLP vaccines. However, the relatively low level antigen accumulation and long time frame to produce transgenic plants are the two major roadblocks in the practical development of plant-based VLP production. In this paper, we describe the optimization of geminivirus-derived DNA replicon vectors for rapid, high-yield plant-based production of VLPs. Co-delivery of bean yellow dwarf virus (BeYDV)-derived vector and Rep/RepA-supplying vector by agroinfiltration of Nicotiana benthamiana leaves resulted in efficient replicon amplification and robust protein production within five days. Co-expression of the P19 protein of tomato bush stunt virus, a gene silencing inhibitor, further enhanced VLP accumulation by stabilizing the mRNA. With this system, hepatitis B core antigen (HBc) and Norwalk virus capsid protein (NVCP) were produced at 0.80 and 0.34 mg/g leaf fresh weight, respectively. Sedimentation analysis and electron microscopy of transiently expressed antigens verified the efficient assembly of VLPs. Furthermore, a single replicon vector containing a built-in Rep/RepA cassette without p19 drove protein expression at similar levels as the three-component system. These results demonstrate the advantages of fast and high-level production of VLP-based vaccines using the BeYDV-derived DNA replicon system for transient expression in plants. PMID:19309755

In planta expression of HIV-1 p24 protein using an RNA plant virus-based expression vector.

PubMed

Zhang, G; Leung, C; Murdin, L; Rovinski, B; White, K A

2000-02-01

Plant viruses show significant potential as expression vectors for the production of foreign proteins (e.g., antigens) in plants. The HIV-1 p24 nucleocapsid protein is an important early marker of HIV infection and has been used as an antigen in the development of HIV vaccines. Toward developing a plant-based expression system for the production of p24, we have investigated the use of a (positive)-strand RNA plant virus, tomato bushy stunt virus (TBSV), as an expression vector. The HIV p24 open reading frame (ORF) was introduced into a cloned cDNA copy of the TBSV genome as an in-frame fusion with a 5'-terminal portion of the TBSV coat protein ORF. In vitro-generated RNA transcripts corresponding to the engineered virus vector were infectious when inoculated into plant protoplasts; Northern and Western blot analyses verified the accumulation of a predicted p24-encoding viral subgenomic mRNA and the production of p24 fusion product. Whole-plant infections with the viral vector led to the accumulation of p24 fusion protein in inoculated leaves, which cross-reacted with p24-specific antibodies, thus confirming the maintenance of key antigenic determinants. This study is the first to demonstrate that TBSV can be engineered to express a complete foreign protein of clinical importance. Strategies for optimizing protein yield from this viral vector are discussed.

Cereal transformation through particle bombardment

NASA Technical Reports Server (NTRS)

Casas, A. M.; Kononowicz, A. K.; Bressan, R. A.; Hasegawa, P. M.; Mitchell, C. A. (Principal Investigator)

1995-01-01

The review focuses on experiments that lead to stable transformation in cereals using microprojectile bombardment. The discussion of biological factors that affect transformation examines target tissues and vector systems for gene transfer. The vector systems include reporter genes, selectable markers, genes of agronomic interest, and vector constructions. Other topics include physical parameters that affect DNA delivery, selection of stably transformed cells and plant regeneration, and analysis of gene expression and transmission to the progeny.

Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-12-20

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-09-30

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Construction of fusion vectors of corynebacteria: expression of glutathione-S-transferase fusion protein in Corynebacterium acetoacidophilum ATCC 21476.

PubMed

Srivastava, Preeti; Deb, J K

2002-07-02

A series of fusion vectors containing glutathione-S-transferase (GST) were constructed by inserting GST fusion cassette of Escherichia coli vectors pGEX4T-1, -2 and -3 in corynebacterial vector pBK2. Efficient expression of GST driven by inducible tac promoter of E. coli was observed in Corynebacterium acetoacidophilum. Fusion of enhanced green fluorescent protein (EGFP) and streptokinase genes in this vector resulted in the synthesis of both the fusion proteins. The ability of this recombinant organism to produce several-fold more of the product in the extracellular medium than in the intracellular space would make this system quite attractive as far as the downstream processing of the product is concerned.

Methods for Gene Transfer to the Central Nervous System

PubMed Central

Kantor, Boris; Bailey, Rachel M.; Wimberly, Keon; Kalburgi, Sahana N.; Gray, Steven J.

2015-01-01

Gene transfer is an increasingly utilized approach for research and clinical applications involving the central nervous system (CNS). Vectors for gene transfer can be as simple as an unmodified plasmid, but more commonly involve complex modifications to viruses to make them suitable gene delivery vehicles. This chapter will explain how tools for CNS gene transfer have been derived from naturally occurring viruses. The current capabilities of plasmid, retroviral, adeno-associated virus, adenovirus, and herpes simplex virus vectors for CNS gene delivery will be described. These include both focal and global CNS gene transfer strategies, with short- or long-term gene expression. As is described in this chapter, an important aspect of any vector is the cis-acting regulatory elements incorporated into the vector genome that control when, where, and how the transgene is expressed. PMID:25311922

Development of a GFP expression vector for Cucurbit chlorotic yellows virus.

PubMed

Wei, Ying; Han, Xiaoyu; Wang, Zhenyue; Gu, Qinsheng; Li, Honglian; Chen, Linlin; Sun, Bingjian; Shi, Yan

2018-05-24

Cucurbit chlorotic yellows virus (CCYV), a bipartite crinivirus, causes chlorotic leaf spots and yellowing symptoms on cucurbit leaves. We previously developed an infectious clone of CCYV. Limited work has been conducted on the construction of a crinivirus green fluorescence protein (GFP) expression vector to date. We constructed a CCYV GFP expression vector using the "add a gene" strategy based on CCYV RNA2 cDNA constrcut. Three resultant clones, pCCYVGFP SGC , pCCYVGFP CGC , and pCCYVGFP CGS, were constructed with different promoters used to initiate GFP and CP expression. At 25 dpi GFP fluorescence was detectable not only in leaf veins but also in the surrounding cells. pCCYVGFP CGC -infected cucumber leaves exhibited cell spread at 25 dpi, whereas pCCYVGFP SGC and pCCYVGFP CGS were mainly found in single cells. Further observation of pCCYVGFP CGC GFP expression at 30 dpi, 40 dpi, and 50 dpi showed phloem-limited localization in the systemic leaves. We developed of a CCYV GFP expression vector that will be useful for further study of CCYV movement in cucurbits.

A genetically adjuvanted influenza B virus vector increases immunogenicity and protective efficacy in mice.

PubMed

Kittel, Christian; Wressnigg, Nina; Shurygina, Anna Polina; Wolschek, Markus; Stukova, Marina; Romanovskaya-Romanko, Ekatherina; Romanova, Julia; Kiselev, Oleg; Muster, Thomas; Egorov, Andrej

2015-10-01

The existence of multiple antigenically distinct types and subtypes of influenza viruses allows the construction of a multivalent vector system for the mucosal delivery of foreign sequences. Influenza A viruses have been exploited successfully for the expression of extraneous antigens as well as immunostimulatory molecules. In this study, we describe the development of an influenza B virus vector whose functional part of the interferon antagonist NS1 was replaced by human interleukin 2 (IL2) as a genetic adjuvant. We demonstrate that IL2 expressed by this viral vector displays immune adjuvant activity in immunized mice. Animals vaccinated with the IL2 viral vector showed an increased hemagglutination inhibition antibody response and higher protective efficacy after challenge with a wild-type influenza B virus when compared to mice vaccinated with a control virus. Our results demonstrate that it is feasible to construct influenza B vaccine strains expressing immune-potentiating foreign sequences from the NS genomic segment. Based on these data, it is now hypothetically possible to create a trivalent (or quadrivalent) live attenuated influenza vaccine in which each component expresses a selected genetic adjuvant with tailored expression levels.

Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

PubMed Central

Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria

2010-01-01

Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151

A Modular Toolset for Recombination Transgenesis and Neurogenetic Analysis of Drosophila

PubMed Central

Wang, Ji-Wu; Beck, Erin S.; McCabe, Brian D.

2012-01-01

Transgenic Drosophila have contributed extensively to our understanding of nervous system development, physiology and behavior in addition to being valuable models of human neurological disease. Here, we have generated a novel series of modular transgenic vectors designed to optimize and accelerate the production and analysis of transgenes in Drosophila. We constructed a novel vector backbone, pBID, that allows both phiC31 targeted transgene integration and incorporates insulator sequences to ensure specific and uniform transgene expression. Upon this framework, we have built a series of constructs that are either backwards compatible with existing restriction enzyme based vectors or utilize Gateway recombination technology for high-throughput cloning. These vectors allow for endogenous promoter or Gal4 targeted expression of transgenic proteins with or without fluorescent protein or epitope tags. In addition, we have generated constructs that facilitate transgenic splice isoform specific RNA inhibition of gene expression. We demonstrate the utility of these constructs to analyze proteins involved in nervous system development, physiology and neurodegenerative disease. We expect that these reagents will facilitate the proficiency and sophistication of Drosophila genetic analysis in both the nervous system and other tissues. PMID:22848718

Stable and Efficient Gene Transfer into the Retina Using an HIV-Based Lentiviral Vector

NASA Astrophysics Data System (ADS)

Miyoshi, Hiroyuki; Takahashi, Masayo; Gage, Fred H.; Verma, Inder M.

1997-09-01

The development of methods for efficient gene transfer to terminally differentiated retinal cells is important to study the function of the retina as well as for gene therapy of retinal diseases. We have developed a lentiviral vector system based on the HIV that can transduce terminally differentiated neurons of the brain in vivo. In this study, we have evaluated the ability of HIV vectors to transfer genes into retinal cells. An HIV vector containing a gene encoding the green fluorescent protein (GFP) was injected into the subretinal space of rat eyes. The GFP gene under the control of the cytomegalovirus promoter was efficiently expressed in both photoreceptor cells and retinal pigment epithelium. However, the use of the rhodopsin promoter resulted in expression predominantly in photoreceptor cells. Most successfully transduced eyes showed that photoreceptor cells in >80% of the area of whole retina expressed the GFP. The GFP expression persisted for at least 12 weeks with no apparent decrease. The efficient gene transfer into photoreceptor cells by HIV vectors will be useful for gene therapy of retinal diseases such as retinitis pigmentosa.

A Generic Protocol for Intracellular Expression of Recombinant Proteins in Bacillus subtilis.

PubMed

Phan, Trang; Huynh, Phuong; Truong, Tuom; Nguyen, Hoang

2017-01-01

Bacillus subtilis (B. subtilis) is a potential and attractive host for the production of recombinant proteins. Different expression systems for B. subtilis have been developed recently, and various target proteins have been recombinantly synthesized and purified using this host. In this chapter, we introduce a generic protocol to express a recombinant protein in B. subtilis. It includes protocols for (1) using our typical expression vector (plasmid pHT254) to introduce a target gene, (2) transformation of the target vector into B. subtilis, and (3) evaluation of the actual expression of a recombinant protein.

Evaluation of the specificity and sensitivity of ferritin as an MRI reporter gene in the mouse brain using lentiviral and adeno-associated viral vectors.

PubMed

Vande Velde, G; Rangarajan, J R; Toelen, J; Dresselaers, T; Ibrahimi, A; Krylychkina, O; Vreys, R; Van der Linden, A; Maes, F; Debyser, Z; Himmelreich, U; Baekelandt, V

2011-06-01

The development of in vivo imaging protocols to reliably track transplanted cells or to report on gene expression is critical for treatment monitoring in (pre)clinical cell and gene therapy protocols. Therefore, we evaluated the potential of lentiviral vectors (LVs) and adeno-associated viral vectors (AAVs) to express the magnetic resonance imaging (MRI) reporter gene ferritin in the rodent brain. First, we compared the induction of background MRI contrast for both vector systems in immune-deficient and immune-competent mice. LV injection resulted in hypointense (that is, dark) changes of T(2)/T(2)(*) (spin-spin relaxation time)-weighted MRI contrast at the injection site, which can be partially explained by an inflammatory response against the vector injection. In contrast to LVs, AAV injection resulted in reduced background contrast. Moreover, AAV-mediated ferritin overexpression resulted in significantly enhanced contrast to background on T(2)(*)-weighted MRI. Although sensitivity associated with the ferritin reporter remains modest, AAVs seem to be the most promising vector system for in vivo MRI reporter gene imaging.

Adenovirus tumor targeting and hepatic untargeting by a coxsackie/adenovirus receptor ectodomain anti-carcinoembryonic antigen bispecific adapter.

PubMed

Li, Hua-Jung; Everts, Maaike; Pereboeva, Larisa; Komarova, Svetlana; Idan, Anat; Curiel, David T; Herschman, Harvey R

2007-06-01

Adenovirus vectors have a number of advantages for gene therapy. However, because of their lack of tumor tropism and their preference for liver infection following systemic administration, they cannot be used for systemic attack on metastatic disease. Many epithelial tumors (e.g., colon, lung, and breast) express carcinoembryonic antigen (CEA). To block the natural hepatic tropism of adenovirus and to "retarget" the virus to CEA-expressing tumors, we used a bispecific adapter protein (sCAR-MFE), which fuses the ectodomain of the coxsackie/adenovirus receptor (sCAR) with a single-chain anti-CEA antibody (MFE-23). sCAR-MFE untargets adenovirus-directed luciferase transgene expression in the liver by >90% following systemic vector administration. Moreover, sCAR-MFE can "retarget" adenovirus to CEA-positive epithelial tumor cells in cell culture, in s.c. tumor grafts, and in hepatic tumor grafts. The sCAR-MFE bispecific adapter should, therefore, be a powerful agent to retarget adenovirus vectors to epithelial tumor metastases.

Construction of a Shuttle Vector for Heterologous Expression of a Novel Fungal α-Amylase Gene in Aspergillus oryzae.

PubMed

Yin, Yanchen; Mao, Youzhi; Yin, Xiaolie; Gao, Bei; Wei, Dongzhi

2015-07-01

The filamentous fungus Aspergillus oryzae is a well-known expression host used to express homologous and heterologous proteins in a number of industrial applications. To facilitate higher yields of proteins of interest, we constructed the pAsOP vector to express heterologous proteins in A. oryzae. pAsOP carries a selectable marker, pyrG, derived from Aspergillus nidulans, and a strong promoter and a terminator of the amyB gene derived from A. oryzae. pAsOP transformed A. oryzae efficiently via the PEG-CaCl2-mediated transformation method. As proof of concept, green fluorescent protein (GFP) was successfully expressed in A. oryzae transformed by pAsOP-GFP. Additionally, we identified a novel fungal α-amylase (PcAmy) gene from Penicillium sp. and cloned the gene into the vector. After transformation by pAsOPPcAmy, the α-amylase PcAmy from Penicillium sp. was successfully expressed in a heterologous host system for the first time. The α-amylase activity in the A. oryzae transformant was increased by 62.3% compared with the untransformed A. oryzae control. The PcAmy protein produced in the system had an optimum pH of 5.0 and optimum temperature of 30°C. As a cold-adapted enzyme, PcAmy shows potential value in industrial applications because of its high catalytic activity at low temperature. Furthermore, the expression vector reported in this study provides promising utility for further scientific research and biotechnological applications.

A versatile expression vector for the growth and amplification of unmodified phage display polypeptides.

PubMed

Winton, Alexander J; Baptiste, Janae L; Allen, Mark A

2018-09-01

Proteins and polypeptides represent nature's most complex and versatile polymer. They provide complicated shapes, diverse chemical functionalities, and tightly regulated and controlled sizes. Several disease states are related to the misfolding or overproduction of polypeptides and yet polypeptides are present in several therapeutic molecules. In addition to biological roles; short chain polypeptides have been shown to interact with and drive the bio-inspired synthesis or modification of inorganic materials. This paper outlines the development of a versatile cloning vector which allows for the expression of a short polypeptide by controlling the incorporation of a desired DNA coding insert. As a demonstration of the efficacy of the expression system, a solid binding polypeptide identified from M13 phage display was expressed and purified. The solid binding polypeptide was expressed as a soluble 6xHis-SUMO tagged construct. Expression was performed in E. coli using auto-induction followed by Ni-NTA affinity chromatography and ULP1 protease cleavage. Methodology demonstrates the production of greater than 8 mg of purified polypeptide per liter of E. coli culture. Isotopic labeling of the peptide is also demonstrated. The versatility of the designed cloning vector, use of the 6xHis-SUMO solubility partner, bacterial expression in auto-inducing media and the purification methodology make this expressionun vector a readily scalable and user-friendly system for the creation of desired peptide domains. Copyright © 2018. Published by Elsevier Inc.

Single-Step Conversion of Cells to Retrovirus Vector Producers with Herpes Simplex Virus–Epstein-Barr Virus Hybrid Amplicons

PubMed Central

Sena-Esteves, Miguel; Saeki, Yoshinaga; Camp, Sara M.; Chiocca, E. Antonio; Breakefield, Xandra O.

1999-01-01

We report here on the development and characterization of a novel herpes simplex virus type 1 (HSV-1) amplicon-based vector system which takes advantage of the host range and retention properties of HSV–Epstein-Barr virus (EBV) hybrid amplicons to efficiently convert cells to retrovirus vector producer cells after single-step transduction. The retrovirus genes gag-pol and env (GPE) and retroviral vector sequences were modified to minimize sequence overlap and cloned into an HSV-EBV hybrid amplicon. Retrovirus expression cassettes were used to generate the HSV-EBV-retrovirus hybrid vectors, HERE and HERA, which code for the ecotropic and the amphotropic envelopes, respectively. Retrovirus vector sequences encoding lacZ were cloned downstream from the GPE expression unit. Transfection of 293T/17 cells with amplicon plasmids yielded retrovirus titers between 106 and 107 transducing units/ml, while infection of the same cells with amplicon vectors generated maximum titers 1 order of magnitude lower. Retrovirus titers were dependent on the extent of transduction by amplicon vectors for the same cell line, but different cell lines displayed varying capacities to produce retrovirus vectors even at the same transduction efficiencies. Infection of human and dog primary gliomas with this system resulted in the production of retrovirus vectors for more than 1 week and the long-term retention and increase in transgene activity over time in these cell populations. Although the efficiency of this system still has to be determined in vivo, many applications are foreseeable for this approach to gene delivery. PMID:10559361

The myeloid-binding peptide adenoviral vector enables multi-organ vascular endothelial gene targeting.

PubMed

Lu, Zhi Hong; Kaliberov, Sergey; Zhang, Jingzhu; Muz, Barbara; Azab, Abdel K; Sohn, Rebecca E; Kaliberova, Lyudmila; Du, Yingqiu; Curiel, David T; Arbeit, Jeffrey M

2014-08-01

Vascular endothelial cells (ECs) are ideal gene therapy targets as they provide widespread tissue access and are the first contact surfaces following intravenous vector administration. Human recombinant adenovirus serotype 5 (Ad5) is the most frequently used gene transfer system because of its appreciable transgene payload capacity and lack of somatic mutation risk. However, standard Ad5 vectors predominantly transduce liver but not the vasculature following intravenous administration. We recently developed an Ad5 vector with a myeloid cell-binding peptide (MBP) incorporated into the knob-deleted, T4 fibritin chimeric fiber (Ad.MBP). This vector was shown to transduce pulmonary ECs presumably via a vector handoff mechanism. Here we tested the body-wide tropism of the Ad.MBP vector, its myeloid cell necessity, and vector-EC expression dose response. Using comprehensive multi-organ co-immunofluorescence analysis, we discovered that Ad.MBP produced widespread EC transduction in the lung, heart, kidney, skeletal muscle, pancreas, small bowel, and brain. Surprisingly, Ad.MBP retained hepatocyte tropism albeit at a reduced frequency compared with the standard Ad5. While binding specifically to myeloid cells ex vivo, multi-organ Ad.MBP expression was not dependent on circulating monocytes or macrophages. Ad.MBP dose de-escalation maintained full lung-targeting capacity but drastically reduced transgene expression in other organs. Swapping the EC-specific ROBO4 for the CMV promoter/enhancer abrogated hepatocyte expression but also reduced gene expression in other organs. Collectively, our multilevel targeting strategy could enable therapeutic biological production in previously inaccessible organs that pertain to the most debilitating or lethal human diseases.

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize.

PubMed

Mei, Yu; Zhang, Chunquan; Kernodle, Bliss M; Hill, John H; Whitham, Steven A

2016-06-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. © 2016 American Society of Plant Biologists. All Rights Reserved.

A Foxtail mosaic virus Vector for Virus-Induced Gene Silencing in Maize1[OPEN

PubMed Central

Mei, Yu; Kernodle, Bliss M.; Hill, John H.

2016-01-01

Plant viruses have been widely used as vectors for foreign gene expression and virus-induced gene silencing (VIGS). A limited number of viruses have been developed into viral vectors for the purposes of gene expression or VIGS in monocotyledonous plants, and among these, the tripartite viruses Brome mosaic virus and Cucumber mosaic virus have been shown to induce VIGS in maize (Zea mays). We describe here a new DNA-based VIGS system derived from Foxtail mosaic virus (FoMV), a monopartite virus that is able to establish systemic infection and silencing of endogenous maize genes homologous to gene fragments inserted into the FoMV genome. To demonstrate VIGS applications of this FoMV vector system, four genes, phytoene desaturase (functions in carotenoid biosynthesis), lesion mimic22 (encodes a key enzyme of the porphyrin pathway), iojap (functions in plastid development), and brown midrib3 (caffeic acid O-methyltransferase), were silenced and characterized in the sweet corn line Golden × Bantam. Furthermore, we demonstrate that the FoMV infectious clone establishes systemic infection in maize inbred lines, sorghum (Sorghum bicolor), and green foxtail (Setaria viridis), indicating the potential wide applications of this viral vector system for functional genomics studies in maize and other monocots. PMID:27208311

A novel pair of inducible expression vectors for use in Methylobacterium extorquens.

PubMed

Chubiz, Lon M; Purswani, Jessica; Carroll, Sean Michael; Marx, Chistopher J

2013-05-06

Due to the ever increasing use of diverse microbial taxa in basic research and industrial settings, there is a growing need for genetic tools to alter the physiology of these organisms. In particular, there is a dearth of inducible expression systems available for bacteria outside commonly used γ-proteobacteria, such as Escherichia coli or Pseudomonas species. To this end, we have sought to develop a pair of inducible expression vectors for use in the α-proteobacterium Methylobacterium extorquens, a model methylotroph. We found that the P(R) promoter from rhizobial phage 16-3 was active in M. extorquens and engineered the promoter to be inducible by either p-isopropyl benzoate (cumate) or anhydrotetracycline. These hybrid promoters, P(R/cmtO) and P(R/tetO), were found to have high levels of expression in M. extorquens with a regulatory range of 10-fold and 30-fold, respectively. Compared to an existing cumate-inducible (10-fold range), high-level expression system for M. extorquens, P(R/cmtO) and P(R/tetO) have 33% of the maximal activity but were able to repress gene expression 3 and 8-fold greater, respectively. Both promoters were observed to exhibit homogeneous, titratable activation dynamics rather than on-off, switch-like behavior. The utility of these promoters was further demonstrated by complementing loss of function of ftfL--essential for growth on methanol--where we show P(R/tetO) is capable of not only fully complementing function but also producing a conditional null phenotype. These promoters have been incorporated into a broad-host-range backbone allowing for potential use in a variety of bacterial hosts. We have developed two novel expression systems for use in M. extorquens. The expression range of these vectors should allow for increased ability to explore cellular physiology in M. extorquens. Further, the P(R/tetO) promoter is capable of producing conditional null phenotypes, previously unattainable in M. extorquens. As both expression systems rely on the use of membrane permeable inducers, we suspect these expression vectors will be useful for ectopic gene expression in numerous proteobacteria.

A single EBV-based vector for stable episomal maintenance and expression of GFP in human embryonic stem cells.

PubMed

Thyagarajan, Bhaskar; Scheyhing, Kelly; Xue, Haipeng; Fontes, Andrew; Chesnut, Jon; Rao, Mahendra; Lakshmipathy, Uma

2009-03-01

Stable expression of transgenes in stem cells has been a challenge due to the nonavailability of efficient transfection methods and the inability of transgenes to support sustained gene expression. Several methods have been reported to stably modify both embryonic and adult stem cells. These methods rely on integration of the transgene into the genome of the host cell, which could result in an expression pattern dependent on the number of integrations and the genomic locus of integration. To overcome this issue, site-specific integration methods mediated by integrase, adeno-associated virus or via homologous recombination have been used to generate stable human embryonic stem cell (hESC) lines. In this study, we describe a vector that is maintained episomally in hESCs. The vector used in this study is based on components derived from the Epstein-Barr virus, containing the Epstein-Barr virus nuclear antigen 1 expression cassette and the OriP origin of replication. The vector also expresses the drug-resistance marker gene hygromycin, which allows for selection and long-term maintenance of cells harboring the plasmid. Using this vector system, we show sustained expression of green fluorescent protein in undifferentiated hESCs and their differentiating embryoid bodies. In addition, the stable hESC clones show comparable expression with and without drug selection. Consistent with this observation, bulk-transfected adipose tissue-derived mesenchymal stem cells showed persistent marker gene expression as they differentiate into adipocytes, osteoblasts and chondroblasts. Episomal vectors offer a fast and efficient method to create hESC reporter lines, which in turn allows one to test the effect of overexpression of various genes on stem cell growth, proliferation and differentiation.

Using HSV-TK/GCV suicide gene therapy to inhibit lens epithelial cell proliferation for treatment of posterior capsular opacification

PubMed Central

Jiang, Yong-Xiang; Liu, Tian-Jing; Yang, Jin; Chen, Yan; Fang, Yan-Wen

2011-01-01

Purpose To establish a novel, targeted lentivirus-based HSV-tk (herpes simplex virus thymidine kinase)/GCV (ganciclovir) gene therapy system to inhibit lens epithelial cell proliferation for treatment of posterior capsular opacification (PCO) after cataract surgery. Methods An enhanced Cre recombinase (Cre/loxP) system with a lentiviral vector expressing Cre under the control of the lens-specific promoter LEP503 (Lenti-LEP503-HSVtk-Cre [LTKCRE]) was constructed, as well as another lentiviral vector containing a switching unit. The latter vector contains a stuffer sequence encoding EGFP (Lenti-hPGK-Loxp-EGFP-pA-Loxp-HSVtk [PGFPTK]) with a functional polyadenylation signal between two loxP sites, followed by the herpes simplex virus thymidine kinase (HSV-tk) gene, both under the control of the human posphoglycerate kinase (hPGK) promoter. Expression of the downstream gene (HSV-tk) is activated by co-expression of Cre. Human lens epithelial cells (HLECs) or retinal pigmental epithelial cells (RPECs) were co-infected with LTKCRE and PGFPTK. The inhibitory effects on HLECs and RPECs infected by the enhanced specific lentiviral vector combination at the concentration of 20 µg/ml GCV were assayed and compared. Results The specific gene expression of Cre and HSV-tk in HLECs is activated by the LEP503 promoter. LTKCRE and PGFPTK co-infected HLECs, but not RPECs, expressed high levels of the HSV-tk protein. After 96 h of GCV treatment, the percentage of apoptotic HLECs infected by the enhanced specific lentiviral vector combination was 87.23%, whereas that of apoptotic RPECs was only 10.12%. Electron microscopy showed that GCV induced apoptosis and necrosis of the infected HLECs. Conclusions The enhanced specific lentiviral vector combination selectively and effectively expressed HSV-tk in HLECs. A concentration of 20 µg/ml, GCV is effective against the proliferation of HLECs in vitro. This cell-type-specific gene therapy using a Cre/loxP lentivirus system may be a feasible treatment strategy to prevent PCO. PMID:21283526

Development of novel types of plastid transformation vectors and evaluation of factors controlling expression.

PubMed

Herz, Stefan; Füssl, Monika; Steiger, Sandra; Koop, Hans-Ulrich

2005-12-01

Two new vector types for plastid transformation were developed and uidA reporter gene expression was compared to standard transformation vectors. The first vector type does not contain any plastid promoter, instead it relies on extension of existing plastid operons and was therefore named "operon-extension" vector. When a strongly expressed plastid operon like psbA was extended by the reporter gene with this vector type, the expression level was superior to that of a standard vector under control of the 16S rRNA promoter. Different insertion sites, promoters and 5'-UTRs were analysed for their effect on reporter gene expression with standard and operon-extension vectors. The 5'-UTR of phage 7 gene 10 in combination with a modified N-terminus was found to yield the highest expression levels. Expression levels were also strongly dependent on external factors like plant or leaf age or light intensity. In the second vector type, named "split" plastid transformation vector, modules of the expression cassette were distributed on two separate vectors. Upon co-transformation of plastids with these vectors, the complete expression cassette became inserted into the plastome. This result can be explained by successive co-integration of the split vectors and final loop-out recombination of the duplicated sequences. The split vector concept was validated with different vector pairs.

AAV vector-mediated secretion of chondroitinase provides a sensitive tracer for axonal arborisations.

PubMed

Alves, João Nuno; Muir, Elizabeth M; Andrews, Melissa R; Ward, Anneliese; Michelmore, Nicholas; Dasgupta, Debayan; Verhaagen, Joost; Moloney, Elizabeth B; Keynes, Roger J; Fawcett, James W; Rogers, John H

2014-04-30

As part of a project to express chondroitinase ABC (ChABC) in neurons of the central nervous system, we have inserted a modified ChABC gene into an adeno-associated viral (AAV) vector and injected it into the vibrissal motor cortex in adult rats to determine the extent and distribution of expression of the enzyme. A similar vector for expression of green fluorescent protein (GFP) was injected into the same location. For each vector, two versions with minor differences were used, giving similar results. After 4 weeks, the brains were stained to show GFP and products of chondroitinase digestion. Chondroitinase was widely expressed, and the AAV-ChABC and AAV-GFP vectors gave similar expression patterns in many respects, consistent with the known projections from the directly transduced neurons in vibrissal motor cortex and adjacent cingulate cortex. In addition, diffusion of vector to deeper neuronal populations led to labelling of remote projection fields which was much more extensive with AAV-ChABC than with AAV-GFP. The most notable of these populations are inferred to be neurons of cortical layer 6, projecting widely in the thalamus, and neurons of the anterior pole of the hippocampus, projecting through most of the hippocampus. We conclude that, whereas GFP does not label the thinnest axonal branches of some neuronal types, chondroitinase is efficiently secreted from these arborisations and enables their extent to be sensitively visualised. After 12 weeks, chondroitinase expression was undiminished. Copyright © 2014 Elsevier B.V. All rights reserved.

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector

PubMed Central

2013-01-01

Background Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. Results We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit’s component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. Conclusions We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins. PMID:23957834

A plasmid toolkit for cloning chimeric cDNAs encoding customized fusion proteins into any Gateway destination expression vector.

PubMed

Buj, Raquel; Iglesias, Noa; Planas, Anna M; Santalucía, Tomàs

2013-08-20

Valuable clone collections encoding the complete ORFeomes for some model organisms have been constructed following the completion of their genome sequencing projects. These libraries are based on Gateway cloning technology, which facilitates the study of protein function by simplifying the subcloning of open reading frames (ORF) into any suitable destination vector. The expression of proteins of interest as fusions with functional modules is a frequent approach in their initial functional characterization. A limited number of Gateway destination expression vectors allow the construction of fusion proteins from ORFeome-derived sequences, but they are restricted to the possibilities offered by their inbuilt functional modules and their pre-defined model organism-specificity. Thus, the availability of cloning systems that overcome these limitations would be highly advantageous. We present a versatile cloning toolkit for constructing fully-customizable three-part fusion proteins based on the MultiSite Gateway cloning system. The fusion protein components are encoded in the three plasmids integral to the kit. These can recombine with any purposely-engineered destination vector that uses a heterologous promoter external to the Gateway cassette, leading to the in-frame cloning of an ORF of interest flanked by two functional modules. In contrast to previous systems, a third part becomes available for peptide-encoding as it no longer needs to contain a promoter, resulting in an increased number of possible fusion combinations. We have constructed the kit's component plasmids and demonstrate its functionality by providing proof-of-principle data on the expression of prototype fluorescent fusions in transiently-transfected cells. We have developed a toolkit for creating fusion proteins with customized N- and C-term modules from Gateway entry clones encoding ORFs of interest. Importantly, our method allows entry clones obtained from ORFeome collections to be used without prior modifications. Using this technology, any existing Gateway destination expression vector with its model-specific properties could be easily adapted for expressing fusion proteins.

[Prokaryotic expression systems].

PubMed

Porowińska, Dorota; Wujak, Magdalena; Roszek, Katarzyna; Komoszyński, Michał

2013-03-01

For overproduction of recombinant proteins both eukaryotic and prokaryotic expression systems are used. Choosing the right system depends, among other things, on the growth rate and culture of host cells, level of the target gene expression and posttranslational processing of the synthesized protein. Regardless of the type of expression system, its basic elements are the vector and the expression host. The most widely used system for protein overproduction, both on a laboratory and industrial scale, is the prokaryotic system. This system is based primarily on the bacteria E. coli, although increasingly often Bacillus species are used. The prokaryotic system allows one to obtain large quantities of recombinant proteins in a short time. A simple and inexpensive bacterial cell culture and well-known mechanisms of transcription and translation facilitate the use of these microorganisms. The simplicity of genetic modifications and the availability of many bacterial mutants are additional advantages of the prokaryotic system. In this article we characterize the structural elements of prokaryotic expression vectors. Also strategies for preparation of the target protein gene that increase productivity, facilitate detection and purification of recombinant protein and provide its activity are discussed. Bacterial strains often used as host cells in expression systems as well as the potential location of heterologous proteins are characterized. Knowledge of the basic elements of the prokaryotic expression system allows for production of biologically active proteins in a short time and in satisfactory quantities. 

Heterologous viral expression systems in fosmid vectors increase the functional analysis potential of metagenomic libraries.

PubMed

Terrón-González, L; Medina, C; Limón-Mortés, M C; Santero, E

2013-01-01

The extraordinary potential of metagenomic functional analyses to identify activities of interest present in uncultured microorganisms has been limited by reduced gene expression in surrogate hosts. We have developed vectors and specialized E. coli strains as improved metagenomic DNA heterologous expression systems, taking advantage of viral components that prevent transcription termination at metagenomic terminators. One of the systems uses the phage T7 RNA-polymerase to drive metagenomic gene expression, while the other approach uses the lambda phage transcription anti-termination protein N to limit transcription termination. A metagenomic library was constructed and functionally screened to identify genes conferring carbenicillin resistance to E. coli. The use of these enhanced expression systems resulted in a 6-fold increase in the frequency of carbenicillin resistant clones. Subcloning and sequence analysis showed that, besides β-lactamases, efflux pumps are not only able contribute to carbenicillin resistance but may in fact be sufficient by themselves to convey carbenicillin resistance.

Optimizing promoters for recombinant adeno-associated virus-mediated gene expression in the peripheral and central nervous system using self-complementary vectors.

PubMed

Gray, Steven J; Foti, Stacey B; Schwartz, Joel W; Bachaboina, Lavanya; Taylor-Blake, Bonnie; Coleman, Jennifer; Ehlers, Michael D; Zylka, Mark J; McCown, Thomas J; Samulski, R Jude

2011-09-01

With the increased use of small self-complementary adeno-associated viral (AAV) vectors, the design of compact promoters becomes critical for packaging and expressing larger transgenes under ubiquitous or cell-specific control. In a comparative study of commonly used 800-bp cytomegalovirus (CMV) and chicken β-actin (CBA) promoters, we report significant differences in the patterns of cell-specific gene expression in the central and peripheral nervous systems. The CMV promoter provides high initial neural expression that diminishes over time. The CBA promoter displayed mostly ubiquitous and high neural expression, but substantially lower expression in motor neurons (MNs). We report the creation of a novel hybrid form of the CBA promoter (CBh) that provides robust long-term expression in all cells observed with CMV or CBA, including MNs. To develop a short neuronal promoter to package larger transgenes into AAV vectors, we also found that a 229-bp fragment of the mouse methyl-CpG-binding protein-2 (MeCP2) promoter was able to drive neuron-specific expression within the CNS. Thus the 800-bp CBh promoter provides strong, long-term, and ubiquitous CNS expression whereas the MeCP2 promoter allows an extra 570-bp packaging capacity, with low and mostly neuronal expression within the CNS, similar to the MeCP2 transcription factor.

Naturally occurring minichromosome platforms in chromosome engineering: an overview.

PubMed

Raimondi, Elena

2011-01-01

Artificially modified chromosome vectors are non-integrating gene delivery platforms that can shuttle very large DNA fragments in various recipient cells: theoretically, no size limit exists for the chromosome segments that an engineered minichromosome can accommodate. Therefore, genetically manipulated chromosomes might be potentially ideal vector systems, especially when the complexity of higher eukaryotic genes is concerned. This review focuses on those chromosome vectors generated using spontaneously occurring small markers as starting material. The definition and manipulation of the centromere domain is one of the main obstacles in chromosome engineering: naturally occurring minichromosomes, due to their inherent small size, were helpful in defining some aspects of centromere function. In addition, several distinctive features of small marker chromosomes, like their appearance as supernumerary elements in otherwise normal karyotypes, have been successfully exploited to use them as gene delivery vectors. The key technologies employed for minichromosome engineering are: size reduction, gene targeting, and vector delivery in various recipient cells. In spite of the significant advances that have been recently achieved in all these fields, several unsolved problems limit the potential of artificially modified chromosomes. Still, these vector systems have been exploited in a number of applications where the investigation of the controlled expression of large DNA segments is needed. A typical example is the analysis of genes whose expression strictly depends on the chromosomal environment in which they are positioned, where engineered chromosomes can be envisaged as epigenetically regulated expression systems. A novel and exciting advance concerns the use of engineered minichromosomes to study the organization and dynamics of local chromatin structures.

Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

PubMed

Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

2007-06-15

A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

Gene Transfer of Glutamic Acid Decarboxylase 67 by Herpes Simplex Virus Vectors Suppresses Neuropathic Pain Induced by Human Immunodeficiency Virus gp120 Combined with ddC in Rats.

PubMed

Kanao, Megumi; Kanda, Hirotsugu; Huang, Wan; Liu, Shue; Yi, Hyun; Candiotti, Keith A; Lubarsky, David A; Levitt, Roy C; Hao, Shuanglin

2015-06-01

Human immunodeficiency virus (HIV)-related painful sensory neuropathies primarily consist of the HIV infection-related distal sensory polyneuropathy and antiretroviral toxic neuropathies. Pharmacotherapy provides only partial relief of pain in patients with HIV/acquired immune deficiency syndrome because little is known about the exact neuropathological mechanisms for HIV-associated neuropathic pain (NP). Hypofunction of γ-aminobutyric acid (GABA) GABAergic inhibitory mechanisms has been reported after peripheral nerve injury. In this study, we tested the hypothesis that HIV gp120 combined with antiretroviral therapy reduces spinal GABAergic inhibitory tone and that restoration of GABAergic inhibitory tone will reduce HIV-related NP in a rat model. The application of recombinant HIV-1 envelope protein gp120 into the sciatic nerve plus systemic ddC (one antiretroviral drug) induced mechanical allodynia. The hind paws of rats were inoculated with replication-defective herpes simplex virus (HSV) vectors genetically encoding gad1 gene to express glutamic acid decarboxylase 67 (GAD67), an enzyme that catalyzes the decarboxylation of glutamate to GABA. Mechanical threshold was tested using von Frey filaments before and after treatments with the vectors. The expression of GAD67 in both the lumbar spinal cord and the L4-5 dorsal root ganglia was examined using western blots. The expression of mitochondrial superoxide in the spinal dorsal horn was examined using MitoSox imaging. The immunoreactivity of spinal GABA, pCREB, and pC/EBPβ was tested using immunohistochemistry. In the gp120 with ddC-induced neuropathic pain model, GAD67 expression mediated by the HSV vector caused an elevation of mechanical threshold that was apparent on day 3 after vector inoculation. The antiallodynic effect of the single HSV vector inoculation expressing GAD67 lasted >28 days. The area under the time-effect curves in the HSV vector expressing GAD67 was increased compared with that in the control vectors (P = 0.0005). Intrathecal GABA-A/B agonists elevated mechanical threshold in the pain model. The HSV vectors expressing GAD67 reversed the lowered GABA immunoreactivity in the spinal dorsal horn in the neuropathic rats. HSV vectors expressing GAD67 in the neuropathic rats reversed the increased signals of mitochondrial superoxide in the spinal dorsal horn. The vectors expressing GAD67 reversed the upregulated immunoreactivity expression of pCREB and pC/EBPβ in the spinal dorsal horn in rats exhibiting NP. Based on our results, we suggest that GAD67 mediated by HSV vectors acting through the suppression of mitochondrial reactive oxygen species and transcriptional factors in the spinal cord decreases pain in the HIV-related neuropathic pain model, providing preclinical evidence for gene therapy applications in patients with HIV-related pain states.

GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives.

PubMed

Kao, Tim; Labonne, Tanya; Niclis, Jonathan C; Chaurasia, Ritu; Lokmic, Zerina; Qian, Elizabeth; Bruveris, Freya F; Howden, Sara E; Motazedian, Ali; Schiesser, Jacqueline V; Costa, Magdaline; Sourris, Koula; Ng, Elizabeth; Anderson, David; Giudice, Antonietta; Farlie, Peter; Cheung, Michael; Lamande, Shireen R; Penington, Anthony J; Parish, Clare L; Thomson, Lachlan H; Rafii, Arash; Elliott, David A; Elefanty, Andrew G; Stanley, Edouard G

2016-09-13

The ability to reliably express fluorescent reporters or other genes of interest is important for using human pluripotent stem cells (hPSCs) as a platform for investigating cell fates and gene function. We describe a simple expression system, designated GAPTrap (GT), in which reporter genes, including GFP, mCherry, mTagBFP2, luc2, Gluc, and lacZ are inserted into the GAPDH locus in hPSCs. Independent clones harboring variations of the GT vectors expressed remarkably consistent levels of the reporter gene. Differentiation experiments showed that reporter expression was reliably maintained in hematopoietic cells, cardiac mesoderm, definitive endoderm, and ventral midbrain dopaminergic neurons. Similarly, analysis of teratomas derived from GT-lacZ hPSCs showed that β-galactosidase expression was maintained in a spectrum of cell types representing derivatives of the three germ layers. Thus, the GAPTrap vectors represent a robust and straightforward tagging system that enables indelible labeling of PSCs and their differentiated derivatives. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

VectorBase: a data resource for invertebrate vector genomics

PubMed Central

Lawson, Daniel; Arensburger, Peter; Atkinson, Peter; Besansky, Nora J.; Bruggner, Robert V.; Butler, Ryan; Campbell, Kathryn S.; Christophides, George K.; Christley, Scott; Dialynas, Emmanuel; Hammond, Martin; Hill, Catherine A.; Konopinski, Nathan; Lobo, Neil F.; MacCallum, Robert M.; Madey, Greg; Megy, Karine; Meyer, Jason; Redmond, Seth; Severson, David W.; Stinson, Eric O.; Topalis, Pantelis; Birney, Ewan; Gelbart, William M.; Kafatos, Fotis C.; Louis, Christos; Collins, Frank H.

2009-01-01

VectorBase (http://www.vectorbase.org) is an NIAID-funded Bioinformatic Resource Center focused on invertebrate vectors of human pathogens. VectorBase annotates and curates vector genomes providing a web accessible integrated resource for the research community. Currently, VectorBase contains genome information for three mosquito species: Aedes aegypti, Anopheles gambiae and Culex quinquefasciatus, a body louse Pediculus humanus and a tick species Ixodes scapularis. Since our last report VectorBase has initiated a community annotation system, a microarray and gene expression repository and controlled vocabularies for anatomy and insecticide resistance. We have continued to develop both the software infrastructure and tools for interrogating the stored data. PMID:19028744

Cardiac Gene Therapy: Optimization of Gene Delivery Techniques In Vivo

PubMed Central

Katz, Michael G.; Swain, JaBaris D.; White, Jennifer D.; Low, David; Stedman, Hansell

2010-01-01

Abstract Vector-mediated cardiac gene therapy holds tremendous promise as a translatable platform technology for treating many cardiovascular diseases. The ideal technique is one that is efficient and practical, allowing for global cardiac gene expression, while minimizing collateral expression in other organs. Here we survey the available in vivo vector-mediated cardiac gene delivery methods—including transcutaneous, intravascular, intramuscular, and cardiopulmonary bypass techniques—with consideration of the relative merits and deficiencies of each. Review of available techniques suggests that an optimal method for vector-mediated gene delivery to the large animal myocardium would ideally employ retrograde and/or anterograde transcoronary gene delivery,extended vector residence time in the coronary circulation, an increased myocardial transcapillary gradient using physical methods, increased endothelial permeability with pharmacological agents, minimal collateral gene expression by isolation of the cardiac circulation from the systemic, and have low immunogenicity. PMID:19947886

Insulated hsp70B' promoter: stringent heat-inducible activity in replication-deficient, but not replication-competent adenoviruses.

PubMed

Rohmer, Stanimira; Mainka, Astrid; Knippertz, Ilka; Hesse, Andrea; Nettelbeck, Dirk M

2008-04-01

Key to the realization of gene therapy is the development of efficient and targeted gene transfer vectors. Therapeutic gene transfer by replication-deficient or more recently by conditionally replication-competent/oncolytic adenoviruses has shown much promise. For specific applications, however, it will be advantageous to provide vectors that allow for external control of gene expression. The efficient cellular heat shock system in combination with available technology for focused and controlled hyperthermia suggests heat-regulated transcription control as a promising tool for this purpose. We investigated the feasibility of a short fragment of the human hsp70B' promoter, with and without upstream insulator elements, for the regulation of transgene expression by replication-deficient or oncolytic adenoviruses. Two novel adenoviral vectors with an insulated hsp70B' promoter were developed and showed stringent heat-inducible gene expression with induction ratios up to 8000-fold. In contrast, regulation of gene expression from the hsp70B' promoter without insulation was suboptimal. In replication-competent/oncolytic adenoviruses regulation of the hsp70B' promoter was lost specifically during late replication in permissive cells and could not be restored by the insulators. We developed novel adenovirus gene transfer vectors that feature improved and stringent regulation of transgene expression from the hsp70B' promoter using promoter insulation. These vectors have potential for gene therapy applications that benefit from external modulation of therapeutic gene expression or for combination therapy with hyperthermia. Furthermore, our study reveals that vector replication can deregulate inserted cellular promoters, an observation which is of relevance for the development of replication-competent/oncolytic gene transfer vectors. (c) 2008 John Wiley & Sons, Ltd.

Hypoxia-inducible bidirectional shRNA expression vector delivery using PEI/chitosan-TBA copolymers for colorectal Cancer gene therapy.

PubMed

Javan, Bita; Atyabi, Fatemeh; Shahbazi, Majid

2018-06-01

This investigation was conducted to construct a hypoxia/colorectal dual-specific bidirectional short hairpin RNA (shRNA) expression vector and to transfect it into the colon cancer cell line HT-29 with PEI/chitosan-TBA nanoparticles for the simultaneous knock down of β-catenin and Bcl-2 under hypoxia. To construct a pRNA-bipHRE-CEA vector, the carcinoma embryonic antigen (CEA) promoter designed in two directions and the vascular endothelial growth factor (VEGF) enhancer were inserted between two promoters for hypoxic cancer specific gene expression. To confirm the therapeutic effect of the dual-specific vector, β-catenin and Bcl-2 shRNAs were inserted downstream of each promoter. The physicochemical properties, the cytotoxicity, and the transfection efficiency of these PEI/chitosan-TBA nanoparticles were investigated. In addition, the antitumor effects of the designed vector on the expression of β-catenin and Bcl-2, cell cycle distribution, and apoptosis were investigated in vitro. The silencing effect of the hypoxia-response shRNA expression vector was relatively low (18%-25%) under normoxia, whereas it was significantly increased to approximately 50%-60% in the HT-29 cell line. Moreover, the cancer cells showed significant G0/G1 arrest and increased apoptosis due to gene silencing under hypoxia. Furthermore, MTS assay, fluorescence microscopy images, and flow cytometry analyses confirmed that the PEI/chitosan-TBA blend system provided effective transfection with low cytotoxicity. This novel hypoxia-responsive shRNA expression vector may be useful for RNA interference (RNAi)-based cancer gene therapy in hypoxic colorectal tumors. Moreover, the PEI/chitosan-TBA copolymer might be a promising gene carrier for use in gene transfer in vivo. Copyright © 2018. Published by Elsevier Inc.

Gene transfer to brain using herpes simplex virus vectors.

PubMed

Glorioso, J C; Goins, W F; Meaney, C A; Fink, D J; DeLuca, N A

1994-01-01

Herpes simplex virus type 1 represents an ideal candidate for development as a vehicle for gene transfer to postmitotic neurons of the central nervous system. The natural biology of this virus makes it well suited for this purpose as it is capable of infecting a variety of neuronal cell types in the brain where the viral genome can persist indefinitely in a latent state. In latency, the viral lytic genes are transcriptionally silent and a unique set of latency-associated transcripts are expressed. Two impediments to using herpes simplex virus vectors must be overcome: (1) A noncytotoxic mutant virus backbone must be engineered, and (2) a suitable promoter-regulator that stably expresses foreign genes from the vector genome during latency must be constructed. Deletion of specific immediate early genes from the vector can render the virus nontoxic to neurons in culture and in vivo following stereotactic inoculation into specific regions of the brain. Because these viruses cannot replicate, they enter latency on infection of central nervous system neurons. A number of viral and cellular promoters have been tested for their ability to express genes during latency. Strong viral promoters and neurospecific promoters display transient activity. Although the promoter regions for the latency-associated transcripts are highly active in the peripheral nervous system, they show low-level but persistent activity in the brain. Experiments are in progress to exploit RNA polymerase III gene promoters or novel recombinant promoters capable of auto-inducing their own expression in order to increase gene expression during latency in brain neurons.

Cloning and characterization of an adenoviral vector for highly efficient and doxycycline – suppressible expression of bioactive human single – chain interleukin 12 in colon cancer

PubMed Central

Wulff, Holger; Krieger, Thorsten; Krüger, Karen; Stahmer, Ingrid; Thaiss, Friedrich; Schäfer, Hansjörg; Block, Andreas

2007-01-01

Background Interleukin-12 (IL-12) is well characterized to induce cellular antitumoral immunity by activation of NK-cells and T-lymphocytes. However, systemic administration of recombinant human IL-12 resulted in severe toxicity without perceptible therapeutic benefit. Even though intratumoral expression of IL-12 leads to tumor regression and long-term survival in a variety of animal models, clinical trials have not yet shown a significant therapeutic benefit. One major obstacle in the treatment with IL-12 is to overcome the relatively low expression of the therapeutic gene without compromising the safety of such an approach. Our objective was to generate an adenoviral vector system enabling the regulated expression of very high levels of bioactive, human IL-12. Results High gene expression was obtained utilizing the VP16 herpes simplex transactivator. Strong regulation of gene expression was realized by fusion of the VP16 to a tetracycline repressor with binding of the fusion protein to a flanking tetracycline operator and further enhanced by auto-regulated expression of its fusion gene within a bicistronic promoter construct. Infection of human colon cancer cells (HT29) at a multiplicity of infection (m.o.i.) of 10 resulted in the production of up to 8000 ng/106 cells in 48 h, thus exceeding any published vector system so far. Doxycycline concentrations as low as 30 ng/ml resulted in up to 5000-fold suppression, enabling significant reduction of gene expression in a possible clinical setting. Bioactivity of the human single-chain IL-12 was similar to purified human heterodimeric IL-12. Frozen sections of human colon cancer showed high expression of the coxsackie adenovirus receptor with significant production of human single chain IL-12 in colon cancer biopsies after infection with 3*107 p.f.u. Ad.3r-scIL12. Doxycycline mediated suppression of gene expression was up to 9000-fold in the infected colon cancer tissue. Conclusion VP16 transactivator-mediated and doxycycline-regulated expression of the human interleukin-12 gene enables highly efficient and tightly controlled cytokine expression in human cancer. These data illustrate the potential of the described adenoviral vector system for the safe and superior expression of therapeutic genes in the treatment of colorectal cancer and other malignancies. PMID:17594499

Vector 33: A reduce program for vector algebra and calculus in orthogonal curvilinear coordinates

NASA Astrophysics Data System (ADS)

Harper, David

1989-06-01

This paper describes a package with enables REDUCE 3.3 to perform algebra and calculus operations upon vectors. Basic algebraic operations between vectors and between scalars and vectors are provided, including scalar (dot) product and vector (cross) product. The vector differential operators curl, divergence, gradient and Laplacian are also defined, and are valid in any orthogonal curvilinear coordinate system. The package is written in RLISP to allow algebra and calculus to be performed using notation identical to that for operations. Scalars and vectors can be mixed quite freely in the same expression. The package will be of interest to mathematicians, engineers and scientists who need to perform vector calculations in orthogonal curvilinear coordinates.

Generation of a new Gateway-compatible inducible lentiviral vector platform allowing easy derivation of co-transduced cells.

PubMed

De Groote, Philippe; Grootjans, Sasker; Lippens, Saskia; Eichperger, Chantal; Leurs, Kirsten; Kahr, Irene; Tanghe, Giel; Bruggeman, Inge; De Schamphelaire, Wouter; Urwyler, Corinne; Vandenabeele, Peter; Haustraete, Jurgen; Declercq, Wim

2016-01-01

In contrast to most common gene delivery techniques, lentiviral vectors allow targeting of almost any mammalian cell type, even non-dividing cells, and they stably integrate in the genome. Therefore, these vectors are a very powerful tool for biomedical research. Here we report the generation of a versatile new set of 22 lentiviral vectors with broad applicability in multiple research areas. In contrast to previous systems, our platform provides a choice between constitutive and/or conditional expression and six different C-terminal fusions. Furthermore, two compatible selection markers enable the easy derivation of stable cell lines co-expressing differently tagged transgenes in a constitutive or inducible manner. We show that all of the vector features are functional and that they contribute to transgene overexpression in proof-of-principle experiments.

Induction of Human Blood Group A Antigen Expression on Mouse Cells, Using Lentiviral Gene Transduction

PubMed Central

Fan, Xiaohu; Lang, Haili; Zhou, Xianpei; Zhang, Li; Yin, Rong; Maciejko, Jessica; Giannitsos, Vasiliki; Motyka, Bruce; Medin, Jeffrey A.; Platt, Jeffrey L.

2010-01-01

Abstract The ABO histo-blood group system is the most important antigen system in transplantation medicine, yet no small animal model of the ABO system exists. To determine the feasibility of developing a murine model, we previously subcloned the human α-1,2-fucosyltransferase (H-transferase, EC 2.4.1.69) cDNA and the human α-1,3-N-acetylgalactosaminyltransferase (A-transferase, EC 2.4.1.40) cDNA into lentiviral vectors to study their ability to induce human histo-blood group A antigen expression on mouse cells. Herein we investigated the optimal conditions for human A and H antigen expression in murine cells. We determined that transduction of a bicistronic lentiviral vector (LvEF1-AH-trs) resulted in the expression of A antigen in a mouse endothelial cell line. We also studied the in vivo utility of this vector to induce human A antigen expression in mouse liver. After intrahepatic injection of LvEF1-AH-trs, A antigen expression was observed on hepatocytes as detected by immunohistochemistry and real-time RT-PCR. In human group A erythrocyte-sensitized mice, A antigen expression in the liver was associated with tissue damage, and deposition of antibody and complement. These results suggest that this gene transfer strategy can be used to simulate the human ABO blood group system in a murine model. This model will facilitate progress in the development of interventions for ABO-incompatible transplantation and transfusion scenarios, which are difficult to develop in clinical or large animal settings. PMID:20163247

Transient Expression of Lumbrokinase (PI239) in Tobacco (Nicotiana tabacum) Using a Geminivirus-Based Single Replicon System Dissolves Fibrin and Blood Clots.

PubMed

Dickey, Alexia; Wang, Nan; Cooper, Edwin; Tull, Lauren; Breedlove, Drew; Mason, Hugh; Liu, Dehu; Wang, Kevin Yueju

2017-01-01

Lumbrokinases, a group of fibrinolytic enzymes extracted from earthworm, have been widely used to prevent and treat various cardiovascular diseases. They specifically target fibrin to effectively degrade thrombi without major side effects. Plant expression systems are becoming potential alternative expression platforms for producing pharmaceutical proteins. In this work, a lumbrokinase (PI239) was produced from a plant system. Both wild-type (WT) and plant codon-optimized (OP) PI239 gene sequences were synthesized and cloned into a geminivirus-based single-vector DNA replicon system. Both vectors were independently expressed in tobacco (Nicotiana tabacum) leaves transiently by agroinfiltration. Overexpressed PI239 resulted in sudden tissue necrosis 3 days after infiltration. Remaining proteins were purified through His-tag affinity chromatography and analyzed with SDS-PAGE and Western blot methods. Purified PI239 successfully degraded artificial fibrin with relative activity of 13,400 U/mg when compared with commercial lumbrokinase product. In vitro tests demonstrated that plant-derived PI239 dissolved human blood clots and that the plant expression system is capable of producing functional PI239.

Kinematics and constraints associated with swashplate blade pitch control

NASA Technical Reports Server (NTRS)

Leyland, Jane A.

1993-01-01

An important class of techniques to reduce helicopter vibration is based on using a Higher Harmonic controller to optimally define the Higher Harmonic blade pitch. These techniques typically require solution of a general optimization problem requiring the determination of a control vector which minimizes a performance index where functions of the control vector are subject to inequality constraints. Six possible constraint functions associated with swashplate blade pitch control were identified and defined. These functions constrain: (1) blade pitch Fourier Coefficients expressed in the Rotating System, (2) blade pitch Fourier Coefficients expressed in the Nonrotating System, (3) stroke of the individual actuators expressed in the Nonrotating System, (4) blade pitch expressed as a function of blade azimuth and actuator stroke, (5) time rate-of-change of the aforementioned parameters, and (6) required actuator power. The aforementioned constraints and the associated kinematics of swashplate blade pitch control by means of the strokes of the individual actuators are documented.

Knock-in fibroblasts and transgenic blastocysts for expression of human FGF2 in the bovine β-casein gene locus using CRISPR/Cas9 nuclease-mediated homologous recombination.

PubMed

Jeong, Young-Hee; Kim, Yeong Ji; Kim, Eun Young; Kim, Se Eun; Kim, Jiwoo; Park, Min Jee; Lee, Hong-Gu; Park, Se Pill; Kang, Man-Jong

2016-06-01

Many transgenic domestic animals have been developed to produce therapeutic proteins in the mammary gland, and this approach is one of the most important methods for agricultural and biomedical applications. However, expression and secretion of a protein varies because transgenes are integrated at random sites in the genome. In addition, distal enhancers are very important for transcriptional gene regulation and tissue-specific gene expression. Development of a vector system regulated accurately in the genome is needed to improve production of therapeutic proteins. The objective of this study was to develop a knock-in system for expression of human fibroblast growth factor 2 (FGF2) in the bovine β-casein gene locus. The F2A sequence was fused to the human FGF2 gene and inserted into exon 3 of the β-casein gene. We detected expression of human FGF2 mRNA in the HC11 mouse mammary epithelial cells by RT-PCR and human FGF2 protein in the culture media using western blot analysis when the knock-in vector was introduced. We transfected the knock-in vector into bovine ear fibroblasts and produced knock-in fibroblasts using the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system. Moreover, the CRISPR/Cas9 system was more efficient than conventional methods. In addition, we produced knock-in blastocysts by somatic cell nuclear transfer using the knock-in fibroblasts. Our knock-in fibroblasts may help to create cloned embryos for development of transgenic dairy cattle expressing human FGF2 protein in the mammary gland via the expression system of the bovine β-casein gene.

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed Central

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors. Images PMID:2404285

Transient foreign gene expression in chloroplasts of cultured tobacco cells after biolistic delivery of chloroplast vectors.

PubMed

Daniell, H; Vivekananda, J; Nielsen, B L; Ye, G N; Tewari, K K; Sanford, J C

1990-01-01

Expression of chloramphenicol acetyltransferase (cat) by suitable vectors in chloroplasts of cultured tobacco cells, delivered by high-velocity microprojectiles, is reported here. Several chloroplast expression vectors containing bacterial cat genes, placed under the control of either psbA promoter region from pea (pHD series) or rbcL promoter region from maize (pAC series) have been used in this study. In addition, chloroplast expression vectors containing replicon fragments from pea, tobacco, or maize chloroplast DNA have also been tested for efficiency and duration of cat expression in chloroplasts of tobacco cells. Cultured NT1 tobacco cells collected on filter papers were bombarded with tungsten particles coated with pUC118 (negative control), 35S-CAT (nuclear expression vector), pHD312 (repliconless chloroplast expression vector), and pHD407, pACp18, and pACp19 (chloroplast expression vectors with replicon). Sonic extracts of cells bombarded with pUC118 showed no detectable cat activity in the autoradiograms. Nuclear expression of cat reached two-thirds of the maximal 48 hr after bombardment and the maximal at 72 hr. Cells bombarded with chloroplast expression vectors showed a low level of expression until 48 hr of incubation. A dramatic increase in the expression of cat was observed 24 hr after the addition of fresh medium to cultured cells in samples bombarded with pHD407; the repliconless vector pHD312 showed about 50% of this maximal activity. The expression of nuclear cat and the repliconless chloroplast vector decreased after 72 hr, but a high level of chloroplast cat expression was maintained in cells bombarded with pHD407. Organelle-specific expression of cat in appropriate compartments was checked by introducing various plasmid constructions into tobacco protoplasts by electroporation. Although the nuclear expression vector 35S-CAT showed expression of cat, no activity was observed with any chloroplast vectors.

Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells.

PubMed

Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G; Martin, Francisco

2016-11-17

Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny.

Lent-On-Plus Lentiviral vectors for conditional expression in human stem cells

PubMed Central

Benabdellah, Karim; Muñoz, Pilar; Cobo, Marién; Gutierrez-Guerrero, Alejandra; Sánchez-Hernández, Sabina; Garcia-Perez, Angélica; Anderson, Per; Carrillo-Gálvez, Ana Belén; Toscano, Miguel G.; Martin, Francisco

2016-01-01

Conditional transgene expression in human stem cells has been difficult to achieve due to the low efficiency of existing delivery methods, the strong silencing of the transgenes and the toxicity of the regulators. Most of the existing technologies are based on stem cells clones expressing appropriate levels of tTA or rtTA transactivators (based on the TetR-VP16 chimeras). In the present study, we aim the generation of Tet-On all-in-one lentiviral vectors (LVs) that tightly regulate transgene expression in human stem cells using the original TetR repressor. By using appropriate promoter combinations and shielding the LVs with the Is2 insulator, we have constructed the Lent-On-Plus Tet-On system that achieved efficient transgene regulation in human multipotent and pluripotent stem cells. The generation of inducible stem cell lines with the Lent-ON-Plus LVs did not require selection or cloning, and transgene regulation was maintained after long-term cultured and upon differentiation toward different lineages. To our knowledge, Lent-On-Plus is the first all-in-one vector system that tightly regulates transgene expression in bulk populations of human pluripotent stem cells and its progeny. PMID:27853296

A super gene expression system enhances the anti-glioma effects of adenovirus-mediated REIC/Dkk-3 gene therapy

NASA Astrophysics Data System (ADS)

Oka, Tetsuo; Kurozumi, Kazuhiko; Shimazu, Yosuke; Ichikawa, Tomotsugu; Ishida, Joji; Otani, Yoshihiro; Shimizu, Toshihiko; Tomita, Yusuke; Sakaguchi, Masakiyo; Watanabe, Masami; Nasu, Yasutomo; Kumon, Hiromi; Date, Isao

2016-09-01

Reduced expression in immortalized cells/Dickkopf-3 (REIC/Dkk-3) is a tumor suppressor and therapeutic gene in many human cancers. Recently, an adenovirus REIC vector with the super gene expression system (Ad-SGE-REIC) was developed to increase REIC/Dkk-3 expression and enhance therapeutic effects compared with the conventional adenoviral vector (Ad-CAG-REIC). In this study, we investigated the in vitro and in vivo effects of Ad-SGE-REIC on malignant glioma. In U87ΔEGFR and GL261 glioma cells, western blotting confirmed that robust upregulation of REIC/Dkk-3 expression occurred in Ad-SGE-REIC-transduced cells, most notably after transduction at a multiplicity of infection of 10. Cytotoxicity assays showed that Ad-SGE-REIC resulted in a time-dependent and significant reduction in the number of malignant glioma cells attaching to the bottom of culture wells. Xenograft and syngeneic mouse intracranial glioma models treated with Ad-SGE-REIC had significantly longer survival than those treated with the control vector Ad-LacZ or with Ad-CAG-REIC. This study demonstrated the anti-glioma effect of Ad-SGE-REIC, which may represent a promising strategy for the treatment of malignant glioma.

Hybrid Adeno-Associated Viral Vectors Utilizing Transposase-Mediated Somatic Integration for Stable Transgene Expression in Human Cells

PubMed Central

Zhang, Wenli; Solanki, Manish; Müther, Nadine; Ebel, Melanie; Wang, Jichang; Sun, Chuanbo; Izsvak, Zsuzsanna; Ehrhardt, Anja

2013-01-01

Recombinant adeno-associated viral (AAV) vectors have been shown to be one of the most promising vectors for therapeutic gene delivery because they can induce efficient and long-term transduction in non-dividing cells with negligible side-effects. However, as AAV vectors mostly remain episomal, vector genomes and transgene expression are lost in dividing cells. Therefore, to stably transduce cells, we developed a novel AAV/transposase hybrid-vector. To facilitate SB-mediated transposition from the rAAV genome, we established a system in which one AAV vector contains the transposon with the gene of interest and the second vector delivers the hyperactive Sleeping Beauty (SB) transposase SB100X. Human cells were infected with the AAV-transposon vector and the transposase was provided in trans either by transient and stable plasmid transfection or by AAV vector transduction. We found that groups which received the hyperactive transposase SB100X showed significantly increased colony forming numbers indicating enhanced integration efficiencies. Furthermore, we found that transgene copy numbers in transduced cells were dose-dependent and that predominantly SB transposase-mediated transposition contributed to stabilization of the transgene. Based on a plasmid rescue strategy and a linear-amplification mediated PCR (LAM-PCR) protocol we analysed the SB100X-mediated integration profile after transposition from the AAV vector. A total of 1840 integration events were identified which revealed a close to random integration profile. In summary, we show for the first time that AAV vectors can serve as template for SB transposase mediated somatic integration. We developed the first prototype of this hybrid-vector system which with further improvements may be explored for treatment of diseases which originate from rapidly dividing cells. PMID:24116154

Recombination–deletion between homologous cassettes in retrovirus is suppressed via a strategy of degenerate codon substitution

PubMed Central

Im, Eung Jun; Bais, Anthony J; Yang, Wen; Ma, Qiangzhong; Guo, Xiuyang; Sepe, Steven M; Junghans, Richard P

2014-01-01

Transduction and expression procedures in gene therapy protocols may optimally transfer more than a single gene to correct a defect and/or transmit new functions to recipient cells or organisms. This may be accomplished by transduction with two (or more) vectors, or, more efficiently, in a single vector. Occasionally, it may be useful to coexpress homologous genes or chimeric proteins with regions of shared homology. Retroviridae include the dominant vector systems for gene transfer (e.g., gamma-retro and lentiviruses) and are capable of such multigene expression. However, these same viruses are known for efficient recombination–deletion when domains are duplicated within the viral genome. This problem can be averted by resorting to two-vector strategies (two-chain two-vector), but at a penalty to cost, convenience, and efficiency. Employing a chimeric antigen receptor system as an example, we confirm that coexpression of two genes with homologous domains in a single gamma-retroviral vector (two-chain single-vector) leads to recombination–deletion between repeated sequences, excising the equivalent of one of the chimeric antigen receptors. Here, we show that a degenerate codon substitution strategy in the two-chain single-vector format efficiently suppressed intravector deletional loss with rescue of balanced gene coexpression by minimizing sequence homology between repeated domains and preserving the final protein sequence. PMID:25419532

Development of a baculovirus vector carrying a small hairpin RNA for suppression of sf-caspase-1 expression and improvement of recombinant protein production.

PubMed

Zhang, Xiaoyue; Xu, Keyan; Ou, Yanmei; Xu, Xiaodong; Chen, Hongying

2018-05-02

The Baculovirus expression vector system (BEVS) is a transient expression platform for recombinant protein production in insect cells. Baculovirus infection of insect cells will shutoff host translation and induce apoptosis and lead to the termination of protein expression. Previous reports have demonstrated the enhancement of protein yield in BEVS using stable insect cell lines expressing interference RNA to suppress the expression of caspase-1. In this study, short-hairpin RNA (shRNA) expression cassettes targeting Spodoptera frugiperda caspase-1 (Sf-caspase-1) were constructed and inserted into an Autographa californica multiple nucleopolyhedrovirus (AcMNPV) vector. Using the recombinant baculovirus vectors, we detected the suppression of Sf-caspase-1 expression and cell apoptosis. Green fluorescent protein (GFP), Discosoma sp. Red (DsRed) and firefly luciferase were then expressed as reporter proteins. The results showed that suppression of apoptosis enhanced the accumulation of exogenous proteins at 2 and 3 days post infection. After 4 days post infection, the activity of the reporter proteins remained higher in BEVS using the baculovirus carrying shRNA in comparison with the control without shRNA, but the accumulated protein levels showed no obvious difference between them, suggesting that apoptosis suppression resulted in improved protein folding rather than translation efficiency at the very late stage of baculovirus infection. The baculovirus vector developed in this study would be a useful tool for the production of active proteins suitable for structural and functional studies or pharmaceutical applications in Sf9 cells, and it also has the potential to be adapted for the improvement of protein expression in different insect cell lines that can be infected by AcMNPV.

Alpharetroviral Vector-mediated Gene Therapy for X-CGD: Functional Correction and Lack of Aberrant Splicing

PubMed Central

Kaufmann, Kerstin B.; Brendel, Christian; Suerth, Julia D.; Mueller-Kuller, Uta; Chen-Wichmann, Linping; Schwäble, Joachim; Pahujani, Shweta; Kunkel, Hana; Schambach, Axel; Baum, Christopher; Grez, Manuel

2013-01-01

Comparative integrome analysis has revealed that the most neutral integration pattern among retroviruses is attributed to alpharetroviruses. We chose X-linked chronic granulomatous disease (X-CGD) as model to evaluate the potential of self-inactivating (SIN) alpharetroviral vectors for gene therapy of monogenic diseases. Therefore, we combined the alpharetroviral vector backbone with the elongation factor-1α short promoter, both considered to possess a low genotoxic profile, to drive transgene (gp91phox) expression. Following efficient transduction transgene expression was sustained and provided functional correction of the CGD phenotype in a cell line model at low vector copy number. Further analysis in a murine X-CGD transplantation model revealed gene-marking of bone marrow cells and oxidase positive granulocytes in peripheral blood. Transduction of human X-CGD CD34+ cells provided functional correction up to wild-type levels and long-term expression upon transplantation into a humanized mouse model. In contrast to lentiviral vectors, no aberrantly spliced transcripts containing cellular exons fused to alpharetroviral sequences were found in transduced cells, implying that the safety profile of alpharetroviral vectors may extend beyond their neutral integration profile. Taken together, this highlights the potential of this SIN alpharetroviral system as a platform for new candidate vectors for future gene therapy of hematopoietic disorders. PMID:23207695

Human adipose derived mesenchymal stromal cells transduced with GFP lentiviral vectors: assessment of immunophenotype and differentiation capacity in vitro.

PubMed

van Vollenstee, Fiona A; Jackson, Carlo; Hoffmann, Danie; Potgieter, Marnie; Durandt, Chrisna; Pepper, Michael S

2016-10-01

Adipose derived mesenchymal stromal/stem cells (ASCs) are a heterogeneous population characterized by (a) their ability to adhere to plastic; (b) immunophenotypic expression of certain cell surface markers, while lacking others; and (c) the capacity to differentiate into lineages of mesodermal origin including osteocytes, chondrocytes and adipocytes. The long-term goal is to utilize these cells for clinical translation into cell-based therapies. However, preclinical safety and efficacy need to be demonstrated in animal models. ASCs can also be utilized as biological vehicles for vector-based gene delivery systems, since they are believed to home to sites of inflammation and infection in vivo. These factors motivated the development of a labelling system for ASCs using lentiviral vector-based green fluorescent protein (GFP) transduction. Human ASCs were transduced with GFP-expressing lentiviral vectors. A titration study determined the viral titer required to transduce the maximum number of ASCs. The effect of the transduced GFP lentiviral vector on ASC immunophenotypic expression of surface markers as well as their ability to differentiate into osteocytes and adipocytes were assessed in vitro. A transduction efficiency in ASC cultures of approximately 80 % was observed with an MOI of ~118. No significant immunophenotypic differences were observed between transduced and non-transduced cells and both cell types successfully differentiated into adipocytes and osteocytes in vitro. We obtained >80 % transduction of ASCs using GFP lentiviral vectors. Transduced ASCs maintained plastic adherence, demonstrated ASC immunophenotype and the ability to differentiate into cells of the mesodermal lineage. This GFP-ASC transduction technique offers a potential tracking system for future pre-clinical studies.

Using viral vectors as gene transfer tools (Cell Biology and Toxicology Special Issue: ETCS-UK 1 day meeting on genetic manipulation of cells).

PubMed

Howarth, Joanna L; Lee, Youn Bok; Uney, James B

2010-02-01

In recent years, the development of powerful viral gene transfer techniques has greatly facilitated the study of gene function. This review summarises some of the viral delivery systems routinely used to mediate gene transfer into cell lines, primary cell cultures and in whole animal models. The systems described were originally discussed at a 1-day European Tissue Culture Society (ETCS-UK) workshop that was held at University College London on 1st April 2009. Recombinant-deficient viral vectors (viruses that are no longer able to replicate) are used to transduce dividing and post-mitotic cells, and they have been optimised to mediate regulatable, powerful, long-term and cell-specific expression. Hence, viral systems have become very widely used, especially in the field of neurobiology. This review introduces the main categories of viral vectors, focusing on their initial development and highlighting modifications and improvements made since their introduction. In particular, the use of specific promoters to restrict expression, translational enhancers and regulatory elements to boost expression from a single virion and the development of regulatable systems is described.

Direct In Vivo Reprogramming with Sendai Virus Vectors Improves Cardiac Function after Myocardial Infarction.

PubMed

Miyamoto, Kazutaka; Akiyama, Mizuha; Tamura, Fumiya; Isomi, Mari; Yamakawa, Hiroyuki; Sadahiro, Taketaro; Muraoka, Naoto; Kojima, Hidenori; Haginiwa, Sho; Kurotsu, Shota; Tani, Hidenori; Wang, Li; Qian, Li; Inoue, Makoto; Ide, Yoshinori; Kurokawa, Junko; Yamamoto, Tsunehisa; Seki, Tomohisa; Aeba, Ryo; Yamagishi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

2018-01-04

Direct cardiac reprogramming holds great promise for regenerative medicine. We previously generated directly reprogrammed induced cardiomyocyte-like cells (iCMs) by overexpression of Gata4, Mef2c, and Tbx5 (GMT) using retrovirus vectors. However, integrating vectors pose risks associated with insertional mutagenesis and disruption of gene expression and are inefficient. Here, we show that Sendai virus (SeV) vectors expressing cardiac reprogramming factors efficiently and rapidly reprogram both mouse and human fibroblasts into integration-free iCMs via robust transgene expression. SeV-GMT generated 100-fold more beating iCMs than retroviral-GMT and shortened the duration to induce beating cells from 30 to 10 days in mouse fibroblasts. In vivo lineage tracing revealed that the gene transfer of SeV-GMT was more efficient than retroviral-GMT in reprogramming resident cardiac fibroblasts into iCMs in mouse infarct hearts. Moreover, SeV-GMT improved cardiac function and reduced fibrosis after myocardial infarction. Thus, efficient, non-integrating SeV vectors may serve as a powerful system for cardiac regeneration. Copyright © 2017 Elsevier Inc. All rights reserved.

Rapid construction of a Bacterial Artificial Chromosomal (BAC) expression vector using designer DNA fragments.

PubMed

Chen, Chao; Zhao, Xinqing; Jin, Yingyu; Zhao, Zongbao Kent; Suh, Joo-Won

2014-11-01

Bacterial artificial chromosomal (BAC) vectors are increasingly being used in cloning large DNA fragments containing complex biosynthetic pathways to facilitate heterologous production of microbial metabolites for drug development. To express inserted genes using Streptomyces species as the production hosts, an integration expression cassette is required to be inserted into the BAC vector, which includes genetic elements encoding a phage-specific attachment site, an integrase, an origin of transfer, a selection marker and a promoter. Due to the large sizes of DNA inserted into the BAC vectors, it is normally inefficient and time-consuming to assemble these fragments by routine PCR amplifications and restriction-ligations. Here we present a rapid method to insert fragments to construct BAC-based expression vectors. A DNA fragment of about 130 bp was designed, which contains upstream and downstream homologous sequences of both BAC vector and pIB139 plasmid carrying the whole integration expression cassette. In-Fusion cloning was performed using the designer DNA fragment to modify pIB139, followed by λ-RED-mediated recombination to obtain the BAC-based expression vector. We demonstrated the effectiveness of this method by rapid construction of a BAC-based expression vector with an insert of about 120 kb that contains the entire gene cluster for biosynthesis of immunosuppressant FK506. The empty BAC-based expression vector constructed in this study can be conveniently used for construction of BAC libraries using either microbial pure culture or environmental DNA, and the selected BAC clones can be directly used for heterologous expression. Alternatively, if a BAC library has already been constructed using a commercial BAC vector, the selected BAC vectors can be manipulated using the method described here to get the BAC-based expression vectors with desired gene clusters for heterologous expression. The rapid construction of a BAC-based expression vector facilitates heterologous expression of large gene clusters for drug discovery. Copyright © 2014 Elsevier Inc. All rights reserved.

Intranuclear DNA release is a determinant of transfection activity for a non-viral vector: biocleavable polyrotaxane as a supramolecularly dissociative condenser for efficient intranuclear DNA release.

PubMed

Yamada, Yuma; Nomura, Taku; Harashima, Hideyoshi; Yamashita, Atsushi; Katoono, Ryo; Yui, Nobuhiko

2010-01-01

It has been believed that nuclear gene delivery is the most important process for gene expression, and various non-viral vectors are currently being developed with this assumption. However, some of our earlier studies revealed a surprising difference in transfection activity between viral and non-viral vectors: this difference is largely due to the result of the intranuclear disposition of DNA rather than its delivery to the nucleus (Hama S. et al. (2006), Quantitative comparison of intracellular trafficking and nuclear transcription between adenoviral and lipoplex systems. Mol. Ther., 13, 786-794). Here, we report on some direct evidence that demonstrates the importance of the release of intranuclear DNA on transfection activity. The data show that transfection activity can be substantially enhanced by integrating a multifunctional envelope-type nano device (MEND) and a biocleavable polyrotaxane (DMAE-SS-PRX) as an artificial condenser. Our integration system showed significantly higher transfection activity compared to conventional gene delivery system. Moreover, this system provides a strong support for our hypothesis that intranuclear DNA disposition plays a critical role in gene expression for non-viral vectors.

Improved muscle-derived expression of human coagulation factor IX from a skeletal actin/CMV hybrid enhancer/promoter.

PubMed

Hagstrom, J N; Couto, L B; Scallan, C; Burton, M; McCleland, M L; Fields, P A; Arruda, V R; Herzog, R W; High, K A

2000-04-15

Hemophilia B is caused by the absence of functional coagulation factor IX (F.IX) and represents an important model for treatment of genetic diseases by gene therapy. Recent studies have shown that intramuscular injection of an adeno-associated viral (AAV) vector into mice and hemophilia B dogs results in vector dose-dependent, long-term expression of biologically active F.IX at therapeutic levels. In this study, we demonstrate that levels of expression of approximately 300 ng/mL (6% of normal human F.IX levels) can be reached by intramuscular injection of mice using a 2- to 4-fold lower vector dose (1 x 10(11) vector genomes/mouse, injected into 4 intramuscular sites) than previously described. This was accomplished through the use of an improved expression cassette that uses the cytomegalovirus (CMV) immediate early enhancer/promoter in combination with a 1.2-kilobase portion of human skeletal actin promoter. These results correlated with enhanced levels of F.IX transcript and secreted F.IX protein in transduced murine C2C12 myotubes. Systemic F.IX expression from constructs containing the CMV enhancer/promoter alone was 120 to 200 ng/mL in mice injected with 1 x 10(11) vector genomes. Muscle-specific promoters performed poorly for F.IX transgene expression in vitro and in vivo. However, the incorporation of a sequence from the alpha-skeletal actin promoter containing at least 1 muscle-specific enhancer and 1 enhancer-like element further improved muscle-derived expression of F.IX from a CMV enhancer/promoter-driven expression cassette over previously published results. These findings will allow the design of a clinical protocol for therapeutic levels of F.IX expression with lower vector doses, thus enhancing efficacy and safety of the protocol. (Blood. 2000;95:2536-2542)

Heterologous Protein Secretion in Lactobacilli with Modified pSIP Vectors

PubMed Central

Karlskås, Ingrid Lea; Maudal, Kristina; Axelsson, Lars; Rud, Ida; Eijsink, Vincent G. H.; Mathiesen, Geir

2014-01-01

We describe new variants of the modular pSIP-vectors for inducible gene expression and protein secretion in lactobacilli. The basic functionality of the pSIP system was tested in Lactobacillus strains representing 14 species using pSIP411, which harbors the broad-host-range Lactococcus lactis SH71rep replicon and a β-glucuronidase encoding reporter gene. In 10 species, the inducible gene expression system was functional. Based on these results, three pSIP vectors with different signal peptides were modified by replacing their narrow-host-range L. plantarum 256rep replicon with SH71rep and transformed into strains of five different species of Lactobacillus. All recombinant strains secreted the target protein NucA, albeit with varying production levels and secretion efficiencies. The Lp_3050 derived signal peptide generally resulted in the highest levels of secreted NucA. These modified pSIP vectors are useful tools for engineering a wide variety of Lactobacillus species. PMID:24614815

High-efficiency Transduction of Rhesus Hematopoietic Repopulating Cells by a Modified HIV1-based Lentiviral Vector

PubMed Central

Uchida, Naoya; Hargrove, Phillip W.; Lap, Coen J.; Evans, Molly E.; Phang, Oswald; Bonifacino, Aylin C.; Krouse, Allen E.; Metzger, Mark E.; Nguyen, Anh-Dao; Hsieh, Matthew M.; Wolfsberg, Tyra G.; Donahue, Robert E.; Persons, Derek A.; Tisdale, John F.

2012-01-01

Human immunodeficiency virus type 1 (HIV1) vectors poorly transduce rhesus hematopoietic cells due to species-specific restriction factors, including the tripartite motif-containing 5 isoformα (TRIM5α) which targets the HIV1 capsid. We previously developed a chimeric HIV1 (χHIV) vector system wherein the vector genome is packaged with the simian immunodeficiency virus (SIV) capsid for efficient transduction of both rhesus and human CD34+ cells. To evaluate whether χHIV vectors could efficiently transduce rhesus hematopoietic repopulating cells, we performed a competitive repopulation assay in rhesus macaques, in which half of the CD34+ cells were transduced with standard SIV vectors and the other half with χHIV vectors. As compared with SIV vectors, χHIV vectors achieved higher vector integration, and the transgene expression rates were two- to threefold higher in granulocytes and red blood cells and equivalent in lymphocytes and platelets for 2 years. A recipient of χHIV vector-only transduced cells reached up to 40% of transgene expression rates in granulocytes and lymphocytes and 20% in red blood cells. Similar to HIV1 and SIV vectors, χHIV vector frequently integrated into gene regions, especially into introns. In summary, our χHIV vector demonstrated efficient transduction for rhesus long-term repopulating cells, comparable with SIV vectors. This χHIV vector should allow preclinical testing of HIV1-based therapeutic vectors in large animal models. PMID:22871664

Under-Expression of Chemosensory Genes in Domiciliary Bugs of the Chagas Disease Vector Triatoma brasiliensis

PubMed Central

Marchant, Axelle; Mougel, Florence; Jacquin-Joly, Emmanuelle; Costa, Jane; Almeida, Carlos Eduardo; Harry, Myriam

2016-01-01

Background In Latin America, the bloodsucking bugs Triatominae are vectors of Trypanosoma cruzi, the parasite that causes Chagas disease. Chemical elimination programs have been launched to control Chagas disease vectors. However, the disease persists because native vectors from sylvatic habitats are able to (re)colonize houses—a process called domiciliation. Triatoma brasiliensis is one example. Because the chemosensory system allows insects to interact with their environment and plays a key role in insect adaption, we conducted a descriptive and comparative study of the chemosensory transcriptome of T. brasiliensis samples from different ecotopes. Methodology/Principal Finding In a reference transcriptome built using de novo assembly, we found transcripts encoding 27 odorant-binding proteins (OBPs), 17 chemosensory proteins (CSPs), 3 odorant receptors (ORs), 5 transient receptor potential channel (TRPs), 1 sensory neuron membrane protein (SNMPs), 25 takeout proteins, 72 cytochrome P450s, 5 gluthatione S-transferases, and 49 cuticular proteins. Using protein phylogenies, we showed that most of the OBPs and CSPs for T. brasiliensis had well supported orthologs in the kissing bug Rhodnius prolixus. We also showed a higher number of these genes within the bloodsucking bugs and more generally within all Hemipterans compared to the other species in the super-order Paraneoptera. Using both DESeq2 and EdgeR software, we performed differential expression analyses between samples of T. brasiliensis, taking into account their environment (sylvatic, peridomiciliary and domiciliary) and sex. We also searched clusters of co-expressed contigs using HTSCluster. Among differentially expressed (DE) contigs, most were under-expressed in the chemosensory organs of the domiciliary bugs compared to the other samples and in females compared to males. We clearly identified DE genes that play a role in the chemosensory system. Conclusion/Significance Chemosensory genes could be good candidates for genes that contribute to adaptation or plastic rearrangement to an anthropogenic system. The domiciliary environment probably includes less diversity of xenobiotics and probably has more stable abiotic parameters than do sylvatic and peridomiciliary environments. This could explain why both detoxification and cuticle protein genes are less expressed in domiciliary bugs. Understanding the molecular basis for how vectors adapt to human dwellings may reveal new tools to control disease vectors; for example, by disrupting chemical communication. PMID:27792774

Under-Expression of Chemosensory Genes in Domiciliary Bugs of the Chagas Disease Vector Triatoma brasiliensis.

PubMed

Marchant, Axelle; Mougel, Florence; Jacquin-Joly, Emmanuelle; Costa, Jane; Almeida, Carlos Eduardo; Harry, Myriam

2016-10-01

In Latin America, the bloodsucking bugs Triatominae are vectors of Trypanosoma cruzi, the parasite that causes Chagas disease. Chemical elimination programs have been launched to control Chagas disease vectors. However, the disease persists because native vectors from sylvatic habitats are able to (re)colonize houses-a process called domiciliation. Triatoma brasiliensis is one example. Because the chemosensory system allows insects to interact with their environment and plays a key role in insect adaption, we conducted a descriptive and comparative study of the chemosensory transcriptome of T. brasiliensis samples from different ecotopes. In a reference transcriptome built using de novo assembly, we found transcripts encoding 27 odorant-binding proteins (OBPs), 17 chemosensory proteins (CSPs), 3 odorant receptors (ORs), 5 transient receptor potential channel (TRPs), 1 sensory neuron membrane protein (SNMPs), 25 takeout proteins, 72 cytochrome P450s, 5 gluthatione S-transferases, and 49 cuticular proteins. Using protein phylogenies, we showed that most of the OBPs and CSPs for T. brasiliensis had well supported orthologs in the kissing bug Rhodnius prolixus. We also showed a higher number of these genes within the bloodsucking bugs and more generally within all Hemipterans compared to the other species in the super-order Paraneoptera. Using both DESeq2 and EdgeR software, we performed differential expression analyses between samples of T. brasiliensis, taking into account their environment (sylvatic, peridomiciliary and domiciliary) and sex. We also searched clusters of co-expressed contigs using HTSCluster. Among differentially expressed (DE) contigs, most were under-expressed in the chemosensory organs of the domiciliary bugs compared to the other samples and in females compared to males. We clearly identified DE genes that play a role in the chemosensory system. Chemosensory genes could be good candidates for genes that contribute to adaptation or plastic rearrangement to an anthropogenic system. The domiciliary environment probably includes less diversity of xenobiotics and probably has more stable abiotic parameters than do sylvatic and peridomiciliary environments. This could explain why both detoxification and cuticle protein genes are less expressed in domiciliary bugs. Understanding the molecular basis for how vectors adapt to human dwellings may reveal new tools to control disease vectors; for example, by disrupting chemical communication.

The Tol2 transposon system mediates the genetic engineering of T-cells with CD19-specific chimeric antigen receptors for B-cell malignancies.

PubMed

Tsukahara, T; Iwase, N; Kawakami, K; Iwasaki, M; Yamamoto, C; Ohmine, K; Uchibori, R; Teruya, T; Ido, H; Saga, Y; Urabe, M; Mizukami, H; Kume, A; Nakamura, M; Brentjens, R; Ozawa, K

2015-02-01

Engineered T-cell therapy using a CD19-specific chimeric antigen receptor (CD19-CAR) is a promising strategy for the treatment of advanced B-cell malignancies. Gene transfer of CARs to T-cells has widely relied on retroviral vectors, but transposon-based gene transfer has recently emerged as a suitable nonviral method to mediate stable transgene expression. The advantages of transposon vectors compared with viral vectors include their simplicity and cost-effectiveness. We used the Tol2 transposon system to stably transfer CD19-CAR into human T-cells. Normal human peripheral blood lymphocytes were co-nucleofected with the Tol2 transposon donor plasmid carrying CD19-CAR and the transposase expression plasmid and were selectively propagated on NIH3T3 cells expressing human CD19. Expanded CD3(+) T-cells with stable and high-level transgene expression (~95%) produced interferon-γ upon stimulation with CD19 and specifically lysed Raji cells, a CD19(+) human B-cell lymphoma cell line. Adoptive transfer of these T-cells suppressed tumor progression in Raji tumor-bearing Rag2(-/-)γc(-/-) immunodeficient mice compared with control mice. These results demonstrate that the Tol2 transposon system could be used to express CD19-CAR in genetically engineered T-cells for the treatment of refractory B-cell malignancies.

Quantitative evaluation of first, second, and third generation hairpin systems reveals the limit of mammalian vector-based RNAi

PubMed Central

Watanabe, Colin; Cuellar, Trinna L.; Haley, Benjamin

2016-01-01

ABSTRACT Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional siRNAs into shRNA/artificial miRNA backbones, or large-scale screens to identify efficacious sequences. Thus, we used quantitative cell-based assays to compare separate third generation artificial miRNA systems, miR-E (based on miR-30a) and miR-3G (based on miR-16-2 and first described in this study) to widely-adopted, first and second generation formats in both Pol-II and Pol-III expression vector contexts. Despite their unique structures and strandedness, and in contrast to first and second-generation RNAi triggers, the third generation formats operated with remarkable similarity to one another, and strong silencing was observed with a significant fraction of the evaluated target sequences within either promoter context. By pairing an established siRNA design algorithm with the third generation vectors we could readily identify targeting sequences that matched or exceeded the potency of those discovered through large-scale sensor-based assays. We find that third generation hairpin systems enable the maximal level of siRNA function, likely through enhanced processing and accumulation of precisely-defined guide RNAs. Therefore, we predict future gains in RNAi potency will come from improved hairpin expression and identification of optimal siRNA-intrinsic silencing properties rather than further modification of these scaffolds. Consequently, third generation systems should be the primary format for vector-based RNAi studies; miR-3G is advantageous due to its small expression cassette and simplified, cost-efficient cloning scheme. PMID:26786363

RNA interference mediated in human primary cells via recombinant baculoviral vectors.

PubMed

Nicholson, Linda J; Philippe, Marie; Paine, Alan J; Mann, Derek A; Dolphin, Colin T

2005-04-01

The success of RNA interference (RNAi) in mammalian cells, mediated by siRNAs or shRNA-generating plasmids, is dependent, to an extent, upon transfection efficiency. This is a particular problem with primary cells, which are often difficult to transfect using cationic lipid vehicles. Effective RNAi in primary cells is thus best achieved with viral vectors, and retro-, adeno-, and lentivirus RNAi systems have been described. However, the use of such human viral vectors is inherently problematic, e.g., Class 2 status and requirement of secondary helper functions. Although insect cells are their natural host, baculoviruses also transduce a range of vertebrate cell lines and primary cells with high efficiency. The inability of baculoviral vectors to replicate in mammalian cells, their Class 1 status, and the simplicity of their construction make baculovirus an attractive alternative gene delivery vector. We have developed a baculoviral-based RNAi system designed to express shRNAs and GFP from U6 and CMV promoters, respectively. Transduction of Saos2, HepG2, Huh7, and primary human hepatic stellate cells with a baculoviral construct expressing shRNAs targeting lamin A/C resulted in effective knockdown of the corresponding mRNA and protein. Development of this baculoviral-based system provides an additional shRNA delivery option for RNAi-based investigations in mammalian cells.

A direct comparison of two nonviral gene therapy vectors for somatic integration: in vivo evaluation of the bacteriophage integrase phiC31 and the Sleeping Beauty transposase.

PubMed

Ehrhardt, Anja; Xu, Hui; Huang, Zan; Engler, Jeffrey A; Kay, Mark A

2005-05-01

In this study we performed a head-to-head comparison of the integrase phiC31 derived from a Streptomyces phage and the Sleeping Beauty (SB) transposase, a member of the TC1/mariner superfamily of transposable elements. Mouse liver was cotransfused with a vector containing our most robust human coagulation factor IX expression cassette and the appropriate recombinase recognition site and either a phiC31- or a SB transposase-expressing vector. To analyze transgene persistence and to prove somatic integration in vivo we induced cell cycling of mouse hepatocytes and found that the transgene expression levels dropped by only 16 to 21% and 56 to 66% in mice that received phiC31 and SB, respectively. Notably, no difference in the toxicity profile was detected in mice treated with either recombinase. Moreover we observed that with the integrase-mediated gene transfer, transgene expression levels were dependent on the remaining noncoding vector sequences, which also integrate into the host genome. Further analyses of a hot spot of integration after phiC31-mediated integration revealed small chromosomal deletions at the target site and that the recombination process was not dependent on the orientation in which the phiC31 recognition site attached to the pseudo-recognition sites in the host genome. Coupled together with ongoing improvements in both systems this study suggests that both nonviral vector systems will have important roles in achieving stable gene transfer in vivo.

Development of oral CTL vaccine using a CTP-integrated Sabin 1 poliovirus-based vector system.

PubMed

Han, Seung-Soo; Lee, Jinjoo; Jung, Yideul; Kang, Myeong-Ho; Hong, Jung-Hyub; Cha, Min-Suk; Park, Yu-Jin; Lee, Ezra; Yoon, Cheol-Hee; Bae, Yong-Soo

2015-09-11

We developed a CTL vaccine vector by modification of the RPS-Vax system, a mucosal vaccine vector derived from a poliovirus Sabin 1 strain, and generated an oral CTL vaccine against HIV-1. A DNA fragment encoding a cytoplasmic transduction peptide (CTP) was integrated into the RPS-Vax system to generate RPS-CTP, a CTL vaccine vector. An HIV-1 p24 cDNA fragment was introduced into the RPS-CTP vector system and a recombinant poliovirus (rec-PV) named vRPS-CTP/p24 was produced. vRPS-CTP/p24 was genetically stable and efficiently induced Th1 immunity and p24-specific CTLs in immunized poliovirus receptor-transgenic (PVR-Tg) mice. In challenge experiments, PVR-Tg mice that were pre-immunized orally with vRPS-CTP/p24 were resistant to challenge with a lethal dose of p24-expressing recombinant vaccinia virus (rMVA-p24). These results suggested that the RPS-CTP vector system had potential for developing oral CTL vaccines against infectious diseases. Copyright © 2015 Elsevier Ltd. All rights reserved.

Increased tumor localization and reduced immune response to adenoviral vector formulated with the liposome DDAB/DOPE.

PubMed

Steel, Jason C; Cavanagh, Heather M A; Burton, Mark A; Abu-Asab, Mones S; Tsokos, Maria; Morris, John C; Kalle, Wouter H J

2007-04-01

We aimed to increase the efficiency of adenoviral vectors by limiting adenoviral spread from the target site and reducing unwanted host immune responses to the vector. We complexed adenoviral vectors with DDAB-DOPE liposomes to form adenovirus-liposomal (AL) complexes. AL complexes were delivered by intratumoral injection in an immunocompetent subcutaneous rat tumor model and the immunogenicity of the AL complexes and the expression efficiency in the tumor and other organs was examined. Animals treated with the AL complexes had significantly lower levels of beta-galactosidase expression in systemic tissues compared to animals treated with the naked adenovirus (NA) (P<0.05). The tumor to non-tumor ratio of beta-galactosidase marker expression was significantly higher for the AL complex treated animals. NA induced significantly higher titers of adenoviral-specific antibodies compared to the AL complexes (P<0.05). The AL complexes provided protection (immunoshielding) to the adenovirus from neutralizing antibody. Forty-seven percent more beta-galactosidase expression was detected following intratumoral injection with AL complexes compared to the NA in animals pre-immunized with adenovirus. Complexing of adenovirus with liposomes provides a simple method to enhance tumor localization of the vector, decrease the immunogenicity of adenovirus, and provide protection of the virus from pre-existing neutralizing antibodies.

Muscle-specific CRISPR/Cas9 dystrophin gene editing ameliorates pathophysiology in a mouse model for Duchenne muscular dystrophy

PubMed Central

Bengtsson, Niclas E.; Hall, John K.; Odom, Guy L.; Phelps, Michael P.; Andrus, Colin R.; Hawkins, R. David; Hauschka, Stephen D.; Chamberlain, Joel R.; Chamberlain, Jeffrey S.

2017-01-01

Gene replacement therapies utilizing adeno-associated viral (AAV) vectors hold great promise for treating Duchenne muscular dystrophy (DMD). A related approach uses AAV vectors to edit specific regions of the DMD gene using CRISPR/Cas9. Here we develop multiple approaches for editing the mutation in dystrophic mdx4cv mice using single and dual AAV vector delivery of a muscle-specific Cas9 cassette together with single-guide RNA cassettes and, in one approach, a dystrophin homology region to fully correct the mutation. Muscle-restricted Cas9 expression enables direct editing of the mutation, multi-exon deletion or complete gene correction via homologous recombination in myogenic cells. Treated muscles express dystrophin in up to 70% of the myogenic area and increased force generation following intramuscular delivery. Furthermore, systemic administration of the vectors results in widespread expression of dystrophin in both skeletal and cardiac muscles. Our results demonstrate that AAV-mediated muscle-specific gene editing has significant potential for therapy of neuromuscular disorders. PMID:28195574

Mifepristone-inducible transgene expression in neural progenitor cells in vitro and in vivo

PubMed Central

Hjelm, BE; Grunseich, C; Gowing, G; Avalos, P; Tian, J; Shelley, BC; Mooney, M; Narwani, K; Shi, Y; Svendsen, CN; Wolfe, JH; Fischbeck, KH; Pierson, TM

2016-01-01

Numerous gene and cell therapy strategies are being developed for the treatment of neurodegenerative disorders. Many of these strategies use constitutive expression of therapeutic transgenic proteins, and although functional in animal models of disease, this method is less likely to provide adequate flexibility for delivering therapy to humans. Ligand-inducible gene expression systems may be more appropriate for these conditions, especially within the central nervous system (CNS). Mifepristone’s ability to cross the blood–brain barrier makes it an especially attractive ligand for this purpose. We describe the production of a mifepristone-inducible vector system for regulated expression of transgenes within the CNS. Our inducible system used a lentivirus-based vector platform for the ex vivo production of mifepristone-inducible murine neural progenitor cells that express our transgenes of interest. These cells were processed through a series of selection steps to ensure that the cells exhibited appropriate transgene expression in a dose-dependent and temporally controlled manner with minimal background activity. Inducible cells were then transplanted into the brains of rodents, where they exhibited appropriate mifepristone-inducible expression. These studies detail a strategy for regulated expression in the CNS for use in the development of safe and efficient gene therapy for neurological disorders. PMID:26863047

An experimental system for the evaluation of retroviral vector design to diminish the risk for proto-oncogene activation

PubMed Central

Ryu, Byoung Y.; Evans-Galea, Marguerite V.; Gray, John T.; Bodine, David M.; Persons, Derek A.

2008-01-01

Pathogenic activation of the LMO2 proto-oncogene by an oncoretroviral vector insertion in a clinical trial for X-linked severe combined immunodeficiency (X-SCID) has prompted safety concerns. We used an adeno-associated virus vector to achieve targeted insertion of a γ-retroviral long terminal repeat (LTR) driving a GFP expression cassette with flanking loxP sites in a human T-cell line at the precise location of vector integration in one of the patients with X-SCID. The LTR-GFP cassette was inserted into the first intron of the LMO2 gene, resulting in strong activation of LMO2. Cre-mediated cassette exchange was used to replace the original LTR-GFP cassette with one flanked by insulator elements leading to a several fold reduction in LMO2 expression. The LTR-GFP cassette was also replaced with a globin gene regulatory cassette that failed to activate the LMO2 gene in lymphoid cells. A γ-retroviral vector with 2 intact LTRs resulted in activation of the LMO2 gene when inserted into the first intron, but a self-inactivating lentiviral vector with an internal cellular promoter and flanking insulator elements did not activate the LMO2 gene. Thus, this system is useful for comparing the safety profiles of vector cassettes with various regulatory elements for their potential for proto-oncogene activation. PMID:17991809

Administration of helper-dependent adenoviral vectors and sequential delivery of different vector serotype for long-term liver-directed gene transfer in baboons

PubMed Central

Morral, Núria; O’Neal, Wanda; Rice, Karen; Leland, Michele; Kaplan, Johanne; Piedra, Pedro A.; Zhou, Heshan; Parks, Robin J.; Velji, Rizwan; Aguilar-Córdova, Estuardo; Wadsworth, Samuel; Graham, Frank L.; Kochanek, Stefan; Carey, K. Dee; Beaudet, Arthur L.

1999-01-01

The efficiency of first-generation adenoviral vectors as gene delivery tools is often limited by the short duration of transgene expression, which can be related to immune responses and to toxic effects of viral proteins. In addition, readministration is usually ineffective unless the animals are immunocompromised or a different adenovirus serotype is used. Recently, adenoviral vectors devoid of all viral coding sequences (helper-dependent or gutless vectors) have been developed to avoid expression of viral proteins. In mice, liver-directed gene transfer with AdSTK109, a helper-dependent adenoviral (Ad) vector containing the human α1-antitrypsin (hAAT) gene, resulted in sustained expression for longer than 10 months with negligible toxicity to the liver. In the present report, we have examined the duration of expression of AdSTK109 in the liver of baboons and compared it to first-generation vectors expressing hAAT. Transgene expression was limited to approximately 3–5 months with the first-generation vectors. In contrast, administration of AdSTK109 resulted in transgene expression for longer than a year in two of three baboons. We have also investigated the feasibility of circumventing the humoral response to the virus by sequential administration of vectors of different serotypes. We found that the ineffectiveness of readministration due to the humoral response to an Ad5 first-generation vector was overcome by use of an Ad2-based vector expressing hAAT. These data suggest that long-term expression of transgenes should be possible by combining the reduced immunogenicity and toxicity of helper-dependent vectors with sequential delivery of vectors of different serotypes. PMID:10536005

New Recombinant Mycobacterium bovis BCG Expression Vectors: Improving Genetic Control over Mycobacterial Promoters.

PubMed

Kanno, Alex I; Goulart, Cibelly; Rofatto, Henrique K; Oliveira, Sergio C; Leite, Luciana C C; McFadden, Johnjoe

2016-04-01

The expression of many antigens, stimulatory molecules, or even metabolic pathways in mycobacteria such as Mycobacterium bovis BCG or M. smegmatis was made possible through the development of shuttle vectors, and several recombinant vaccines have been constructed. However, gene expression in any of these systems relied mostly on the selection of natural promoters expected to provide the required level of expression by trial and error. To establish a systematic selection of promoters with a range of strengths, we generated a library of mutagenized promoters through error-prone PCR of the strong PL5 promoter, originally from mycobacteriophage L5. These promoters were cloned upstream of the enhanced green fluorescent protein reporter gene, and recombinant M. smegmatis bacteria exhibiting a wide range of fluorescence levels were identified. A set of promoters was selected and identified as having high (pJK-F8), intermediate (pJK-B7, pJK-E6, pJK-D6), or low (pJK-C1) promoter strengths in both M. smegmatis and M. bovisBCG. The sequencing of the promoter region demonstrated that it was extensively modified (6 to 11%) in all of the plasmids selected. To test the functionality of the system, two different expression vectors were demonstrated to allow corresponding expression levels of the Schistosoma mansoni antigen Sm29 in BCG. The approach used here can be used to adjust expression levels for synthetic and/or systems biology studies or for vaccine development to maximize the immune response. Copyright © 2016 Kanno et al.

Development of an optimized tetracycline-inducible expression system to increase the accumulation of interleukin-10 in tobacco BY-2 suspension cells.

PubMed

Bortesi, Luisa; Rademacher, Thomas; Schiermeyer, Andreas; Schuster, Flora; Pezzotti, Mario; Schillberg, Stefan

2012-07-11

Plant cell suspension cultures can be used for the production of valuable pharmaceutical and industrial proteins. When the recombinant protein is secreted into the culture medium, restricting expression to a defined growth phase can improve both the quality and quantity of the recovered product by minimizing proteolytic activity. Temporal restriction is also useful for recombinant proteins whose constitutive expression affects cell growth and viability, such as viral interleukin-10 (vIL-10). We have developed a novel, tetracycline-inducible system suitable for tobacco BY-2 suspension cells which increases the yields of vIL-10. The new system is based on a binary vector that is easier to handle than conventional vectors, contains an enhanced inducible promoter and 5'-UTR to improve yields, and incorporates a constitutively-expressed visible marker gene to allow the rapid and straightforward selection of the most promising transformed clones. Stable transformation of BY-2 cells with this vector, without extensive optimization of the induction conditions, led to a 3.5 fold increase in vIL-10 levels compared to constitutive expression in the same host. We have developed an effective and straightforward molecular farming platform technology that improves both the quality and the quantity of recombinant proteins produced in plant cells, particularly those whose constitutive expression has a negative impact on plant growth and development. Although we tested the platform using vIL-10 produced in BY-2 cells, it can be applied to other host/product combinations and is also useful for basic research requiring strictly controlled transgene expression.

A regulatory sequence from the retinoid X receptor γ gene directs expression to horizontal cells and photoreceptors in the embryonic chicken retina.

PubMed

Blixt, Maria K E; Hallböök, Finn

2016-01-01

Combining techniques of episomal vector gene-specific Cre expression and genomic integration using the piggyBac transposon system enables studies of gene expression-specific cell lineage tracing in the chicken retina. In this work, we aimed to target the retinal horizontal cell progenitors. A 208 bp gene regulatory sequence from the chicken retinoid X receptor γ gene (RXRγ208) was used to drive Cre expression. RXRγ is expressed in progenitors and photoreceptors during development. The vector was combined with a piggyBac "donor" vector containing a floxed STOP sequence followed by enhanced green fluorescent protein (EGFP), as well as a piggyBac helper vector for efficient integration into the host cell genome. The vectors were introduced into the embryonic chicken retina with in ovo electroporation. Tissue electroporation targets specific developmental time points and in specific structures. Cells that drove Cre expression from the regulatory RXRγ208 sequence excised the floxed STOP-sequence and expressed GFP. The approach generated a stable lineage with robust expression of GFP in retinal cells that have activated transcription from the RXRγ208 sequence. Furthermore, GFP was expressed in cells that express horizontal or photoreceptor markers when electroporation was performed between developmental stages 22 and 28. Electroporation of a stage 12 optic cup gave multiple cell types in accordance with RXRγ gene expression in the early retina. In this study, we describe an easy, cost-effective, and time-efficient method for testing regulatory sequences in general. More specifically, our results open up the possibility for further studies of the RXRγ-gene regulatory network governing the formation of photoreceptor and horizontal cells. In addition, the method presents approaches to target the expression of effector genes, such as regulators of cell fate or cell cycle progression, to these cells and their progenitor.

Transforming Lepidopteran Insect Cells for Improved Protein Processing and Expression

USDA-ARS?s Scientific Manuscript database

The lepidopteran insect cells used with the baculovirus expression vector system (BEVS) are capable of synthesizing and accurately processing foreign proteins. However, proteins expressed in baculovirus-infected cells often fail to be completely processed, or are not processed in a manner that meet...

Chapter 15. transforming lepidopteran insect cells for continuous recombinant protein expression

USDA-ARS?s Scientific Manuscript database

The baculovirus expression vector system (BEVS) is widely used to produce large quantities of recombinant proteins. However, yields of extracellular and membrane-bound proteins obtained with this system often are very low, possibly due to the adverse effects of baculovirus infection on the host ins...

Improving the Transduction of Bone Marrow–Derived Cells with an Integrase-Defective Lentiviral Vector

PubMed Central

Pay, S. Louise; Qi, Xiaoping; Willard, Jeffrey F.; Godoy, Juliana; Sankhavaram, Kavya; Horton, Ranier; Mitter, Sayak K.; Quigley, Judith L.; Chang, Lung-Ji; Grant, Maria B.; Boulton, Michael E.

2018-01-01

In lentiviral vector (LV) applications where transient transgene expression is sufficient, integrase-defective lentiviral vectors (IDLVs) are beneficial for reducing the potential for off-target effects associated with insertional mutagenesis. It was previously demonstrated that human RPE65 mRNA expression from an integrating lentiviral vector (ILV) induces endogenous Rpe65 and Cralbp mRNA expression in murine bone marrow–derived cells (BMDCs), initiating programming of the cells to retinal pigment epithelium (RPE)-like cells. These cells regenerate RPE in retinal degeneration models when injected systemically. As transient expression of RPE65 is sufficient to activate endogenous RPE-associated genes for programming BMDCs, use of an ILV is an unnecessary risk. In this study, an IDLV expressing RPE65 (IDLV3-RPE65) was generated. Transduction with IDLV3-RPE65 is less efficient than the integrating vector (ILV3-RPE65). Therefore, IDLV3-RPE65 transduction was enhanced with a combination of preloading 20 × -concentrated viral supernatant on RetroNectin at a multiplicity of infection of 50 and transduction of BMDCs by low-speed centrifugation. RPE65 mRNA levels increased from ∼12-fold to ∼25-fold (p < 0.05) after modification of the IDLV3-RPE65 transduction protocol, achieving expression similar to the ∼27-fold (p < 0.05) increase observed with ILV3-RPE65. Additionally, the study shows that the same preparation of RetroNectin can be used to coat up to three wells with no reduction in transduction. Critically, IDLV3-RPE65 transduction initiates endogenous Rpe65 mRNA expression in murine BMDCs and Cralbp/CRALBP mRNA in both murine and human BMDCs, similar to expression observed in ILV3-RPE65-transduced cells. Systemic administration of ILV3-RPE65 or IDLV3-RPE65 programmed BMDCs in a mouse model of retinal degeneration is sufficient to retain visual function and reduce retinal degeneration compared to mice receiving no treatment or naïve BMDC. It is concluded that IDLV3-RPE65 is appropriate for programming BMDCs to RPE-like cells. PMID:29160102

The Development of a Viral Mediated CRISPR/Cas9 System with Doxycycline Dependent gRNA Expression for Inducible In vitro and In vivo Genome Editing

PubMed Central

de Solis, Christopher A.; Ho, Anthony; Holehonnur, Roopashri; Ploski, Jonathan E.

2016-01-01

The RNA-guided Cas9 nuclease, from the type II prokaryotic Clustered Regularly Interspersed Short Palindromic Repeats (CRISPR) adaptive immune system, has been adapted and utilized by scientists to edit the genomes of eukaryotic cells. Here, we report the development of a viral mediated CRISPR/Cas9 system that can be rendered inducible utilizing doxycycline (Dox) and can be delivered to cells in vitro and in vivo utilizing adeno-associated virus (AAV). Specifically, we developed an inducible gRNA (gRNAi) AAV vector that is designed to express the gRNA from a H1/TO promoter. This AAV vector is also designed to express the Tet repressor (TetR) to regulate the expression of the gRNAi in a Dox dependent manner. We show that H1/TO promoters of varying length and a U6/TO promoter can edit DNA with similar efficiency in vitro, in a Dox dependent manner. We also demonstrate that our inducible gRNAi vector can be used to edit the genomes of neurons in vivo within the mouse brain in a Dox dependent manner. Genome editing can be induced in vivo with this system by supplying animals Dox containing food for as little as 1 day. This system might be cross compatible with many existing S. pyogenes Cas9 systems (i.e., Cas9 mouse, CRISPRi, etc.), and therefore it likely can be used to render these systems inducible as well. PMID:27587996

Elucidating the Potential of Plant Rhabdoviruses as Vector Expressions Systems

USDA-ARS?s Scientific Manuscript database

Maize fine streak virus (MFSV) is a member of the genus Nucleorhabdovirus that is transmitted by the leafhopper Graminella nigrifons. The virus replicates in both its maize host and its insect vector. To determine whether Drosophila S2 cells support the production of full-length MFSV proteins, we ...

Expression of short hairpin RNAs using the compact architecture of retroviral microRNA genes.

PubMed

Burke, James M; Kincaid, Rodney P; Aloisio, Francesca; Welch, Nicole; Sullivan, Christopher S

2017-09-29

Short hairpin RNAs (shRNAs) are effective in generating stable repression of gene expression. RNA polymerase III (RNAP III) type III promoters (U6 or H1) are typically used to drive shRNA expression. While useful for some knockdown applications, the robust expression of U6/H1-driven shRNAs can induce toxicity and generate heterogeneous small RNAs with undesirable off-target effects. Additionally, typical U6/H1 promoters encompass the majority of the ∼270 base pairs (bp) of vector space required for shRNA expression. This can limit the efficacy and/or number of delivery vector options, particularly when delivery of multiple gene/shRNA combinations is required. Here, we develop a compact shRNA (cshRNA) expression system based on retroviral microRNA (miRNA) gene architecture that uses RNAP III type II promoters. We demonstrate that cshRNAs coded from as little as 100 bps of total coding space can precisely generate small interfering RNAs (siRNAs) that are active in the RNA-induced silencing complex (RISC). We provide an algorithm with a user-friendly interface to design cshRNAs for desired target genes. This cshRNA expression system reduces the coding space required for shRNA expression by >2-fold as compared to the typical U6/H1 promoters, which may facilitate therapeutic RNAi applications where delivery vector space is limiting. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants.

PubMed

Lukan, Tjaša; Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

2018-01-01

Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science.

Plant X-tender: An extension of the AssemblX system for the assembly and expression of multigene constructs in plants

PubMed Central

Machens, Fabian; Coll, Anna; Baebler, Špela; Messerschmidt, Katrin; Gruden, Kristina

2018-01-01

Cloning multiple DNA fragments for delivery of several genes of interest into the plant genome is one of the main technological challenges in plant synthetic biology. Despite several modular assembly methods developed in recent years, the plant biotechnology community has not widely adopted them yet, probably due to the lack of appropriate vectors and software tools. Here we present Plant X-tender, an extension of the highly efficient, scar-free and sequence-independent multigene assembly strategy AssemblX, based on overlap-depended cloning methods and rare-cutting restriction enzymes. Plant X-tender consists of a set of plant expression vectors and the protocols for most efficient cloning into the novel vector set needed for plant expression and thus introduces advantages of AssemblX into plant synthetic biology. The novel vector set covers different backbones and selection markers to allow full design flexibility. We have included ccdB counterselection, thereby allowing the transfer of multigene constructs into the novel vector set in a straightforward and highly efficient way. Vectors are available as empty backbones and are fully flexible regarding the orientation of expression cassettes and addition of linkers between them, if required. We optimised the assembly and subcloning protocol by testing different scar-less assembly approaches: the noncommercial SLiCE and TAR methods and the commercial Gibson assembly and NEBuilder HiFi DNA assembly kits. Plant X-tender was applicable even in combination with low efficient homemade chemically competent or electrocompetent Escherichia coli. We have further validated the developed procedure for plant protein expression by cloning two cassettes into the newly developed vectors and subsequently transferred them to Nicotiana benthamiana in a transient expression setup. Thereby we show that multigene constructs can be delivered into plant cells in a streamlined and highly efficient way. Our results will support faster introduction of synthetic biology into plant science. PMID:29300787

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3.

PubMed

Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping

2015-08-15

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

An Update on Canine Adenovirus Type 2 and Its Vectors

PubMed Central

Bru, Thierry; Salinas, Sara; Kremer, Eric J.

2010-01-01

Adenovirus vectors have significant potential for long- or short-term gene transfer. Preclinical and clinical studies using human derived adenoviruses (HAd) have demonstrated the feasibility of flexible hybrid vector designs, robust expression and induction of protective immunity. However, clinical use of HAd vectors can, under some conditions, be limited by pre-existing vector immunity. Pre-existing humoral and cellular anti-capsid immunity limits the efficacy and duration of transgene expression and is poorly circumvented by injections of larger doses and immuno-suppressing drugs. This review updates canine adenovirus serotype 2 (CAV-2, also known as CAdV-2) biology and gives an overview of the generation of early region 1 (E1)-deleted to helper-dependent (HD) CAV-2 vectors. We also summarize the essential characteristics concerning their interaction with the anti-HAd memory immune responses in humans, the preferential transduction of neurons, and its high level of retrograde axonal transport in the central and peripheral nervous system. CAV-2 vectors are particularly interesting tools to study the pathophysiology and potential treatment of neurodegenerative diseases, as anti-tumoral and anti-viral vaccines, tracer of synaptic junctions, oncolytic virus and as a platform to generate chimeric vectors. PMID:21994722

Inhibition of histone deacetylation and DNA methylation improves gene expression mediated by the adeno-associated virus/phage in cancer cells.

PubMed

Kia, Azadeh; Yata, Teerapong; Hajji, Nabil; Hajitou, Amin

2013-10-22

Bacteriophage (phage), viruses that infect bacteria only, have become promising vectors for targeted systemic delivery of genes to cancer, although, with poor efficiency. We previously designed an improved phage vector by incorporating cis genetic elements of adeno-associated virus (AAV). This novel AAV/phage hybrid (AAVP) specifically targeted systemic delivery of therapeutic genes into tumors. To advance the AAVP vector, we recently introduced the stress-inducible Grp78 tumor specific promoter and found that this dual tumor-targeted AAVP provides persistent gene expression, over time, in cancer cells compared to silenced gene expression from the CMV promoter in the parental AAVP. Herein, we investigated the effect of histone deacetylation and DNA methylation on AAVP-mediated gene expression in cancer cells and explored the effect of cell confluence state on AAVP gene expression efficacy. Using a combination of AAVP expressing the GFP reporter gene, flow cytometry, inhibitors of histone deacetylation, and DNA methylation, we have demonstrated that histone deacetylation and DNA methylation are associated with silencing of gene expression from the CMV promoter in the parental AAVP. Importantly, inhibitors of histone deacetylases boost gene expression in cancer cells from the Grp78 promoter in the dual tumor-targeted AAVP. However, cell confluence had no effect on AAVP-guided gene expression. Our findings prove that combination of histone deacetylase inhibitor drugs with the Grp78 promoter is an effective approach to improve AAVP-mediated gene expression in cancer cells and should be considered for AAVP-based clinical cancer gene therapy.

Vector modifications to eliminate transposase expression following piggyBac-mediated transgenesis

PubMed Central

Chakraborty, Syandan; Ji, HaYeun; Chen, Jack; Gersbach, Charles A.; Leong, Kam W.

2014-01-01

Transgene insertion plays an important role in gene therapy and in biological studies. Transposon-based systems that integrate transgenes by transposase-catalyzed “cut-and-paste” mechanism have emerged as an attractive system for transgenesis. Hyperactive piggyBac transposon is particularly promising due to its ability to integrate large transgenes with high efficiency. However, prolonged expression of transposase can become a potential source of genotoxic effects due to uncontrolled transposition of the integrated transgene from one chromosomal locus to another. In this study we propose a vector design to decrease post-transposition expression of transposase and to eliminate the cells that have residual transposase expression. We design a single plasmid construct that combines the transposase and the transpositioning transgene element to share a single polyA sequence for termination. Consequently, the separation of the transposase element from the polyA sequence after transposition leads to its deactivation. We also co-express Herpes Simplex Virus thymidine kinase (HSV-tk) with the transposase. Therefore, cells having residual transposase expression can be eliminated by the administration of ganciclovir. We demonstrate the utility of this combination transposon system by integrating and expressing a model therapeutic gene, human coagulation Factor IX, in HEK293T cells. PMID:25492703

Recombinant adeno-associated virus targets passenger gene expression to cones in primate retina

NASA Astrophysics Data System (ADS)

Mancuso, Katherine; Hendrickson, Anita E.; Connor, Thomas B., Jr.; Mauck, Matthew C.; Kinsella, James J.; Hauswirth, William W.; Neitz, Jay; Neitz, Maureen

2007-05-01

Recombinant adeno-associated virus (rAAV) is a promising vector for gene therapy of photoreceptor-based diseases. Previous studies have demonstrated that rAAV serotypes 2 and 5 can transduce both rod and cone photoreceptors in rodents and dogs, and it can target rods, but not cones in primates. Here we report that using a human cone-specific enhancer and promoter to regulate expression of a green fluorescent protein (GFP) reporter gene in an rAAV-5 vector successfully targeted expression of the reporter gene to primate cones, and the time course of GFP expression was able to be monitored in a living animal using the RetCam II digital imaging system.

Recent tissue engineering-based advances for effective rAAV-mediated gene transfer in the musculoskeletal system.

PubMed

Rey-Rico, Ana; Cucchiarini, Magali

2016-04-01

Musculoskeletal tissues are diverse and significantly different in their ability to repair upon injury. Current treatments often fail to reproduce the natural functions of the native tissue, leading to an imperfect healing. Gene therapy might improve the repair of tissues by providing a temporarily and spatially defined expression of the therapeutic gene(s) at the site of the injury. Several gene transfer vehicles have been developed to modify various human cells and tissues from musculoskeletal system among which the non-pathogenic, effective, and relatively safe recombinant adeno-associated viral (rAAV) vectors that have emerged as the preferred gene delivery system to treat human disorders. Adapting tissue engineering platforms to gene transfer approaches mediated by rAAV vectors is an attractive tool to circumvent both the limitations of the current therapeutic options to promote an effective healing of the tissue and the natural obstacles from these clinically adapted vectors to achieve an efficient and durable gene expression of the therapeutic sequences within the lesions.

A novel expression system for intracellular production and purification of recombinant affinity-tagged proteins in Aspergillus niger.

PubMed

Roth, Andreas H F J; Dersch, Petra

2010-03-01

A set of different integrative expression vectors for the intracellular production of recombinant proteins with or without affinity tag in Aspergillus niger was developed. Target genes can be expressed under the control of the highly efficient, constitutive pkiA promoter or the novel sucrose-inducible promoter of the beta-fructofuranosidase (sucA) gene of A. niger in the presence or absence of alternative carbon sources. All expression plasmids contain an identical multiple cloning sequence that allows parallel construction of N- or C-terminally His6- and StrepII-tagged versions of the target proteins. Production of two heterologous model proteins, the green fluorescence protein and the Thermobifida fusca hydrolase, proved the functionality of the vector system. Efficient production and easy detection of the target proteins as well as their fast purification by a one-step affinity chromatography, using the His6- or StrepII-tag sequence, was demonstrated.

NUDTSNA at TREC 2015 Microblog Track: A Live Retrieval System Framework for Social Network based on Semantic Expansion and Quality Model

DTIC Science & Technology

2015-11-20

between tweets and profiles as follow, • TFIDF Score, which calculates the cosine similarity between a tweet and a profile in vector space model with...TFIDF weight of terms. Vector space model is a model which represents a document as a vector. Tweets and profiles can be expressed as vectors, ~ T = (t...gain(Tr i ) (13) where Tr is the returned tweet sets, gain() is the score func- tion for a tweet. Not interesting, spam/ junk tweets receive a gain of 0

An efficient transgenic system by TA cloning vectors and RNAi for C. elegans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gengyo-Ando, Keiko; CREST, JST, 4-1-8 Hon-cho, Kawaguchi, Saitama 332-0012; Yoshina, Sawako

2006-11-03

In the nematode, transgenic analyses have been performed by microinjection of DNA from various sources into the syncytium gonad. To expedite these transgenic analyses, we solved two potential problems in this work. First, we constructed an efficient TA-cloning vector system which is useful for any promoter. By amplifying the genomic DNA fragments which contain regulatory sequences with or without the coding region, we could easily construct plasmids expressing fluorescent protein fusion without considering restriction sites. We could dissect motor neurons with three colors in a single animal. Second, we used feeding RNAi to isolate transgenic strains which express lag-2::venus fusionmore » gene. We found that the fusion protein is toxic when ectopically expressed in embryos but is functional to rescue a loss of function mutant in the lag-2 gene. Thus, the transgenic system described here should be useful to examine the protein function in the nematode.« less

A Vector with a Single Promoter for In Vitro Transcription and Mammalian Cell Expression of CRISPR gRNAs.

PubMed

Romanienko, Peter J; Giacalone, Joseph; Ingenito, Joanne; Wang, Yijie; Isaka, Mayumi; Johnson, Thomas; You, Yun; Mark, Willie H

2016-01-01

The genomes of more than 50 organisms have now been manipulated due to rapid advancement of gene editing technology. One way to perform gene editing in the mouse using the CRISPR/CAS system, guide RNA (gRNA) and CAS9 mRNA transcribed in vitro are microinjected into fertilized eggs that are then allowed to develop to term. As a rule, gRNAs are tested first in tissue culture cells and the one with the highest locus-specific cleavage activity is chosen for microinjection. For cell transfections, gRNAs are typically expressed using the human U6 promoter (hU6). However, gRNAs for microinjection into zygotes are obtained by in vitro transcription from a T7 bacteriophage promoter in a separate plasmid vector. Here, we describe the design and construction of a combined U6T7 hybrid promoter from which the same gRNA sequence can be expressed. An expression vector containing such a hybrid promoter can now be used to generate gRNA for testing in mammalian cells as well as for microinjection purposes. The gRNAs expressed and transcribed from this vector are found to be functional in cells as well as in mice.

Recombinant Human Parvovirus B19 Vectors: Erythroid Cell-Specific Delivery and Expression of Transduced Genes

PubMed Central

Ponnazhagan, Selvarangan; Weigel, Kirsten A.; Raikwar, Sudhanshu P.; Mukherjee, Pinku; Yoder, Mervin C.; Srivastava, Arun

1998-01-01

A novel packaging strategy combining the salient features of two human parvoviruses, namely the pathogenic parvovirus B19 and the nonpathogenic adeno-associated virus type 2 (AAV), was developed to achieve erythroid cell-specific delivery as well as expression of the transduced gene. The development of such a chimeric vector system was accomplished by packaging heterologous DNA sequences cloned within the inverted terminal repeats of AAV and subsequently packaging the DNA inside the capsid structure of B19 virus. Recombinant B19 virus particles were assembled, as evidenced by electron microscopy as well as DNA slot blot analyses. The hybrid vector failed to transduce nonerythroid human cells, such as 293 cells, as expected. However, MB-02 cells, a human megakaryocytic leukemia cell line which can be infected by B19 virus following erythroid differentiation with erythropoietin (N. C. Munshi, S. Z. Zhou, M. J. Woody, D. A. Morgan, and A. Srivastava, J. Virol. 67:562–566, 1993) but lacks the putative receptor for AAV (S. Ponnazhagan, X.-S. Wang, M. J. Woody, F. Luo, L. Y. Kang, M. L. Nallari, N. C. Munshi, S. Z. Zhou, and A. Srivastava, J. Gen. Virol. 77:1111–1122, 1996), were readily transduced by this vector. The hybrid vector was also found to specifically target the erythroid population in primary human bone marrow cells as well as more immature hematopoietic progenitor cells following erythroid differentiation, as evidenced by selective expression of the transduced gene in these target cells. Preincubation with anticapsid antibodies against B19 virus, but not anticapsid antibodies against AAV, inhibited transduction of primary human erythroid cells. The efficiency of transduction of primary human erythroid cells by the recombinant B19 virus vector was significantly higher than that by the recombinant AAV vector. Further development of the AAV-B19 virus hybrid vector system should prove beneficial in gene therapy protocols aimed at the correction of inherited and acquired human diseases affecting cells of erythroid lineage. PMID:9573295

Risk-managed production of bioactive recombinant proteins using a novel plant virus vector with a helper plant to complement viral systemic movement.

PubMed

Fukuzawa, Noriho; Ishihara, Takeaki; Itchoda, Noriko; Tabayashi, Noriko; Kataoka, Chiwa; Masuta, Chikara; Matsumura, Takeshi

2011-01-01

A plant viral vector has the potential to efficiently produce recombinant proteins at a low cost in a short period. Although recombinant proteins can be also produced by transgenic plants, a plant viral vector, if available, may be more convenient when urgent scale-up in production is needed. However, it is difficult to use a viral vector in open fields because of the risk of escape to the environment. In this study, we constructed a novel viral vector system using a movement-defective Cucumber mosaic virus (CMV) vector, which is theoretically localized in the inoculated cells but infects systemically only with the aid of the transgenic helper plant that complements viral movement, diminishing the risk of viral proliferation. Interestingly, the helper plant systemically infected with the vector gave strong cross-protection against challenge inoculation with wild-type CMVs. Using CMV strains belonging to two discrete CMV groups (subgroups I and II), we also improved the system to prevent recombination between the vector and the transgene transcript in the helper plant. We here demonstrate the expression of an anti-dioxin single chain variable fragment (DxscFv) and interleukin-1 receptor antagonist (IL1-Ra) in Nicotiana benthamiana by this viral vector confinement system, which is applicable for many useful high-quality recombinant proteins. © 2010 The Authors. Plant Biotechnology Journal © 2010 Society for Experimental Biology and Blackwell Publishing Ltd.

Utilization of Virus ϕCh1 Elements To Establish a Shuttle Vector System for Halo(alkali)philic Archaea via Transformation of Natrialba magadii

PubMed Central

Mayrhofer-Iro, M.; Ladurner, A.; Meissner, C.; Derntl, C.; Reiter, M.; Haider, F.; Dimmel, K.; Rössler, N.; Klein, R.; Baranyi, U.; Scholz, H.

2013-01-01

In the study described here, we successfully developed a transformation system for halo(alkali)philic members of the Archaea. This transformation system comprises a series of Natrialba magadii/Escherichia coli shuttle vectors based on a modified method to transform halophilic members of the Archaea and genomic elements of the N. magadii virus ϕCh1. The shuttle vector pRo-5, based on the repH-containing region of ϕCh1, stably replicated in E. coli and N. magadii and in several halophilic and haloalkaliphilic members of the Archaea not transformable so far. The ϕCh1 operon ORF53/ORF54 (repH) was essential for pRo-5 replication and was thus identified as the minimal replication origin. The plasmid allowed homologous and heterologous gene expression, as exemplified by the expression of ϕCh1 ORF3452, which encodes a structural protein, and the reporter gene bgaH of Haloferax lucentense in N. magadii. The new transformation/vector system will facilitate genetic studies within N. magadii and other haloalkaliphilic archaea and will allow the detailed characterization of the gene functions of N. magadii virus ϕCh1 in their extreme environments. PMID:23416999

Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro

P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNAmore » expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. -- Highlights: •Adenovirus vector infection induced P-gp mRNA expression in three NSCLC cell lines. •Adenovirus vector infection enhanced P-gp-mediated doxorubicin efflux from the cells. •The increase of P-gp was not mediated by nuclear receptors (PXR, CAR) or COX-2.« less

A Novel Dual Expression Platform for High Throughput Functional Screening of Phage Libraries in Product like Format.

PubMed

Xiao, Xiaodong; Chen, Yan; Mugabe, Sheila; Gao, Changshou; Tkaczyk, Christine; Mazor, Yariv; Pavlik, Peter; Wu, Herren; Dall'Acqua, William; Chowdhury, Partha Sarathi

2015-01-01

High throughput screenings of single chain Fv (scFv) antibody phage display libraries are currently done as soluble scFvs produced in E.coli. Due to endotoxin contaminations from bacterial cells these preparations cannot be reliably used in mammalian cell based assays. The monovalent nature and lack of Fc in soluble scFvs prevent functional assays that are dependent on target cross linking and/or Fc functions. A convenient approach is to convert scFvs into scFv.Fc fusion proteins and express them in mammalian cell lines for screening. This approach is low throughput and is only taken after primary screening of monovalent scFvs that are expressed in bacteria. There is no platform at present that combines the benefits of both bacterial and mammalian expression system for screening phage library output. We have, therefore, developed a novel dual expression vector, called pSplice, which can be used to express scFv.Fc fusion proteins both in E.coli and mammalian cell lines. The hallmark of the vector is an engineered intron which houses the bacterial promoter and signal peptide for expression and secretion of scFv.Fc in E.coli. When the vector is transfected into a mammalian cell line, the intron is efficiently spliced out resulting in a functional operon for expression and secretion of the scFv.Fc fusion protein into the culture medium. By applying basic knowledge of mammalian introns and splisosome, we designed this vector to enable screening of phage libraries in a product like format. Like IgG, the scFv.Fc fusion protein is bi-valent for the antigen and possesses Fc effector functions. Expression in E.coli maintains the speed of the bacterial expression platform and is used to triage clones based on binding and other assays that are not sensitive to endotoxin. Triaged clones are then expressed in a mammalian cell line without the need for any additional cloning steps. Conditioned media from the mammalian cell line containing the fusion proteins are then used for different types of cell based assays. Thus this system retains the speed of the current screening system for phage libraries and adds additional functionality to it.

Efficient mouse airway transduction following recombination between AAV vectors carrying parts of a larger gene.

PubMed

Halbert, Christine L; Allen, James M; Miller, A Dusty

2002-07-01

The small packaging capacity of adeno-associated virus (AAV) vectors limits the utility of this promising vector system for transfer of large genes. We explored the possibility that larger genes could be reconstituted following homologous recombination between AAV vectors carrying overlapping gene fragments. An alkaline phosphatase (AP) gene was split between two such AAV vectors (rec vectors) and packaged using AAV2 or AAV6 capsid proteins. Rec vectors having either capsid protein recombined to express AP in cultured cells at about 1-2% of the rate observed for an intact vector. Surprisingly, the AAV6 rec vectors transduced lung cells in mice almost as efficiently as did an intact vector, with 10% of airway epithelial cells, the target for treatment of cystic fibrosis (CF), being positive. Thus AAV rec vectors may be useful for diseases such as CF that require transfer of large genes.

A Multipurpose Toolkit to Enable Advanced Genome Engineering in Plants[OPEN

PubMed Central

Gil-Humanes, Javier; Čegan, Radim; Kono, Thomas J.Y.; Konečná, Eva; Belanto, Joseph J.; Starker, Colby G.

2017-01-01

We report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on transcription activator-like effector nucleases (TALENs) and the clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A Web-based tool streamlines vector selection and construction. One advantage of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 (Csy4) and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing 12 gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare). PMID:28522548

A multi-purpose toolkit to enable advanced genome engineering in plants

DOE PAGES

Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier; ...

2017-05-18

Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

A multi-purpose toolkit to enable advanced genome engineering in plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cermak, Tomas; Curtin, Shaun J.; Gil-Humanes, Javier

Here, we report a comprehensive toolkit that enables targeted, specific modification of monocot and dicot genomes using a variety of genome engineering approaches. Our reagents, based on Transcription Activator-Like Effector Nucleases TALENs and the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system, are systematized for fast, modular cloning and accommodate diverse regulatory sequences to drive reagent expression. Vectors are optimized to create either single or multiple gene knockouts and large chromosomal deletions. Moreover, integration of geminivirus-based vectors enables precise gene editing through homologous recombination. Regulation of transcription is also possible. A web-based tool streamlines vector selection and construction. One advantagemore » of our platform is the use of the Csy-type (CRISPR system yersinia) ribonuclease 4 Csy4 and tRNA processing enzymes to simultaneously express multiple guide RNAs (gRNAs). For example, we demonstrate targeted deletions in up to six genes by expressing twelve gRNAs from a single transcript. Csy4 and tRNA expression systems are almost twice as effective in inducing mutations as gRNAs expressed from individual RNA polymerase III promoters. Mutagenesis can be further enhanced 2.5-fold by incorporating the Trex2 exonuclease. Finally, we demonstrate that Cas9 nickases induce gene targeting at frequencies comparable to native Cas9 when they are delivered on geminivirus replicons. The reagents have been successfully validated in tomato (Solanum lycopersicum), tobacco (Nicotiana tabacum), Medicago truncatula, wheat (Triticum aestivum), and barley (Hordeum vulgare).« less

CRISPR/Cas9 delivery with one single adenoviral vector devoid of all viral genes.

PubMed

Ehrke-Schulz, Eric; Schiwon, Maren; Leitner, Theo; Dávid, Stephan; Bergmann, Thorsten; Liu, Jing; Ehrhardt, Anja

2017-12-07

The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR)/Cas9 system revolutionized the field of gene editing but viral delivery of the CRISPR/Cas9 system has not been fully explored. Here we adapted clinically relevant high-capacity adenoviral vectors (HCAdV) devoid of all viral genes for the delivery of the CRISPR/Cas9 machinery using a single viral vector. We present a platform enabling fast transfer of the Cas9 gene and gRNA expression units into the HCAdV genome including the option to choose between constitutive or inducible Cas9 expression and gRNA multiplexing. Efficacy and versatility of this pipeline was exemplified by producing different CRISPR/Cas9-HCAdV targeting the human papillomavirus (HPV) 18 oncogene E6, the dystrophin gene causing Duchenne muscular dystrophy (DMD) and the HIV co-receptor C-C chemokine receptor type 5 (CCR5). All CRISPR/Cas9-HCAdV proved to be efficient to deliver the respective CRISPR/Cas9 expression units and to introduce the desired DNA double strand breaks at their intended target sites in immortalized and primary cells.

Central Nervous System Delivery of Helper-Dependent Canine Adenovirus Corrects Neuropathology and Behavior in Mucopolysaccharidosis Type VII Mice

PubMed Central

Ariza, Lorena; Giménez-Llort, Lydia; Cubizolle, Aurélie; Pagès, Gemma; García-Lareu, Belén; Serratrice, Nicolas; Cots, Dan; Thwaite, Rosemary; Chillón, Miguel; Kremer, Eric J.

2014-01-01

Abstract Canine adenovirus type 2 vectors (CAV-2) are promising tools to treat global central nervous system (CNS) disorders because of their preferential transduction of neurons and efficient retrograde axonal transport. Here we tested the potential of a helper-dependent CAV-2 vector expressing β-glucuronidase (HD-RIGIE) in a mouse model of mucopolysaccharidosis type VII (MPS VII), a lysosomal storage disease caused by deficiency in β-glucuronidase activity. MPS VII leads to glycosaminoglycan accumulation into enlarged vesicles in peripheral tissues and the CNS, resulting in peripheral and neuronal dysfunction. After intracranial administration of HD-RIGIE, we show long-term expression of β-glucuronidase that led to correction of neuropathology around the injection site and in distal areas. This phenotypic correction correlated with a decrease in secondary-elevated lysosomal enzyme activity and glycosaminoglycan levels, consistent with global biochemical correction. Moreover, HD-RIGIE-treated mice show significant cognitive improvement. Thus, injections of HD-CAV-2 vectors in the brain allow a global and sustained expression and may have implications for brain therapy in patients with lysosomal storage disease. PMID:24299455

Paratransgenesis applied for control of tsetse transmitted sleeping sickness.

PubMed

Aksoy, Serap; Weiss, Brian; Attardo, Geoffrey

2008-01-01

African trypanosomiasis (sleeping sickness) is a major cause of morbidity and mortality in Subsaharan Africa for human and animal health. In the absence of effective vaccines and efficacious drugs, vector control is an alternative intervention tool to break the disease cycle. This chapter describes the vectorial and symbiotic biology of tsetse with emphasis on the current knowledge on tsetse symbiont genomics and functional biology, and tsetse's trypanosome transmission capability. The ability to culture one of tsetse's commensal symbiotic microbes, Sodalis in vitro has allowed for the development of a genetic transformation system for this organism. Tsetse can be repopulated with the modified Sodalis symbiont, which can express foreign gene products (an approach we refer to as paratransgenic expression system). Expanding knowledge on tsetse immunity effectors, on genomics of tsetse symbionts and on tsetse's parasite transmission biology stands to enhance the development and potential application of paratransgenesis as a new vector-control strategy. We describe the hallmarks of the paratransgenic transformation technology where the modified symbionts expressing trypanocidal compounds can be used to manipulate host functions and lead to the control of trypanosomiasis by blocking trypanosome transmission in the tsetse vector.

Secreted expression of Leuconostoc mesenteroides glucansucrase in Lactococcus lactis for the production of insoluble glucans

USDA-ARS?s Scientific Manuscript database

We expressed a glucansucrase, DsrI, from Leuconostoc mesenteroides that catalyzes formation of water-insoluble glucans from sucrose in Lactococcus lactis using a nisin-controlled gene expression system. Production of DsrI was optimized using several different background vectors, signal peptides, str...

Adapter-directed display: a modular design for shuttling display on phage surfaces.

PubMed

Wang, Kevin Caili; Wang, Xinwei; Zhong, Pingyu; Luo, Peter Peizhi

2010-02-05

A novel adapter-directed phage display system was developed with modular features. In this system, the target protein is expressed as a fusion protein consisting of adapter GR1 from the phagemid vector, while the recombinant phage coat protein is expressed as a fusion protein consisting of adapter GR2 in the helper phage vector. Surface display of the target protein is accomplished through specific heterodimerization of GR1 and GR2 adapters, followed by incorporation of the heterodimers into phage particles. A series of engineered helper phages were constructed to facilitate both display valency and formats, based on various phage coat proteins. As the target protein is independent of a specific phage coat protein, this modular system allows the target protein to be displayed on any given phage coat protein and allows various display formats from the same vector without the need for reengineering. Here, we demonstrate the shuttling display of a single-chain Fv antibody on phage surfaces between multivalent and monovalent formats, as well as the shuttling display of an antigen-binding fragment molecule on phage coat proteins pIII, pVII, and pVIII using the same phagemid vectors combined with different helper phage vectors. This adapter-directed display concept has been applied to eukaryotic yeast surface display and to a novel cross-species display that can shuttle between prokaryotic phage and eukaryotic yeast systems. Copyright 2009 Elsevier Ltd. All rights reserved.

Application of eGFP to label human periodontal ligament stem cells in periodontal tissue engineering.

PubMed

Wen, Yong; Lan, Jing; Huang, Haiyun; Yu, Meijiao; Cui, Jun; Liang, Jin; Jiang, Baoqi; Xu, Xin

2012-09-01

To establish human periodontal ligament stem cells (hPDLSC) with high and stable expression of enhanced green fluorescent protein (eGFP) and to obtain an ideal vector expression system that suitable for gene therapy in periodontal tissue engineering. hPDLSCs were transfected with eGFP for 48h via different MOI (25, 50, 100, 200 and 400) by lentiviral vector, the transfection efficiency was evaluated by fluorescent microscopy and flow cytometry, and transfected hPDLSCs proliferation was evaluated by MTT. Pluripotent, differentiation capacity and ALP expression status were determined further. Osteoblast-associated genes expressions for osteogenesis were evaluated by quantitative-PCR. In addition, rat molar periodontal fenestration defect model was used for evaluating periodontal tissue engineering. The transfection efficiency after 48h were 44.7%, 60.9%, 71.7%, 85.8%, and 86.9% respectively. There was no significant effect of transfection (at different MOI levels of 25, 50, 100, and 200) on the proliferation of hPDLSCs (designated as eGFP-hPDLSCs) compared with hPDLSCs (P>0.05). However, proliferation of eGFP hPDLSCs at MOI 400 became slower (P<0.05). Both eGFP hPDLSCs and hPDLSCs were able to differentiate into osteocytes and adipocytes under certain conditioned media. At 7 days, expression levels of COL-1, RUNX2 in hPDLSCS were higher than those in eGFP hPDLSCs (P<0.05); expression levels of ALP and OPN in eGFP hPDLSCs were similar to those in hPDLSCs (P>0.05). Newly regenerated bone formation was observed in the defect model used. Among the transfection conditions, 48h transfection at MOI 200 is optimal for labelling hPDLSCs with eGFP in a lentiviral vector. There is no change in capability of the eGFP hPDLSCs osteogenesis. The lentiviral vector with eGFP is an appropriate expression vector system and hPDLSCs are ideal seeding cells for gene therapy in periodontal tissue engineering. Copyright © 2012 Elsevier Ltd. All rights reserved.

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

Adenoviral Vectors Armed with Cell Fusion-Inducing Proteins as Anti-Cancer Agents

PubMed Central

Del Papa, Joshua; Parks, Robin J.

2017-01-01

Cancer is a devastating disease that affects millions of patients every year, and causes an enormous economic burden on the health care system and emotional burden on affected families. The first line of defense against solid tumors is usually extraction of the tumor, when possible, by surgical methods. In cases where solid tumors can not be safely removed, chemotherapy is often the first line of treatment. As metastatic cancers often become vigorously resistant to treatments, the development of novel, more potent and selective anti-cancer strategies is of great importance. Adenovirus (Ad) is the most commonly used virus in cancer clinical trials, however, regardless of the nature of the Ad-based therapeutic, complete responses to treatment remain rare. A number of pre-clinical studies have shown that, for all vector systems, viral spread throughout the tumor mass can be a major limiting factor for complete tumor elimination. By expressing exogenous cell-fusion proteins, many groups have shown improved spread of Ad-based vectors. This review summarizes the research done to examine the potency of Ad vectors expressing fusogenic proteins as anti-cancer therapeutics. PMID:28106842

Widespread transduction of astrocytes and neurons in the mouse central nervous system after systemic delivery of a self-complementary AAV-PHP.B vector.

PubMed

Rincon, Melvin Y; de Vin, Filip; Duqué, Sandra I; Fripont, Shelly; Castaldo, Stephanie A; Bouhuijzen-Wenger, Jessica; Holt, Matthew G

2018-04-01

Until recently, adeno-associated virus 9 (AAV9) was considered the AAV serotype most effective in crossing the blood-brain barrier (BBB) and transducing cells of the central nervous system (CNS), following systemic injection. However, a newly engineered capsid, AAV-PHP.B, is reported to cross the BBB at even higher efficiency. We investigated how much we could boost CNS transgene expression by using AAV-PHP.B carrying a self-complementary (sc) genome. To allow comparison, 6 weeks old C57BL/6 mice received intravenous injections of scAAV2/9-GFP or scAAV2/PHP.B-GFP at equivalent doses. Three weeks postinjection, transgene expression was assessed in brain and spinal cord. We consistently observed more widespread CNS transduction and higher levels of transgene expression when using the scAAV2/PHP.B-GFP vector. In particular, we observed an unprecedented level of astrocyte transduction in the cortex, when using a ubiquitous CBA promoter. In comparison, neuronal transduction was much lower than previously reported. However, strong neuronal expression (including spinal motor neurons) was observed when the human synapsin promoter was used. These findings constitute the first reported use of an AAV-PHP.B capsid, encapsulating a scAAV genome, for gene transfer in adult mice. Our results underscore the potential of this AAV construct as a platform for safer and more efficacious gene therapy vectors for the CNS.

Safety mechanism assisted by the repressor of tetracycline (SMART) vaccinia virus vectors for vaccines and therapeutics.

PubMed

Grigg, Patricia; Titong, Allison; Jones, Leslie A; Yilma, Tilahun D; Verardi, Paulo H

2013-09-17

Replication-competent viruses, such as Vaccinia virus (VACV), are powerful tools for the development of oncolytic viral therapies and elicit superior immune responses when used as vaccine and immunotherapeutic vectors. However, severe complications from uncontrolled viral replication can occur, particularly in immunocompromised individuals or in those with other predisposing conditions. VACVs constitutively expressing interferon-γ (IFN-γ) replicate in cell culture indistinguishably from control viruses; however, they replicate in vivo to low or undetectable levels, and are rapidly cleared even in immunodeficient animals. In an effort to develop safe and highly effective replication-competent VACV vectors, we established a system to inducibly express IFN-γ. Our SMART (safety mechanism assisted by the repressor of tetracycline) vectors are designed to express the tetracycline repressor under a constitutive VACV promoter and IFN-γ under engineered tetracycline-inducible promoters. Immunodeficient SCID mice inoculated with VACVs not expressing IFN-γ demonstrated severe weight loss, whereas those given VACVs expressing IFN-γ under constitutive VACV promoters showed no signs of infection. Most importantly, mice inoculated with a VACV expressing the IFN-γ gene under an inducible promoter remained healthy in the presence of doxycycline, but exhibited severe weight loss in the absence of doxycycline. In this study, we developed a safety mechanism for VACV based on the conditional expression of IFN-γ under a tightly controlled tetracycline-inducible VACV promoter for use in vaccines and oncolytic cancer therapies.

Development of an optimized tetracycline-inducible expression system to increase the accumulation of interleukin-10 in tobacco BY-2 suspension cells

PubMed Central

2012-01-01

Background Plant cell suspension cultures can be used for the production of valuable pharmaceutical and industrial proteins. When the recombinant protein is secreted into the culture medium, restricting expression to a defined growth phase can improve both the quality and quantity of the recovered product by minimizing proteolytic activity. Temporal restriction is also useful for recombinant proteins whose constitutive expression affects cell growth and viability, such as viral interleukin-10 (vIL-10). Results We have developed a novel, tetracycline-inducible system suitable for tobacco BY-2 suspension cells which increases the yields of vIL-10. The new system is based on a binary vector that is easier to handle than conventional vectors, contains an enhanced inducible promoter and 5′-UTR to improve yields, and incorporates a constitutively-expressed visible marker gene to allow the rapid and straightforward selection of the most promising transformed clones. Stable transformation of BY-2 cells with this vector, without extensive optimization of the induction conditions, led to a 3.5 fold increase in vIL-10 levels compared to constitutive expression in the same host. Conclusions We have developed an effective and straightforward molecular farming platform technology that improves both the quality and the quantity of recombinant proteins produced in plant cells, particularly those whose constitutive expression has a negative impact on plant growth and development. Although we tested the platform using vIL-10 produced in BY-2 cells, it can be applied to other host/product combinations and is also useful for basic research requiring strictly controlled transgene expression. PMID:22784336

Tumor-specific expression of shVEGF and suicide gene as a novel strategy for esophageal cancer therapy.

PubMed

Liu, Ting; Wu, Hai-Jun; Liang, Yu; Liang, Xu-Jun; Huang, Hui-Chao; Zhao, Yan-Zhong; Liao, Qing-Chuan; Chen, Ya-Qi; Leng, Ai-Min; Yuan, Wei-Jian; Zhang, Gui-Ying; Peng, Jie; Chen, Yong-Heng

2016-06-21

To develop a potent and safe gene therapy for esophageal cancer. An expression vector carrying fusion suicide gene (yCDglyTK) and shRNA against vascular endothelial growth factor (VEGF) was constructed and delivered into EC9706 esophageal cancer cells by calcium phosphate nanoparticles (CPNP). To achieve tumor selectivity, expression of the fusion suicide gene was driven by a tumor-specific human telomerase reverse transcriptase (hTERT) promoter. The biologic properties and therapeutic efficiency of the vector, in the presence of prodrug 5-fluorocytosine (5-FC), were evaluated in vitro and in vivo. Both in vitro and in vivo testing showed that the expression vector was efficiently introduced by CPNP into tumor cells, leading to cellular expression of yCDglyTK and decreased VEGF level. With exposure to 5-FC, it exhibited strong anti-tumor effects against esophageal cancer. Combination of VEGF shRNA with the fusion suicide gene demonstrated strong anti-tumor activity. The shVEGF-hTERT-yCDglyTK/5-FC system provided a novel approach for esophageal cancer-targeted gene therapy.

Characterization of a Brome mosaic virus strain and its use as a vector for gene silencing in monocotyledonous hosts.

PubMed

Ding, Xin Shun; Schneider, William L; Chaluvadi, Srinivasa Rao; Mian, M A Rouf; Nelson, Richard S

2006-11-01

Virus-induced gene silencing (VIGS) is used to analyze gene function in dicotyledonous plants but less so in monocotyledonous plants (particularly rice and corn), partially due to the limited number of virus expression vectors available. Here, we report the cloning and modification for VIGS of a virus from Festuca arundinacea Schreb. (tall fescue) that caused systemic mosaic symptoms on barley, rice, and a specific cultivar of maize (Va35) under greenhouse conditions. Through sequencing, the virus was determined to be a strain of Brome mosaic virus (BMV). The virus was named F-BMV (F for Festuca), and genetic determinants that controlled the systemic infection of rice were mapped to RNAs 1 and 2 of the tripartite genome. cDNA from RNA 3 of the Russian strain of BMV (R-BMV) was modified to accept inserts from foreign genes. Coinoculation of RNAs 1 and 2 from F-BMV and RNA 3 from R-BMV expressing a portion of a plant gene to leaves of barley, rice, and maize plants resulted in visual silencing-like phenotypes. The visual phenotypes were correlated with decreased target host transcript levels in the corresponding leaves. The VIGS visual phenotype varied from maintained during silencing of actin 1 transcript expression to transient with incomplete penetration through affected tissue during silencing of phytoene desaturase expression. F-BMV RNA 3 was modified to allow greater accumulation of virus while minimizing virus pathogenicity. The modified vector C-BMV(A/G) (C for chimeric) was shown to be useful for VIGS. These BMV vectors will be useful for analysis of gene function in rice and maize for which no VIGS system is reported.

A Herpes Simplex Virus-Derived Replicative Vector Expressing LIF Limits Experimental Demyelinating Disease and Modulates Autoimmunity

PubMed Central

Nygårdas, Michaela; Paavilainen, Henrik; Müther, Nadine; Nagel, Claus-Henning; Röyttä, Matias; Sodeik, Beate; Hukkanen, Veijo

2013-01-01

Herpes simplex virus type 1 (HSV-1) has properties that can be exploited for the development of gene therapy vectors. The neurotropism of HSV enables delivery of therapeutic genes to the nervous system. Using a bacterial artificial chromosome (BAC), we constructed an HSV-1(17+)-based replicative vector deleted of the neurovirulence gene γ134.5, and expressing leukemia inhibitory factor (LIF) as a transgene for treatment of experimental autoimmune encephalomyelitis (EAE). EAE is an inducible T-cell mediated autoimmune disease of the central nervous system (CNS) and is used as an animal model for multiple sclerosis. Demyelination and inflammation are hallmarks of both diseases. LIF is a cytokine that has the potential to limit demyelination and oligodendrocyte loss in CNS autoimmune diseases and to affect the T-cell mediated autoimmune response. In this study SJL/J mice, induced for EAE, were treated with a HSV-LIF vector intracranially and the subsequent changes in disease parameters and immune responses during the acute disease were investigated. Replicating HSV-LIF and its DNA were detected in the CNS during the acute infection, and the vector spread to the spinal cord but was non-virulent. The HSV-LIF significantly ameliorated the EAE and contributed to a higher number of oligodendrocytes in the brains when compared to untreated mice. The HSV-LIF therapy also induced favorable changes in the expression of immunoregulatory cytokines and T-cell population markers in the CNS during the acute disease. These data suggest that BAC-derived HSV vectors are suitable for gene therapy of CNS disease and can be used to test the therapeutic potential of immunomodulatory factors for treatment of EAE. PMID:23700462

Insect cells as factories for biomanufacturing.

PubMed

Drugmand, Jean-Christophe; Schneider, Yves-Jacques; Agathos, Spiros N

2012-01-01

Insect cells (IC) and particularly lepidopteran cells are an attractive alternative to mammalian cells for biomanufacturing. Insect cell culture, coupled with the lytic expression capacity of baculovirus expression vector systems (BEVS), constitutes a powerful platform, IC-BEVS, for the abundant and versatile formation of heterologous gene products, including proteins, vaccines and vectors for gene therapy. Such products can be manufactured on a large scale thanks to the development of efficient and scaleable production processes involving the integration of a cell growth stage and a stage of cell infection with the recombinant baculovirus vector. Insect cells can produce multimeric proteins functionally equivalent to the natural ones and engineered vectors can be used for efficient expression. Insect cells can be cultivated easily in serum- and protein-free media. A growing number of companies are currently developing an interest in producing therapeutics using IC-BEVS, and many products are today in clinical trials and on the market for veterinary and human applications. This review summarizes current knowledge on insect cell metabolism, culture conditions and applications. Copyright © 2011 Elsevier Inc. All rights reserved.

Inhibition of hepatitis B virus replication via HBV DNA cleavage by Cas9 from Staphylococcus aureus.

PubMed

Liu, Yu; Zhao, Miaoxian; Gong, Mingxing; Xu, Ying; Xie, Cantao; Deng, Haohui; Li, Xueying; Wu, Hongkai; Wang, Zhanhui

2018-04-01

Chronic hepatitis B virus (HBV) infection is difficult to cure due to the presence of covalently closed circular DNA (cccDNA). Accumulating evidence indicates that the CRISPR/Cas9 system effectively disrupts HBV genome, including cccDNA, in vitro and in vivo. However, efficient delivery of CRISPR/Cas9 system to the liver or hepatocytes using an adeno-associated virus (AAV) vector remains challenging due to the large size of Cas9 from Streptococcus pyogenes (Sp). The recently identified Cas9 protein from Staphylococcus aureus (Sa) is smaller than SpCas9 and thus is able to be packaged into the AAV vector. To examine the efficacy of SaCas9 system on HBV genome destruction, we designed 5 guide RNAs (gRNAs) that targeted different HBV genotypes, 3 of which were shown to be effective. The SaCas9 system significantly reduced HBV antigen expression, as well as pgRNA and cccDNA levels, in Huh7, HepG2.2.15 and HepAD38 cells. The dual expression of gRNAs/SaCas9 in these cell lines resulted in more efficient HBV genome cleavage. In the mouse model, hydrodynamic injection of gRNA/SaCas9 plasmids resulted in significantly lower levels of HBV protein expression. We also delivered the SaCas9 system into mice with persistent HBV replication using an AAV vector. Both the AAV vector and the mRNA of Cas9 could be detected in the C3H mouse liver cells. Decreased hepatitis B surface antigen (HBsAg), HBV DNA and pgRNA levels were observed when a higher titer of AAV was injected, although this decrease was not significantly different from the control. In summary, the SaCas9 system accurately and efficiently targeted the HBV genome and inhibited HBV replication both in vitro and in vivo. The system was delivered by an AAV vector and maybe used as a novel therapeutic strategy against chronic HBV infection. Copyright © 2018 Elsevier B.V. All rights reserved.

Comparative analysis of lentiviral vectors and modular protein nanovectors for traumatic brain injury gene therapy

PubMed Central

Negro-Demontel, María Luciana; Saccardo, Paolo; Giacomini, Cecilia; Yáñez-Muñoz, Rafael Joaquín; Ferrer-Miralles, Neus; Vazquez, Esther; Villaverde, Antonio; Peluffo, Hugo

2014-01-01

Traumatic brain injury (TBI) remains as one of the leading causes of mortality and morbidity worldwide and there are no effective treatments currently available. Gene therapy applications have emerged as important alternatives for the treatment of diverse nervous system injuries. New strategies are evolving with the notion that each particular pathological condition may require a specific vector. Moreover, the lack of detailed comparative studies between different vectors under similar conditions hampers the selection of an ideal vector for a given pathological condition. The potential use of lentiviral vectors versus several modular protein-based nanovectors was compared using a controlled cortical impact model of TBI under the same gene therapy conditions. We show that variables such as protein/DNA ratio, incubation volume, and presence of serum or chloroquine in the transfection medium impact on both nanovector formation and transfection efficiency in vitro. While lentiviral vectors showed GFP protein 1 day after TBI and increased expression at 14 days, nanovectors showed stable and lower GFP transgene expression from 1 to 14 days. No toxicity after TBI by any of the vectors was observed as determined by resulting levels of IL-1β or using neurological sticky tape test. In fact, both vector types induced functional improvement per se. PMID:26015985

Regulatable Transgene Expression for Prevention of Chemotherapy-Induced Peripheral Neuropathy.

PubMed

Kawata, Daisuke; Wu, Zetang

2017-09-15

Chemotherapy-induced peripheral neuropathy (CIPN) is a debilitating complication associated with drug treatment of cancer for which there are no effective strategies of prevention or treatment. In this study, we examined the effect of intermittent expression of neurotophin-3 (NT-3) or interleukin-10 (IL-10) from replication-defective herpes simplex virus (HSV)-based regulatable vectors delivered by subcutaneous inoculation to the dorsal root ganglion (DRG) on the development of paclitaxel-induced peripheral neuropathy. We constructed two different tetracycline (tet)-on-based regulatable HSV vectors, one expressing NT-3 and the other expressing IL-10, in which the transactivator expression in the tet-on system was under the control of HSV latency-associated promoter 2 (LAP-2), and expression of the transgene was controlled by doxycycline (DOX). We examined the therapeutic effect of intermittent expression of the transgene in animals with paclitaxel-induced peripheral neuropathy modeled by intraperitoneal injection of paclitaxel (16 mg/kg) once a week for 5 weeks. Intermittent expression of either NT-3 or IL-10 3 days before and 1 day after paclitaxel administration protected animals against paclitaxel-induced peripheral neuropathy over the course of 5 weeks. These results suggest the potential of regulatable vectors for prevention of chemotherapy-induced peripheral neuropathy.

Interferon-α Silencing by Small Interference RNA Increases Adenovirus Transduction and Transgene Expression in Huh7 Cells.

PubMed

Sobrevilla-Navarro, Ana Alondra; Sandoval-Rodríguez, Ana; García-Bañuelos, Jesús Javier; Armendariz-Borunda, Juan; Salazar-Montes, Adriana María

2018-04-01

Adenoviruses are the most common vectors used in clinical trials of gene therapy. In 2017, 21.2% of clinical trials used rAds as vectors. Systemic administration of rAds results in high tropism in the liver. Interferon types α and β are the major antiviral cytokines which orchestrate the host's immune response against rAd, limiting therapeutic gene expression and preventing subsequent vector administration. siRNA is small double-strand RNAs that temporally inhibit the expression of a specific gene. The aim is to evaluate the effect of IFN-α blocking by a specific siRNA on Ad-GFP transduction and on transgene expression in Huh7 cells in culture. Huh7 cells were cultured in DMEM and transfected with 70 nM of siRNA-IFN-α. Six hours later, the cells were exposed to 1 × 10 9  vp/ml of rAd-GFP for 24 h. Expression of IFN-α, TNF-α and the PKR gene was determined by RT-qPCR. Percentage of transduction was analyzed by flow cytometry and by qPCR. GFP expression was determined by western blot. 70 nM of siRNA-IFN-α inhibited 96% of IFN-α and 65% of TNF-α gene expression compared to an irrelevant siRNA. Percentage of transduction and transgene expression increased in these cells compared to an irrelevant siRNA. Inhibition of IFN-α expression by siRNA-IFN-α enabled a higher level of transduction and transgene expression GFP, highlighting the role of IFN-α in the elimination of adenovirus in transduced cells and thus suggesting that its inhibition could be an important strategy for gene therapy in clinical trials using adenovirus as a vector directed to liver diseases.

Gene Delivery to Adipose Tissue Using Transcriptionally Targeted rAAV8 Vectors

PubMed Central

Uhrig-Schmidt, Silke; Geiger, Matthias; Luippold, Gerd; Birk, Gerald; Mennerich, Detlev; Neubauer, Heike; Grimm, Dirk; Wolfrum, Christian; Kreuz, Sebastian

2014-01-01

In recent years, the increasing prevalence of obesity and obesity-related co-morbidities fostered intensive research in the field of adipose tissue biology. To further unravel molecular mechanisms of adipose tissue function, genetic tools enabling functional studies in vitro and in vivo are essential. While the use of transgenic animals is well established, attempts using viral and non-viral vectors to genetically modify adipocytes in vivo are rare. Therefore, we here characterized recombinant Adeno-associated virus (rAAV) vectors regarding their potency as gene transfer vehicles for adipose tissue. Our results demonstrate that a single dose of systemically applied rAAV8-CMV-eGFP can give rise to remarkable transgene expression in murine adipose tissues. Upon transcriptional targeting of the rAAV8 vector to adipocytes using a 2.2 kb fragment of the murine adiponectin (mAP2.2) promoter, eGFP expression was significantly decreased in off-target tissues while efficient transduction was maintained in subcutaneous and visceral fat depots. Moreover, rAAV8-mAP2.2-mediated expression of perilipin A – a lipid-droplet-associated protein – resulted in significant changes in metabolic parameters only three weeks post vector administration. Taken together, our findings indicate that rAAV vector technology is applicable as a flexible tool to genetically modify adipocytes for functional proof-of-concept studies and the assessment of putative therapeutic targets in vivo. PMID:25551639

An alternative approach in regulation of expression of a transgene by endogenous miR-145 in carcinoma and normal breast cell lines.

PubMed

Ghanbari Safari, Maryam; Baesi, Kazem; Hosseinkhani, Saman

2017-03-01

MicroRNAs are small noncoding RNAs that regulate gene expression by repressing translation of target cellular transcripts. Increasing evidences indicate that miRNAs have different expression profiles and play crucial roles in numerous cellular processes. Delivery and expression of transgenes for cancer therapy must be specific for tumors to avoid killing of healthy tissues. Many investigators have shown that transgene expression can be suppressed in normal cells using vectors that are responsive to microRNA regulation. To overcome this problem, miR-145 that exhibits downregulation in many types of cancer cells was chosen for posttranscriptional regulatory systems mediated by microRNAs. In this study, a psiCHECK-145T vector carrying four tandem copies of target sequences of miR-145 into 3'-UTR of the Renilla luciferase gene was constructed. Renilla luciferase activity from the psiCHECK-145T vector was 57% lower in MCF10A cells with high miR-145 expression as compared to a control condition. Additionally, overexpression of miR-145 in MCF-7 cells with low expression level of miR-145 showed more than 76% reduction in the Renilla luciferase activity from the psiCHECK-145T vector. Inclusion of miR-145 target sequences into the 3'-UTR of the Renilla luciferase gene is a feasible strategy for restricting transgene expression in a breast cancer cell line while sparing a breast normal cell line. © 2015 International Union of Biochemistry and Molecular Biology, Inc.

Quantum kinetic theory of the filamentation instability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bret, A.; Haas, F.

2011-07-15

The quantum electromagnetic dielectric tensor for a multi-species plasma is re-derived from the gauge-invariant Wigner-Maxwell system and presented under a form very similar to the classical one. The resulting expression is then applied to a quantum kinetic theory of the electromagnetic filamentation instability. Comparison is made with the quantum fluid theory including a Bohm pressure term and with the cold classical plasma result. A number of analytical expressions are derived for the cutoff wave vector, the largest growth rate, and the most unstable wave vector.

Development of Defective and Persistent Sendai Virus Vector

PubMed Central

Nishimura, Ken; Sano, Masayuki; Ohtaka, Manami; Furuta, Birei; Umemura, Yoko; Nakajima, Yoshiro; Ikehara, Yuzuru; Kobayashi, Toshihiro; Segawa, Hiroaki; Takayasu, Satoko; Sato, Hideyuki; Motomura, Kaori; Uchida, Eriko; Kanayasu-Toyoda, Toshie; Asashima, Makoto; Nakauchi, Hiromitsu; Yamaguchi, Teruhide; Nakanishi, Mahito

2011-01-01

The ectopic expression of transcription factors can reprogram differentiated tissue cells into induced pluripotent stem cells. However, this is a slow and inefficient process, depending on the simultaneous delivery of multiple genes encoding essential reprogramming factors and on their sustained expression in target cells. Moreover, once cell reprogramming is accomplished, these exogenous reprogramming factors should be replaced with their endogenous counterparts for establishing autoregulated pluripotency. Complete and designed removal of the exogenous genes from the reprogrammed cells would be an ideal option for satisfying this latter requisite as well as for minimizing the risk of malignant cell transformation. However, no single gene delivery/expression system has ever been equipped with these contradictory characteristics. Here we report the development of a novel replication-defective and persistent Sendai virus (SeVdp) vector based on a noncytopathic variant virus, which fulfills all of these requirements for cell reprogramming. The SeVdp vector could accommodate up to four exogenous genes, deliver them efficiently into various mammalian cells (including primary tissue cells and human hematopoietic stem cells) and express them stably in the cytoplasm at a prefixed balance. Furthermore, interfering with viral transcription/replication using siRNA could erase the genomic RNA of SeVdp vector from the target cells quickly and thoroughly. A SeVdp vector installed with Oct4/Sox2/Klf4/c-Myc could reprogram mouse primary fibroblasts quite efficiently; ∼1% of the cells were reprogrammed to Nanog-positive induced pluripotent stem cells without chromosomal gene integration. Thus, this SeVdp vector has potential as a tool for advanced cell reprogramming and for stem cell research. PMID:21138846

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

Comprehensive gene expression profiling following DNA vaccination of rainbow trout against infectious hematopoietic necrosis virus

USGS Publications Warehouse

Purcell, Maureen K.; Nichols, Krista M.; Winton, James R.; Kurath, Gael; Thorgaard, Gary H.; Wheeler, Paul; Hansen, John D.; Herwig, Russell P.; Park, Linda K.

2006-01-01

The DNA vaccine based on the glycoprotein gene of Infectious hematopoietic necrosis virus induces a non-specific anti-viral immune response and long-term specific immunity against IHNV. This study characterized gene expression responses associated with the early anti-viral response. Homozygous rainbow trout were injected intra-muscularly (I.M.) with vector DNA or the IHNV DNA vaccine. Gene expression in muscle tissue (I.M. site) was evaluated using a 16,008 feature salmon cDNA microarray. Eighty different genes were significantly modulated in the vector DNA group while 910 genes were modulated in the IHNV DNA vaccinate group relative to control group. Quantitative reverse-transcriptase PCR was used to examine expression of selected immune genes at the I.M. site and in other secondary tissues. In the localized response (I.M. site), the magnitudes of gene expression changes were much greater in the vaccinate group relative to the vector DNA group for the majority of genes analyzed. At secondary systemic sites (e.g. gill, kidney and spleen), type I IFN-related genes were up-regulated in only the IHNV DNA vaccinated group. The results presented here suggest that the IHNV DNA vaccine induces up-regulation of the type I IFN system across multiple tissues, which is the functional basis of early anti-viral immunity.

A versatile and efficient high-throughput cloning tool for structural biology.

PubMed

Geertsma, Eric R; Dutzler, Raimund

2011-04-19

Methods for the cloning of large numbers of open reading frames into expression vectors are of critical importance for challenging structural biology projects. Here we describe a system termed fragment exchange (FX) cloning that facilitates the high-throughput generation of expression constructs. The method is based on a class IIS restriction enzyme and negative selection markers. FX cloning combines attractive features of established recombination- and ligation-independent cloning methods: It allows the straightforward transfer of an open reading frame into a variety of expression vectors and is highly efficient and very economic in its use. In addition, FX cloning avoids the common but undesirable feature of significantly extending target open reading frames with cloning related sequences, as it leaves a minimal seam of only a single extra amino acid to either side of the protein. The method has proven to be very robust and suitable for all common pro- and eukaryotic expression systems. It considerably speeds up the generation of expression constructs compared to traditional methods and thus facilitates a broader expression screening.

Application of Mutated miR-206 Target Sites Enables Skeletal Muscle-specific Silencing of Transgene Expression of Cardiotropic AAV9 Vectors

PubMed Central

Geisler, Anja; Schön, Christian; Größl, Tobias; Pinkert, Sandra; Stein, Elisabeth A; Kurreck, Jens; Vetter, Roland; Fechner, Henry

2013-01-01

Insertion of completely complementary microRNA (miR) target sites (miRTS) into a transgene has been shown to be a valuable approach to specifically repress transgene expression in non-targeted tissues. miR-122TS have been successfully used to silence transgene expression in the liver following systemic application of cardiotropic adeno-associated virus (AAV) 9 vectors. For miR-206–mediated skeletal muscle-specific silencing of miR-206TS–bearing AAV9 vectors, however, we found this approach failed due to the expression of another member (miR-1) of the same miR family in heart tissue, the intended target. We introduced single-nucleotide substitutions into the miR-206TS and searched for those which prevented miR-1–mediated cardiac repression. Several mutated miR-206TS (m206TS), in particular m206TS-3G, were resistant to miR-1, but remained fully sensitive to miR-206. All these variants had mismatches in the seed region of the miR/m206TS duplex in common. Furthermore, we found that some m206TS, containing mismatches within the seed region or within the 3′ portion of the miR-206, even enhanced the miR-206– mediated transgene repression. In vivo expression of m206TS-3G– and miR-122TS–containing transgene of systemically applied AAV9 vectors was strongly repressed in both skeletal muscle and the liver but remained high in the heart. Thus, site-directed mutagenesis of miRTS provides a new strategy to differentiate transgene de-targeting of related miRs. PMID:23439498

Robust and accurate vectorization of line drawings.

PubMed

Hilaire, Xavier; Tombre, Karl

2006-06-01

This paper presents a method for vectorizing the graphical parts of paper-based line drawings. The method consists of separating the input binary image into layers of homogeneous thickness, skeletonizing each layer, segmenting the skeleton by a method based on random sampling, and simplifying the result. The segmentation method is robust with a best bound of 50 percent noise reached for indefinitely long primitives. Accurate estimation of the recognized vector's parameters is enabled by explicitly computing their feasibility domains. Theoretical performance analysis and expression of the complexity of the segmentation method are derived. Experimental results and comparisons with other vectorization systems are also provided.

Disclosing the Parameters Leading to High Productivity of Retroviral Producer Cells Lines: Evaluating Random Versus Targeted Integration.

PubMed

Bandeira, Vanessa S; Tomás, Hélio A; Alici, Evren; Carrondo, Manuel J T; Coroadinha, Ana S

2017-04-01

Gammaretrovirus and lentivirus are the preferred viral vectors to genetically modify T and natural killer cells to be used in immune cell therapies. The transduction efficiency of hematopoietic and T cells is more efficient using gibbon ape leukemia virus (GaLV) pseudotyping. In this context gammaretroviral vector producer cells offer competitive higher titers than transient lentiviral vectors productions. The main aim of this work was to identify the key parameters governing GaLV-pseudotyped gammaretroviral vector productivity in stable producer cells, using a retroviral vector expression cassette enabling positive (facilitating cell enrichment) and negative cell selection (allowing cell elimination). The retroviral vector contains a thymidine kinase suicide gene fused with a ouabain-resistant Na + ,K + -ATPase gene, a potential safer and faster marker. The establishment of retroviral vector producer cells is traditionally performed by randomly integrating the retroviral vector expression cassette codifying the transgene. More recently, recombinase-mediated cassette exchange methodologies have been introduced to achieve targeted integration. Herein we compared random and targeted integration of the retroviral vector transgene construct. Two retroviral producer cell lines, 293 OuaS and 293 FlexOuaS, were generated by random and targeted integration, respectively, producing high titers (on the order of 10 7 infectious particles·ml -1 ). Results showed that the retroviral vector transgene cassette is the key retroviral vector component determining the viral titers notwithstanding, single-copy integration is sufficient to provide high titers. The expression levels of the three retroviral constructs (gag-pol, GaLV env, and retroviral vector transgene) were analyzed. Although gag-pol and GaLV env gene expression levels should surpass a minimal threshold, we found that relatively modest expression levels of these two expression cassettes are required. Their levels of expression should not be maximized. We concluded, to establish a high producer retroviral vector cell line only the expression level of the genomic retroviral RNA, that is, the retroviral vector transgene cassette, should be maximized, both through (1) the optimization of its design (i.e., genetic elements composition) and (2) the selection of high expressing chromosomal locus for its integration. The use of methodologies identifying and promoting integration into high-expression loci, as targeted integration or high-throughput screening are in this perspective highly valuable.

Inhalation of Nebulized Perfluorochemical Enhances Recombinant Adenovirus and Adeno-Associated Virus-Mediated Gene Expression in Lung Epithelium

PubMed Central

Beckett, Travis; Bonneau, Laura; Howard, Alan; Blanchard, James; Borda, Juan; Weiner, Daniel J.; Wang, Lili; Gao, Guang Ping; Kolls, Jay K.; Bohm, Rudolf; Liggitt, Denny

2012-01-01

Abstract Use of perfluorochemical liquids during intratracheal vector administration enhances recombinant adenovirus and adeno-associated virus (AAV)-mediated lung epithelial gene expression. We hypothesized that inhalation of nebulized perfluorochemical vapor would also enhance epithelial gene expression after subsequent intratracheal vector administration. Freely breathing adult C57BL/6 mice were exposed for selected times to nebulized perflubron or sterile saline in a sealed Plexiglas chamber. Recombinant adenoviral vector was administered by transtracheal puncture at selected times afterward and mice were killed 3 days after vector administration to assess transgene expression. Mice tolerated the nebulized perflubron without obvious ill effects. Vector administration 6 hr after nebulized perflubron exposure resulted in an average 540% increase in gene expression in airway and alveolar epithelium, compared with that with vector alone or saline plus vector control (p<0.05). However, vector administration 1 hr, 1 day, or 3 days after perflubron exposure was not different from either nebulized saline with vector or vector alone and a 60-min exposure to nebulized perflubron is required. In parallel pilot studies in macaques, inhalation of nebulized perflubron enhanced recombinant AAV2/5 vector expression throughout the lung. Serial chest radiographs, bronchoalveolar lavages, and results of complete blood counts and serum biochemistries demonstrated no obvious adverse effects of nebulized perflubron. Further, one macaque receiving nebulized perflubron only was monitored for 1 year with no obvious adverse effects of exposure. These results demonstrate that inhalation of nebulized perflubron, a simple, clinically more feasible technique than intratracheal administration of liquid perflubron, safely enhances lung gene expression. PMID:22568624

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

Impact of age and vector construct on striatal and nigral transgene expression

PubMed Central

Polinski, Nicole K; Manfredsson, Fredric P; Benskey, Matthew J; Fischer, D Luke; Kemp, Christopher J; Steece-Collier, Kathy; Sandoval, Ivette M; Paumier, Katrina L; Sortwell, Caryl E

2016-01-01

Therapeutic protein delivery using viral vectors has shown promise in preclinical models of Parkinson’s disease (PD) but clinical trial success remains elusive. This may partially be due to a failure to include advanced age as a covariate despite aging being the primary risk factor for PD. We investigated transgene expression following intracerebral injections of recombinant adeno-associated virus pseudotypes 2/2 (rAAV2/2), 2/5 (rAAV2/5), 2/9 (rAAV2/9), and lentivirus (LV) expressing green fluorescent protein (GFP) in aged versus young adult rats. Both rAAV2/2 and rAAV2/5 yielded lower GFP expression following injection to either the aged substantia nigra or striatum. rAAV2/9-mediated GFP expression was deficient in the aged striatonigral system but displayed identical transgene expression between ages in the nigrostriatal system. Young and aged rats displayed equivalent GFP levels following LV injection to the striatonigral system but LV-delivered GFP was deficient in delivering GFP to the aged nigrostriatal system. Notably, age-related transgene expression deficiencies revealed by protein quantitation were poorly predicted by GFP-immunoreactive cell counts. Further, in situ hybridization for the viral CβA promoter revealed surprisingly limited tropism for astrocytes compared to neurons. Our results demonstrate that aging is a critical covariate to consider when designing gene therapy approaches for PD. PMID:27933309

Production of SV40-derived vectors.

PubMed

Strayer, David S; Mitchell, Christine; Maier, Dawn A; Nichols, Carmen N

2010-06-01

Recombinant simian virus 40 (rSV40)-derived vectors are particularly useful for gene delivery to bone marrow progenitor cells and their differentiated derivatives, certain types of epithelial cells (e.g., hepatocytes), and central nervous system neurons and microglia. They integrate rapidly into cellular DNA to provide long-term gene expression in vitro and in vivo in both resting and dividing cells. Here we describe a protocol for production and purification of these vectors. These procedures require only packaging cells (e.g., COS-7) and circular vector genome DNA. Amplification involves repeated infection of packaging cells with vector produced by transfection. Cotransfection is not required in any step. Viruses are purified by centrifugation using discontinuous sucrose or cesium chloride (CsCl) gradients and resulting vectors are replication-incompetent and contain no detectable wild-type SV40 revertants. These approaches are simple, give reproducible results, and may be used to generate vectors that are deleted only for large T antigen (Tag), or for all SV40-coding sequences capable of carrying up to 5 kb of foreign DNA. These vectors are best applied to long-term expression of proteins normally encoded by mammalian cells or by viruses that infect mammalian cells, or of untranslated RNAs (e.g., RNA interference). The preparative approaches described facilitate application of these vectors and allow almost any laboratory to exploit their strengths for diverse gene delivery applications.

Development of siRNA expression vector utilizing rock bream beta-actin promoter: a potential therapeutic tool against viral infection in fish.

PubMed

Zenke, Kosuke; Nam, Yoon Kwon; Kim, Ki Hong

2010-01-01

In the present study, we have developed short interfering RNA (siRNA) expression vector utilizing rock bream beta-actin promoter and examined the possible use for the inhibition of highly pathogenic fish virus, rock bream iridovirus (RBIV), replication in vitro. Initially, in order to express siRNA effectively, we added several modifications to wild-type rock bream beta-actin promoter. Next, we succeeded in knocking down the expression of enhanced green fluorescent protein reporter gene expression in fish cells using newly developed vector more effectively than the fugu U6 promoter-driven vector we described previously. Finally, we could observe that cells transfected with modified rock bream beta-actin promoter-driven siRNA expression vector targeting major capsid protein (MCP) gene of RBIV exhibited more resistance to RBIV challenge than other control cells. Our results indicate that this novel siRNA expression vector can be used as a new tool for therapeutics in virus infection in fish species.

Targeted systemic gene therapy and molecular imaging of cancer contribution of the vascular-targeted AAVP vector.

PubMed

Hajitou, Amin

2010-01-01

Gene therapy and molecular-genetic imaging have faced a major problem: the lack of an efficient systemic gene delivery vector. Unquestionably, eukaryotic viruses have been the vectors of choice for gene delivery to mammalian cells; however, they have had limited success in systemic gene therapy. This is mainly due to undesired uptake by the liver and reticuloendothelial system, broad tropism for mammalian cells causing toxicity, and their immunogenicity. On the other hand, prokaryotic viruses such as bacteriophage (phage) have no tropism for mammalian cells, but can be engineered to deliver genes to these cells. However, phage-based vectors have inherently been considered poor vectors for mammalian cells. We have reported a new generation of vascular-targeted systemic hybrid prokaryotic-eukaryotic vectors as chimeras between an adeno-associated virus (AAV) and targeted bacteriophage (termed AAV/phage; AAVP). In this hybrid vector, the targeted bacteriophage serves as a shuttle to deliver the AAV transgene cassette inserted in an intergenomic region of the phage DNA genome. As a proof of concept, we assessed the in vivo efficacy of vector in animal models of cancer by displaying on the phage capsid the cyclic Arg-Gly-Asp (RGD-4C) ligand that binds to alphav integrin receptors specifically expressed on the angiogenic blood vessels of tumors. The ligand-directed vector was able to specifically deliver imaging and therapeutic transgenes to tumors in mice, rats, and dogs while sparing the normal organs. This chapter reviews some gene transfer strategies and the potential of the vascular-targeted AAVP vector for enhancing the effectiveness of existing systemic gene delivery and genetic-imaging technologies. Copyright (c) 2010 Elsevier Inc. All rights reserved.

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

Modulating ectopic gene expression levels by using retroviral vectors equipped with synthetic promoters.

PubMed

Ferreira, Joshua P; Peacock, Ryan W S; Lawhorn, Ingrid E B; Wang, Clifford L

2011-12-01

The human cytomegalovirus and elongation factor 1α promoters are constitutive promoters commonly employed by mammalian expression vectors. These promoters generally produce high levels of expression in many types of cells and tissues. To generate a library of synthetic promoters capable of generating a range of low, intermediate, and high expression levels, the TATA and CAAT box elements of these promoters were mutated. Other promoter variants were also generated by random mutagenesis. Evaluation using plasmid vectors integrated at a single site in the genome revealed that these various synthetic promoters were capable of expression levels spanning a 40-fold range. Retroviral vectors were equipped with the synthetic promoters and evaluated for their ability to reproduce the graded expression demonstrated by plasmid integration. A vector with a self-inactivating long terminal repeat could neither reproduce the full range of expression levels nor produce stable expression. Using a second vector design, the different synthetic promoters enabled stable expression over a broad range of expression levels in different cell lines. The online version of this article (doi:10.1007/s11693-011-9089-0) contains supplementary material, which is available to authorized users.

TMV-Gate vectors: Gateway compatible tobacco mosaic virus based expression vectors for functional analysis of proteins

PubMed Central

Kagale, Sateesh; Uzuhashi, Shihomi; Wigness, Merek; Bender, Tricia; Yang, Wen; Borhan, M. Hossein; Rozwadowski, Kevin

2012-01-01

Plant viral expression vectors are advantageous for high-throughput functional characterization studies of genes due to their capability for rapid, high-level transient expression of proteins. We have constructed a series of tobacco mosaic virus (TMV) based vectors that are compatible with Gateway technology to enable rapid assembly of expression constructs and exploitation of ORFeome collections. In addition to the potential of producing recombinant protein at grams per kilogram FW of leaf tissue, these vectors facilitate either N- or C-terminal fusions to a broad series of epitope tag(s) and fluorescent proteins. We demonstrate the utility of these vectors in affinity purification, immunodetection and subcellular localisation studies. We also apply the vectors to characterize protein-protein interactions and demonstrate their utility in screening plant pathogen effectors. Given its broad utility in defining protein properties, this vector series will serve as a useful resource to expedite gene characterization efforts. PMID:23166857

Robust production of virus-like particles and monoclonal antibodies with geminiviral replicon vectors in lettuce

PubMed Central

Lai, Huafang; He, Junyun; Engle, Michael; Diamond, Michael S.; Chen, Qiang

2011-01-01

Summary Pharmaceutical protein production in plants has been greatly promoted by the development of viral-based vectors and transient expression systems. Tobacco and related Nicotiana species are currently the most common host plants for generation of plant-made pharmaceutical proteins (PMPs). Downstream processing of target PMPs from these plants, however, is hindered by potential technical and regulatory difficulties due to the presence of high levels of phenolics and toxic alkaloids. Here, we explored the use of lettuce, which grows quickly yet produces low levels of secondary metabolites, and viral vector-based transient expression systems to develop a robust PMP production platform. Our results showed that a geminiviral replicon system based on the bean yellow dwarf virus permits high-level expression in lettuce of virus-like particles (VLP) derived from the Norwalk virus capsid protein and therapeutic monoclonal antibodies (mAbs) against Ebola and West Nile viruses. These vaccine and therapeutic candidates can be readily purified from lettuce leaves with scalable processing methods while fully retaining functional activity. Furthermore, this study also demonstrated the feasibility of using commercially produced lettuce for high-level PMP production. This allows our production system to have access to unlimited quantities of inexpensive plant material for large-scale production. These results establish a new production platform for biological pharmaceutical agents that is effective, safe, low-cost, and amenable to large-scale manufacturing. PMID:21883868

Expression of the human blood coagulation protein factor XIIIa in Saccharomyces cerevisiae: dependence of the expression levels from host-vector systems and medium conditions.

PubMed

Bröker, M; Bäuml, O; Göttig, A; Ochs, J; Bodenbenner, M; Amann, E

1991-03-01

The human blood coagulation protein Factor XIIIa (FXIIIa) was expressed in Saccharomyces cerevisiae employing Escherichia coli-yeast shuttle vectors based on a 2-mu plasmid. Several factors affecting high production yield of recombinant FXIIIa were analysed. The use of the regulatable GAL-CYC1 hybrid promoter resulted in higher FXIIIa expression when compared with the constitutive ADCI promoter. Screening for suitable yeast strains for expression of FXIIIa under the transcriptional control of the GAL-CYC1 hybrid promoter revealed a broad spectrum of productivity. No obvious correlation between the expression rate and the genetic markers of the strains could be identified. The medium composition markedly influenced the FXIIIa expression rates. The expression of FXIIIa was strictly regulated by the carbon source. Glucose as the only sugar and energy source repressed the synthesis of FXIIIa, whereas addition of galactose induced FXIIIa expression. Special feeding schemes resulted in a productivity of up to 100 mg FXIIIa/l in shake flasks.

Genetically Modifying the Insect Gut Microbiota to Control Chagas Disease Vectors through Systemic RNAi

PubMed Central

Taracena, Mabel L.; Oliveira, Pedro L.; Almendares, Olivia; Umaña, Claudia; Lowenberger, Carl; Dotson, Ellen M.; Paiva-Silva, Gabriela O.; Pennington, Pamela M.

2015-01-01

Technologies based on RNA interference may be used for insect control. Sustainable strategies are needed to control vectors of Chagas disease such as Rhodnius prolixus. The insect microbiota can be modified to deliver molecules to the gut. Here, Escherichia coli HT115(DE3) expressing dsRNA for the Rhodnius heme-binding protein (RHBP) and for catalase (CAT) were fed to nymphs and adult triatomine stages. RHBP is an egg protein and CAT is an antioxidant enzyme expressed in all tissues by all developmental stages. The RNA interference effect was systemic and temporal. Concentrations of E. coli HT115(DE3) above 3.35 × 107 CFU/mL produced a significant RHBP and CAT gene knockdown in nymphs and adults. RHBP expression in the fat body was reduced by 99% three days after feeding, returning to normal levels 10 days after feeding. CAT expression was reduced by 99% and 96% in the ovary and the posterior midgut, respectively, five days after ingestion. Mortality rates increased by 24-30% in first instars fed RHBP and CAT bacteria. Molting rates were reduced by 100% in first instars and 80% in third instars fed bacteria producing RHBP or CAT dsRNA. Oviposition was reduced by 43% (RHBP) and 84% (CAT). Embryogenesis was arrested in 16% (RHBP) and 20% (CAT) of laid eggs. Feeding females 105 CFU/mL of the natural symbiont, Rhodococcus rhodnii, transformed to express RHBP-specific hairpin RNA reduced RHBP expression by 89% and reduced oviposition. Modifying the insect microbiota to induce systemic RNAi in R. prolixus may result in a paratransgenic strategy for sustainable vector control. PMID:25675102

Single-Construct Polycistronic Doxycycline-Inducible Vectors Improve Direct Cardiac Reprogramming and Can Be Used to Identify the Critical Timing of Transgene Expression.

PubMed

Umei, Tomohiko C; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

2017-08-19

Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming.

Single-Construct Polycistronic Doxycycline-Inducible Vectors Improve Direct Cardiac Reprogramming and Can Be Used to Identify the Critical Timing of Transgene Expression

PubMed Central

Umei, Tomohiko C.; Yamakawa, Hiroyuki; Muraoka, Naoto; Sadahiro, Taketaro; Isomi, Mari; Haginiwa, Sho; Kojima, Hidenori; Kurotsu, Shota; Tamura, Fumiya; Osakabe, Rina; Tani, Hidenori; Nara, Kaori; Miyoshi, Hiroyuki; Fukuda, Keiichi; Ieda, Masaki

2017-01-01

Direct reprogramming is a promising approach in regenerative medicine. Overexpression of the cardiac transcription factors Gata4, Mef2c, and Tbx5 (GMT) or GMT plus Hand2 (GHMT) directly reprogram fibroblasts into cardiomyocyte-like cells (iCMs). However, the critical timing of transgene expression and the molecular mechanisms for cardiac reprogramming remain unclear. The conventional doxycycline (Dox)-inducible temporal transgene expression systems require simultaneous transduction of two vectors (pLVX-rtTA/pLVX-cDNA) harboring the reverse tetracycline transactivator (rtTA) and the tetracycline response element (TRE)-controlled transgene, respectively, leading to inefficient cardiac reprogramming. Herein, we developed a single-construct-based polycistronic Dox-inducible vector (pDox-cDNA) expressing both the rtTA and TRE-controlled transgenes. Fluorescence activated cell sorting (FACS) analyses, quantitative RT-PCR, and immunostaining revealed that pDox-GMT increased cardiac reprogramming three-fold compared to the conventional pLVX-rtTA/pLVX-GMT. After four weeks, pDox-GMT-induced iCMs expressed multiple cardiac genes, produced sarcomeric structures, and beat spontaneously. Co-transduction of pDox-Hand2 with retroviral pMX-GMT increased cardiac reprogramming three-fold compared to pMX-GMT alone. Temporal Dox administration revealed that Hand2 transgene expression is critical during the first two weeks of cardiac reprogramming. Microarray analyses demonstrated that Hand2 represses cell cycle-promoting genes and enhances cardiac reprogramming. Thus, we have developed an efficient temporal transgene expression system, which could be invaluable in the study of cardiac reprogramming. PMID:28825623

Adenoviral Vector Immunity: Its Implications and circumvention strategies

PubMed Central

Ahi, Yadvinder S.; Bangari, Dinesh S.; Mittal, Suresh K.

2014-01-01

Adenoviral (Ad) vectors have emerged as a promising gene delivery platform for a variety of therapeutic and vaccine purposes during last two decades. However, the presence of preexisting Ad immunity and the rapid development of Ad vector immunity still pose significant challenges to the clinical use of these vectors. Innate inflammatory response following Ad vector administration may lead to systemic toxicity, drastically limit vector transduction efficiency and significantly abbreviate the duration of transgene expression. Currently, a number of approaches are being extensively pursued to overcome these drawbacks by strategies that target either the host or the Ad vector. In addition, significant progress has been made in the development of novel Ad vectors based on less prevalent human Ad serotypes and nonhuman Ad. This review provides an update on our current understanding of immune responses to Ad vectors and delineates various approaches for eluding Ad vector immunity. Approaches targeting the host and those targeting the vector are discussed in light of their promises and limitations. PMID:21453277

TimesVector: a vectorized clustering approach to the analysis of time series transcriptome data from multiple phenotypes.

PubMed

Jung, Inuk; Jo, Kyuri; Kang, Hyejin; Ahn, Hongryul; Yu, Youngjae; Kim, Sun

2017-12-01

Identifying biologically meaningful gene expression patterns from time series gene expression data is important to understand the underlying biological mechanisms. To identify significantly perturbed gene sets between different phenotypes, analysis of time series transcriptome data requires consideration of time and sample dimensions. Thus, the analysis of such time series data seeks to search gene sets that exhibit similar or different expression patterns between two or more sample conditions, constituting the three-dimensional data, i.e. gene-time-condition. Computational complexity for analyzing such data is very high, compared to the already difficult NP-hard two dimensional biclustering algorithms. Because of this challenge, traditional time series clustering algorithms are designed to capture co-expressed genes with similar expression pattern in two sample conditions. We present a triclustering algorithm, TimesVector, specifically designed for clustering three-dimensional time series data to capture distinctively similar or different gene expression patterns between two or more sample conditions. TimesVector identifies clusters with distinctive expression patterns in three steps: (i) dimension reduction and clustering of time-condition concatenated vectors, (ii) post-processing clusters for detecting similar and distinct expression patterns and (iii) rescuing genes from unclassified clusters. Using four sets of time series gene expression data, generated by both microarray and high throughput sequencing platforms, we demonstrated that TimesVector successfully detected biologically meaningful clusters of high quality. TimesVector improved the clustering quality compared to existing triclustering tools and only TimesVector detected clusters with differential expression patterns across conditions successfully. The TimesVector software is available at http://biohealth.snu.ac.kr/software/TimesVector/. sunkim.bioinfo@snu.ac.kr. Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

Versatile Cosmid Vectors for the Isolation, Expression, and Rescue of Gene Sequences: Studies with the Human α -globin Gene Cluster

NASA Astrophysics Data System (ADS)

Lau, Yun-Fai; Kan, Yuet Wai

1983-09-01

We have developed a series of cosmids that can be used as vectors for genomic recombinant DNA library preparations, as expression vectors in mammalian cells for both transient and stable transformations, and as shuttle vectors between bacteria and mammalian cells. These cosmids were constructed by inserting one of the SV2-derived selectable gene markers-SV2-gpt, SV2-DHFR, and SV2-neo-in cosmid pJB8. High efficiency of genomic cloning was obtained with these cosmids and the size of the inserts was 30-42 kilobases. We isolated recombinant cosmids containing the human α -globin gene cluster from these genomic libraries. The simian virus 40 DNA in these selectable gene markers provides the origin of replication and enhancer sequences necessary for replication in permissive cells such as COS 7 cells and thereby allows transient expression of α -globin genes in these cells. These cosmids and their recombinants could also be stably transformed into mammalian cells by using the respective selection systems. Both of the adult α -globin genes were more actively expressed than the embryonic zeta -globin genes in these transformed cell lines. Because of the presence of the cohesive ends of the Charon 4A phage in the cosmids, the transforming DNA sequences could readily be rescued from these stably transformed cells into bacteria by in vitro packaging of total cellular DNA. Thus, these cosmid vectors are potentially useful for direct isolation of structural genes.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

PubMed

Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

2009-12-30

Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency.

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

Gene Overexpression and RNA Silencing Tools for the Genetic Manipulation of the S-(+)-Abscisic Acid Producing Ascomycete Botrytis cinerea

PubMed Central

Ding, Zhong-Tao; Zhang, Zhi; Luo, Di; Zhou, Jin-Yan; Zhong, Juan; Yang, Jie; Xiao, Liang; Shu, Dan; Tan, Hong

2015-01-01

The phytopathogenic ascomycete Botrytis cinerea produces several secondary metabolites that have biotechnical significance and has been particularly used for S-(+)-abscisic acid production at the industrial scale. To manipulate the expression levels of specific secondary metabolite biosynthetic genes of B. cinerea with Agrobacterium tumefaciens-mediated transformation system, two expression vectors (pCBh1 and pCBg1 with different selection markers) and one RNA silencing vector, pCBSilent1, were developed with the In-Fusion assembly method. Both expression vectors were highly effective in constitutively expressing eGFP, and pCBSilent1 effectively silenced the eGFP gene in B. cinerea. Bcaba4, a gene suggested to participate in ABA biosynthesis in B. cinerea, was then targeted for gene overexpression and RNA silencing with these reverse genetic tools. The overexpression of bcaba4 dramatically induced ABA formation in the B. cinerea wild type strain Bc-6, and the gene silencing of bcaba4 significantly reduced ABA-production in an ABA-producing B. cinerea strain. PMID:25955649

Development of Bacteriocinogenic Strains of Saccharomyces cerevisiae Heterologously Expressing and Secreting the Leaderless Enterocin L50 Peptides L50A and L50B from Enterococcus faecium L50▿

PubMed Central

Basanta, Antonio; Herranz, Carmen; Gutiérrez, Jorge; Criado, Raquel; Hernández, Pablo E.; Cintas, Luis M.

2009-01-01

A segregationally stable expression and secretion vector for Saccharomyces cerevisiae, named pYABD01, was constructed by cloning the yeast gene region encoding the mating pheromone α-factor 1 secretion signal (MFα1s) into the S. cerevisiae high-copy-number expression vector pYES2. The structural genes of the two leaderless peptides of enterocin L50 (EntL50A and EntL50B) from Enterococcus faecium L50 were cloned, separately (entL50A or entL50B) and together (entL50AB), into pYABD01 under the control of the galactose-inducible promoter PGAL1. The generation of recombinant S. cerevisiae strains heterologously expressing and secreting biologically active EntL50A and EntL50B demonstrates the suitability of the MFα1s-containing vector pYABD01 to direct processing and secretion of these antimicrobial peptides through the S. cerevisiae Sec system. PMID:19218405

Cloning and Expression of Major Surface Antigen 1 Gene of Toxoplasma gondii RH Strain Using the Expression Vector pVAX1 in Chinese Hamster Ovary Cells

PubMed Central

Abdizadeh, Rahman; Maraghi, Sharif; Ghadiri, Ata A.; Tavalla, Mehdi; Shojaee, Saeedeh

2015-01-01

Background: Toxoplasmosis is an opportunistic protozoan infection with a high prevalence in a broad range of hosts infecting up to one-third of the world human population. Toxoplasmosis leads to serious medical problems in immunocompromised individuals and fetuses and also induces abortion and mortality in domestic animals. Therefore, there is a huge demand for the development of an effective vaccine. Surface Antigen 1 (SAG1) is one of the important immunodominant surface antigens of Toxoplasma gondii, which interacts with host cells and primarily involved in adhesion, invasion and stimulation of host immune response. Surface antigen 1 is considered as the leading candidate for development of an effective vaccine against toxoplasmosis. Objectives: The purpose of this study was to clone the major surface antigen1 gene (SAG1) from the genotype 1 of T. gondii, RH strain into the eukaryotic expression vector pVAX1 in order to use for a DNA vaccine. Materials and Methods: Genomic DNA was extracted from tachyzoite of the parasite using the QIAamp DNA mini kit. After designing the specific primers, SAG1 gene was amplified by Polymerase Chain Reaction (PCR). The purified PCR products were then cloned into a pPrime plasmid vector. The aforementioned product was subcloned into the pVAX1 eukaryotic expression vector. The recombinant pVAX1-SAG1 was then transfected into Chinese Hamster Ovary (CHO) cells and expression of SAG1 antigen was evaluated using Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Immunofluorescence Assay (IFA) and Western Blotting (WB). Results: The cloning and subcloning products (pPrime-SAG1 and pVAX1-SAG1 plasmid vectors) of SAG1 gene were verified and confirmed by enzyme digestion and sequencing. A 30 kDa recombinant protein was expressed in CHO cells as shown by IFA and WB methods. Conclusions: The pVAX1 expression vector and CHO cells are a suitable system for high-level recombinant protein production for SAG1 gene from T. gondii parasites and are promising approaches for antigen preparation in vaccine development. PMID:25861441

A tetracycline inducible expression vector for Corynebacterium glutamicum allowing tightly regulable gene expression.

PubMed

Lausberg, Frank; Chattopadhyay, Ava Rebecca; Heyer, Antonia; Eggeling, Lothar; Freudl, Roland

2012-09-01

Here we report on the construction of a tetracycline inducible expression vector that allows a tightly regulable gene expression in Corynebacterium glutamicum which is used in industry for production of small molecules such as amino acids. Using the green fluorescent protein (GFP) as a reporter protein we show that this vector, named pCLTON1, is characterized by tight repression under non-induced conditions as compared to a conventional IPTG inducible expression vector, and that it allows gradual GFP synthesis upon gradual increase of anhydrotetracycline addition. Copyright © 2012 Elsevier Inc. All rights reserved.

Selection of transduced CD34+ progenitors and enzymatic correction of cells from Gaucher patients, with bicistronic vectors.

PubMed Central

Migita, M; Medin, J A; Pawliuk, R; Jacobson, S; Nagle, J W; Anderson, S; Amiri, M; Humphries, R K; Karlsson, S

1995-01-01

The gene transfer efficiency of human hematopoietic stem cells is still inadequate for efficient gene therapy of most disorders. To overcome this problem, a selectable retroviral vector system for gene therapy has been developed for gene therapy of Gaucher disease. We constructed a bicistronic retroviral vector containing the human glucocerebrosidase (GC) cDNA and the human small cell surface antigen CD24 (243 bp). Expression of both cDNAs was controlled by the long terminal repeat enhancer/promoter of the Molony murine leukemia virus. The CD24 selectable marker was placed downstream of the GC cDNA and its translation was enhanced by inclusion of the long 5' untranslated region of encephalomyocarditis virus internal ribosomal entry site. Virus-producing GP+envAM12 cells were created by multiple supernatant transductions to create vector producer cells. The vector LGEC has a high titer and can drive expression of GC and the cell surface antigen CD24 simultaneously in transduced NIH 3T3 cells and Gaucher skin fibroblasts. These transduced cells have been successfully separated from untransduced cells by fluorescence-activated cell sorting, based on cell surface expression of CD24. Transduced and sorted NIH 3T3 cells showed higher GC enzyme activity than the unsorted population, demonstrating coordinated expression of both genes. Fibroblasts from Gaucher patients were transduced and sorted for CD24 expression, and GC enzyme activity was measured. The transduced sorted Gaucher fibroblasts had a marked increase in enzyme activity (149%) compared with virgin Gaucher fibroblasts (17% of normal GC enzyme activity). Efficient transduction of CD34+ hematopoietic progenitors (20-40%) was accomplished and fluorescence-activated cell sorted CD24(+)-expressing progenitors generated colonies, all of which (100%) were vector positive. The sorted, CD24-expressing progenitors generated erythroid burst-forming units, colony-forming units (CFU)-granulocyte, CFU-macrophage, CFU-granulocyte/macrophage, and CFU-mix hematopoietic colonies, demonstrating their ability to differentiate into these myeloid lineages in vitro. The transduced, sorted progenitors raised the GC enzyme levels in their progeny cells manyfold compared with untransduced CD34+ progenitors. Collectively, this demonstrates the development of high titer, selectable bicistronic vectors that allow isolation of transduced hematopoietic progenitors and cells that have been metabolically corrected. Images Fig. 2 Fig. 3 PMID:8618847

Vectorology and Factor Delivery in Induced Pluripotent Stem Cell Reprogramming

PubMed Central

2014-01-01

Induced pluripotent stem cell (iPSC) reprogramming requires sustained expression of multiple reprogramming factors for a limited period of time (10–30 days). Conventional iPSC reprogramming was achieved using lentiviral or simple retroviral vectors. Retroviral reprogramming has flaws of insertional mutagenesis, uncontrolled silencing, residual expression and re-activation of transgenes, and immunogenicity. To overcome these issues, various technologies were explored, including adenoviral vectors, protein transduction, RNA transfection, minicircle DNA, excisable PiggyBac (PB) transposon, Cre-lox excision system, negative-sense RNA replicon, positive-sense RNA replicon, Epstein-Barr virus-based episomal plasmids, and repeated transfections of plasmids. This review provides summaries of the main vectorologies and factor delivery systems used in current reprogramming protocols. PMID:24625220

Student difficulties regarding symbolic and graphical representations of vector fields

NASA Astrophysics Data System (ADS)

Bollen, Laurens; van Kampen, Paul; Baily, Charles; Kelly, Mossy; De Cock, Mieke

2017-12-01

The ability to switch between various representations is an invaluable problem-solving skill in physics. In addition, research has shown that using multiple representations can greatly enhance a person's understanding of mathematical and physical concepts. This paper describes a study of student difficulties regarding interpreting, constructing, and switching between representations of vector fields, using both qualitative and quantitative methods. We first identified to what extent students are fluent with the use of field vector plots, field line diagrams, and symbolic expressions of vector fields by conducting individual student interviews and analyzing in-class student activities. Based on those findings, we designed the Vector Field Representations test, a free response assessment tool that has been given to 196 second- and third-year physics, mathematics, and engineering students from four different universities. From the obtained results we gained a comprehensive overview of typical errors that students make when switching between vector field representations. In addition, the study allowed us to determine the relative prevalence of the observed difficulties. Although the results varied greatly between institutions, a general trend revealed that many students struggle with vector addition, fail to recognize the field line density as an indication of the magnitude of the field, confuse characteristics of field lines and equipotential lines, and do not choose the appropriate coordinate system when writing out mathematical expressions of vector fields.

HSV Recombinant Vectors for Gene Therapy

PubMed Central

Manservigi, Roberto; Argnani, Rafaela; Marconi, Peggy

2010-01-01

The very deep knowledge acquired on the genetics and molecular biology of herpes simplex virus (HSV), has allowed the development of potential replication-competent and replication-defective vectors for several applications in human healthcare. These include delivery and expression of human genes to cells of the nervous systems, selective destruction of cancer cells, prophylaxis against infection with HSV or other infectious diseases, and targeted infection to specific tissues or organs. Replication-defective recombinant vectors are non-toxic gene transfer tools that preserve most of the neurotropic features of wild type HSV-1, particularly the ability to express genes after having established latent infections, and are thus proficient candidates for therapeutic gene transfer settings in neurons. A replication-defective HSV vector for the treatment of pain has recently entered in phase 1 clinical trial. Replication-competent (oncolytic) vectors are becoming a suitable and powerful tool to eradicate brain tumours due to their ability to replicate and spread only within the tumour mass, and have reached phase II/III clinical trials in some cases. The progress in understanding the host immune response induced by the vector is also improving the use of HSV as a vaccine vector against both HSV infection and other pathogens. This review briefly summarizes the obstacle encountered in the delivery of HSV vectors and examines the various strategies developed or proposed to overcome such challenges. PMID:20835362

Viral Vectors for Gene Delivery to the Central Nervous System

PubMed Central

Lentz, Thomas B.; Gray, Steven J.; Samulski, R. Jude

2011-01-01

The potential benefits of gene therapy for neurological diseases such as Parkinson’s, Amyotrophic Lateral Sclerosis (ALS), Epilepsy, and Alzheimer’s are enormous. Even a delay in the onset of severe symptoms would be invaluable to patients suffering from these and other diseases. Significant effort has been placed in developing vectors capable of delivering therapeutic genes to the CNS in order to treat neurological disorders. At the forefront of potential vectors, viral systems have evolved to efficiently deliver their genetic material to a cell. The biology of different viruses offers unique solutions to the challenges of gene therapy, such as cell targeting, transgene expression and vector production. It is important to consider the natural biology of a vector when deciding whether it will be the most effective for a specific therapeutic function. In this review, we outline desired features of the ideal vector for gene delivery to the CNS and discuss how well available viral vectors compare to this model. Adeno-associated virus, retrovirus, adenovirus and herpesvirus vectors are covered. Focus is placed on features of the natural biology that have made these viruses effective tools for gene delivery with emphasis on their application in the CNS. Our goal is to provide insight into features of the optimal vector and which viral vectors can provide these features. PMID:22001604

[Use of a novel baculovirus vector to express nucleoprotein gene of Crimean-Congo hemorrhagic fever virus in both insect and mammalian cells].

PubMed

Ma, Benjiang; Hang, Changshou; Zhao, Yun; Wang, Shiwen; Xie, Yanxiang

2002-09-01

To construct a novel baculovirus vector which is capable of promoting the high-yield expression of foreign gene in mammalian cells and to express by this vector the nucleoprotein (NP) gene of Crimean-Congo hemorrhagic fever virus (CCHFV) Chinese isolate (Xinjiang hemorrhagic fever virus, XHFV) BA88166 in insect and Vero cells. Human cytomegalovirus (CMV) immediate early (IE) promoter was ligated to the baculovirus vector pFastBac1 downstream of the polyhedrin promoter to give rise to the novel vector pCB1. XHFV NP gene was cloned to this vector and was well expressed in COS-7 cells and Vero cells by means of recombinant plasmid transfection and baculovirus infection. The XHFV NP gene in vector pCB1 could be well expressed in mammalian cells. Vero cells infected with recombinant baculovirus harboring NP gene could be employed as antigens to detect XHF serum specimens whose results were in good correlation with those of ELISA and in parallel with clinical diagnoses. This novel baculovirus vector is able to express the foreign gene efficiently in both insect and mammalian cells, which provides not only the convenient diagnostic antigens but also the potential for developing recombinant virus vaccines and gene therapies.

Pathology Associated with AAV Mediated Expression of Beta Amyloid or C100 in Adult Mouse Hippocampus and Cerebellum

PubMed Central

Drummond, Eleanor S.; Muhling, Jill; Martins, Ralph N.; Wijaya, Linda K.; Ehlert, Erich M.; Harvey, Alan R.

2013-01-01

Accumulation of beta amyloid (Aβ) in the brain is a primary feature of Alzheimer’s disease (AD) but the exact molecular mechanisms by which Aβ exerts its toxic actions are not yet entirely clear. We documented pathological changes 3 and 6 months after localised injection of recombinant, bi-cistronic adeno-associated viral vectors (rAAV2) expressing human Aβ40-GFP, Aβ42-GFP, C100-GFP or C100V717F-GFP into the hippocampus and cerebellum of 8 week old male mice. Injection of all rAAV2 vectors resulted in wide-spread transduction within the hippocampus and cerebellum, as shown by expression of transgene mRNA and GFP protein. Despite the lack of accumulation of Aβ protein after injection with AAV vectors, injection of rAAV2-Aβ42-GFP and rAAV2- C100V717F-GFP into the hippocampus resulted in significantly increased microgliosis and altered permeability of the blood brain barrier, the latter revealed by high levels of immunoglobulin G (IgG) around the injection site and the presence of IgG positive cells. In comparison, injection of rAAV2-Aβ40-GFP and rAAV2-C100-GFP into the hippocampus resulted in substantially less neuropathology. Injection of rAAV2 vectors into the cerebellum resulted in similar types of pathological changes, but to a lesser degree. The use of viral vectors to express different types of Aβ and C100 is a powerful technique with which to examine the direct in vivo consequences of Aβ expression in different regions of the mature nervous system and will allow experimentation and analysis of pathological AD-like changes in a broader range of species other than mouse. PMID:23516609

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

AAVPG: A vigilant vector where transgene expression is induced by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

2013-12-15

Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

Optimized Sleeping Beauty transposons rapidly generate stable transgenic cell lines.

PubMed

Kowarz, Eric; Löscher, Denise; Marschalek, Rolf

2015-04-01

Stable gene expression in mammalian cells is a prerequisite for many in vitro and in vivo experiments. However, either the integration of plasmids into mammalian genomes or the use of retro-/lentiviral systems have intrinsic limitations. The use of transposable elements, e.g. the Sleeping Beauty system (SB), circumvents most of these drawbacks (integration sites, size limitations) and allows the quick generation of stable cell lines. The integration process of SB is catalyzed by a transposase and the handling of this gene transfer system is easy, fast and safe. Here, we report our improvements made to the existing SB vector system and present two new vector types for robust constitutive or inducible expression of any gene of interest. Both types are available in 16 variants with different selection marker (puromycin, hygromycin, blasticidin, neomycin) and fluorescent protein expression (GFP, RFP, BFP) to fit most experimental requirements. With this system it is possible to generate cell lines from stable transfected cells quickly and reliably in a medium-throughput setting (three to five days). Cell lines robustly express any gene-of-interest, either constitutively or tightly regulated by doxycycline. This allows many laboratory experiments to speed up generation of data in a rapid and robust manner. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Validation of the use of an artificial mitochondrial reporter DNA vector containing a Cytomegalovirus promoter for mitochondrial transgene expression.

PubMed

Yamada, Yuma; Ishikawa, Takuya; Harashima, Hideyoshi

2017-08-01

Mitochondria have their own gene expression system that is independent of the nuclear system, and control cellular functions in cooperation with the nucleus. While a number of useful technologies for achieving nuclear transgene expression have been reported, only a few have focused on mitochondria. In this study, we validated the utility of an artificial mitochondrial DNA vector with a virus promoter on mitochondrial transgene expression. We designed and constructed pCMV-mtLuc (CGG) that contains a CMV promotor derived from Cytomegalovirus and an artificial mitochondrial genome with a NanoLuc (Nluc) luciferase gene that records adjustments to the mitochondrial codon system. Nluc luciferase activity measurements showed that the pCMV-mtLuc (CGG) efficiently produced the Nluc luciferase protein in human HeLa cells. Moreover, we optimized the mitochondrial transfection of pCMV-mtLuc (CGG) using a MITO-Porter system, a liposome-based carrier for mitochondrial delivery via membrane fusion. As a result, we found that transfection of pCMV-mtLuc (CGG) by MITO-Porter modified with the KALA peptide (cationic amphipathic cell-penetrating peptide) showed a high mitochondrial transgene expression. The developed mitochondrial transgene expression system represents a potentially useful tool for the fields of nanoscience and nanotechnology for controlling the intracellular microenvironment via the regulation of mitochondrial function and promises to open additional innovative research fields of study. Copyright © 2017 Elsevier Ltd. All rights reserved.

[Construction and characterization of liposomal magnetofection system in pig kidney cells].

PubMed

Chen, Wenjie; Cui, Haixin; Zhao, Xiang; Cui, Jinhui; Wang, Yan; Sun, Changjiao

2014-06-01

Magnetic nano gene vector is one of the non-viral gene vectors, modified by functional group to bind cationic transfect reagents. Coupling magnetofection with the universal lipofection we developed a novel somatic cell transfection method as the so-called liposomal magnetofection (LMF). This approach is potential to provide somatic cell cloning with stable genetic cell lines to cultivate transgenic animals. In order to construct such liposomal magnetic gene vectors complexes system, we used nano magnetic gene vector to combine with liposomal cationic transfect reagents by molecular self-assembly. This vectors system successfully carried exogenous gene and then transfected animal somatic cells. Here, we conducted atomic force microscopy (AFM), zeta potential-diameter analysis and other characterization experiments to investegate the size distribution and morphology of magnetic nanoparticles, the way of the vectors to load and concentrate DNA molecules. Our data reveal that, the LMF of Pig Kidney cells exhibited higher transfection efficiency comparing with the transfection mediated by the commercial lipofectamine2000. Moreover, LMF method overcomes the constraint of transient expression mediated by lipofection. Meanwhile, MTT assay showed low cytotoxicity of LMF. Hence, LMF is a feasible, low cytotoxic and effective method of cell transfection.

Method: low-cost delivery of the cotton leaf crumple virus-induced gene silencing system

PubMed Central

2012-01-01

Background We previously developed a virus-induced gene silencing (VIGS) vector for cotton from the bipartite geminivirusCotton leaf crumple virus (CLCrV). The original CLCrV VIGS vector was designed for biolistic delivery by a gene gun. This prerequisite limited the use of the system to labs with access to biolistic equipment. Here we describe the adaptation of this system for delivery by Agrobacterium (Agrobacterium tumefaciens). We also describe the construction of two low-cost particle inflow guns. Results The biolistic CLCrV vector was transferred into two Agrobacterium binary plasmids. Agroinoculation of the binary plasmids into cotton resulted in silencing and GFP expression comparable to the biolistic vector. Two homemade low-cost gene guns were used to successfully inoculate cotton (G. hirsutum) and N. benthamiana with either the CLCrV VIGS vector or the Tomato golden mosaic virus (TGMV) VIGS vector respectively. Conclusions These innovations extend the versatility of CLCrV-based VIGS for analyzing gene function in cotton. The two low-cost gene guns make VIGS experiments affordable for both research and teaching labs by providing a working alternative to expensive commercial gene guns. PMID:22853641

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design.

PubMed

Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh; Mahboudi, Fereidoun

2017-01-01

Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios.

Monoclonal antibodies expression improvement in CHO cells by PiggyBac transposition regarding vectors ratios and design

PubMed Central

Ahmadi, Samira; Davami, Fatemeh; Davoudi, Noushin; Nematpour, Fatemeh; Ahmadi, Maryam; Ebadat, Saeedeh; Azadmanesh, Kayhan; Barkhordari, Farzaneh

2017-01-01

Establishing stable Chinese Hamster Ovary (CHO) cells producing monoclonal antibodies (mAbs) usually pass through the random integration of vectors to the cell genome, which is sensitive to gene silencing. One approach to overcome this issue is to target a highly transcribed region in the genome. Transposons are useful devices to target active parts of genomes, and PiggyBac (PB) transposon can be considered as a good option. In the present study, three PB transposon donor vectors containing both heavy and light chains were constructed, one contained independent expression cassettes while the others utilized either an Internal Ribosome Entry Site (IRES) or 2A element to express mAb. Conventional cell pools were created by transferring donor vectors into the CHO cells, whereas transposon-based cells were generated by transfecting the cells with donor vectors with a companion of a transposase-encoding helper vector, with 1:2.5 helper/donor vectors ratio. To evaluate the influence of helper/donor vectors ratio on expression, the second transposon-based cell pools were generated with 1:5 helper/donor ratio. Expression levels in the transposon-based cells were two to five -folds more than those created by conventional method except for the IRES-mediated ones, in which the observed difference increased more than 100-fold. The results were dependent on both donor vector design and vectors ratios. PMID:28662065

Extended Closed-form Expressions for the Robust Symmetrical Number System Dynamic Range and an Efficient Algorithm for its Computation

DTIC Science & Technology

2014-01-01

and distance between all of the vector ambiguity pairs for the combined N−sequences. To simplify our derivation, we define the center of ambiguity (COA...modulo N . The resulting structure of the N sequences ensures that two successive RSNS vectors (paired terms from all N sequences) when considered...represented by a vector , Xh = [x1,h, x2,h, . . . , xN,h] T , of N paired integers from each se- quence at h. For example, a left-shifted, three-sequence

Spectroscopy detection of green and red fluorescent proteins in genetically modified plants using a fiber optics system

NASA Astrophysics Data System (ADS)

Liew, Oi Wah; Asundi, Anand K.; Chen, Jun-Wei; Chew, Yiwen; Yu, Shangjuan; Yeo, Gare H.

2001-05-01

In this paper, fiber optic spectroscopy is developed to detect and quantify recombinant green (EGFP) and red (DsRED) fluorescent proteins in vitro and in vivo. The bacterial expression vectors carrying the coding regions of EGFP and DsRED were introduced into Escherichia coli host cells and fluorescent proteins were produced following induction with IPTG. Soluble EGFP and DsRED proteins were isolated from lysed bacterial cells and serially diluted for quantitative analysis by fiber optic spectroscopy. Fluorescence at the appropriate emission wavelengths could be detected up to 64X dilution for EGFP and 40X dilution for DsRED. To determine the capability of spectroscopy detection in vivo, transgenic potato hairy roots expressing EGFP and DsRED were regenerated. This was achieved by cloning the EGFP and DsRED genes into the plant binary vector, pTMV35S, to create the recombinant vectors pGLOWGreen and pGLOWRed. These latter binary vectors were introduced into Agrobacterium rhizogenes strain A4T. Infection of potato cells with transformed agrobacteria was used to insert the fluorescent protein genes into the potato genome. Genetically modified potato cells were then regenerated into hairy roots. A panel of transformed hairy roots expressing varying levels of fluorescent proteins was selected by fluorescence microscopy. We are now assessing the capability of spectroscopic detection system for in vivo quantification of green and red fluorescence levels in transformed roots.

Dual AAV therapy ameliorates exercise-induced muscle injury and functional ischemia in murine models of Duchenne muscular dystrophy.

PubMed

Zhang, Yadong; Yue, Yongping; Li, Liang; Hakim, Chady H; Zhang, Keqing; Thomas, Gail D; Duan, Dongsheng

2013-09-15

Neuronal nitric oxide synthase (nNOS) membrane delocalization contributes to the pathogenesis of Duchenne muscular dystrophy (DMD) by promoting functional muscle ischemia and exacerbating muscle injury during exercise. We have previously shown that supra-physiological expression of nNOS-binding mini-dystrophin restores normal blood flow regulation and prevents functional ischemia in transgenic mdx mice, a DMD model. A critical next issue is whether systemic dual adeno-associated virus (AAV) gene therapy can restore nNOS-binding mini-dystrophin expression and mitigate muscle activity-related functional ischemia and injury. Here, we performed systemic gene transfer in mdx and mdx4cv mice using a pair of dual AAV vectors that expressed a 6 kb nNOS-binding mini-dystrophin gene. Vectors were packaged in tyrosine mutant AAV-9 and co-injected (5 × 10(12) viral genome particles/vector/mouse) via the tail vein to 1-month-old dystrophin-null mice. Four months later, we observed 30-50% mini-dystrophin positive myofibers in limb muscles. Treatment ameliorated histopathology, increased muscle force and protected against eccentric contraction-induced injury. Importantly, dual AAV therapy successfully prevented chronic exercise-induced muscle force drop. Doppler hemodynamic assay further showed that therapy attenuated adrenergic vasoconstriction in contracting muscle. Our results suggest that partial transduction can still ameliorate nNOS delocalization-associated functional deficiency. Further evaluation of nNOS binding mini-dystrophin dual AAV vectors is warranted in dystrophic dogs and eventually in human patients.

A virus vector based on Canine Herpesvirus for vaccine applications in canids.

PubMed

Strive, T; Hardy, C M; Wright, J; Reubel, G H

2007-01-31

Canine Herpesvirus (CHV) is being developed as a virus vector for the vaccination of European red foxes. However, initial studies using recombinant CHV vaccines in foxes revealed viral attenuation and lack of antibody response to inserted foreign antigens. These findings were attributed both to inactivation of the thymidine kinase (TK) gene and excess foreign genetic material in the recombinant viral genome. In this study, we report an improved CHV-bacterial artificial chromosome (BAC) vector system designed to overcome attenuation in foxes. A non-essential region was identified in the CHV genome as an alternative insertion site for foreign genes. Replacement of a guanine/cytosine (GC)-rich intergenic region between UL21 and UL22 of CHV with a marker gene did not change growth behaviour in vitro, showing that this region is not essential for virus growth in cell culture. We subsequently produced a CHV-BAC vector with an intact TK gene in which the bacterial genes and the antigen expression cassette were inserted into this GC-rich locus. Unlike earlier constructs, the new CHV-BAC allowed self-excision of the bacterial genes via homologous recombination after transfection of BACs into cell culture. The BAC-CHV system was used to produce a recombinant virus that constitutively expressed porcine zona pellucida subunit C protein between the UL21 and UL22 genes of CHV. Complete self-excision of the bacterial genes from CHV was achieved within one round of replication whilst retaining antigen gene expression.

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

PubMed Central

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements in T-cell specific gene expression were observed with the incorporation of additional cis-regulatory elements, such as a human polyadenylation signal and intron 7 from the human ADA gene. Conclusion These studies suggest that the combination of an authentically regulated ADA gene in a murine retroviral vector, together with additional locus-specific regulatory refinements, will yield a vector with a safer profile and greater efficacy in terms of high-level, therapeutic, regulated gene expression for the treatment of ADA-deficient severe combined immunodeficiency. PMID:20042112

HSV as a vector in vaccine development and gene therapy.

PubMed

Marconi, Peggy; Argnani, Rafaela; Epstein, Alberto L; Manservigi, Roberto

2009-01-01

The very deep knowledge acquired on the genetics and molecular biology of herpes simplex virus (HSV), major human pathogen whose lifestyle is based on a long-term dual interaction with the infected host characterized by the existence of lytic and latent infections, has allowed the development of potential vectors for several applications in human healthcare. These include delivery and expression of human genes to cells of the nervous system, selective destruction of cancer cells, prophylaxis against infection with HSV or other infectious diseases and targeted infection of specific tissues or organs. Three different classes of vectors can be derived from HSV-1: replication-competent attenuated vectors, replication-incompetent recombinant vectors and defective helper-dependent vectors known as amplicons. This chapter highlights the current knowledge concerning design, construction and recent applications, as well as the potential and current limitations of the three different classes of HSV-1-based vectors.

Induction of humoral responses to BHV-1 glycoprotein D expressed by HSV-1 amplicon vectors

PubMed Central

Blanc, Andrea Maria; Berois, Mabel Beatriz; Tomé, Lorena Magalí; Epstein, Alberto L.

2012-01-01

Herpes simplex virus type-1 (HSV-1) amplicon vectors are versatile and useful tools for transferring genes into cells that are capable of stimulating a specific immune response to their expressed antigens. In this work, two HSV-1-derived amplicon vectors were generated. One of these expressed the full-length glycoprotein D (gD) of bovine herpesvirus 1 while the second expressed the truncated form of gD (gDtr) which lacked the trans-membrane region. After evaluating gD expression in the infected cells, the ability of both vectors to induce a specific gD immune response was tested in BALB/c mice that were intramuscularly immunized. Specific serum antibody responses were detected in mice inoculated with both vectors, and the response against truncated gD was higher than the response against full-length gD. These results reinforce previous findings that HSV-1 amplicon vectors can potentially deliver antigens to animals and highlight the prospective use of these vectors for treating infectious bovine rhinotracheitis disease. PMID:22437537

Effective genetic modification and differentiation of hMSCs upon controlled release of rAAV vectors using alginate/poloxamer composite systems.

PubMed

Díaz-Rodríguez, P; Rey-Rico, A; Madry, H; Landin, M; Cucchiarini, M

2015-12-30

Viral vectors are common tools in gene therapy to deliver foreign therapeutic sequences in a specific target population via their natural cellular entry mechanisms. Incorporating such vectors in implantable systems may provide strong alternatives to conventional gene transfer procedures. The goal of the present study was to generate different hydrogel structures based on alginate (AlgPH155) and poloxamer PF127 as new systems to encapsulate and release recombinant adeno-associated viral (rAAV) vectors. Inclusion of rAAV in such polymeric capsules revealed an influence of the hydrogel composition and crosslinking temperature upon the vector release profiles, with alginate (AlgPH155) structures showing the fastest release profiles early on while over time vector release was more effective from AlgPH155+PF127 [H] capsules crosslinked at a high temperature (50°C). Systems prepared at room temperature (AlgPH155+PF127 [C]) allowed instead to achieve a more controlled release profile. When tested for their ability to target human mesenchymal stem cells, the different systems led to high transduction efficiencies over time and to gene expression levels in the range of those achieved upon direct vector application, especially when using AlgPH155+PF127 [H]. No detrimental effects were reported on either cell viability or on the potential for chondrogenic differentiation. Inclusion of PF127 in the capsules was also capable of delaying undesirable hypertrophic cell differentiation. These findings are of promising value for the further development of viral vector controlled release strategies. Copyright © 2015 Elsevier B.V. All rights reserved.

Verifying the equivalence of representations of the knee joint moment vector from a drop vertical jump task.

PubMed

Nichols, Julia K; O'Reilly, Oliver M

2017-03-01

Biomechanics software programs, such as Visual3D, Nexus, Cortex, and OpenSim, have the capability of generating several distinct component representations for joint moments and forces from motion capture data. These representations include those for orthonormal proximal and distal coordinate systems and a non-orthogonal joint coordinate system. In this article, a method is presented to address the challenging problem of evaluating and verifying the equivalence of these representations. The method accommodates the difficulty that there are two possible sets of non-orthogonal basis vectors that can be used to express a vector in the joint coordinate system and is illuminated using motion capture data from a drop vertical jump task. Copyright © 2016 Elsevier B.V. All rights reserved.

Rapid Assembly of Customized TALENs into Multiple Delivery Systems

PubMed Central

Zhang, Zhengxing; Zhang, Siliang; Huang, Xin; Orwig, Kyle E.; Sheng, Yi

2013-01-01

Transcriptional activator-like effector nucleases (TALENs) have become a powerful tool for genome editing. Here we present an efficient TALEN assembly approach in which TALENs are assembled by direct Golden Gate ligation into Gateway® Entry vectors from a repeat variable di-residue (RVD) plasmid array. We constructed TALEN pairs targeted to mouse Ddx3 subfamily genes, and demonstrated that our modified TALEN assembly approach efficiently generates accurate TALEN moieties that effectively introduce mutations into target genes. We generated “user friendly” TALEN Entry vectors containing TALEN expression cassettes with fluorescent reporter genes that can be efficiently transferred via Gateway (LR) recombination into different delivery systems. We demonstrated that the TALEN Entry vectors can be easily transferred to an adenoviral delivery system to expand application to cells that are difficult to transfect. Since TALENs work in pairs, we also generated a TALEN Entry vector set that combines a TALEN pair into one PiggyBac transposon-based destination vector. The approach described here can also be modified for construction of TALE transcriptional activators, repressors or other functional domains. PMID:24244669

Viral vectors for production of recombinant proteins in plants.

PubMed

Lico, Chiara; Chen, Qiang; Santi, Luca

2008-08-01

Global demand for recombinant proteins has steadily accelerated for the last 20 years. These recombinant proteins have a wide range of important applications, including vaccines and therapeutics for human and animal health, industrial enzymes, new materials and components of novel nano-particles for various applications. The majority of recombinant proteins are produced by traditional biological "factories," that is, predominantly mammalian and microbial cell cultures along with yeast and insect cells. However, these traditional technologies cannot satisfy the increasing market demand due to prohibitive capital investment requirements. During the last two decades, plants have been under intensive investigation to provide an alternative system for cost-effective, highly scalable, and safe production of recombinant proteins. Although the genetic engineering of plant viral vectors for heterologous gene expression can be dated back to the early 1980s, recent understanding of plant virology and technical progress in molecular biology have allowed for significant improvements and fine tuning of these vectors. These breakthroughs enable the flourishing of a variety of new viral-based expression systems and their wide application by academic and industry groups. In this review, we describe the principal plant viral-based production strategies and the latest plant viral expression systems, with a particular focus on the variety of proteins produced and their applications. We will summarize the recent progress in the downstream processing of plant materials for efficient extraction and purification of recombinant proteins. (c) 2008 Wiley-Liss, Inc.

Precomputed state dependent digital control of a nuclear rocket engine

NASA Technical Reports Server (NTRS)

Johnson, M. R.

1972-01-01

A control method applicable to multiple-input multiple-output nonlinear time-invariant systems in which desired behavior can be expressed explicitly as a trajectory in system state space is developed. The precomputed state dependent control method is basically a synthesis technique in which a suboptimal control law is developed off-line, prior to system operation. This law is obtained by conducting searches at a finite number of points in state space, in the vicinity of some desired trajectory, to obtain a set of constant control vectors which tend to return the system to the desired trajectory. These vectors are used to evaluate the unknown coefficients in a control law having an assumed hyperellipsoidal form. The resulting coefficients constitute the heart of the controller and are used in the on-line computation of control vectors. Two examples of PSDC are given prior to the more detailed description of the NERVA control system development.

Integration Profile and Safety of an Adenovirus Hybrid-Vector Utilizing Hyperactive Sleeping Beauty Transposase for Somatic Integration

PubMed Central

Zhang, Wenli; Muck-Hausl, Martin; Wang, Jichang; Sun, Chuanbo; Gebbing, Maren; Miskey, Csaba; Ivics, Zoltan; Izsvak, Zsuzsanna; Ehrhardt, Anja

2013-01-01

We recently developed adenovirus/transposase hybrid-vectors utilizing the previously described hyperactive Sleeping Beauty (SB) transposase HSB5 for somatic integration and we could show stabilized transgene expression in mice and a canine model for hemophilia B. However, the safety profile of these hybrid-vectors with respect to vector dose and genotoxicity remains to be investigated. Herein, we evaluated this hybrid-vector system in C57Bl/6 mice with escalating vector dose settings. We found that in all mice which received the hyperactive SB transposase, transgene expression levels were stabilized in a dose-dependent manner and that the highest vector dose was accompanied by fatalities in mice. To analyze potential genotoxic side-effects due to somatic integration into host chromosomes, we performed a genome-wide integration site analysis using linker-mediated PCR (LM-PCR) and linear amplification-mediated PCR (LAM-PCR). Analysis of genomic DNA samples obtained from HSB5 treated female and male mice revealed a total of 1327 unique transposition events. Overall the chromosomal distribution pattern was close-to-random and we observed a random integration profile with respect to integration into gene and non-gene areas. Notably, when using the LM-PCR protocol, 27 extra-chromosomal integration events were identified, most likely caused by transposon excision and subsequent transposition into the delivered adenoviral vector genome. In total, this study provides a careful evaluation of the safety profile of adenovirus/Sleeping Beauty transposase hybrid-vectors. The obtained information will be useful when designing future preclinical studies utilizing hybrid-vectors in small and large animal models. PMID:24124483

The targeting expression of the vascular endothelial growth factor gene in endothelial cells regulated by HRE.ppET-1.

PubMed

Zheng, Xiangrong; Zhang, Shangshang; Yang, Yujia; Wang, Xia; Zhong, Le; Yu, Xiaohe

2008-11-01

The success of gene therapy depends largely on the efficacy of gene delivery vector systems that can deliver genes to target organs or cells selectively and efficiently with minimal toxicity. Here, we show that by using the HRE.ppET-1 regulatory element, we were able to restrict expression of the transgene of vascular endothelial growth factor (VEGF) to endothelial cells exclusively in hypoxic conditions. Eukaryotic expression vectors such as pEGFP-HRE.ppET-1, pcDNA3.1-VEGF+Pa, pcDNA3.1-ppET-1+ EGF+Pa, and pcDNA3.1-HRE.ppET-1+VEGF+Pa were constructed by using a series of nuclear molecule handling methods like PCR, enzyme digestion. The recombinant vectors were transfected into HUVEC cells and HL7702 cells by the lipofectin method. GFP expression was observed with a fluorescence microscope to validate the specificity of expression in endothelial cells under the regulation of HRE.ppET-1 element. Cobalt chloride (final concentration 100 mumol/L) was added to the medium to mimic hypoxia in vitro. After transfection of vectors, the expression of VEGF mRNA was detected by RT-PCR, and the expression of VEGF was detected by Western blotting and ELISA methods under normoxia and hypoxia, respectively. The cell proliferation rate was detected by the MTT test. The expression of GFP revealed that the exterior gene was transcripted effectively in endothelial cells regulated by the HRE.ppET-1 element, while the expression of GFP was very weak in nonendothelial cells. The results of RT-PCR, Western blotting and ELISA showed that VEGF gene expression in the pcDNA3.1-HRE.ppET-1+VEGF+Pa group and in the pcDNA3.1-ppET-1+VEGF+Pa group was higher in hypoxia than it was in normoxia (P<0.05). The MTT test showed that the proliferation rate of HUVEC transfected with HPVA under hypoxia exceeded that of the control group. We conclude that the HRE.ppET-1 element was expressed specifically in endothelial cells, and can increase the expression of VEGF in hypoxia and stimulate proliferation of endothelial cells. Taking advantage of these facts could greatly improve the efficiency of gene therapy. The vector would be valuable for various gene transfer studies targeting endothelial cells.

Temporal dynamics of the ABC transporter response to insecticide treatment: insights from the malaria vector Anopheles stephensi

NASA Astrophysics Data System (ADS)

Epis, Sara; Porretta, Daniele; Mastrantonio, Valentina; Urbanelli, Sandra; Sassera, Davide; De Marco, Leone; Mereghetti, Valeria; Montagna, Matteo; Ricci, Irene; Favia, Guido; Bandi, Claudio

2014-12-01

In insects, ABC transporters have been shown to contribute to defence/resistance to insecticides by reducing toxic concentrations in cells/tissues. Despite the extensive studies about this detoxifying mechanism, the temporal patterns of ABC transporter activation have been poorly investigated. Using the malaria vector Anopheles stephensi as a study system, we investigated the expression profile of ABC genes belonging to different subfamilies in permethrin-treated larvae at different time points (30 min to 48 h). Our results showed that the expression of ABCB and ABCG subfamily genes was upregulated at 1 h after treatment, with the highest expression observed at 6 h. Therefore, future investigations on the temporal dynamics of ABC gene expression will allow a better implementation of insecticide treatment regimens, including the use of specific inhibitors of ABC efflux pumps.

Emotion-independent face recognition

NASA Astrophysics Data System (ADS)

De Silva, Liyanage C.; Esther, Kho G. P.

2000-12-01

Current face recognition techniques tend to work well when recognizing faces under small variations in lighting, facial expression and pose, but deteriorate under more extreme conditions. In this paper, a face recognition system to recognize faces of known individuals, despite variations in facial expression due to different emotions, is developed. The eigenface approach is used for feature extraction. Classification methods include Euclidean distance, back propagation neural network and generalized regression neural network. These methods yield 100% recognition accuracy when the training database is representative, containing one image representing the peak expression for each emotion of each person apart from the neutral expression. The feature vectors used for comparison in the Euclidean distance method and for training the neural network must be all the feature vectors of the training set. These results are obtained for a face database consisting of only four persons.

Lentivirus Vectors Incorporating the Immunoglobulin Heavy Chain Enhancer and Matrix Attachment Regions Provide Position-Independent Expression in B Lymphocytes

PubMed Central

Lutzko, Carolyn; Senadheera, Dinithi; Skelton, Dianne; Petersen, Denise; Kohn, Donald B.

2003-01-01

In the present studies we developed lentivirus vectors with regulated, consistent transgene expression in B lymphocytes by incorporating the immunoglobulin heavy chain enhancer (Eμ) with and without associated matrix attachment regions (EμMAR) into lentivirus vectors. Incorporation of these fragments upstream of phosphoglycerate kinase (PGK) or cytomegalovirus promoters resulted in a two- to threefold increase in enhanced green fluorescent protein (EGFP) mean fluorescence intensity (MFI) in B-lymphoid but not T-lymphoid, myeloid, fibroblast, or carcinoma cell lines. A 1-log increase in EGFP expression was observed in B-lymphoid cells (but not myeloid cells) differentiated from human CD34+ progenitors in vitro transduced with Eμ- and EμMAR-containing lentivectors. Lastly, we evaluated the expression from the EμMAR element in mice 2 to 24 weeks posttransplant with transduced hematopoietic stem cells. In mice receiving vectors with the Eμ and EμMAR elements upstream of the PGK promoter, there was a 2- to 10-fold increase in EGFP expression in B cells (but not other cell types). Evaluation of the coefficient of variation of expression among different cell types demonstrated that consistent, position-independent transgene expression was observed exclusively in B cells transduced with the EμMAR-containing vector and not other cells types or vectors. Proviral genomes with the EμMAR element had increased chromatin accessibility, which likely contributed to the position independence of expression in B lymphocytes. In summary, incorporation of the EμMAR element in lentivirus vectors resulted in enhanced, position-independent expression in primary B lymphocytes. These vectors provide a useful tool for the study of B-lymphocyte biology and the development of gene therapy for disorders affecting B lymphocytes, such as immune deficiencies. PMID:12805432

Generation of stable human cell lines with Tetracycline-inducible (Tet-on) shRNA or cDNA expression.

PubMed

Gomez-Martinez, Marta; Schmitz, Debora; Hergovich, Alexander

2013-03-05

A major approach in the field of mammalian cell biology is the manipulation of the expression of genes of interest in selected cell lines, with the aim to reveal one or several of the gene's function(s) using transient/stable overexpression or knockdown of the gene of interest. Unfortunately, for various cell biological investigations this approach is unsuitable when manipulations of gene expression result in cell growth/proliferation defects or unwanted cell differentiation. Therefore, researchers have adapted the Tetracycline repressor protein (TetR), taken from the E. coli tetracycline resistance operon(1), to generate very efficient and tight regulatory systems to express cDNAs in mammalian cells(2,3). In short, TetR has been modified to either (1) block initiation of transcription by binding to the Tet-operator (TO) in the promoter region upon addition of tetracycline (termed Tet-off system) or (2) bind to the TO in the absence of tetracycline (termed Tet-on system) (Figure 1). Given the inconvenience that the Tet-off system requires the continuous presence of tetracycline (which has a half-life of about 24 hr in tissue cell culture medium) the Tet-on system has been more extensively optimized, resulting in the development of very tight and efficient vector systems for cDNA expression as used here. Shortly after establishment of RNA interference (RNAi) for gene knockdown in mammalian cells(4), vectors expressing short-hairpin RNAs (shRNAs) were described that function very similar to siRNAs(5-11). However, these shRNA-mediated knockdown approaches have the same limitation as conventional knockout strategies, since stable depletion is not feasible when gene targets are essential for cellular survival. To overcome this limitation, van de Wetering et al.(12) modified the shRNA expression vector pSUPER(5) by inserting a TO in the promoter region, which enabled them to generate stable cell lines with tetracycline-inducible depletion of their target genes of interest. Here, we describe a method to efficiently generate stable human Tet-on cell lines that reliably drive either inducible overexpression or depletion of the gene of interest. Using this method, we have successfully generated Tet-on cell lines which significantly facilitated the analysis of the MST/hMOB/NDR cascade in centrosome(13,14) and apoptosis signaling(15,16). In this report, we describe our vectors of choice, in addition to describing the two consecutive manipulation steps that are necessary to efficiently generate human Tet-on cell lines (Figure 2). Moreover, besides outlining a protocol for the generation of human Tet-on cell lines, we will discuss critical aspects regarding the technical procedures and the characterization of Tet-on cells.

Hybrid lentivirus-phiC31-int-NLS vector allows site-specific recombination in murine and human cells but induces DNA damage.

PubMed

Grandchamp, Nicolas; Altémir, Dorothée; Philippe, Stéphanie; Ursulet, Suzanna; Pilet, Héloïse; Serre, Marie-Claude; Lenain, Aude; Serguera, Che; Mallet, Jacques; Sarkis, Chamsy

2014-01-01

Gene transfer allows transient or permanent genetic modifications of cells for experimental or therapeutic purposes. Gene delivery by HIV-derived lentiviral vector (LV) is highly effective but the risk of insertional mutagenesis is important and the random/uncontrollable integration of the DNA vector can deregulate the cell transcriptional activity. Non Integrative Lentiviral Vectors (NILVs) solve this issue in non-dividing cells, but they do not allow long term expression in dividing cells. In this context, obtaining stable expression while avoiding the problems inherent to unpredictable DNA vector integration requires the ability to control the integration site. One possibility is to use the integrase of phage phiC31 (phiC31-int) which catalyzes efficient site-specific recombination between the attP site in the phage genome and the chromosomal attB site of its Streptomyces host. Previous studies showed that phiC31-int is active in many eukaryotic cells, such as murine or human cells, and directs the integration of a DNA substrate into pseudo attP sites (pattP) which are homologous to the native attP site. In this study, we combined the efficiency of NILV for gene delivery and the specificity of phiC31-int for DNA substrate integration to engineer a hybrid tool for gene transfer with the aim of allowing long term expression in dividing and non-dividing cells preventing genotoxicity. We demonstrated the feasibility to target NILV integration in human and murine pattP sites with a dual NILV vectors system: one which delivers phiC31-int, the other which constitute the substrate containing an attB site in its DNA sequence. These promising results are however alleviated by the occurrence of significant DNA damages. Further improvements are thus required to prevent chromosomal rearrangements for a therapeutic use of the system. However, its use as a tool for experimental applications such as transgenesis is already applicable.

Versatile approach for functional analysis of human proteins and efficient stable cell line generation using FLP-mediated recombination system

PubMed Central

Szczesny, Roman J.; Kowalska, Katarzyna; Klosowska-Kosicka, Kamila; Chlebowski, Aleksander; Owczarek, Ewelina P.; Warkocki, Zbigniew; Kulinski, Tomasz M.; Adamska, Dorota; Affek, Kamila; Jedroszkowiak, Agata; Kotrys, Anna V.; Tomecki, Rafal; Krawczyk, Pawel S.; Borowski, Lukasz S.; Dziembowski, Andrzej

2018-01-01

Deciphering a function of a given protein requires investigating various biological aspects. Usually, the protein of interest is expressed with a fusion tag that aids or allows subsequent analyses. Additionally, downregulation or inactivation of the studied gene enables functional studies. Development of the CRISPR/Cas9 methodology opened many possibilities but in many cases it is restricted to non-essential genes. Recombinase-dependent gene integration methods, like the Flp-In system, are very good alternatives. The system is widely used in different research areas, which calls for the existence of compatible vectors and efficient protocols that ensure straightforward DNA cloning and generation of stable cell lines. We have created and validated a robust series of 52 vectors for streamlined generation of stable mammalian cell lines using the FLP recombinase-based methodology. Using the sequence-independent DNA cloning method all constructs for a given coding-sequence can be made with just three universal PCR primers. Our collection allows tetracycline-inducible expression of proteins with various tags suitable for protein localization, FRET, bimolecular fluorescence complementation (BiFC), protein dynamics studies (FRAP), co-immunoprecipitation, the RNA tethering assay and cell sorting. Some of the vectors contain a bidirectional promoter for concomitant expression of miRNA and mRNA, so that a gene can be silenced and its product replaced by a mutated miRNA-insensitive version. Our toolkit and protocols have allowed us to create more than 500 constructs with ease. We demonstrate the efficacy of our vectors by creating stable cell lines with various tagged proteins (numatrin, fibrillarin, coilin, centrin, THOC5, PCNA). We have analysed transgene expression over time to provide a guideline for future experiments and compared the effectiveness of commonly used inducers for tetracycline-responsive promoters. As proof of concept we examined the role of the exoribonuclease XRN2 in transcription termination by RNAseq. PMID:29590189

A Split-GFP Gateway Cloning System for Topology Analyses of Membrane Proteins in Plants.

PubMed

Xie, Wenjun; Nielsen, Mads Eggert; Pedersen, Carsten; Thordal-Christensen, Hans

2017-01-01

To understand the function of membrane proteins, it is imperative to know their topology. For such studies, a split green fluorescent protein (GFP) method is useful. GFP is barrel-shaped, consisting of 11 β-sheets. When the first ten β-sheets (GFP1-10) and the 11th β-sheet (GFP11) are expressed from separate genes they will self-assembly and reconstitute a fluorescent GFP protein. However, this will only occur when the two domains co-localize in the same cellular compartment. We have developed an easy-to-use Gateway vector set for determining on which side of the membrane the N- and C-termini are located. Two vectors were designed for making N- and C-terminal fusions between the membrane proteins-of-interest and GFP11, while another three plasmids were designed to express GFP1-10 in either the cytosol, the endoplasmic reticulum (ER) lumen or the apoplast. We tested functionality of the system by applying the vector set for the transmembrane domain, CNXTM, of the ER membrane protein, calnexin, after transient expression in Nicotiana benthamiana leaves. We observed GFP signal from the ER when we reciprocally co-expressed GFP11-CNXTM with GFP1-10-HDEL and CNXTM-GFP with cytosolic GFP1-10. The opposite combinations did not result in GFP signal emission. This test using the calnexin ER-membrane domain demonstrated its C-terminus to be in the cytosol and its N-terminus in the ER lumen. This result confirmed the known topology of calnexin, and we therefore consider this split-GFP system highly useful for ER membrane topology studies. Furthermore, the vector set provided is useful for detecting the topology of proteins on other membranes in the cell, which we confirmed for a plasma membrane syntaxin. The set of five Ti-plasmids are easily and efficiently used for Gateway cloning and transient transformation of N. benthamiana leaves.

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Expression of Rous sarcoma virus-derived retroviral vectors in the avian blastoderm: Potential as stable genetic markers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reddy, S.T.; Stoker, A.W.; Bissell, M.J.

1991-12-01

Retroviruses are valuable tools in studies of embryonic development, both as gene expression vectors and as cell lineage markers. In this study early chicken blastoderm cells are shown to be permissive for infection by Rous sarcoma virus and derivative replication-defective by Rous sarcoma virus and derivative replication-defective vectors, and, in contrast to previously published data, these cells will readily express viral genes. In cultured blastoderm cells, Rous sarcoma virus stably integrates and is transcribed efficiently, producing infectious virus particles. Using replication-defective vectors encoding the bacterial lacZ gene, the authors further show that blastoderms can be infected in culture and inmore » ovo. In ovo, lacZ expression is seen within 24 hours of virus inoculation, and by 96 hours stably expressing clones of cells are observed in diverse tissues throughout the embryo, including epidermis, somites, and heart, as well as in extraembryonic membranes. Given the rapid onset of vector expression and the broad range of permissive cell types, it should be feasible to use Rous sarcoma virus-derived retroviruses as early lineage markers and expression vectors beginning at the blastoderm stage of avian embryogenesis.« less

The Agrobacterium-mediated transformation of common wheat (Triticum aestivum L.) and triticale (x Triticosecale Wittmack): role of the binary vector system and selection cassettes.

PubMed

Bińka, Agnieszka; Orczyk, Wacław; Nadolska-Orczyk, Anna

2012-02-01

The influence of two binary vector systems, pGreen and pCAMBIA, on the Agrobacterium-mediated transformation ability of wheat and triticale was studied. Both vectors carried selection cassettes with bar or nptII driven by different promoters. Two cultivars of wheat, Kontesa and Torka, and one cultivar of triticale, Wanad, were tested. The transformation rates for the wheat cultivars ranged from 0.00 to 3.58% and from 0.00 to 6.79% for triticale. The best values for wheat were 3.58% for Kontesa and 3.14% for Torka, and these were obtained after transformation with the pGreen vector carrying the nptII selection gene under the control of 35S promoter. In the case of the bar selection system, the best transformation rates were, respectively, 1.46 and 1.79%. Such rates were obtained when the 35S::bar cassette was carried by the pCAMBIA vector; they were significantly lower with the pGreen vector. The triticale cultivar Wanad had its highest transformation rate after transformation with nptII driven by 35S in pCAMBIA. The bar selection system for the same triticale cultivar was better when the gene was driven by nos and the selection cassette was carried by pGreen. The integration of the transgenes was confirmed with at least three pairs of specific starters amplifying the fragments of nptII, bar, or gus. The expression of selection genes, measured by reverse transcriptase polymerase chain reaction (RT-PCR) in relation to the actin gene, was low, ranging from 0.00 to 0.63 for nptII and from 0.00 to 0.33 for bar. The highest relative transcript accumulation was observed for nptII driven by 35S and expressed in Kontesa that had been transformed with pGreen.

Adenoviral vector tethering to metal surfaces via hydrolysable cross-linkers for the modulation of vector release and transduction

PubMed Central

Fishbein, Ilia; Forbes, Scott P.; Chorny, Michael; Connolly, Jeanne M.; Adamo, Richard F.; Corrales, Ricardo; Alferiev, Ivan S.; Levy, Robert J.

2013-01-01

The use of arterial stents and other medical implants as a delivery platform for surface immobilized gene vectors allows for safe and efficient localized expression of therapeutic transgenes. In this study we investigate the use of hydrolysable cross-linkers with distinct kinetics of hydrolysis for delivery of gene vectors from polyallylamine bisphosphonate-modified metal surfaces. Three cross-linkers with the estimated t1/2 of ester bonds hydrolysis of 5, 12 and 50 days demonstrated a cumulative 20%, 39% and 45% vector release, respectively, after 30 days exposure to physiological buffer at 37°C. Transgene expression in endothelial and smooth muscles cells transduced with substrate immobilized adenovirus resulted in significantly different expression profiles for each individual cross-linker. Furthermore, immobilization of adenoviral vectors effectively extended their transduction effectiveness beyond the initial phase of release. Transgene expression driven by adenovirus-tethered stents in rat carotid arteries demonstrated that a faster rate of cross-linker hydrolysis resulted in higher expression levels at day 1, which declined by day 8 after stent implantation, while inversely, slower hydrolysis was associated with increased arterial expression at day 8 in comparison with day 1. In conclusion, adjustable release of transduction-competent adenoviral vectors from metallic surfaces can be achieved, both in vitro and in vivo, through surface immobilization of adenoviral vectors using hydrolysable cross-linkers with structure-specific release kinetics. PMID:23777912

Approaches to utilize mesenchymal progenitor cells as cellular vehicles.

PubMed

Pereboeva, L; Komarova, S; Mikheeva, G; Krasnykh, V; Curiel, D T

2003-01-01

Mammalian cells represent a novel vector approach for gene delivery that overcomes major drawbacks of viral and nonviral vectors and couples cell therapy with gene delivery. A variety of cell types have been tested in this regard, confirming that the ideal cellular vector system for ex vivo gene therapy has to comply with stringent criteria and is yet to be found. Several properties of mesenchymal progenitor cells (MPCs), such as easy access and simple isolation and propagation procedures, make these cells attractive candidates as cellular vehicles. In the current work, we evaluated the potential utility of MPCs as cellular vectors with the intent to use them in the cancer therapy context. When conventional adenoviral (Ad) vectors were used for MPC transduction, the highest transduction efficiency of MPCs was 40%. We demonstrated that Ad primary-binding receptors were poorly expressed on MPCs, while the secondary Ad receptors and integrins presented in sufficient amounts. By employing Ad vectors with incorporated integrin-binding motifs (Ad5lucRGD), MPC transduction was augmented tenfold, achieving efficient genetic loading of MPCs with reporter and anticancer genes. MPCs expressing thymidine kinase were able to exert a bystander killing effect on the cancer cell line SKOV3ip1 in vitro. In addition, we found that MPCs were able to support Ad replication, and thus can be used as cell vectors to deliver oncolytic viruses. Our results show that MPCs can foster expression of suicide genes or support replication of adenoviruses as potential anticancer therapeutic payloads. These findings are consistent with the concept that MPCs possess key properties that ensure their employment as cellular vehicles and can be used to deliver either therapeutic genes or viruses to tumor sites.

Adenovirus Vector Pseudotyping in Fiber-Expressing Cell Lines: Improved Transduction of Epstein-Barr Virus-Transformed B Cells

PubMed Central

Von Seggern, Dan J.; Huang, Shuang; Fleck, Shonna Kaye; Stevenson, Susan C.; Nemerow, Glen R.

2000-01-01

While adenovirus (Ad) gene delivery vectors are useful in many gene therapy applications, their broad tropism means that they cannot be directed to a specific target cell. There are also a number of cell types involved in human disease which are not transducible with standard Ad vectors, such as Epstein-Barr virus (EBV)-transformed B lymphocytes. Adenovirus binds to host cells via the viral fiber protein, and Ad vectors have previously been retargeted by modifying the fiber gene on the viral chromosome. This requires that the modified fiber be able to bind to the cell in which the vector is grown, which prevents truly specific vector targeting. We previously reported a gene delivery system based on a fiber gene-deleted Ad type 5 (Ad5) vector (Ad5.βgal.ΔF) and packaging cells that express the viral fiber protein. Expression of different fibers in packaging cells will allow Ad retargeting without modifying the viral chromosome. Importantly, fiber proteins which can no longer bind to the producer cells can also be used. Using this approach, we generated for the first time pseudotyped Ad5.βgal.ΔF particles containing either the wild-type Ad5 fiber protein or a chimeric fiber with the receptor-binding knob domain of the Ad3 fiber. Particles equipped with the chimeric fiber bound to the Ad3 receptor rather than the coxsackievirus-adenovirus receptor protein used by Ad5. EBV-transformed B lymphocytes were infected efficiently by the Ad3-pseudotyped particles but poorly by virus containing the Ad5 fiber protein. The strategy described here represents a broadly applicable method for targeting gene delivery to specific cell types. PMID:10590124

Direct expression and validation of phage-selected peptide variants in mammalian cells.

PubMed

Quinlan, Brian D; Gardner, Matthew R; Joshi, Vinita R; Chiang, Jessica J; Farzan, Michael

2013-06-28

Phage display is a key technology for the identification and maturation of high affinity peptides, antibodies, and other proteins. However, limitations of bacterial expression restrict the range and sensitivity of assays that can be used to evaluate phage-selected variants. To address this problem, selected genes are typically transferred to mammalian expression vectors, a major rate-limiting step in the iterative improvement of peptides and proteins. Here we describe a system that combines phage display and efficient mammalian expression in a single vector, pDQ1. This system permits immediate expression of phage-selected genes as IgG1-Fc fusions in mammalian cells, facilitating the rapid, sensitive characterization of a large number of library outputs for their biochemical and functional properties. We demonstrate the utility of this system by improving the ability of a CD4-mimetic peptide to bind the HIV-1 envelope glycoprotein and neutralize HIV-1 entry. We further improved the potency of the resulting peptide, CD4mim6, by limiting its ability to induce the CD4-bound conformation of the envelope glycoprotein. Thus, CD4mim6 and its variants can be used to investigate the properties of the HIV-1 envelope glycoprotein, and pDQ1 can accelerate the discovery of new peptides and proteins through phage display.

Kinematic sensitivity of robot manipulators

NASA Technical Reports Server (NTRS)

Vuskovic, Marko I.

1989-01-01

Kinematic sensitivity vectors and matrices for open-loop, n degrees-of-freedom manipulators are derived. First-order sensitivity vectors are defined as partial derivatives of the manipulator's position and orientation with respect to its geometrical parameters. The four-parameter kinematic model is considered, as well as the five-parameter model in case of nominally parallel joint axes. Sensitivity vectors are expressed in terms of coordinate axes of manipulator frames. Second-order sensitivity vectors, the partial derivatives of first-order sensitivity vectors, are also considered. It is shown that second-order sensitivity vectors can be expressed as vector products of the first-order sensitivity vectors.

Lentiviral vectors encoding shRNAs efficiently transduce and knockdown LINGO-1 but induce an interferon response and cytotoxicity in CNS neurons

PubMed Central

Hutson, Thomas H.; Foster, Edmund; Dawes, John M.; Hindges, Robert; Yáñez-Muñoz, Rafael J.; Moon, Lawrence D.F.

2017-01-01

Background Knocking down neuronal LINGO-1 using short hairpin RNAs (shRNAs) might enhance axon regeneration in the CNS. Integration-deficient lentiviral vectors have great potential as a therapeutic delivery system for CNS injuries. However, recent studies have revealed that shRNAs can induce an interferon response resulting in off-target effects and cytotoxicity. Methods CNS neurons were transduced with integration-deficient lentiviral vectors in vitro. The transcriptional effect of shRNA expression was analysed using qRT-PCR and northern blots were used to assess shRNA production. Results Integration-deficient lentiviral vectors efficiently transduced CNS neurons and knocked down LINGO-1 mRNA in vitro. However, an increase in cell death was observed when lentiviral vectors encoding an shRNA were applied or when high vector concentrations were used. We demonstrate that high doses of vector or the use of vectors encoding shRNAs can induce an up-regulation of interferon stimulated genes (OAS1 and PKR) and a down-regulation of off- target genes (including p75NTR and NgR1). Furthermore, the northern blot demonstrated that these negative consequences occur even when lentiviral vectors express low levels of shRNAs. Together, these results may explain why neurite outgrowth was not enhanced on an inhibitory substrate after transduction with lentiviral vectors encoding an shRNA targeting LINGO-1. Conclusions These findings highlight the importance of including appropriate controls to verify silencing specificity and the requirement to check for an interferon response when conducting RNA interference experiments. However, the potential benefits that RNA interference and viral vectors offer to gene-based therapies to CNS injuries cannot be overlooked and demand further investigation. PMID:22499506

Glymphatic fluid transport controls paravascular clearance of AAV vectors from the brain

PubMed Central

Murlidharan, Giridhar; Crowther, Andrew; Reardon, Rebecca A.; Song, Juan

2016-01-01

Adeno-associated viruses (AAV) are currently being evaluated in clinical trials for gene therapy of CNS disorders. However, host factors that influence the spread, clearance, and transduction efficiency of AAV vectors in the brain are not well understood. Recent studies have demonstrated that fluid flow mediated by aquaporin-4 (AQP4) channels located on astroglial end feet is essential for exchange of solutes between interstitial and cerebrospinal fluid. This phenomenon, which is essential for interstitial clearance of solutes from the CNS, has been termed glial-associated lymphatic transport or glymphatic transport. In the current study, we demonstrate that glymphatic transport profoundly affects various aspects of AAV gene transfer in the CNS. Altered localization of AQP4 in aged mouse brains correlated with significantly increased retention of AAV vectors in the parenchyma and reduced systemic leakage following ventricular administration. We observed a similar increase in AAV retention and transgene expression upon i.c.v. administration in AQP4–/– mice. Consistent with this observation, fluorophore-labeled AAV vectors showed markedly reduced flux from the ventricles of AQP4–/– mice compared with WT mice. These results were further corroborated by reduced AAV clearance from the AQP4-null brain, as demonstrated by reduced transgene expression and vector genome accumulation in systemic organs. We postulate that deregulation of glymphatic transport in aged and diseased brains could markedly affect the parenchymal spread, clearance, and gene transfer efficiency of AAV vectors. Assessment of biomarkers that report the kinetics of CSF flux in prospective gene therapy patients might inform variable treatment outcomes and guide future clinical trial design. PMID:27699236

Engineering zucchini yellow mosaic potyvirus as a non-pathogenic vector for expression of heterologous proteins in cucurbits.

PubMed

Arazi, T; Slutsky, S G; Shiboleth, Y M; Wang, Y; Rubinstein, M; Barak, S; Yang, J; Gal-On, A

2001-04-27

Plant virus vectors provide an attractive biotechnological tool for the transient expression of foreign genes in whole plants. As yet there has been no use of recombinant viruses for the improvement of commercial crops. This is mainly because the viruses used to create vectors usually cause significant yield loss and can be transmitted in the field. A novel attenuated zucchini yellow mosaic potyvirus (AG) was used for the development of an environmentally safe non-pathogenic virus vector. The suitability of AG as an expression vector in plants was tested by analysis of two infectious viral constructs, each containing a distinct gene insertion site. Introduction of a foreign viral coat protein gene into AG genome between the P1 and HC-Pro genes, resulted in no expression in planta. In contrast, the same gene was stably expressed when inserted between NIb and CP genes, suggesting that this site is more suitable for a gene vector. Virus-mediated expression of reporter genes was observed in squash and cucumber leaves, stems, roots and edible fruit. Furthermore, AG stably expressed human interferon-alpha 2, an important human anti-viral drug, without affecting plant development and yield. Interferon biological activity was measured in cucumber and squash fruit. Together, these data corroborate a biotechnological utility of AG as a non-pathogenic vector for the expression of a foreign gene, as a benefit trait, in cucurbits and their edible fruit.

A Potent, Imaging Adenoviral Vector Driven by the Cancer-selective Mucin-1 Promoter That Targets Breast Cancer Metastasis

PubMed Central

Huyn, Steven T.; Burton, Jeremy B.; Sato, Makoto; Carey, Michael; Gambhir, Sanjiv S.; Wu, Lily

2009-01-01

Purpose With breast cancer, early detection and proper staging are critical, and will often influence both the treatment regimen and the therapeutic outcome for those affected with this disease. Improvements in these areas will play a profound role in reducing mortality from breast cancer. Experimental Design In this work we developed a breast cancer – targeted serotype 5 adenoviral vector, utilizing the tumor-specific mucin-1 promoter in combination with the two-step transcriptional amplification system, a system used to augment the activity of weak tissue – specific promoters. Results We showed the strong specificity of this tumor-selective adenovirus to express the luciferase optical imaging gene, leading to diagnostic signals that enabled detection of sentinel lymph node metastasis of breast cancer. Furthermore, we were able to target hepatic metastases following systemic administration of this mucin-1 selective virus. Conclusions Collectively, we showed that the amplified mucin-1 promoter – driven vector is able to deliver to and selectively express a desirable transgene in metastatic lesions of breast tumors. This work has strong clinical relevance to current diagnostic staging approaches, and could add to targeted therapeutic strategies to advance the fight against breast cancer. PMID:19366829

Identification of the subgenomic promoter of the coat protein gene of cucumber fruit mottle mosaic virus and development of a heterologous expression vector.

PubMed

Rhee, Sun-Ju; Jang, Yoon Jeong; Lee, Gung Pyo

2016-06-01

Heterologous gene expression using plant virus vectors enables research on host-virus interactions and the production of useful proteins, but the host range of plant viruses limits the practical applications of such vectors. Here, we aimed to develop a viral vector based on cucumber fruit mottle mosaic virus (CFMMV), a member of the genus Tobamovirus, whose members infect cucurbits. The subgenomic promoter (SGP) in the coat protein (CP) gene, which was used to drive heterologous expression, was mapped by analyzing deletion mutants from a CaMV 35S promoter-driven infectious CFMMV clone. The region from nucleotides (nt) -55 to +160 relative to the start codon of the open reading frame (ORF) of CP was found to be a fully active promoter, and the region from nt -55 to +100 was identified as the active core promoter. Based on these SGPs, we constructed a cloning site in the CFMMV vector and successfully expressed enhanced green fluorescent protein (EGFP) in Nicotiana benthamiana and watermelon (Citrullus lanatus). Co-inoculation with the P19 suppressor increased EGFP expression and viral replication by blocking degradation of the viral genome. Our CFMMV vector will be useful as an expression vector in cucurbits.

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases

PubMed Central

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T. Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L.; Peterson, James J.; Boye, Shannon E.; Hauswirth, William W.; Chulay, Jeffrey D.

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia. PMID:26603570

Cone-Specific Promoters for Gene Therapy of Achromatopsia and Other Retinal Diseases.

PubMed

Ye, Guo-Jie; Budzynski, Ewa; Sonnentag, Peter; Nork, T Michael; Sheibani, Nader; Gurel, Zafer; Boye, Sanford L; Peterson, James J; Boye, Shannon E; Hauswirth, William W; Chulay, Jeffrey D

2016-01-01

Adeno-associated viral (AAV) vectors containing cone-specific promoters have rescued cone photoreceptor function in mouse and dog models of achromatopsia, but cone-specific promoters have not been optimized for use in primates. Using AAV vectors administered by subretinal injection, we evaluated a series of promoters based on the human L-opsin promoter, or a chimeric human cone transducin promoter, for their ability to drive gene expression of green fluorescent protein (GFP) in mice and nonhuman primates. Each of these promoters directed high-level GFP expression in mouse photoreceptors. In primates, subretinal injection of an AAV-GFP vector containing a 1.7-kb L-opsin promoter (PR1.7) achieved strong and specific GFP expression in all cone photoreceptors and was more efficient than a vector containing the 2.1-kb L-opsin promoter that was used in AAV vectors that rescued cone function in mouse and dog models of achromatopsia. A chimeric cone transducin promoter that directed strong GFP expression in mouse and dog cone photoreceptors was unable to drive GFP expression in primate cones. An AAV vector expressing a human CNGB3 gene driven by the PR1.7 promoter rescued cone function in the mouse model of achromatopsia. These results have informed the design of an AAV vector for treatment of patients with achromatopsia.

Adeno-associated virus serotype 8 efficiently delivers genes to muscle and heart.

PubMed

Wang, Zhong; Zhu, Tong; Qiao, Chunping; Zhou, Liqiao; Wang, Bing; Zhang, Jian; Chen, Chunlian; Li, Juan; Xiao, Xiao

2005-03-01

Systemic gene delivery into muscle has been a major challenge for muscular dystrophy gene therapy, with capillary blood vessels posing the principle barrier and limiting vector dissemination. Previous efforts to deliver genes into multiple muscles have relied on isolated vessel perfusion or pharmacological interventions to enforce broad vector distribution. We compared the efficiency of multiple adeno-associated virus (AAV) vectors after a single injection via intraperitoneal or intravenous routes without additional intervention. We show that AAV8 is the most efficient vector for crossing the blood vessel barrier to attain systemic gene transfer in both skeletal and cardiac muscles of mice and hamsters. Serotypes such as AAV1 and AAV6, which demonstrate robust infection in skeletal muscle cells, were less effective in crossing the blood vessel barrier. Gene expression persisted in muscle and heart, but diminished in tissues undergoing rapid cell division, such as neonatal liver. This technology should prove useful for muscle-directed systemic gene therapy.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

Adenovirus vector infection of non-small-cell lung cancer cells is a trigger for multi-drug resistance mediated by P-glycoprotein.

PubMed

Tomono, Takumi; Kajita, Masahiro; Yano, Kentaro; Ogihara, Takuo

2016-08-05

P-glycoprotein (P-gp) is an ATP-binding cassette protein involved in cancer multi-drug resistance (MDR). It has been reported that infection with some bacteria and viruses induces changes in the activities of various drug-metabolizing enzymes and transporters, including P-gp. Although human adenoviruses (Ad) cause the common cold, the effect of Ad infection on MDR in cancer has not been established. In this study, we investigated whether Ad infection is a cause of MDR in A549, H441 and HCC827 non-small-cell lung cancer (NSCLC) cell lines, using an Ad vector system. We found that Ad vector infection of NSCLC cell lines induced P-gp mRNA expression, and the extent of induction was dependent on the number of Ad vector virus particles and the infection time. Heat-treated Ad vector, which is not infectious, did not alter P-gp mRNA expression. Uptake experiments with doxorubicin (DOX), a P-gp substrate, revealed that DOX accumulation was significantly decreased in Ad vector-infected A549 cells. The decrease of DOX uptake was blocked by verapamil, a P-gp inhibitor. Our results indicated that Ad vector infection of NSCLC cells caused MDR mediated by P-gp overexpression. The Ad vector genome sequence is similar to that of human Ad, and therefore human Ad infection of lung cancer patients may lead to chemoresistance in the clinical environment. Copyright © 2016 Elsevier Inc. All rights reserved.

A Partial E3 Deletion in Replication-Defective Adenoviral Vectors Allows for Stable Expression of Potentially Toxic Transgene Products.

PubMed

Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J

2016-10-01

Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.

Alpharetroviral Self-inactivating Vectors: Long-term Transgene Expression in Murine Hematopoietic Cells and Low Genotoxicity

PubMed Central

Suerth, Julia D; Maetzig, Tobias; Brugman, Martijn H; Heinz, Niels; Appelt, Jens-Uwe; Kaufmann, Kerstin B; Schmidt, Manfred; Grez, Manuel; Modlich, Ute; Baum, Christopher; Schambach, Axel

2012-01-01

Comparative integrome analyses have highlighted alpharetroviral vectors with a relatively neutral, and thus favorable, integration spectrum. However, previous studies used alpharetroviral vectors harboring viral coding sequences and intact long-terminal repeats (LTRs). We recently developed self-inactivating (SIN) alpharetroviral vectors with an advanced split-packaging design. In a murine bone marrow (BM) transplantation model we now compared alpharetroviral, gammaretroviral, and lentiviral SIN vectors and showed that all vectors transduced hematopoietic stem cells (HSCs), leading to comparable, sustained multilineage transgene expression in primary and secondary transplanted mice. Alpharetroviral integrations were decreased near transcription start sites, CpG islands, and potential cancer genes compared with gammaretroviral, and decreased in genes compared with lentiviral integrations. Analyzing the transcriptome and intragenic integrations in engrafting cells, we observed stronger correlations between in-gene integration targeting and transcriptional activity for gammaretroviral and lentiviral vectors than for alpharetroviral vectors. Importantly, the relatively “extragenic” alpharetroviral integration pattern still supported long-term transgene expression upon serial transplantation. Furthermore, sensitive genotoxicity studies revealed a decreased immortalization incidence compared with gammaretroviral and lentiviral SIN vectors. We conclude that alpharetroviral SIN vectors have a favorable integration pattern which lowers the risk of insertional mutagenesis while supporting long-term transgene expression in the progeny of transplanted HSCs. PMID:22334016

Large inserts for big data: artificial chromosomes in the genomic era.

PubMed

Tocchetti, Arianna; Donadio, Stefano; Sosio, Margherita

2018-05-01

The exponential increase in available microbial genome sequences coupled with predictive bioinformatic tools is underscoring the genetic capacity of bacteria to produce an unexpected large number of specialized bioactive compounds. Since most of the biosynthetic gene clusters (BGCs) present in microbial genomes are cryptic, i.e. not expressed under laboratory conditions, a variety of cloning systems and vectors have been devised to harbor DNA fragments large enough to carry entire BGCs and to allow their transfer in suitable heterologous hosts. This minireview provides an overview of the vectors and approaches that have been developed for cloning large BGCs, and successful examples of heterologous expression.

Global Screening of Antiviral Genes that Suppress Baculovirus Transgene Expression in Mammalian Cells.

PubMed

Wang, Chia-Hung; Naik, Nenavath Gopal; Liao, Lin-Li; Wei, Sung-Chan; Chao, Yu-Chan

2017-09-15

Although baculovirus has been used as a safe and convenient gene delivery vector in mammalian cells, baculovirus-mediated transgene expression is less effective in various mammalian cell lines. Identification of the negative regulators in host cells is necessary to improve baculovirus-based expression systems. Here, we performed high-throughput shRNA library screening, targeting 176 antiviral innate immune genes, and identified 43 host restriction factor genes in a human A549 lung carcinoma cell line. Among them, suppression of receptor interaction protein kinase 1 (RIP1, also known as RIPK1) significantly increased baculoviral transgene expression without resulting in significant cell death. Silencing of RIP1 did not affect viral entry or cell viability, but it did inhibit nuclear translocation of the IRF3 and NF-κB transcription factors. Also, activation of downstream signaling mediators (such as TBK1 and IRF7) was affected, and subsequent interferon and cytokine gene expression levels were abolished. Further, Necrostatin-1 (Nec-1)-an inhibitor of RIP1 kinase activity-dramatically increased baculoviral transgene expression in RIP1-silenced cells. Using baculovirus as a model system, this study presents an initial investigation of large numbers of human cell antiviral innate immune response factors against a "nonadaptive virus." In addition, our study has made baculovirus a more efficient gene transfer vector for some of the most frequently used mammalian cell systems.

“Stealth” Adenoviruses Blunt Cell-Mediated and Humoral Immune Responses against the Virus and Allow for Significant Gene Expression upon Readministration in the Lung

PubMed Central

Croyle, Maria A.; Chirmule, Narendra; Zhang, Yi; Wilson, James M.

2001-01-01

Most of the early gene therapy trials for cystic fibrosis have been with adenovirus vectors. First-generation viruses with E1a and E1b deleted are limited by transient expression of the transgene and substantial inflammatory responses. Gene transfer is also significantly curtailed following a second dose of virus. In an effort to reduce adenovirus-associated inflammation, capsids of first-generation vectors were modified with various activated monomethoxypolyethylene glycols. Cytotoxic T-lymphocyte production was significantly reduced in C57BL/6 mice after a single intratracheal administration of modified vectors, and length of gene expression was extended from 4 to 42 days. T-cell subsets from mice exposed to the conjugated vectors demonstrated a marked decrease in Th1 responses and slight enhancement of Th2 responses compared to animals dosed with native virus. Neutralizing antibodies (NAB) against adenovirus capsid proteins were reduced in serum and bronchoalveolar lavage fluid of animals after a single dose of modified virus, allowing significant levels of gene expression upon rechallenge with native adenovirus. Modification with polyethylene glycol (PEG) also allowed substantial gene expression from the new vectors in animals previously immunized with unmodified virus. However, gene expression was significantly reduced after two doses of the same PEG-conjugated vector. Alternating the activation group of PEG between doses did produce significant gene expression upon readministration. This technology in combination with second-generation or helper-dependent adenovirus could produce dosing strategies which promote successful readministration of vector in clinical trials and marked expression in patients with significant anti-adenovirus NAB levels and reduce the possibility of immune reactions against viral vectors for gene therapy. PMID:11312351

Large-scale adenovirus and poxvirus-vectored vaccine manufacturing to enable clinical trials.

PubMed

Kallel, Héla; Kamen, Amine A

2015-05-01

Efforts to make vaccines against infectious diseases and immunotherapies for cancer have evolved to utilize a variety of heterologous expression systems such as viral vectors. These vectors are often attenuated or engineered to safely deliver genes encoding antigens of different pathogens. Adenovirus and poxvirus vectors are among the viral vectors that are most frequently used to develop prophylactic vaccines against infectious diseases as well as therapeutic cancer vaccines. This mini-review describes the trends and processes in large-scale production of adenovirus and poxvirus vectors to meet the needs of clinical applications. We briefly describe the general principles for the production and purification of adenovirus and poxvirus viral vectors. Currently, adenovirus and poxvirus vector manufacturing methods rely on well-established cell culture technologies. Several improvements have been evaluated to increase the yield and to reduce the overall manufacturing cost, such as cultivation at high cell densities and continuous downstream processing. Additionally, advancements in vector characterization will greatly facilitate the development of novel vectored vaccine candidates. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Efficient Sleeping Beauty DNA Transposition From DNA Minicircles

PubMed Central

Sharma, Nynne; Cai, Yujia; Bak, Rasmus O; Jakobsen, Martin R; Schrøder, Lisbeth Dahl; Mikkelsen, Jacob Giehm

2013-01-01

DNA transposon-based vectors have emerged as new potential delivery tools in therapeutic gene transfer. Such vectors are now showing promise in hematopoietic stem cells and primary human T cells, and clinical trials with transposon-engineered cells are on the way. However, the use of plasmid DNA as a carrier of the vector raises safety concerns due to the undesirable administration of bacterial sequences. To optimize vectors based on the Sleeping Beauty (SB) DNA transposon for clinical use, we examine here SB transposition from DNA minicircles (MCs) devoid of the bacterial plasmid backbone. Potent DNA transposition, directed by the hyperactive SB100X transposase, is demonstrated from MC donors, and the stable transfection rate is significantly enhanced by expressing the SB100X transposase from MCs. The stable transfection rate is inversely related to the size of circular donor, suggesting that a MC-based SB transposition system benefits primarily from an increased cellular uptake and/or enhanced expression which can be observed with DNA MCs. DNA transposon and transposase MCs are easily produced, are favorable in size, do not carry irrelevant DNA, and are robust substrates for DNA transposition. In accordance, DNA MCs should become a standard source of DNA transposons not only in therapeutic settings but also in the daily use of the SB system. PMID:23443502

A rapid generation of adenovirus vector with a genetic modification in hexon protein.

PubMed

Di, Bingyan; Mao, Qinwen; Zhao, Junli; Li, Xing; Wang, Dongyang; Xia, Haibin

2012-02-10

The generation of hexon-modified adenovirus vector has proven difficult. In this paper, we developed a novel method for rapid generation of hexon-modified adenoviral vector via one step ligation in vitro followed by quick white/blue color screening. The new system has the following features. First, eGFP expression driven by the CMV promoter in E1 region functions as a reporter to evaluate the tropism of hexon-modified adenovirus in vitro. Second, it has two unique restriction enzyme sites with sticky ends located in the hexon HVR5 region. Third, a lacZ expression cassette under the control of plac promoter is placed between the two restriction enzyme sites, which allows recombinants to be selected using blue/white screening. To prove the principle of the method, genetically modified adenoviruses were successfully produced by insertion of NGR, RGD or Tat PTD peptide into hexon HVR5. Furthermore, the transduction efficiency of the Tat PTD modified virus was shown to be a significant enhancement in A172 and CHO-K1 cells. In conclusion, the novel system makes the production of truly retargeted vectors more promising, which would be of substantial benefit for cancer gene therapy. Copyright © 2012 Elsevier B.V. All rights reserved.

Forces Associated with Nonlinear Nonholonomic Constraint Equations

NASA Technical Reports Server (NTRS)

Roithmayr, Carlos M.; Hodges, Dewey H.

2010-01-01

A concise method has been formulated for identifying a set of forces needed to constrain the behavior of a mechanical system, modeled as a set of particles and rigid bodies, when it is subject to motion constraints described by nonholonomic equations that are inherently nonlinear in velocity. An expression in vector form is obtained for each force; a direction is determined, together with the point of application. This result is a consequence of expressing constraint equations in terms of dot products of vectors rather than in the usual way, which is entirely in terms of scalars and matrices. The constraint forces in vector form are used together with two new analytical approaches for deriving equations governing motion of a system subject to such constraints. If constraint forces are of interest they can be brought into evidence in explicit dynamical equations by employing the well-known nonholonomic partial velocities associated with Kane's method; if they are not of interest, equations can be formed instead with the aid of vectors introduced here as nonholonomic partial accelerations. When the analyst requires only the latter, smaller set of equations, they can be formed directly; it is not necessary to expend the labor to form the former, larger set first and subsequently perform matrix multiplications.

Gene Therapy with the Sleeping Beauty Transposon System.

PubMed

Kebriaei, Partow; Izsvák, Zsuzsanna; Narayanavari, Suneel A; Singh, Harjeet; Ivics, Zoltán

2017-11-01

The widespread clinical implementation of gene therapy requires the ability to stably integrate genetic information through gene transfer vectors in a safe, effective, and economical manner. The latest generation of Sleeping Beauty (SB) transposon vectors fulfills these requirements, and may overcome limitations associated with viral gene transfer vectors and transient nonviral gene delivery approaches that are prevalent in ongoing clinical trials. The SB system enables high-level stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, thereby representing a highly attractive gene transfer strategy for clinical use. Here, we review the most important aspects of using SB for gene therapy, including vectorization as well as genomic integration features. We also illustrate the path to successful clinical implementation by highlighting the application of chimeric antigen receptor (CAR)-modified T cells in cancer immunotherapy. Copyright © 2017 Elsevier Ltd. All rights reserved.

Foamy Virus Vector-mediated Gene Correction of a Mouse Model of Wiskott–Aldrich Syndrome

PubMed Central

Uchiyama, Toru; Adriani, Marsilio; Jagadeesh, G Jayashree; Paine, Adam; Candotti, Fabio

2012-01-01

The Wiskott–Aldrich syndrome (WAS) is an X-linked disorder characterized by eczema, thrombocytopenia and immunodeficiency. Hematopoietic cell transplantation can cure the disease and gene therapy is being tested as an alternative treatment option. In this study, we assessed the use of foamy virus (FV) vectors as a gene transfer system for WAS, using a Was knockout (KO) mouse model. Preliminary experiments using FV vectors expressing the green fluorescent protein under the transcriptional control of the endogenous WAS promoter or a ubiquitously acting chromatin opening element allowed us to define transduction conditions resulting in high (>40%) and long-term in-vivo marking of blood cells after transplantation. In following experiments, Was KO mice were treated with FV vectors containing the human WAS complementary DNA (cDNA). Transplanted animals expressed the WAS protein (WASp) in T and B lymphocytes, as well as platelets and showed restoration of both T-cell receptor-mediated responses and B-cell migration. We also observed recovery of platelet adhesion and podosome formation in dendritic cells (DCs) of treated mice. These data demonstrate that FV vectors can be effective for hematopoietic stem cell (HSC)-directed gene correction of WAS. PMID:22215016

Cre-lox Univector acceptor vectors for functional screening in protoplasts: analysis of Arabidopsis donor cDNAs encoding ABSCISIC ACID INSENSITIVE1-Like protein phosphatases

PubMed Central

Jia, Fan; Gampala, Srinivas S.L.; Mittal, Amandeep; Luo, Qingjun; Rock, Christopher D.

2009-01-01

The 14,200 available full length Arabidopsis thaliana cDNAs in the Universal Plasmid System (UPS) donor vector pUNI51 should be applied broadly and efficiently to leverage a “functional map-space” of homologous plant genes. We have engineered Cre-lox UPS host acceptor vectors (pCR701- 705) with N-terminal epitope tags in frame with the loxH site and downstream from the maize Ubiquitin promoter for use in transient protoplast expression assays and particle bombardment transformation of monocots. As an example of the utility of these vectors, we recombined them with several Arabidopsis cDNAs encoding Ser/Thr protein phosphatase type 2C (PP2Cs) known from genetic studies or predicted by hierarchical clustering meta-analysis to be involved in ABA and stress responses. Our functional results in Zea mays mesophyll protoplasts on ABA-inducible expression effects on the Late Embryogenesis Abundant promoter ProEm:GUS reporter were consistent with predictions and resulted in identification of novel activities of some PP2Cs. Deployment of these vectors can facilitate functional genomics and proteomics and identification of novel gene activities. PMID:19499346

Optimized Lentiviral Vector Design Improves Titer and Transgene Expression of Vectors Containing the Chicken β-Globin Locus HS4 Insulator Element

PubMed Central

Hanawa, Hideki; Yamamoto, Motoko; Zhao, Huifen; Shimada, Takashi; Persons, Derek A

2009-01-01

Hematopoietic cell gene therapy using retroviral vectors has achieved success in clinical trials. However, safety issues regarding vector insertional mutagenesis have emerged. In two different trials, vector insertion resulted in the transcriptional activation of proto-oncogenes. One strategy for potentially diminishing vector insertional mutagenesis is through the use of self-inactivating lentiviral vectors containing the 1.2-kb insulator element derived from the chicken β-globin locus. However, use of this element can dramatically decrease both vector titer and transgene expression, thereby compromising its practical use. Here, we studied lentiviral vectors containing either the full-length 1.2-kb insulator or the smaller 0.25-kb core element in both orientations in the partially deleted long-terminal repeat. We show that use of the 0.25-kb core insulator rescued vector titer by alleviating a postentry block to reverse transcription associated with the 1.2-kb element. In addition, in an orientation-dependent manner, the 0.25-kb core element significantly increased transgene expression from an internal promoter due to improved transcriptional termination. This element also demonstrated barrier activity, reducing variability of expression due to position effects. As it is known that the 0.25-kb core insulator has enhancer-blocking activity, this particular insulated lentiviral vector design may be useful for clinical application. PMID:19223867

Design of a muscle cell-specific expression vector utilising human vascular smooth muscle alpha-actin regulatory elements.

PubMed

Keogh, M C; Chen, D; Schmitt, J F; Dennehy, U; Kakkar, V V; Lemoine, N R

1999-04-01

The facility to direct tissue-specific expression of therapeutic gene constructs is desirable for many gene therapy applications. We describe the creation of a muscle-selective expression vector which supports transcription in vascular smooth muscle, cardiac muscle and skeletal muscle, while it is essentially silent in other cell types such as endothelial cells, hepatocytes and fibroblasts. Specific transcriptional regulatory elements have been identified in the human vascular smooth muscle cell (VSMC) alpha-actin gene, and used to create an expression vector which directs the expression of genes in cis to muscle cells. The vector contains an enhancer element we have identified in the 5' flanking region of the human VSMC alpha-actin gene involved in mediating VSMC expression. Heterologous pairing experiments have shown that the enhancer does not interact with the basal transcription complex recruited at the minimal SV40 early promoter. Such a vector has direct application in the modulation of VSMC proliferation associated with intimal hyperplasia/restenosis.

Controllability in nonlinear systems

NASA Technical Reports Server (NTRS)

Hirschorn, R. M.

1975-01-01

An explicit expression for the reachable set is obtained for a class of nonlinear systems. This class is described by a chain condition on the Lie algebra of vector fields associated with each nonlinear system. These ideas are used to obtain a generalization of a controllability result for linear systems in the case where multiplicative controls are present.

Bacteriophage Mediates Efficient Gene Transfer in Combination with Conventional Transfection Reagents

PubMed Central

Donnelly, Amanda; Yata, Teerapong; Bentayebi, Kaoutar; Suwan, Keittisak; Hajitou, Amin

2015-01-01

The development of commercially available transfection reagents for gene transfer applications has revolutionized the field of molecular biology and scientific research. However, the challenge remains in ensuring that they are efficient, safe, reproducible and cost effective. Bacteriophage (phage)-based viral vectors have the potential to be utilized for general gene transfer applications within research and industry. Yet, they require adaptations in order to enable them to efficiently enter cells and overcome mammalian cellular barriers, as they infect bacteria only; furthermore, limited progress has been made at increasing their efficiency. The production of a novel hybrid nanocomplex system consisting of two different nanomaterial systems, phage vectors and conventional transfection reagents, could overcome these limitations. Here we demonstrate that the combination of cationic lipids, cationic polymers or calcium phosphate with M13 bacteriophage-derived vectors, engineered to carry a mammalian transgene cassette, resulted in increased cellular attachment, entry and improved transgene expression in human cells. Moreover, addition of a targeting ligand into the nanocomplex system, through genetic engineering of the phage capsid further increased gene expression and was effective in a stable cell line generation application. Overall, this new hybrid nanocomplex system (i) provides enhanced phage-mediated gene transfer; (ii) is applicable for laboratory transfection processes and (iii) shows promise within industry for large-scale gene transfer applications. PMID:26670247

Bacteriophage Mediates Efficient Gene Transfer in Combination with Conventional Transfection Reagents.

PubMed

Donnelly, Amanda; Yata, Teerapong; Bentayebi, Kaoutar; Suwan, Keittisak; Hajitou, Amin

2015-12-08

The development of commercially available transfection reagents for gene transfer applications has revolutionized the field of molecular biology and scientific research. However, the challenge remains in ensuring that they are efficient, safe, reproducible and cost effective. Bacteriophage (phage)-based viral vectors have the potential to be utilized for general gene transfer applications within research and industry. Yet, they require adaptations in order to enable them to efficiently enter cells and overcome mammalian cellular barriers, as they infect bacteria only; furthermore, limited progress has been made at increasing their efficiency. The production of a novel hybrid nanocomplex system consisting of two different nanomaterial systems, phage vectors and conventional transfection reagents, could overcome these limitations. Here we demonstrate that the combination of cationic lipids, cationic polymers or calcium phosphate with M13 bacteriophage-derived vectors, engineered to carry a mammalian transgene cassette, resulted in increased cellular attachment, entry and improved transgene expression in human cells. Moreover, addition of a targeting ligand into the nanocomplex system, through genetic engineering of the phage capsid further increased gene expression and was effective in a stable cell line generation application. Overall, this new hybrid nanocomplex system (i) provides enhanced phage-mediated gene transfer; (ii) is applicable for laboratory transfection processes and (iii) shows promise within industry for large-scale gene transfer applications.

LacI(Ts)-Regulated Expression as an In Situ Intracellular Biomolecular Thermometer▿

PubMed Central

McCabe, K. M.; Lacherndo, E. J.; Albino-Flores, I.; Sheehan, E.; Hernandez, M.

2011-01-01

In response to needs for in situ thermometry, a temperature-sensitive vector was adapted to report changes in the intracellular heat content of Escherichia coli in near-real time. This model system utilized vectors expressing increasing quantities of β-galactosidase in response to stepwise temperature increases through a biologically relevant range (22 to 45°C). As judged by calibrated fluorometric and colorimetric reporters, both whole E. coli cells and lysates expressed significant repeatable changes in β-galactosidase activity that were sensitive to temperature changes of less than 1°C (35 to 45°C). This model system suggests that changes in cellular heat content can be detected independently of the medium in which cells are maintained, a feature of particular importance where the medium is heterogeneous or nonaqueous, or otherwise has a low heat transfer capacity. We report here that the intracellular temperature can be reliably obtained in near-real time using reliable fluorescent reporting systems from cellular scales, with a 20°C range of detection and at least 0.7°C sensitivity between 35 and 45°C. PMID:21378059

A herpes simplex viral vector expressing green fluorescent protein can be used to visualize morphological changes in high-density neuronal culture

PubMed Central

Falk, Torsten; Strazdas, Lori A.; Borders, Rebecca S.; Kilani, Ramsey K.; Yool, Andrea J.

2010-01-01

High-density cultures of mammalian neurons offer a model system for studies of brain development, but the morphological features of individual neurons is difficult to ascertain. We show that a herpes virus vector expressing a bioluminescent protein allows detailed morphometric analyses of living neurons in complex culture environments. Expression of enhanced green fluorescent protein (eGFP) was constitutively driven in neurons using the herpes simplex virus amplicon system. This system allowed us to make novel observations regarding development in high-density cultures from rat hippocampus and cerebellum. After the phase of initial neurite outgrowth, maturing neurons continue to show rapid remodeling of the neurite branches (0.79 ± 0.11 μm/h per neurite; mean ± SEM, n=8), and displacement of the soma within the neurite arbor (1.35 ± 0.74 μm/h). These results demonstrate that a substantial capacity for morphological plasticity persists in maturing mammalian CNS neurons after cessation of net neurite outgrowth in early development. PMID:20811504

Fluorescent tagged episomals for stoichiometric induced pluripotent stem cell reprogramming.

PubMed

Schmitt, Christopher E; Morales, Blanca M; Schmitz, Ellen M H; Hawkins, John S; Lizama, Carlos O; Zape, Joan P; Hsiao, Edward C; Zovein, Ann C

2017-06-05

Non-integrating episomal vectors have become an important tool for induced pluripotent stem cell reprogramming. The episomal vectors carrying the "Yamanaka reprogramming factors" (Oct4, Klf, Sox2, and L-Myc + Lin28) are critical tools for non-integrating reprogramming of cells to a pluripotent state. However, the reprogramming process remains highly stochastic, and is hampered by an inability to easily identify clones that carry the episomal vectors. We modified the original set of vectors to express spectrally separable fluorescent proteins to allow for enrichment of transfected cells. The vectors were then tested against the standard original vectors for reprogramming efficiency and for the ability to enrich for stoichiometric ratios of factors. The reengineered vectors allow for cell sorting based on reprogramming factor expression. We show that these vectors can assist in tracking episomal expression in individual cells and can select the reprogramming factor dosage. Together, these modified vectors are a useful tool for understanding the reprogramming process and improving induced pluripotent stem cell isolation efficiency.

Gene expression systems in corynebacteria.

PubMed

Srivastava, Preeti; Deb, J K

2005-04-01

Corynebacterium belongs to a group of gram-positive bacteria having moderate to high G+C content, the other members being Mycobacterium, Nocardia, and Rhodococcus. Considerable information is now available on the plasmids, gene regulatory elements, and gene expression in corynebacteria, especially in soil corynebacteria such as Corynebacterium glutamicum. These bacteria are non-pathogenic and, unlike Bacillus and Streptomyces, are low in proteolytic activity and thus have the potential of becoming attractive systems for expression of heterologous proteins. This review discusses recent advances in our understanding of the organization of various regulatory elements, such as promoters, transcription terminators, and development of vectors for cloning and gene expression.

In situ reprogramming to transdifferentiate fibroblasts into cardiomyocytes using adenoviral vectors: Implications for clinical myocardial regeneration.

PubMed

Mathison, Megumi; Singh, Vivek P; Chiuchiolo, Maria J; Sanagasetti, Deepthi; Mao, Yun; Patel, Vivekkumar B; Yang, Jianchang; Kaminsky, Stephen M; Crystal, Ronald G; Rosengart, Todd K

2017-02-01

The reprogramming of cardiac fibroblasts into induced cardiomyocyte-like cells improves ventricular function in myocardial infarction models. Only integrating persistent expression vectors have thus far been used to induce reprogramming, potentially limiting its clinical applicability. We therefore tested the reprogramming potential of nonintegrating, acute expression adenoviral (Ad) vectors. Ad or lentivirus vectors encoding Gata4 (G), Mef2c (M), and Tbx5 (T) were validated in vitro. Sprague-Dawley rats then underwent coronary ligation and Ad-mediated administration of vascular endothelial growth factor to generate infarct prevascularization. Three weeks later, animals received Ad or lentivirus encoding G, M, or T (AdGMT or LentiGMT) or an equivalent dose of a null vector (n = 11, 10, and 10, respectively). Outcomes were analyzed by echocardiography, magnetic resonance imaging, and histology. Ad and lentivirus vectors provided equivalent G, M, and T expression in vitro. AdGMT and LentiGMT both likewise induced expression of the cardiomyocyte marker cardiac troponin T in approximately 6% of cardiac fibroblasts versus <1% cardiac troponin T expression in AdNull (adenoviral vector that does not encode a transgene)-treated cells. Infarcted myocardium that had been treated with AdGMT likewise demonstrated greater density of cells expressing the cardiomyocyte marker beta myosin heavy chain 7 compared with AdNull-treated animals. Echocardiography demonstrated that AdGMT and LentiGMT both increased ejection fraction compared with AdNull (AdGMT: 21% ± 3%, LentiGMT: 14% ± 5%, AdNull: -0.4% ± 2%; P < .05). Ad vectors are at least as effective as lentiviral vectors in inducing cardiac fibroblast transdifferentiation into induced cardiomyocyte-like cells and improving cardiac function in postinfarct rat hearts. Short-term expression Ad vectors may represent an important means to induce cardiac cellular reprogramming in humans. Copyright © 2016 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

Differential proteomics analysis of Frankliniella occidentalis immune response after infection with Tomato spotted wilt virus (Tospovirus).

PubMed

Ogada, Pamella Akoth; Kiirika, Leonard Muriithi; Lorenz, Christin; Senkler, Jennifer; Braun, Hans-Peter; Poehling, Hans-Michael

2017-02-01

Tomato spotted wilt virus (TSWV) is mainly vectored by Frankliniella occidentalis Pergande, and it potentially activates the vector's immune response. However, molecular background of the altered immune response is not clearly understood. Therefore, using a proteomic approach, we investigated the immune pathways that are activated in F. occidentalis larvae after 24 h exposure to TSWV. Two-dimensional isoelectric focusing/sodium dodecyl sulfate polyacrylamide gel electrophoresis (2D-IEF/SDS/PAGE) combined with mass spectrometry (MS), were used to identify proteins that were differentially expressed upon viral infection. High numbers of proteins were abundantly expressed in F. occidentalis exposed to TSWV (73%) compared to the non-exposed (27%), with the majority functionally linked to the innate immune system such as: signaling, stress response, defense response, translation, cellular lipids and nucleotide metabolism. Key proteins included: 70 kDa heat shock proteins, Ubiquitin and Dermcidin, among others, indicative of a responsive pattern of the vector's innate immune system to viral infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

Fundamental Principles of Classical Mechanics: a Geometrical Perspectives

NASA Astrophysics Data System (ADS)

Lam, Kai S.

2014-07-01

Classical mechanics is the quantitative study of the laws of motion for oscopic physical systems with mass. The fundamental laws of this subject, known as Newton's Laws of Motion, are expressed in terms of second-order differential equations governing the time evolution of vectors in a so-called configuration space of a system (see Chapter 12). In an elementary setting, these are usually vectors in 3-dimensional Euclidean space, such as position vectors of point particles; but typically they can be vectors in higher dimensional and more abstract spaces. A general knowledge of the mathematical properties of vectors, not only in their most intuitive incarnations as directed arrows in physical space but as elements of abstract linear vector spaces, and those of linear operators (transformations) on vector spaces as well, is then indispensable in laying the groundwork for both the physical and the more advanced mathematical - more precisely topological and geometrical - concepts that will prove to be vital in our subject. In this beginning chapter we will review these properties, and introduce the all-important related notions of dual spaces and tensor products of vector spaces. The notational convention for vectorial and tensorial indices used for the rest of this book (except when otherwise specified) will also be established...

Diametrical clustering for identifying anti-correlated gene clusters.

PubMed

Dhillon, Inderjit S; Marcotte, Edward M; Roshan, Usman

2003-09-01

Clustering genes based upon their expression patterns allows us to predict gene function. Most existing clustering algorithms cluster genes together when their expression patterns show high positive correlation. However, it has been observed that genes whose expression patterns are strongly anti-correlated can also be functionally similar. Biologically, this is not unintuitive-genes responding to the same stimuli, regardless of the nature of the response, are more likely to operate in the same pathways. We present a new diametrical clustering algorithm that explicitly identifies anti-correlated clusters of genes. Our algorithm proceeds by iteratively (i). re-partitioning the genes and (ii). computing the dominant singular vector of each gene cluster; each singular vector serving as the prototype of a 'diametric' cluster. We empirically show the effectiveness of the algorithm in identifying diametrical or anti-correlated clusters. Testing the algorithm on yeast cell cycle data, fibroblast gene expression data, and DNA microarray data from yeast mutants reveals that opposed cellular pathways can be discovered with this method. We present systems whose mRNA expression patterns, and likely their functions, oppose the yeast ribosome and proteosome, along with evidence for the inverse transcriptional regulation of a number of cellular systems.

Tunable Control of an Escherichia coli Expression System for the Overproduction of Membrane Proteins by Titrated Expression of a Mutant lac Repressor.

PubMed

Kim, Seong Keun; Lee, Dae-Hee; Kim, Oh Cheol; Kim, Jihyun F; Yoon, Sung Ho

2017-09-15

Most inducible expression systems suffer from growth defects, leaky basal induction, and inhomogeneous expression levels within a host cell population. These difficulties are most prominent with the overproduction of membrane proteins that are toxic to host cells. Here, we developed an Escherichia coli inducible expression system for membrane protein production based on titrated expression of a mutant lac repressor (mLacI). Performance of the mLacI inducible system was evaluated in conjunction with commonly used lac operator-based expression vectors using a T7 or tac promoter. Remarkably, expression of a target gene can be titrated by the dose-dependent addition of l-rhamnose, and the expression levels were homogeneous in the cell population. The developed system was successfully applied to overexpress three membrane proteins that were otherwise difficult to produce in E. coli. This gene expression control system can be easily applied to a broad range of existing protein expression systems and should be useful in constructing genetic circuits that require precise output signals.

Green fluorescent protein is lighting up fungal biology

USGS Publications Warehouse

Lorang, J.M.; Tuori, R.P; Martinez, J.P; Sawyer, T.L.; Redman, R.S.; Rollins, J. A.; Wolpert, T.J.; Johnson, K.B.; Rodriguez, R.J.; Dickman, M. B.; Ciuffetti, L.M.

2001-01-01

Expression of gfp in filamentous fungi requires agfp variant that is efficiently translated in fungi, a transformation system, and a fungal promoter that satisfies the requirements of a given experimental objective. Transformation of fungi has recently been reviewed by Gold et al. (26). Robinson and Sharon (44) suggest that GFP can actually be used to optimize transformation protocols. In addition to reporting the construction of a new fungal transformation vector that expressesSGFP under the control of the ToxA gene promoter from Pyrenophora tritici-repentis (12) and demonstrating its use in plant pathogens belonging to eight different genera of filamentous fungi (Fusarium, Botrytis, Pyrenophora, Alternaria, Cochliobolus, Sclerotinia, Colletotrichum, andVerticillium), in this review we also enumerate and describe a comprehensive list of vectors for expressing GFP in fungi.

Construction and Characterization of an in-vivo Linear Covalently Closed DNA Vector Production System

PubMed Central

2012-01-01

Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697

Construction and characterization of an in-vivo linear covalently closed DNA vector production system.

PubMed

Nafissi, Nafiseh; Slavcev, Roderick

2012-12-06

While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.

Wide Awake and Ready to Move: 20 Years of Non-Viral Therapeutic Genome Engineering with the Sleeping Beauty Transposon System.

PubMed

Hodge, Russ; Narayanavari, Suneel A; Izsvák, Zsuzsanna; Ivics, Zoltán

2017-10-01

Gene therapies will only become a widespread tool in the clinical treatment of human diseases with the advent of gene transfer vectors that integrate genetic information stably, safely, effectively, and economically. Two decades after the discovery of the Sleeping Beauty (SB) transposon, it has been transformed into a vector system that is fulfilling these requirements. SB may well overcome some of the limitations associated with viral gene transfer vectors and transient non-viral gene delivery approaches that are being used in the majority of ongoing clinical trials. The SB system has achieved a high level of stable gene transfer and sustained transgene expression in multiple primary human somatic cell types, representing crucial steps that may permit its clinical use in the near future. This article reviews the most important aspects of SB as a tool for gene therapy, including aspects of its vectorization and genomic integration. As an illustration, the clinical development of the SB system toward gene therapy of age-related macular degeneration and cancer immunotherapy is highlighted.

Agroinfiltration: a rapid and reliable method to select suitable rose cultivars for blue flower production.

PubMed

Zeinipour, Masoume; Azadi, Pejman; Majd, Ahmad; Kermani, Maryam Jafarkhani; Irian, Saeed; Hosseini, Seyed Mohammad; Mii, Masahiro

2018-05-01

Rose cultivars with blue flower color are among the most attractive breeding targets in floriculture. However, they are difficult to produce due to the low efficiency of transformation systems, interactive effects of hosts and vectors, and lengthy processes. In this study, agroinfiltration-mediated transient expression was investigated as a tool to assess the function of flower color genes and to determine appropriate host cultivars for stable transformation in Rosa hybrida . To induce delphinidin accumulation and consequently to produce blue hue, the petals of 30 rose cultivars were infiltrated with three different expression vectors namely pBIH-35S-CcF3'5'H, pBIH-35S-Del2 and pBIH-35S-Del8, harbouring different sets of flower color genes. The results obtained showed that the ectopic expression of the genes was only detected in three cultivars with dark pink petals (i.e. 'Purple power', 'High & Mora' and 'Marina') after 6-8 days. The high performance liquid chromatography analyses confirmed delphinidin accumulation in the infiltrated petals caused by transient expression of CcF3'5'H gene. Moreover, there were significant differences in the amounts of delphinidin among the three cultivars infiltrated with the three different expression vectors. More specifically, the highest delphinidin content was detected in the cultivar 'Purple power' (4.67 µg g -1 FW), infiltrated with the pBIH-35S-Del2 vector. The expression of CcF3'5'H gene in the infiltrated petals was also confirmed by real time PCR. In conclusion and based on the findings of the present study, the agroinfiltration could be regarded as a reliable method to identify suitable rose cultivars in blue rose flower production programs.

The diagnostic performance of recombinant Trypanosoma cruzi ribosomal P2beta protein is influenced by its expression system.

PubMed

Marcipar, Iván S; Olivares, María Laura; Robles, Lucía; Dekanty, Andrés; Marcipar, Alberto; Silber, Ariel M

2004-03-01

In the present work, we have determined the effect of expression vectors and their corresponding host bacteria on the antigenic performance of Trypanosoma cruzi P2beta (TcP2beta) full-length recombinant protein. The gene encoding the TcP2beta ribosomal protein was cloned in pMAL-c2 and pET-32a vectors that allow the expression of high levels of soluble fusion proteins. A panel of 32 positive and 32 negative sera was assayed with the purified proteins expressed using pMal-c2 (TcP2beta-MBP) and pET-32a (TcP2beta-TRX) vectors and with MBP and TRX purified from pMAL-c2 and pET-32a vectors, respectively. The antigenic behavior of each TcP2beta recombinant protein differed in the diagnostic performance in terms of DI(+) (93.7 for TcP2beta-MBP vs 100% for TcP2beta-TRX), in DI(-) (90.5 for TcP2beta-MBP vs 100% for TcP2beta-TRX) and in cross-reaction with negative sera. To determine if the higher reactivity of expressed pMAL-c2 protein was due to folding during protein expression or to a steric effect related to the protein adsorption at the titration plate, the reactivity of sera against soluble proteins was assessed by ELISA inhibition assays. As each soluble protein preserved its level of reactivity, we concluded that differences in reactivity were due to intrinsic characteristics of the proteins and not to differences in patterns of adsorption to the plates.

Construction of siRNA/miRNA expression vectors based on a one-step PCR process

PubMed Central

Xu, Jun; Zeng, Jie Qiong; Wan, Gang; Hu, Gui Bin; Yan, Hong; Ma, Li Xin

2009-01-01

Background RNA interference (RNAi) has become a powerful means for silencing target gene expression in mammalian cells and is envisioned to be useful in therapeutic approaches to human disease. In recent years, high-throughput, genome-wide screening of siRNA/miRNA libraries has emerged as a desirable approach. Current methods for constructing siRNA/miRNA expression vectors require the synthesis of long oligonucleotides, which is costly and suffers from mutation problems. Results Here we report an ingenious method to solve traditional problems associated with construction of siRNA/miRNA expression vectors. We synthesized shorter primers (< 50 nucleotides) to generate a linear expression structure by PCR. The PCR products were directly transformed into chemically competent E. coli and converted to functional vectors in vivo via homologous recombination. The positive clones could be easily screened under UV light. Using this method we successfully constructed over 500 functional siRNA/miRNA expression vectors. Sequencing of the vectors confirmed a high accuracy rate. Conclusion This novel, convenient, low-cost and highly efficient approach may be useful for high-throughput assays of RNAi libraries. PMID:19490634

[Prokaryotic expression and immunological activity of human neutrophil gelatinase associated lipocalin].

PubMed

Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua

2015-07-01

To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.

Newcastle disease virus vectored vaccines as bivalent or antigen delivery vaccines

PubMed Central

2017-01-01

Recent advances in reverse genetics techniques make it possible to manipulate the genome of RNA viruses such as Newcastle disease virus (NDV). Several NDV vaccine strains have been used as vaccine vectors in poultry, mammals, and humans to express antigens of different pathogens. The safety, immunogenicity, and protective efficacy of these NDV-vectored vaccines have been evaluated in pre-clinical and clinical studies. The vaccines are safe in mammals, humans, and poultry. Bivalent NDV-vectored vaccines against pathogens of economic importance to the poultry industry have been developed. These bivalent vaccines confer solid protective immunity against NDV and other foreign antigens. In most cases, NDV-vectored vaccines induce strong local and systemic immune responses against the target foreign antigen. This review summarizes the development of NDV-vectored vaccines and their potential use as a base for designing other effective vaccines for veterinary and human use. PMID:28775971

The baculovirus expression vector system: A commercial manufacturing platform for viral vaccines and gene therapy vectors.

PubMed

Felberbaum, Rachael S

2015-05-01

The baculovirus expression vector system (BEVS) platform has become an established manufacturing platform for the production of viral vaccines and gene therapy vectors. Nine BEVS-derived products have been approved - four for human use (Cervarix(®), Provenge(®), Glybera(®) and Flublok(®)) and five for veterinary use (Porcilis(®) Pesti, BAYOVAC CSF E2(®), Circumvent(®) PCV, Ingelvac CircoFLEX(®) and Porcilis(®) PCV). The BEVS platform offers many advantages, including manufacturing speed, flexible product design, inherent safety and scalability. This combination of features and product approvals has previously attracted interest from academic researchers, and more recently from industry leaders, to utilize BEVS to develop next generation vaccines, vectors for gene therapy, and other biopharmaceutical complex proteins. In this review, we explore the BEVS platform, detailing how it works, platform features and limitations and important considerations for manufacturing and regulatory approval. To underscore the growth in opportunities for BEVS-derived products, we discuss the latest product developments in the gene therapy and influenza vaccine fields that follow in the wake of the recent product approvals of Glybera(®) and Flublok(®), respectively. We anticipate that the utility of the platform will expand even further as new BEVS-derived products attain licensure. Finally, we touch on some of the areas where new BEVS-derived products are likely to emerge. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

PubMed

Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

2014-05-01

To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

Managing the resilience space of the German energy system - A vector analysis.

PubMed

Schlör, Holger; Venghaus, Sandra; Märker, Carolin; Hake, Jürgen-Friedrich

2018-07-15

The UN Sustainable Development Goals formulated in 2016 confirmed the sustainability concept of the Earth Summit of 1992 and supported UNEP's green economy transition concept. The transformation of the energy system (Energiewende) is the keystone of Germany's sustainability strategy and of the German green economy concept. We use ten updated energy-related indicators of the German sustainability strategy to analyse the German energy system. The development of the sustainable indicators is examined in the monitoring process by a vector analysis performed in two-dimensional Euclidean space (Euclidean plane). The aim of the novel vector analysis is to measure the current status of the Energiewende in Germany and thereby provide decision makers with information about the strains for the specific remaining pathway of the single indicators and of the total system in order to meet the sustainability targets of the Energiewende. Within this vector model, three vectors (the normative sustainable development vector, the real development vector, and the green economy vector) define the resilience space of our analysis. The resilience space encloses a number of vectors representing different pathways with different technological and socio-economic strains to achieve a sustainable development of the green economy. In this space, the decision will be made as to whether the government measures will lead to a resilient energy system or whether a readjustment of indicator targets or political measures is necessary. The vector analysis enables us to analyse both the government's ambitiousness, which is expressed in the sustainability target for the indicators at the start of the sustainability strategy representing the starting preference order of the German government (SPO) and, secondly, the current preference order of German society in order to bridge the remaining distance to reach the specific sustainability goals of the strategy summarized in the current preference order (CPO). Copyright © 2018 Elsevier Ltd. All rights reserved.

Fully synchronous solutions and the synchronization phase transition for the finite-N Kuramoto model

NASA Astrophysics Data System (ADS)

Bronski, Jared C.; DeVille, Lee; Jip Park, Moon

2012-09-01

We present a detailed analysis of the stability of phase-locked solutions to the Kuramoto system of oscillators. We derive an analytical expression counting the dimension of the unstable manifold associated to a given stationary solution. From this we are able to derive a number of consequences, including analytic expressions for the first and last frequency vectors to phase-lock, upper and lower bounds on the probability that a randomly chosen frequency vector will phase-lock, and very sharp results on the large N limit of this model. One of the surprises in this calculation is that for frequencies that are Gaussian distributed, the correct scaling for full synchrony is not the one commonly studied in the literature; rather, there is a logarithmic correction to the scaling which is related to the extremal value statistics of the random frequency vector.

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

Nephron segment-specific gene expression using AAV vectors.

PubMed

Asico, Laureano D; Cuevas, Santiago; Ma, Xiaobo; Jose, Pedro A; Armando, Ines; Konkalmatt, Prasad R

2018-02-26

AAV9 vector provides efficient gene transfer in all segments of the renal nephron, with minimum expression in non-renal cells, when administered retrogradely via the ureter. It is important to restrict the transgene expression to the desired cell type within the kidney, so that the physiological endpoints represent the function of the transgene expressed in that specific cell type within kidney. We hypothesized that segment-specific gene expression within the kidney can be accomplished using the highly efficient AAV9 vectors carrying the promoters of genes that are expressed exclusively in the desired segment of the nephron in combination with administration by retrograde infusion into the kidney via the ureter. We constructed AAV vectors carrying eGFP under the control of: kidney-specific cadherin (KSPC) gene promoter for expression in the entire nephron; Na + /glucose co-transporter (SGLT2) gene promoter for expression in the S1 and S2 segments of the proximal tubule; sodium, potassium, 2 chloride co-transporter (NKCC2) gene promoter for expression in the thick ascending limb of Henle's loop (TALH); E-cadherin (ECAD) gene promoter for expression in the collecting duct (CD); and cytomegalovirus (CMV) early promoter that provides expression in most of the mammalian cells, as control. We tested the specificity of the promoter constructs in vitro for cell type-specific expression in mouse kidney cells in primary culture, followed by retrograde infusion of the AAV vectors via the ureter in the mouse. Our data show that AAV9 vector, in combination with the segment-specific promoters administered by retrograde infusion via the ureter, provides renal nephron segment-specific gene expression. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Interleukin 10 mediated by herpes simplex virus vectors suppresses neuropathic pain induced by human immunodeficiency virus gp120 in rats.

PubMed

Zheng, Wenwen; Huang, Wan; Liu, Shue; Levitt, Roy C; Candiotti, Keith A; Lubarsky, David A; Hao, Shuanglin

2014-09-01

Human immunodeficiency virus (HIV)-associated sensory neuropathy is a common neurological complication of HIV infection affecting up to 30% of HIV-positive individuals. However, the exact neuropathological mechanisms remain unknown, which hinders our ability to develop effective treatments for HIV-related neuropathic pain (NP). In this study, we tested the hypothesis that inhibition of proinflammatory factors with overexpression of interleukin (IL)-10 reduces HIV-related NP in a rat model. NP was induced by the application of recombinant HIV-1 envelope protein gp120 into the sciatic nerve. The hindpaws of rats were inoculated with nonreplicating herpes simplex virus (HSV) vectors expressing anti-inflammatory cytokine IL-10 or control vector. Mechanical threshold was tested using von Frey filaments before and after treatments with the vectors. The mechanical threshold response was assessed over time using the area under curves. The expression of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 in both the lumbar spinal cord and the L4/5 dorsal root ganglia (DRG), was examined at 14 and 28 days after vector inoculation using Western blots. We found that in the gp120-induced NP model, IL-10 overexpression mediated by the HSV vector resulted in a significant elevation of the mechanical threshold that was apparent on day 3 after vector inoculation compared with the control vector (P < 0.001). The antiallodynic effect of the single HSV vector inoculation expressing IL-10 lasted >28 days. The area under curve in the HSV vector expressing IL-10 was increased compared with that in the control vector (P < 0.0001). HSV vectors expressing IL-10 reversed the upregulation of phosphorylated p38 mitogen-activated kinase, tumor necrosis factor-α, stromal cell-derived factor-1α, and C-X-C chemokine receptor type 4 expression at 14 and/or 28 days in the DRG and/or the spinal dorsal horn. Our studies demonstrate that blocking the signaling of these proinflammatory molecules in the DRG and/or the spinal cord using the HSV vector expressing IL-10 is able to reduce HIV-related NP. These results provide new insights on the potential mechanisms of HIV-associated NP and a proof of concept for treating painful HIV sensory neuropathy with this type of gene therapy.

Rapid high-yield expression of full-size IgG antibodies in plants coinfected with noncompeting viral vectors

PubMed Central

Giritch, Anatoli; Marillonnet, Sylvestre; Engler, Carola; van Eldik, Gerben; Botterman, Johan; Klimyuk, Victor; Gleba, Yuri

2006-01-01

Plant viral vectors allow expression of heterologous proteins at high yields, but so far, they have been unable to express heterooligomeric proteins efficiently. We describe here a rapid and indefinitely scalable process for high-level expression of functional full-size mAbs of the IgG class in plants. The process relies on synchronous coinfection and coreplication of two viral vectors, each expressing a separate antibody chain. The two vectors are derived from two different plant viruses that were found to be noncompeting. Unlike vectors derived from the same virus, noncompeting vectors effectively coexpress the heavy and light chains in the same cell throughout the plant body, resulting in yields of up to 0.5 g of assembled mAbs per kg of fresh-leaf biomass. This technology allows production of gram quantities of mAbs for research purposes in just several days, and the same protocol can be used on an industrial scale in situations requiring rapid response, such as pandemic or terrorism events. PMID:16973752

Generation of mammalian cells stably expressing multiple genes at predetermined levels.

PubMed

Liu, X; Constantinescu, S N; Sun, Y; Bogan, J S; Hirsch, D; Weinberg, R A; Lodish, H F

2000-04-10

Expression of cloned genes at desired levels in cultured mammalian cells is essential for studying protein function. Controlled levels of expression have been difficult to achieve, especially for cell lines with low transfection efficiency or when expression of multiple genes is required. An internal ribosomal entry site (IRES) has been incorporated into many types of expression vectors to allow simultaneous expression of two genes. However, there has been no systematic quantitative analysis of expression levels in individual cells of genes linked by an IRES, and thus the broad use of these vectors in functional analysis has been limited. We constructed a set of retroviral expression vectors containing an IRES followed by a quantitative selectable marker such as green fluorescent protein (GFP) or truncated cell surface proteins CD2 or CD4. The gene of interest is placed in a multiple cloning site 5' of the IRES sequence under the control of the retroviral long terminal repeat (LTR) promoter. These vectors exploit the approximately 100-fold differences in levels of expression of a retrovirus vector depending on its site of insertion in the host chromosome. We show that the level of expression of the gene downstream of the IRES and the expression level and functional activity of the gene cloned upstream of the IRES are highly correlated in stably infected target cells. This feature makes our vectors extremely useful for the rapid generation of stably transfected cell populations or clonal cell lines expressing specific amounts of a desired protein simply by fluorescent activated cell sorting (FACS) based on the level of expression of the gene downstream of the IRES. We show how these vectors can be used to generate cells expressing high levels of the erythropoietin receptor (EpoR) or a dominant negative Smad3 protein and to generate cells expressing two different cloned proteins, Ski and Smad4. Correlation of a biologic effect with the level of expression of the protein downstream of the IRES provides strong evidence for the function of the protein placed upstream of the IRES.

Construction of heat-inducible expression vector of Corynebacterium glutamicum and C. ammoniagenes: fusion of lambda operator with promoters isolated from C. ammoniagenes.

PubMed

Park, Jong-Uk; Jo, Jae-Hyung; Kim, Young-Ji; Chung, So-Sun; Lee, Jin-Ho; Lee, Hyune Hwan

2008-04-01

The heat-inducible expression vectors for Corynebacterium glutamicum and C. ammoniagenes were constructed by using the lambdaOL1 and the cryptic promoters, CJ1 and CJ4 that express genes constitutively in C. ammoniagenes.. Although the promoters were isolated from C. ammoniagenes, CJ1 and CJ4 were also active in C. glutamicum. To construct vectors, the OL1 from the lambdaPL promoter was isolated and fused to the CJ1 and CJ4 promoters by recombinant PCR. The resulting artificial promoters, CJ1O and CJ4O, which have one lambdaOL1, and CJ1OX2, which has two successive lambdaOL1, were fused to the green fluorescent protein (GFP) gene followed by subcloning into pCES208. The expression of GFP in the corynebacteria harboring the vectors was regulated successfully by the temperature sensitive cI857 repressor. Among them, C. ammoniagenes harboring plasmid pCJ1OX2G containing GFP fused to CJ1OX2 showed more GFP than the other ones and the expression was tightly regulated by the repressor. To construct the generally applicable expression vector using the plasmid pCJ1OX2G, the His-tag, enterokinase (EK) moiety, and the MCS were inserted in front of the GFP gene. Using the vector, the expression of pyrR from C. glutamicum was tried by temperature shift-up. The results indicated that the constructed vectors (pCeHEMG) can be successfully used in the expression and regulation of foreign genes in corynebacteria.

A pepper mottle virus-based vector enables systemic expression of endoglucanase D in non-transgenic plants.

PubMed

Song, Eun Gyeong; Ryu, Ki Hyun

2017-12-01

Plant-virus-based expression vectors have been used as an alternative to the creation of transgenic plants. Using a virus-based vector, we investigated the feasibility of producing the endoglucanase D (EngD) from Clostridium cellulovorans in Nicotiana benthamiana. This protein has endoglucanase, xylanase, and exoglucanase activities and may be of value for cellulose digestion in the generation of biofuels from plant biomass. The EngD gene was cloned between the nuclear inclusion b (NIb)- and coat protein (CP)-encoding sequences of pSP6PepMoV-Vb1. In vitro transcripts derived from the clone (pSP6PepMoV-Vb1/EngD) were infectious in N. benthamiana but caused milder symptoms than wild-type PepMoV-Vb1. RT-PCR amplification of total RNA from non-inoculated upper leaves infected with PepMoV-Vb1/EngD produced the target band for the CP, partial NIb and EngD-CP regions of PepMoV-V1/EngD, in addition to nonspecific bands. Western blot analysis showed the CP target bands of PepMoV-Vb1/EngD as well as non-target bands. EngD enzymatic activity in infected plants was detected using a glucose assay. The plant leaves showed increased senescence compared with healthy and PepMoV-Vb1-infected plants. Our study suggests the feasibility of using a viral vector for systemic infection of plants for expression of heterologous engD for the purpose of digesting a cellulose substrate in plant cells for biomass production.

Targeted Knock-Down of miR21 Primary Transcripts Using snoMEN Vectors Induces Apoptosis in Human Cancer Cell Lines.

PubMed

Ono, Motoharu; Yamada, Kayo; Avolio, Fabio; Afzal, Vackar; Bensaddek, Dalila; Lamond, Angus I

2015-01-01

We have previously reported an antisense technology, 'snoMEN vectors', for targeted knock-down of protein coding mRNAs using human snoRNAs manipulated to contain short regions of sequence complementarity with the mRNA target. Here we characterise the use of snoMEN vectors to target the knock-down of micro RNA primary transcripts. We document the specific knock-down of miR21 in HeLa cells using plasmid vectors expressing miR21-targeted snoMEN RNAs and show this induces apoptosis. Knock-down is dependent on the presence of complementary sequences in the snoMEN vector and the induction of apoptosis can be suppressed by over-expression of miR21. Furthermore, we have also developed lentiviral vectors for delivery of snoMEN RNAs and show this increases the efficiency of vector transduction in many human cell lines that are difficult to transfect with plasmid vectors. Transduction of lentiviral vectors expressing snoMEN targeted to pri-miR21 induces apoptosis in human lung adenocarcinoma cells, which express high levels of miR21, but not in human primary cells. We show that snoMEN-mediated suppression of miRNA expression is prevented by siRNA knock-down of Ago2, but not by knock-down of Ago1 or Upf1. snoMEN RNAs colocalise with Ago2 in cell nuclei and nucleoli and can be co-immunoprecipitated from nuclear extracts by antibodies specific for Ago2.

Ribosomal DNA Integrating rAAV-rDNA Vectors Allow for Stable Transgene Expression

PubMed Central

Lisowski, Leszek; Lau, Ashley; Wang, Zhongya; Zhang, Yue; Zhang, Feijie; Grompe, Markus; Kay, Mark A

2012-01-01

Although recombinant adeno-associated virus (rAAV) vectors are proving to be efficacious in clinical trials, the episomal character of the delivered transgene restricts their effectiveness to use in quiescent tissues, and may not provide lifelong expression. In contrast, integrating vectors enhance the risk of insertional mutagenesis. In an attempt to overcome both of these limitations, we created new rAAV-rDNA vectors, with an expression cassette flanked by ribosomal DNA (rDNA) sequences capable of homologous recombination into genomic rDNA. We show that after in vivo delivery the rAAV-rDNA vectors integrated into the genomic rDNA locus 8–13 times more frequently than control vectors, providing an estimate that 23–39% of the integrations were specific to the rDNA locus. Moreover, a rAAV-rDNA vector containing a human factor IX (hFIX) expression cassette resulted in sustained therapeutic levels of serum hFIX even after repeated manipulations to induce liver regeneration. Because of the relative safety of integration in the rDNA locus, these vectors expand the usage of rAAV for therapeutics requiring long-term gene transfer into dividing cells. PMID:22990671

Protein interaction networks at the host-microbe interface in Diaphorina citri, the insect vector of the citrus greening pathogen.

PubMed

Ramsey, J S; Chavez, J D; Johnson, R; Hosseinzadeh, S; Mahoney, J E; Mohr, J P; Robison, F; Zhong, X; Hall, D G; MacCoss, M; Bruce, J; Cilia, M

2017-02-01

The Asian citrus psyllid ( Diaphorina citri) is the insect vector responsible for the worldwide spread of ' Candidatus Liberibacter asiaticus' (CLas), the bacterial pathogen associated with citrus greening disease. Developmental changes in the insect vector impact pathogen transmission, such that D. citri transmission of CLas is more efficient when bacteria are acquired by nymphs when compared with adults. We hypothesize that expression changes in the D. citri immune system and commensal microbiota occur during development and regulate vector competency. In support of this hypothesis, more proteins, with greater fold changes, were differentially expressed in response to CLas in adults when compared with nymphs, including insect proteins involved in bacterial adhesion and immunity. Compared with nymphs, adult insects had a higher titre of CLas and the bacterial endosymbionts Wolbachia, Profftella and Carsonella. All Wolbachia and Profftella proteins differentially expressed between nymphs and adults are upregulated in adults, while most differentially expressed Carsonella proteins are upregulated in nymphs. Discovery of protein interaction networks has broad applicability to the study of host-microbe relationships. Using protein interaction reporter technology, a D. citri haemocyanin protein highly upregulated in response to CLas was found to physically interact with the CLas coenzyme A (CoA) biosynthesis enzyme phosphopantothenoylcysteine synthetase/decarboxylase. CLas pantothenate kinase, which catalyses the rate-limiting step of CoA biosynthesis, was found to interact with a D. citri myosin protein. Two Carsonella enzymes involved in histidine and tryptophan biosynthesis were found to physically interact with D. citri proteins. These co-evolved protein interaction networks at the host-microbe interface are highly specific targets for controlling the insect vector responsible for the spread of citrus greening.

Protein interaction networks at the host–microbe interface in Diaphorina citri, the insect vector of the citrus greening pathogen

PubMed Central

Chavez, J. D.; Johnson, R.; Hosseinzadeh, S.; Mahoney, J. E.; Mohr, J. P.; Robison, F.; Zhong, X.; Hall, D. G.; MacCoss, M.; Bruce, J.; Cilia, M.

2017-01-01

The Asian citrus psyllid (Diaphorina citri) is the insect vector responsible for the worldwide spread of ‘Candidatus Liberibacter asiaticus’ (CLas), the bacterial pathogen associated with citrus greening disease. Developmental changes in the insect vector impact pathogen transmission, such that D. citri transmission of CLas is more efficient when bacteria are acquired by nymphs when compared with adults. We hypothesize that expression changes in the D. citri immune system and commensal microbiota occur during development and regulate vector competency. In support of this hypothesis, more proteins, with greater fold changes, were differentially expressed in response to CLas in adults when compared with nymphs, including insect proteins involved in bacterial adhesion and immunity. Compared with nymphs, adult insects had a higher titre of CLas and the bacterial endosymbionts Wolbachia, Profftella and Carsonella. All Wolbachia and Profftella proteins differentially expressed between nymphs and adults are upregulated in adults, while most differentially expressed Carsonella proteins are upregulated in nymphs. Discovery of protein interaction networks has broad applicability to the study of host–microbe relationships. Using protein interaction reporter technology, a D. citri haemocyanin protein highly upregulated in response to CLas was found to physically interact with the CLas coenzyme A (CoA) biosynthesis enzyme phosphopantothenoylcysteine synthetase/decarboxylase. CLas pantothenate kinase, which catalyses the rate-limiting step of CoA biosynthesis, was found to interact with a D. citri myosin protein. Two Carsonella enzymes involved in histidine and tryptophan biosynthesis were found to physically interact with D. citri proteins. These co-evolved protein interaction networks at the host–microbe interface are highly specific targets for controlling the insect vector responsible for the spread of citrus greening. PMID:28386418

Host structural carbohydrate induces vector transmission of a bacterial plant pathogen.

PubMed

Killiny, Nabil; Almeida, Rodrigo P P

2009-12-29

Many insect-borne pathogens have complex life histories because they must colonize both hosts and vectors for successful dissemination. In addition, the transition from host to vector environments may require changes in gene expression before the pathogen's departure from the host. Xylella fastidiosa is a xylem-limited plant-pathogenic bacterium transmitted by leafhopper vectors that causes diseases in a number of economically important plants. We hypothesized that factors of host origin, such as plant structural polysaccharides, are important in regulating X. fastidiosa gene expression and mediating vector transmission of this pathogen. The addition of pectin and glucan to a simple defined medium resulted in dramatic changes in X. fastidiosa's phenotype and gene-expression profile. Cells grown in the presence of pectin became more adhesive than in other media tested. In addition, the presence of pectin and glucan in media resulted in significant changes in the expression of several genes previously identified as important for X. fastidiosa's pathogenicity in plants. Furthermore, vector transmission of X. fastidiosa was induced in the presence of both polysaccharides. Our data show that host structural polysaccharides mediate gene regulation in X. fastidiosa, which results in phenotypic changes required for vector transmission. A better understanding of how vector-borne pathogens transition from host to vector, and vice versa, may lead to previously undiscovered disease-control strategies.

Development of inducer-free expression plasmids based on IPTG-inducible promoters for Bacillus subtilis.

PubMed

Tran, Dinh Thi Minh; Phan, Trang Thi Phuong; Huynh, Thanh Kieu; Dang, Ngan Thi Kim; Huynh, Phuong Thi Kim; Nguyen, Tri Minh; Truong, Tuom Thi Tinh; Tran, Thuoc Linh; Schumann, Wolfgang; Nguyen, Hoang Duc

2017-07-25

Besides Escherichia coli, Bacillus subtilis is an important bacterial species for the production of recombinant proteins. Recombinant genes are inserted into shuttle expression vectors which replicate in both E. coli and in B. subtilis. The ligation products are first transformed into E. coli cells, analyzed for correct insertions, and the correct recombinant plasmids are then transformed into B. subtilis. A major problem using E. coli cells can be the strong basal level of expression of the recombinant protein which may interfere with the stability of the cells. To minimize this problem, we developed strong expression vectors being repressed in E. coli and inducer-free in B. subtilis. In general, induction of IPTG-inducible expression vectors is determined by the regulatory lacI gene encoding the LacI repressor in combination with the lacO operator on the promoter. To investigate the inducer-free properties of the vectors, we constructed inducer-free expression plasmids by removing the lacI gene and characterized their properties. First, we examined the ability to repress a reporter gene in E. coli, which is a prominent property facilitating the construction of the expression vectors carrying a target gene. The β-galactosidase (bgaB gene) basal levels expressed from Pgrac01-bgaB could be repressed at least twice in the E. coli cloning strain. Second, the inducer-free production of BgaB from four different plasmids with the Pgrac01 promoter in B. subtilis was investigated. As expected, BgaB expression levels of inducer-free constructs are at least 37 times higher than that of the inducible constructs in the absence of IPTG, and comparable to those in the presence of the inducer. Third, using efficient IPTG-inducible expression vectors containing the strong promoter Pgrac100, we could convert them into inducer-free expression plasmids. The BgaB production levels from the inducer-free plasmid in the absence of the inducer were at least 4.5 times higher than that of the inducible vector using the same promoter. Finally, we used gfp as a reporter gene in combination with the two promoters Pgrac01 and Pgrac100 to test the new vector types. The GFP expression levels could be repressed at least 1.5 times for the Pgrac01-gfp+ inducer-free construct in E. coli. The inducer-free constructs Pgrac01-gfp+ and Pgrac100-gfp+ allowed GFP expression at high levels from 23 × 10 4 to 32 × 10 4 RFU units and 9-13% of total intracellular proteins. We could reconfirm the two major advantages of the new inducer-free expression plasmids: (1) Strong repression of the target gene expression in the E. coli cloning strain, and (2) production of the target protein at high levels in B. subtilis in the absence of the inducer. We propose a general strategy to generate inducer-free expression vector by using IPTG-inducible vectors, and more specifically we developed inducer-free expression plasmids using IPTG-inducible promoters in the absence of the LacI repressor. These plasmids could be an excellent choice for high-level production of recombinant proteins in B. subtilis without the addition of inducer and at the same time maintaining a low basal level of the recombinant proteins in E. coli. The repression of the recombinant gene expression would facilitate cloning of genes that potentially inhibit the growth of E. coli cloning strains. The inducer-free expression plasmids will be extended versions of the current available IPTG-inducible expression vectors for B. subtilis, in which all these vectors use the same cognate promoters. These inducer-free and previously developed IPTG-inducible expression plasmids will be a useful cassette to study gene expression at a small scale up to a larger scale up for the production of recombinant proteins.

AAVrh.10-mediated expression of an anti-cocaine antibody mediates persistent passive immunization that suppresses cocaine-induced behavior.

PubMed

Rosenberg, Jonathan B; Hicks, Martin J; De, Bishnu P; Pagovich, Odelya; Frenk, Esther; Janda, Kim D; Wee, Sunmee; Koob, George F; Hackett, Neil R; Kaminsky, Stephen M; Worgall, Stefan; Tignor, Nicole; Mezey, Jason G; Crystal, Ronald G

2012-05-01

Cocaine addiction is a major problem affecting all societal and economic classes for which there is no effective therapy. We hypothesized an effective anti-cocaine vaccine could be developed by using an adeno-associated virus (AAV) gene transfer vector as the delivery vehicle to persistently express an anti-cocaine monoclonal antibody in vivo, which would sequester cocaine in the blood, preventing access to cognate receptors in the brain. To accomplish this, we constructed AAVrh.10antiCoc.Mab, an AAVrh.10 gene transfer vector expressing the heavy and light chains of the high affinity anti-cocaine monoclonal antibody GNC92H2. Intravenous administration of AAVrh.10antiCoc.Mab to mice mediated high, persistent serum levels of high-affinity, cocaine-specific antibodies that sequestered intravenously administered cocaine in the blood. With repeated intravenous cocaine challenge, naive mice exhibited hyperactivity, while the AAVrh.10antiCoc.Mab-vaccinated mice were completely resistant to the cocaine. These observations demonstrate a novel strategy for cocaine addiction by requiring only a single administration of an AAV vector mediating persistent, systemic anti-cocaine passive immunity.

Intra-Amniotic rAAV-Mediated Microdystrophin Gene Transfer Improves Canine X-Linked Muscular Dystrophy and May Induce Immune Tolerance

PubMed Central

Hayashita-Kinoh, Hiromi; Yugeta, Naoko; Okada, Hironori; Nitahara-Kasahara, Yuko; Chiyo, Tomoko; Okada, Takashi; Takeda, Shin'ichi

2015-01-01

Duchenne muscular dystrophy (DMD) is a severe congenital disease due to mutations in the dystrophin gene. Supplementation of dystrophin using recombinant adenoassociated virus vector has promise as a treatment of DMD, although therapeutic benefit of the truncated dystrophin still remains to be elucidated. Besides, host immune responses against the vector as well as transgene products have been denoted in the clinical gene therapy studies. Here, we transduced dystrophic dogs fetuses to investigate the therapeutic effects of an AAV vector expressing microdystrophin under conditions of immune tolerance. rAAV-CMV-microdystrophin and a rAAV-CAG-luciferase were injected into the amniotic fluid surrounding fetuses. We also reinjected rAAV9-CMV-microdystrophin into the jugular vein of an infant dystrophic dog to induce systemic expression of microdystrophin. Gait and cardiac function significantly improved in the rAAV-microdystrophin-injected dystrophic dog, suggesting that an adequate treatment of rAAV-microdystrophin with immune modulation induces successful long-term transgene expression to analyze improved dystrophic phenotype. PMID:25586688

Novel redox nanomedicine improves gene expression of polyion complex vector

NASA Astrophysics Data System (ADS)

Toh, Kazuko; Yoshitomi, Toru; Ikeda, Yutaka; Nagasaki, Yukio

2011-12-01

Gene therapy has generated worldwide attention as a new medical technology. While non-viral gene vectors are promising candidates as gene carriers, they have several issues such as toxicity and low transfection efficiency. We have hypothesized that the generation of reactive oxygen species (ROS) affects gene expression in polyplex supported gene delivery systems. The effect of ROS on the gene expression of polyplex was evaluated using a nitroxide radical-containing nanoparticle (RNP) as an ROS scavenger. When polyethyleneimine (PEI)/pGL3 or PEI alone was added to the HeLa cells, ROS levels increased significantly. In contrast, when (PEI)/pGL3 or PEI was added with RNP, the ROS levels were suppressed. The luciferase expression was increased by the treatment with RNP in a dose-dependent manner and the cellular uptake of pDNA was also increased. Inflammatory cytokines play an important role in ROS generation in vivo. In particular, tumor necrosis factor (TNF)-α caused intracellular ROS generation in HeLa cells and decreased gene expression. RNP treatment suppressed ROS production even in the presence of TNF-α and increased gene expression. This anti-inflammatory property of RNP suggests that it may be used as an effective adjuvant for non-viral gene delivery systems.

A Dual Luciferase Reporter System for B. burgdorferi Measures Transcriptional Activity during Tick-Pathogen Interactions

PubMed Central

Adams, Philip P.; Flores Avile, Carlos; Jewett, Mollie W.

2017-01-01

Knowledge of the transcriptional responses of vector-borne pathogens at the vector-pathogen interface is critical for understanding disease transmission. Borrelia (Borreliella) burgdorferi, the causative agent of Lyme disease in the United States, is transmitted by the bite of infected Ixodes sp. ticks. It is known that B. burgdorferi has altered patterns of gene expression during tick acquisition, persistence and transmission. Recently, we and others have discovered in vitro expression of RNAs found internal, overlapping, and antisense to annotated open reading frames in the B. burgdorferi genome. However, there is a lack of molecular genetic tools for B. burgdorferi for quantitative, strand-specific, comparative analysis of these transcripts in distinct environments such as the arthropod vector. To address this need, we have developed a dual luciferase reporter system to quantify B. burgdorferi promoter activities in a strand-specific manner. We demonstrate that constitutive expression of a B. burgdorferi codon-optimized Renilla reniformis luciferase gene (rlucBb) allows normalization of the activity of a promoter of interest when fused to the B. burgdorferi codon-optimized Photinus pyralis luciferase gene (flucBb) on the same plasmid. Using the well characterized, differentially regulated, promoters for flagellin (flaBp), outer surface protein A (ospAp) and outer surface protein C (ospCp), we document the efficacy of the dual luciferase system for quantitation of promoter activities during in vitro growth and in infected ticks. Cumulatively, the dual luciferase method outlined herein is the first dual reporter system for B. burgdorferi, providing a novel and highly versatile approach for strand-specific molecular genetic analyses. PMID:28620587

A Dual Luciferase Reporter System for B. burgdorferi Measures Transcriptional Activity during Tick-Pathogen Interactions.

PubMed

Adams, Philip P; Flores Avile, Carlos; Jewett, Mollie W

2017-01-01

Knowledge of the transcriptional responses of vector-borne pathogens at the vector-pathogen interface is critical for understanding disease transmission. Borrelia ( Borreliella ) burgdorferi , the causative agent of Lyme disease in the United States, is transmitted by the bite of infected Ixodes sp . ticks. It is known that B. burgdorferi has altered patterns of gene expression during tick acquisition, persistence and transmission. Recently, we and others have discovered in vitro expression of RNAs found internal, overlapping, and antisense to annotated open reading frames in the B. burgdorferi genome. However, there is a lack of molecular genetic tools for B. burgdorferi for quantitative, strand-specific, comparative analysis of these transcripts in distinct environments such as the arthropod vector. To address this need, we have developed a dual luciferase reporter system to quantify B. burgdorferi promoter activities in a strand-specific manner. We demonstrate that constitutive expression of a B. burgdorferi codon-optimized Renilla reniformis luciferase gene ( rluc Bb ) allows normalization of the activity of a promoter of interest when fused to the B. burgdorferi codon-optimized Photinus pyralis luciferase gene ( fluc Bb ) on the same plasmid. Using the well characterized, differentially regulated, promoters for flagellin ( flaBp ), outer surface protein A ( ospAp ) and outer surface protein C ( ospCp ), we document the efficacy of the dual luciferase system for quantitation of promoter activities during in vitro growth and in infected ticks. Cumulatively, the dual luciferase method outlined herein is the first dual reporter system for B. burgdorferi , providing a novel and highly versatile approach for strand-specific molecular genetic analyses.

Modified Newcastle Disease virus as an improved vaccine vector against Simian Immunodeficiency virus.

PubMed

Manoharan, Vinoth K; Khattar, Sunil K; LaBranche, Celia C; Montefiori, David C; Samal, Siba K

2018-06-12

SIV infection in macaques is a relevant animal model for HIV pathogenesis and vaccine study in humans. To design a safe and effective vaccine against HIV, we evaluated the suitability of naturally-occurring avirulent Newcastle disease virus (NDV) strains and several modified versions of NDV as vectors for the expression and immunogenicity of SIV envelope protein gp160. All the NDV vectors expressed gp160 protein in infected cells. The gp160 expressed by these vectors formed oligomers and was incorporated into the NDV envelope. All the NDV vectors expressing gp160 were attenuated in chickens. Intranasal immunization of guinea pigs with modified NDV vectors such as rNDV-APMV-2CS/gp160 and rNDV-APMV-8CS/gp160 (NDV strain LaSota containing the cleavage site sequences of F protein of avian paramyxovirus (APMV) serotype 2 and 8, respectively), and rNDV-BC-F-HN/gp160 (NDV strain BC containing LaSota F cleavage site and LaSota F and HN genes) elicited improved SIV-specific humoral and mucosal immune responses compared to other NDV vectors. These modified vectors were also efficient in inducing neutralizing antibody responses to tier 1 A SIVmac251.6 and tier 1B SIVmac251/M766 strains. This study suggests that our novel modified NDV vectors are safe and immunogenic and can be used as vaccine vector to control HIV.

Ectopic ERK Expression Induces Phenotypic Conversion of C10 Cells and Alters DNA Methyltransferase Expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sontag, Ryan L.; Weber, Thomas J.

2012-05-04

In some model systems constitutive extracellular signal regulated kinase (ERK) activation is sufficient to promote an oncogenic phenotype. Here we investigate whether constitutive ERK expression influences phenotypic conversion in murine C10 type II alveolar epithelial cells. C10 cells were stably transduced with an ERK1-green fluorescent protein (ERK1-GFP) chimera or empty vector and ectopic ERK expression was associated with the acquisition of soft agar focus-forming potential in late passage, but not early passage cells. Late passage ERK1-GFP cells exhibited a significant increase in the expression of DNA methyl transferases (DNMT1 and 3b) and a marked increase in sensitivity to 5-azacytidine (5-azaC)-mediatedmore » toxicity, relative to early passage ERK1-GFP cells and vector controls. The expression of xeroderma pigmentosum complementation group A (XPA) and DNA-dependent protein kinase catalytic subunit (DNA-PKcs) were significantly increased in late passage cells, suggesting enhanced DNA damage recognition and repair activity which we interpret as a reflection of genomic instability. Phospho-ERK levels were dramatically decreased in late passage ERK1-GFP cells, relative to early passage and vector controls, and phospho-ERK levels were restored by treatment with sodium orthovanadate, indicating a role for phosphatase activity in this response. Collectively these observations suggest that ectopic ERK expression promotes phenotypic conversion of C10 cells that is associated with latent effects on epigenetic programming and phosphatase activities.« less

Tissue-specific expression of silkmoth chorion genes in vivo using Bombyx mori nuclear polyhedrosis virus as a transducing vector.

PubMed Central

Iatrou, K; Meidinger, R G

1990-01-01

A pair of silkmoth chorion chromosomal genes, HcA.12-HcB.12, was inserted into a baculovirus transfer vector, pBmp2, derived from the nuclear polyhedrosis virus of Bombyx mori. This vector, which permits the insertion of foreign genetic material in the vicinity of a mutationally inactivated polyhedrin gene, was used to acquire the corresponding recombinant virus. Injection of mutant silkmoth pupae that lack all Hc chorion genes with the recombinant virus resulted in the infection of all internal organs including follicular tissue. Analysis of RNA from infected tissues has demonstrated that the two chorion genes present in the viral genome are correctly transcribed under the control of their own promoter in follicular cells, the tissue in which chorion genes are normally expressed. The chorion primary transcripts are also correctly processed in the infected follicular cells and yield mature mRNAs indistinguishable from authentic chorion mRNAs present in wild-type follicles. These results demonstrate that recombinant nuclear polyhedrosis viruses can be used as transducing vectors for introducing genetic material of host origin into the cells of the organism and that the transduced genes are transiently expressed in a tissue-specific manner under the control of their resident regulatory sequences. Thus we show the in vivo expression of cloned genes under cellular promoter control in an insect other than Drosophila melanogaster. The approach should be applicable to all insect systems that are subject to nuclear polyhedrosis virus infection. Images PMID:2187186

A piggyBac-based reporter system for scalable in vitro and in vivo analysis of 3′ untranslated region-mediated gene regulation

PubMed Central

Chaudhury, Arindam; Kongchan, Natee; Gengler, Jon P.; Mohanty, Vakul; Christiansen, Audrey E.; Fachini, Joseph M.; Martin, James F.; Neilson, Joel R.

2014-01-01

Regulation of messenger ribonucleic acid (mRNA) subcellular localization, stability and translation is a central aspect of gene expression. Much of this control is mediated via recognition of mRNA 3′ untranslated regions (UTRs) by microRNAs (miRNAs) and RNA-binding proteins. The gold standard approach to assess the regulation imparted by a transcript's 3′ UTR is to fuse the UTR to a reporter coding sequence and assess the relative expression of this reporter as compared to a control. Yet, transient transfection approaches or the use of highly active viral promoter elements may overwhelm a cell's post-transcriptional regulatory machinery in this context. To circumvent this issue, we have developed and validated a novel, scalable piggyBac-based vector for analysis of 3′ UTR-mediated regulation in vitro and in vivo. The vector delivers three independent transcription units to the target genome—a selection cassette, a turboGFP control reporter and an experimental reporter expressed under the control of a 3′ UTR of interest. The pBUTR (piggyBac-based 3′ UnTranslated Region reporter) vector performs robustly as a siRNA/miRNA sensor, in established in vitro models of post-transcriptional regulation, and in both arrayed and pooled screening approaches. The vector is robustly expressed as a transgene during murine embryogenesis, highlighting its potential usefulness for revealing post-transcriptional regulation in an in vivo setting. PMID:24753411

Viral vector-based reversible neuronal inactivation and behavioral manipulation in the macaque monkey

PubMed Central

Nielsen, Kristina J.; Callaway, Edward M.; Krauzlis, Richard J.

2012-01-01

Viral vectors are promising tools for the dissection of neural circuits. In principle, they can manipulate neurons at a level of specificity not otherwise achievable. While many studies have used viral vector-based approaches in the rodent brain, only a few have employed this technique in the non-human primate, despite the importance of this animal model for neuroscience research. Here, we report evidence that a viral vector-based approach can be used to manipulate a monkey's behavior in a task. For this purpose, we used the allatostatin receptor/allatostatin (AlstR/AL) system, which has previously been shown to allow inactivation of neurons in vivo. The AlstR was expressed in neurons in monkey V1 by injection of an adeno-associated virus 1 (AAV1) vector. Two monkeys were trained in a detection task, in which they had to make a saccade to a faint peripheral target. Injection of AL caused a retinotopic deficit in the detection task in one monkey. Specifically, the monkey showed marked impairment for detection targets placed at the visual field location represented at the virus injection site, but not for targets shown elsewhere. We confirmed that these deficits indeed were due to the interaction of AlstR and AL by injecting saline, or AL at a V1 location without AlstR expression. Post-mortem histology confirmed AlstR expression in this monkey. We failed to replicate the behavioral results in a second monkey, as AL injection did not impair the second monkey's performance in the detection task. However, post-mortem histology revealed a very low level of AlstR expression in this monkey. Our results demonstrate that viral vector-based approaches can produce effects strong enough to influence a monkey's performance in a behavioral task, supporting the further development of this approach for studying how neuronal circuits control complex behaviors in non-human primates. PMID:22723770

Subpial Adeno-associated Virus 9 (AAV9) Vector Delivery in Adult Mice.

PubMed

Tadokoro, Takahiro; Miyanohara, Atsushi; Navarro, Michael; Kamizato, Kota; Juhas, Stefan; Juhasova, Jana; Marsala, Silvia; Platoshyn, Oleksandr; Curtis, Erik; Gabel, Brandon; Ciacci, Joseph; Lukacova, Nada; Bimbova, Katarina; Marsala, Martin

2017-07-13

The successful development of a subpial adeno-associated virus 9 (AAV9) vector delivery technique in adult rats and pigs has been reported on previously. Using subpially-placed polyethylene catheters (PE-10 or PE-5) for AAV9 delivery, potent transgene expression through the spinal parenchyma (white and gray matter) in subpially-injected spinal segments has been demonstrated. Because of the wide range of transgenic mouse models of neurodegenerative diseases, there is a strong desire for the development of a potent central nervous system (CNS)-targeted vector delivery technique in adult mice. Accordingly, the present study describes the development of a spinal subpial vector delivery device and technique to permit safe and effective spinal AAV9 delivery in adult C57BL/6J mice. In spinally immobilized and anesthetized mice, the pia mater (cervical 1 and lumbar 1-2 spinal segmental level) was incised with a sharp 34 G needle using an XYZ manipulator. A second XYZ manipulator was then used to advance a blunt 36G needle into the lumbar and/or cervical subpial space. The AAV9 vector (3-5 µL; 1.2 x 10 13 genome copies (gc)) encoding green fluorescent protein (GFP) was then injected subpially. After injections, neurological function (motor and sensory) was assessed periodically, and animals were perfusion-fixed 14 days after AAV9 delivery with 4% paraformaldehyde. Analysis of horizontal or transverse spinal cord sections showed transgene expression throughout the entire spinal cord, in both gray and white matter. In addition, intense retrogradely-mediated GFP expression was seen in the descending motor axons and neurons in the motor cortex, nucleus ruber, and formatio reticularis. No neurological dysfunction was noted in any animals. These data show that the subpial vector delivery technique can successfully be used in adult mice, without causing procedure-related spinal cord injury, and is associated with highly potent transgene expression throughout the spinal neuraxis.

[Prokaryotic expression, purification and biological activity analysis of recombinant β-Lactamase protein].

PubMed

Zhou, Xiao-liang; Shi, Pei-ji; Wang, Hao

2011-01-01

To prepare RGD4CβL fusion protein using prokaryotic expression system and evaluate the biological activity of the RGD4CβL. RGD4CβL gene was cloned into pColdII to contruct β-Lactamase prokaryotic expression vector. After transformation, the recombinant vector was induced to express recombinant protein RGD4CβL by IPTG in E.coli BL(DE3). The recombinant protein was purified by Ni-NTA resin under denaturing condition and then dialyzed to renature. The tumor cell targeting ability of the recombinant protein was analyzed by flow cytometric analysis. After cleavage and purification, β-Lactamase moiety showed the expected size of 42 000 on Tricine-SDS-PAGE, and was further confirmed by Western blotting. Based on flow cytometric analysis, the purified protein specially targeted breast cancer cell line MCF-7. This research successfully estiblished a method for prokaryotic expression and purification of β-lactamase. These results suggest the potential use of the protein as an agent for ADEPT.

High-level recombinant protein expression in transgenic plants by using a double-inducible viral vector

PubMed Central

Werner, Stefan; Breus, Oksana; Symonenko, Yuri; Marillonnet, Sylvestre; Gleba, Yuri

2011-01-01

We describe here a unique ethanol-inducible process for expression of recombinant proteins in transgenic plants. The process is based on inducible release of viral RNA replicons from stably integrated DNA proreplicons. A simple treatment with ethanol releases the replicon leading to RNA amplification and high-level protein production. To achieve tight control of replicon activation and spread in the uninduced state, the viral vector has been deconstructed, and its two components, the replicon and the cell-to-cell movement protein, have each been placed separately under the control of an inducible promoter. Transgenic Nicotiana benthamiana plants incorporating this double-inducible system demonstrate negligible background expression, high (over 0.5 × 104-fold) induction multiples, and high absolute levels of protein expression upon induction (up to 4.3 mg/g fresh biomass). The process can be easily scaled up, supports expression of practically important recombinant proteins, and thus can be directly used for industrial manufacturing. PMID:21825158

Gene and enhancer trap tagging of vascular-expressed genes in poplar trees

Treesearch

Andrew Groover; Joseph R. Fontana; Gayle Dupper; Caiping Ma; Robert Martienssen; Steven Strauss; Richard Meilan

2004-01-01

We report a gene discovery system for poplar trees based on gene and enhancer traps. Gene and enhancer trap vectors carrying the β-glucuronidase (GUS) reporter gene were inserted into the poplar genome via Agrobacterium tumefaciens transformation, where they reveal the expression pattern of genes at or near the insertion sites. Because GUS...

SPECIAL ISSUE ON OPTICAL PROCESSING OF INFORMATION: Analysis of the precision parameters of an optoelectronic vector-matrix processor of digital information

NASA Astrophysics Data System (ADS)

Odinokov, S. B.; Petrov, A. V.

1995-10-01

Mathematical models of components of a vector-matrix optoelectronic multiplier are considered. Perturbing factors influencing a real optoelectronic system — noise and errors of radiation sources and detectors, nonlinearity of an analogue—digital converter, nonideal optical systems — are taken into account. Analytic expressions are obtained for relating the precision of such a multiplier to the probability of an error amounting to one bit, to the parameters describing the quality of the multiplier components, and to the quality of the optical system of the processor. Various methods of increasing the dynamic range of a multiplier are considered at the technical systems level.

Protection from the toxicity of diisopropylfluorophosphate by adeno-associated virus expressing acetylcholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li Bin; Duysen, Ellen G.; Poluektova, Larisa Y.

2006-07-15

Organophosphorus esters (OP) are highly toxic chemicals used as pesticides and nerve agents. Their acute toxicity is attributed to inhibition of acetylcholinesterase (AChE, EC 3.1.1.7) in nerve synapses. Our goal was to find a new therapeutic for protection against OP toxicity. We used a gene therapy vector, adeno-associated virus serotype 2 (AAV-2), to deliver murine AChE to AChE-/- mice that have no endogenous AChE activity. The vector encoded the most abundant form of AChE: exons 2, 3, 4, and 6. Two-day old animals, with an immature immune system, were injected. AChE delivered intravenously was expressed up to 5 months inmore » plasma, liver, heart, and lung, at 5-15% of the level in untreated wild-type mice. A few mice formed antibodies, but antibodies did not block AChE activity. The plasma AChE was a mixture of dimers and tetramers. AChE delivered intramuscularly had 40-fold higher activity levels than in wild-type muscle. None of the AChE was collagen-tailed. No retrograde transport through the motor neurons to the central nervous system was detected. AChE delivered intrastriatally assembled into tetramers. In brain, the AAV-2 vector transduced neurons, but not astrocytes and microglia. Vector-treated AChE-/- mice lived longer than saline-treated controls. AChE-/- mice were protected from diisopropylfluorophosphate-induced respiratory failure when the vector was delivered intravenously, but not intrastriatally. Since vector-treated animals had no AChE activity in diaphragm muscle, protection from respiratory failure came from AChE in other tissues. We conclude that AChE scavenged OP and in this way protected the activity of butyrylcholinesterase (BChE, EC 3.1.1.8) in motor endplates.« less

Single residue AAV capsid mutation improves transduction of photoreceptors in the Abca4-/- mouse and bipolar cells in the rd1 mouse and human retina ex vivo.

PubMed

De Silva, Samantha R; Charbel Issa, Peter; Singh, Mandeep S; Lipinski, Daniel M; Barnea-Cramer, Alona O; Walker, Nathan J; Barnard, Alun R; Hankins, Mark W; MacLaren, Robert E

2016-11-01

Gene therapy using adeno-associated viral (AAV) vectors for the treatment of retinal degenerations has shown safety and efficacy in clinical trials. However, very high levels of vector expression may be necessary for the treatment of conditions such as Stargardt disease where a dual vector approach is potentially needed, or in optogenetic strategies for end-stage degeneration in order to achieve maximal light sensitivity. In this study, we assessed two vectors with single capsid mutations, rAAV2/2(Y444F) and rAAV2/8(Y733F) in their ability to transduce retina in the Abca4 -/- and rd1 mouse models of retinal degeneration. We noted significantly increased photoreceptor transduction using rAAV2/8(Y733F) in the Abca4 -/- mouse, in contrast to previous work where vectors tested in this model have shown low levels of photoreceptor transduction. Bipolar cell transduction was achieved following subretinal delivery of both vectors in the rd1 mouse, and via intravitreal delivery of rAAV2/2(Y444F). The successful use of rAAV2/8(Y733F) to target bipolar cells was further validated on human tissue using an ex vivo culture system of retinal explants. Capsid mutant AAV vectors transduce human retinal cells and may be particularly suited to treat retinal degenerations in which high levels of transgene expression are required.

Lentiviral gene ontology (LeGO) vectors equipped with novel drug-selectable fluorescent proteins: new building blocks for cell marking and multi-gene analysis.

PubMed

Weber, K; Mock, U; Petrowitz, B; Bartsch, U; Fehse, B

2010-04-01

Vector-encoded fluorescent proteins (FPs) facilitate unambiguous identification or sorting of gene-modified cells by fluorescence-activated cell sorting (FACS). Exploiting this feature, we have recently developed lentiviral gene ontology (LeGO) vectors (www.LentiGO-Vectors.de) for multi-gene analysis in different target cells. In this study, we extend the LeGO principle by introducing 10 different drug-selectable FPs created by fusing one of the five selection marker (protecting against blasticidin, hygromycin, neomycin, puromycin and zeocin) and one of the five FP genes (Cerulean, eGFP, Venus, dTomato and mCherry). All tested fusion proteins allowed both fluorescence-mediated detection and drug-mediated selection of LeGO-transduced cells. Newly generated codon-optimized hygromycin- and neomycin-resistance genes showed improved expression as compared with their ancestors. New LeGO constructs were produced at titers >10(6) per ml (for non-concentrated supernatants). We show efficient combinatorial marking and selection of various cells, including mesenchymal stem cells, simultaneously transduced with different LeGO constructs. Inclusion of the cytomegalovirus early enhancer/chicken beta-actin promoter into LeGO vectors facilitated robust transgene expression in and selection of neural stem cells and their differentiated progeny. We suppose that the new drug-selectable markers combining advantages of FACS and drug selection are well suited for numerous applications and vector systems. Their inclusion into LeGO vectors opens new possibilities for (stem) cell tracking and functional multi-gene analysis.

Immunogenicity of Newcastle Disease Virus Vectors Expressing Norwalk Virus Capsid Protein in the Presence or Absence of VP2 Protein

PubMed Central

Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y.; Samal, Siba K.

2015-01-01

Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirs-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. PMID:26099695

Preclinical development of BCG.HIVA2auxo.int, harboring an integrative expression vector, for a HIV-TB Pediatric vaccine. Enhancement of stability and specific HIV-1 T-cell immunity.

PubMed

Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan

2017-08-03

One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.

Reflections on the early development of poxvirus vectors.

PubMed

Moss, Bernard

2013-09-06

Poxvirus expression vectors were described in 1982 and quickly became widely used for vaccine development as well as research in numerous fields. Advantages of the vectors include simple construction, ability to accommodate large amounts of foreign DNA and high expression levels. Numerous poxvirus-based veterinary vaccines are currently in use and many others are in human clinical trials. The early reports of poxvirus vectors paved the way for and stimulated the development of other viral vectors and recombinant DNA vaccines. Published by Elsevier Ltd.

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

[RS-1 enhanced the efficiency of CRISPR-Cas9 mediated knock-in of human lactoferrin].

PubMed

Zhou, Wenjun; Guo, Rihong; Deng, Mingtian; Wang, Feng; Zhang, Yanli

2017-08-25

This study aims to knock out the goat β-lactoglobulin (BLG) gene using CRISPR-Cas9 system and knock in human lactoferrin (hLF) at the BLG locus, and further study the effect of RAD51 stimulatory compound (RS-1) on homologous recombination efficiency. First, we designed an sgRNA targeting the first exon of goat BLG gene and constructed a co-expression vector pCas9-sgBLG. This sgRNA vector was then transfected into goat ear fibroblasts (GEFs), and the target region was examined by T7EN1 assay and sequencing. Second, we constructed a targeting vector pBHA-hLF-NIE including NEO and EGFP genes based on BLG gene locus. This targeting vector together with pCas9-sgBLG expression vector was co-transfected into GEFs. Transfected cells were then treated with 0, 5, 10 and 20 μmol/L RS-1 for 72 h to analyse the EGFP expression efficiency. Next, we used 800 μg/mL G418 to screen G418-resistent cell clones, and studied hLF site-specific knock-in cell clones by PCR and sequencing. The editing efficiency of sgBLG was between 25% and 31%. The EGFP expression efficiency indicated that the gene knock-in efficiency was improved by RS-1 in a dose-dependent manner, which could reach 3.5-fold compared to the control group. The percentage of positive cells with hLF knock-in was increased to 32.61% when 10 μmol/L RS-1 was used. However, when the concentration of RS-1 increased to 20 μmol/L, the percentage of positive cells decreased to 22.22% and resulted in an increase of senescent cell clone number. These results suggested that hLF knock-in and BLG knock-out in GEFs were achieved by using CRISPR/Cas9 system, and optimum concentration of RS-1 could improve knock-in efficiency, which provides a reference for efficiently obtaining gene knock-in cells using CRISPR/Cas9 in the future.

Integration of adeno-associated virus vectors in CD34+ human hematopoietic progenitor cells after transduction.

PubMed

Fisher-Adams, G; Wong, K K; Podsakoff, G; Forman, S J; Chatterjee, S

1996-07-15

Gene transfer vectors based on adeno-associated virus (AAV) appear promising because of their high transduction frequencies regardless of cell cycle status and ability to integrate into chromosomal DNA. We tested AAV-mediated gene transfer into a panel of human bone marrow or umbilical cord-derived CD34+ hematopoietic progenitor cells, using vectors encoding several transgenes under the control of viral and cellular promoters. Gene transfer was evaluated by (1) chromosomal integration of vector sequences and (2) analysis of transgene expression. Southern hybridization and fluorescence in situ hybridization analysis of transduced CD34 genomic DNA showed the presence of integrated vector sequences in chromosomal DNA in a portion of transduced cells and showed that integrated vector sequences were replicated along with cellular DNA during mitosis. Transgene expression in transduced CD34 cells in suspension cultures and in myeloid colonies differentiating in vitro from transduced CD34 cells approximated that predicted by the multiplicity of transduction. This was true in CD34 cells from different donors, regardless of the transgene or selective pressure. Comparisons of CD34 cell transduction either before or after cytokine stimulation showed similar gene transfer frequencies. Our findings suggest that AAV transduction of CD34+ hematopoietic progenitor cells is efficient, can lead to stable integration in a population of transduced cells, and may therefore provide the basis for safe and efficient ex vivo gene therapy of the hematopoietic system.

Generation of Envelope-Modified Baculoviruses for Gene Delivery into Mammalian Cells.

PubMed

Hofmann, Christian

2016-01-01

Genetically modified baculoviruses can efficiently deliver and express genes in mammalian cells. The major prerequisite for the expression of a gene transferred by baculovirus is its control by a promoter that is active in mammalian cells. This chapter describes methods for producing second generation baculovirus vectors through modification of their envelope. Envelope modified baculoviruses offer additional new applications of the system, such as their use in in vivo gene delivery, targeting, and vaccination. Methods of generating a recombinant baculovirus vector with a modified envelope and its amplification and purification, including technical scale production, are discussed. A variety of notes give clues regarding specific technical procedures. Finally, methods to analyze the virus and transduction procedures are presented.

Expression of proteins in Escherichia coli as fusions with maltose-binding protein to rescue non-expressed targets in a high-throughput protein-expression and purification pipeline

PubMed Central

Hewitt, Stephen N.; Choi, Ryan; Kelley, Angela; Crowther, Gregory J.; Napuli, Alberto J.; Van Voorhis, Wesley C.

2011-01-01

Despite recent advances, the expression of heterologous proteins in Escherichia coli for crystallization remains a nontrivial challenge. The present study investigates the efficacy of maltose-binding protein (MBP) fusion as a general strategy for rescuing the expression of target proteins. From a group of sequence-verified clones with undetectable levels of protein expression in an E. coli T7 expression system, 95 clones representing 16 phylogenetically diverse organisms were selected for recloning into a chimeric expression vector with an N-terminal histidine-tagged MBP. PCR-amplified inserts were annealed into an identical ligation-independent cloning region in an MBP-fusion vector and were analyzed for expression and solubility by high-throughput nickel-affinity binding. This approach yielded detectable expression of 72% of the clones; soluble expression was visible in 62%. However, the solubility of most proteins was marginal to poor upon cleavage of the MBP tag. This study offers large-scale evidence that MBP can improve the soluble expression of previously non-expressing proteins from a variety of eukaryotic and prokaryotic organisms. While the behavior of the cleaved proteins was disappointing, further refinements in MBP tagging may permit the more widespread use of MBP-fusion proteins in crystallographic studies. PMID:21904041

An effective system for detecting protein-protein interaction based on in vivo cleavage by PPV NIa protease.

PubMed

Zheng, Nuoyan; Huang, Xiahe; Yin, Bojiao; Wang, Dan; Xie, Qi

2012-12-01

Detection of protein-protein interaction can provide valuable information for investigating the biological function of proteins. The current methods that applied in protein-protein interaction, such as co-immunoprecipitation and pull down etc., often cause plenty of working time due to the burdensome cloning and purification procedures. Here we established a system that characterization of protein-protein interaction was accomplished by co-expression and simply purification of target proteins from one expression cassette within E. coli system. We modified pET vector into co-expression vector pInvivo which encoded PPV NIa protease, two cleavage site F and two multiple cloning sites that flanking cleavage sites. The target proteins (for example: protein A and protein B) were inserted at multiple cloning sites and translated into polyprotein in the order of MBP tag-protein A-site F-PPV NIa protease-site F-protein B-His(6) tag. PPV NIa protease carried out intracellular cleavage along expression, then led to the separation of polyprotein components, therefore, the interaction between protein A-protein B can be detected through one-step purification and analysis. Negative control for protein B was brought into this system for monitoring interaction specificity. We successfully employed this system to prove two cases of reported protien-protein interaction: RHA2a/ANAC and FTA/FTB. In conclusion, a convenient and efficient system has been successfully developed for detecting protein-protein interaction.

A lentiviral vector with expression controlled by E2F-1: A potential tool for the study and treatment of proliferative diseases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Strauss, Bryan E.; Patricio, Juliana Rotelli; Program in Biotechnology, University of Sao Paulo

2006-10-06

We have constructed a lentiviral vector with expression limited to cells presenting active E2F-1 protein, a potential advantage for gene therapy of proliferative diseases. For the FE2FLW vector, the promoter region of the human E2F-1 gene was utilized to drive expression of luciferase cDNA, included as a reporter of viral expression. Primary, immortalized, and transformed cells were transduced with the FE2FLW vector and cell cycle alterations were induced with serum starvation/replacement, contact inhibition or drug treatment, revealing cell cycle-dependent changes in reporter activity. Forced E2F-1 expression, but not E2F-2 or E2F-3, increased reporter activity, indicating a major role for thismore » factor in controlling expression from the FE2FLW virus. We show the utility of this vector as a reporter of E2F-1 and proliferation-dependent cellular alterations upon cytotoxic/cytostatic treatment, such as the introduction of tumor suppressor genes. We propose that the FE2FLW vector may be a starting point for the development of gene therapy strategies for proliferative diseases, such as cancer or restinosis.« less

Cloning and expression of Clostridium perfringens type D vaccine strain epsilon toxin gene in E. coli as a recombinant vaccine candidate.

PubMed

Aziminia, Parastoo; Pilehchian-Langroudi, Reza; Esmaeilnia, Kasra

2016-08-01

Clostridium perfringens, a Gram-positive obligate anaerobic bacterium, is able to form resistant spores which are widely distributed in the environment. C. perfringens is subdivided into five types A to E based on its four major alpha, beta, epsilon and iota toxins. The aim of the present study was cloning and expression of C. perfringens type D vaccine strain epsilon toxin gene. Genomic DNA was extracted and the epsilon toxin gene was amplified using Pfu DNA polymerase. The PCR product was cloned into pJET1.2/blunt cloning vector. The recombinant vector (pJETε) was sequenced using universal primers. At the next step epsilon toxin gene was subcloned into pET22b(+) expression vector and transformed into E. coli Rosetta (DE3) host strain. The recombinant protein has been expressed in E. coli Rosetta (DE3) cells after subcloning of C. perfringens etx gene (1008 bp) into the expression vector. We concluded that E. coli Rosetta strain was suitable for the expression of recombinant C. perfringens epsilon toxin protein from pET22ε expression vector. This recombinant cell can be used for further research on recombinant vaccine development.

[Expression and identification of eukaryotic expression vectors of Brucella melitensis lipoprotein OMP19].

PubMed

He, Zuoping; Luo, Peifang; Hu, Feihuan; Weng, Yunceng; Wang, Wenjing; Li, Chengyao

2016-04-01

To construct eukaryotic expression vectors carrying Brucella melitensis outer membrane protein 19 (OMP19), express them in transfected Huh7.5.1 and JEG-3 cells, and analyze their role in cell apoptosis. Brucella melitensis lipidated OMP19 (L-OMP19) gene and unlipidated OMP19 (U-OMP19) gene were amplified by PCR and inserted into the vector pZeroBack/blunt. The correct L-OMP19 and U-OMP19 genes verified by XbaI and BamHI double digestion and sequencing were cloned into the lentivirus expression vector pHAGE-CMV-MCS-IZsGreen to construct vectors pHAGE-L-OMP19 and pHAGE-U-OMP19, which were separately transfected into 293FT cells, Huh7.5.1 and JEG-3 cells. L-OMP19 and U-OMP19 in the cells were detected by Western blotting and immunofluorescence technique. Flow cytometry combined with annexin V-PE/7-AAD staining was used to detect the cell apoptosis. The lentiviral vectors pHAGE-L-OMP19 and pHAGE-U-OMP19 were constructed correctly and the recombinant lipoproteins L-OMP19 and U-OMP19 expressed in the above cells were well recognized by the specific antibodies against L-OMP19 in Western blotting and immunofluorescence technique. L-OMP19 and U-OMP19 induced JEG-3 cell death, but did not induce the apoptosis of Huh7.5.1 cells. The eukaryotic expression vectors of L-OMP19 and U-OMP19 have been constructed successfully. Recombinant lipoproteins L-OMP19 and U-OMP19 expressed in cells have a good antigenicity, which could be used as experimental materials for the research on the relationship between host cells and lipoproteins in Brucella infection.

[The expression of interferon-lambda1 in CHO cell].

PubMed

Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

2013-06-01

To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

Recombinant Salmonella Bacteria Vectoring HIV/AIDS Vaccines

PubMed Central

Chin’ombe, Nyasha; Ruhanya, Vurayai

2013-01-01

HIV/AIDS is an important public health problem globally. An affordable, easy-to-deliver and protective HIV vaccine is therefore required to curb the pandemic from spreading further. Recombinant Salmonella bacteria can be harnessed to vector HIV antigens or DNA vaccines to the immune system for induction of specific protective immunity. These are capable of activating the innate, humoral and cellular immune responses at both mucosal and systemic compartments. Several studies have already demonstrated the utility of live recombinant Salmonella in delivering expressed foreign antigens as well as DNA vaccines to the host immune system. This review gives an overview of the studies in which recombinant Salmonella bacteria were used to vector HIV/AIDS antigens and DNA vaccines. Most of the recombinant Salmonella-based HIV/AIDS vaccines developed so far have only been tested in animals (mainly mice) and are yet to reach human trials. PMID:24478808

Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eric Y. Chuang

2006-08-31

It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors tomore » deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose γ-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.« less

Adenovirus vector expressing keratinocyte growth factor using CAG promoter impairs pulmonary function of mice with elastase-induced emphysema.

PubMed

Oki, Hiroshi; Yazawa, Takuya; Baba, Yasuko; Kanegae, Yumi; Sato, Hanako; Sakamoto, Seiko; Goto, Takahisa; Saito, Izumu; Kurahashi, Kiyoyasu

2017-07-01

Pulmonary emphysema impairs quality of life and increases mortality. It has previously been shown that administration of adenovirus vector expressing murine keratinocyte growth factor (KGF) before elastase instillation prevents pulmonary emphysema in mice. We therefore hypothesized that therapeutic administration of KGF would restore damage to lungs caused by elastase instillation and thus improve pulmonary function in an animal model. KGF expressing adenovirus vector, which prevented bleomycin-induced pulmonary fibrosis in a previous study, was constructed. Adenovirus vector (1.0 × 10 9 plaque-forming units) was administered intratracheally one week after administration of elastase into mouse lungs. One week after administration of KGF-vector, exercise tolerance testing and blood gas analysis were performed, after which the lungs were removed under deep anesthesia. KGF-positive pneumocytes were more numerous, surfactant protein secretion in the airspace greater and mean linear intercept of lungs shorter in animals that had received KGF than in control animals. Unexpectedly, however, arterial blood oxygenation was worse in the KGF group and maximum running speed, an indicator of exercise capacity, had not improved after KGF in mice with elastase-induced emphysema, indicating that KGF-expressing adenovirus vector impaired pulmonary function in these mice. Notably, vector lacking KGF-expression unit did not induce such impairment, implying that the KGF expression unit itself may cause the damage to alveolar cells. Possible involvement of the CAG promoter used for KGF expression in impairing pulmonary function is discussed. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

[Enhancement of functional expression of wheat peroxidase WP1 in prokaryotic system by co-transforming with hemA and hemL of Esherichia coli].

PubMed

Zhang, Chao; Shan, Liwei; Su, Shuaikun; Nan, Yanni; Guo, Zhongyu; Fan, Sanhong

2012-07-01

Wheat grain peroxidase 1 (WP1) belonged to class III plant peroxidase with cofactor heme, which not only has antifungal activity, but also influences the processing quality of flour. In order to enhance functional expression of WP1 in prokaryotic system by increasing endogenous heme synthesis, we constructed a recombinant plasmid pACYC-A-L containing hemA and hemL of Esherichia coli. Then, we co-transformed it into host strain T7 Express with secretive expression vector (pMAL-p4x-WP1) or non-secretive expression vector (pET21a-MBP-WP1), respectively. The MBP-WP1 fusion protein was further purified by amylose affinity chromatography and its peroxidase activity was assayed using 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) as substrate. At 12 h after induction at 28 degree, the extracellular 5-aminolevulinic acid (5-ALA) production of T7 Express/pACYC-A-L was up to 146.73 mg/L, simultaneously the extracellular porphrins also increased dramatically. The peroxidase activity of functional MBP-WP1 obtained from T7 Express/ (pACYC-A-L + pMAL-p4x-WP1) was 14.6-folds of that purified from T7 Express/ pET21a-MBP-WP1. This study not only successfully enhanced functional expression of wheat peroxidase 1 in Esherichia coli, but also provided beneficial references for other important proteins with cofactor heme.

A helper virus-free HSV-1 vector containing the vesicular glutamate transporter-1 promoter supports expression preferentially in VGLUT1-containing glutamatergic neurons.

PubMed

Zhang, Guo-rong; Geller, Alfred I

2010-05-17

Multiple potential uses of direct gene transfer into neurons require restricting expression to specific classes of glutamatergic neurons. Thus, it is desirable to develop vectors containing glutamatergic class-specific promoters. The three vesicular glutamate transporters (VGLUTs) are expressed in distinct populations of neurons, and VGLUT1 is the predominant VGLUT in the neocortex, hippocampus, and cerebellar cortex. We previously reported a plasmid (amplicon) Herpes Simplex Virus (HSV-1) vector that placed the Lac Z gene under the regulation of the VGLUT1 promoter (pVGLUT1lac). Using helper virus-free vector stocks, we showed that this vector supported approximately 90% glutamatergic neuron-specific expression in postrhinal (POR) cortex, in rats sacrificed at either 4 days or 2 months after gene transfer. We now show that pVGLUT1lac supports expression preferentially in VGLUT1-containing glutamatergic neurons. pVGLUT1lac vector stock was injected into either POR cortex, which contains primarily VGLUT1-containing glutamatergic neurons, or into the ventral medial hypothalamus (VMH), which contains predominantly VGLUT2-containing glutamatergic neurons. Rats were sacrificed at 4 days after gene transfer, and the types of cells expressing ss-galactosidase were determined by immunofluorescent costaining. Cell counts showed that pVGLUT1lac supported expression in approximately 10-fold more cells in POR cortex than in the VMH, whereas a control vector supported expression in similar numbers of cells in these two areas. Further, in POR cortex, pVGLUT1lac supported expression predominately in VGLUT1-containing neurons, and, in the VMH, pVGLUT1lac showed an approximately 10-fold preference for the rare VGLUT1-containing neurons. VGLUT1-specific expression may benefit specific experiments on learning or specific gene therapy approaches, particularly in the neocortex. Copyright 2010 Elsevier B.V. All rights reserved.

Generation of 2A-linked multicistronic cassettes by recombinant PCR.

PubMed

Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A

2012-02-01

The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. It is now possible to express multiple proteins from a single open reading frame (ORF) using 2A peptide-linked multicistronic vectors. These small sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector. This protocol describes the use of recombinant polymerase chain reaction (PCR) to connect multiple 2A-linked protein sequences. The final construct is subcloned into an expression vector.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Characteristics of lentiviral vectors harboring the proximal promoter of the vav proto-oncogene: a weak and efficient promoter for gene therapy.

PubMed

Almarza, Elena; Río, Paula; Meza, Nestor W; Aldea, Montserrat; Agirre, Xabier; Guenechea, Guillermo; Segovia, José C; Bueren, Juan A

2007-08-01

Recent published data have shown the efficacy of gene therapy treatments of certain monogenic diseases. Risks of insertional oncogenesis, however, indicate the necessity of developing new vectors with weaker or cell-restricted promoters to minimize the trans-activation activity of integrated proviruses. We have inserted the proximal promoter of the vav proto-oncogene into self-inactivating lentiviral vectors (vav-LVs) and investigated the expression pattern and therapeutic efficacy of these vectors. Compared with other LVs frequently used in gene therapy, vav-LVs mediated a weak, though homogeneous and stable, expression in in vitro-cultured cells. Transplantation experiments using transduced mouse bone marrow and human CD34(+) cells confirmed the stable activity of the promoter in vivo. To investigate whether the weak activity of this promoter was compatible with a therapeutic effect, a LV expressing the Fanconi anemia A (FANCA) gene was constructed (vav-FANCA LV). Although this vector induced a low expression of FANCA, compared to the expression induced by a LV harboring the spleen focus-forming virus (SFFV) promoter, the two vectors corrected the phenotype of cells from a patient with FA-A with the same efficacy. We propose that self-inactivating vectors harboring weak promoters, such as the vav promoter, will improve the safety of gene therapy and will be of particular interest for the treatment of diseases where a high expression of the transgene is not required.

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

Cre/lox system to develop selectable marker free transgenic tobacco plants conferring resistance against sap sucking homopteran insect.

PubMed

Chakraborti, Dipankar; Sarkar, Anindya; Mondal, Hossain A; Schuermann, David; Hohn, Barbara; Sarmah, Bidyut K; Das, Sampa

2008-10-01

A binary expression vector was constructed containing the insecticidal gene Allium sativum leaf agglutinin (ASAL), and a selectable nptII marker gene cassette, flanked by lox sites. Similarly, another binary vector was developed with the chimeric cre gene construct. Transformed tobacco plants were generated with these two independent vectors. Each of the T(0) lox plants was crossed with T(0) Cre plants. PCR analyses followed by the sequencing of the target T-DNA part of the hybrid T(1) plants demonstrated the excision of the nptII gene in highly precised manner in certain percentage of the T(1) hybrid lines. The frequency of such marker gene excision was calculated to be 19.2% in the hybrids. Marker free plants were able to express ASAL efficiently and reduce the survivability of Myzus persiceae, the deadly pest of tobacco significantly, compared to the control tobacco plants. Results of PCR and Southern blot analyses of some of the T(2) plants detected the absence of cre as well as nptII genes. Thus, the crossing strategy involving Cre/lox system for the excision of marker genes appears to be very effective and easy to execute. Documentation of such marker excision phenomenon in the transgenic plants expressing the important insecticidal protein for the first time has a great significance from agricultural and biotechnological points of view.

Development of Sendai Virus Vectors and their Potential Applications in Gene Therapy and Regenerative Medicine

PubMed Central

Nakanishi, Mahito; Otsu, Makoto

2012-01-01

Gene delivery/expression vectors have been used as fundamental technologies in gene therapy since the 1980s. These technologies are also being applied in regenerative medicine as tools to reprogram cell genomes to a pluripotent state and to other cell lineages. Rapid progress in these new research areas and expectations for their translation into clinical applications have facilitated the development of more sophisticated gene delivery/expression technologies. Since its isolation in 1953 in Japan, Sendai virus (SeV) has been widely used as a research tool in cell biology and in industry, but the application of SeV as a recombinant viral vector has been investigated only recently. Recombinant SeV vectors have various unique characteristics, such as low pathogenicity, powerful capacity for gene expression and a wide host range. In addition, the cytoplasmic gene expression mediated by this vector is advantageous for applications, in that chromosomal integration of exogenous genes can be undesirable. In this review, we introduce a brief historical background on the development of recombinant SeV vectors and describe their current applications in gene therapy. We also describe the application of SeV vectors in advanced nuclear reprogramming and introduce a defective and persistent SeV vector (SeVdp) optimized for such reprogramming. PMID:22920683

[Expression of Dengue virus type 2 nonstructural protein 3 and isolation of host proteins interacting with it].

PubMed

Weng, Daihui; Lei, Yingfeng; Dong, Yangchao; Han, Peijun; Ye, Chuantao; Yang, Jing; Wang, Yuan; Yin, Wen

2015-12-01

To construct the plasmid expressing the fusion protein of Dengue virus type 2 (DENV2) nonstructural protein 3 (NS3) with affinity tag, and isolate the cellular proteins interacting with NS3 protein using tandem affinity purification (TAP) assay. Primers for amplifying NS3 gene were designed according to the sequence of DENV2 genome and chemically synthesized. The NS3 fragments, after amplified by PCR with DENV2 cDNA as template, were digested and cloned into the mammalian eukaryotic expression vector pCI-SF with the tandem affinity tag (FLAG-StrepII). The recombinant pCI-NS3-SF was transiently transformed by Lipofectamine(TM) 2000 into HEK293T cells, and the expression of the fusion protein was confirmed by Western blotting. Cellular proteins that interacted with NS3 were isolated and purified by TAP assay. The eukaryotic expression vector expressing NS3 protein was successfully constructed. The host proteins interacting with NS3 protein were isolated by TAP system. TAP is an efficient method to isolate the cellular proteins interacting with DENV2 NS3.

Efficient gusA transient expression in Porphyra yezoensis protoplasts mediated by endogenous beta-tubulin flanking sequences

NASA Astrophysics Data System (ADS)

Gong, Qianhong; Yu, Wengong; Dai, Jixun; Liu, Hongquan; Xu, Rifu; Guan, Huashi; Pan, Kehou

2007-01-01

Endogenous tubulin promoter has been widely used for expressing foreign genes in green algae, but the efficiency and feasibility of endogenous tubulin promoter in the economically important Porphyra yezoensis (Rhodophyta) are unknown. In this study, the flanking sequences of beta-tubulin gene from P. yezoensis were amplified and two transient expression vectors were constructed to determine their transcription promoting feasibility for foreign gene gusA. The testing vector pATubGUS was constructed by inserting 5'-and 3'-flanking regions ( Tub5' and Tub3') up-and down-stream of β-glucuronidase (GUS) gene ( gusA), respectively, into pA, a derivative of pCAT®3-enhancer vector. The control construct, pAGUSTub3, contains only gusA and Tub3'. These constructs were electroporated into P. yezoensis protoplasts and the GUS activities were quantitatively analyzed by spectrometry. The results demonstrated that gusA gene was efficiently expressed in P. yezoensis protoplasts under the regulation of 5'-flanking sequence of the beta-tubulin gene. More interestingly, the pATubGUS produced stronger GUS activity in P. yezoensis protoplasts when compared to the result from pBI221, in which the gusA gene was directed by a constitutive CaMV 35S promoter. The data suggest that the integration of P. yezoensis protoplast and its endogenous beta-tubulin flanking sequences is a potential novel system for foreign gene expression.

Better Targeting, Better Efficiency for Wide-Scale Neuronal Transduction with the Synapsin Promoter and AAV-PHP.B

PubMed Central

Jackson, Kasey L.; Dayton, Robert D.; Deverman, Benjamin E.; Klein, Ronald L.

2016-01-01

Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats. PMID:27867348

Better Targeting, Better Efficiency for Wide-Scale Neuronal Transduction with the Synapsin Promoter and AAV-PHP.B.

PubMed

Jackson, Kasey L; Dayton, Robert D; Deverman, Benjamin E; Klein, Ronald L

2016-01-01

Widespread genetic modification of cells in the central nervous system (CNS) with a viral vector has become possible and increasingly more efficient. We previously applied an AAV9 vector with the cytomegalovirus/chicken beta-actin (CBA) hybrid promoter and achieved wide-scale CNS transduction in neonatal and adult rats. However, this method transduces a variety of tissues in addition to the CNS. Thus we studied intravenous AAV9 gene transfer with a synapsin promoter to better target the neurons. We noted in systematic comparisons that the synapsin promoter drives lower level expression than does the CBA promoter. The engineered adeno-associated virus (AAV)-PHP.B serotype was compared with AAV9, and AAV-PHP.B did enhance the efficiency of expression. Combining the synapsin promoter with AAV-PHP.B could therefore be advantageous in terms of combining two refinements of targeting and efficiency. Wide-scale expression was used to model a disease with widespread pathology. Vectors encoding the amyotrophic lateral sclerosis (ALS)-related protein transactive response DNA-binding protein, 43 kDa (TDP-43) with the synapsin promoter and AAV-PHP.B were used for efficient CNS-targeted TDP-43 expression. Intracerebroventricular injections were also explored to limit TDP-43 expression to the CNS. The neuron-selective promoter and the AAV-PHP.B enhanced gene transfer and ALS disease modeling in adult rats.

Simple and effective generation of transgene-free induced pluripotent stem cells using an auto-erasable Sendai virus vector responding to microRNA-302.

PubMed

Nishimura, Ken; Ohtaka, Manami; Takada, Hitomi; Kurisaki, Akira; Tran, Nhi Vo Kieu; Tran, Yen Thi Hai; Hisatake, Koji; Sano, Masayuki; Nakanishi, Mahito

2017-08-01

Transgene-free induced pluripotent stem cells (iPSCs) are valuable for both basic research and potential clinical applications. We previously reported that a replication-defective and persistent Sendai virus (SeVdp) vector harboring four reprogramming factors (SeVdp-iPS) can efficiently induce generation of transgene-free iPSCs. This vector can express all four factors stably and simultaneously without chromosomal integration and can be eliminated completely from reprogrammed cells by suppressing vector-derived RNA-dependent RNA polymerase. Here, we describe an improved SeVdp-iPS vector (SeVdp(KOSM)302L) that is automatically erased in response to microRNA-302 (miR-302), uniquely expressed in pluripotent stem cells (PSCs). Gene expression and genome replication of the SeVdp-302L vector, which contains miRNA-302a target sequences at the 3' untranslated region of L mRNA, are strongly suppressed in PSCs. Consequently, SeVdp(KOSM)302L induces expression of reprogramming factors in somatic cells, while it is automatically erased from cells successfully reprogrammed to express miR-302. As this vector can reprogram somatic cells into transgene-free iPSCs without the aid of exogenous short interfering RNA (siRNA), the results we present here demonstrate that this vector may become an invaluable tool for the generation of human iPSCs for future clinical applications. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

Detectable reporter gene expression following transduction of adenovirus and adeno-associated virus serotype 2 vectors within full-thickness osteoarthritic and unaffected canine cartilage in vitro and unaffected guinea pig cartilage in vivo.

PubMed

Santangelo, Kelly S; Baker, Sarah A; Nuovo, Gerard; Dyce, Jonathan; Bartlett, Jeffrey S; Bertone, Alicia L

2010-02-01

This study quantified and compared the transduction efficiencies of adenoviral (Ad), Arg-Gly-Asp (RGD)-modified Ad, adeno-associated viral serotype 2 (AAV2), and self-complementary AAV2 (scAAV2) vectors within full-thickness osteoarthritic (OA) and unaffected canine cartilage explants in vitro. Intraarticular administration of Ad and scAAV2 vectors was performed to determine the ability of these vectors to transduce unaffected guinea pig cartilage in vivo. Following explant exposure to vector treatment or control, the onset and surface distribution of reporter gene expression was monitored daily with fluorescent microscopy. At termination, explants were divided: one half was digested for analysis using flow cytometry; the remaining portion was used for histology and immunohistochemistry (IHC). Intact articular joints were collected for real-time RT-PCR and IHC to detect reporter gene expression following injection of selected vectors. Ad vector transduced focal areas along the perimeters of explants; the remaining vectors transduced chondrocytes across 100% of the surface. Greater mean transduction efficiencies were found with both AAV2 vectors as compared to the Ad vector (p < or = 0.026). Ad and Ad-RGD vectors transduced only superficial chondrocytes of OA and unaffected cartilage. Uniform reporter gene expression from AAV2 and scAAV2 was detected in the tangential and transitional zones of OA cartilage, but not deeper zones. AAV2 and scAAV2 vectors achieved partial and full-thickness transduction of unaffected cartilage. In vivo work revealed that scAAV2 vector, but not Ad vector, transduced deeper zones of cartilage and menisci. This study demonstrates that AAV2 and scAAV2 are reliable vectors for use in cartilage in vitro and in vivo. (c) 2009 Orthopaedic Research Society.

Baculovirus vectors expressing F proteins in combination with virus-induced signaling adaptor (VISA) molecules confer protection against respiratory syncytial virus infection.

PubMed

Zhang, Yuan; Qiao, Lei; Hu, Xiao; Zhao, Kang; Zhang, Yanwen; Chai, Feng; Pan, Zishu

2016-01-04

Baculovirus has been exploited for use as a novel vaccine vector. To investigate the feasibility and efficacy of recombinant baculoviruses (rBVs) expressing respiratory syncytial virus (RSV) fusion (F) proteins, four constructs (Bac-tF/64, Bac-CF, Bac-CF/tF64 and Bac-CF/tF64-VISA) were generated. Bac-tF64 displays the F ectodomain (tF) on the envelope of rBVs, whereas Bac-CF expresses full-length F protein in transduced mammalian cells. Bac-CF/tF64 not only displays tF on the envelope but also expresses F in cells. Bac-CF/tF64-VISA comprises Bac-CF/tF64 harboring the virus-induced signaling adaptor (VISA) gene. After administration to BALB/c mice, all four vectors elicited RSV neutralizing antibody (Ab), systemic Ab (IgG, IgG1, and IgG2a), and cytokine responses. Compared with Bac-tF64, mice inoculated with Bac-CF and Bac-CF/tF64 exhibited an increased mixed Th1/Th2 cytokine response, increased ratios of IgG2a/IgG1 antibody responses, and reduced immunopathology upon RSV challenge. Intriguingly, co-expression of VISA reduced Th2 cytokine (IL-4, IL-5, and IL-10) production induced by Bac-CF/tF64, thus relieving lung pathology upon a subsequent RSV challenge. Our results indicated that the Bac-CF/tF64 vector incorporated with the VISA molecule may provide an effective vaccine strategy for protection against RSV. Copyright © 2015 Elsevier Ltd. All rights reserved.

[Construction and selection of effective mouse Smad6 recombinant lenti-virus interference vectors].

PubMed

Yu, Jing; Qi, Mengchun; Deng, Jiupeng; Liu, Gang; Chen, Huaiqing

2010-10-01

This experiment was designed to construct mouse Smad6 recombinant RNA interference vectors and determine their interference effects on bone marrow mesenchymal stem cells (BMSCs). Three recombinant Smad6 RNA interference vectors were constructed by molecular clone techniques with a lenti-virus vector expressing green fluorescent protein (GFP), and the correctness of recombinant vectors was verified by DNA sequencing. Mouse BMSCs were used for transfection experiments and BMP-2 was in use for osteogenic induction of MSCs. The transfection efficiency of recombinant vectors was examined by Laser confocal scanning microscope and the interference effect of recombinant vectors on Smad6 gene expression was determined by real-time RT-PCR and Western blot, respectively. Three Smad6 recombinant RNA interference vectors were successfully constructed and their correctness was proved by DNA sequencing. After transfection, GFPs were effectively expressed in MSCs and all of three recombinant vectors gained high transfection efficiency (> 95%). Both real-time PCR and Western blot examination indicated that among three recombinant vectors, No. 2 Svector had the best interference effect and the interference effect was nearly 91% at protein level. In conclusion, Mouse recombinant Smad6 RNA interference (RNAi) vector was successfully constructed and it provided an effective tool for further studies on BMP signal pathways.

High-level expression of recombinant beta-galactosidases in Lactobacillus plantarum and Lactobacillus sakei using a Sakacin P-based expression system.

PubMed

Halbmayr, Elisabeth; Mathiesen, Geir; Nguyen, Thu-Ha; Maischberger, Thomas; Peterbauer, Clemens K; Eijsink, Vincent G H; Haltrich, Dietmar

2008-06-25

This work presents the cloning and expression of the genes encoding heterodimeric beta-galactosidases from Lactobacillus reuteri L103, Lactobacillus acidophilus R22, Lactobacillus plantarum WCFS1, and Lactobacillus sakei Lb790. These enzymes consist of two subunits of approximately 73 and 35 kDa, which are encoded by two overlapping genes, lacL and lacM, respectively. We have cloned these genes into the lactobacillal expression vectors pSIP403 and pSIP409, which are based on the sakacin P operon of L. sakei ( Sørvig et al. Microbiology 2005, 151, 2439- 2449 ), and expressed them in the host strains L. plantarum WCFS1 and L. sakei Lb790. Results varied considerably, ranging from 2.23 to 61.1 U/mg of beta-galactosidase activity, depending on the origin of the lacLM genes, the host strain, and the expression vector used. Highest expression levels were obtained in a laboratory cultivation of L. plantarum WCFS1 harboring the plasmid pEH3R containing the lacLM gene from L. reuteri L103. These cultivations yielded approximately 23 000 U of beta-galactosidase activity per liter, corresponding to the formation of roughly 100 mg of recombinant protein per liter of fermentation medium, and beta-galactosidase levels amounted to 55% of the total intracellular protein of the host organism. To further verify the suitability of this expression system, recombinant beta-galactosidase from L. reuteri was purified to apparent homogeneity. The properties of the purified enzyme were essentially identical with the properties of purified native beta-galactosidase from L. reuteri L103. The presented results lead the way to efficient overproduction of beta-galactosidase in a food-grade expression system, which is of high interest for applications in food industry.

CPT1{alpha} over-expression increases long-chain fatty acid oxidation and reduces cell viability with incremental palmitic acid concentration in 293T cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jambor de Sousa, Ulrike L.; Koss, Michael D.; Fillies, Marion

2005-12-16

To test the cellular response to an increased fatty acid oxidation, we generated a vector for an inducible expression of the rate-limiting enzyme carnitine palmitoyl-transferase 1{alpha} (CPT1{alpha}). Human embryonic 293T kidney cells were transiently transfected and expression of the CPT1{alpha} transgene in the tet-on vector was activated with doxycycline. Fatty acid oxidation was measured by determining the conversion of supplemented, synthetic cis-10-heptadecenoic acid (C17:1n-7) to C15:ln-7. CPT1{alpha} over-expression increased mitochondrial long-chain fatty acid oxidation about 6-fold. Addition of palmitic acid (PA) decreased viability of CPT1{alpha} over-expressing cells in a concentration-dependent manner. Both, PA and CPT1{alpha} over-expression increased cell death. Interestingly,more » PA reduced total cell number only in cells over-expressing CPT1{alpha}, suggesting an effect on cell proliferation that requires PA translocation across the mitochondrial inner membrane. This inducible expression system should be well suited to study the roles of CPT1 and fatty acid oxidation in lipotoxicity and metabolism in vivo.« less

Optimized paired-sgRNA/Cas9 cloning and expression cassette triggers high-efficiency multiplex genome editing in kiwifruit.

PubMed

Wang, Zupeng; Wang, Shuaibin; Li, Dawei; Zhang, Qiong; Li, Li; Zhong, Caihong; Liu, Yifei; Huang, Hongwen

2018-01-13

Kiwifruit is an important fruit crop; however, technologies for its functional genomic and molecular improvement are limited. The clustered regulatory interspaced short palindromic repeats (CRISPR)/CRISPR-associated protein (Cas) system has been successfully applied to genetic improvement in many crops, but its editing capability is variable depending on the different combinations of the synthetic guide RNA (sgRNA) and Cas9 protein expression devices. Optimizing conditions for its use within a particular species is therefore needed to achieve highly efficient genome editing. In this study, we developed a new cloning strategy for generating paired-sgRNA/Cas9 vectors containing four sgRNAs targeting the kiwifruit phytoene desaturase gene (AcPDS). Comparing to the previous method of paired-sgRNA cloning, our strategy only requires the synthesis of two gRNA-containing primers which largely reduces the cost. We further compared efficiencies of paired-sgRNA/Cas9 vectors containing different sgRNA expression devices, including both the polycistronic tRNA-sgRNA cassette (PTG) and the traditional CRISPR expression cassette. We found the mutagenesis frequency of the PTG/Cas9 system was 10-fold higher than that of the CRISPR/Cas9 system, coinciding with the relative expressions of sgRNAs in two different expression cassettes. In particular, we identified large chromosomal fragment deletions induced by the paired-sgRNAs of the PTG/Cas9 system. Finally, as expected, we found both systems can successfully induce the albino phenotype of kiwifruit plantlets regenerated from the G418-resistance callus lines. We conclude that the PTG/Cas9 system is a more powerful system than the traditional CRISPR/Cas9 system for kiwifruit genome editing, which provides valuable clues for optimizing CRISPR/Cas9 editing system in other plants. © 2018 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

The natural dietary genistein boosts bacteriophage-mediated cancer cell killing by improving phage-targeted tumor cell transduction.

PubMed

Tsafa, Effrosyni; Al-Bahrani, Mariam; Bentayebi, Kaoutar; Przystal, Justyna; Suwan, Keittisak; Hajitou, Amin

2016-08-09

Gene therapy has long been regarded as a promising treatment for cancer. However, cancer gene therapy is still facing the challenge of targeting gene delivery vectors specifically to tumors when administered via clinically acceptable non-invasive systemic routes (i.e. intravenous). The bacteria virus, bacteriophage (phage), represents a new generation of promising vectors in systemic gene delivery since their targeting can be achieved through phage capsid display ligands, which enable them to home to specific tumor receptors without the need to ablate any native eukaryotic tropism. We have previously reported a tumor specific bacteriophage vector named adeno-associated virus/phage, or AAVP, in which gene expression is under a recombinant human rAAV2 virus genome targeted to tumors via a ligand-directed phage capsid. However, cancer gene therapy with this tumor-targeted vector achieved variable outcomes ranging from tumor regression to no effect in both experimental and natural preclinical models. Herein, we hypothesized that combining the natural dietary genistein, with proven anticancer activity, would improve bacteriophage anticancer safe therapy. We show that combination treatment with genistein and AAVP increased targeted cancer cell killing by AAVP carrying the gene for Herpes simplex virus thymidine kinase (HSVtk) in 2D tissue cultures and 3D tumor spheroids. We found this increased tumor cell killing was associated with enhanced AAVP-mediated gene expression. Next, we established that genistein protects AAVP against proteasome degradation and enhances vector genome accumulation in the nucleus. Combination of genistein and phage-guided virotherapy is a safe and promising strategy that should be considered in anticancer therapy with AAVP.

Viral Vectors for in Vivo Gene Transfer

NASA Astrophysics Data System (ADS)

Thévenot, E.; Dufour, N.; Déglon, N.

The transfer of DNA into the nucleus of a eukaryotic cell (gene transfer) is a central theme of modern biology. The transfer is said to be somatic when it refers to non-germline organs of a developed individual, and germline when it concerns gametes or the fertilised egg of an animal, with the aim of transmitting the relevant genetic modification to its descendents [1]. The efficient introduction of genetic material into a somatic or germline cell and the control of its expression over time have led to major advances in understanding how genes work in vivo, i.e., in living organisms (functional genomics), but also to the development of innovative therapeutic methods (gene therapy). The efficiency of gene transfer is conditioned by the vehicle used, called the vector. Desirable features for a vector are as follows: Easy to produce high titer stocks of the vector in a reproducible way. Absence of toxicity related to transduction (transfer of genetic material into the target cell, and its expression there) and no immune reaction of the organism against the vector and/or therapeutic protein. Stability in the expression of the relevant gene over time, and the possibility of regulation, e.g., to control expression of the therapeutic protein on the physiological level, or to end expression at the end of treatment. Transduction of quiescent cells should be as efficient as transduction of dividing cells. Vectors currently used fall into two categories: non-viral and viral vectors. In non-viral vectors, the DNA is complexed with polymers, lipids, or cationic detergents (described in Chap. 3). These vectors have a low risk of toxicity and immune reaction. However, they are less efficient in vivo than viral vectors when it comes to the number of cells transduced and long-term transgene expression. (Naked DNA transfer or electroporation is rather inefficient in the organism. This type of gene transfer will not be discussed here, and the interested reader is referred to the review [2].) For this reason, it is mainly viral vectors that are used for gene transfer in animals and humans.

A lentiviral vector that activates latent human immunodeficiency virus-1 proviruses by the overexpression of tat and that kills the infected cells.

PubMed

Macías, David; Oya, Ricardo; Saniger, Luisa; Martín, Francisco; Luque, Francisco

2009-11-01

Despite the efficient HIV-1 replication blockage achieved with current highly active antiretroviral therapy (HAART) therapies, HIV-1 persists in the body and survives in a latent state that can last for the entire life of the patient. A long-lived reservoir of latently infected CD4(+) memory T cells represents the most important sanctuary for the virus and the greatest obstacle for viral eradication. In this work, we present an initial step toward a gene therapy approach aimed at the activation of latent provirus to induce the death of latently infected T cells. Latent HIV-1 infection is characterized by the failure of viral gene expression as a consequence of uninitiated or aborted transcription. We have constructed an HIV-1-based lentiviral vector (p5p53RTAT3) that expresses the viral trans-activating protein Tat in a drug-regulated manner and p53 in a Rev-dependent manner. We have demonstrated that the Tat-expressed protein from p5p53RTAT3 vector reactivates latent HIV-1 proviruses in J1.1 and ACH-2 cell lines and promotes p53-induced apoptosis in the presence of Rev. Our system was able to trigger the trans-activation of the provirus 5' long terminal repeat (LTR), stimulate the expression of the Rev protein from a tat-defective provirus, and provoke apoptosis selectively in the cells transfected with a tat-defective HIV-1 provirus in contrast to those with no HIV-1 provirus. However, the Rev-dependent p53 killing of latently infected cells was not effective enough for complete elimination of the awakened HIV-1 viruses. In summary, we have developed a vector system that is efficient in activating latent HIV-1 proviruses but that needs further improvement to kill infected cells.

CARSVM: a class association rule-based classification framework and its application to gene expression data.

PubMed

Kianmehr, Keivan; Alhajj, Reda

2008-09-01

In this study, we aim at building a classification framework, namely the CARSVM model, which integrates association rule mining and support vector machine (SVM). The goal is to benefit from advantages of both, the discriminative knowledge represented by class association rules and the classification power of the SVM algorithm, to construct an efficient and accurate classifier model that improves the interpretability problem of SVM as a traditional machine learning technique and overcomes the efficiency issues of associative classification algorithms. In our proposed framework: instead of using the original training set, a set of rule-based feature vectors, which are generated based on the discriminative ability of class association rules over the training samples, are presented to the learning component of the SVM algorithm. We show that rule-based feature vectors present a high-qualified source of discrimination knowledge that can impact substantially the prediction power of SVM and associative classification techniques. They provide users with more conveniences in terms of understandability and interpretability as well. We have used four datasets from UCI ML repository to evaluate the performance of the developed system in comparison with five well-known existing classification methods. Because of the importance and popularity of gene expression analysis as real world application of the classification model, we present an extension of CARSVM combined with feature selection to be applied to gene expression data. Then, we describe how this combination will provide biologists with an efficient and understandable classifier model. The reported test results and their biological interpretation demonstrate the applicability, efficiency and effectiveness of the proposed model. From the results, it can be concluded that a considerable increase in classification accuracy can be obtained when the rule-based feature vectors are integrated in the learning process of the SVM algorithm. In the context of applicability, according to the results obtained from gene expression analysis, we can conclude that the CARSVM system can be utilized in a variety of real world applications with some adjustments.

Long-term and stable correction of uremic anemia by intramuscular injection of plasmids containing hypoxia-regulated system of erythropoietin expression

PubMed Central

Wang, Yarong; Du, Dewei; Li, Zhanting; Wei, Junxia; Yang, Angang

2012-01-01

Relative deficiency in production of glycoprotein hormone erythropoietin (Epo) is a major cause of renal anemia. This study planned to investigate whether the hypoxia-regulated system of Epo expression, constructed by fusing Epo gene to the chimeric phosphoglycerate kinase (PGK) hypoxia response elements (HRE) in combination with cytomegalovirus immediate-early (CMV IE) basal gene promoter and delivered by plasmid intramuscular injection, might provide a long-term physiologically regulated Epo secretion expression to correct the anemia in adenine-induced uremic rats. Plasmid vectors (pHRE-Epo) were synthesized by fusing human Epo cDNA to the HRE/CMV promoter. Hypoxia-inducible activity of this promoter was evaluated first in vitro and then in vivo in healthy and uremic rats (n = 30 per group). The vectors (pCMV-Epo) in which Epo expression was directed by a constitutive CMV gene promoter served as control. ANOVA and Student's t-test were used to analyze between-group differences. A high-level expression of Epo was induced by hypoxia in vitro and in vivo. Though both pHRE-Epo and pCMV-Epo corrected anemia, the hematocrit of the pCMV-Epo-treated rats exceeded the normal (P < 0.05), but that of the pHRE-Epo-treated rats didn't. Hypoxia-regulated system of Epo gene expression constructed by fusing Epo to the HRE/CMV promoter and delivered by plasmid intramuscular injection may provide a long-term and stable Epo expression and secretion in vivo to correct the anemia in adenine-induced uremic rats. PMID:22990115

Identification of germline transcriptional regulatory elements in Aedes aegypti.

PubMed

Akbari, Omar S; Papathanos, Philippos A; Sandler, Jeremy E; Kennedy, Katie; Hay, Bruce A

2014-02-04

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UD(MEL), and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

Identification of germline transcriptional regulatory elements in Aedes aegypti

NASA Astrophysics Data System (ADS)

Akbari, Omar S.; Papathanos, Philippos A.; Sandler, Jeremy E.; Kennedy, Katie; Hay, Bruce A.

2014-02-01

The mosquito Aedes aegypti is the principal vector for the yellow fever and dengue viruses, and is also responsible for recent outbreaks of the alphavirus chikungunya. Vector control strategies utilizing engineered gene drive systems are being developed as a means of replacing wild, pathogen transmitting mosquitoes with individuals refractory to disease transmission, or bringing about population suppression. Several of these systems, including Medea, UDMEL, and site-specific nucleases, which can be used to drive genes into populations or bring about population suppression, utilize transcriptional regulatory elements that drive germline-specific expression. Here we report the identification of multiple regulatory elements able to drive gene expression specifically in the female germline, or in the male and female germline, in the mosquito Aedes aegypti. These elements can also be used as tools with which to probe the roles of specific genes in germline function and in the early embryo, through overexpression or RNA interference.

[Expression and Preliminary Research on the Soluble Domain of EV-D68 3A Protein].

PubMed

Li, Ting; Kong, Jia; Yu, Xiao-fang; Han, Xue

2015-11-01

To understand the structure of the soluble region of Enterovirus 68 3A protein, we construct a prokaryotic expression vector expressing the soluble region of EV-D68 3A protein, and identify the forms of expression product after purification. The EV-D68 3A(1-61) gene was amplified by PCR and then cloned into the expression vector pET-28a-His-SUMO. The recombinant plasmid was transformed into Escherichia coli BL21 induced by IPTG to express the fusion protein His-SUMO-3A(1-61). The recombinant protein was purified by Ni-NTA Agarose and cleaved by ULP Protease to remove His-SUMO tag. After that, the target protein 3A(1-61) was purified by a series of purification methods such as Ni-NTA, anion exchange chromatography and gel filtration chromato- graphy. Chemical cross-linking reaction assay was taken to determine the multiple polymerization state of the 3A soluble region. A prokaryotic expression vector pET28a-His-SUMO-3A(1-61) expressing the solution region of EV-D68 3A was successfully constructed and plenty of highly pure target proteins were obtained by multiple purification steps . The total protein amount was about 5 mg obtained from 1L Escherichia coli BL21 with purity > 95%. At the same time, those results determined the homomultimer form of soluble 3A construct. These data demonstrated that the expression and purification system of the soluble region of 3A were successfully set up and provide some basic konwledge for the research about 3A crystal structure and the development of antiviral drugs targeted at 3A to block viral replication.

Generation of a non-transmissive Borna disease virus vector lacking both matrix and glycoprotein genes.

PubMed

Fujino, Kan; Yamamoto, Yusuke; Daito, Takuji; Makino, Akiko; Honda, Tomoyuki; Tomonaga, Keizo

2017-09-01

Borna disease virus (BoDV), a prototype of mammalian bornavirus, is a non-segmented, negative strand RNA virus that often causes severe neurological disorders in infected animals, including horses and sheep. Unique among animal RNA viruses, BoDV transcribes and replicates non-cytopathically in the cell nucleus, leading to establishment of long-lasting persistent infection. This striking feature of BoDV indicates its potential as an RNA virus vector system. It has previously been demonstrated by our team that recombinant BoDV (rBoDV) lacking an envelope glycoprotein (G) gene develops persistent infections in transduced cells without loss of the viral genome. In this study, a novel non-transmissive rBoDV, rBoDV ΔMG, which lacks both matrix (M) and G genes in the genome, is reported. rBoDV-ΔMG expressing green fluorescence protein (GFP), rBoDV ΔMG-GFP, was efficiently generated in Vero/MG cells stably expressing both BoDV M and G proteins. Infection with rBoDV ΔMG-GFP was persistently maintained in the parent Vero cells without propagation within cell culture. The optimal ratio of M and G for efficient viral particle production by transient transfection of M and G expression plasmids into cells persistently infected with rBoDV ΔMG-GFP was also demonstrated. These findings indicate that the rBoDV ΔMG-based BoDV vector may provide an extremely safe virus vector system and could be a novel strategy for investigating the function of M and G proteins and the host range of bornaviruses. © 2017 The Societies and John Wiley & Sons Australia, Ltd.

An efficient strategy for cell-based antibody library selection using an integrated vector system.

PubMed

Yoon, Hyerim; Song, Jin Myung; Ryu, Chun Jeih; Kim, Yeon-Gu; Lee, Eun Kyo; Kang, Sunghyun; Kim, Sang Jick

2012-09-18

Cell panning of phage-displayed antibody library is a powerful tool for the development of therapeutic and imaging agents since disease-related cell surface proteins in native complex conformation can be directly targeted. Here, we employed a strategy taking advantage of an integrated vector system which allows rapid conversion of scFv-displaying phage into scFv-Fc format for efficient cell-based scFv library selection on a tetraspanin protein, CD9. A mouse scFv library constructed by using a phagemid vector, pDR-D1 was subjected to cell panning against stable CD9 transfectant, and the scFv repertoire from the enriched phage pool was directly transferred to a mammalian cassette vector, pDR-OriP-Fc1. The resulting constructs enabled transient expression of enough amounts of scFv-Fcs in HEK293E cells, and flow cytometric screening of binders for CD9 transfectant could be performed simply by using the culture supernatants. All three clones selected from the screening showed correct CD9-specificity. They could immunoprecipitate CD9 molecules out of the transfectant cell lysate and correctly stain endogenous CD9 expression on cancer cell membrane. Furthermore, competition assay with a known anti-CD9 monoclonal antibody (mAb) suggested that the binding epitopes of some of them overlap with that of the mAb which resides within the large extracellular loop of CD9. This study demonstrates that scFv-Fc from mammalian transient expression can be chosen as a reliable format for rapid screening and validation in cell-based scFv library selection, and the strategy described here will be applicable to efficient discovery of antibodies to diverse cell-surface targets.

Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis

PubMed Central

Aalbers, Caroline J.; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J. Fraser; Mingozzi, Federico; Tak, Paul P.; Vervoordeldonk, Margriet J.

2015-01-01

Introduction Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). Methods The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Results Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. Conclusions These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA. PMID:26107769

Preclinical Potency and Biodistribution Studies of an AAV 5 Vector Expressing Human Interferon-β (ART-I02) for Local Treatment of Patients with Rheumatoid Arthritis.

PubMed

Aalbers, Caroline J; Bevaart, Lisette; Loiler, Scott; de Cortie, Karin; Wright, J Fraser; Mingozzi, Federico; Tak, Paul P; Vervoordeldonk, Margriet J

2015-01-01

Proof of concept for local gene therapy for the treatment of arthritis with immunomodulatory cytokine interferon beta (IFN-β) has shown promising results in animal models of rheumatoid arthritis (RA). For the treatment of RA patients, we engineered a recombinant adeno-associated serotype 5 vector (rAAV5) encoding human (h)IFN-β under control of a nuclear factor κB promoter (ART-I02). The potency of ART-I02 in vitro as well as biodistribution in vivo in arthritic animals was evaluated to characterize the vector prior to clinical application. ART-I02 expression and bioactivity after transduction was evaluated in fibroblast-like synoviocytes (FLS) from different species. Biodistribution of the vector after local injection was assessed in a rat adjuvant arthritis model through qPCR analysis of vector DNA. In vivo imaging was used to investigate transgene expression and kinetics in a mouse collagen induced arthritis model. Transduction of RA FLS in vitro with ART-I02 resulted in high expression levels of bioactive hIFN-β. Transduction of FLS from rhesus monkeys, rodents and rabbits with ART-I02 showed high transgene expression, and hIFN-β proved bioactive in FLS from rhesus monkeys. Transgene expression and bioactivity in RA FLS were unaltered in the presence of methotrexate. In vivo, vector biodistribution analysis in rats after intra-articular injection of ART-I02 demonstrated that the majority of vector DNA remained in the joint (>93%). In vivo imaging in mice confirmed local expression of rAAV5 in the knee joint region and demonstrated rapid detectable and sustained expression up until 7 weeks. These data show that hIFN-β produced by RA FLS transduced with ART-I02 is bioactive and that intra-articular delivery of rAAV5 drives expression of a therapeutic transgene in the joint, with only limited biodistribution of vector DNA to other tissues, supporting progress towards a phase 1 clinical trial for the local treatment of arthritis in patients with RA.

Transcriptional Enhancers Induce Insertional Gene Deregulation Independently From the Vector Type and Design

PubMed Central

Maruggi, Giulietta; Porcellini, Simona; Facchini, Giulia; Perna, Serena K; Cattoglio, Claudia; Sartori, Daniela; Ambrosi, Alessandro; Schambach, Axel; Baum, Christopher; Bonini, Chiara; Bovolenta, Chiara; Mavilio, Fulvio; Recchia, Alessandra

2009-01-01

The integration characteristics of retroviral (RV) vectors increase the probability of interfering with the regulation of cellular genes, and account for a tangible risk of insertional mutagenesis in treated patients. To assess the potential genotoxic risk of conventional or self-inactivating (SIN) γ-RV and lentiviral (LV) vectors independently from the biological consequences of the insertion event, we developed a quantitative assay based on real-time reverse transcriptase—PCR on low-density arrays to evaluate alterations of gene expression in individual primary T-cell clones. We show that the Moloney leukemia virus long terminal repeat (LTR) enhancer has the strongest activity in both a γ-RV and a LV vector context, while an internal cellular promoter induces deregulation of gene expression less frequently, at a shorter range and to a lower extent in both vector types. Downregulation of gene expression was observed only in the context of LV vectors. This study indicates that insertional gene activation is determined by the characteristics of the transcriptional regulatory elements carried by the vector, and is largely independent from the vector type or design. PMID:19293778

Insect cell transformation vectors that support high level expression and promoter assessment in insect cell culture

USDA-ARS?s Scientific Manuscript database

A somatic transformation vector, pDP9, was constructed that provides a simplified means of producing permanently transformed cultured insect cells that support high levels of protein expression of foreign genes. The pDP9 plasmid vector incorporates DNA sequences from the Junonia coenia densovirus th...

Differential gene expression in laboratory strains of human head and body lice when challenged with Bartonella quintana, a pathogenic bacterium

PubMed Central

Previte, D.; Olds, B. P.; Yoon, K.; Sun, W.; Muir, W.; Paige, K. N.; Lee, S. H.; Clark, J.; Koehler, J. E.; Pittendrigh, B. R.

2014-01-01

Human head and body lice are obligatory hematophagous ectoparasites that belong to a single species, Pediculus humanus. Only body lice, however, are vectors of the infectious Gram-negative bacterium Bartonella quintana. Because of their near identical genomes, yet differential vector competence, head and body lice provide a unique model system to study the gain or loss of vector competence. Using our in vitro louse-rearing system, we infected head and body lice with blood containing B. quintana in order to detect both differences in the proliferation of B. quintana and transcriptional differences of immune-related genes in the lice. B. quintana proliferated rapidly in body lice at 6 days postinfection, but plateaued in head lice at 4 days postinfection. RNAseq and quantitative real-time PCR validation analyses determined gene expression differences. Eight immunoresponse genes were observed to be significantly different with many associated with the Toll pathway: Fibrinogen-like protein, Spaetzle, Defensin 1, Serpin, Scavenger receptor A and Apolipoporhrin 2. Our findings support the hypothesis that body lice, unlike head lice, fight infection from B. quintana only at the later stages of its proliferation. PMID:24404961

Differential gene expression in laboratory strains of human head and body lice when challenged with Bartonella quintana, a pathogenic bacterium.

PubMed

Previte, D; Olds, B P; Yoon, K; Sun, W; Muir, W; Paige, K N; Lee, S H; Clark, J; Koehler, J E; Pittendrigh, B R

2014-04-01

Human head and body lice are obligatory hematophagous ectoparasites that belong to a single species, Pediculus humanus. Only body lice, however, are vectors of the infectious Gram-negative bacterium Bartonella quintana. Because of their near identical genomes, yet differential vector competence, head and body lice provide a unique model system to study the gain or loss of vector competence. Using our in vitro louse-rearing system, we infected head and body lice with blood containing B. quintana in order to detect both differences in the proliferation of B. quintana and transcriptional differences of immune-related genes in the lice. B. quintana proliferated rapidly in body lice at 6 days post-infection, but plateaued in head lice at 4 days post-infection. RNAseq and quantitative real-time PCR validation analyses determined gene expression differences. Eight immunoresponse genes were observed to be significantly different with many associated with the Toll pathway: Fibrinogen-like protein, Spaetzle, Defensin 1, Serpin, Scavenger receptor A and Apolipoporhrin 2. Our findings support the hypothesis that body lice, unlike head lice, fight infection from B. quintana only at the later stages of its proliferation. © 2014 The Royal Entomological Society.

Gene transfer to the cerebellum.

PubMed

Louboutin, Jean-Pierre; Reyes, Beverly A S; Van Bockstaele, Elisabeth J; Strayer, David S

2010-12-01

There are several diseases for which gene transfer therapy to the cerebellum might be practicable. In these studies, we used recombinant Tag-deleted SV40-derived vectors (rSV40s) to study gene delivery targeting the cerebellum. These vectors transduce neurons and microglia very effectively in vitro and in vivo, and so we tested them to evaluate gene transfer to the cerebellum in vivo. Using a rSV40 vector carrying human immunodeficiency virus (HIV)-Nef with a C-terminal FLAG epitope, we characterized the distribution, duration, and cell types transduced. Rats received test and control vectors by stereotaxic injection into the cerebellum. Transgene expression was assessed 1, 2, and 4 weeks later by immunostaining of serial brain sections. FLAG epitope-expressing cells were seen, at all times after vector administration, principally detected in the Purkinje cells of the cerebellum, identified as immunopositive for calbindin. Occasional microglial cells were tranduced; transgene expression was not detected in astrocytes or oligodendrocytes. No inflammatory or other reaction was detected at any time. Thus, SV40-derived vectors can deliver effective, safe, and durable transgene expression to the cerebellum.

Design and construction of 2A peptide-linked multicistronic vectors.

PubMed

Szymczak-Workman, Andrea L; Vignali, Kate M; Vignali, Dario A A

2012-02-01

The need for reliable, multicistronic vectors for multigene delivery is at the forefront of biomedical technology. This article describes the design and construction of 2A peptide-linked multicistronic vectors, which can be used to express multiple proteins from a single open reading frame (ORF). The small 2A peptide sequences, when cloned between genes, allow for efficient, stoichiometric production of discrete protein products within a single vector through a novel "cleavage" event within the 2A peptide sequence. Expression of more than two genes using conventional approaches has several limitations, most notably imbalanced protein expression and large size. The use of 2A peptide sequences alleviates these concerns. They are small (18-22 amino acids) and have divergent amino-terminal sequences, which minimizes the chance for homologous recombination and allows for multiple, different 2A peptide sequences to be used within a single vector. Importantly, separation of genes placed between 2A peptide sequences is nearly 100%, which allows for stoichiometric and concordant expression of the genes, regardless of the order of placement within the vector.

[Construction and expression of a eukaryotic expression vector containing human CR2-Fc fusion protein].

PubMed

Li, Xinxin; Wu, Zhihao; Zhang, Chuanfu; Jia, Leili; Song, Hongbin; Xu, Yuanyong

2014-01-01

To construct a eukaryotic expression vector containing human complement receptor 2 (CR2)-Fc and express the CR2-Fc fusion protein in Chinese hamster ovary (CHO) cells. The extracellular domain of human CR2 and IgG1 Fc were respectively amplified, ligated and inserted into the eukaryotic expression vector PCI-neo. After verified by restriction enzyme digestion and sequencing, the recombinant plasmid was transfected into CHO K1 cells. The ones with stable expression of the fusion protein were obtained by means of G418 selection. The expression of the CR2-Fc fusion protein was detected and confirmed by SDS-PAGE and Western blotting. Restriction enzyme digestion and sequencing demonstrated that the recombinant plasmid was valid. SDS-PAGE showed that relative molecular mass (Mr;) of the purified product was consistent with the expected value. Western blotting further proved the single band at the same position. We constructed the eukaryotic expression vector of CR2-Fc/PCI-neo successfully. The obtained fusion protein was active and can be used for the further study of the role in HIV control.

Immune Recognition of Gene Transfer Vectors: Focus on Adenovirus as a Paradigm

PubMed Central

Aldhamen, Yasser Ali; Seregin, Sergey S.; Amalfitano, Andrea

2011-01-01

Recombinant Adenovirus (Ad) based vectors have been utilized extensively as a gene transfer platform in multiple pre-clinical and clinical applications. These applications are numerous, and inclusive of both gene therapy and vaccine based approaches to human or animal diseases. The widespread utilization of these vectors in both animal models, as well as numerous human clinical trials (Ad-based vectors surpass all other gene transfer vectors relative to numbers of patients treated, as well as number of clinical trials overall), has shed light on how this virus vector interacts with both the innate and adaptive immune systems. The ability to generate and administer large amounts of this vector likely contributes not only to their ability to allow for highly efficient gene transfer, but also their elicitation of host immune responses to the vector and/or the transgene the vector expresses in vivo. These facts, coupled with utilization of several models that allow for full detection of these responses has predicted several observations made in human trials, an important point as lack of similar capabilities by other vector systems may prevent detection of such responses until only after human trials are initiated. Finally, induction of innate or adaptive immune responses by Ad vectors may be detrimental in one setting (i.e., gene therapy) and be entirely beneficial in another (i.e., prophylactic or therapeutic vaccine based applications). Herein, we review the current understanding of innate and adaptive immune responses to Ad vectors, as well some recent advances that attempt to capitalize on this understanding so as to further broaden the safe and efficient use of Ad-based gene transfer therapies in general. PMID:22566830

Disabled infectious single cycle-herpes simplex virus (DISC-HSV) as a vector for immunogene therapy of cancer.

PubMed

Rees, Robert C; McArdle, Stephanie; Mian, Shahid; Li, Geng; Ahmad, Murrium; Parkinson, Richard; Ali, Selman A

2002-02-01

Disabled infectious single cycle-herpes simplex viruses (DISC-HSV) have been shown to be safe for use in humans and may be considered efficacious as vectors for immunogene therapy in cancer. Preclinical studies show that DISC-HSV is an efficient delivery system for cytokine genes and antigens. DISC-HSV infects a high proportion of cells, resulting in rapid gene expression for at least 72 h. The DISC-HSV-mGM-CSF vector, when inoculated into tumors, induces tumor regression in a high percentage of animals, concomitant with establishing a cytotoxic T-cell response, which is MHC class I restricted and directed against peptides of known tumor antigens. The inherent properties of DISC-HSV makes it a suitable vector for consideration in human immunogene therapy trials.

In Vivo Stable Transduction of Humanized Liver Tissue in Chimeric Mice via High-Capacity Adenovirus–Lentivirus Hybrid Vector

PubMed Central

Kataoka, Miho; Tateno, Chise; Yoshizato, Katsutoshi; Kawasaki, Yoshiko; Kimura, Takahiro; Faure-Kumar, Emmanuelle; Palmer, Donna J.; Ng, Philip; Okamura, Haruki; Kasahara, Noriyuki

2010-01-01

Abstract We developed hybrid vectors employing high-capacity adenovirus as a first-stage carrier encoding all the components required for in situ production of a second-stage lentivirus, thereby achieving stable transgene expression in secondary target cells. Such vectors have never previously been tested in normal tissues, because of the scarcity of suitable in vivo systems permissive for second-stage lentivirus assembly. Here we employed a novel murine model in which endogenous liver tissue is extensively reconstituted with engrafted human hepatocytes, and successfully achieved stable transduction by the second-stage lentivirus produced in situ from first-stage adenovirus. This represents the first demonstration of the functionality of adenoviral-lentiviral hybrid vectors in a normal parenchymal organ in vivo. PMID:19725756

Adenovirus Type 5 Viral Particles Pseudotyped with Mutagenized Fiber Proteins Show Diminished Infectivity of Coxsackie B-Adenovirus Receptor-Bearing Cells

PubMed Central

Jakubczak, John L.; Rollence, Michele L.; Stewart, David A.; Jafari, Jonathon D.; Von Seggern, Dan J.; Nemerow, Glen R.; Stevenson, Susan C.; Hallenbeck, Paul L.

2001-01-01

A major limitation of adenovirus type 5 (Ad5)-based gene therapy, the inability to target therapeutic genes to selected cell types, is attributable to the natural tropism of the virus for the widely expressed coxsackievirus-adenovirus receptor (CAR) protein. Modifications of the Ad5 fiber knob domain have been shown to alter the tropism of the virus. We have developed a novel system to rapidly evaluate the function of modified fiber proteins in their most relevant context, the adenoviral capsid. This transient transfection/infection system combines transfection of cells with plasmids that express high levels of the modified fiber protein and infection with Ad5.βgal.ΔF, an E1-, E3-, and fiber-deleted adenoviral vector encoding β-galactosidase. We have used this system to test the adenoviral transduction efficiency mediated by a panel of fiber protein mutants that were proposed to influence CAR interaction. A series of amino acid modifications were incorporated via mutagenesis into the fiber expression plasmid, and the resulting fiber proteins were subsequently incorporated onto adenoviral particles. Mutations located in the fiber knob AB and CD loops demonstrated the greatest reduction in fiber-mediated gene transfer in HeLa cells. We also observed effects on transduction efficiency with mutations in the FG loop, indicating that the binding site may extend to the adjacent monomer in the fiber trimer and in the HI loop. These studies support the concept that modification of the fiber knob domain to diminish or ablate CAR interaction should result in a detargeted adenoviral vector that can be combined simultaneously with novel ligands for the development of a systemically administered, targeted adenoviral vector. PMID:11222722

Immunogenicity of Newcastle disease virus vectors expressing Norwalk virus capsid protein in the presence or absence of VP2 protein.

PubMed

Kim, Shin-Hee; Chen, Shun; Jiang, Xi; Green, Kim Y; Samal, Siba K

2015-10-01

Noroviruses are the most common cause of acute gastroenteritis in humans. Development of an effective vaccine is required for reducing their outbreaks. In order to develop a GI norovirus vaccine, Newcastle disease virus vectors, rLaSota and modified rBC, were used to express VP1 protein of Norwalk virus. Co-expression of VP1 and VP2 proteins by Newcastle disease virus vectors resulted in enhanced expression of Norwalk virus VP1 protein and self-assembly of VP1 protein into virus-like particles. Furthermore, the Norwalk virus-specific IgG response induced in mice by Newcastle disease virus vectors was similar to that induced by baculovirus-expressed virus-like particles in mice. However, the modified rBC vector in the presence of VP2 protein induced significantly higher levels of cellular and mucosal immune responses than those induced by baculovirus-expressed VLPs. These results indicate that Newcastle disease virus has great potential for developing a live Norwalk virus vaccine by inducing humoral, cellular and mucosal immune responses in humans. Copyright © 2015 Elsevier Inc. All rights reserved.

Laplace-Runge-Lenz vector for arbitrary spin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nikitin, A. G.

2013-12-15

A countable set of superintegrable quantum mechanical systems is presented which admit the dynamical symmetry with respect to algebra so(4). This algebra is generated by the Laplace-Runge-Lenz vector generalized to the case of arbitrary spin. The presented systems describe neutral particles with non-trivial multipole momenta. Their spectra can be found algebraically like in the case of hydrogen atom. Solutions for the systems with spins 1/2 and 1 are presented explicitly, solutions for spin 3/2 can be expressed via solutions of an ordinary differential equation of first order. A more extended version of this paper including detailed calculations is published asmore » an e-print arXiv:1308.4279.« less

Response to Blood Meal in the Fat Body of Anopheles stephensi Using Quantitative Proteomics: Toward New Vector Control Strategies Against Malaria.

PubMed

Kumar, Manish; Mohanty, Ajeet Kumar; Sreenivasamurthy, Sreelakshmi K; Dey, Gourav; Advani, Jayshree; Pinto, Sneha M; Kumar, Ashwani; Prasad, Thottethodi Subrahmanya Keshava

2017-09-01

Malaria remains a grand challenge for disruptive innovation in global health therapeutics and diagnostics. Anopheles stephensi is one of the major vectors of malaria in Asia. Vector and transmission control are key focus areas in the fight against malaria, a field of postgenomics research where proteomics can play a substantive role. Moreover, to identify novel strategies to control the vector population, it is necessary to understand the vector life processes at a global and molecular scale. In this context, fat body is a vital organ required for vitellogenesis, vector immunity, vector physiology, and vector-parasite interaction. Given its central role in energy metabolism, vitellogenesis, and immune function, the proteome profile of the fat body and the impact of blood meal (BM) ingestion on the protein abundances of this vital organ have not been investigated so far. Therefore, using a proteomics approach, we identified the proteins expressed in the fat body of An. stephensi and their differential expression in response to BM ingestion. In all, we identified 3,218 proteins in the fat body using high-resolution mass spectrometry, of which 483 were found to be differentially expressed in response to the BM ingestion. Bioinformatics analysis of these proteins underscored their role in amino acid metabolism, vitellogenesis, lipid transport, signal peptide processing, mosquito immunity, and oxidation-reduction processes. Interestingly, we identified five novel genes, which were found to be differentially expressed upon BM ingestion. Proteins that exhibited altered expression in the present study are potential targets for vector control strategies and development of transmission blocking vaccines in the fight against malaria.

Novel approaches to models of Alzheimer's disease pathology for drug screening and development.

PubMed

Shaughnessy, Laura; Chamblin, Beth; McMahon, Lori; Nair, Ayyappan; Thomas, Mary Beth; Wakefield, John; Koentgen, Frank; Ramabhadran, Ram

2004-01-01

Development of therapeutics for Alzheimer's disease (AD) requires appropriate cell culture models that reflect the errant biochemical pathways and animal models that reflect the pathological hallmarks of the disease as well as the clinical manifestations. In the past two decades AD research has benefited significantly from the use of genetically engineered cell lines expressing components of the amyloid-generating pathway, as well as from the study of transgenic mice that develop the pathological hallmarks of the disease, mainly neuritic plaques. The choice of certain cell types and the choice of mouse as the model organism have been mandated by the feasibility of introduction and expression of foreign genes into these model systems. We describe a universal and efficient gene-delivery system, using lentiviral vectors, that permits the development of relevant cell biological systems using neuronal cells, including primary neurons and animal models in mammalian species best suited for the study of AD. In addition, lentiviral gene delivery provides avenues for creation of novel models by direct and prolonged expression of genes in the brain in any vertebrate animal. TranzVector is a lentiviral vector optimized for efficiency and safety that delivers genes to cells in culture, in tissue explants, and in live animals regardless of the dividing or differentiated status of the cells. Genes can also be delivered efficiently to fertilized single-cell-stage embryos of a wide range of mammalian species, broadening the range of the model organism (from rats to nonhuman primates) for the study of disease mechanism as well as for development of therapeutics. Copyright 2004 Humana Press Inc.

Development of an adenoviral vector with robust expression driven by p53

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajgelman, Marcio C.; Biotechnology Program, Biomedical Sciences Institute, University of Sao Paulo; Millennium Institute-Gene Therapy Network, Ministry of Science and Technology

2008-02-05

Here we introduce a new adenoviral vector where transgene expression is driven by p53. We first developed a synthetic promoter, referred to as PGTx{beta}, containing a p53-responsive element, a minimal promoter and the first intron of the rabbit {beta}-globin gene. Initial assays using plasmid-based vectors indicated that expression was tightly controlled by p53 and was 5-fold stronger than the constitutive CMV immediate early promoter/enhancer. The adenoviral vector, AdPG, was also shown to offer p53-responsive expression in prostate carcinoma cells LNCaP (wt p53), DU-145 (temperature sensitive mutant of p53) and PC3 (p53-null, but engineered to express temperature-sensitive p53 mutants). AdPG servedmore » as a sensor of p53 activity in LNCaP cells treated with chemotherapeutic agents. Since p53 can be induced by radiotherapy and chemotherapy, this new vector could be further developed for use in combination with conventional therapies to bring about cooperation between the genetic and pharmacologic treatment modalities.« less

Display of adenoregulin with a novel Pichia pastoris cell surface display system.

PubMed

Ren, Ren; Jiang, Zhengbing; Liu, Meiyun; Tao, Xinyi; Ma, Yushu; Wei, Dongzhi

2007-02-01

Two Pichia pastoris cell surface display vectors were constructed. The vectors consisted of the flocculation functional domain of Flo1p with its own secretion signal sequence or the alpha-factor secretion signal sequence, a polyhistidine (6xHis) tag for detection, an enterokinase recognition site, and the insertion sites for target proteins. Adenoregulin (ADR) is a 33-amino-acid antimicrobial peptide isolated from Phyllomedusa bicolor skin. The ADR was expressed and displayed on the Pichia pastoris KM71 cell surface with the system reported. The displayed recombinant ADR fusion protein was detected by fluorescence microscopy and confocal laser scanning microscopy (CLSM). The antimicrobial activity of the recombinant adenoregulin was detected after proteolytic cleavage of the fusion protein on cell surface. The validity of the Pichia pastoris cell surface display vectors was proved by the displayed ADR.

A bioluminescent imaging mouse model for Marburg virus based on a pseudovirus system.

PubMed

Zhang, Li; Li, Qianqian; Liu, Qiang; Huang, Weijin; Nie, Jianhui; Wang, Youchun

2017-08-03

Marburg virus (MARV) can cause lethal hemorrhagic fever in humans. Handling of MARV is restricted to high-containment biosafety level 4 (BSL-4) facilities, which greatly impedes research into this virus. In this study, a high titer of MARV pseudovirus was generated through optimization of the HIV backbone vectors, the ratio of backbone vector to MARV glycoprotein expression vector, and the transfection reagents. An in vitro neutralization assay and an in vivo bioluminescent imaging mouse model for MARV were developed based on the pseudovirus. Protective serum against MARV was successfully induced in guinea pigs, which showed high neutralization activity in vitro and could also protect Balb/c mice from MARV pseudovirus infection in vivo. This system could be a convenient tool to enable the evaluation of vaccines and therapeutic drugs against MARV in non-BSL-4 laboratories.

Yeast Genetics and Biotechnological Applications

NASA Astrophysics Data System (ADS)

Mishra, Saroj; Baranwal, Richa

Yeast can be recognized as one of the very important groups of microorganisms on account of its extensive use in the fermentation industry and as a basic eukaryotic model cellular system. The yeast Saccharomyces cerevisiae has been extensively used to elucidate the genetics and regulation of several key functions in the cell such as cell mating, electron transport chain, protein trafficking, cell cycle events and others. Even before the genome sequence of the yeast was out, the structural organization and function of several of its genes was known. With the availability of the origin of replication from the 2 μm plasmid and the development of transformation system, it became the host of choice for expression of a number of important proteins. A large number of episomal and integrative shuttle vectors are available for expression of mammalian proteins. The latest developments in genomics and micro-array technology have allowed investigations of individual gene function by site-specific deletion method. The application of metabolic profiling has also assisted in understanding the cellular network operating in this yeast. This chapter is aimed at reviewing the use of this system as an experimental tool for conducting classical genetics. Various vector systems available, foreign genes expressed and the limitations as a host will be discussed. Finally, the use of various yeast enzymes in biotechnology sector will be reviewed.

Systemic Gene Delivery Transduces the Enteric Nervous System of Guinea Pigs and Cynomolgus Macaques

PubMed Central

Gombash, Sara E; Cowley, Christopher J; Fitzgerald, Julie A; Lepak, Christina A; Neides, Mitchell G; Hook, Kathryn; Todd, Levi J; Wang, Guo-Du; Mueller, Christian; Kaspar, Brian K; Bielefeld, Eric C; Fischer, Andrew J; Wood, Jackie D; Foust, Kevin D

2017-01-01

Characterization of adeno-associated viral vector (AAV) mediated gene delivery to the enteric nervous system (ENS) was recently described in mice and rats. In these proof-of-concept experiments, we show that intravenous injections of clinically relevant AAVs can transduce the ENS in guinea pigs and non-human primates. Neonatal guinea pigs were given intravenous injections of either AAV8 or AAV9 vectors that contained a green fluorescent protein (GFP) expression cassette or PBS. Piglets were euthanized three weeks post-injection and tissues were harvested for immunofluorescent analysis. GFP expression was detected in myenteric and submucosal neurons along the length of the gastrointestinal tract in AAV8 injected guinea pigs. GFP positive neurons were found in dorsal motor nucleus of the vagus and dorsal root ganglia. Less transduction occurred in AAV9 treated tissues. Gastrointestinal tissues were analyzed from young cynomolgus macaques that received systemic injection of AAV9 GFP. GFP expression was detected in myenteric neurons of the stomach, small and large intestine. These data demonstrate that ENS gene delivery translates to larger species. This work develops tools for the field of neurogastroenterology to explore gut physiology and anatomy using emerging technologies such as optogenetics and gene editing. It also provides a basis to develop novel therapies for chronic gut disorders. PMID:28771235

Systemic gene delivery transduces the enteric nervous system of guinea pigs and cynomolgus macaques.

PubMed

Gombash, S E; Cowley, C J; Fitzgerald, J A; Lepak, C A; Neides, M G; Hook, K; Todd, L J; Wang, G-D; Mueller, C; Kaspar, B K; Bielefeld, E C; Fischer, A J; Wood, J D; Foust, K D

2017-10-01

Characterization of adeno-associated viral vector (AAV) mediated gene delivery to the enteric nervous system (ENS) was recently described in mice and rats. In these proof-of-concept experiments, we show that intravenous injections of clinically relevant AAVs can transduce the ENS in guinea pigs and non-human primates. Neonatal guinea pigs were given intravenous injections of either AAV8 or AAV9 vectors that contained a green fluorescent protein (GFP) expression cassette or phosphate-buffered saline. Piglets were euthanized three weeks post injection and tissues were harvested for immunofluorescent analysis. GFP expression was detected in myenteric and submucosal neurons along the length of the gastrointestinal tract in AAV8 injected guinea pigs. GFP-positive neurons were found in dorsal motor nucleus of the vagus and dorsal root ganglia. Less transduction occurred in AAV9-treated tissues. Gastrointestinal tissues were analyzed from young cynomolgus macaques that received systemic injection of AAV9 GFP. GFP expression was detected in myenteric neurons of the stomach, small and large intestine. These data demonstrate that ENS gene delivery translates to larger species. This work develops tools for the field of neurogastroenterology to explore gut physiology and anatomy using emerging technologies such as optogenetics and gene editing. It also provides a basis to develop novel therapies for chronic gut disorders.

Influence of vector dose on factor IX-specific T and B cell responses in muscle-directed gene therapy.

PubMed

Herzog, Roland W; Fields, Paul A; Arruda, Valder R; Brubaker, Jeff O; Armstrong, Elina; McClintock, Darryl; Bellinger, Dwight A; Couto, Linda B; Nichols, Timothy C; High, Katherine A

2002-07-20

Intramuscular injection of an adeno-associated virus (AAV) vector has resulted in vector dose-dependent, stable expression of canine factor IX (cF.IX) in hemophilia B dogs with an F.IX missense mutation (Herzog et al., Nat. Med. 1999;5:56-63). The use of a species-specific transgene allowed us to study risks and characteristics of antibody formation against the therapeutic transgene product. We analyzed seven dogs that had been injected at a single time point at multiple intramuscular sites with varying vector doses (dose per kilogram, dose per animal, dose per site). Comparison of individual animals suggests an increased likelihood of inhibitory anti-cF.IX (inhibitor) development with increased vector doses, with dose per site showing the strongest correlation with the risk of inhibitor formation. In six of seven animals, such immune responses were either absent or transient, and therefore did not prevent sustained systemic expression of cF.IX. Transient inhibitory/neutralizing anti-cF.IX responses occurred at vector doses of 2 x 10(12)/site, whereas a 6-fold higher dose resulted in a longer lasting, higher titer inhibitor. Anti-cF.IX was efficiently blocked in an eighth animal that was injected with a high vector dose per site, but in addition received transient immune suppression. Inhibitor formation was characterized by synthesis of two IgG subclasses and in vitro proliferation of lymphocytes to cF.IX antigen, indicating a helper T cell-dependent mechanism. Anti-cF.IX formation is likely influenced by the extent of local antigen presentation and may be avoided by limited vector doses or by transient immune modulation.

Validation of a recombinant human bactericidal/permeability-increasing protein (hBPI) expression vector using murine mammary gland tumor cells and the early development of hBPI transgenic goat embryos.

PubMed

Gui, Tao; Liu, Xing; Tao, Jia; Chen, Jianwen; Li, Yunsheng; Zhang, Meiling; Wu, Ronghua; Zhang, Yuanliang; Peng, Kaisong; Liu, Ya; Zhang, Xiaorong; Zhang, Yunhai

2013-12-01

Human bactericidal/permeability-increasing protein (hBPI) is the only antibacterial peptide which acts against both gram-negative bacteria and neutralizes endotoxins in human polymorphonuclear neutrophils; therefore, hBPI is of great value in clinical applications. In the study, we constructed a hBPI expression vector (pBC1-Loxp-Neo-Loxp-hBPI) containing the full-length hBPI coding sequence which could be specifically expressed in the mammary gland. To validate the function of the vector, in vitro cultured C127 (mouse mammary Carcinoma Cells) were transfected with the vector, and the transgenic cell clones were selected to express hBPI by hormone induction. The mRNA and protein expression of hBPI showed that the constructed vector was effective and suitable for future application in producing mammary gland bioreactor. Then, female and male goat fibroblasts were transfected with the vector, and two male and two female transgenic clonal cell lines were obtained. Using the transgenic cell lines as nuclear donors for somatic cell nuclear transfer, the reconstructed goat embryos produced from all four clones could develop to blastocysts in vitro. In conclusion, we constructed and validated an efficient mammary gland-specific hBPI expression vector, pBC1-Loxp-Neo-Loxp-hBPI, and transgenic hBPI goat embryos were successfully produced, laying foundations for future production of recombinant hBPI in goat mammary gland. Copyright © 2013 Elsevier B.V. All rights reserved.

A host-restricted viral vector for antigen-specific immunization against Lyme disease pathogen.

PubMed

Xiao, Sa; Kumar, Manish; Yang, Xiuli; Akkoyunlu, Mustafa; Collins, Peter L; Samal, Siba K; Pal, Utpal

2011-07-18

Newcastle disease virus (NDV) is an avian virus that is attenuated in primates and is a potential vaccine vector for human use. We evaluated NDV as a vector for expressing selected antigens of the Lyme disease pathogen Borrelia burgdorferi. A series of recombinant NDVs were generated that expressed intracellular or extracellular forms of two B. burgdorferi antigens: namely, the basic membrane protein A (BmpA) and the outer surface protein C (OspC). Expression of the intracellular and extracellular forms of these antigens was confirmed in cultured chicken cells. C3H or Balb/C mice that were immunized intranasally with the NDV vectors mounted vigorous serum antibody responses against the NDV vector, but failed to mount a robust response against either the intracellular or extracellular forms of BmpA or OspC. By contrast, a single immunization of hamsters with the NDV vectors via the intranasal, intramuscular, or intraperitoneal route resulted in rapid and rigorous antibody responses against the intracellular or extracellular forms of BmpA and OspC. When groups of hamsters were separately inoculated with various NDV vectors and challenged with B. burgdorferi (10(8)cells/animal), immunization with vector expressing either intracellular or extracellular BmpA was associated with a significant reduction of the pathogen load in the joints. Taken together, our studies highlighted the importance of NDV as vaccine vector that can be used for simple yet effective immunization of hosts against bacterial infections including Lyme disease. Copyright © 2011 Elsevier Ltd. All rights reserved.

Mouse mammary tumor virus-based vector transduces non-dividing cells, enters the nucleus via a TNPO3-independent pathway and integrates in a less biased fashion than other retroviruses.

PubMed

Konstantoulas, Constantine James; Indik, Stanislav

2014-04-30

Mouse mammary tumor virus (MMTV) is a complex, milk-born betaretrovirus, which preferentially infects dendritic cells (DC) in the gastrointestinal tract and then spreads to T and B lymphocytes and finally to the mammary gland. It is not clear how the prototypic betaretrovirus infects mucosal DCs and naïve lymphocytes as these cells are considered to be non-proliferative. Studies of MMTV biology have been hampered by the difficulty of obtaining sufficient virus/vector titers after transfection of a molecular clone in cultured cells. To surmount this barrier we developed a novel MMTV-based vector system with a split genome design containing potent posttranscriptional regulatory functions. Using this system, vector particles were produced to markedly greater titers (>1000-fold) than those obtained previously. The titers (>106 transduction units /ml) were comparable to those achieved with lentiviral or gammaretroviral vectors. Importantly, the vector transduced the enhanced green fluorescence protein gene into the chromosomes of non-dividing cells, such as cells arrested at the G2/M phase of the cell cycle and unstimulated hematopoietic progenitor cells, at an efficiency similar to that obtained with the HIV-1-based vector. In contrast to HIV-1, MMTV transductions were not affected by knocking down the expression of a factor involved in nuclear import of the HIV-1 pre-integration complexes, TNPO3. In contrast to HIV-1, the MMTV-based vector did not preferentially integrate in transcription units. Additionally, no preference for integration near transcription start sites, the regions preferentially targeted by gammaretroviral vectors, was observed. The vector derived from MMTV exhibits a random integration pattern. Overall, the betaretroviral vector system should facilitate molecular virology studies of the prototypic betaretrovirus as well as studies attempting to elucidate fundamental cellular processes such as nuclear import pathways. Random integration in cycling and non-cycling cells may be applicable in unbiased gene delivery.

Gene therapy delivery systems for enhancing viral and nonviral vectors for cardiac diseases: current concepts and future applications.

PubMed

Katz, Michael G; Fargnoli, Anthony S; Williams, Richard D; Bridges, Charles R

2013-11-01

Gene therapy is one of the most promising fields for developing new treatments for the advanced stages of ischemic and monogenetic, particularly autosomal or X-linked recessive, cardiomyopathies. The remarkable ongoing efforts in advancing various targets have largely been inspired by the results that have been achieved in several notable gene therapy trials, such as the hemophilia B and Leber's congenital amaurosis. Rate-limiting problems preventing successful clinical application in the cardiac disease area, however, are primarily attributable to inefficient gene transfer, host responses, and the lack of sustainable therapeutic transgene expression. It is arguable that these problems are directly correlated with the choice of vector, dose level, and associated cardiac delivery approach as a whole treatment system. Essentially, a delicate balance exists in maximizing gene transfer required for efficacy while remaining within safety limits. Therefore, the development of safe, effective, and clinically applicable gene delivery techniques for selected nonviral and viral vectors will certainly be invaluable in obtaining future regulatory approvals. The choice of gene transfer vector, dose level, and the delivery system are likely to be critical determinants of therapeutic efficacy. It is here that the interactions between vector uptake and trafficking, delivery route means, and the host's physical limits must be considered synergistically for a successful treatment course.

Cre/lox-Recombinase-Mediated Cassette Exchange for Reversible Site-Specific Genomic Targeting of the Disease Vector, Aedes aegypti.

PubMed

Häcker, Irina; Harrell Ii, Robert A; Eichner, Gerrit; Pilitt, Kristina L; O'Brochta, David A; Handler, Alfred M; Schetelig, Marc F

2017-03-07

Site-specific genome modification (SSM) is an important tool for mosquito functional genomics and comparative gene expression studies, which contribute to a better understanding of mosquito biology and are thus a key to finding new strategies to eliminate vector-borne diseases. Moreover, it allows for the creation of advanced transgenic strains for vector control programs. SSM circumvents the drawbacks of transposon-mediated transgenesis, where random transgene integration into the host genome results in insertional mutagenesis and variable position effects. We applied the Cre/lox recombinase-mediated cassette exchange (RMCE) system to Aedes aegypti, the vector of dengue, chikungunya, and Zika viruses. In this context we created four target site lines for RMCE and evaluated their fitness costs. Cre-RMCE is functional in a two-step mechanism and with good efficiency in Ae. aegypti. The advantages of Cre-RMCE over existing site-specific modification systems for Ae. aegypti, phiC31-RMCE and CRISPR, originate in the preservation of the recombination sites, which 1) allows successive modifications and rapid expansion or adaptation of existing systems by repeated targeting of the same site; and 2) provides reversibility, thus allowing the excision of undesired sequences. Thereby, Cre-RMCE complements existing genomic modification tools, adding flexibility and versatility to vector genome targeting.

Molecular cloning and production of caprine recombinant Oct4 protein for generation induced pluripotent stem cells.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Singh, Surender; Kumar, Sudarshan; Kaushik, Jai K; Mohanty, Ashok K; Malakar, Dhruba

2015-12-01

Oct4, pluripotency marker and transcription factor, expresses in embryonic stem cells. It plays a pivotal role in determination of stem cells fate. Up and down regulation of Oct4 causes differentiation of embryonic stem cells. It is one of the main transcription factors which remained concerned in every study related to induced pluripotent stem cell. Here, we report the production of goat Oct4 protein using plasmid and lentiviral based vectors. Firstly, Oct4 ORF was cloned in pAcGFP1-N1 plasmid vector and positive clones were screened with colony PCR. Oct4 was over-expressed in CHO-K1 cell line and expression was confirmed by observing green florescent protein expression in CHO-K1 cells. Secondly, Oct4 lentiviral expression construct has been prepared using pLenti-gw vector. Oct4 ORF was cloned into pLenti4/V5-DEST vector and viral particles were produced in 293FT cells. Oct4 viral particles were used to infect goat fibroblast cells. Oct4 expression was observed and confirmed in transfected goat fibroblast cells using RT-PCR. Detection of Oct4 protein in western blotting assay affirmed the capacity of over-expression of our Oct4 lentiviral vector. The lentiviral expression construct and recombinant Oct4 protein may be used for reprogramming of somatic cell into induced pluripotent stem cell.

A novel expression vector for the improved solubility of recombinant scorpion venom in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Tianqing; Ming, Hongyan; Deng, Lili

Recombinant scorpion anti-excitation peptide (rANEP) has previously been expressed using the pET32a system and purified via affinity chromatography. However, rANEP is expressed in BL21(DE3) cells as an inclusion body, and the affinity tag can not be removed. To overcome this problem, we used a variety of protein, DsbA, MBP, TrxA, intein, and affinity tags in fusion and co-expression to achieve soluble and functional rANEP without any affinity tag. In the pCIT-ANEP expression vector, the highest soluble expression level was approximately 90% of the total cellular proteins in E. coli, and the rANEP was cleaved by the intein protein and subsequently purifiedmore » to obtain rANEP, which had the same activity as the natural ANEP. The purity of rANEP obtained using this method was over 95%, with a quantity of 5.1 mg from of purified rANEP from 1 L of culture. This method could expand the application of the soluble expression of disulfide-rich peptides in E. coli.« less

AAVrh.10-Mediated Expression of an Anti-Cocaine Antibody Mediates Persistent Passive Immunization That Suppresses Cocaine-Induced Behavior

PubMed Central

Rosenberg, Jonathan B.; Hicks, Martin J.; De, Bishnu P.; Pagovich, Odelya; Frenk, Esther; Janda, Kim D.; Wee, Sunmee; Koob, George F.; Hackett, Neil R.; Kaminsky, Stephen M.; Worgall, Stefan; Tignor, Nicole; Mezey, Jason G.

2012-01-01

Abstract Cocaine addiction is a major problem affecting all societal and economic classes for which there is no effective therapy. We hypothesized an effective anti-cocaine vaccine could be developed by using an adeno-associated virus (AAV) gene transfer vector as the delivery vehicle to persistently express an anti-cocaine monoclonal antibody in vivo, which would sequester cocaine in the blood, preventing access to cognate receptors in the brain. To accomplish this, we constructed AAVrh.10antiCoc.Mab, an AAVrh.10 gene transfer vector expressing the heavy and light chains of the high affinity anti-cocaine monoclonal antibody GNC92H2. Intravenous administration of AAVrh.10antiCoc.Mab to mice mediated high, persistent serum levels of high-affinity, cocaine-specific antibodies that sequestered intravenously administered cocaine in the blood. With repeated intravenous cocaine challenge, naive mice exhibited hyperactivity, while the AAVrh.10antiCoc.Mab-vaccinated mice were completely resistant to the cocaine. These observations demonstrate a novel strategy for cocaine addiction by requiring only a single administration of an AAV vector mediating persistent, systemic anti-cocaine passive immunity. PMID:22486244

Episome-generated N-myc antisense RNA restricts the differentiation potential of primitive neuroectodermal cell lines.

PubMed Central

Whitesell, L; Rosolen, A; Neckers, L M

1991-01-01

Neuroectodermal tumors of childhood provide a unique opportunity to examine the role of genes potentially regulating neuronal growth and differentiation because many cell lines derived from these tumors are composed of at least two distinct morphologic cell types. These types display variant phenotypic characteristics and spontaneously interconvert, or transdifferentiate, in vitro. The factors that regulate transdifferentiation are unknown. Application of antisense approaches to the transdifferentiation process has allowed us to explore the precise role that N-myc may play in regulating developing systems. We now report construction of an episomally replicating expression vector designed to generate RNA antisense to part of the human N-myc gene. Such a vector is able to specifically inhibit N-myc expression in cell lines carrying both normal and amplified N-myc alleles. Inhibition of N-myc expression blocks transdifferentiation in these lines, with accumulation of cells of an intermediate phenotype. A concomitant decrease in growth rate but not loss of tumorigenicity was observed in the N-myc nonamplified cell line CHP-100. Vector-generated antisense RNA should allow identification of genes specifically regulated by the proto-oncogene N-myc. Images PMID:1996098

pLR: a lentiviral backbone series to stable transduction of bicistronic genes and exchange of promoters.

PubMed

Vargas, José Eduardo; Salton, Gabrielle; Sodré de Castro Laino, Andressa; Pires, Tiago Dalberto; Bonamino, Martin; Lenz, Guido; Delgado-Cañedo, Andrés

2012-11-01

Gene transfer based on lentiviral vectors allow the integration of exogenous genes into the genome of a target cell, turning these vectors into one of the most used methods for stable transgene expression in mammalian cells, in vitro and in vivo. Currently, there are no lentivectors that allow the cloning of different genes to be regulated by different promoters. Also, there are none that permit the analysis of the expression through an IRES (internal ribosome entry site)-- reporter gene system. In this work, we have generated a series of lentivectors containing: (1) a malleable structure to allow the cloning of different target genes in a multicloning site (mcs); (2) unique site to exchange promoters, and (3) IRES followed by one of two reporter genes: eGFP or DsRed. The series of the produced vectors were named pLR (for lentivirus and RSV promoter) and were fairly efficient with a strong fluorescence of the reporter genes in direct transfection and viral transduction experiments. This being said, the pLR series have been found to be powerful biotechnological tools for stable gene transfer and expression. Copyright © 2012 Elsevier Inc. All rights reserved.

Energy density and energy flux in the focus of an optical vortex: reverse flux of light energy.

PubMed

Kotlyar, Victor V; Kovalev, Alexey A; Nalimov, Anton G

2018-06-15

Using the Richards-Wolf formulas for an arbitrary circularly polarized optical vortex with an integer topological charge m, we obtain explicit expressions for all components of the electric and magnetic field strength vectors near the focus, as well as expressions for the intensity (energy density) and for the energy flux (components of the Poynting vector) in the focal plane of an aplanatic optical system. For m=2, from the obtained expressions it follows that the energy flux near the optical axis propagates in the reversed direction, rotating along a spiral around the optical axis. On the optical axis itself, the reversed flux is maximal and decays rapidly with the distance from the axis. For m=3, in contrast, the reversed energy flux in the focal plane is minimal (zero) on the optical axis and increases (until the first ring of the light intensity) as a squared distance from the axis.

Development of a domain-specific genetic language to design Chlamydomonas reinhardtii expression vectors.

PubMed

Wilson, Mandy L; Okumoto, Sakiko; Adam, Laura; Peccoud, Jean

2014-01-15

Expression vectors used in different biotechnology applications are designed with domain-specific rules. For instance, promoters, origins of replication or homologous recombination sites are host-specific. Similarly, chromosomal integration or viral delivery of an expression cassette imposes specific structural constraints. As de novo gene synthesis and synthetic biology methods permeate many biotechnology specialties, the design of application-specific expression vectors becomes the new norm. In this context, it is desirable to formalize vector design strategies applicable in different domains. Using the design of constructs to express genes in the chloroplast of Chlamydomonas reinhardtii as an example, we show that a vector design strategy can be formalized as a domain-specific language. We have developed a graphical editor of context-free grammars usable by biologists without prior exposure to language theory. This environment makes it possible for biologists to iteratively improve their design strategies throughout the course of a project. It is also possible to ensure that vectors designed with early iterations of the language are consistent with the latest iteration of the language. The context-free grammar editor is part of the GenoCAD application. A public instance of GenoCAD is available at http://www.genocad.org. GenoCAD source code is available from SourceForge and licensed under the Apache v2.0 open source license.

Transformable Rhodobacter strains, method for producing transformable Rhodobacter strains

DOEpatents

Laible, Philip D.; Hanson, Deborah K.

2018-05-08

The invention provides an organism for expressing foreign DNA, the organism engineered to accept standard DNA carriers. The genome of the organism codes for intracytoplasmic membranes and features an interruption in at least one of the genes coding for restriction enzymes. Further provided is a system for producing biological materials comprising: selecting a vehicle to carry DNA which codes for the biological materials; determining sites on the vehicle's DNA sequence susceptible to restriction enzyme cleavage; choosing an organism to accept the vehicle based on that organism not acting upon at least one of said vehicle's sites; engineering said vehicle to contain said DNA; thereby creating a synthetic vector; and causing the synthetic vector to enter the organism so as cause expression of said DNA.

Construction of an agglutination tool: recombinant Fab fragments biotinylated in vitro.

PubMed

Czerwinski, Marcin; Krop-Watorek, Anna; Wasniowska, Kazimiera; Smolarek, Dorota; Spitalnik, Steven L

2009-11-30

The pComb3H vector system is used for constructing and panning recombinant antibody libraries. It allows for expression of monovalent Fab fragments, either on the surface of M13 phage, or in the form of soluble proteins secreted into the periplasmic space of bacteria. We constructed a modified pComb3H vector containing cDNA encoding for a 23-amino acid fragment of the Escherichia coli biotin carboxy carrier protein (BCCP), which is an acceptor sequence for biotinylation. The vector was used to express the Fab fragment recognizing human glycophorin A. The purified Fab fragment containing this biotin acceptor sequence was effectively biotinylated in vitro using biotin ligase (BirA). The specificity and avidity of the biotinylated Fab fragments were similar to the previously produced, unmodified Fab fragments. An avidin-alkaline phosphatase conjugate was used to detect the recombinant Fab fragments, instead of secondary antibody. In addition, when biotinylated Fab fragments were mixed with avidin, red blood cells were directly agglutinated.

A simple method to generate stable cell lines for the analysis of transient protein-protein interactions.

PubMed

Savage, Emilia Elizabeth; Wootten, Denise; Christopoulos, Arthur; Sexton, Patrick Michael; Furness, Sebastian George Barton

2013-04-01

Transient protein-protein interactions form the basis of signal transduction pathways in addition to many other biological processes. One tool for studying these interactions is bioluminescence resonance energy transfer (BRET). This technique has been widely applied to study signaling pathways, in particular those initiated by G protein-coupled receptors (GPCRs). These assays are routinely performed using transient transfection, a technique that has limitations in terms of assay cost and variability, overexpression of interacting proteins, vector uptake limited to cycling cells, and non-homogenous expression across cells within the assay. To address these issues, we developed bicistronic vectors for use with Life Technology's Gateway and flpIN systems. These vectors provide a means to generate isogenic cell lines for comparison of interacting proteins. They have the advantage of stable, single copy, isogenic, homogeneous expression with low inter-assay variation. We demonstrate their utility by assessing ligand-induced interactions between GPCRs and arrestin proteins.

Computation of optimal output-feedback compensators for linear time-invariant systems

NASA Technical Reports Server (NTRS)

Platzman, L. K.

1972-01-01

The control of linear time-invariant systems with respect to a quadratic performance criterion was considered, subject to the constraint that the control vector be a constant linear transformation of the output vector. The optimal feedback matrix, f*, was selected to optimize the expected performance, given the covariance of the initial state. It is first shown that the expected performance criterion can be expressed as the ratio of two multinomials in the element of f. This expression provides the basis for a feasible method of determining f* in the case of single-input single-output systems. A number of iterative algorithms are then proposed for the calculation of f* for multiple input-output systems. For two of these, monotone convergence is proved, but they involve the solution of nonlinear matrix equations at each iteration. Another is proposed involving the solution of Lyapunov equations at each iteration, and the gradual increase of the magnitude of a penalty function. Experience with this algorithm will be needed to determine whether or not it does, indeed, possess desirable convergence properties, and whether it can be used to determine the globally optimal f*.

Genetic engineering of cell lines using lentiviral vectors to achieve antibody secretion following encapsulated implantation.

PubMed

Lathuilière, Aurélien; Bohrmann, Bernd; Kopetzki, Erhard; Schweitzer, Christoph; Jacobsen, Helmut; Moniatte, Marc; Aebischer, Patrick; Schneider, Bernard L

2014-01-01

The controlled delivery of antibodies by immunoisolated bioimplants containing genetically engineered cells is an attractive and safe approach for chronic treatments. To reach therapeutic antibody levels there is a need to generate renewable cell lines, which can long-term survive in macroencapsulation devices while maintaining high antibody specific productivity. Here we have developed a dual lentiviral vector strategy for the genetic engineering of cell lines compatible with macroencapsulation, using separate vectors encoding IgG light and heavy chains. We show that IgG expression level can be maximized as a function of vector dose and transgene ratio. This approach allows for the generation of stable populations of IgG-expressing C2C12 mouse myoblasts, and for the subsequent isolation of clones stably secreting high IgG levels. Moreover, we demonstrate that cell transduction using this lentiviral system leads to the production of a functional glycosylated antibody by myogenic cells. Subsequent implantation of antibody-secreting cells in a high-capacity macroencapsulation device enables continuous delivery of recombinant antibodies in the mouse subcutaneous tissue, leading to substantial levels of therapeutic IgG detectable in the plasma.

Rapid production of functionalized recombinant proteins: marrying ligation independent cloning and in vitro protein ligation.

PubMed

Kushnir, Susanna; Marsac, Yoann; Breitling, Reinhard; Granovsky, Igor; Brok-Volchanskaya, Vera; Goody, Roger S; Becker, Christian F W; Alexandrov, Kirill

2006-01-01

Functional genomics and proteomics have been very active fields since the sequencing of several genomes was completed. To assign a physiological role to the newly discovered coding genes with unknown function, new generic methods for protein production, purification, and targeted functionalization are needed. This work presents a new vector, pCYSLIC, that allows rapid generation of Escherichia coli expression constructs via ligation-independent cloning (LIC). The vector is designed to facilitate protein purification by either Ni-NTA or GSH affinity chromatography. Subsequent proteolytic removal of affinity tags liberates an N-terminal cysteine residue that is then used for covalent modification of the target protein with different biophysical probes via protein ligation. The described system has been tested on 36 mammalian Rab GTPases, and it was demonstrated that recombinant GTPases produced with pCYSLIC could be efficiently modified with fluorescein or biotin in vitro. Finally, LIC was compared with the recently developed In-Fusion cloning method, and it was demonstrated that In-Fusion provides superior flexibility in choice of expression vector. By the application of In-Fusion cloning Cys-Rab6A GTPase with an N-terminal cysteine residue was generated employing unmodified pET30a vector and TVMV protease.

[Effects of canine IL-2 and IL-7 genes on enhancing immunogenicity of canine parvovirus VP2 gene vaccine in mice].

PubMed

Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia

2012-11-04

To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P < 0.05). The lymphocyte proliferation indices of VP2 + cIL-7/cIL-2 vector-immunized mice were also higher than that of other two groups although not statistically significant. However, the IFN-gamma expression levels of VP2 + cIL-7/cIL-2 vector-immunized mice were significantly higher than other immunized mice (P < 0.05). The cIL-2 and cIL-7 genes showed the significant synergic effects on enhancing the immunogenecity of CPV VP2 DNA vaccine.

Chromosomal integration of adenoviral vector DNA in vivo.

PubMed

Stephen, Sam Laurel; Montini, Eugenio; Sivanandam, Vijayshankar Ganesh; Al-Dhalimy, Muhseen; Kestler, Hans A; Finegold, Milton; Grompe, Markus; Kochanek, Stefan

2010-10-01

So far there has been no report of any clinical or preclinical evidence for chromosomal vector integration following adenovirus (Ad) vector-mediated gene transfer in vivo. We used liver gene transfer with high-capacity Ad vectors in the FAH(Deltaexon5) mouse model to analyze homologous and heterologous recombination events between vector and chromosomal DNA. Intravenous injection of Ad vectors either expressing a fumarylacetoacetate hydrolase (FAH) cDNA or carrying part of the FAH genomic locus resulted in liver nodules of FAH-expressing hepatocytes, demonstrating chromosomal vector integration. Analysis of junctions between vector and chromosomal DNA following heterologous recombination indicated integration of the vector genome through its termini. Heterologous recombination occurred with a median frequency of 6.72 x 10(-5) per transduced hepatocyte, while homologous recombination occurred more rarely with a median frequency of 3.88 x 10(-7). This study has established quantitative and qualitative data on recombination of adenoviral vector DNA with genomic DNA in vivo, contributing to a risk-benefit assessment of the biosafety of Ad vector-mediated gene transfer.

Intramuscular injection of AAV8 in mice and macaques is associated with substantial hepatic targeting and transgene expression.

PubMed

Greig, Jenny A; Peng, Hui; Ohlstein, Jason; Medina-Jaszek, C Angelica; Ahonkhai, Omua; Mentzinger, Anne; Grant, Rebecca L; Roy, Soumitra; Chen, Shu-Jen; Bell, Peter; Tretiakova, Anna P; Wilson, James M

2014-01-01

Intramuscular (IM) administration of adeno-associated viral (AAV) vectors has entered the early stages of clinical development with some success, including the first approved gene therapy product in the West called Glybera. In preparation for broader clinical development of IM AAV vector gene therapy, we conducted detailed pre-clinical studies in mice and macaques evaluating aspects of delivery that could affect performance. We found that following IM administration of AAV8 vectors in mice, a portion of the vector reached the liver and hepatic gene expression contributed significantly to total expression of secreted transgenes. The contribution from liver could be controlled by altering injection volume and by the use of traditional (promoter) and non-traditional (tissue-specific microRNA target sites) expression control elements. Hepatic distribution of vector following IM injection was also noted in rhesus macaques. These pre-clinical data on AAV delivery should inform safe and efficient development of future AAV products.

MicroRNA-Regulated Non-Viral Vectors with Improved Tumor Specificity in an Orthotopic Rat Model of Hepatocellular Carcinoma

PubMed Central

Ronald, John A.; Katzenberg, Regina; Nielsen, Carsten H.; Jae, Hwan Jun; Hofmann, Lawrence V.; Gambhir, Sanjiv S.

2013-01-01

In hepatocellular carcinoma, tumor specificity of gene therapy is of utmost importance to preserve liver function. MicroRNAs are powerful negative regulators of gene expression and many are down-regulated in human HCC. We identified seven miRNAs that are also down-regulated in tumors in a rat hepatoma model (p<0.05) and attempted to improve tumor specificity by constructing a panel of luciferase-expressing vectors containing binding sites for these microRNAs. Attenuation of luciferase expression by the corresponding microRNAs was confirmed across various cell lines and in mouse liver. We then tested our vectors in tumor-bearing rats and identified two microRNAs, miR-26a and miR-122, that significantly decreased expression in liver compared to control vector (6.40% and 0.26%, respectively; p<0.05). In tumor, miR-122 had a non-significant trend towards decreased (~50%) expression , while miR-26 had no significant effect on tumor expression. To our knowledge this is the first work using differentially expressed microRNAs to de-target transgene expression in an orthotopic hepatoma model and identification of miR-26a in addition to miR-122 for de-targeting liver. Considering the heterogeneity of microRNA expression in human HCC, this information will be important in guiding development of more personalized vectors for the treatment of this devastating disease. PMID:23719066

Generation of HIV-1 based bi-cistronic lentiviral vectors for stable gene expression and live cell imaging.

PubMed

Sehgal, Lalit; Budnar, Srikanth; Bhatt, Khyati; Sansare, Sneha; Mukhopadhaya, Amitabha; Kalraiya, Rajiv D; Dalal, Sorab N

2012-10-01

The study of protein-protein interactions, protein localization, protein organization into higher order structures and organelle dynamics in live cells, has greatly enhanced the understanding of various cellular processes. Live cell imaging experiments employ plasmid or viral vectors to express the protein/proteins of interest fused to a fluorescent protein. Unlike plasmid vectors, lentiviral vectors can be introduced into both dividing and non dividing cells, can be pseudotyped to infect a broad or narrow range of cells, and can be used to generate transgenic animals. However, the currently available lentiviral vectors are limited by the choice of fluorescent protein tag, choice of restriction enzyme sites in the Multiple Cloning Sites (MCS) and promoter choice for gene expression. In this report, HIV-1 based bi-cistronic lentiviral vectors have been generated that drive the expression of multiple fluorescent tags (EGFP, mCherry, ECFP, EYFP and dsRed), using two different promoters. The presence of a unique MCS with multiple restriction sites allows the generation of fusion proteins with the fluorescent tag of choice, allowing analysis of multiple fusion proteins in live cell imaging experiments. These novel lentiviral vectors are improved delivery vehicles for gene transfer applications and are important tools for live cell imaging in vivo.

Development of A Flexible System for the Simultaneous Conversion of Biomass to Industrial Chemicals and the Production of Industrial Biocatalysts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gao, Johnway; Hooker, Brian S.; Skeen, R S.

2002-01-01

A flexible system was developed for the simultaneous conversion of biomass to industrial chemicals and the production of industrial biocatalysts. In particular, the expression of a bacterial enzyme, beta-glucuronidase (GUS), was investigated using a genetically modified starch-degrading Saccharomyces strain in suspension cultures in starch media. Different sources of starch including corn and waste potato starch were used for yeast biomass accumulation and GUS expression studies under controls of inducible and constitutive promoters. A thermostable bacterial cellulase, Acidothermus cellulolyticus E1 endoglucanase gene was also cloned into an episomal plasmid expression vector and expressed in the starch-degrading Saccharomyces strain.

Insect cells-baculovirus system for the production of difficult to express proteins.

PubMed

Osz-Papai, Judit; Radu, Laura; Abdulrahman, Wassim; Kolb-Cheynel, Isabelle; Troffer-Charlier, Nathalie; Birck, Catherine; Poterszman, Arnaud

2015-01-01

The production of sufficient quantities of homogenous protein not only is an essential prelude for structural investigations but also represents a rate-limiting step for many human functional studies. Although technologies for expression of recombinant proteins and complexes have been improved tremendously, in many cases, protein production remains a challenge and can be associated with considerable investment. This chapter describes simple and efficient protocols for expression screening and optimization of protein production in insect cells using the baculovirus expression system. We describe the procedure, starting from the cloning of a gene of interest into an expression transfer baculovirus vector, followed by generation of the recombinant virus by homologous recombination, evaluation of protein expression, and scale-up. Handling of insect cell cultures and preparation of bacmid for co-transfection are also detailed.

UMG Lenti: novel lentiviral vectors for efficient transgene- and reporter gene expression in human early hematopoietic progenitors.

PubMed

Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni

2014-01-01

Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and progenitor cells, as well as in non-hematopoietic cells.

Stent-based delivery of adeno-associated viral vectors with sustained vascular transduction and iNOS-mediated inhibition of in-stent restenosis

PubMed Central

Fishbein, Ilia; Guerrero, David T.; Alferiev, Ivan S.; Foster, Jonathan B.; Minutolo, Nicholas G.; Chorny, Michael; Mas Monteys, Alejandro; Driesbaugh, Kathryn H.; Nagaswami, Chandrasekaran; Levy, Robert J.

2017-01-01

In-stent restenosis remains an important clinical problem in the era of drug eluting stents. Development of clinical gene therapy protocols for the prevention and treatment of in-stent restenosis is hampered by the lack of adequate local delivery systems. Herein we describe a novel stent-based gene delivery platform capable of providing local arterial gene transfer with adeno-associated viral (AAV) vectors. This system exploits the natural affinity of protein G (PrG) to bind to the Fc region of mammalian IgG, making PrG a universal adaptor for surface immobilization of vector-capturing antibodies (Ab). Our results: 1) demonstrate the feasibility of reversible immobilization of AAV2 vectors using vector tethering by AAV2-specific Ab appended to the stent surface through covalently attached PrG, 2) show sustained release kinetics of PrG/Ab-immobilized AAV2 vector particles into simulated physiological medium in vitro and site-specific transduction of cultured cells, 3) provide evidence of long-term (12 weeks) arterial expression of luciferase with PrG/Ab-tethered AAV2Luc, and 4) show anti-proliferative activity and anti-restenotic efficacy of stent-immobilized AAV2iNOS in the rat carotid artery model of stent angioplasty. PMID:28832561

Undetectable Transcription of cap in a Clinical AAV Vector: Implications for Preformed Capsid in Immune Responses

PubMed Central

Hauck, Bernd; Murphy, Samuel L; Smith, Peter H; Qu, Guang; Liu, Xingge; Zelenaia, Olga; Mingozzi, Federico; Sommer, Jürg M; High, Katherine A; Wright, J. Fraser

2008-01-01

In a gene therapy clinical trial for hemophilia B, adeno-associated virus 2 (AAV2) capsid–specific CD8+ T cells were previously implicated in the elimination of vector-transduced hepatocytes, resulting in loss of human factor IX (hFIX) transgene expression. To test the hypothesis that expression of AAV2 cap DNA impurities in the AAV2-hFIX vector was the source of epitopes presented on transduced cells, transcription of cap was assessed by quantitative reverse transcription–PCR (Q-RT-PCR) following transduction of target cells with the vector used in the clinical trial. Transcriptional profiling was also performed for residual AmpR, and adenovirus E2A and E4. Although trace amounts of DNA impurities were present in the clinical vector, transcription of these sequences was not detected after transduction of human hepatocytes, nor in mice administered a dose 26-fold above the highest dose administered in the clinical study. Two methods used to minimize encapsidated DNA impurities in the clinical vector were: (i) a vector (cis) production plasmid with a backbone exceeding the packaging limit of AAV; and (ii) a vector purification step that achieved separation of the vector from vector-related impurities (e.g., empty capsids). In conclusion, residual cap expression was undetectable following transduction with AAV2-hFIX clinical vectors. Preformed capsid protein is implicated as the source of epitopes recognized by CD8+ T cells that eliminated vector-transduced cells in the clinical study. PMID:18941440

Practical method for targeted disruption of cilia-related genes by using CRISPR/Cas9-mediated, homology-independent knock-in system.

PubMed

Katoh, Yohei; Michisaka, Saki; Nozaki, Shohei; Funabashi, Teruki; Hirano, Tomoaki; Takei, Ryota; Nakayama, Kazuhisa

2017-04-01

The CRISPR/Cas9 system has revolutionized genome editing in virtually all organisms. Although the CRISPR/Cas9 system enables the targeted cleavage of genomic DNA, its use for gene knock-in remains challenging because levels of homologous recombination activity vary among various cells. In contrast, the efficiency of homology-independent DNA repair is relatively high in most cell types. Therefore the use of a homology-independent repair mechanism is a possible alternative for efficient genome editing. Here we constructed a donor knock-in vector optimized for the CRISPR/Cas9 system and developed a practical system that enables efficient disruption of target genes by exploiting homology-independent repair. Using this practical knock-in system, we successfully disrupted genes encoding proteins involved in ciliary protein trafficking, including IFT88 and IFT20, in hTERT-RPE1 cells, which have low homologous recombination activity. The most critical concern using the CRISPR/Cas9 system is off-target cleavage. To reduce the off-target cleavage frequency and increase the versatility of our knock-in system, we constructed a universal donor vector and an expression vector containing Cas9 with enhanced specificity and tandem sgRNA expression cassettes. We demonstrated that the second version of our system has improved usability. © 2017 Katoh et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

A sparse matrix algorithm on the Boolean vector machine

NASA Technical Reports Server (NTRS)

Wagner, Robert A.; Patrick, Merrell L.

1988-01-01

VLSI technology is being used to implement a prototype Boolean Vector Machine (BVM), which is a large network of very small processors with equally small memories that operate in SIMD mode; these use bit-serial arithmetic, and communicate via cube-connected cycles network. The BVM's bit-serial arithmetic and the small memories of individual processors are noted to compromise the system's effectiveness in large numerical problem applications. Attention is presently given to the implementation of a basic matrix-vector iteration algorithm for space matrices of the BVM, in order to generate over 1 billion useful floating-point operations/sec for this iteration algorithm. The algorithm is expressed in a novel language designated 'BVM'.

A potyvirus vector efficiently targets recombinant proteins to chloroplasts, mitochondria and nuclei in plant cells when expressed at the amino terminus of the polyprotein.

PubMed

Majer, Eszter; Navarro, José-Antonio; Daròs, José-Antonio

2015-09-01

Plant virus-based expression systems allow quick and efficient production of recombinant proteins in plant biofactories. Among them, a system derived from tobacco etch virus (TEV; genus potyvirus) permits coexpression of equimolar amounts of several recombinant proteins. This work analyzed how to target recombinant proteins to different subcellular localizations in the plant cell using this system. We constructed TEV clones in which green fluorescent protein (GFP), with a chloroplast transit peptide (cTP), a nuclear localization signal (NLS) or a mitochondrial targeting peptide (mTP) was expressed either as the most amino-terminal product or embedded in the viral polyprotein. Results showed that cTP and mTP mediated efficient translocation of GFP to the corresponding organelle only when present at the amino terminus of the viral polyprotein. In contrast, the NLS worked efficiently at both positions. Viruses expressing GFP in the amino terminus of the viral polyprotein produced milder symptoms. Untagged GFPs and cTP and NLS tagged amino-terminal GFPs accumulated to higher amounts in infected tissues. Finally, viral progeny from clones with internal GFPs maintained the extra gene better. These observations will help in the design of potyvirus-based vectors able to coexpress several proteins while targeting different subcellular localizations, as required in plant metabolic engineering. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A gene cassette for adapting Escherichia coli strains as hosts for att-Int-mediated rearrangement and pL expression vectors.

PubMed

Balakrishnan, R; Bolten, B; Backman, K C

1994-01-28

A cassette of genes from bacteriophage lambda, when carried on a derivative of bacteriophage Mu, renders strains of Escherichia coli (and in principle other Mu-sensitive bacteria) capable of supporting lambda-based expression vectors, such as rearrangement vectors and pL vectors. The gene cassette contains a temperature-sensitive allele of the repressor gene, cIts857, and a shortened leftward operon comprising, oLpL, N, xis and int. Transfection and lysogenization of this cassette into various host bacteria is mediated by phage Mu functions. Examples of regulated expression of the gene encoding T4 DNA ligase are presented.

Safety profile, efficacy, and biodistribution of a bicistronic high-capacity adenovirus vector encoding a combined immunostimulation and cytotoxic gene therapy as a prelude to a phase I clinical trial for glioblastoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Puntel, Mariana; Department of Cell and Developmental Biology, The University of Michigan School of Medicine, MSRB II, RM 4570C, 1150 West Medical Center Drive, Ann Arbor, MI 48109-5689; Gene Therapeutics Research Institute, Cedars-Sinai Medical Center, Los Angeles, CA 90048

2013-05-01

Adenoviral vectors (Ads) are promising gene delivery vehicles due to their high transduction efficiency; however, their clinical usefulness has been hampered by their immunogenicity and the presence of anti-Ad immunity in humans. We reported the efficacy of a gene therapy approach for glioma consisting of intratumoral injection of Ads encoding conditionally cytotoxic herpes simplex type 1 thymidine kinase (Ad-TK) and the immunostimulatory cytokine fms-like tyrosine kinase ligand 3 (Ad-Flt3L). Herein, we report the biodistribution, efficacy, and neurological and systemic effects of a bicistronic high-capacity Ad, i.e., HC-Ad-TK/TetOn-Flt3L. HC-Ads elicit sustained transgene expression, even in the presence of anti-Ad immunity, andmore » can encode large therapeutic cassettes, including regulatory elements to enable turning gene expression “on” or “off” according to clinical need. The inclusion of two therapeutic transgenes within a single vector enables a reduction of the total vector load without adversely impacting efficacy. Because clinically the vectors will be delivered into the surgical cavity, normal regions of the brain parenchyma are likely to be transduced. Thus, we assessed any potential toxicities elicited by escalating doses of HC-Ad-TK/TetOn-Flt3L (1 × 10{sup 8}, 1 × 10{sup 9}, or 1 × 10{sup 10} viral particles [vp]) delivered into the rat brain parenchyma. We assessed neuropathology, biodistribution, transgene expression, systemic toxicity, and behavioral impact at acute and chronic time points. The results indicate that doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered into the normal rat brain and underpin further developments for its implementation in a phase I clinical trial for glioma. - Highlights: ► High capacity Ad vectors elicit sustained therapeutic gene expression in the brain. ► HC-Ad-TK/TetOn-Flt3L encodes two therapeutic genes and a transcriptional switch. ► We performed a dose escalation study at acute and chronic time points. ► Doses up to 1 × 10{sup 9} vp of HC-Ad-TK/TetOn-Flt3L can be safely delivered in the brain. ► Efficacy and safety of HC-Ad-TK/TetOn-Flt3L merits its use in a GBM Phase I trial.« less

A lentiviral vector with a short troponin-I promoter for tracking cardiomyocyte differentiation of human embryonic stem cells.

PubMed

Gallo, P; Grimaldi, S; Latronico, M V G; Bonci, D; Pagliuca, A; Gallo, P; Ausoni, S; Peschle, C; Condorelli, G

2008-02-01

Human embryonic stem cells (hESCs) may become important for cardiac repair due to their potentially unlimited ability to generate cardiomyocytes (CMCs). Moreover, genetic manipulation of hESC-derived CMCs would be a very promising technique for curing myocardial disorders. At the present time, however, inducing the differentiation of hESCs into CMCs is extremely difficult and, therefore, an easy and standardizable technique is needed to evaluate differentiation strategies. Vectors driving cardiac-specific expression may represent an important tool not only for monitoring new cardiac-differentiation strategies, but also for the manipulation of cardiac differentiation of ESCs. To this aim, we generated cardiac-specific lentiviral vectors (LVVs) in which expression is driven by a short fragment of the cardiac troponin-I proximal promoter (TNNI3) with a human cardiac alpha-actin enhancer, and tested its suitability in inducing tissue-specific gene expression and ability to track the CMC lineage during differentiation of ESCs. We determined that (1) TNNI3-LVVs efficiently drive cardiac-specific gene expression and mark the cardiomyogenic lineage in human and mouse ESC differentiation systems (2) the cardiac alpha-actin enhancer confers a further increase in gene-expression specificity of TNNI3-LVVs in hESCs. Although this technique may not be useful in tracking small numbers of cells, data suggested that TNNI3-based LVVs are a powerful tool for manipulating human ESCs and modifying hESC-derived CMCs.

Sustainability of keratinocyte gene transfer and cell survival in vivo.

PubMed

Choate, K A; Khavari, P A

1997-05-20

The epidermis is an attractive site for therapeutic gene delivery because it is accessible and capable of delivering polypeptides to the systemic circulation. A number of difficulties, however, have emerged in attempts at cutaneous gene delivery, and central among these is an inability to sustain therapeutic gene production. We have examined two major potential contributing factors, viral vector stamina and involvement of long-lived epidermal progenitor cells. Human keratinocytes were either untreated or transduced with a retroviral vector for beta-galactosidase (beta-Gal) at > 99% efficiency and then grafted onto immunodeficient mice to regenerate human epidermis. Human epidermis was monitored in vivo after grafting for clinical and histologic appearance as well as for gene expression. Although integrated vector sequences persisted unchanged in engineered epidermis at 10 weeks post-grafting, retroviral long terminal repeat (LTR)-driven beta-Gal expression ceased in vivo after approximately 4 weeks. Endogenous cellular promoters, however, maintained consistently normal gene expression levels without evidence of time-dependent decline, as determined by immunostaining with species-specific antibodies for human involucrin, filaggrin, keratinocyte transglutaminase, keratin 10, type VII collagen, and Laminin 5 proteins out to week 14 post-grafting. Transduced human keratinocytes generated multilayer epidermis sustained through multiple epidermal turnover cycles; this epidermis demonstrated retention of a spatially appropriate pattern of basal and suprabasal epidermal marker gene expression. These results confirm previous findings suggesting that viral promoter-driven gene expression is not durable and demonstrate that keratinocytes passaged in vitro can regenerate and sustain normal epidermis for prolonged periods.

Characterization of intravitreally delivered capsid mutant AAV2-Cre vector to induce tissue-specific mutations in murine retinal ganglion cells.

PubMed

Langouet-Astrie, Christophe J; Yang, Zhiyong; Polisetti, Sraavya M; Welsbie, Derek S; Hauswirth, William W; Zack, Donald J; Merbs, Shannath L; Enke, Raymond A

2016-10-01

Targeted expression of Cre recombinase in murine retinal ganglion cells (RGCs) by viral vector is an effective strategy for creating tissue-specific gene knockouts for investigation of genetic contribution to RGC degeneration associated with optic neuropathies. Here we characterize dosage, efficacy and toxicity for sufficient intravitreal delivery of a capsid mutant Adeno-associated virus 2 (AAV2) vector encoding Cre recombinase. Wild type and Rosa26 (R26) LacZ mice were intravitreally injected with capsid mutant AAV2 viral vectors. Murine eyes were harvested at intervals ranging from 2 weeks to 15 weeks post-injection and were assayed for viral transduction, transgene expression and RGC survival. 10(9) vector genomes (vg) were sufficient for effective in vivo targeting of murine ganglion cell layer (GCL) retinal neurons. Transgene expression was observed as early as 2 weeks post-injection of viral vectors and persisted to 11 weeks. Early expression of Cre had no significant effect on RGC survival, while significant RGC loss was detected beginning 5 weeks post-injection. Early expression of viral Cre recombinase was robust, well-tolerated and predominantly found in GCL neurons suggesting this strategy can be effective in short-term RGC-specific mutation studies in experimental glaucoma models such as optic nerve crush and transection experiments. RGC degeneration with Cre expression for more than 4 weeks suggests that Cre toxicity is a limiting factor for targeted mutation strategies in RGCs. Copyright © 2016 Elsevier Ltd. All rights reserved.

Vector design for liver specific expression of multiple interfering RNAs that target hepatitis B virus transcripts

PubMed Central

Snyder, Lindsey L.; Esser, Jonathan M.; Pachuk, Catherine J.; Steel, Laura F.

2008-01-01

RNA interference (RNAi) is a process that can target intracellular RNAs for degradation in a highly sequence specific manner, making it a powerful tool that is being pursued in both research and therapeutic applications. Hepatitis B virus (HBV) is a serious public health problem in need of better treatment options, and aspects of its life cycle make it an excellent target for RNAi-based therapeutics. We have designed a vector that expresses interfering RNAs that target HBV transcripts, including both viral RNA replicative intermediates and mRNAs encoding viral proteins. Our vector design incorporates many features of endogenous microRNA (miRNA) gene organization that are proving useful for the development of reagents for RNAi. In particular, our vector contains an RNA pol II driven gene cassette that leads to tissue specific expression and efficient processing of multiple interfering RNAs from a single transcript, without the co-expression of any protein product. This vector shows potent silencing of HBV targets in cell culture models of HBV infection. The vector design will be applicable to silencing of additional cellular or disease-related genes. PMID:18499277

Live attenuated rubella vectors expressing SIV and HIV vaccine antigens replicate and elicit durable immune responses in rhesus macaques

PubMed Central

2013-01-01

Background Live attenuated viruses are among our most potent and effective vaccines. For human immunodeficiency virus, however, a live attenuated strain could present substantial safety concerns. We have used the live attenuated rubella vaccine strain RA27/3 as a vector to express SIV and HIV vaccine antigens because its safety and immunogenicity have been demonstrated in millions of children. One dose protects for life against rubella infection. In previous studies, rubella vectors replicated to high titers in cell culture while stably expressing SIV and HIV antigens. Their viability in vivo, however, as well as immunogenicity and antibody persistence, were unknown. Results This paper reports the first successful trial of rubella vectors in rhesus macaques, in combination with DNA vaccines in a prime and boost strategy. The vectors grew robustly in vivo, and the protein inserts were highly immunogenic. Antibody titers elicited by the SIV Gag vector were greater than or equal to those elicited by natural SIV infection. The antibodies were long lasting, and they were boosted by a second dose of replication-competent rubella vectors given six months later, indicating the induction of memory B cells. Conclusions Rubella vectors can serve as a vaccine platform for safe delivery and expression of SIV and HIV antigens. By presenting these antigens in the context of an acute infection, at a high level and for a prolonged duration, these vectors can stimulate a strong and persistent immune response, including maturation of memory B cells. Rhesus macaques will provide an ideal animal model for demonstrating immunogenicity of novel vectors and protection against SIV or SHIV challenge. PMID:24041113

Use and comparison of different internal ribosomal entry sites (IRES) in tricistronic retroviral vectors

PubMed Central

Douin, Victorine; Bornes, Stephanie; Creancier, Laurent; Rochaix, Philippe; Favre, Gilles; Prats, Anne-Catherine; Couderc, Bettina

2004-01-01

Background Polycistronic retroviral vectors that contain several therapeutic genes linked via internal ribosome entry sites (IRES), provide new and effective tools for the co-expression of exogenous cDNAs in clinical gene therapy protocols. For example, tricistronic retroviral vectors could be used to genetically modify antigen presenting cells, enabling them to express different co-stimulatory molecules known to enhance tumor cell immunogenicity. Results We have constructed and compared different retroviral vectors containing two co-stimulatory molecules (CD70, CD80) and selectable marker genes linked to different IRES sequences (IRES from EMCV, c-myc, FGF-2 and HTLV-1). The tricistronic recombinant amphotropic viruses containing the IRES from EMCV, FGF-2 or HTLV-1 were equally efficient in inducing the expression of an exogenous gene in the transduced murine or human cells, without displaying any cell type specificity. The simultaneous presence of several IRESes on the same mRNA, however, can induce the differential expression of the various cistrons. Here we show that the IRESes of HTLV-1 and EMCV interfere with the translation induced by other IRESes in mouse melanoma cells. The IRES from FGF-2 did however induce the expression of exogenous cDNA in human melanoma cells without any positive or negative regulation from the other IRESs present within the vectors. Tumor cells that were genetically modified with the tricistronic retroviral vectors, were able to induce an in vivo anti-tumor immune response in murine models. Conclusion Translation of the exogenous gene is directed by the IRES and its high level of expression not only depends on the type of cell that is transduced but also on the presence of other genetic elements within the vector. PMID:15279677

A native promoter and inclusion of an intron is necessary for efficient expression of GFP or mRFP in Armillaria mellea

PubMed Central

Ford, Kathryn L.; Baumgartner, Kendra; Henricot, Béatrice; Bailey, Andy M.; Foster, Gary D.

2016-01-01

Armillaria mellea is a significant pathogen that causes Armillaria root disease on numerous hosts in forests, gardens and agricultural environments worldwide. Using a yeast-adapted pCAMBIA0380 Agrobacterium vector, we have constructed a series of vectors for transformation of A. mellea, assembled using yeast-based recombination methods. These have been designed to allow easy exchange of promoters and inclusion of introns. The vectors were first tested by transformation into basidiomycete Clitopilus passeckerianus to ascertain vector functionality then used to transform A. mellea. We show that heterologous promoters from the basidiomycetes Agaricus bisporus and Phanerochaete chrysosporium that were used successfully to control the hygromycin resistance cassette were not able to support expression of mRFP or GFP in A. mellea. The endogenous A. mellea gpd promoter delivered efficient expression, and we show that inclusion of an intron was also required for transgene expression. GFP and mRFP expression was stable in mycelia and fluorescence was visible in transgenic fruiting bodies and GFP was detectable in planta. Use of these vectors has been successful in giving expression of the fluorescent proteins GFP and mRFP in A. mellea, providing an additional molecular tool for this pathogen. PMID:27384974

The natural dietary genistein boosts bacteriophage-mediated cancer cell killing by improving phage-targeted tumor cell transduction

PubMed Central

Tsafa, Effrosyni; Al-Bahrani, Mariam; Bentayebi, Kaoutar; Przystal, Justyna; Suwan, Keittisak; Hajitou, Amin

2016-01-01

Gene therapy has long been regarded as a promising treatment for cancer. However, cancer gene therapy is still facing the challenge of targeting gene delivery vectors specifically to tumors when administered via clinically acceptable non-invasive systemic routes (i.e. intravenous). The bacteria virus, bacteriophage (phage), represents a new generation of promising vectors in systemic gene delivery since their targeting can be achieved through phage capsid display ligands, which enable them to home to specific tumor receptors without the need to ablate any native eukaryotic tropism. We have previously reported a tumor specific bacteriophage vector named adeno-associated virus/phage, or AAVP, in which gene expression is under a recombinant human rAAV2 virus genome targeted to tumors via a ligand-directed phage capsid. However, cancer gene therapy with this tumor-targeted vector achieved variable outcomes ranging from tumor regression to no effect in both experimental and natural preclinical models. Herein, we hypothesized that combining the natural dietary genistein, with proven anticancer activity, would improve bacteriophage anticancer safe therapy. We show that combination treatment with genistein and AAVP increased targeted cancer cell killing by AAVP carrying the gene for Herpes simplex virus thymidine kinase (HSVtk) in 2D tissue cultures and 3D tumor spheroids. We found this increased tumor cell killing was associated with enhanced AAVP-mediated gene expression. Next, we established that genistein protects AAVP against proteasome degradation and enhances vector genome accumulation in the nucleus. Combination of genistein and phage-guided virotherapy is a safe and promising strategy that should be considered in anticancer therapy with AAVP. PMID:27437775

Hypoxia/hepatoma dual specific suicide gene expression plasmid delivery using bio-reducible polymer for hepatocellular carcinoma therapy.

PubMed

Kim, Hyun Ah; Nam, Kihoon; Lee, Minhyung; Kim, Sung Wan

2013-10-10

Gene therapy is suggested as a promising alternative strategy of hepatocellular carcinoma (HCC, also called hepatoma) therapy. To achieve a successful and safe gene therapy, tight regulation of gene expression is required to minimize side-effects in normal tissues. In this study, we developed a novel hypoxia and hepatoma dual specific gene expression vector. The constructed vectors were transfected into various cell lines using bio-reducible polymer, PAM-ABP. First, pAFPS-Luc or pAFPL-Luc vector was constructed with the alpha-fectoprotein (AFP) promoter and enhancer for hepatoma tissue specific gene expression. Then, pEpo-AFPL-Luc was constructed by insertion of the erythropoietin (Epo) enhancer for hypoxic cancer specific gene expression. In vitro transfection assay showed that pEpo-AFPL-Luc transfected hepatoma cell increased gene expression under hypoxic condition. To confirm the therapeutic effect of dual specific vector, herpes simplex virus thymidine kinase (HSV-TK) gene was introduced for cancer cell killing. The pEpo-AFPL-TK was transfected into hepatoma cell lines in the presence of ganciclovir (GCV) pro-drug. Caspase-3/7, MTT and TUNEL assays elucidated that pEpo-AFPL-TK transfected cells showed significant increasing of death rate in hypoxic hepatoma cells compared to controls. Therefore, the hypoxia/hepatoma dual specific gene expression vector with the Epo enhancer and AFP promoter may be useful for hepatoma specific gene therapy. © 2013.

Helper-dependent adenovirus achieve more efficient and persistent liver transgene expression in non-human primates under immunosuppression.

PubMed

Unzu, C; Melero, I; Hervás-Stubbs, S; Sampedro, A; Mancheño, U; Morales-Kastresana, A; Serrano-Mendioroz, I; de Salamanca, R E; Benito, A; Fontanellas, A

2015-11-01

Helper-dependent adenoviral (HDA) vectors constitute excellent gene therapy tools for metabolic liver diseases. We have previously shown that an HDA vector encoding human porphobilinogen deaminase (PBGD) corrects acute intermittent porphyria mice. Now, six non-human primates were injected in the left hepatic lobe with the PBGD-encoding HDA vector to study levels and persistence of transgene expression. Intrahepatic administration of 5 × 10(12) viral particles kg(-1) (10(10) infective units kg(-1)) of HDA only resulted in transient (≈14 weeks) transgene expression in one out of three individuals. In contrast, a more prolonged 90-day immunosuppressive regimen (tacrolimus, mycophenolate, rituximab and steroids) extended meaningful transgene expression for over 76 weeks in two out of two cases. Transgene expression under immunosuppression (IS) reached maximum levels 6 weeks after HDA administration and gradually declined reaching a stable plateau within the therapeutic range for acute porphyria. The non-injected liver lobes also expressed the transgene because of vector circulation. IS controlled anticapsid T-cell responses and decreased the induction of neutralizing antibodies. Re-administration of HDA-hPBGD at week +78 achieved therapeutically meaningful transgene expression only in those animals receiving IS again at the time of this second vector exposure. Overall, immunity against adenoviral capsids poses serious hurdles for long-term HDA-mediated liver transduction, which can be partially circumvented by pharmacological IS.

Development of a novel set of Gateway-compatible vectors for live imaging in insect cells.

PubMed

Maroniche, G A; Mongelli, V C; Alfonso, V; Llauger, G; Taboga, O; del Vas, Mariana

2011-10-01

Insect genomics is a growing area of research. To exploit fully the genomic data that are being generated, high-throughput systems for the functional characterization of insect proteins and their interactomes are required. In this work, a Gateway-compatible vector set for expression of fluorescent fusion proteins in insect cells was developed. The vector set was designed to express a protein of interest fused to any of four different fluorescent proteins [green fluorescent protein (GFP), cyan fluorescent protein (CFP), yellow fluorescent protein (YFP) and mCherry] by either the C-terminal or the N-terminal ends. Additionally, a collection of organelle-specific fluorescent markers was assembled for colocalization with fluorescent recombinant proteins of interest. Moreover, the vector set was proven to be suitable for simultaneously detecting up to three proteins by multiple labelling. The use of the vector set was exemplified by defining the subcellular distribution of Mal de Río Cuarto virus (MRCV) outer coat protein P10 and by analysing the in vivo self-interaction of the MRCV viroplasm matrix protein P9-1 in Förster resonance energy transfer (FRET) experiments. In conclusion, we have developed a valuable tool for high-throughput studies of protein subcellular localization that will aid in the elucidation of the function of newly described insect and virus proteins. © 2011 The Authors. Insect Molecular Biology © 2011 The Royal Entomological Society.

Production and purification of non replicative canine adenovirus type 2 derived vectors.

PubMed

Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard

2013-12-03

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.

Challenging assumptions of notational transparency: the case of vectors in engineering mathematics

NASA Astrophysics Data System (ADS)

Craig, Tracy S.

2017-11-01

The notation for vector analysis has a contentious nineteenth century history, with many different notations describing the same or similar concepts competing for use. While the twentieth century has seen a great deal of unification in vector analysis notation, variation still remains. In this paper, the two primary notations used for expressing the components of a vector are discussed in historical and current context. Popular mathematical texts use the two notations as if they are transparent and interchangeable. In this research project, engineering students' proficiency at vector analysis was assessed and the data were analyzed using the Rasch measurement method. Results indicate that the students found items expressed in unit vector notation more difficult than those expressed in parenthesis notation. The expert experience of notation as transparent and unproblematically symbolic of underlying processes independent of notation is shown to contrast with the student experience where the less familiar notation is experienced as harder to work with.

Virus-Derived Gene Expression and RNA Interference Vector for Grapevine

PubMed Central

Kurth, Elizabeth G.; Peremyslov, Valera V.; Prokhnevsky, Alexey I.; Kasschau, Kristin D.; Miller, Marilyn; Carrington, James C.

2012-01-01

The improvement of the agricultural and wine-making qualities of the grapevine (Vitis vinifera) is hampered by adherence to traditional varieties, the recalcitrance of this plant to genetic modifications, and public resistance to genetically modified organism (GMO) technologies. To address these challenges, we developed an RNA virus-based vector for the introduction of desired traits into grapevine without heritable modifications to the genome. This vector expresses recombinant proteins in the phloem tissue that is involved in sugar transport throughout the plant, from leaves to roots to berries. Furthermore, the vector provides a powerful RNA interference (RNAi) capability of regulating the expression of endogenous genes via virus-induced gene-silencing (VIGS) technology. Additional advantages of this vector include superb genetic capacity and stability, as well as the swiftness of technology implementation. The most significant applications of the viral vector include functional genomics of the grapevine and disease control via RNAi-enabled vaccination against pathogens or invertebrate pests. PMID:22438553

Essential and Dispensable Virus-Encoded Replication Elements Revealed by Efforts To Develop Hypoviruses as Gene Expression Vectors

PubMed Central

Suzuki, Nobuhiro; Geletka, Lynn M.; Nuss, Donald L.

2000-01-01

We have investigated whether hypoviruses, viral agents responsible for virulence attenuation (hypovirulence) of the chestnut blight fungus Cryphonectria parasitica, could serve as gene expression vectors. The infectious cDNA clone of the prototypic hypovirus CHV1-EP713 was modified to generate 20 different vector candidates. Although transient expression was achieved for a subset of vectors that contained the green fluorescent protein gene from Aequorea victoria, long-term expression (past day 8) was not observed for any vector construct. Analysis of viral RNAs recovered from transfected fungal colonies revealed that the foreign genes were readily deleted from the replicating virus, although small portions of foreign sequences were retained by some vectors after months of replication. However, the results of vector viability and progeny characterization provided unexpected new insights into essential and dispensable elements of hypovirus replication. The N-terminal portion (codons 1 to 24) of the 5′-proximal open reading frame (ORF), ORF A, was found to be required for virus replication, while the remaining 598 codons of this ORF were completely dispensable. Substantial alterations were tolerated in the pentanucleotide UAAUG that contains the ORF A termination codon and the overlapping putative initiation codon of the second of the two hypovirus ORFs, ORF B. Replication competence was maintained following either a frameshift mutation that caused a two-codon extension of ORF A or a modification that produced a single-ORF genomic organization. These results are discussed in terms of determinants of hypovirus replication, the potential utility of hypoviruses as gene expression vectors, and possible mechanisms by which hypoviruses recognize and delete foreign sequences. PMID:10906211

Modified Newcastle disease virus vectors expressing the H5 hemagglutinin induce enhanced protection against highly pathogenic H5N1 avian influenza virus in chickens

PubMed Central

Kim, Shin-Hee; Paldurai, Anandan; Xiao, Sa; Collins, Peter L.; Samal, Siba K.

2016-01-01

Naturally-occurring attenuated strains of Newcastle disease virus (NDV) are being developed as vaccine vectors for use in poultry and humans. However, some NDV strains, such as Beaudette C (BC), may retain too much virulence in poultry for safe use, and more highly attenuated strains may be suboptimally immunogenic. We therefore modified the BC strain by changing the multibasic cleavage site sequence of the F protein to the dibasic sequence of avirulent strain LaSota. Additionally, the BC, F, and HN proteins were modified in several ways to enhance virus replication. These modified BC-derived vectors and the LaSota strain were engineered to express the hemagglutin (HA) protein of H5N1 highly pathogenic influenza virus (HPAIV). In general, the modified BC-based vectors expressing HA replicated better than LaSota/HA, and expressed higher levels of HA protein. Pathogenicity tests indicated that all the modified viruses were highly attenuated in chickens. Based on in vitro characterization, two of the modified BC vectors were chosen for evaluation in chickens as vaccine vectors against H5N1 HPAIV A/Vietnam/1203/04. Immunization of chickens with rNDV vector vaccines followed by challenge with HPAIV demonstrated high levels of protection against clinical disease and mortality. However, only those chickens immunized with modified BC/HA in which residues 271–330 from the F protein had been replaced with the corresponding sequence from the NDV AKO strain conferred complete protection against challenge virus shedding. Our findings suggest that this modified rNDV can be used safely as a vaccine vector with enhanced replication, expression, and protective efficacy in avian species, and potentially in humans. PMID:24968158

Covariance expressions for eigenvalue and eigenvector problems

NASA Astrophysics Data System (ADS)

Liounis, Andrew J.

There are a number of important scientific and engineering problems whose solutions take the form of an eigenvalue--eigenvector problem. Some notable examples include solutions to linear systems of ordinary differential equations, controllability of linear systems, finite element analysis, chemical kinetics, fitting ellipses to noisy data, and optimal estimation of attitude from unit vectors. In many of these problems, having knowledge of the eigenvalue and eigenvector Jacobians is either necessary or is nearly as important as having the solution itself. For instance, Jacobians are necessary to find the uncertainty in a computed eigenvalue or eigenvector estimate. This uncertainty, which is usually represented as a covariance matrix, has been well studied for problems similar to the eigenvalue and eigenvector problem, such as singular value decomposition. There has been substantially less research on the covariance of an optimal estimate originating from an eigenvalue-eigenvector problem. In this thesis we develop two general expressions for the Jacobians of eigenvalues and eigenvectors with respect to the elements of their parent matrix. The expressions developed make use of only the parent matrix and the eigenvalue and eigenvector pair under consideration. In addition, they are applicable to any general matrix (including complex valued matrices, eigenvalues, and eigenvectors) as long as the eigenvalues are simple. Alongside this, we develop expressions that determine the uncertainty in a vector estimate obtained from an eigenvalue-eigenvector problem given the uncertainty of the terms of the matrix. The Jacobian expressions developed are numerically validated with forward finite, differencing and the covariance expressions are validated using Monte Carlo analysis. Finally, the results from this work are used to determine covariance expressions for a variety of estimation problem examples and are also applied to the design of a dynamical system.

Conditional Cytotoxic Anti-HIV Gene Therapy for Selectable Cell Modification

PubMed Central

Garg, Himanshu; Joshi, Anjali

2016-01-01

Gene therapy remains one of the potential strategies to achieve a cure for HIV infection. One of the major limitations of anti-HIV gene therapy concerns recovering an adequate number of modified cells to generate an HIV-proof immune system. Our study addresses this issue by developing a methodology that can mark conditional vector-transformed cells for selection and subsequently target HIV-infected cells for elimination by treatment with ganciclovir (GCV). We used the herpes simplex virus thymidine kinase (TK) mutant SR39, which is highly potent at killing cells at low GCV concentrations. This gene was cloned into a conditional HIV vector, pNL-GFPRRESA, which expresses the gene of interest as well as green fluorescent protein (GFP) in the presence of HIV Tat protein. We show here that TK-SR39 was more potent that wild-type TK (TK-WT) at eliminating infected cells at lower concentrations of GCV. As the vector expresses GFP in the presence of Tat, transient expression of Tat either by Tat RNA transfection or transduction by a nonintegrating lentiviral (NIL) vector marked the cells with GFP for selection. In cells selected by this strategy, TK-SR39 was more potent at limiting virus replication than TK-WT. Finally, in Jurkat cells modified and selected by this approach, infection with CXCR4-tropic Lai virus could be suppressed by treatment with GCV. GCV treatment limited the number of HIV-infected cells, virus production, as well as virus-induced cytopathic effects in this model. We provide proof of principle that TK-SR39 in a conditional HIV vector can provide a safe and effective anti-HIV strategy. PMID:26800572

Conditional Cytotoxic Anti-HIV Gene Therapy for Selectable Cell Modification.

PubMed

Garg, Himanshu; Joshi, Anjali

2016-05-01

Gene therapy remains one of the potential strategies to achieve a cure for HIV infection. One of the major limitations of anti-HIV gene therapy concerns recovering an adequate number of modified cells to generate an HIV-proof immune system. Our study addresses this issue by developing a methodology that can mark conditional vector-transformed cells for selection and subsequently target HIV-infected cells for elimination by treatment with ganciclovir (GCV). We used the herpes simplex virus thymidine kinase (TK) mutant SR39, which is highly potent at killing cells at low GCV concentrations. This gene was cloned into a conditional HIV vector, pNL-GFPRRESA, which expresses the gene of interest as well as green fluorescent protein (GFP) in the presence of HIV Tat protein. We show here that TK-SR39 was more potent that wild-type TK (TK-WT) at eliminating infected cells at lower concentrations of GCV. As the vector expresses GFP in the presence of Tat, transient expression of Tat either by Tat RNA transfection or transduction by a nonintegrating lentiviral (NIL) vector marked the cells with GFP for selection. In cells selected by this strategy, TK-SR39 was more potent at limiting virus replication than TK-WT. Finally, in Jurkat cells modified and selected by this approach, infection with CXCR4-tropic Lai virus could be suppressed by treatment with GCV. GCV treatment limited the number of HIV-infected cells, virus production, as well as virus-induced cytopathic effects in this model. We provide proof of principle that TK-SR39 in a conditional HIV vector can provide a safe and effective anti-HIV strategy.

Adeno-associated virus Rep-mediated targeting of integrase-defective retroviral vector DNA circles into human chromosome 19

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Shuohao; Kawabe, Yoshinori; Ito, Akira

2012-01-06

Highlights: Black-Right-Pointing-Pointer Adeno-associated virus (AAV) is capable of targeted integration in human cells. Black-Right-Pointing-Pointer Integrase-defective retroviral vector (IDRV) enables a circular DNA delivery. Black-Right-Pointing-Pointer A targeted integration system of IDRV DNA using the AAV integration mechanism. Black-Right-Pointing-Pointer Targeted IDRV integration ameliorates the safety concerns for retroviral vectors. -- Abstract: Retroviral vectors have been employed in clinical trials for gene therapy owing to their relative large packaging capacity, alterable cell tropism, and chromosomal integration for stable transgene expression. However, uncontrollable integrations of transgenes are likely to cause safety issues, such as insertional mutagenesis. A targeted transgene integration system for retroviral vectors,more » therefore, is a straightforward way to address the insertional mutagenesis issue. Adeno-associated virus (AAV) is the only known virus capable of targeted integration in human cells. In the presence of AAV Rep proteins, plasmids possessing the p5 integration efficiency element (p5IEE) can be integrated into the AAV integration site (AAVS1) in the human genome. In this report, we describe a system that can target the circular DNA derived from non-integrating retroviral vectors to the AAVS1 site by utilizing the Rep/p5IEE integration mechanism. Our results showed that after G418 selection 30% of collected clones had retroviral DNA targeted at the AAVS1 site.« less

Cytomegalovirus vector expressing RAE-1γ induces enhanced anti-tumor capacity of murine CD8+ T cells.

PubMed

Tršan, Tihana; Vuković, Kristina; Filipović, Petra; Brizić, Ana Lesac; Lemmermann, Niels A W; Schober, Kilian; Busch, Dirk H; Britt, William J; Messerle, Martin; Krmpotić, Astrid; Jonjić, Stipan

2017-08-01

Designing CD8 + T-cell vaccines, which would provide protection against tumors is still considered a great challenge in immunotherapy. Here we show the robust potential of cytomegalovirus (CMV) vector expressing the NKG2D ligand RAE-1γ as CD8 + T cell-based vaccine against malignant tumors. Immunization with the CMV vector expressing RAE-1γ, delayed tumor growth or even provided complete protection against tumor challenge in both prophylactic and therapeutic settings. Moreover, a potent tumor control in mice vaccinated with this vector can be further enhanced by blocking the immune checkpoints TIGIT and PD-1. CMV vector expressing RAE-1γ potentiated expansion of KLRG1 + CD8 + T cells with enhanced effector properties. This vaccination was even more efficient in neonatal mice, resulting in the expansion and long-term maintenance of epitope-specific CD8 + T cells conferring robust resistance against tumor challenge. Our data show that immunomodulation of CD8 + T-cell responses promoted by herpesvirus expressing a ligand for NKG2D receptor can provide a powerful platform for the prevention and treatment of CD8 + T-cell sensitive tumors. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.