Early detection of Candida albicans biofilms at porous electrodes.

PubMed

Congdon, Robert B; Feldberg, Alexander S; Ben-Yakar, Natalie; McGee, Dennis; Ober, Christopher; Sammakia, Bahgat; Sadik, Omowunmi A

2013-02-15

We describe the development of an electrochemical sensor for early detection of biofilm using Candida albicans. The electrochemical sensor used the ability of biofilms to accept electrons from redox mediators relative to the number of metabolically active cells present. Cyclic voltammetry and differential pulse voltammetry techniques were used to monitor the redox reaction of K(3)Fe(CN)(6) at porous reticulated vitreous carbon (RVC) (238.7 cm(2)) working electrodes versus Ag/AgCl reference. A shift in the peak potential occurred after 12 h of film growth, which is attributed to the presence of C. albicans. Moreover, the intensity of the ferricyanide reduction peak first increased as C. albicans deposited onto the porous electrodes at various growth times. The peak current subsequently decreased at extended periods of growth of 48 h. The reduction in peak current was attributed to the biofilm reaching its maximum growth thickness, which correlated with the maximum number of metabolically active cells. The observed diffusion coefficients for the bare RVC and biofilm-coated electrodes were 2.2 × 10(-3) and 7.0 × 10(-6) cm(2)/s, respectively. The increase in diffusivity from the bare electrode to the biofilm-coated electrode indicated some enhancement of electron transfer mediated by the biofilm to the porous electrode. Verification of the growth of biofilm was achieved using scanning electron microcopy and laser scanning confocal imaging microscopy. Validation with conventional plating techniques confirmed that the correlation (R(2) = 0.9392) could be achieved between the electrochemical sensors data and colony-forming units. Copyright © 2012 Elsevier Inc. All rights reserved.

Cooled railplug

DOEpatents

Weldon, W.F.

1996-05-07

The railplug is a plasma ignitor capable of injecting a high energy plasma jet into a combustion chamber of an internal combustion engine or continuous combustion system. An improved railplug is provided which has dual coaxial chambers (either internal or external to the center electrode) that provide for forced convective cooling of the electrodes using the normal pressure changes occurring in an internal combustion engine. This convective cooling reduces the temperature of the hot spot associated with the plasma initiation point, particularly in coaxial railplug configurations, and extends the useful life of the railplug. The convective cooling technique may also be employed in a railplug having parallel dual rails using dual, coaxial chambers. 10 figs.

Cooled railplug

DOEpatents

Weldon, William F.

1996-01-01

The railplug is a plasma ignitor capable of injecting a high energy plasma jet into a combustion chamber of an internal combustion engine or continuous combustion system. An improved railplug is provided which has dual coaxial chambers (either internal or external to the center electrode) that provide for forced convective cooling of the electrodes using the normal pressure changes occurring in an internal combustion engine. This convective cooling reduces the temperature of the hot spot associated with the plasma initiation point, particularly in coaxial railplug configurations, and extends the useful life of the railplug. The convective cooling technique may also be employed in a railplug having parallel dual rails using dual, coaxial chambers.

Bridging Redox Species-Coated Graphene Oxide Sheets to Electrode for Extending Battery Life Using Nanocomposite Electrolyte.

PubMed

Huang, Yi Fu; Ruan, Wen Hong; Lin, Dong Ling; Zhang, Ming Qiu

2017-01-11

Substituting conventional electrolyte for redox electrolyte has provided a new intriguing method for extending battery life. The efficiency of utilizing the contained redox species (RS) in the redox electrolyte can benefit from increasing the specific surface area of battery electrodes from the electrode side of the electrode-electrolyte interface, but is not limited to that. Herein, a new strategy using nanocomposite electrolyte is proposed to enlarge the interface with the aid of nanoinclusions from the electrolyte side. To do this, graphene oxide (GO) sheets are first dispersed in the electrolyte solution of tungstosilicic salt/lithium sulfate/poly(vinyl alcohol) (SiWLi/Li 2 SO 4 /PVA), and then the sheets are bridged to electrode, after casting and evaporating the solution on the electrode surface. By applying in situ conductive atomic force microscopy and Raman spectra, it is confirmed that the GO sheets doped with RS of SiWLi/Li 2 SO 4 can be bridged and electrically reduced as an extended electrode-electrolyte interface. As a result, the RS-coated GO sheets bridged to LiTi 2 (PO 4 ) 3 //LiMn 2 O 4 battery electrodes are found to deliver extra energy capacity (∼30 mAh/g) with excellent electrochemical cycling stability, which successfully extends the battery life by over 50%.

Optimization of multifocal transcranial current stimulation for weighted cortical pattern targeting from realistic modeling of electric fields

PubMed Central

Ruffini, Giulio; Fox, Michael D.; Ripolles, Oscar; Miranda, Pedro Cavaleiro; Pascual-Leone, Alvaro

2014-01-01

Recently, multifocal transcranial current stimulation (tCS) devices using several relatively small electrodes have been used to achieve more focal stimulation of specific cortical targets. However, it is becoming increasingly recognized that many behavioral manifestations of neurological and psychiatric disease are not solely the result of abnormality in one isolated brain region but represent alterations in brain networks. In this paper we describe a method for optimizing the configuration of multifocal tCS for stimulation of brain networks, represented by spatially extended cortical targets. We show how, based on fMRI, PET, EEG or other data specifying a target map on the cortical surface for excitatory, inhibitory or neutral stimulation and a constraint of the maximal number of electrodes, a solution can be produced with the optimal currents and locations of the electrodes. The method described here relies on a fast calculation of multifocal tCS electric fields (including components normal and tangential to the cortical boundaries) using a five layer finite element model of a realistic head. Based on the hypothesis that the effects of current stimulation are to first order due to the interaction of electric fields with populations of elongated cortical neurons, it is argued that the optimization problem for tCS stimulation can be defined in terms of the component of the electric field normal to the cortical surface. Solutions are found using constrained least squares to optimize current intensities, while electrode number and their locations are selected using a genetic algorithm. For direct current tCS (tDCS) applications, we provide some examples of this technique using an available tCS system providing 8 small Ag/AgCl stimulation electrodes. We demonstrate the approach both for localized and spatially extended targets defined using rs-fcMRI and PET data, with clinical applications in stroke and depression. Finally, we extend these ideas to more general stimulation protocols, such as alternating current tCS (tACS). PMID:24345389

Electrodes for solid state gas sensor

DOEpatents

Mukundan, Rangachary [Santa Fe, NM; Brosha, Eric L [Los Alamos, NM; Garzon, Fernando [Santa Fe, NM

2007-05-08

A mixed potential electrochemical sensor for the detection of gases has a ceria-based electrolyte with a surface for exposing to the gases to be detected, and with a reference wire electrode and a sensing wire electrode extending through the surface and fixed within the electrolyte as the electrolyte is compressed and sintered. The electrochemical sensor is formed by placing a wire reference electrode and a wire sensing electrode in a die, where each electrode has a first compressed planar section and a second section depending from the first section with the second section of each electrode extending axially within the die. The die is filled with an oxide-electrolyte powder and the powder is pressed within the die with the wire electrodes. The wire-electrodes and the pressed oxide-electrolyte powder are sintered to form a ceramic electrolyte base with a reference wire electrode and a sensing wire electrode depending therefrom.

Electrodes for solid state gas sensor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mukundan, Rangachary; Brosha, Eric L; Garzon, Fernando

2007-05-08

A mixed potential electrochemical sensor for the detection of gases has a ceria-based electrolyte with a surface for exposing to the gases to be detected, and with a reference wire electrode and a sensing wire electrode extending through the surface and fixed within the electrolyte as the electrolyte is compressed and sintered. The electrochemical sensor is formed by placing a wire reference electrode and a wire sensing electrode in a die, where each electrode has a first compressed planar section and a second section depending from the first section with the second section of each electrode extending axially within themore » die. The die is filled with an oxide-electrolyte powder and the powder is pressed within the die with the wire electrodes. The wire-electrodes and the pressed oxide-electrolyte powder are sintered to form a ceramic electrolyte base with a reference wire electrode and a sensing wire electrode depending therefrom.« less

Electrodes for solid state gas sensor

DOEpatents

Mukundan, Rangachary; Brosha, Eric L.; Garzon, Fernando

2003-08-12

A mixed potential electrochemical sensor for the detection of gases has a ceria-based electrolyte with a surface for exposing to the gases to be detected, and with a reference wire electrode and a sensing wire electrode extending through the surface and fixed within the electrolyte as the electrolyte is compressed and sintered. The electrochemical sensor is formed by placing a wire reference electrode and a wire sensing electrode in a die, where each electrode has a first compressed planar section and a second section depending from the first section with the second section of each electrode extending axially within the die. The die is filled with an oxide-electrolyte powder and the powder is pressed within the die with the wire electrodes. The wire-electrodes and the pressed oxide-electrolyte powder are sintered to form a ceramic electrolyte base with a reference wire electrode and a sensing wire electrode depending therefrom.

Electromagnetic navigation technology for more precise electrode placement in the foramen ovale: a technical report.

PubMed

Van Buyten, Jean-Pierre; Smet, Iris; Van de Kelft, Erik

2009-07-01

Introduction. Interventional pain management techniques require precise positioning of needles or electrodes, therefore fluoroscopic control is mandatory. This imaging technique does however not visualize soft tissues such as blood vessels. Moreover, patient and physician are exposed to a considerable dose of radiation. Computed tomography (CT)-scans give a better view of soft tissues, but there use requires presence of a radiologist and has proven to be laborious and time consuming. Objectives. This study is to develop a technique using electromagnetic (EM) navigation as a guidance technique for interventional pain management, using CT and/or magnetic resonance (MRI) images uploaded on the navigation station. Methods. One of the best documented interventional procedures for the management of trigeminal neuralgia is percutaneous radiofrequency treatment of the Gasserian ganglion. EM navigation software for intracranial applications already exists. We developed a technique using a stylet with two magnetic coils suitable for EM navigation. The procedure is followed in real time on a computer screen where the patient's multislice CT-scan images and three-dimensional reconstruction of his face are uploaded. Virtual landmarks on the screen are matched with those on the patient's face, calculating the precision of the needle placement. Discussion. The experience with EM navigation acquired with the radiofrequency technique can be transferred to other interventional pain management techniques, for instance, for the placement of a neuromodulation electrode close to the Gasserian ganglion. Currently, research is ongoing to extend the software of the navigation station for spinal application, and to adapt neurostimulation hardware to the EM navigation technology. This technology will allow neuromodulation techniques to be performed without x-ray exposure for the patient and the physician, and this with the precision of CT/MR imaging guidance. © 2009 International Neuromodulation Society.

Fabrication and characterization of spiral interdigitated electrodes based biosensor for salivary glucose detection

NASA Astrophysics Data System (ADS)

Adelyn, P. Y. P.; Hashim, U.; Arshad, M. K. Md; Voon, C. H.; Liu, Wei-Wen; Kahar, S. M.; Huda, A. R. N.; Lee, H. Cheun

2017-03-01

This work introduces the non-invasive glucose monitoring technique by using the Complementary Metal Oxide Semiconductor (CMOS) technologically fabricated spiral Interdigitated Electrodes (IDE) based biosensor. Scanning Electron Microscopy (SEM) image explores the morphology of spiral IDE while Energy Dispersive X-Ray (EDX) determines the elements induced in spiral IDE. Oral saliva of two patients are collected and tested on the spiral IDE sensor with electrical characterization as glucose detection results. However, both patients exhibit their glucose level characteristics inconsistently. Therefore, this work could be extended and enhanced by adding Glutaraldehyde in between 3-Aminoproply)triethoxysilane (APTES) modified and glucose oxidase (GOD) enzyme immobilized layer with FTIR validation for bonding attachment.

Transient analysis of intercalation electrodes for parameter estimation

NASA Astrophysics Data System (ADS)

Devan, Sheba

An essential part of integrating batteries as power sources in any application, be it a large scale automotive application or a small scale portable application, is an efficient Battery Management System (BMS). The combination of a battery with the microprocessor based BMS (called "smart battery") helps prolong the life of the battery by operating in the optimal regime and provides accurate information regarding the battery to the end user. The main purposes of BMS are cell protection, monitoring and control, and communication between different components. These purposes are fulfilled by tracking the change in the parameters of the intercalation electrodes in the batteries. Consequently, the functions of the BMS should be prompt, which requires the methodology of extracting the parameters to be efficient in time. The traditional transient techniques applied so far may not be suitable due to reasons such as the inability to apply these techniques when the battery is under operation, long experimental time, etc. The primary aim of this research work is to design a fast, accurate and reliable technique that can be used to extract parameter values of the intercalation electrodes. A methodology based on analysis of the short time response to a sinusoidal input perturbation, in the time domain is demonstrated using a porous electrode model for an intercalation electrode. It is shown that the parameters associated with the interfacial processes occurring in the electrode can be determined rapidly, within a few milliseconds, by measuring the response in the transient region. The short time analysis in the time domain is then extended to a single particle model that involves bulk diffusion in the solid phase in addition to interfacial processes. A systematic procedure for sequential parameter estimation using sensitivity analysis is described. Further, the short time response and the input perturbation are transformed into the frequency domain using Fast Fourier Transform (FFT) to generate impedance spectra to derive immediate qualitative information regarding the nature of the system. The short time analysis technique gives the ability to perform both time domain and frequency domain analysis using data measured within short durations.

Fatigue Microcrack Behavior under the Influence of Surface Residual Stresses.

DTIC Science & Technology

1982-11-01

Stress Surface Crack Opening Displacement Technique * Brine Environment Stress Intensity Weld Microstructure W. *O ABSTRACT (Continue on reverse aide If...discussed. The results of preliminary optical metallography of the microstructural development in three types of welding processes for one inch thick...of Gas-Metal Arc Weld (GMA) 35 14 Macrograph of Extended Electrode Weld (EE) 35 15 Macrograpb of Deep Gas-Tungsten Arc Weld (DTIG) 36 16

Invisible Base Electrode Coordinates Approximation for Simultaneous SPECT and EEG Data Visualization

NASA Astrophysics Data System (ADS)

Kowalczyk, L.; Goszczynska, H.; Zalewska, E.; Bajera, A.; Krolicki, L.

2014-04-01

This work was performed as part of a larger research concerning the feasibility of improving the localization of epileptic foci, as compared to the standard SPECT examination, by applying the technique of EEG mapping. The presented study extends our previous work on the development of a method for superposition of SPECT images and EEG 3D maps when these two examinations are performed simultaneously. Due to the lack of anatomical data in SPECT images it is a much more difficult task than in the case of MRI/EEG study where electrodes are visible in morphological images. Using the appropriate dose of radioisotope we mark five base electrodes to make them visible in the SPECT image and then approximate the coordinates of the remaining electrodes using properties of the 10-20 electrode placement system and the proposed nine-ellipses model. This allows computing a sequence of 3D EEG maps spanning on all electrodes. It happens, however, that not all five base electrodes can be reliably identified in SPECT data. The aim of the current study was to develop a method for determining the coordinates of base electrode(s) missing in the SPECT image. The algorithm for coordinates approximation has been developed and was tested on data collected for three subjects with all visible electrodes. To increase the accuracy of the approximation we used head surface models. Freely available model from Oostenveld research based on data from SPM package and our own model based on data from our EEG/SPECT studies were used. For data collected in four cases with one electrode not visible we compared the invisible base electrode coordinates approximation for Oostenveld and our models. The results vary depending on the missing electrode placement, but application of the realistic head model significantly increases the accuracy of the approximation.

Plasma generators, reactor systems and related methods

DOEpatents

Kong, Peter C [Idaho Falls, ID; Pink, Robert J [Pocatello, ID; Lee, James E [Idaho Falls, ID

2007-06-19

A plasma generator, reactor and associated systems and methods are provided in accordance with the present invention. A plasma reactor may include multiple sections or modules which are removably coupled together to form a chamber. Associated with each section is an electrode set including three electrodes with each electrode being coupled to a single phase of a three-phase alternating current (AC) power supply. The electrodes are disposed about a longitudinal centerline of the chamber and are arranged to provide and extended arc and generate an extended body of plasma. The electrodes are displaceable relative to the longitudinal centerline of the chamber. A control system may be utilized so as to automatically displace the electrodes and define an electrode gap responsive to measure voltage or current levels of the associated power supply.

Ion manipulation method and device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Gordon A.; Baker, Erin M.; Smith, Richard D.

2017-11-07

An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electricmore » field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area.« less

Ion manipulation device

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Gordon A.; Baker, Erin M.; Smith, Richard D.

2018-05-08

An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electricmore » field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area.« less

Optimization of multifocal transcranial current stimulation for weighted cortical pattern targeting from realistic modeling of electric fields.

PubMed

Ruffini, Giulio; Fox, Michael D; Ripolles, Oscar; Miranda, Pedro Cavaleiro; Pascual-Leone, Alvaro

2014-04-01

Recently, multifocal transcranial current stimulation (tCS) devices using several relatively small electrodes have been used to achieve more focal stimulation of specific cortical targets. However, it is becoming increasingly recognized that many behavioral manifestations of neurological and psychiatric disease are not solely the result of abnormality in one isolated brain region but represent alterations in brain networks. In this paper we describe a method for optimizing the configuration of multifocal tCS for stimulation of brain networks, represented by spatially extended cortical targets. We show how, based on fMRI, PET, EEG or other data specifying a target map on the cortical surface for excitatory, inhibitory or neutral stimulation and a constraint on the maximal number of electrodes, a solution can be produced with the optimal currents and locations of the electrodes. The method described here relies on a fast calculation of multifocal tCS electric fields (including components normal and tangential to the cortical boundaries) using a five layer finite element model of a realistic head. Based on the hypothesis that the effects of current stimulation are to first order due to the interaction of electric fields with populations of elongated cortical neurons, it is argued that the optimization problem for tCS stimulation can be defined in terms of the component of the electric field normal to the cortical surface. Solutions are found using constrained least squares to optimize current intensities, while electrode number and their locations are selected using a genetic algorithm. For direct current tCS (tDCS) applications, we provide some examples of this technique using an available tCS system providing 8 small Ag/AgCl stimulation electrodes. We demonstrate the approach both for localized and spatially extended targets defined using rs-fcMRI and PET data, with clinical applications in stroke and depression. Finally, we extend these ideas to more general stimulation protocols, such as alternating current tCS (tACS). Copyright © 2013 Elsevier Inc. All rights reserved.

Soft Nanoimprint Lithography for Direct Printing of Crystalline Metal Oxide Nanostructures

NASA Astrophysics Data System (ADS)

Kothari, Rohit; Beaulieu, Michael; Watkins, James

2015-03-01

We demonstrate a solution-based soft nanoimprint lithography technique to directly print dimensionally-stable crystalline metal oxide nanostructures. A patterned PDMS stamp is used in combination with a UV/thermal cure step to imprint a resist containing high concentrations of crystalline nanoparticles in an inorganic/organic binder phase. The as-imprinted nanostructures are highly crystalline and therefore undergo little shrinkage (less than 5% in some cases) upon thermal annealing. High aspect ratio nanostructures and sub-100 nm features are easily realized. Residual layer free direct imprinting (no etching) was achieved by choosing the resist with the appropriate surface energy to ensure dewetting at stamp-substrate interface. The technique was further extended to stack the nanostructures by deploying a layer-by-layer imprint strategy. The method is scalable and can produce large area device quality nanostructures in a rapid fashion at a low cost. CeO2, ITO and TiO2 nanopatterns are illustrated for their potential use in fuel cell electrodes, solar cell electrodes and photonic devices, respectively.

Cellulose Derived Graphenic Fibers for Capacitive Desalination of Brackish Water.

PubMed

Pugazhenthiran, Nalenthiran; Sen Gupta, Soujit; Prabhath, Anupama; Manikandan, Muthu; Swathy, Jakka Ravindran; Raman, V Kalyan; Pradeep, Thalappil

2015-09-16

We describe a simple and inexpensive cellulose-derived and layer-by-layer stacked carbon fiber network electrode for capacitive deionization (CDI) of brackish water. The microstructure and chemical composition were characterized using spectroscopic and microscopic techniques; electrochemical/electrical performance was evaluated by cyclic voltammetry and 4-probe electrical conductivity and surface area by Brunauer-Emmett-Teller analysis, respectively. The desalination performance was investigated using a laboratory batch model CDI unit, under fixed applied voltage and varying salt concentrations. Electro-adsorption of NaCl on the graphite reinforced-cellulose (GrC) electrode reached equilibrium quickly (within 90 min) and the adsorbed salts were released swiftly (in 40 min) back into the solution, during reversal of applied potential. X-ray photoelectron spectroscopic studies clearly illustrate that sodium and chloride ions were physisorbed on the negative and positive electrodes, respectively during electro-adsorption. This GrC electrode showed an electro-adsorption capacity of 13.1 mg/g of the electrode at a cell potential of 1.2 V, with excellent recyclability and complete regeneration. The electrode has a high tendency for removal of specific anions, such as fluoride, nitrate, chloride, and sulfate from water in the following order: Cl->NO3->F->SO4(2-). GrC electrodes also showed resistance to biofouling with negligible biofilm formation even after 5 days of incubation in Pseudomonas putida bacterial culture. Our unique cost-effective methodology of layer-by-layer stacking of carbon nanofibers and concurrent reinforcement using graphite provides uniform conductivity throughout the electrode with fast electro-adsorption, rapid desorption, and extended reuse, making the electrode affordable for capacitive desalination of brackish water.

Three dimensional microelectrode system for dielectrophoresis

DOEpatents

Dehlinger, Dietrich A; Rose, Klint A; Shusteff, Maxim; Bailey, Christopher G; Mariella, Jr., Raymond P

2014-12-02

A dielectrophoresis method for separating particles from a sample, including a dielectrophoresis channel, the dielectrophoresis channel having a central axis, a bottom, a top, a first side, and a second side; a first mesa projecting into the dielectrophoresis channel from the bottom and extending from the first side across the dielectrophoresis channel to the second side, the first mesa extending at an angle to the central axis of the dielectrophoresis channel; a second mesa projecting into the dielectrophoresis channel from the bottom and extending from the first side across the dielectrophoresis channel to the second side, the second mesa parallel to said first mesa; a space between at least one of the first electrode and the second side or the second electrode and the second side; and a gap between the first electrode and the second electrode, and pumping a recovery fluid through said gap between said first electrode and into said space between at least one of said first mesa and said second side or said second mesa and said second side.

Vacuum chamber for ion manipulation device

DOEpatents

Chen, Tsung-Chi; Tang, Keqi; Ibrahim, Yehia M; Smith, Richard D; Anderson, Gordon A; Baker, Erin M

2014-12-09

An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electric field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area. A predetermined number of pairs of surfaces are disposed in one or more chambers, forming a multiple-layer ion mobility cyclotron device.

Rapid prototyping of all-solution-processed multi-lengthscale electrodes using polymer-induced thin film wrinkling

PubMed Central

Gabardo, Christine M.; Adams-McGavin, Robert C.; Fung, Barnabas C.; Mahoney, Eric J.; Fang, Qiyin; Soleymani, Leyla

2017-01-01

Three-dimensional electrodes that are controllable over multiple lengthscales are very important for use in bioanalytical systems that integrate solid-phase devices with solution-phase samples. Here we present a fabrication method based on all-solution-processing and thin film wrinkling using smart polymers that is ideal for rapid prototyping of tunable three-dimensional electrodes and is extendable to large volume manufacturing. Although all-solution-processing is an attractive alternative to vapor-based techniques for low-cost manufacturing of electrodes, it often results in films suffering from low conductivity and poor substrate adhesion. These limitations are addressed here by using a smart polymer to create a conformal layer of overlapping wrinkles on the substrate to shorten the current path and embed the conductor onto the polymer layer. The structural evolution of these wrinkled electrodes, deposited by electroless deposition onto a nanoparticle seed layer, is studied at varying deposition times to understand its effects on structural parameters such as porosity, wrinkle wavelength and height. Furthermore, the effect of structural parameters on functional properties such as electro-active surface area and surface-enhanced Raman scattering is investigated. It is found that wrinkling of electroless-deposited thin films can be used to reduce sheet resistance, increase surface area, and enhance the surface-enhanced Raman scattering signal. PMID:28211898

Rapid prototyping of all-solution-processed multi-lengthscale electrodes using polymer-induced thin film wrinkling

NASA Astrophysics Data System (ADS)

Gabardo, Christine M.; Adams-McGavin, Robert C.; Fung, Barnabas C.; Mahoney, Eric J.; Fang, Qiyin; Soleymani, Leyla

2017-02-01

Three-dimensional electrodes that are controllable over multiple lengthscales are very important for use in bioanalytical systems that integrate solid-phase devices with solution-phase samples. Here we present a fabrication method based on all-solution-processing and thin film wrinkling using smart polymers that is ideal for rapid prototyping of tunable three-dimensional electrodes and is extendable to large volume manufacturing. Although all-solution-processing is an attractive alternative to vapor-based techniques for low-cost manufacturing of electrodes, it often results in films suffering from low conductivity and poor substrate adhesion. These limitations are addressed here by using a smart polymer to create a conformal layer of overlapping wrinkles on the substrate to shorten the current path and embed the conductor onto the polymer layer. The structural evolution of these wrinkled electrodes, deposited by electroless deposition onto a nanoparticle seed layer, is studied at varying deposition times to understand its effects on structural parameters such as porosity, wrinkle wavelength and height. Furthermore, the effect of structural parameters on functional properties such as electro-active surface area and surface-enhanced Raman scattering is investigated. It is found that wrinkling of electroless-deposited thin films can be used to reduce sheet resistance, increase surface area, and enhance the surface-enhanced Raman scattering signal.

Reborn quadrant anode image sensor

NASA Astrophysics Data System (ADS)

Prokazov, Yury; Turbin, Evgeny; Vitali, Marco; Herzog, Andreas; Michaelis, Bernd; Zuschratter, Werner; Kemnitz, Klaus

2009-06-01

We describe a position sensitive photon counting microchannel plate based detector with an improved quadrant anode (QA) readout system. The technique relies on a combination of the four planar elements pattern and an additional fifth electrode. The charge cloud induced by single particle detection is split between the electrodes. The measured charge values uniquely define the position of the initial event. QA has been first published in 1976 by Lampton and Malina. This anode configuration was undeservedly forgotten and its potential has been hardly underestimated. The presented approach extends the operating spatial range to the whole sensitive area of the microchannel plate surface and demonstrates good linearity over the field of view. Therefore, the novel image sensor results in spatial resolution better then 50 μm and count rates up to one million events per second.

Ion manipulation device with electrical breakdown protection

DOEpatents

Chen, Tsung-Chi; Tang, Keqi; Ibrahim, Yehia M; Smith, Richard D; Anderson, Gordon A; Baker, Erin M

2014-12-02

An ion manipulation method and device is disclosed. The device includes a pair of substantially parallel surfaces. An array of inner electrodes is contained within, and extends substantially along the length of, each parallel surface. The device includes a first outer array of electrodes and a second outer array of electrodes. Each outer array of electrodes is positioned on either side of the inner electrodes, and is contained within and extends substantially along the length of each parallel surface. A DC voltage is applied to the first and second outer array of electrodes. A RF voltage, with a superimposed electric field, is applied to the inner electrodes by applying the DC voltages to each electrode. Ions either move between the parallel surfaces within an ion confinement area or along paths in the direction of the electric field, or can be trapped in the ion confinement area. The surfaces are housed in a chamber, and at least one electrically insulative shield is coupled to an inner surface of the chamber for increasing a mean-free-path between two adjacent electrodes in the chamber.

Charge Injection Capacity of TiN Electrodes for an Extended Voltage Range

PubMed Central

Patan, Mustafa; Shah, Tosha; Sahin, Mesut

2011-01-01

Many applications of neural stimulation demand a high current density from the electrodes used for stimulus delivery. New materials have been searched that can provide such large current and charge densities where the traditional noble metal and capacitor electrodes are inadequate. Titanium nitride, which has been used in cardiac pacemaker leads for many years, is one of these materials recently considered for neural stimulation. In this short report, we investigated the charge injection capacity of TiN electrodes for an extended range of cathodic voltages. The injected charge increased first slowly as a function of the electrode voltage, and then at a faster rate beyond −1.6 V. The maximum charge was 4.45 mC/cm2 (n=6) for a cathodic voltage peak of −3.0 V and a bias voltage of −0.8 V. There was no evidence of bubble generation under microscopic observation. The unrecoverable charges remained under 7% of the total injected charge for the largest cathodic voltage tested. These large values of charge injection capacity and relatively small unrecoverable charges warrant further investigation of the charge injection mechanism in TiN interfaces at this extended range of electrode voltages. PMID:17946870

High Density Polymer-Based Integrated Electgrode Array

DOEpatents

Maghribi, Mariam N.; Krulevitch, Peter A.; Davidson, James Courtney; Hamilton, Julie K.

2006-04-25

A high density polymer-based integrated electrode apparatus that comprises a central electrode body and a multiplicity of arms extending from the electrode body. The central electrode body and the multiplicity of arms are comprised of a silicone material with metal features in said silicone material that comprise electronic circuits.

Chemical Modification of Boron-Doped Diamond Electrodes for Applications to Biosensors and Biosensing.

PubMed

Svítková, Jana; Ignat, Teodora; Švorc, Ľubomír; Labuda, Ján; Barek, Jiří

2016-05-03

Boron-doped diamond (BDD) is a prospective electrode material that possesses many exceptional properties including wide potential window, low noise, low and stable background current, chemical and mechanical stability, good biocompatibility, and last but not least exceptional resistance to passivation. These characteristics extend its usability in various areas of electrochemistry as evidenced by increasing number of published articles over the past two decades. The idea of chemically modifying BDD electrodes with molecular species attached to the surface for the purpose of creating a rational design has found promising applications in the past few years. BDD electrodes have appeared to be excellent substrate materials for various chemical modifications and subsequent application to biosensors and biosensing. Hence, this article presents modification strategies that have extended applications of BDD electrodes in electroanalytical chemistry. Different methods and steps of surface modification of this electrode material for biosensing and construction of biosensors are discussed.

Amorphous silicon carbide ultramicroelectrode arrays for neural stimulation and recording

NASA Astrophysics Data System (ADS)

Deku, Felix; Cohen, Yarden; Joshi-Imre, Alexandra; Kanneganti, Aswini; Gardner, Timothy J.; Cogan, Stuart F.

2018-02-01

Objective. Foreign body response to indwelling cortical microelectrodes limits the reliability of neural stimulation and recording, particularly for extended chronic applications in behaving animals. The extent to which this response compromises the chronic stability of neural devices depends on many factors including the materials used in the electrode construction, the size, and geometry of the indwelling structure. Here, we report on the development of microelectrode arrays (MEAs) based on amorphous silicon carbide (a-SiC). Approach. This technology utilizes a-SiC for its chronic stability and employs semiconductor manufacturing processes to create MEAs with small shank dimensions. The a-SiC films were deposited by plasma enhanced chemical vapor deposition and patterned by thin-film photolithographic techniques. To improve stimulation and recording capabilities with small contact areas, we investigated low impedance coatings on the electrode sites. The assembled devices were characterized in phosphate buffered saline for their electrochemical properties. Main results. MEAs utilizing a-SiC as both the primary structural element and encapsulation were fabricated successfully. These a-SiC MEAs had 16 penetrating shanks. Each shank has a cross-sectional area less than 60 µm2 and electrode sites with a geometric surface area varying from 20 to 200 µm2. Electrode coatings of TiN and SIROF reduced 1 kHz electrode impedance to less than 100 kΩ from ~2.8 MΩ for 100 µm2 Au electrode sites and increased the charge injection capacities to values greater than 3 mC cm‑2. Finally, we demonstrated functionality by recording neural activity from basal ganglia nucleus of Zebra Finches and motor cortex of rat. Significance. The a-SiC MEAs provide a significant advancement in the development of microelectrodes that over the years has relied on silicon platforms for device manufacture. These flexible a-SiC MEAs have the potential for decreased tissue damage and reduced foreign body response. The technique is promising and has potential for clinical translation and large scale manufacturing.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Electrical contact structures for solid oxide electrolyte fuel cell

DOEpatents

Isenberg, Arnold O.

1984-01-01

An improved electrical output connection means is provided for a high temperature solid oxide electrolyte type fuel cell generator. The electrical connection of the fuel cell electrodes to the electrical output bus, which is brought through the generator housing to be connected to an electrical load line maintains a highly uniform temperature distribution. The electrical connection means includes an electrode bus which is spaced parallel to the output bus with a plurality of symmetrically spaced transversely extending conductors extending between the electrode bus and the output bus, with thermal insulation means provided about the transverse conductors between the spaced apart buses. Single or plural stages of the insulated transversely extending conductors can be provided within the high temperatures regions of the fuel cell generator to provide highly homogeneous temperature distribution over the contacting surfaces.

Failure mechanisms of single-crystal silicon electrodes in lithium-ion batteries

PubMed Central

Shi, Feifei; Song, Zhichao; Ross, Philip N.; Somorjai, Gabor A.; Ritchie, Robert O.; Komvopoulos, Kyriakos

2016-01-01

Long-term durability is a major obstacle limiting the widespread use of lithium-ion batteries in heavy-duty applications and others demanding extended lifetime. As one of the root causes of the degradation of battery performance, the electrode failure mechanisms are still unknown. In this paper, we reveal the fundamental fracture mechanisms of single-crystal silicon electrodes over extended lithiation/delithiation cycles, using electrochemical testing, microstructure characterization, fracture mechanics and finite element analysis. Anisotropic lithium invasion causes crack initiation perpendicular to the electrode surface, followed by growth through the electrode thickness. The low fracture energy of the lithiated/unlithiated silicon interface provides a weak microstructural path for crack deflection, accounting for the crack patterns and delamination observed after repeated cycling. On the basis of this physical understanding, we demonstrate how electrolyte additives can heal electrode cracks and provide strategies to enhance the fracture resistance in future lithium-ion batteries from surface chemical, electrochemical and material science perspectives. PMID:27297565

Failure mechanisms of single-crystal silicon electrodes in lithium-ion batteries

DOE PAGES

Shi, Feifei; Song, Zhichao; Ross, Philip N.; ...

2016-06-14

Long-term durability is a major obstacle limiting the widespread use of lithium-ion batteries in heavy-duty applications and others demanding extended lifetime. As one of the root causes of the degradation of battery performance, the electrode failure mechanisms are still unknown. In this paper, we reveal the fundamental fracture mechanisms of single-crystal silicon electrodes over extended lithiation/delithiation cycles, using electrochemical testing, microstructure characterization, fracture mechanics and finite element analysis. Anisotropic lithium invasion causes crack initiation perpendicular to the electrode surface, followed by growth through the electrode thickness. The low fracture energy of the lithiated/unlithiated silicon interface provides a weak microstructural pathmore » for crack deflection, accounting for the crack patterns and delamination observed after repeated cycling. On the basis of this physical understanding, we demonstrate how electrolyte additives can heal electrode cracks and provide strategies to enhance the fracture resistance in future lithium-ion batteries from surface chemical, electrochemical and material science perspectives.« less

Failure mechanisms of single-crystal silicon electrodes in lithium-ion batteries

NASA Astrophysics Data System (ADS)

Shi, Feifei; Song, Zhichao; Ross, Philip N.; Somorjai, Gabor A.; Ritchie, Robert O.; Komvopoulos, Kyriakos

2016-06-01

Long-term durability is a major obstacle limiting the widespread use of lithium-ion batteries in heavy-duty applications and others demanding extended lifetime. As one of the root causes of the degradation of battery performance, the electrode failure mechanisms are still unknown. In this paper, we reveal the fundamental fracture mechanisms of single-crystal silicon electrodes over extended lithiation/delithiation cycles, using electrochemical testing, microstructure characterization, fracture mechanics and finite element analysis. Anisotropic lithium invasion causes crack initiation perpendicular to the electrode surface, followed by growth through the electrode thickness. The low fracture energy of the lithiated/unlithiated silicon interface provides a weak microstructural path for crack deflection, accounting for the crack patterns and delamination observed after repeated cycling. On the basis of this physical understanding, we demonstrate how electrolyte additives can heal electrode cracks and provide strategies to enhance the fracture resistance in future lithium-ion batteries from surface chemical, electrochemical and material science perspectives.

Mixed Ionic Liquid Improves Electrolyte Dynamics in Supercapacitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osti, Naresh C.; Gallegos, Alejandro; Dyatkin, Boris

Well-tailored mixtures of distinct ionic liquids can act as optimal electrolytes that extend the operating electrochemical window and improve charge storage density in supercapacitors. Here, we explore two room-temperature ionic liquids, 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (EmimTFSI) and 1-ethyl-3-methylimidazolium tetrafluoroborate (EmimBF 4). We study their electric double-layer behavior in the neat state and as binary mixtures on the external surfaces of onion-like carbon electrodes using quasielastic neutron scattering (QENS) and classical density functional theory techniques. Computational results reveal that a mixture with 4:1 EmimTFSI/EmimBF 4 volume ratio displaces the larger [TFSI –] anions with smaller [BF 4 –] ions, leading to an excessmore » adsorption of [Emim +] cations near the electrode surface. These findings are corroborated by the manifestation of nonuniform ion diffusivity change, complementing the description of structural modifications with changing composition, from QENS measurements. In conclusion, molecular-level understanding of ion packing near electrodes provides insight for design of ionic liquid formulations that enhance the performance of electrochemical energy storage devices.« less

Mixed Ionic Liquid Improves Electrolyte Dynamics in Supercapacitors

DOE PAGES

Osti, Naresh C.; Gallegos, Alejandro; Dyatkin, Boris; ...

2018-04-19

Well-tailored mixtures of distinct ionic liquids can act as optimal electrolytes that extend the operating electrochemical window and improve charge storage density in supercapacitors. Here, we explore two room-temperature ionic liquids, 1-ethyl-3-methylimidazolium bis(trifluoromethylsulfonyl)imide (EmimTFSI) and 1-ethyl-3-methylimidazolium tetrafluoroborate (EmimBF 4). We study their electric double-layer behavior in the neat state and as binary mixtures on the external surfaces of onion-like carbon electrodes using quasielastic neutron scattering (QENS) and classical density functional theory techniques. Computational results reveal that a mixture with 4:1 EmimTFSI/EmimBF 4 volume ratio displaces the larger [TFSI –] anions with smaller [BF 4 –] ions, leading to an excessmore » adsorption of [Emim +] cations near the electrode surface. These findings are corroborated by the manifestation of nonuniform ion diffusivity change, complementing the description of structural modifications with changing composition, from QENS measurements. In conclusion, molecular-level understanding of ion packing near electrodes provides insight for design of ionic liquid formulations that enhance the performance of electrochemical energy storage devices.« less

Electrode-shaping for the excitation and detection of permitted arbitrary modes in arbitrary geometries in piezoelectric resonators.

PubMed

Pulskamp, Jeffrey S; Bedair, Sarah S; Polcawich, Ronald G; Smith, Gabriel L; Martin, Joel; Power, Brian; Bhave, Sunil A

2012-05-01

This paper reports theoretical analysis and experimental results on a numerical electrode shaping design technique that permits the excitation of arbitrary modes in arbitrary geometries for piezoelectric resonators, for those modes permitted to exist by the nonzero piezoelectric coefficients and electrode configuration. The technique directly determines optimal electrode shapes by assessing the local suitability of excitation and detection electrode placement on two-port resonators without the need for iterative numerical techniques. The technique is demonstrated in 61 different electrode designs in lead zirconate titanate (PZT) thin film on silicon RF micro electro-mechanical system (MEMS) plate, beam, ring, and disc resonators for out-of-plane flexural and various contour modes up to 200 MHz. The average squared effective electromechanical coupling factor for the designs was 0.54%, approximately equivalent to the theoretical maximum value of 0.53% for a fully electroded length-extensional mode beam resonator comprised of the same composite. The average improvement in S(21) for the electrode-shaped designs was 14.6 dB with a maximum improvement of 44.3 dB. Through this piezoelectric electrodeshaping technique, 95% of the designs showed a reduction in insertion loss.

Cryogenic Cathode Cooling Techniques for Improved SABRE Extraction Ion Diode Li Beam Generation

NASA Astrophysics Data System (ADS)

Hanson, D. L.; Johnston, R. R.; Cuneo, M. E.; Menge, P. R.; Fowler, W. E.; Armijo, J.; Nielsen, D. S.; Petmecky, D.

1997-11-01

We are developing techniques for cryogenic cooling of the SABRE extraction ion diode cathode that, combined with source cleaning, should improve the purity and brightness of Li beams for ICF light ion fusion. By liquid helium (LHe) cathode cooling, we have been able to maintain A-K gap base pressures in the range of 5 - 7x10-8 Torr for about 45 minutes. These base pressures extend the monolayer formation time for the worst beam contaminants (H2 and water vapor) to 10 - 100 sec or longer, which should allow the accelerator to be fired without significant Li source recontamination. This technique is compatible with He glow discharge cleaning, laser cleaning, and in situ Li deposition. We are also developing techniques for Ti-gettering of H2 and for cryogenic cooling of cathode electrodes to delay cathode plasma expansion.

MHD generator with improved network coupling electrodes to a load

DOEpatents

Rosa, Richard J.

1977-01-01

An MHD generator has a plurality of segmented electrodes extending longitudinally of a duct, whereby progressively increasing high DC voltages are derived from a set of cathode electrodes and progressively increasing low DC voltages are derived from a set of anode electrodes. First and second load terminals are respectively connected to the cathode and anode electrodes by separate coupling networks, each of which includes a number of SCR's and a number of diode rectifiers.

Transportation and Accumulation of Redox Active Species at the Buried Interfaces of Plasticized Membrane Electrodes.

PubMed

Sohail, Manzar; De Marco, Roland; Jarolímová, Zdeňka; Pawlak, Marcin; Bakker, Eric; He, Ning; Latonen, Rose-Marie; Lindfors, Tom; Bobacka, Johan

2015-09-29

The transportation and accumulation of redox active species at the buried interface between glassy carbon electrodes and plasticized polymeric membranes have been studied using synchrotron radiation X-ray photoelectron spectroscopy (SR-XPS), near edge X-ray absorption fine structure (NEXAFS), in situ electrochemical Fourier transform infrared-attenuated total reflectance (FTIR-ATR) spectroscopy, cyclic voltammetry (CV), chronoamperometry (CA), and electrochemical impedance spectroscopy (EIS). Ferrocene tagged poly(vinyl chloride) [FcPVC], ferrocene (Fc), and its derivatives together with tetracyanoquinodimethane (TCNQ) doped plasticized polymeric membrane electrodes have been investigated, so as to extend the study of the mechanism of this reaction chemistry to different time scales (both small and large molecules with variable diffusion coefficients) using a range of complementary electrochemical and surface analysis techniques. This study also provides direct spectroscopic evidence for the transportation and electrochemical reactivity of redox active species, regardless of the size of the electrochemically reactive molecule, at the buried interface of the substrate electrode. With all redox dopants, when CA electrolysis was performed, redox active species were undetectable (<1 wt % of signature elements or below the detection limit of SR-XPS and NEXAFS) in the outermost surface layers of the membrane, while a high concentration of redox species was located at the electrode substrate as a consequence of the deposition of the reaction product (Fc(+)-anion complex) at the buried interface between the electrode and the membrane. This reaction chemistry for redox active species within plasticized polymeric membranes may be useful in the fashioning of multilayered polymeric devices (e.g., chemical sensors, organic electronic devices, protective laminates, etc.) based on an electrochemical tunable deposition of redox molecules at the buried substrate electrode beneath the membrane.

Extended foil capacitor with radially spoked electrodes

DOEpatents

Foster, James C.

1990-01-01

An extended foil capacitor has a conductive disk electrically connected in oncrushing contact to the extended foil. A conductive paste is placed through spaces between radial spokes on the disk to electrically and mechanically connect the extended foil to the disk.

Process for producing elements from a fused bath using a metal strap and ceramic electrode body nonconsumable electrode assembly

DOEpatents

Byrne, Stephen C.

1984-01-01

A nonconsumable electrode assembly suitable for use in the production of metal by electrolytic reduction of a metal compound dissolved in a molten salt, the assembly comprising a ceramic electrode body and a metal subassembly of a metal conductor rod and at least one metal strap affixed to an end of the rod with opposing portions extending radially outwardly from the rod axis and having the ends of the strap attached to the electrode body.

Method and apparatus for processing exhaust gas with corona discharge

DOEpatents

Barlow, Stephan E.; Orlando, Thomas M.; Tonkyn, Russell G.

1999-01-01

The present invention is placing a catalyst coating upon surfaces surrounding a volume containing corona discharge. In addition, the electrodes are coated with a robust dielectric material. Further, the electrodes are arranged so that at least a surface portion of each electrode extends into a flow path of the exhaust gas to be treated and there is only exhaust gas in the volume between each pair of electrodes.

In-electrode vs. on-electrode: ultrasensitive Faraday cage-type electrochemiluminescence immunoassay.

PubMed

Guo, Zhiyong; Sha, Yuhong; Hu, Yufang; Wang, Sui

2016-03-28

A new-concept of an "in-electrode" Faraday cage-type electrochemiluminescence immunoassay (ECLIA) method for the ultrasensitive detection of neurotensin (NT) was reported with capture antibody (Ab1)-nanoFe3O4@graphene (GO) and detector antibody (Ab2)&N-(4-aminobutyl)-N-ethylisoluminol (ABEI)@GO, which led to about 1000-fold improvement in sensitivity by extending the Helmholtz plane (OHP) of the proposed electrode assembly effectively.

Thin Film Electrodes with an Integral Current Collection Grid for Use with Solid Electrolytes

NASA Technical Reports Server (NTRS)

Ryan, M. A.; Kisor, A.; Williams, R. M.; Jeffries-Nakamura, B.; O'Connor, D.

1994-01-01

Thin film, high performance electrodes which can operate in high temperature environments are necessary for many devices which use a solid electrolyte. Electrodes of rhodium-tungsten alloy have been deposited on solid electrolyte using photolytic chemical vapor deposition (PCVD). A technique for depositing electrodes and current collection grids simultaneously has been developed using the prenucleation characteristics of PCVD. This technique makes it possible to fabricate electrodes which allow vapor transport through the thin (<1 (micro)m) portions of the electrode while integral thick grid lines improve the electronic conductivity of the electrode, thus improving overall performance.

Improved electrode paste provides reliable measurement of galvanic skin response

NASA Technical Reports Server (NTRS)

Day, J. L.

1966-01-01

High-conductivity electrode paste is used in obtaining accurate skin resistance or skin potential measurements. The paste is isotonic to perspiration, is nonirritating and nonsensitizing, and has an extended shelf life.

Electrode support for gas arc welding torch having coaxial vision

NASA Technical Reports Server (NTRS)

Richardson, Richard W. (Inventor)

1987-01-01

An improved electrode mounting structure for a gas tungsten arc welding torch having a coaxial imaging system. The electrode mounting structure includes a support having a central hub and a plurality of spokes which extend from the hub generally radially with respect to the axis of the torch into supporting engagement with the interior walls of the torch. The spaces between the spokes are optical passages for transmission of light to form the image. A tubular collet holder is threadedly engaged at its upper end to the hub and extends downwardly toward the open end of the torch. The collet holder has an inwardly tapering constriction near its lower end. An electrode-retaining, tubular collet is mounted within the collet holder and has a longitudinally split and tapered end seating against the tapered constriction. A spring seats against the upper end of the collet and forces the split end against the tapered constriction to wedge the split end radially inwardly to grip the electrode within the collet.

Narrow groove welding gas diffuser assembly and welding torch

DOEpatents

Rooney, Stephen J.

2001-01-01

A diffuser assembly is provided for narrow groove welding using an automatic gas tungsten arc welding torch. The diffuser assembly includes a manifold adapted for adjustable mounting on the welding torch which is received in a central opening in the manifold. Laterally extending manifold sections communicate with a shield gas inlet such that shield gas supplied to the inlet passes to gas passages of the manifold sections. First and second tapered diffusers are respectively connected to the manifold sections in fluid communication with the gas passages thereof. The diffusers extend downwardly along the torch electrode on opposite sides thereof so as to release shield gas along the length of the electrode and at the distal tip of the electrode. The diffusers are of a transverse width which is on the order of the thickness of the electrode so that the diffusers can, in use, be inserted into a narrow welding groove before and after the electrode in the direction of the weld operation.

Detection of Electrocardiogram by Electrodes with Fabrics Using Capacitive Coupling

NASA Astrophysics Data System (ADS)

Ueno, Akinori; Furusawa, Yoichi; Hoshino, Hiroshi; Ishiyama, Yoji

This article reports on a novel technique for detecting electrocardiogram (ECG) at a condition where thin cloth is interpolated between sensing electrodes and the skin to which the electrodes are attached. The technique is based upon capacitive coupling composed of the electrode, the cloth and the skin, so that the electrode can lead alternating electrocardiographic current through capacitance of the coupling. The technique is also founded on impedance transforming circuit that has extremely high input impedance around 1000GΩ and low output impedance, so as to match high output impedance of the electrode to low input impedance required by subsequent circuitry. A pilot ECG measuring device was manufactured using the technique and experiments showed (1) ECG recordings using the device with silk of 240μm thickness or with cotton of 564μm thickness were quite similar to ECGs recorded from the skin using conventional system, (2) stable ECGs were observed with the silk below 600μm thickness or with the cotton below 1128μm thickness, (3) effects of long-term measurement and perspiration on ECG waveform were negligible. These results prove feasibility of the proposed technique for detecting ECG by electrodes with fabrics.

MULTIPLE SPARK GAP SWITCH

DOEpatents

Schofield, A.E.

1958-07-22

A multiple spark gap switch of unique construction is described which will permit controlled, simultaneous discharge of several capacitors into a load. The switch construction includes a disc electrode with a plurality of protuberances of generally convex shape on one surface. A firing electrode is insulatingly supponted In each of the electrode protuberances and extends substantially to the apex thereof. Individual electrodes are disposed on an insulating plate parallel with the disc electrode to form a number of spark gaps with the protuberances. These electrodes are each connected to a separate charged capacitor and when a voltage ls applied simultaneously between the trigger electrodes and the dlsc electrode, each spark gap fires to connect its capacitor to the disc electrode and a subsequent load.

Method and apparatus for processing exhaust gas with corona discharge

DOEpatents

Barlow, S.E.; Orlando, T.M.; Tonkyn, R.G.

1999-06-22

The present invention is placing a catalyst coating upon surfaces surrounding a volume containing corona discharge. In addition, the electrodes are coated with a robust dielectric material. Further, the electrodes are arranged so that at least a surface portion of each electrode extends into a flow path of the exhaust gas to be treated and there is only exhaust gas in the volume between each pair of electrodes. 12 figs.

Techniques For Mass Production Of Tunneling Electrodes

NASA Technical Reports Server (NTRS)

Kenny, Thomas W.; Podosek, Judith A.; Reynolds, Joseph K.; Rockstad, Howard K.; Vote, Erika C.; Kaiser, William J.

1993-01-01

Techniques for mass production of tunneling electrodes developed from silicon-micromachining, lithographic patterning, and related microfabrication processes. Tunneling electrodes named because electrons travel between them by quantum-mechanical tunneling; tunneling electrodes integral parts of tunneling transducer/sensors, which act in conjunction with feedback circuitry to stabilize tunneling currents by maintaining electrode separations of order of 10 Angstrom. Essential parts of scanning tunneling microscopes and related instruments, and used as force and position transducers in novel microscopic accelerometers and infrared detectors.

Electronic drop sensing in microfluidic devices: automated operation of a nanoliter viscometer

PubMed Central

Srivastava, Nimisha; Burns, Mark A.

2007-01-01

We describe three droplet sensing techniques: a digital electrode, an analog electrode, and a thermal method. All three techniques use a single layer of metal lines that is easy to microfabricate and an electronic signal can be produced using low DC voltages. While the electrode methods utilize changes in electrical conductivity when the air/liquid interface of the droplet passes over a pair of electrodes, the thermal method is based on convective heat loss from a locally heated region. For the electrode method, the analog technique is able to detect 25 nL droplets while the digital technique is capable of detecting droplets as small as 100 pL. For thermal sensing, temperature profiles in the range of 36 °C and higher were used. Finally, we have used the digital electrode method and an array of electrodes located at preset distances to automate the operation of a previously described microfluidic viscometer. The viscometer is completely controlled by a laptop computer, and the total time for operation including setup, calibration, sample addition and viscosity calculation is approximately 4 minutes. PMID:16738725

Model parameter extraction of lateral propagating surface acoustic waves with coupling on SiO2/grating/LiNbO3 structure

NASA Astrophysics Data System (ADS)

Zhang, Benfeng; Han, Tao; Li, Xinyi; Huang, Yulin; Omori, Tatsuya; Hashimoto, Ken-ya

2018-07-01

This paper investigates how lateral propagation of Rayleigh and shear horizontal (SH) surface acoustic waves (SAWs) changes with rotation angle θ and SiO2 and electrode thicknesses, h SiO2 and h Cu, respectively. The extended thin plate model is used for purpose. First, the extraction method is presented for determining parameters appearing in the extended thin plate model. Then, the model parameters are expressed in polynomials in terms of h SiO2, h Cu, and θ. Finally, a piston mode structure without phase shifters is designed using the extracted parameters. The possible piston mode structures can be searched automatically by use of the polynomial expression. The resonance characteristics are analyzed by both the extended thin plate model and three-dimensional (3D) finite element method (FEM). Agreement between the results of both methods confirms validity and effectiveness of the parameter extraction process and the design technique.

Wick-and-pool electrodes for electrochemical cell

DOEpatents

Roche, Michael F.; Faist, Suzan M.; Eberhart, James G.; Ross, Laurids E.

1977-01-01

An electrode system includes a reservoir of liquid-metal reactant, and a wick extending from a submersed location within the reservoir into the molten electrolyte of an electrochemical cell structure. The wick is flooded with the liquid metal and thereby serves as one electrode within the cell. This electrode system has application in high-temperature batteries employing molten alkali metals or their alloys as active material within an electrode submersed within a molten salt electrolyte. It also can be used in electrochemical cells where the purification, separation or electrowinning of liquid metals is accomplished.

Wick-and-pool electrodes for electrochemical cell

DOEpatents

Roche, Michael F.; Faist, Suzan M.; Eberhart, James G.; Ross, Laurids E.

1980-01-01

An electrode system includes a reservoir of liquid-metal reactant, and a wick extending from a submersed location within the reservoir into the molten electrolyte of an electrochemical cell structure. The wick is flooded with the liquid metal and thereby serves as one electrode within the cell. This electrode system has application in high-temperature batteries employing molten alkali metals or their alloys as active material within an electrode submersed within a molten salt electrolyte. It also can be used in electrochemical cells where the purification, separation or electrowinning of liquid metals is accomplished.

Process for producing elements from a fused bath using a metal strap and ceramic electrode body nonconsumable electrode assembly

DOEpatents

Byrne, S.C.

1984-07-03

A nonconsumable electrode assembly is described suitable for use in the production of metal by electrolytic reduction of a metal compound dissolved in a molten salt, the assembly comprising a ceramic electrode body and a metal subassembly of a metal conductor rod and at least one metal strap affixed to an end of the rod with opposing portions extending radially outwardly from the rod axis and having the ends of the strap attached to the electrode body. 7 figs.

Carbon-Fiber Microelectrodes for In Vivo Applications

PubMed Central

Huffman, Megan L.; Venton, B. Jill

2009-01-01

Carbon-fiber microelectrodes (CFMEs) have been a useful tool for measuring rapid changes in neurotransmitters because of their small size, sensitivity, and good electrochemical properties. In this article, we highlight recent advances using CFMEs for measuring neurotransmitters in vivo. Dopamine has been a primary neurotransmitter of interest but direct electrochemical detection of other neurochemicals including nitric oxide and adenosine has also been investigated. Surface treatments have been studied to enhance electrode sensitivity, such as covalent modification or the addition of a layer of carbon nanotubes. Enzyme-modified microelectrodes that detect non-electroactive compounds further extend the usefulness of CFMEs beyond the traditional monoamines. CFMEs continue to be used in vivo to understand basic neurobiological mechanisms and the actions of pharmacological agents, including drugs of abuse. Advances in sensitivity and instrumentation now allow CFMEs to be used for measurements of natural dopamine release that occur during behavioral experiments. A new technique combining electrochemistry with electrophysiology at a single microelectrode facilitates a better understanding of neurotransmitter concentrations and their effects on cell firing. Future research in this field will likely concentrate on fabricating smaller electrodes and electrode arrays, as well as expanding the use of CFMEs in neuroscience beyond dopamine. PMID:19082168

Imaging mass spectrometry tackles interfacial challenges in electrochemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Xiao-Ying

Electrochemistry has played a significant role in many research fields. Owing to its sensitivity and selectivity, in situ electroanalysis has been widely used as a fast and economical means for achieving outstanding results. Although many spectroscopic techniques have been used in electrochemistry, the challenges to capture short-lived intermediate species as a result of electron transfer in the buried solid electrode and electrolyte solution interface remains a grand challenge. In situ imaging mass spectrometry (IMS) recently has been extended to capture transient species in electrochemistry. This review intends to summarize newest development of IMS and its applications in advancing fundamental electrochemistry.

Solid state oxygen sensor

DOEpatents

Garzon, Fernando H.; Brosha, Eric L.

1997-01-01

A potentiometric oxygen sensor is formed having a logarithmic response to a differential oxygen concentration while operating as a Nernstian-type sensor. Very thin films of mixed conducting oxide materials form electrode services while permitting diffusional oxygen access to the interface between the zirconia electrolyte and the electrode. Diffusion of oxygen through the mixed oxide is not rate-limiting. Metal electrodes are not used so that morphological changes in the electrode structure do not occur during extended operation at elevated temperatures.

Solid state oxygen sensor

DOEpatents

Garzon, F.H.; Brosha, E.L.

1997-12-09

A potentiometric oxygen sensor is formed having a logarithmic response to a differential oxygen concentration while operating as a Nernstian-type sensor. Very thin films of mixed conducting oxide materials form electrode services while permitting diffusional oxygen access to the interface between the zirconia electrolyte and the electrode. Diffusion of oxygen through the mixed oxide is not rate-limiting. Metal electrodes are not used so that morphological changes in the electrode structure do not occur during extended operation at elevated temperatures. 6 figs.

Condensation enhancement by means of electrohydrodynamic techniques

NASA Astrophysics Data System (ADS)

Butrymowicz, Dariusz; Karwacki, Jarosław; Trela, Marian

2014-12-01

Short state-of-the-art on the enhancement of condensation heat transfer techniques by means of condensate drainage is presented in this paper. The electrohydrodynamic (EHD) technique is suitable for dielectric media used in refrigeration, organic Rankine cycles and heat pump devices. The electric field is commonly generated in the case of horizontal tubes by means of a rod-type electrode or mesh electrodes. Authors proposed two geometries in the presented own experimental investigations. The first one was an electrode placed just beneath the tube bottom and the second one consisted of a horizontal finned tube with a double electrode placed beneath the tube. The experimental investigations of these two configurations for condensation of refrigerant R-123 have been accomplished. The obtained results confirmed that the application of the EHD technique for the investigated tube and electrode arrangement caused significant increase in heat transfer coefficient. The condensation enhancement depends both on the geometry of the electrode system and on the applied voltage.

Trace vanadium analysis by catalytic adsorptive stripping voltammetry using mercury-coated micro-wire and polystyrene-coated bismuth film electrodes

PubMed Central

Dansby-Sparks, Royce; Chambers, James Q.; Xue, Zi-Ling

2009-01-01

An electrochemical technique has been developed for ultra trace (ngL−1) vanadium (V) measurement. Catalytic adsorptive stripping voltammetry for V analysis was developed at mercury-coated gold micro-wire (MWE, 100 μm) electrodes in the presence of gallic acid (GA) and bromate ion. A potential of −0.275 V (vs Ag/AgCl) was used to accumulate the complex in acetate buffer (pH 5.0) at the electrode surface followed by a differential pulse voltammetric scan. Parameters affecting the electrochemical response, including pH, concentration of GA and bromate, deposition potential and time have been optimized. Linear response was obtained in the 0–1000 ngL−1 range (2 min deposition), with a detection limit of 0.88 ngL−1. The method was validated by comparison of results for an unknown solution of V by atomic absorption measurement. The protocol was evaluated in a real sample by measuring the amount of V in river water samples. Thick bismuth film electrodes with protective polystyrene films have also been made and evaluated as a mercury free alternative. However, ngL−1 level detection was only attainable with extended (10 min) deposition times. The proposed use of MWEs for the detection of V is sensitive enough for future use to test V concentration in biological fluids treated by the advanced oxidation process (AOP). PMID:19446059

Oriented nanotube electrodes for lithium ion batteries and supercapacitors

DOEpatents

Frank, Arthur J.; Zhu, Kai; Wang, Qing

2013-03-05

An electrode having an oriented array of multiple nanotubes is disclosed. Individual nanotubes have a lengthwise inner pore defined by interior tube walls which extends at least partially through the length of the nanotube. The nanotubes of the array may be oriented according to any identifiable pattern. Also disclosed is a device featuring an electrode and methods of fabrication.

Modification of Patterned Nanoporous Gold Thin Film Electrodes via Electro-annealing and Electrochemical Etching

NASA Astrophysics Data System (ADS)

Dorofeeva, Tatiana

Nanostructured materials have had a major impact on various fields, including medicine, catalysis, and energy storage, for the major part due to unique phenomena that arise at nanoscale. For this reason, there is a sustained need for new nanostructured materials, techniques to pattern them, and methods to precisely control their nanostructure. To that end, the primary focus of this dissertation is to demonstrate novel techniques to fabricate and tailor the morphology of a class of nanoporous metals, obtained by a process known as dealloying. In this process, while the less noble constituent of an alloy is chemically dissolved, surface-diffusion of the more noble constituent leads to self-assembly of a bicontinuous ligament network with characteristic porosity of ˜70% and ligament diameter of 10s of nanometers. As a model material produced by dealloying, this work employ nanoporous gold (np-Au), which has attracted significant attention of desirable features, such as high effective surface area, electrical conductivity, well-defined thiol-based surface modification strategies, microfabrication-compatibility, and biocompatibility. The most commonly method used to modify the morphology of np-Au is thermal treatment, where the enhanced diffusivity of the surface atoms leads to ligament (and consequently pore) coarsening. This method, however, is not conducive to modifying the morphology of thin films at specific locations on the film, which is necessary for creating devices that may need to contain different morphologies on a single device. In addition, coarsening attained by thermal treatment also leads to an undesirable reduction in effective surface area. In response to these challenges, this work demonstrates two different techniques that enables in situ modification of np-Au thin film electrodes obtained by sputter-deposition of a precursors silver-rich gold-silver alloy. The first method, referred to as electro-annealing, is achieved by injecting electrical current to np-Au electrodes, which leads coarsening due to a combination of Joule heating and other mechanisms. This method offers the capability to anneal different electrodes to varying degrees of coarsening in one step, by employing electrodes patterns with different cross-sectional areas - easily attained since np-Au can be patterned into arbitrary shapes via photolithography - to control electrode resistivity, thus current density and the amount of electro-annealing of an electrode. A surprising finding was that electro-annealing lead to electrode coarsening at much lower temperatures than conventional thermal treatment, which was attributed to augmented electron-surface atom interactions at high current densities that may in turn enhance surface atom diffusivity. A major advantage of electro-annealing is the ability to monitor the resistance change of the electrode (surrogate for electrode morphology) in real-time and vary the electro-annealing current accordingly to establish a closed-loop electro-annealing configuration. In nanostructured materials, the electrical resistance is often a function of nanostructure, thus changes in resistance can be directly linked to morphological changes of the electrode. Examination of the underlying mechanisms of nanostructure-dependent resistance change revealed that both ligament diameter and grain size play a role in dictating the observed electrode resistance change. The second method relies on electrochemical etching of ligaments to modify electrode morphology in order to maintain both a high effective surface area and large pores for unhindered transport of molecules to/from the ligament surfaces - an important consideration for many physico-chemical processes, such fuel cells, electrochemical sensors, and drug delivery platforms. The advantage of this method over purely chemical approach is that while an entire sample in exposed to the chemical reagent, the etching process does not occur until the necessary electrochemical potential is applied. Similar to the electro-annealing methods, electrical addressability allows for differentially modifying the morphology individual electrodes on a single substrate. The results of this study also revealed that electrochemical etching is a combination of coarsening and etching processes, where the optimization of etching parameters makes it possible precisely control the etching by favoring one process over the other. In summary, the two techniques, taken together in combination with np-Au's compatibility with microfabrication processes, can be extended to create multiple electrode arrays that display different morphologies for studying structure?property relationships and tuning catalysts/sensors for optimal performance.

Segmentally structured disk triboelectric nanogenerator

DOEpatents

Wang, Zhong Lin; Zhu, Guang; Lin, Long; Wang, Sihong; Chen, Jun

2016-11-01

A generator includes a disc shaped first unit, a disc shaped second unit and an axle. The first unit includes a substrate layer, a double complementary electrode layer and an electrification material layer. The electrode layer includes a first electrode member and a second electrode member. The first electrode member includes evenly spaced apart first electrode legs extending inwardly. The second electrode member is complementary in shape to the first electrode member. The legs of the first electrode member and the second electrode member are interleaved with each other and define a continuous gap therebetween. The electrification material includes a first material that is in a first position on the triboelectric series. The second unit defines elongated openings and corresponding elongated leg portions, and includes a second material that is at a second position on a triboelectric series, different than the first position.

Modeling of electrical capacitance tomography with the use of complete electrode model

NASA Astrophysics Data System (ADS)

Fang, Weifu

2016-10-01

We introduce the complete electrode model in the modeling of electrical capacitance tomography (ECT), which extends the model with the commonly used model for electrodes. We show that the solution of the complete electrode model approaches the solution of the corresponding common electrode model as the impedance effect on the electrodes vanishes. We also derive the nonlinear relation between capacitance and permitivity and the sensitivity maps with respect to both the permittivity and the impedance constants, and present a finite difference scheme in polar coordinates for the case of circular ECT sensors that retains the continuity of displacement current with piecewise-constant permitivities.

Organic light emitting diodes with structured electrodes

DOEpatents

Mao, Samuel S.; Liu, Gao; Johnson, Stephen G.

2012-12-04

A cathode that contain nanostructures that extend into the organic layer of an OLED has been described. The cathode can have an array of nanotubes or a layer of nanoclusters extending out from its surface. In another arrangement, the cathode is patterned and etched to form protruding nanostructures using a standard lithographic process. Various methods for fabricating these structures are provided, all of which are compatible with large-scale manufacturing. OLEDs made with these novel electrodes have greatly enhanced electron injection, have good environmental stability.

Large-scale fabrication of vertically aligned ZnO nanowire arrays

DOEpatents

Wang, Zhong Lin; Hu, Youfan; Zhang, Yan; Xu, Chen; Zhu, Guang

2014-09-09

A generator includes a substrate, a first electrode layer, a dense plurality of vertically-aligned piezoelectric elongated nanostructures, an insulating layer and a second electrode layer. The substrate has a top surface and the first electrode layer is disposed on the top surface of the substrate. The dense plurality of vertically-aligned piezoelectric elongated nanostructures extends from the first electrode layer. Each of the nanostructures has a top end. The insulating layer is disposed on the top ends of the nanostructures. The second electrode layer is disposed on the non-conductive layer and is spaced apart from the nanostructures.

Stretchable Platinum Network-Based Transparent Electrodes for Highly Sensitive Wearable Electronics.

PubMed

Wang, Yuting; Cheng, Jing; Xing, Yan; Shahid, Muhammad; Nishijima, Hiroki; Pan, Wei

2017-07-01

A platinum network-based transparent electrode has been fabricated by electrospinning. The unique nanobelt structured electrode demonstrates low sheet resistance (about 16 Ω sq -1 ) and high transparency of 80% and excellent flexibility. One of the most interesting demonstrations of this Pt nanobelt electrode is its excellent reversibly resilient characteristic. The electric conductivity of the flexible Pt electrode can recover to its initial value after 160% extending and this performance is repeatable and stable. The good linear relationship between the resistance and strain of the unique structured Pt electrode makes it possible to assemble a wearable high sensitive strain sensor. Present reported Pt nanobelt electrode also reveals potential applications in electrode for flexible fuel cells and highly transparent ultraviolet (UV) sensors. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Modeling of electrically actuated elastomer structures for electro-optical modulation

NASA Astrophysics Data System (ADS)

Kluge, Christian; Galler, Nicole; Ditlbacher, Harald; Gerken, Martina

2011-02-01

A transparent elastomer layer sandwiched between two metal electrodes deforms upon voltage application due to electrostatic forces. This structure can be used as tunable waveguide. We investigate structures of a polydimethylsiloxane (PDMS) layer with 1-30 μm thickness and 40 nm gold electrodes. For extended electrodes the effect size may be calculated analytically as a function of the Poisson ratio. A fully coupled finite-element method (FEM) is used for calculation of the position-dependent deformation in case of structured electrodes. Different geometries are compared concerning actuation effect size and homogeneity. Structuring of the top electrode results in high effect magnitude, but non-uniform deformation concentrated at the electrode edges. Structured bottom electrodes provide good compromise between effect size and homogeneity for electrode widths of 2.75 times the elastomer thickness.

Fundamental electrode kinetics

NASA Technical Reports Server (NTRS)

Elder, J. P.

1968-01-01

Report presents the fundamentals of electrode kinetics and the methods used in evaluating the characteristic parameters of rapid-charge transfer processes at electrode-electrolyte interfaces. The concept of electrode kinetics is outlined, followed by the principles underlying the experimental techniques for the investigation of electrode kinetics.

Evaluation of molecular dynamics simulation methods for ionic liquid electric double layers.

PubMed

Haskins, Justin B; Lawson, John W

2016-05-14

We investigate how systematically increasing the accuracy of various molecular dynamics modeling techniques influences the structure and capacitance of ionic liquid electric double layers (EDLs). The techniques probed concern long-range electrostatic interactions, electrode charging (constant charge versus constant potential conditions), and electrolyte polarizability. Our simulations are performed on a quasi-two-dimensional, or slab-like, model capacitor, which is composed of a polarizable ionic liquid electrolyte, [EMIM][BF4], interfaced between two graphite electrodes. To ensure an accurate representation of EDL differential capacitance, we derive new fluctuation formulas that resolve the differential capacitance as a function of electrode charge or electrode potential. The magnitude of differential capacitance shows sensitivity to different long-range electrostatic summation techniques, while the shape of differential capacitance is affected by charging technique and the polarizability of the electrolyte. For long-range summation techniques, errors in magnitude can be mitigated by employing two-dimensional or corrected three dimensional electrostatic summations, which led to electric fields that conform to those of a classical electrostatic parallel plate capacitor. With respect to charging, the changes in shape are a result of ions in the Stern layer (i.e., ions at the electrode surface) having a higher electrostatic affinity to constant potential electrodes than to constant charge electrodes. For electrolyte polarizability, shape changes originate from induced dipoles that soften the interaction of Stern layer ions with the electrode. The softening is traced to ion correlations vertical to the electrode surface that induce dipoles that oppose double layer formation. In general, our analysis indicates an accuracy dependent differential capacitance profile that transitions from the characteristic camel shape with coarser representations to a more diffuse profile with finer representations.

Effective recycling of manganese oxide cathodes for lithium based batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poyraz, Altug S.; Huang, Jianping; Cheng, Shaobo

Rechargeable lithium ion batteries (LIBs) occupy a prominent consumer presence due to their high cell potential and gravimetric energy density, there are also limited opportunities for electrode recycling. Currently used or proposed cathode recycling processes are multistep procedures which involve sequences of mechanical, thermal, and chemical leaching, where only the base material is recovered and significant processing is required to generate a recycled electrode structure. Another significant issue facing lithium based batteries is capacity fade due to structural degradation of the electroactive material upon extending cycling. Herein, inspired by heterogeneous catalyst thermal regeneration strategies, we present a new facile cathodemore » recycling process, where previously used cathodes are removed from a cell, heat treated, and then inserted into a new cell restoring the delivered capacity and cycle life. An environmentally sustainable manganese based material is employed, where binder-free self-supporting (BFSS) electrodes are prepared using a fibrous, high aspect ratio manganese oxide active material. After 200 discharge–charge cycles, the recycled BFSS electrodes display restored crystallinity and oxidation state of the manganese centers with the resulting electrochemistry (capacity and coulombic efficiency) reminiscent of freshly prepared BFSS cathodes. Of note, the BFSS electrode structure is robust with no degradation during the cell disassembly, electrode recovery, washing, and heat treatment steps; thus no post-processing is required for the recycled electrode. Furthermore, this work shows for the first time that a thermal regeneration method previously employed in catalyst systems can fully restore battery electrochemical performance, demonstrating a novel electrode recycling process which could open up new possibilities for energy storage devices with extended electrode lifecycles.« less

Effective recycling of manganese oxide cathodes for lithium based batteries

DOE PAGES

Poyraz, Altug S.; Huang, Jianping; Cheng, Shaobo; ...

2016-02-29

Rechargeable lithium ion batteries (LIBs) occupy a prominent consumer presence due to their high cell potential and gravimetric energy density, there are also limited opportunities for electrode recycling. Currently used or proposed cathode recycling processes are multistep procedures which involve sequences of mechanical, thermal, and chemical leaching, where only the base material is recovered and significant processing is required to generate a recycled electrode structure. Another significant issue facing lithium based batteries is capacity fade due to structural degradation of the electroactive material upon extending cycling. Herein, inspired by heterogeneous catalyst thermal regeneration strategies, we present a new facile cathodemore » recycling process, where previously used cathodes are removed from a cell, heat treated, and then inserted into a new cell restoring the delivered capacity and cycle life. An environmentally sustainable manganese based material is employed, where binder-free self-supporting (BFSS) electrodes are prepared using a fibrous, high aspect ratio manganese oxide active material. After 200 discharge–charge cycles, the recycled BFSS electrodes display restored crystallinity and oxidation state of the manganese centers with the resulting electrochemistry (capacity and coulombic efficiency) reminiscent of freshly prepared BFSS cathodes. Of note, the BFSS electrode structure is robust with no degradation during the cell disassembly, electrode recovery, washing, and heat treatment steps; thus no post-processing is required for the recycled electrode. Furthermore, this work shows for the first time that a thermal regeneration method previously employed in catalyst systems can fully restore battery electrochemical performance, demonstrating a novel electrode recycling process which could open up new possibilities for energy storage devices with extended electrode lifecycles.« less

Bending Properties of Nickel Electrodes for Nickel-Hydrogen Batteries

NASA Technical Reports Server (NTRS)

Lerch, Brad A.; Wilson, Richard M.; Keller, Dennis; Corner, Ralph

1995-01-01

Recent changes in manufacturing have resulted in nickel-hydrogen batteries that fail prematurely by electrical shorting, This failure is believed to be a result of a blistering problem in the nickel electrodes. In this study the bending properties of nickel electrodes are investigated in an attempt to correlate the bending properties of the electrode with its propensity to blister. Nickel electrodes from three different batches of material were tested in both the as-received and impregnated forms. The effects of specimen curvature and position within the electrode on the bending strength were studied, and within-electrode and batch-to-batch variations were addressed. Two color-imaging techniques were employed to differentiate between the phases within the electrodes. These techniques aided in distinguishing the relative amounts of nickel hyroxide surface loading on each electrode, thereby relating surface loading to bend strength. Bend strength was found to increase with the amount of surface loading.

Nanopillar based electrochemical biosensor for monitoring microfluidic based cell culture

NASA Astrophysics Data System (ADS)

Gangadharan, Rajan

In-vitro assays using cultured cells have been widely performed for studying many aspects of cell biology and cell physiology. These assays also form the basis of cell based sensing. Presently, analysis procedures on cell cultures are done using techniques that are not integrated with the cell culture system. This approach makes continuous and real-time in-vitro measurements difficult. It is well known that the availability of continuous online measurements for extended periods of time will help provide a better understanding and will give better insight into cell physiological events. With this motivation we developed a highly sensitive, selective and stable microfluidic electrochemical glucose biosensor to make continuous glucose measurements in cell culture media. The performance of the microfluidic biosensor was enhanced by adding 3D nanopillars to the electrode surfaces. The microfluidic glucose biosensor consisted of three electrodes---Enzyme electrode, Working electrode, and Counter electrode. All these electrodes were enhanced with nanopillars and were optimized in their respective own ways to obtain an effective and stable biosensing device in cell culture media. For example, the 'Enzyme electrode' was optimized for enzyme immobilization via either a polypyrrole-based or a self-assembled-monolayer-based immobilization method, and the 'Working electrode' was modified with Prussian Blue or electropolymerized Neutral Red to reduce the working potential and also the interference from other interacting electro-active species. The complete microfluidic biosensor was tested for its ability to monitor glucose concentration changes in cell culture media. The significance of this work is multifold. First, the developed device may find applications in continuous and real-time measurements of glucose concentrations in in-vitro cell cultures. Second, the development of a microfluidic biosensor will bring technical know-how toward constructing continuous glucose monitoring devices. Third, the methods used to develop 3D electrodes incorporated with nanopillars can be used for other applications such as neural probes, fuel cells, solar cells etc., and finally, the knowledge obtained from the immobilization of enzymes onto nanostructures sheds some new insight into nanomaterial/biomolecule interactions.

Application of the shaped electrode technique to a large area rectangular capacitively coupled plasma reactor to suppress standing wave nonuniformity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sansonnens, L.; Schmidt, H.; Howling, A.A.

The electromagnetic standing wave effect can become the main source of nonuniformity limiting the use of very high frequency in large area reactors exceeding 1 m{sup 2} required for industrial applications. Recently, it has been proposed and shown experimentally in a cylindrical reactor that a shaped electrode in place of the conventional flat electrode can be used in order to suppress the electromagnetic standing wave nonuniformity. In this study, we show experimental measurements demonstrating that the shaped electrode technique can also be applied in large area rectangular reactors. We also present results of electromagnetic screening by a conducting substrate whichmore » has important consequences for industrial application of the shaped electrode technique.« less

Collection of ions

DOEpatents

Orr, Christopher Henry; Luff, Craig Janson; Dockray, Thomas; Macarthur, Duncan Whittemore; Bounds, John Alan; Koster, James E.

2001-01-01

The apparatus and method provide an improved technique for detecting ions as the area from which ions are attracted to a detector is increased, consequently increasing the number of ions detected. This is achieved by providing the outer electrodes of the detector connected to the electrical potential, together with alternate intermediate electrodes. The other intermediate electrodes and preferably the housing are grounded. The technique renders such detection techniques more sensitive and gives them a lower threshold at which they can function.

Growth Stimulation of Biological Cells and Tissue by Electromagnetic Fields and Uses Thereof

NASA Technical Reports Server (NTRS)

Wolf, David A. (Inventor); Goodwin, Thomas J. (Inventor)

2002-01-01

The present invention provides systems for growing two or three dimensional mammalian cells within a culture medium facilitated by an electromagnetic field, and preferably, a time varying electromagnetic field. The cells, and culture medium are contained within a fixed or rotating culture vessel, and the electromagnetic field is emitted from at least one electrode. In one embodiment, the electrode is spaced from the vessel. The invention further provides methods to promote neural tissue regeneration by means of culturing the neural cells in the claimed system. In one embodiment, neuronal cells are grown within longitudinally extending tissue strands extending axially along and within electrodes comprising electrically conductive channels or guides through which a time varying electrical current is conducted, the conductive channels being positioned within a culture medium.

Growth stimulation of biological cells and tissue by electromagnetic fields and uses thereof

NASA Technical Reports Server (NTRS)

Wolf, David A. (Inventor); Goodwin, Thomas J. (Inventor)

2004-01-01

The present invention provides systems for growing two or three dimensional mammalian cells within a culture medium facilitated by an electromagnetic field, and preferably, a time varying electromagnetic field. The cells and culture medium are contained within a fixed or rotating culture vessel, and the electromagnetic field is emitted from at least one electrode. In one embodiment, the electrode is spaced from the vessel. The invention further provides methods to promote neural tissue regeneration by means of culturing the neural cells in the claimed system. In one embodiment, neuronal cells are grown within longitudinally extending tissue strands extending axially along and within electrodes comprising electrically conductive channels or guides through which a time varying electrical current is conducted, the conductive channels being positioned within a culture medium.

Design and Optimization of a Stationary Electrode in a Vertically-Driven MEMS Inertial Switch for Extending Contact Duration

PubMed Central

Xu, Qiu; Yang, Zhuo-Qing; Fu, Bo; Bao, Yan-Ping; Wu, Hao; Sun, Yun-Na; Zhao, Meng-Yuan; Li, Jian; Ding, Gui-Fu; Zhao, Xiao-Lin

2017-01-01

A novel micro-electro-mechanical systems (MEMS) inertial microswitch with a flexible contact-enhanced structure to extend the contact duration has been proposed in the present work. In order to investigate the stiffness k of the stationary electrodes, the stationary electrodes with different shapes, thickness h, width b, and length l were designed, analyzed, and simulated using ANSYS software. Both the analytical and the simulated results indicate that the stiffness k increases with thickness h and width b, while decreasing with an increase of length l, and it is related to the shape. The inertial micro-switches with different kinds of stationary electrodes were simulated using ANSYS software and fabricated using surface micromachining technology. The dynamic simulation indicates that the contact time will decrease with the increase of thickness h and width b, but increase with the length l, and it is related to the shape. As a result, the contact time decreases with the stiffness k of the stationary electrode. Furthermore, the simulated results reveal that the stiffness k changes more rapidly with h and l compared to b. However, overlarge dimension of the whole microswitch is contradicted with small footprint area expectation in the structure design. Therefore, it is unreasonable to extend the contact duration by increasing the length l excessively. Thus, the best and most convenient way to prolong the contact time is to reduce the thickness h of the stationary electrode while keeping the plane geometric structure of the inertial micro-switch unchanged. Finally, the fabricated micro-switches with different shapes of stationary electrodes have been evaluated by a standard dropping hammer system. The test maximum contact time under 288 g acceleration can reach 125 µs. It is shown that the test results are in accordance with the simulated results. The conclusions obtained in this work can provide guidance for the future design and fabrication of inertial microswitches. PMID:28272330

Design and Optimization of a Stationary Electrode in a Vertically-Driven MEMS Inertial Switch for Extending Contact Duration.

PubMed

Xu, Qiu; Yang, Zhuo-Qing; Fu, Bo; Bao, Yan-Ping; Wu, Hao; Sun, Yun-Na; Zhao, Meng-Yuan; Li, Jian; Ding, Gui-Fu; Zhao, Xiao-Lin

2017-03-07

A novel micro-electro-mechanical systems (MEMS) inertial microswitch with a flexible contact-enhanced structure to extend the contact duration has been proposed in the present work. In order to investigate the stiffness k of the stationary electrodes, the stationary electrodes with different shapes, thickness h , width b , and length l were designed, analyzed, and simulated using ANSYS software. Both the analytical and the simulated results indicate that the stiffness k increases with thickness h and width b , while decreasing with an increase of length l , and it is related to the shape. The inertial micro-switches with different kinds of stationary electrodes were simulated using ANSYS software and fabricated using surface micromachining technology. The dynamic simulation indicates that the contact time will decrease with the increase of thickness h and width b , but increase with the length l , and it is related to the shape. As a result, the contact time decreases with the stiffness k of the stationary electrode. Furthermore, the simulated results reveal that the stiffness k changes more rapidly with h and l compared to b . However, overlarge dimension of the whole microswitch is contradicted with small footprint area expectation in the structure design. Therefore, it is unreasonable to extend the contact duration by increasing the length l excessively. Thus, the best and most convenient way to prolong the contact time is to reduce the thickness h of the stationary electrode while keeping the plane geometric structure of the inertial micro-switch unchanged. Finally, the fabricated micro-switches with different shapes of stationary electrodes have been evaluated by a standard dropping hammer system. The test maximum contact time under 288 g acceleration can reach 125 µs. It is shown that the test results are in accordance with the simulated results. The conclusions obtained in this work can provide guidance for the future design and fabrication of inertial microswitches.

First-principles molecular transport calculation for the benzenedithiolate molecule

NASA Astrophysics Data System (ADS)

Rumetshofer, M.; Dorn, G.; Boeri, L.; Arrigoni, E.; von der Linden, W.

2017-10-01

A first-principles approach based on density functional theory and non-equilibrium Green’s functions is used to study the molecular transport system consisting of benzenedithiolate connected with monoatomic gold and platinum electrodes. Using symmetry arguments we explain why the conductance mechanism is different for gold and platinum electrodes. We present the charge stability diagram for the benzenedithiolate connected with monoatomic platinum electrodes including many-body effects in terms of an extended Hubbard Hamiltonian and discuss how the electrodes and the many-body effects influence the transport properties of the system.

Fabric-based active electrode design and fabrication for health monitoring clothing.

PubMed

Merritt, Carey R; Nagle, H Troy; Grant, Edward

2009-03-01

In this paper, two versions of fabric-based active electrodes are presented to provide a wearable solution for ECG monitoring clothing. The first version of active electrode involved direct attachment of surface-mountable components to a textile screen-printed circuit using polymer thick film techniques. The second version involved attaching a much smaller, thinner, and less obtrusive interposer containing the active electrode circuitry to a simplified textile circuit. These designs explored techniques for electronic textile interconnection, chip attachment to textiles, and packaging of circuits on textiles for durability. The results from ECG tests indicate that the performance of each active electrode is comparable to commercial Ag/AgCl electrodes. The interposer-based active electrodes survived a five-cycle washing test while maintaining good signal integrity.

Effects of cobalt precursor on pyrolyzed carbon-supported cobalt-polypyrrole as electrocatalyst toward oxygen reduction reaction

PubMed Central

2013-01-01

A series of non-precious metal electrocatalysts, namely pyrolyzed carbon-supported cobalt-polypyrrole, Co-PPy-TsOH/C, are synthesized with various cobalt precursors, including cobalt acetate, cobalt nitrate, cobalt oxalate, and cobalt chloride. The catalytic performance towards oxygen reduction reaction (ORR) is comparatively investigated with electrochemical techniques of cyclic voltammogram, rotating disk electrode and rotating ring-disk electrode. The results are analyzed and discussed employing physiochemical techniques of X-ray diffraction, transmission electron microscopy, Raman spectroscopy, X-ray photoelectron spectroscopy, inductively coupled plasma, elemental analysis, and extended X-ray absorption fine structure. It shows that the cobalt precursor plays an essential role on the synthesis process as well as microstructure and performance of the Co-PPy-TsOH/C catalysts towards ORR. Among the studied Co-PPy-TsOH/C catalysts, that prepared with cobalt acetate exhibits the best ORR performance. The crystallite/particle size of cobalt and its distribution as well as the graphitization degree of carbon in the catalyst greatly affects the catalytic performance of Co-PPy-TsOH/C towards ORR. Metallic cobalt is the main component in the active site in Co-PPy-TsOH/C for catalyzing ORR, but some other elements such as nitrogen are probably involved, too. PMID:24229351

Microfluidic process monitor for industrial solvent extraction system

DOEpatents

Gelis, Artem; Pereira, Candido; Nichols, Kevin Paul Flood

2016-01-12

The present invention provides a system for solvent extraction utilizing a first electrode with a raised area formed on its surface, which defines a portion of a microfluidic channel; a second electrode with a flat surface, defining another portion of the microfluidic channel that opposes the raised area of the first electrode; a reversibly deformable substrate disposed between the first electrode and second electrode, adapted to accommodate the raised area of the first electrode and having a portion that extends beyond the raised area of the first electrode, that portion defining the remaining portions of the microfluidic channel; and an electrolyte of at least two immiscible liquids that flows through the microfluidic channel. Also provided is a system for performing multiple solvent extractions utilizing several microfluidic chips or unit operations connected in series.

A 100 electrode intracortical array: structural variability.

PubMed

Campbell, P K; Jones, K E; Normann, R A

1990-01-01

A technique has been developed for fabricating three dimensional "hair brush" electrode arrays from monocrystalline silicon blocks. Arrays consist of a square pattern of 100 penetrating electrodes, with 400 microns interelectrode spacing. Each electrode is 1.5mm in length and tapers from about 100 microns at its base to a sharp point at the tip. The tips of each electrode are coated with platinum and the entire structure, with the exception of the tips, is insulated with polyimide. Electrical connection to selected electrodes is made by wire bonding polyimide insulated 25 microns diameter gold lead wires to bonding pads on the rear surface of the array. As the geometrical characteristics of the electrodes in such an aray will influence their electrical properties (such as impedance, capacitance, spreading resistance in an electrolyte, etc.) it is desirable that such an array have minimal variability in geometry from electrode to electrode. A study was performed to determine the geometrical variability resulting from our micromachining techniques. Measurements of the diameter of each of the 100 electrodes were made at various planes above the silicon substrate of the array. For the array that was measured, the standard deviation of the diameters was approximately 9% of the mean diameter near the tip, 8% near the middle, and 6% near the base. We describe fabrication techniques which should further reduce these variabilities.

NaTi2(PO4)3 as an Aqueous Anode: Degradation Mechanisms and Mitigation Techniques

NASA Astrophysics Data System (ADS)

Mohamed, Alexander I.

With the proliferation of renewable energy sources, there has been a growing interest in battery chemistries for grid scale energy storage. Aqueous sodium ion batteries are particularly interesting for large scale energy storage because of their low cost and high safety, however, they tend to show poor long term stability. NaTi2(PO4)3 (NTP) shows promise as an anode for these systems with excellent long term stability when cycled quickly. When cycled slowly, NaTi2(PO4) 3 shows rapid capacity fade. The reasons for this rate depend capacity fade is poorly understood and is the topic of this document. It has been found that the products of the hydrogen evolution reaction, H2(g) and OH-, are the two largest contributors to capacity fade. High electrolyte pH caused by generation of OH- promotes dissolution of NTP during extend cycling, this is exacerbated when the pH increase above 11. The single greatest cause of apparent capacity fade for this material is loss of electrochemical surface area due to hydrogen gas entrapment within the porous structure of the electrode. Capacity lost in this manner can be recovered through reinfiltration of the electrode. The detrimental effects of gas entrapment within the electrode can be partially mitigated through compositing of the electrode with activated carbon and enhancing the wettability of the pores through addition of a surfactant to the electrolyte.

Presacral abscess as a rare complication of sacral nerve stimulator implantation.

PubMed

Gumber, A; Ayyar, S; Varia, H; Pettit, S

2017-03-01

A 50-year-old man with intractable anal pain attributed to proctalgia fugax underwent insertion of a sacral nerve stimulator via the right S3 vertebral foramen for pain control with good symptomatic relief. Thirteen months later, he presented with signs of sepsis. Computed tomography (CT) and magnetic resonance imaging (MRI) showed a large presacral abscess. MRI demonstrated increased enhancement along the pathway of the stimulator electrode, indicating that the abscess was caused by infection introduced at the time of sacral nerve stimulator placement. The patient was treated with broad spectrum antibiotics, and the sacral nerve stimulator and electrode were removed. Attempts were made to drain the abscess transrectally using minimally invasive techniques but these were unsuccessful and CT guided transperineal drainage was then performed. Despite this, the presacral abscess progressed, developing enlarging gas locules and extending to the pelvic brim to involve the aortic bifurcation, causing hydronephrosis and radiological signs of impending sacral osteomyelitis. MRI showed communication between the rectum and abscess resulting from transrectal drainage. In view of the progressive presacral sepsis, a laparotomy was performed with drainage of the abscess, closure of the upper rectum and formation of a defunctioning end sigmoid colostomy. Following this, the presacral infection resolved. Presacral abscess formation secondary to an infected sacral nerve stimulator electrode has not been reported previously. Our experience suggests that in a similar situation, the optimal management is to perform laparotomy with drainage of the presacral abscess together with simultaneous removal of the sacral nerve stimulator and electrode.

Presacral abscess as a rare complication of sacral nerve stimulator implantation

PubMed Central

Gumber, A; Ayyar, S; Varia, H

2017-01-01

A 50-year-old man with intractable anal pain attributed to proctalgia fugax underwent insertion of a sacral nerve stimulator via the right S3 vertebral foramen for pain control with good symptomatic relief. Thirteen months later, he presented with signs of sepsis. Computed tomography (CT) and magnetic resonance imaging (MRI) showed a large presacral abscess. MRI demonstrated increased enhancement along the pathway of the stimulator electrode, indicating that the abscess was caused by infection introduced at the time of sacral nerve stimulator placement. The patient was treated with broad spectrum antibiotics, and the sacral nerve stimulator and electrode were removed. Attempts were made to drain the abscess transrectally using minimally invasive techniques but these were unsuccessful and CT guided transperineal drainage was then performed. Despite this, the presacral abscess progressed, developing enlarging gas locules and extending to the pelvic brim to involve the aortic bifurcation, causing hydronephrosis and radiological signs of impending sacral osteomyelitis. MRI showed communication between the rectum and abscess resulting from transrectal drainage. In view of the progressive presacral sepsis, a laparotomy was performed with drainage of the abscess, closure of the upper rectum and formation of a defunctioning end sigmoid colostomy. Following this, the presacral infection resolved. Presacral abscess formation secondary to an infected sacral nerve stimulator electrode has not been reported previously. Our experience suggests that in a similar situation, the optimal management is to perform laparotomy with drainage of the presacral abscess together with simultaneous removal of the sacral nerve stimulator and electrode. PMID:28071947

Progress in the biosensing techniques for trace-level heavy metals.

PubMed

Mehta, Jyotsana; Bhardwaj, Sanjeev K; Bhardwaj, Neha; Paul, A K; Kumar, Pawan; Kim, Ki-Hyun; Deep, Akash

2016-01-01

Diverse classes of sensors have been developed over the past few decades for on-site detections of heavy metals. Most of these sensor systems have exploited optical, electrochemical, piezoelectric, ion-selective (electrode), and electrochemical measurement techniques. As such, numerous efforts have been made to explore the role of biosensors in the detection of heavy metals based on well-known interactions between heavy metals and biomolecules (e.g. proteins, peptides, enzymes, antibodies, whole cells, and nucleic acids). In this review, we cover the recent progress made on different types of biosensors for the detection of heavy metals. Our major focus was examining the use of biomolecules for constructing these biosensors. The discussion is extended further to cover the biosensors' performance along with challenges and opportunities for practical utilization. Copyright © 2015 Elsevier Inc. All rights reserved.

Transmission line transformer for reliable and low-jitter triggering of a railgap switch

NASA Astrophysics Data System (ADS)

Verma, Rishi; Mishra, Ekansh; Sagar, Karuna; Meena, Manraj; Shyam, Anurag

2014-09-01

The performance of railgap switch critically relies upon multichannel breakdown between the extended electrodes (rails) in order to ensure distributed current transfer along electrode length and to minimize the switch inductance. The initiation of several simultaneous arc channels along the switch length depends on the gap triggering technique and on the rate at which the electric field changes within the gap. This paper presents design, construction, and output characteristics of a coaxial cable based three-stage transmission line transformer (TLT) that is capable of initiating multichannel breakdown in a high voltage, low inductance railgap switch. In each stage three identical lengths of URM67 coaxial cables have been used in parallel and they have been wounded in separate cassettes to enhance the isolation of the output of transformer from the input. The cascaded output impedance of TLT is ˜50 Ω. Along with multi-channel formation over the complete length of electrode rails, significant reduction in jitter (≤2 ns) and conduction delay (≤60 ns) has been observed by the realization of large amplitude (˜80 kV), high dV/dt (˜6 kV/ns) pulse produced by the indigenously developed TLT based trigger generator. The superior performance of TLT over conventional pulse transformer for railgap triggering application has been compared and demonstrated experimentally.

Energy density and rate limitations in structural composite supercapacitors

NASA Astrophysics Data System (ADS)

Snyder, J. F.; Gienger, E.; Wetzel, E. D.; Xu, K.

2012-06-01

The weight and volume of conventional energy storage technologies greatly limits their performance in mobile platforms. Traditional research efforts target improvements in energy density to reduce device size and mass. Enabling a device to perform additional functions, such as bearing mechanical load, is an alternative approach as long as the total mass efficiency exceeds that of the individual materials it replaces. Our research focuses on structural composites that function as batteries and supercapacitors. These multifunctional devices could be used to replace conventional structural components, such as vehicle frame elements, to provide significant system-level weight reductions and extend mission times. Our approach is to design structural properties directly into the electrolyte and electrode materials. Solid polymer electrolyte materials bind the system and transfer load to the fibers while conducting ions between the electrodes. Carbon fiber electrodes provide a route towards optimizing both energy storage and load-bearing capabilities, and may also obviate the need for a separate current collector. The components are being integrated using scalable, cost-effective composite processing techniques that are amenable to complex part shapes. Practical considerations of energy density and rate behavior are described here as they relate to materials used. Our results highlight the viability as well as the challenges of this multifunctional approach towards energy storage.

Transmission line transformer for reliable and low-jitter triggering of a railgap switch.

PubMed

Verma, Rishi; Mishra, Ekansh; Sagar, Karuna; Meena, Manraj; Shyam, Anurag

2014-09-01

The performance of railgap switch critically relies upon multichannel breakdown between the extended electrodes (rails) in order to ensure distributed current transfer along electrode length and to minimize the switch inductance. The initiation of several simultaneous arc channels along the switch length depends on the gap triggering technique and on the rate at which the electric field changes within the gap. This paper presents design, construction, and output characteristics of a coaxial cable based three-stage transmission line transformer (TLT) that is capable of initiating multichannel breakdown in a high voltage, low inductance railgap switch. In each stage three identical lengths of URM67 coaxial cables have been used in parallel and they have been wounded in separate cassettes to enhance the isolation of the output of transformer from the input. The cascaded output impedance of TLT is ~50 Ω. Along with multi-channel formation over the complete length of electrode rails, significant reduction in jitter (≤2 ns) and conduction delay (≤60 ns) has been observed by the realization of large amplitude (~80 kV), high dV/dt (~6 kV/ns) pulse produced by the indigenously developed TLT based trigger generator. The superior performance of TLT over conventional pulse transformer for railgap triggering application has been compared and demonstrated experimentally.

Long life 80Ah standard IPV NiH2 battery cell

NASA Technical Reports Server (NTRS)

Armantrout, Jon D.; Waller, J. S.

1995-01-01

A standard Nickel-Hydrogen (NiH2) Individual Pressure Vessel (IPV) battery cell is needed to meet future low cost, high performance mission requirements for NASA, military, and civil space programs. A common or standard cell design has evolved from the heritage of HST, Milstar, and other Air Force Mantech cell designs with substantial flight experience, while incorporating some of the historical COMSAT cell design features described in a previous NASA publication. Key features include slurry process nickel electrodes having high strength, long life and high yield (lower cost), and dual layer zircar separators for improved KOH retention, uniformality, and longer life. The cell design will have a zirconium oxide wall wick inside the pressure vessel to redistribute electrolyte and extend life. The slurry electrode will be 35 mils thick to take advantage of qualified cell mechanical configurations and proven assembly and activation techniques developed by Eagle Picher Industries (EPI) for the Hubble Space Telescope (HST) RNH-90-3 and 'Generic HST' RNH-90-5 cell designs with back-to-back nickel electrodes produced by the dry sinter process. The 80Ah common cell design can be scaled to meet capacity requirements from 60Ah to 100Ah. Producibility, commonality, and long life performance will be enhanced with the robust cell design described herein.

Technique eliminates high voltage arcing at electrode-insulator contact area

NASA Technical Reports Server (NTRS)

Mealy, G.

1967-01-01

Coating the electrode-insulator contact area with silver epoxy conductive paint and forcing the electrode and insulator tightly together into a permanent connection, eliminates electrical arcing in high-voltage electrodes supplying electrical power to vacuum facilities.

Hearing Preservation Outcomes With a Mid-Scala Electrode in Cochlear Implantation.

PubMed

Hunter, Jacob B; Gifford, René H; Wanna, George B; Labadie, Robert F; Bennett, Marc L; Haynes, David S; Rivas, Alejandro

2016-03-01

To evaluate hearing preservation (HP) outcomes in adult cochlear implant recipients with a mid-scala electrode. Tertiary academic center. Adult patients implanted with a mid-scala electrode between May 2013 and July 2015. Cochlear implantation. Age, sex, surgical approach, residual hearing changes post cochlear implantation, HP rates using different published classifications, and speech perception scores. Fifty ears for 47 patients (mean age, 58.2 yr; range, 23-86) were implanted with the electrode. Recognizing that not all patients were true HP candidates and/or underwent generally accepted HP surgical techniques, 39 ears had preoperative low-frequency hearing (audiometric threshold ≤ 85dB HL at 250Hz), 24 preserved acoustic hearing postoperatively (75.0%). Patients who had preserved acoustic hearing were implanted via round window (N = 18), extended round window (N = 4), or via cochleostomy (N = 2) approaches. Mean threshold elevation for low-frequency pure-tone average (125, 250, and 500  Hz) was 20.2  dB after surgery. 43.8% of patients had aidable low-frequency hearing at activation, 30.0% at 6-months postoperatively, and 30.8% 1-year postopera tively. Using a formula outlined by Skarzynski and colleagues, at 6-months postoperatively, 15.0% of patients had complete HP, whereas 40.0% had partial HP. At 1-year, these percentages decreased to 0% and 38.5%, respectively. Age, type of approach, and perioperative steroid use were not correlated with HP outcomes at activation and 6-months postoperatively (p > 0.05). The mid-scala electrode evaluated allows preservation of low-frequency hearing in patients undergoing cochlear implantation at rates and degrees of preservation close to other reports in the cochlear implant literature.

Subcutaneous electrode structure

NASA Technical Reports Server (NTRS)

Lund, G. F. (Inventor)

1980-01-01

A subcutaneous electrode structure suitable for a chronic implant and for taking a low noise electrocardiogram of an active animal, comprises a thin inflexible, smooth disc of stainless steel having a diameter as of 5 to 30 mm, which is sutured in place to the animal being monitored. The disc electrode includes a radially directed slot extending in from the periphery of the disc for approximately 1/3 of the diameter. Electrical connection is made to the disc by means of a flexible lead wire that extends longitudinally of the slot and is woven through apertures in the disc and held at the terminal end by means of a spot welded tab. Within the slot, an electrically insulative sleeve, such as silicone rubber, is placed over the wire. The wire with the sleeve mounted thereon is captured in the plane of the disc and within the slot by means of crimping tabs extending laterally of the slot and over the insulative wire. The marginal lip of the slot area is apertured and an electrically insulative potting material such as silicone rubber, is potted in place overlaying the wire slot region and through the apertures.

Preliminary investigation of a sealed, remotely activated silver-zinc battery

NASA Technical Reports Server (NTRS)

Wheat, C. G.

1977-01-01

Methods necessary to provide a remotely activated, silver zinc battery capable of an extended activated stand while in a sealed condition were investigated. These requirements were to be accomplished in a battery package demonstrating an energy density of at least 35 watt hours per pound. Several methods of gas suppression were considered in view of the primary nature of this unit and utilized the electroplated dendritic zinc electrode. Amalgamation of the electrode provided the greatest suppression of gas at the zinc electrode. The approach to extending the activated stand capability of the remotely activated battery was through evaluation of three basic methods of remote, multi-cell activation; 1) the electrolyte manifold, 2) the gas manifold and 3) the individual cell. All three methods of activation can be incorporated into units which will meet the minimum energy density requirement.

Recursive grid partitioning on a cortical surface model: an optimized technique for the localization of implanted subdural electrodes.

PubMed

Pieters, Thomas A; Conner, Christopher R; Tandon, Nitin

2013-05-01

Precise localization of subdural electrodes (SDEs) is essential for the interpretation of data from intracranial electrocorticography recordings. Blood and fluid accumulation underneath the craniotomy flap leads to a nonlinear deformation of the brain surface and of the SDE array on postoperative CT scans and adversely impacts the accurate localization of electrodes located underneath the craniotomy. Older methods that localize electrodes based on their identification on a postimplantation CT scan with coregistration to a preimplantation MR image can result in significant problems with accuracy of the electrode localization. The authors report 3 novel methods that rely on the creation of a set of 3D mesh models to depict the pial surface and a smoothed pial envelope. Two of these new methods are designed to localize electrodes, and they are compared with 6 methods currently in use to determine their relative accuracy and reliability. The first method involves manually localizing each electrode using digital photographs obtained at surgery. This is highly accurate, but requires time intensive, operator-dependent input. The second uses 4 electrodes localized manually in conjunction with an automated, recursive partitioning technique to localize the entire electrode array. The authors evaluated the accuracy of previously published methods by applying the methods to their data and comparing them against the photograph-based localization. Finally, the authors further enhanced the usability of these methods by using automatic parcellation techniques to assign anatomical labels to individual electrodes as well as by generating an inflated cortical surface model while still preserving electrode locations relative to the cortical anatomy. The recursive grid partitioning had the least error compared with older methods (672 electrodes, 6.4-mm maximum electrode error, 2.0-mm mean error, p < 10(-18)). The maximum errors derived using prior methods of localization ranged from 8.2 to 11.7 mm for an individual electrode, with mean errors ranging between 2.9 and 4.1 mm depending on the method used. The authors also noted a larger error in all methods that used CT scans alone to localize electrodes compared with those that used both postoperative CT and postoperative MRI. The large mean errors reported with these methods are liable to affect intermodal data comparisons (for example, with functional mapping techniques) and may impact surgical decision making. The authors have presented several aspects of using new techniques to visualize electrodes implanted for localizing epilepsy. The ability to use automated labeling schemas to denote which gyrus a particular electrode overlies is potentially of great utility in planning resections and in corroborating the results of extraoperative stimulation mapping. Dilation of the pial mesh model provides, for the first time, a sense of the cortical surface not sampled by the electrode, and the potential roles this "electrophysiologically hidden" cortex may play in both eloquent function and seizure onset.

Fabrication and performance of Li4Ti5O12/C Li-ion battery electrodes using combined double flame spray pyrolysis and pressure-based lamination technique

NASA Astrophysics Data System (ADS)

Gockeln, Michael; Pokhrel, Suman; Meierhofer, Florian; Glenneberg, Jens; Schowalter, Marco; Rosenauer, Andreas; Fritsching, Udo; Busse, Matthias; Mädler, Lutz; Kun, Robert

2018-01-01

Reduction of lithium-ion battery (LIB) production costs is inevitable to make the use of LIB technology more viable for applications such as electric vehicles or stationary storage. To meet the requirements in today's LIB cost efficiency, our current research focuses on an alternative electrode fabrication method, characterized by a combination of double flame spray pyrolysis and lamination technique (DFSP/lamination). In-situ carbon coated nano-Li4Ti5O12 (LTO/C) was synthesized using versatile DFSP. The as-prepared composite powder was then directly laminated onto a conductive substrate avoiding the use of any solvent or binder for electrode preparation. The influence of lamination pressures on the microstructure and electrochemical performance of the electrodes was also investigated. Enhancements in intrinsic electrical conductivity were found for higher lamination pressures. Capacity retention of highest pressurized DFSP/lamination-prepared electrode was 87.4% after 200 dis-/charge cycles at 1C (vs. Li). In addition, LTO/C material prepared from the double flame spray pyrolysis was also used for fabricating electrodes via doctor blading technique. Laminated electrodes obtained higher specific discharge capacities compared to calendered and non-calendered blade-casted electrodes due to superior microstructural properties. Such a fast and industrially compelling integrative DFSP/lamination tool could be a prosperous, next generation technology for low-cost LIB electrode fabrication.

Thin metal electrode for AMTEC

NASA Technical Reports Server (NTRS)

Williams, Roger M. (Inventor); Wheeler, Bob L. (Inventor); Jefferies-Nakamura, Barbara (Inventor); Lamb, James L. (Inventor); Bankston, C. Perry (Inventor); Cole, Terry (Inventor)

1989-01-01

An electrode having higher power output is formed of a thin, porous film (less than 1 micrometer) applied to a beta-alumina solid electrolyte (BASE). The electrode includes an open grid, current collector such as a series of thin, parallel, grid lines applied to the thin film and a plurality of cross-members such as loop of metal wire surrounding the BASE tube. The loops are electrically connected by a bus wire. The overall impedance of the electrode considering both the contributions from the bulk BASE and the porous electrode BASE interface is low, about 0.5 OHM/cm.sup.2 and power densities of over 0.3 watt/cm.sup.2 for extended periods.

Photoconductive switch package

DOEpatents

Ca[rasp, George J

2013-10-22

A photoconductive switch is formed of a substrate that has a central portion of SiC or other photoconductive material and an outer portion of cvd-diamond or other suitable material surrounding the central portion. Conducting electrodes are formed on opposed sides of the substrate, with the electrodes extending beyond the central portion and the edges of the electrodes lying over the outer portion. Thus any high electric fields produced at the edges of the electrodes lie outside of and do not affect the central portion, which is the active switching element. Light is transmitted through the outer portion to the central portion to actuate the switch.

Particle trap with dielectric barrier for use in gas insulated transmission lines

DOEpatents

Dale, Steinar J.

1982-01-01

A gas-insulated transmission line includes an outer sheath, an inner conductor within the outer sheath, insulating supports supporting the inner conductor within the outer sheath, and an insulating gas electrically insulating the inner conductor from the outer sheath. An apertured particle trapping electrode is disposed within the outer sheath, and the electrode has a pair of dielectric members secured at each longitudinal end thereof, with the dielectric members extending outwardly from the apertured electrode.

Electrokinetic In Situ Treatment of Metal-Contaminated Soil

NASA Technical Reports Server (NTRS)

Quinn, Jacqueline; Clausen, Christian A., III; Geiger, Cherie; Reinhart, Debra

2004-01-01

An electrokinetic technique has been developed as a means of in situ remediation of soils, sludges, and sediments that are contaminated with heavy metals. Examples of common metal contaminants that can be removed by this technique include cadmium, chromium, zinc, lead, mercury, and radionuclides. Some organic contaminants can also be removed by this technique. In the electrokinetic technique, a low-intensity direct current is applied between electrodes that have been implanted in the ground on each side of a contaminated soil mass. The electric current causes electro-osmosis and migration of ions, thereby moving aqueous-phase subsurface contaminants from one electrode to the other. The half reaction at the anode yields H+, thereby generating an acid front that travels from the anode toward the cathode. As this acid front passes through a given location, the local increase in acidity increases the solubility of cations that were previously adsorbed on soil particles. Ions are transported towards one electrode or the other which one depending on their respective electric charges. Upon arrival at the electrodes, the ionic contaminants can be allowed to become deposited on the electrodes or can be extracted to a recovery system. Surfactants and other reagents can be introduced at the electrodes to enhance rates of removal of contaminants. Placements of electrodes and concentrations and rates of pumping of reagents can be adjusted to maximize efficiency. The basic concept of electrokinetic treatment of soil is not new. What is new here are some of the details of application and the utilization of this technique as an alternative to other techniques (e.g., flushing or bioremediation) that are not suitable for treating soils of low hydraulic conductivity. Another novel aspect is the use of this technique as a less expensive alternative to excavation: The cost advantage over excavation is especially large in settings in which contaminated soil lies near and/or under industrial buildings and therefore excavation would be made even more expensive by the need to prevent damage to numerous underground pipes and cables.

Australian Red Dune Sand: A Potential Martian Regolith Analog

NASA Technical Reports Server (NTRS)

Kuhlman, K. R.; Marshall, J.; Evans, N. D.; Luttge, A.

2001-01-01

To demonstrate the potential scientific and technical merits of in situ microscopy on Mars, we analyzed a possible Martian regolith analog - an acolian red dune sand from the central Australian desert (near Mt. Olga). This sand was chosen for its ubiquitous red coating and the desert environment in which is it found. Grains of this sand were analyzed using a variety of microanalytical techniques. A database of detailed studies of such terrestrial analogs would assist the study of geological and astrobiological specimens in future missions to Mars. Potential instrument concepts for in situ deployment on Mars include local electrode atom probe nanoanalysis (LEAP), vertical scanning white light interferometry (VSWLI), scanning electron microscopies, energy dispersive x-ray microanalysis (EDX), atomic force microscopy (AFM) and X-ray diffraction (XRD). While in situ deployment of these techniques is many years away, ground-based studies using these analytical techniques extend our understanding of the data obtained from instruments to be flown in the near future.

Advanced Characterization Techniques for Sodium-Ion Battery Studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shadike, Zulipiya; Zhao, Enyue; Zhou, Yong-Ning

Sodium (Na)-ion batteries (NIBs) are considered promising alternative candidates to the well-commercialized lithium-ion batteries, especially for applications in large-scale energy storage systems. The electrochemical performance of NIBs such as the cyclability, rate capability, and voltage profiles are strongly dependent on the structural and morphological evolution, phase transformation, sodium-ion diffusion, and electrode/electrolyte interface reconstruction during charge–discharge cycling. Therefore, in-depth understanding of the structure and kinetics of electrode materials and the electrode/electrolyte interfaces is essential for optimizing current NIB systems and exploring new materials for NIBs. Recently, rapid progress and development in spectroscopic, microscopic, and scattering techniques have provided extensive insight intomore » the nature of structural evolution, morphological changes of electrode materials, and electrode/electrolyte interface in NIBs. Here in this review, a comprehensive overview of both static (ex situ) and real-time (in situ or in operando) techniques for studying the NIBs is provided. Lastly, special focus is placed on how these techniques are applied to the fundamental investigation of NIB systems and what important results are obtained.« less

Advanced Characterization Techniques for Sodium-Ion Battery Studies

DOE PAGES

Shadike, Zulipiya; Zhao, Enyue; Zhou, Yong-Ning; ...

2018-02-19

Sodium (Na)-ion batteries (NIBs) are considered promising alternative candidates to the well-commercialized lithium-ion batteries, especially for applications in large-scale energy storage systems. The electrochemical performance of NIBs such as the cyclability, rate capability, and voltage profiles are strongly dependent on the structural and morphological evolution, phase transformation, sodium-ion diffusion, and electrode/electrolyte interface reconstruction during charge–discharge cycling. Therefore, in-depth understanding of the structure and kinetics of electrode materials and the electrode/electrolyte interfaces is essential for optimizing current NIB systems and exploring new materials for NIBs. Recently, rapid progress and development in spectroscopic, microscopic, and scattering techniques have provided extensive insight intomore » the nature of structural evolution, morphological changes of electrode materials, and electrode/electrolyte interface in NIBs. Here in this review, a comprehensive overview of both static (ex situ) and real-time (in situ or in operando) techniques for studying the NIBs is provided. Lastly, special focus is placed on how these techniques are applied to the fundamental investigation of NIB systems and what important results are obtained.« less

Comparisons of Force Measurement Methods for DBD Plasma Actuators in Quiescent Air

NASA Technical Reports Server (NTRS)

Hoskinson, Alan R.; Hershkowitz, Noah; Ashpis, David E.

2009-01-01

We have performed measurements of the force induced by both single (one electrode insulated) and double (both electrodes insulated) dielectric barrier discharge plasma actuators in quiescent air. We have shown that, for single barrier actuators with cylindrical exposed electrodes, as the electrode diameter decrease the force efficiencies increase much faster than a previously reported linear trend. This behavior has been experimentally verified using two different measurement techniques: stagnation probe measurements of the induced flow velocity and direct measurement of the force using an electronic balance. Actuators with rectangular cross-section exposed electrodes do not show the same rapid increase at small thicknesses. We have also shown that the induced force is independent of the material used for the exposed electrode. The same techniques have shown that the induced force of a double barrier actuator increases with decreasing narrow electrode diameter.

Insulated ECG electrodes

NASA Technical Reports Server (NTRS)

Portnoy, W. M.; David, R. M.

1973-01-01

Insulated, capacitively coupled electrode does not require electrolyte paste for attachment. Other features of electrode include wide range of nontoxic material that may be employed for dielectric because of sputtering technique used. Also, electrode size is reduced because there is no need for external compensating networks with FET operational amplifier.

Influence of barrier on partial discharge activity by a conducting particle in liquid nitrogen under AC voltages adopting UHF technique

NASA Astrophysics Data System (ADS)

Sarathi, R.; Giridhar, A. V.; Sethupathi, K.

2011-02-01

The UHF signals are generated due to PD formed by particle movement in liquid nitrogen under AC voltages. The levitation voltage of a particle in liquid nitrogen measured through UHF technique and by conventional PD measurement technique is the same, confirming the sensitivity of UHF technique for identification of PD activity. The frequency content of UHF signal generated due to particle movement in liquid nitrogen, under AC voltages, lies in the range 0.5-1.5 GHz. The characteristics of UHF signal generated due to particle movement between the barrier and high voltage/ground electrode is much similar to the signal generated by particle movement in clean electrode gap. Pseudo resonance phenomena can occur in liquid nitrogen due to particle movement. It is also observed that the partial discharge magnitude, in general, be high when the particle moves between the barrier and high voltage electrode when compared to the barrier and the ground electrode. Percentage of clay in epoxy nanocomposites has not altered the levitation voltage of the particle in the electrode gap. Zero span analysis clearly indicates that pseudo resonance occurs when particle moves (in a short gap) between the barrier and high voltage/ground electrode.

Copper-tantalum alloy

DOEpatents

Schmidt, Frederick A.; Verhoeven, John D.; Gibson, Edwin D.

1986-07-15

A tantalum-copper alloy can be made by preparing a consumable electrode consisting of an elongated copper billet containing at least two spaced apart tantalum rods extending longitudinally the length of the billet. The electrode is placed in a dc arc furnace and melted under conditions which co-melt the copper and tantalum to form the alloy.

High resolution micro-CT scanning as an innovative tool for evaluation of the surgical positioning of cochlear implant electrodes.

PubMed

Postnov, A; Zarowski, A; De Clerck, N; Vanpoucke, F; Offeciers, F E; Van Dyck, D; Peeters, S

2006-05-01

X-ray microtomography (micro-CT) is a new technique allowing for visualization of the internal structure of opaque specimens with a quasi-histological quality. Among multiple potential applications, the use of this technique in otology is very promising. Micro-CT appears to be ideally suited for in vitro visualization of the inner ear tissues as well as for evaluation of the electrode damage and/or surgical insertion trauma during implantation of the cochlear implant electrodes. This technique can greatly aid in design and development of new cochlear implant electrodes and is applicable for temporal bone studies. The main advantage of micro-CT is the practically artefact-free preparation of the samples and the possibility of evaluation of the interesting parameters along the whole insertion depth of the electrode. This paper presents the results of the first application of micro-CT for visualization of the inner ear structures in human temporal bones and for evaluation of the surgical positioning of the cochlear implant electrodes relative to the intracochlear soft tissues.

Dependence of hydrogen arcjet operation on electrode geometry

NASA Technical Reports Server (NTRS)

Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.

1992-01-01

The dependence of 2kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and electrode agreed with Paschen curves for hydrogen. Preliminary characterization of the dependence of hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.

A four-diode full-wave ionic current rectifier based on bipolar membranes: overcoming the limit of electrode capacity.

PubMed

Gabrielsson, Erik O; Janson, Per; Tybrandt, Klas; Simon, Daniel T; Berggren, Magnus

2014-08-13

Full-wave rectification of ionic currents is obtained by constructing the typical four-diode bridge out of ion conducting bipolar membranes. Together with conjugated polymer electrodes addressed with alternating current, the bridge allows for generation of a controlled ionic direct current for extended periods of time without the production of toxic species or gas typically arising from electrode side-reactions. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Reduced size fuel cell for portable applications

NASA Technical Reports Server (NTRS)

Narayanan, Sekharipuram R. (Inventor); Valdez, Thomas I. (Inventor); Clara, Filiberto (Inventor); Frank, Harvey A. (Inventor)

2004-01-01

A flat pack type fuel cell includes a plurality of membrane electrode assemblies. Each membrane electrode assembly is formed of an anode, an electrolyte, and an cathode with appropriate catalysts thereon. The anode is directly into contact with fuel via a wicking element. The fuel reservoir may extend along the same axis as the membrane electrode assemblies, so that fuel can be applied to each of the anodes. Each of the fuel cell elements is interconnected together to provide the voltage outputs in series.

Particle trap with dielectric barrier for use in gas insulated transmission lines

DOEpatents

Dale, S.J.

1982-06-15

A gas-insulated transmission line includes an outer sheath, an inner conductor within the outer sheath, insulating supports supporting the inner conductor within the outer sheath, and an insulating gas electrically insulating the inner conductor from the outer sheath. An apertured particle trapping electrode is disposed within the outer sheath, and the electrode has a pair of dielectric members secured at each longitudinal end thereof, with the dielectric members extending outwardly from the apertured electrode. 7 figs.

Superconducting molybdenum-rhenium electrodes for single-molecule transport studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaudenzi, R.; Island, J. O.; Bruijckere, J. de

2015-06-01

We demonstrate that electronic transport through single molecules or molecular ensembles, commonly based on gold (Au) electrodes, can be extended to superconducting electrodes by combining gold with molybdenum-rhenium (MoRe). This combination induces proximity-effect superconductivity in the gold to temperatures of at least 4.6 K and magnetic fields of 6 T, improving on previously reported aluminum based superconducting nanojunctions. As a proof of concept, we show three-terminal superconductive transport measurements through an individual Fe{sub 4} single-molecule magnet.

Development of paper-gate transistor toward direct detection from microbiological fluids

NASA Astrophysics Data System (ADS)

Kajisa, Taira; Sakata, Toshiya

2017-04-01

In this study, a paper-gate transistor was developed to detect glucose using an extended-gate field-effect transistor (FET). A filter paper was used as an extended gate electrode, in which Au nanoparticles (AuNPs) modified with phenylboronic acids (PBAs) were included. PBA-AuNPs play an important role as a support to not only be entrapped in cellulose fibrils but also bind to the targeted glucose in a paper. The surface properties of PBA-AuNPs were investigated to elucidate the electrical properties of the paper-gate electrode using an absorption spectrum and a zeta potential analysis. Moreover, the paper-gate electrode enabled us to detect glucose at the micromolar level on the basis of the principle of FET devices. A platform based on the paper-gate transistor is suitable for a highly sensitive system to detect glucose in trace samples such as tears, sweat, and saliva in the future.

Electroreduction of CO{sub 2} using copper-deposited on boron-doped diamond (BDD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Panglipur, Hanum Sekar; Ivandini, Tribidasari A., E-mail: ivandini.tri@sci.ui.ac.id; Einaga, Yasuaki

Electroreduction of CO{sub 2} was studied at copper-modified boron-doped diamond (Cu-BDD) electrodes as the working electrode. The Cu-BDD electrodes were prepared by electrochemical reduction with various concentrations of CuSO{sub 4} solutions. FE-SEM was utilized to characterize the electrodes. At Cu-BDD electrodes, a reduction peak at around -1.2 V (vs Ag/AgCl) attributtable to CO{sub 2} reductions could be observed by cyclic voltammetry technique of CO{sub 2} bubbled in water containing 0.1M NaCl. Accordingly, electroreduction of CO{sub 2} was conducted at -1.2 V (vs Ag/AgCl) using amperometry technique. The chemical products of the electroreduction analyzed by using HPLC showed the formation of formaldehyde, formicmore » acid, and acetic acid at Cu-BDD electrodes.« less

Multilayer capacitor suitable for substrate integration and multimegahertz filtering

DOEpatents

Ngo, Khai D. T.

1990-01-01

A multilayer capacitor comprises stacked, spaced-apart electrodes of sheet form, dielectric layers between the electrodes, and first and second groups of spaced-apart conductive vias extending transversely of the sheet-form electrodes and through aligned holes in the dielectric layers. Alternate electrodes are instantaneously positive, and the remaining electrodes are instantaneously negative. Each via of the first group is electrically connected to the positive electrodes and passes insulatingly through the negative electrodes. Similarly, each via of the second group is electrically connected to the negative electrodes and passes insulatingly through the positive electrodes. Each via has, in the plane of the electrodes, a cross-sectional form in the shape of an elongated rib of greater length than width. The elongated ribs of the first group are disposed in a first plurality of rows with their lengths in spaced-apart, aligned relationship, and the ribs of the second group are disposed in a second plurality of rows with their lengths in spaced-apart, aligned relationship. The first plurality of rows is disposed substantially orthogonally with respect to the second plurality of rows.

Electrochemical electron beam lithography: Write, read, and erase metallic nanocrystals on demand

PubMed Central

Park, Jeung Hun; Steingart, Daniel A.; Kodambaka, Suneel; Ross, Frances M.

2017-01-01

We develop a solution-based nanoscale patterning technique for site-specific deposition and dissolution of metallic nanocrystals. Nanocrystals are grown at desired locations by electron beam–induced reduction of metal ions in solution, with the ions supplied by dissolution of a nearby electrode via an applied potential. The nanocrystals can be “erased” by choice of beam conditions and regrown repeatably. We demonstrate these processes via in situ transmission electron microscopy using Au as the model material and extend to other metals. We anticipate that this approach can be used to deposit multicomponent alloys and core-shell nanostructures with nanoscale spatial and compositional resolutions for a variety of possible applications. PMID:28706992

Advanced Ignition in Supersonic Airflow by Tunable Plasma System

NASA Astrophysics Data System (ADS)

Firsov, A. A.; Dolgov, E. V.; Leonov, S. B.; Yarantsev, D. A.

2017-10-01

The plasma-based technique was studied for ignition and flameholding in a supersonic airflow in different laboratories for a long time. It was shown that flameholding of gaseous and liquid hydrocarbon fuel is feasible by means of surface DC discharge without employing mechanical flameholders in a supersonic combustion chamber. However, a high power consumption may limit application of this method in a real apparatus. This experimental and computational work explores a distributed plasma system, which allows reducing the total energy consumption and extending the life cycle of the electrode system. Due to the circuit flexibility, this approach may be potentially enriched with feedbacks for design of a close loop control system.

Fabrication of Graphene on Kevlar Supercapacitor Electrodes

DTIC Science & Technology

2011-05-01

fabricated with graphene to investigate its applicability for energy storage devices, as this carbon- based material has a large surface area and...Distribution List 14 iv List of Figures Figure 1. Dip-and-dry technique applied to Kevlar- based electrodes...2  Figure 2. Three-electrode system used for the CV measurements. The (1) working electrode was the Kevlar- based electrode; (2) the counter

Electro-osmotic infusion for joule heating soil remediation techniques

DOEpatents

Carrigan, Charles R.; Nitao, John J.

1999-01-01

Electro-osmotic infusion of ground water or chemically tailored electrolyte is used to enhance, maintain, or recondition electrical conductivity for the joule heating remediation technique. Induced flows can be used to infuse electrolyte with enhanced ionic conductivity into the vicinity of the electrodes, maintain the local saturation of near-electrode regions and resaturate a partially dried out zone with groundwater. Electro-osmotic infusion can also tailor the conductivity throughout the target layer by infusing chemically modified and/or heated electrolyte to improve conductivity contrast of the interior. Periodic polarity reversals will prevent large pH changes at the electrodes. Electro-osmotic infusion can be used to condition the electrical conductivity of the soil, particularly low permeability soil, before and during the heating operation. Electro-osmotic infusion is carried out by locating one or more electrodes adjacent the heating electrodes and applying a dc potential between two or more electrodes. Depending on the polarities of the electrodes, the induced flow will be toward the heating electrodes or away from the heating electrodes. In addition, electrodes carrying a dc potential may be located throughout the target area to tailor the conductivity of the target area.

Lightweight, durable lead-acid batteries

DOEpatents

Lara-Curzio, Edgar [Lenoir City, TN; An, Ke [Knoxville, TX; Kiggans, Jr., James O.; Dudney, Nancy J [Knoxville, TN; Contescu, Cristian I [Knoxville, TN; Baker, Frederick S [Oak Ridge, TN; Armstrong, Beth L [Clinton, TN

2011-09-13

A lightweight, durable lead-acid battery is disclosed. Alternative electrode materials and configurations are used to reduce weight, to increase material utilization and to extend service life. The electrode can include a current collector having a buffer layer in contact with the current collector and an electrochemically active material in contact with the buffer layer. In one form, the buffer layer includes a carbide, and the current collector includes carbon fibers having the buffer layer. The buffer layer can include a carbide and/or a noble metal selected from of gold, silver, tantalum, platinum, palladium and rhodium. When the electrode is to be used in a lead-acid battery, the electrochemically active material is selected from metallic lead (for a negative electrode) or lead peroxide (for a positive electrode).

Lightweight, durable lead-acid batteries

DOEpatents

Lara-Curzio, Edgar; An, Ke; Kiggans, Jr., James O; Dudney, Nancy J; Contescu, Cristian I; Baker, Frederick S; Armstrong, Beth L

2013-05-21

A lightweight, durable lead-acid battery is disclosed. Alternative electrode materials and configurations are used to reduce weight, to increase material utilization and to extend service life. The electrode can include a current collector having a buffer layer in contact with the current collector and an electrochemically active material in contact with the buffer layer. In one form, the buffer layer includes a carbide, and the current collector includes carbon fibers having the buffer layer. The buffer layer can include a carbide and/or a noble metal selected from of gold, silver, tantalum, platinum, palladium and rhodium. When the electrode is to be used in a lead-acid battery, the electrochemically active material is selected from metallic lead (for a negative electrode) or lead peroxide (for a positive electrode).

Simple and robust strategy for potentiometric detection of glucose using fluorinated phenylboronic acid self-assembled monolayer.

PubMed

Matsumoto, Akira; Matsumoto, Hiroko; Maeda, Yasuhiro; Miyahara, Yuji

2013-09-01

Field effect transistor (FET) based signal-transduction (Bio-FET) is an emerging technique for label-free and real-time basis biosensors for a wide range of targets. Glucose has constantly been of interest due to its clinical relevance. Use of glucose oxidase (GOD) and a lectin protein Concanavalin A are two common strategies to generate glucose-dependent electrochemical events. However, these protein-based materials are intolerant of long-term usage and storage due to their inevitable denaturing. A phenylboronic acid (PBA) modified self-assembled monolayer (SAM) on a gold electrode with an optimized disassociation constant of PBA, that is, 3-fluoro-4-carbamoyl-PBA possessing its pKa of 7.1, was prepared and utilized as an extended gate electrode for Bio-FET. The prepared electrode showed a glucose-dependent change in the surface potential under physiological conditions, thus providing a remarkably simple rationale for the glyco-sensitive Bio-FET. Importantly, the PBA modified electrode showed tolerance to relatively severe heat and drying treatments; conditions under which protein based materials would surely be denatured. A PBA modified SAM with optimized disassociation constant (pKa) can exhibit a glucose-dependent change in the surface potential under physiological conditions, providing a remarkably simple but robust method for the glyco-sensing. This protein-free, totally synthetic glyco-sensing strategy may offer cheap, robust and easily accessible platform that may be useful in developing countries. This article is part of a Special Issue entitled Organic Bioelectronics-Novel Applications in Biomedicine. Copyright © 2013 Elsevier B.V. All rights reserved.

In situ XANES and EXAFS Analysis of Redox Active Fe Center Ionic Liquids

DOE PAGES

Apblett, Christopher A.; Stewart, David M.; Fryer, Robert T.; ...

2015-10-23

We apply in situ X-Ray Absorption Near Edge Spectroscopy (XANES) and Extended X-Ray Absorption Fine Structure (EXAFS) techniques to a metal center ionic liquid undergoing oxidation and reduction in a three electrode spectroscopic cell. Furthermore, the determination of the extent of reduction under negative bias on the working electrode and the extent of oxidation are determined after pulse voltammetry to quiescence. While the ionic liquid undergoes full oxidation, it undergoes only partial reduction, likely due to transport issues on the timescale of the experiment. Nearest neighbor Fe-O distances in the fully oxidized state match well to expected values for similarlymore » coordinated solids, but reduction does not result in an extension of the Fe-O bond length, as would be expected from comparisons to the solid phase. Instead, little change in bond length is observed. Finally, we suggest that this may be due to a more complex interaction between the monodentate ligands of the metal center anion and the surrounding charge cloud, rather than straightforward electrostatics between the metal center and the nearest neighbor grouping.« less

Fabrication of metal nanoelectrodes by interfacial reactions.

PubMed

Zhu, Xinyu; Qiao, Yonghui; Zhang, Xin; Zhang, Sensen; Yin, Xiaohong; Gu, Jing; Chen, Ye; Zhu, Zhiwei; Li, Meixian; Shao, Yuanhua

2014-07-15

Despite great improvements in the past decades, the controllable fabrication of metal nanoelectrodes still remains very challenging. In this work, a simple and general way to fabricate metal nanoelectrodes (Ag, Au, and Pt) is developed. On the basis of interfacial reactions at nano-liquid/liquid interfaces supported at nanopipettes, the nanoparticles can be formed in situ and have been used to block the orifices of pipettes to make nanoelectrodes. The effect of the driving force for interfacial reaction at the liquid/liquid interface, the ratio of redox species in organic and aqueous phases, and the surface charge of the inner wall of a pipette have been studied. The fabricated nanoelectrodes have been characterized by scanning electron microscopy (SEM) and electrochemical techniques. A silver electrode with about 10 nm in radius has been employed as the scanning electrochemical microscopy (SECM) probe to explore the thickness of a water/nitrobenzene (W/NB) interface, and this value is equal to 0.8 ± 0.1 nm (n = 5). This method of fabrication of nanoelectrodes can be extended to other metal or semiconductor electrodes.

One-Dimensional Assembly of Conductive and Capacitive Metal Oxide Electrodes for High-Performance Asymmetric Supercapacitors.

PubMed

Harilal, Midhun; Vidyadharan, Baiju; Misnon, Izan Izwan; Anilkumar, Gopinathan M; Lowe, Adrian; Ismail, Jamil; Yusoff, Mashitah M; Jose, Rajan

2017-03-29

A one-dimensional morphology comprising nanograins of two metal oxides, one with higher electrical conductivity (CuO) and the other with higher charge storability (Co 3 O 4 ), is developed by electrospinning technique. The CuO-Co 3 O 4 nanocomposite nanowires thus formed show high specific capacitance, high rate capability, and high cycling stability compared to their single-component nanowire counterparts when used as a supercapacitor electrode. Practical symmetric (SSCs) and asymmetric (ASCs) supercapacitors are fabricated using commercial activated carbon, CuO, Co 3 O 4 , and CuO-Co 3 O 4 composite nanowires, and their properties are compared. A high energy density of ∼44 Wh kg -1 at a power density of 14 kW kg -1 is achieved in CuO-Co 3 O 4 ASCs employing aqueous alkaline electrolytes, enabling them to store high energy at a faster rate. The current methodology of hybrid nanowires of various functional materials could be applied to extend the performance limit of diverse electrical and electrochemical devices.

Carbon and graphene double protection strategy to improve the SnO(x) electrode performance anodes for lithium-ion batteries.

PubMed

Zhu, Jian; Lei, Danni; Zhang, Guanhua; Li, Qiuhong; Lu, Bingan; Wang, Taihong

2013-06-21

SnOx is a promising high-capacity anode material for lithium-ion batteries (LIBs), but it usually exhibits poor cycling stability because of its huge volume variation during the lithium uptake and release process. In this paper, SnOx carbon nanofibers (SnOx@CNFs) are firstly obtained in the form of a nonwoven mat by electrospinning followed by calcination in a 0.02 Mpa environment at 500 °C. Then we use a simple mixing method for the synthesis of SnOx@CNF@graphene (SnOx@C@G) nanocomposite. By this technique, the SnOx@CNFs can be homogeneously deposited in graphene nanosheets (GNSs). The highly scattered SnOx@C@G composite exhibits enhanced electrochemical performance as anode material for LIBs. The double protection strategy to improve the electrode performance through producing SnOx@C@G composites is versatile. In addition, the double protection strategy can be extended to the fabrication of various types of composites between metal oxides and graphene nanomaterials, possessing promising applications in catalysis, sensing, supercapacitors and fuel cells.

Honeycomb-like NiCo2S4 nanosheets prepared by rapid electrodeposition as a counter electrode for dye-sensitized solar cells

NASA Astrophysics Data System (ADS)

Yin, Jie; Wang, Yuqiao; Meng, Wenfei; Zhou, Tianyue; Li, Baosong; Wei, Tao; Sun, Yueming

2017-08-01

Honeycomb-like nickel cobalt sulfide (NiCo2S4) nanosheets were directly deposited on fluorine-doped tin oxide substrate by a rapid voltammetric deposition method. The method was also controllable and feasible for preparing NiCo2S4 on flexible Ti foil without any heating processes. Compared with Pt, CoS and NiS, NiCo2S4 exhibited low charge-transfer resistances and excellent electrocatalytic activity for {{{{I}}}3}- reduction, acting as a counter electrode for a dye-sensitized solar cell. The NiCo2S4-based solar cell showed higher power conversion efficiency (7.44%) than that of Pt-based solar cell (7.09%) under simulated illumination (AM 1.5 G, 100 mW cm-2). The device based on the flexible NiCo2S4/Ti foil achieved a power conversion efficiency of 5.28% under the above illumination conditions. This work can be extended to flexible and wearable technologies due to its facile technique.

Force Measurements of Single and Double Barrier DBD Plasma Actuators in Quiescent Air

NASA Technical Reports Server (NTRS)

Hoskinson, Alan R.; Hershkowitz, Noah; Ashpis, David E.

2008-01-01

We have performed measurements of the force induced by both single (one electrode insulated) and double (both electrodes insulated) dielectric barrier discharge plasma actuators in quiescent air. We have shown that, for single barrier actuators, as the electrode diameter decreased below those values previously studied the induced Force increases exponentially rather than linearly. This behavior has been experimentally verified using two different measurement techniques: stagnation probe measurements of the induced flow velocity and direct measurement of the force using an electronic balance. In addition, we have shown the the induced force is independent of the material used for the exposed electrode. The same techniques have shown that the induced force of a double barrier actuator increases with decreasing narrow electrode diameter.

Carbon and graphene double protection strategy to improve the SnOx electrode performance anodes for lithium-ion batteries

NASA Astrophysics Data System (ADS)

Zhu, Jian; Lei, Danni; Zhang, Guanhua; Li, Qiuhong; Lu, Bingan; Wang, Taihong

2013-05-01

SnOx is a promising high-capacity anode material for lithium-ion batteries (LIBs), but it usually exhibits poor cycling stability because of its huge volume variation during the lithium uptake and release process. In this paper, SnOx carbon nanofibers (SnOx@CNFs) are firstly obtained in the form of a nonwoven mat by electrospinning followed by calcination in a 0.02 Mpa environment at 500 °C. Then we use a simple mixing method for the synthesis of SnOx@CNF@graphene (SnOx@C@G) nanocomposite. By this technique, the SnOx@CNFs can be homogeneously deposited in graphene nanosheets (GNSs). The highly scattered SnOx@C@G composite exhibits enhanced electrochemical performance as anode material for LIBs. The double protection strategy to improve the electrode performance through producing SnOx@C@G composites is versatile. In addition, the double protection strategy can be extended to the fabrication of various types of composites between metal oxides and graphene nanomaterials, possessing promising applications in catalysis, sensing, supercapacitors and fuel cells.SnOx is a promising high-capacity anode material for lithium-ion batteries (LIBs), but it usually exhibits poor cycling stability because of its huge volume variation during the lithium uptake and release process. In this paper, SnOx carbon nanofibers (SnOx@CNFs) are firstly obtained in the form of a nonwoven mat by electrospinning followed by calcination in a 0.02 Mpa environment at 500 °C. Then we use a simple mixing method for the synthesis of SnOx@CNF@graphene (SnOx@C@G) nanocomposite. By this technique, the SnOx@CNFs can be homogeneously deposited in graphene nanosheets (GNSs). The highly scattered SnOx@C@G composite exhibits enhanced electrochemical performance as anode material for LIBs. The double protection strategy to improve the electrode performance through producing SnOx@C@G composites is versatile. In addition, the double protection strategy can be extended to the fabrication of various types of composites between metal oxides and graphene nanomaterials, possessing promising applications in catalysis, sensing, supercapacitors and fuel cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c3nr00467h

Superwettability-Induced Confined Reaction toward High-Performance Flexible Electrodes.

PubMed

Xiong, Weiwei; Liu, Hongliang; Zhou, Yahong; Ding, Yi; Zhang, Xiqi; Jiang, Lei

2016-05-18

To find a general strategy to realize confinement of the conductive layer for high-performance flexible electrodes, with improved interfacial adhesion and high conductivity, is of important scientific significance. In this work, superwettability-induced confined reaction is used to fabricate high-performance flexible Ag/polymer electrodes, showing significantly improved silver conversion efficiency and interfacial adhesion. The as-prepared flexible electrodes by superhydrophilic polymeric surface under oil are highly conductive with an order of magnitude higher than the Ag/polymer electrodes obtained from original polymeric surface. The high conductivity achieved via superhydrophilic confinement is ascribed to the fact that the superhydrophilic polymeric surface can enhance the reaction rate of silver deposition and reduce the size of silver nanoparticles to achieve the densest packing. This new approach will provide a simple method to fabricate flexible and highly conductive Ag/polymer electrodes with excellent adhesion between the conductive layer and the substrate, and can be extended to other metal/polymeric electrodes or alloy/polymeric electrodes.

Electrode for electrochemical cell

DOEpatents

Kaun, T.D.; Nelson, P.A.; Miller, W.E.

1980-05-09

An electrode structure for a secondary electrochemical cell includes an outer enclosure defining a compartment containing electrochemical active material. The enclosure includes a rigid electrically conductive metal sheet with perforated openings over major side surfaces. The enclosure can be assembled as first and second trays each with a rigid sheet of perforated electrically conductive metal at major side surfaces and normally extending flanges at parametric margins. The trays can be pressed together with moldable active material between the two to form an expandable electrode. A plurality of positive and negative electrodes thus formed are arranged in an alternating array with porous frangible interelectrode separators within the housing of the secondary electrochemical cell.

Electrode for electrochemical cell

DOEpatents

Kaun, Thomas D.; Nelson, Paul A.; Miller, William E.

1981-01-01

An electrode structure for a secondary electrochemical cell includes an outer enclosure defining a compartment containing electrochemical active material. The enclosure includes a rigid electrically conductive metal sheet with perforated openings over major side surfaces. The enclosure can be assembled as first and second trays each with a rigid sheet of perforated electrically conductive metal at major side surfaces and normally extending flanges at parametric margins. The trays can be pressed together with moldable active material between the two to form an expandable electrode. A plurality of positive and negative electrodes thus formed are arranged in an alternating array with porous frangible interelectrode separators within the housing of the secondary electrochemical cell.

Ion funnel with extended mass range and reduced conductance limit aperture

DOEpatents

Tolmachev, Aleksey V [Richland, WA; Smith, Richard D [Richland, WA

2008-04-01

An improved ion funnel design is disclosed that decreases the axial RF (parasite) fields at the ion funnel exit. This is achieved by addition of one or more compensation electrodes after the conductance limit electrode. Various RF voltage profiles may be applied to the various electrodes minimizing the parasite axial potential wells. The smallest RF aperture that serves as the conductance limiting electrode is further reduced over standard designs. Overall, the ion funnel improves transmission ranges of both low m/z and high m/z ions, reducing RF activation of ions and decreasing the gas load to subsequent differential pumping stages.

Photoconductive switch package

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caporaso, George J.

2015-10-27

A photoconductive switch is formed of a substrate that has a central portion of SiC or other photoconductive material and an outer portion of cvd-diamond or other suitable material surrounding the central portion. Conducting electrodes are formed on opposed sides of the substrate, with the electrodes extending beyond the central portion and the edges of the electrodes lying over the outer portion. Thus any high electric fields produced at the edges of the electrodes lie outside of and do not affect the central portion, which is the active switching element. Light is transmitted through the outer portion to the centralmore » portion to actuate the switch.« less

A Manually Operated, Advance Off-Stylet Insertion Tool for Minimally Invasive Cochlear Implantation Surgery

PubMed Central

Kratchman, Louis B.; Schurzig, Daniel; McRackan, Theodore R.; Balachandran, Ramya; Noble, Jack H.; Webster, Robert J.; Labadie, Robert F.

2014-01-01

The current technique for cochlear implantation (CI) surgery requires a mastoidectomy to gain access to the cochlea for electrode array insertion. It has been shown that microstereotactic frames can enable an image-guided, minimally invasive approach to CI surgery called percutaneous cochlear implantation (PCI) that uses a single drill hole for electrode array insertion, avoiding a more invasive mastoidectomy. Current clinical methods for electrode array insertion are not compatible with PCI surgery because they require a mastoidectomy to access the cochlea; thus, we have developed a manually operated electrode array insertion tool that can be deployed through a PCI drill hole. The tool can be adjusted using a preoperative CT scan for accurate execution of the advance off-stylet (AOS) insertion technique and requires less skill to operate than is currently required to implant electrode arrays. We performed three cadaver insertion experiments using the AOS technique and determined that all insertions were successful using CT and microdissection. PMID:22851233

Evaluation of electrochemical, UV/VIS and Raman spectroelectrochemical detection of Naratriptan with screen-printed electrodes.

PubMed

Hernández, Carla Navarro; Martín-Yerga, Daniel; González-García, María Begoña; Hernández-Santos, David; Fanjul-Bolado, Pablo

2018-02-01

Naratriptan, active pharmaceutical ingredient with antimigraine activity was electrochemically detected in untreated screen-printed carbon electrodes (SPCEs). Cyclic voltammetry and differential pulse voltammetry were used to carry out quantitative analysis of this molecule (in a Britton-Robinson buffer solution at pH 3.0) through its irreversible oxidation (diffusion controlled) at a potential of +0.75V (vs. Ag pseudoreference electrode). Naratriptan oxidation product is an indole based dimer with a yellowish colour (maximum absorption at 320nm) so UV-VIS spectroelectrochemistry technique was used for the very first time as an in situ characterization and quantification technique for this molecule. A reflection configuration approach allowed its measurement over the untreated carbon based electrode. Finally, time resolved Raman Spectroelectrochemistry is used as a powerful technique to carry out qualitative and quantitative analysis of Naratriptan. Electrochemically treated silver screen-printed electrodes are shown as easy to use and cost-effective SERS substrates for the analysis of Naratriptan. Copyright © 2017 Elsevier B.V. All rights reserved.

Membrane Bioprobe Electrodes

ERIC Educational Resources Information Center

Rechnitz, Garry A.

1975-01-01

Describes the design of ion selective electrodes coupled with immobilized enzymes which operate either continuously or on drop-sized samples. Cites techniques for urea, L-phenylalanine and amygdalin. Micro size electrodes for use in single cells are discussed. (GH)

High voltage performance of a dc photoemission electron gun with centrifugal barrel-polished electrodes

NASA Astrophysics Data System (ADS)

Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; Wang, Y.; Poelker, M.

2017-09-01

The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain <10 MV/m at the desired operating voltage aiming at little or no field emission once conditioned. Typical electrode surface preparation involves diamond-paste polishing by skilled personnel, requiring several weeks of effort per electrode. In this work, we describe a centrifugal barrel-polishing technique commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (˜11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.

Atmospheric pressure helium afterglow discharge detector for gas chromatography

DOEpatents

Rice, G.; D'Silva, A.P.; Fassel, V.A.

1985-04-05

An apparatus for providing a simple, low-frequency, electrodeless discharge system for atmospheric pressure afterglow generation. A single quartz tube through which a gas mixture is passed is extended beyond a concentric electrode positioned thereabout. A grounding rod is placed directly above the tube outlet to permit optical viewing of the discharge between the electrodes.

Atmospheric pressure helium afterglow discharge detector for gas chromatography

DOEpatents

Rice, Gary; D'Silva, Arthur P.; Fassel, Velmer A.

1986-05-06

An apparatus for providing a simple, low-frequency electrodeless discharge system for atmospheric pressure afterglow generation. A single quartz tube through which a gas mixture is passed is extended beyond a concentric electrode positioned thereabout. A grounding rod is placed directly above the tube outlet to permit optical viewing of the discharge between the electrodes.

Tantalum-copper alloy and method for making

DOEpatents

Schmidt, Frederick A.; Verhoeven, John D.; Gibson, Edwin D.

1984-11-06

A tantalum-copper alloy can be made by preparing a consumable electrode consisting of an elongated copper billet containing at least two spaced apart tantalum rods extending longitudinally the length of the billet. The electrode is placed in a dc arc furnace and melted under conditions which co-melt the copper and tantalum to form the alloy.

Tantalum-copper alloy and method for making

DOEpatents

Schmidt, F.A.; Verhoeven, J.D.; Gibson, E.D.

1983-06-01

A tantalum-copper alloy can be made by preparing a consumable electrode consisting of an elongated copper billet containing at least two spaced apart tantalum rods extending longitudinally the length of the billet. The electrode is placed in a dc arc furnace and melted under conditions which co-melt the copper and tantalum to form the alloy.

Comparison of three‐dimensional analysis and stereological techniques for quantifying lithium‐ion battery electrode microstructures

PubMed Central

TAIWO, OLUWADAMILOLA O.; FINEGAN, DONAL P.; EASTWOOD, DAVID S.; FIFE, JULIE L.; BROWN, LEON D.; DARR, JAWWAD A.; LEE, PETER D.; BRETT, DANIEL J.L.

2016-01-01

Summary Lithium‐ion battery performance is intrinsically linked to electrode microstructure. Quantitative measurement of key structural parameters of lithium‐ion battery electrode microstructures will enable optimization as well as motivate systematic numerical studies for the improvement of battery performance. With the rapid development of 3‐D imaging techniques, quantitative assessment of 3‐D microstructures from 2‐D image sections by stereological methods appears outmoded; however, in spite of the proliferation of tomographic imaging techniques, it remains significantly easier to obtain two‐dimensional (2‐D) data sets. In this study, stereological prediction and three‐dimensional (3‐D) analysis techniques for quantitative assessment of key geometric parameters for characterizing battery electrode microstructures are examined and compared. Lithium‐ion battery electrodes were imaged using synchrotron‐based X‐ray tomographic microscopy. For each electrode sample investigated, stereological analysis was performed on reconstructed 2‐D image sections generated from tomographic imaging, whereas direct 3‐D analysis was performed on reconstructed image volumes. The analysis showed that geometric parameter estimation using 2‐D image sections is bound to be associated with ambiguity and that volume‐based 3‐D characterization of nonconvex, irregular and interconnected particles can be used to more accurately quantify spatially‐dependent parameters, such as tortuosity and pore‐phase connectivity. PMID:26999804

Comparison of three-dimensional analysis and stereological techniques for quantifying lithium-ion battery electrode microstructures.

PubMed

Taiwo, Oluwadamilola O; Finegan, Donal P; Eastwood, David S; Fife, Julie L; Brown, Leon D; Darr, Jawwad A; Lee, Peter D; Brett, Daniel J L; Shearing, Paul R

2016-09-01

Lithium-ion battery performance is intrinsically linked to electrode microstructure. Quantitative measurement of key structural parameters of lithium-ion battery electrode microstructures will enable optimization as well as motivate systematic numerical studies for the improvement of battery performance. With the rapid development of 3-D imaging techniques, quantitative assessment of 3-D microstructures from 2-D image sections by stereological methods appears outmoded; however, in spite of the proliferation of tomographic imaging techniques, it remains significantly easier to obtain two-dimensional (2-D) data sets. In this study, stereological prediction and three-dimensional (3-D) analysis techniques for quantitative assessment of key geometric parameters for characterizing battery electrode microstructures are examined and compared. Lithium-ion battery electrodes were imaged using synchrotron-based X-ray tomographic microscopy. For each electrode sample investigated, stereological analysis was performed on reconstructed 2-D image sections generated from tomographic imaging, whereas direct 3-D analysis was performed on reconstructed image volumes. The analysis showed that geometric parameter estimation using 2-D image sections is bound to be associated with ambiguity and that volume-based 3-D characterization of nonconvex, irregular and interconnected particles can be used to more accurately quantify spatially-dependent parameters, such as tortuosity and pore-phase connectivity. © 2016 The Authors. Journal of Microscopy published by John Wiley & Sons Ltd on behalf of Royal Microscopical Society.

Microfabricated Patch Clamp Electrodes for Improved Ion Channel Protein Measurements

NASA Astrophysics Data System (ADS)

Klemic, James; Klemic, Kathryn; Reed, Mark; Sigworth, Frederick

2002-03-01

Ion channels are trans-membrane proteins that underlie many cell functions including hormone and neurotransmitter release, muscle contraction and cell signaling cascades. Ion channel proteins are commonly characterized via the patch clamp method in which an extruded glass tube containing ionic solution, manipulated by an expert technician, is brought into contact with a living cell to record ionic current through the cell membrane. Microfabricated planar patch electrodes, micromolded in the silicone elastomer poly-dimethylsiloxane (PDMS) from microlithographically patterned structures, have been developed that improve on this method. Microfabrication techniques allow arrays of patch electrodes to be fabricated, increasing the throughput of the measurement technique. Planar patch electrodes readily allow the automation of cell sealing, further increasing throughput. Microfabricated electrode arrays may be readily integrated with microfluidic structures to allow fast, in situ solution exchange. Miniaturization of the electrode geometry should increase both the signal to noise and the bandwidth of the measurement. Microfabricated patch electrode arrays have been fabricated and measurements have been taken.

Graphene-Based Linear Tandem Micro-Supercapacitors with Metal-Free Current Collectors and High-Voltage Output.

PubMed

Shi, Xiaoyu; Wu, Zhong-Shuai; Qin, Jieqiong; Zheng, Shuanghao; Wang, Sen; Zhou, Feng; Sun, Chenglin; Bao, Xinhe

2017-11-01

Printable supercapacitors are regarded as a promising class of microscale power source, but are facing challenges derived from conventional sandwich-like geometry. Herein, the printable fabrication of new-type planar graphene-based linear tandem micro-supercapacitors (LTMSs) on diverse substrates with symmetric and asymmetric configuration, high-voltage output, tailored capacitance, and outstanding flexibility is demonstrated. The resulting graphene-based LTMSs consisting of 10 micro-supercapacitors (MSs) present efficient high-voltage output of 8.0 V, suggestive of superior uniformity of the entire integrated device. Meanwhile, LTMSs possess remarkable flexibility without obvious capacitance degradation under different bending states. Moreover, areal capacitance of LTMSs can be sufficiently modulated by incorporating polyaniline-based pseudocapacitive nanosheets into graphene electrodes, showing enhanced capacitance of 7.6 mF cm -2 . To further improve the voltage output and energy density, asymmetric LTMSs are fabricated through controlled printing of linear-patterned graphene as negative electrodes and MnO 2 nanosheets as positive electrodes. Notably, the asymmetric LTMSs from three serially connected MSs are easily extended to 5.4 V, triple voltage output of the single cell (1.8 V), suggestive of the versatile applicability of this technique. Therefore, this work offers numerous opportunities of graphene and analogous nanosheets for one-step scalable fabrication of flexible tandem energy storage devices integrating with printed electronics on same substrate. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Magnetic Helicity Injection and Thermal Transport

NASA Astrophysics Data System (ADS)

Moses, Ronald; Gerwin, Richard; Schoenberg, Kurt

1999-11-01

In magnetic helicity injection, a current is driven between electrodes, parallel to the magnetic field in the edge plasma of a machine.^1 Plasma instabilities distribute current throughout the plasma. To model the injection of magnetic helicity, K, into an arbitrary closed surface, K is defined as the volume integral of A^.B. To make K unique, a gauge is chosen where the tangential surface components of A are purely solenoidal. If magnetic fields within a plasma are time varying, yet undergo no macroscopic changes over an extended period, and if the plasma is subject to an Ohm’s law with Hall terms, then it is shown that no closed magnetic surfaces with sustained internal currents can exist continuously within the plasma.^2 It is also shown that parallel thermal transport connects all parts of the plasma to the helicity injection electrodes and requires the electrode voltage difference to be at least 2.5 to 3 times the peak plasma temperature. This ratio is almost independent of the length of the electron mean-free path. If magnetic helicity injection is to be used for fusion-grade plasmas, then high-voltage, high-impedance injection techniques must be developed. ^1T. R. Jarboe, Plasma Physics and Controlled Fusion, V36, 945-990 (June 1994). ^2R. W. Moses, 1991 Sherwood International Fusion Theory Conference, Seattle, WA (April 22-24, 1991).

ELECTROCHEMICAL TECHNIQUE FOR TNT USING DISPOSABLE SCREEN-PRINTED ELECTRODE

EPA Science Inventory

Screen-printed thick film electrodes are demonstrated as voltammetric sensors for measurement of 2,4,6-trinitrotoluene (TNT). The square wave voltammetric (SWV) scan technique is used to measure TNT in as little as 50 uL sample volumes. This electrochemical assay is coupled ...

Advantage of four-electrode over two-electrode defibrillators

NASA Astrophysics Data System (ADS)

Bragard, J.; Šimić, A.; Laroze, D.; Elorza, J.

2015-12-01

Defibrillation is the standard clinical treatment used to stop ventricular fibrillation. An electrical device delivers a controlled amount of electrical energy via a pair of electrodes in order to reestablish a normal heart rate. We propose a technique that is a combination of biphasic shocks applied with a four-electrode system rather than the standard two-electrode system. We use a numerical model of a one-dimensional ring of cardiac tissue in order to test and evaluate the benefit of this technique. We compare three different shock protocols, namely a monophasic and two types of biphasic shocks. The results obtained by using a four-electrode system are compared quantitatively with those obtained with the standard two-electrode system. We find that a huge reduction in defibrillation threshold is achieved with the four-electrode system. For the most efficient protocol (asymmetric biphasic), we obtain a reduction in excess of 80% in the energy required for a defibrillation success rate of 90%. The mechanisms of successful defibrillation are also analyzed. This reveals that the advantage of asymmetric biphasic shocks with four electrodes lies in the duration of the cathodal and anodal phase of the shock.

Microbial Biofilm Voltammetry: Direct Electrochemical Characterization of Catalytic Electrode-Attached Biofilms▿ †

PubMed Central

Marsili, Enrico; Rollefson, Janet B.; Baron, Daniel B.; Hozalski, Raymond M.; Bond, Daniel R.

2008-01-01

While electrochemical characterization of enzymes immobilized on electrodes has become common, there is still a need for reliable quantitative methods for study of electron transfer between living cells and conductive surfaces. This work describes growth of thin (<20 μm) Geobacter sulfurreducens biofilms on polished glassy carbon electrodes, using stirred three-electrode anaerobic bioreactors controlled by potentiostats and nondestructive voltammetry techniques for characterization of viable biofilms. Routine in vivo analysis of electron transfer between bacterial cells and electrodes was performed, providing insight into the main redox-active species participating in electron transfer to electrodes. At low scan rates, cyclic voltammetry revealed catalytic electron transfer between cells and the electrode, similar to what has been observed for pure enzymes attached to electrodes under continuous turnover conditions. Differential pulse voltammetry and electrochemical impedance spectroscopy also revealed features that were consistent with electron transfer being mediated by an adsorbed catalyst. Multiple redox-active species were detected, revealing complexity at the outer surfaces of this bacterium. These techniques provide the basis for cataloging quantifiable, defined electron transfer phenotypes as a function of potential, electrode material, growth phase, and culture conditions and provide a framework for comparisons with other species or communities. PMID:18849456

Robust myoelectric signal detection based on stochastic resonance using multiple-surface-electrode array made of carbon nanotube composite paper

NASA Astrophysics Data System (ADS)

Shirata, Kento; Inden, Yuki; Kasai, Seiya; Oya, Takahide; Hagiwara, Yosuke; Kaeriyama, Shunichi; Nakamura, Hideyuki

2016-04-01

We investigated the robust detection of surface electromyogram (EMG) signals based on the stochastic resonance (SR) phenomenon, in which the response to weak signals is optimized by adding noise, combined with multiple surface electrodes. Flexible carbon nanotube composite paper (CNT-cp) was applied to the surface electrode, which showed good performance that is comparable to that of conventional Ag/AgCl electrodes. The SR-based EMG signal system integrating an 8-Schmitt-trigger network and the multiple-CNT-cp-electrode array successfully detected weak EMG signals even when the subject’s body is in the motion, which was difficult to achieve using the conventional technique. The feasibility of the SR-based EMG detection technique was confirmed by demonstrating its applicability to robot hand control.

Creating virtual electrodes with 2D current steering

NASA Astrophysics Data System (ADS)

Spencer, Thomas C.; Fallon, James B.; Shivdasani, Mohit N.

2018-06-01

Objective. Current steering techniques have shown promise in retinal prostheses as a way to increase the number of distinct percepts elicitable without increasing the number of implanted electrodes. Previously, it has been shown that ‘virtual’ electrodes can be created between simultaneously stimulated electrode pairs, producing unique cortical response patterns. This study investigated whether virtual electrodes could be created using 2D current steering, and whether these virtual electrodes can produce cortical responses with predictable spatial characteristics. Approach. Normally-sighted eyes of seven adult anaesthetised cats were implanted with a 42-channel electrode array in the suprachoroidal space and multi-unit neural activity was recorded from the visual cortex. Stimuli were delivered to individual physical electrodes, or electrodes grouped into triangular, rectangular, and hexagonal arrangements. Varying proportions of charge were applied to each electrode in a group to ‘steer’ current and create virtual electrodes. The centroids of cortical responses to stimulation of virtual electrodes were compared to those evoked by stimulation of single physical electrodes. Main results. Responses to stimulation of groups of up to six electrodes with equal ratios of charge on each electrode resulted in cortical activation patterns that were similar to those elicited by the central physical electrode (centroids: RM ANOVA on ranks, p  >  0.05 neural spread: one-way ANOVA on Ranks, p  >  0.05). We were also able to steer the centroid of activation towards the direction of any of the electrodes of the group by applying a greater charge to that electrode, but the movement in the centroid was not found to be significant. Significance. The results suggest that current steering is possible in two dimensions between up to at least six electrodes, indicating it may be possible to increase the number of percepts in patients without increasing the number of physical electrodes. Being able to reproduce spatial characteristics of responses to individual physical electrodes suggests that this technique could also be used to compensate for faulty electrodes.

Signal processing with a summing operational amplifier in multicomponent potentiometric titrations.

PubMed

Parczewski, A

1987-06-01

It has been proved that application of two indicator electrodes connected to the ordinary titration apparatus through an auxiliary electronic device (a summing operational amplifier) significantly extends the scope of multicomponent potentiometric titrations in which the analytes are determined simultaneously from a single titration curve. For each analyte there is a corresponding potential jump on the titration curve. By application of the proposed auxiliary device, the sum of the electrode potentials is measured. The device also enables the relative sizes of the potential jumps at the end-points on the titration curve to be varied. The advantages of the proposed signal processing are exemplified by complexometric potentiometric titrations of Fe(III) and Cu(II) in mixtures, with a platinum electrode and a copper ion-selective electrode as the indicator electrodes.

Welding fixture for joining bar-wound stator conductors

DOE Office of Scientific and Technical Information (OSTI.GOV)

De Souza, Urban J.; Rhoads, Frederick W.; Hanson, Justin

A fixture assembly for welding a plurality of stator wire end pairs may include an anvil, a movable clamp configured to translate between an unclamped state and a clamped state, a first grounding electrode, and a second grounding electrode. The movable clamp may be configured to urge the plurality of stator wire ends against the anvil when in the clamped state. The moveable clamp includes a separator feature that generally extends toward the anvil. Each of the first grounding electrode and second grounding electrodes may be configured to translate between a clamped state and an unclamped state. When in themore » clamped state, each of the first and second grounding electrodes is configured to urge a pair of the plurality of stator wire end pairs against the separator feature.« less

Research on rechargeable oxygen electrodes

NASA Technical Reports Server (NTRS)

Giner, J.; Malachesky, P. A.; Holleck, G.

1971-01-01

Studies were carried out on a number of factors which may influence the behavior of the platinum electrocatalyst of oxygen electrodes for use in rechargeable metal-oxygen batteries or hydrogen-oxygen fuel cells. The effects of pretreatments for various potentials and added ionic species, which could be present in such systems, were studied with reguard to: (1) the state of surface oxidation, (2) platinum dissolution, (3) the kinetics of oxygen evolution and reduction (including the role of hydrogen peroxide), and (4) changes in porous electrode structure. These studies were carried out on smooth platinum, platinized platinum, and Teflon-bonded platinum black electrodes in carefully purified electrolyte solutions. The main factors which appear to affect rechargeable oxygen electrode performance and life are: (1) the buildup of a refractory anodic layer on extended cycling, and (2) the dissolution of platinum.

Induction of Electrode-Cellular Interfaces with ˜ 0.05 μm^2 Contact Areas

NASA Astrophysics Data System (ADS)

Flanders, Bret; Thapa, Prem

2009-10-01

Individual cells of the slime mold Dictyostelium discoideum attach themselves to negatively biased nanoelectrodes that are separated by 30 μm from grounded electrodes. There is a -43 mV voltage-threshold for cell-to-electrode attachment, with negligible probability across the 0 to -38 mV range but probability that approaches 0.7 across the -46 to -100 mV range. A cell initiates contact by extending a pseudopod to the electrode and maintains contact until the voltage is turned off. Scanning electron micrographs of these interfaces show the contact areas to be of the order of 0.05 μm^2. Insight into this straight-forward, reproducible process may lead to new electrode-cellular attachment strategies that complement established approaches, such as blind sampling and patch clamp.

Carbon Nanotube Based Light Sensor

NASA Technical Reports Server (NTRS)

Wincheski, russell A. (Inventor); Smits, Jan M. (Inventor); Jordan, Jeffrey D. (Inventor); Watkins, Anthony Neal (Inventor); Ingram, JoAnne L. (Inventor)

2006-01-01

A light sensor substrate comprises a base made from a semi-conductive material and topped with a layer of an electrically non-conductive material. A first electrode and a plurality of carbon nanotube (CNT)-based conductors are positioned on the layer of electrically non-conductive material with the CNT-based conductors being distributed in a spaced apart fashion about a periphery of the first electrode. Each CNT-based conductor is coupled on one end thereof to the first electrode and extends away from the first electrode to terminate at a second free end. A second or gate electrode is positioned on the non-conductive material layer and is spaced apart from the second free end of each CNT-based conductor. Coupled to the first and second electrode is a device for detecting electron transfer along the CNT-based conductors resulting from light impinging on the CNT-based conductors.

Method for Making a Fuel Cell

NASA Technical Reports Server (NTRS)

Cable, Thomas L. (Inventor); Setlock, John A. (Inventor); Farmer, Serene C. (Inventor)

2014-01-01

The invention is a novel solid oxide fuel cell (SOFC) stack comprising individual bi-electrode supported fuel cells in which an electrolyte layer is supported between porous electrodes. The porous electrodes may be made from graded pore ceramic tape that has been created by the freeze cast method followed by freeze-drying. Each piece of graded pore tape later becomes a graded pore electrode scaffold that, subsequent to sintering, is made into either an anode or a cathode. The electrode scaffold comprising the anode includes a layer of liquid metal. The pores of the electrode scaffolds gradually increase in diameter as the layer extends away from the electrolyte layer. As a result of this diameter increase, any forces that would tend to pull the liquid metal away from the electrolyte are reduced while maintaining a diffusion path for the fuel. Advantageously, the fuel cell of the invention may utilize a hydrocarbon fuel without pre-processing to remove sulfur.

Dependence of hydrogen arcjet operation on electrode geometry

NASA Technical Reports Server (NTRS)

Pencil, Eric J.; Sankovic, John M.; Sarmiento, Charles J.; Hamley, John A.

1992-01-01

The dependence of 2 kW hydrogen arcjet performance on cathode to anode electrode spacing was evaluated at specific impulses of 900 and 1000 s. Less than 2 absolute percent change in efficiency was measured for the spacings tested which did not repeat the 14 absolute percent variation reported in earlier work with similar electrode designs. A different nozzle configuration was used to quantify the variation in hydrogen arcjet performance over an extended range of electrode spacing. Electrode gap variation resulted in less than 3 absolute percent change in efficiency. These null results suggested that electrode spacing is decoupled from hydrogen arcjet performance considerations over the ranges tested. Initial studies were conducted on hydrogen arcjet ignition. The dependence of breakdown voltage on mass flow rate and hydrogen arcjet ignition on rates of pulse repetition and pulse voltage rise were also included for comparison with previous results obtained using simulated hydrazine.

Electro-Active Transducer Using Radial Electric Field To Produce/Motion Sense Out-Of-Plane Transducer

NASA Technical Reports Server (NTRS)

Bryant, Robert G. (Inventor); Fox, Robert L. (Inventor)

2006-01-01

An electro-active transducer includes a ferroelectric material sandwiched by first and second electrode patterns. When the device is used as an actuator, the first and second electrode patterns are configured to introduce an electric field into the ferroelectric material when voltage is applied to the electrode patterns. When the device is used as a sensor. the first and second electrode patterns are configured to introduce an electric field into the ferroelectric material when the ferroelectric material experiences deflection in a direction substantially perpendicular thereto. In each case, the electrode patterns are designed to cause the electric field to: i) originate at a region of the ferroelectric material between the first and second electrode patterns. and ii) extend radially outward from the region of the ferroelectric material (at which the electric field originates) and substantially parallel to the ferroelectric material s plane.

Soviet Research and Development of High-Power Gap Switches

DTIC Science & Technology

1974-01-01

mounted between 5 and trigger electrode 7. The BaTi03 disc face on the side of electrode 7 is coated with silver , the coating extending over the...pressed by springs, coaxial with the cylinder body of the gap, against contacts 4, which are soldered to the silver coating of the cylinder representing...space. Fig. 3 — Gap switch 1 — BaTi03 disc 2 and 3 — electrodes 4 — silver coating 5 — air space The pulse repetition frequency is 3 x lO4 Hz up to

Nanoband array electrode as a platform for high sensitivity enzyme-based glucose biosensing.

PubMed

Falk, Magnus; Sultana, Reshma; Swann, Marcus J; Mount, Andrew R; Freeman, Neville J

2016-12-01

We describe a novel glucose biosensor based on a nanoband array electrode design, manufactured using standard semiconductor processing techniques, and bio-modified with glucose oxidase immobilized at the nanoband electrode surface. The nanoband array architecture allows for efficient diffusion of glucose and oxygen to the electrode, resulting in a thousand-fold improvement in sensitivity and wide linear range compared to a conventional electrode. The electrode constitutes a robust and manufacturable sensing platform. Copyright © 2016 Elsevier B.V. All rights reserved.

Stretchable Conductive Elastomers for Soldier Biosensing Applications: Final Report

DTIC Science & Technology

2016-03-01

public release; distribution is unlimited. 7 the electrical impedance tunability that we required. Representative data for resistance versus volume...Technology Directorate’s (VTD) electric field mediated morphing wing research effort. Fig. 5 Resistance values of EEG electrodes as a function of...extend the resistance range of the developed polymer EEG electrodes to potentially provide insight into defining an optimum electrical performance for

The development of sensors and techniques for in situ water quality monitoring

NASA Technical Reports Server (NTRS)

Liu, C. C.

1976-01-01

Enzyme electrodes and chloride ion electrodes were investigated for in situ monitoring of water quality. Preliminary results show that miniature chloride ion electrodes and a phenol sensor are most promising in determining trace contaminants in water.

An EPR and EMF study of Belousov-Zhabotinsky oscillators: Veratric acid and veratraidehyde in a water-acetonitrile medium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lalitha, P.V.; Ramaswamy, R.; Ramakrishnan, G.

1992-09-17

Electron paramagnetic resonance and potentiometric techniques using a platinium indicator electrode/ion selective electrode, are used to study Belousov-Zhabotinsky oscillatory reactions involving veratric acid and veratraldehyde as substrates in a mixed medium. These two techniques have yield a good correlation.

Capacitive mixing with electrodes of the same kind for energy production from salinity differences

NASA Astrophysics Data System (ADS)

Marino, M.; Kozynchenko, O.; Tennison, S.; Brogioli, D.

2016-03-01

The capacitive mixing technique is aimed at producing renewable energy from salinity differences, for example between sea and river water. The technique makes use of two electrodes that modify their potential in opposite directions when the concentration of the solution in which they are immersed is changed, as a consequence of the dynamics of the electric double layer which forms in the ionic solution. Unfortunately, it is difficult to find two electrodes presenting both optimal performances and opposite potential variations. In order to overcome this problem, we present here a cell scheme with electrodes of the same kind (and thus identical dependence of potential on concentration) which can be operated with a CapMix cycle; it is based on a concentration cell with identical electrodes dipped into two compartments separated by a non-perm-selective porous diaphragm. Thanks to the cyclic operation, the actual cell voltage rise and the power production are close to the values obtained with the traditional scheme, or even higher, depending on the features of the ion transport in the liquid junction region. We present an experimental demonstration of the working principles and we study the power production and energy efficiency in the light of the theory of ion transport in fluids. We show that our technique is competitive with respect to the other CapMix techniques, with the relevant advantage that we make use of only one kind of electrode.

Capacitive mixing with electrodes of the same kind for energy production from salinity differences.

PubMed

Marino, M; Kozynchenko, O; Tennison, S; Brogioli, D

2016-03-23

The capacitive mixing technique is aimed at producing renewable energy from salinity differences, for example between sea and river water. The technique makes use of two electrodes that modify their potential in opposite directions when the concentration of the solution in which they are immersed is changed, as a consequence of the dynamics of the electric double layer which forms in the ionic solution. Unfortunately, it is difficult to find two electrodes presenting both optimal performances and opposite potential variations. In order to overcome this problem, we present here a cell scheme with electrodes of the same kind (and thus identical dependence of potential on concentration) which can be operated with a CapMix cycle; it is based on a concentration cell with identical electrodes dipped into two compartments separated by a non-perm-selective porous diaphragm. Thanks to the cyclic operation, the actual cell voltage rise and the power production are close to the values obtained with the traditional scheme, or even higher, depending on the features of the ion transport in the liquid junction region. We present an experimental demonstration of the working principles and we study the power production and energy efficiency in the light of the theory of ion transport in fluids. We show that our technique is competitive with respect to the other CapMix techniques, with the relevant advantage that we make use of only one kind of electrode.

Nanoscale electrode arrays produced with microscale lithographic techniques for use in biomedical sensing applications.

PubMed

Terry, Jonathan G; Schmüser, Ilka; Underwood, Ian; Corrigan, Damion K; Freeman, Neville J; Bunting, Andrew S; Mount, Andrew R; Walton, Anthony J

2013-12-01

A novel technique for the production of nanoscale electrode arrays that uses standard microfabrication processes and micron-scale photolithography is reported here in detail. These microsquare nanoband edge electrode (MNEE) arrays have been fabricated with highly reproducible control of the key array dimensions, including the size and pitch of the individual elements and, most importantly, the width of the nanoband electrodes. The definition of lateral features to nanoscale dimensions typically requires expensive patterning techniques that are complex and low-throughput. However, the fabrication methodology used here relies on the fact that vertical dimensions (i.e. layer thicknesses) have long been manufacturable at the nanoscale using thin film deposition techniques that are well established in mainstream microelectronics. The authors report for the first time two aspects that highlight the particular suitability of these MNEE array systems for probe monolayer biosensing. The first is simulation, which shows the enhanced sensitivity to the redox reaction of the solution redox couple. The second is the enhancement of probe film functionalisation observed for the probe film model molecule, 6-mercapto-1-hexanol compared with microsquare electrodes. Such surface modification for specific probe layer biosensing and detection is of significance for a wide range of biomedical and other sensing and analytical applications.

In vivo electrode implanting system

NASA Technical Reports Server (NTRS)

Collins, Jr., Earl R. (Inventor)

1989-01-01

A cylindrical intramuscular implantable electrode is provided with a strip of fabric secured around it. The fabric is woven from a polyester fiber having loops of the fiber protruding. The end of the main cylindrical body is provided with a blunt conductive nose, and the opposite end is provided with a smaller diameter rear section with an annular groove to receive tips of fingers extending from a release tube. The fingers are formed to spring outwardly and move the fingertips out of the annular groove in order to release the electrode from the release tube when a sheath over the electrode is drawn back sufficiently. The sheath compresses the fingers of the release tube and the fabric loops until it is drawn back. Muscle tissue grows into the loops to secure the electrode in place after the sheath is drawn back. The entire assembly of electrode, release tube and sheath can be inserted into the patient's muscle to the desired position through a hypodermic needle. The release tube may be used to manipulate the electrode in the patient's muscle to an optimum position before the electrode is released.

On the Ageing of High Energy Lithium-Ion Batteries—Comprehensive Electrochemical Diffusivity Studies of Harvested Nickel Manganese Cobalt Electrodes

PubMed Central

Jaguemont, Joris; Van Den Bossche, Peter; Omar, Noshin; Van Mierlo, Joeri

2018-01-01

This paper examines the impact of the characterisation technique considered for the determination of the Li+ solid state diffusion coefficient in uncycled as in cycled Nickel Manganese Cobalt oxide (NMC) electrodes. As major characterisation techniques, Cyclic Voltammetry (CV), Galvanostatic Intermittent Titration Technique (GITT) and Electrochemical Impedance Spectroscopy (EIS) were systematically investigated. Li+ diffusion coefficients during the lithiation process of the uncycled and cycled electrodes determined by CV at 3.71 V are shown to be equal to 3.48×10−10 cm2·s−1 and 1.56×10−10 cm2·s−1 , respectively. The dependency of the Li+ diffusion with the lithium content in the electrodes is further studied in this paper with GITT and EIS. Diffusion coefficients calculated by GITT and EIS characterisations are shown to be in the range between 1.76×10−15 cm2·s−1 and 4.06×10−12 cm2·s−1, while demonstrating the same decreasing trend with the lithiation process of the electrodes. For both electrode types, diffusion coefficients calculated by CV show greater values compared to those determined by GITT and EIS. With ageing, CV and EIS techniques lead to diffusion coefficients in the electrodes at 3.71 V that are decreasing, in contrast to GITT for which results indicate increasing diffusion coefficient. After long-term cycling, ratios of the diffusion coefficients determined by GITT compared to CV become more significant with an increase about 1 order of magnitude, while no significant variation is seen between the diffusion coefficients calculated from EIS in comparison to CV. PMID:29360787

On the Ageing of High Energy Lithium-Ion Batteries-Comprehensive Electrochemical Diffusivity Studies of Harvested Nickel Manganese Cobalt Electrodes.

PubMed

Capron, Odile; Gopalakrishnan, Rahul; Jaguemont, Joris; Van Den Bossche, Peter; Omar, Noshin; Van Mierlo, Joeri

2018-01-23

This paper examines the impact of the characterisation technique considered for the determination of the L i + solid state diffusion coefficient in uncycled as in cycled Nickel Manganese Cobalt oxide (NMC) electrodes. As major characterisation techniques, Cyclic Voltammetry (CV), Galvanostatic Intermittent Titration Technique (GITT) and Electrochemical Impedance Spectroscopy (EIS) were systematically investigated. L i + diffusion coefficients during the lithiation process of the uncycled and cycled electrodes determined by CV at 3.71 V are shown to be equal to 3 . 48 × 10 - 10 cm 2 ·s - 1 and 1 . 56 × 10 - 10 cm 2 ·s - 1 , respectively. The dependency of the L i + diffusion with the lithium content in the electrodes is further studied in this paper with GITT and EIS. Diffusion coefficients calculated by GITT and EIS characterisations are shown to be in the range between 1 . 76 × 10 - 15 cm 2 ·s - 1 and 4 . 06 × 10 - 12 cm 2 ·s - 1 , while demonstrating the same decreasing trend with the lithiation process of the electrodes. For both electrode types, diffusion coefficients calculated by CV show greater values compared to those determined by GITT and EIS. With ageing, CV and EIS techniques lead to diffusion coefficients in the electrodes at 3.71 V that are decreasing, in contrast to GITT for which results indicate increasing diffusion coefficient. After long-term cycling, ratios of the diffusion coefficients determined by GITT compared to CV become more significant with an increase about 1 order of magnitude, while no significant variation is seen between the diffusion coefficients calculated from EIS in comparison to CV.

Frameless robot-assisted stereoelectroencephalography in children: technical aspects and comparison with Talairach frame technique.

PubMed

Abel, Taylor J; Varela Osorio, René; Amorim-Leite, Ricardo; Mathieu, Francois; Kahane, Philippe; Minotti, Lorella; Hoffmann, Dominique; Chabardes, Stephan

2018-04-20

OBJECTIVE Robot-assisted stereoelectroencephalography (SEEG) is gaining popularity as a technique for localization of the epileptogenic zone (EZ) in children with pharmacoresistant epilepsy. Here, the authors describe their frameless robot-assisted SEEG technique and report preliminary outcomes and relative complications in children as compared to results with the Talairach frame-based SEEG technique. METHODS The authors retrospectively analyzed the results of 19 robot-assisted SEEG electrode implantations in 17 consecutive children (age < 17 years) with pharmacoresistant epilepsy, and compared these results to 19 preceding SEEG electrode implantations in 18 children who underwent the traditional Talairach frame-based SEEG electrode implantation. The primary end points were seizure-freedom rates, operating time, and complication rates. RESULTS Seventeen children (age < 17 years) underwent a total of 19 robot-assisted SEEG electrode implantations. In total, 265 electrodes were implanted. Twelve children went on to have EZ resection: 4 demonstrated Engel class I outcomes, whereas 2 had Engel class II outcomes, and 6 had Engel class III-IV outcomes. Of the 5 patients who did not have resection, 2 underwent thermocoagulation. One child reported transient paresthesia associated with 2 small subdural hematomas, and 3 other children had minor asymptomatic intracranial hemorrhages. There were no differences in complication rates, rates of resective epilepsy surgery, or seizure freedom rates between this cohort and the preceding 18 children who underwent Talairach frame-based SEEG. The frameless robot-assisted technique was associated with shorter operating time (p < 0.05). CONCLUSIONS Frameless robot-assisted SEEG is a safe and effective means of identifying the EZ in children with pharmacoresistant partial epilepsy. Robot-assisted SEEG is faster than the Talairach frame-based method, and has equivalent safety and efficacy. The former, furthermore, facilitates more electrode trajectory possibilities, which may improve the localization of epileptic networks.

High Pt utilization PEMFC electrode obtained by alternative ion-exchange/electrodeposition.

PubMed

Chen, Siguo; Wei, Zidong; Li, Hua; Li, Li

2010-12-14

High Pt utilization PEMFC electrodes were prepared by an alternative ion-exchange/electrodeposition (AIEE) technique. The results demonstrated that the MEA employing an AIEE electrode with a Pt loading of 0.014 mg Pt cm(-2) exhibits performance approximately 2.2 times larger than that employing a conventional Nafion-bonded Pt/C electrode with a same Pt loading.

Direct electrochemistry of Shewanella loihica PV-4 on gold nanoparticles-modified boron-doped diamond electrodes fabricated by layer-by-layer technique.

PubMed

Wu, Wenguo; Xie, Ronggang; Bai, Linling; Tang, Zuming; Gu, Zhongze

2012-05-01

Microbial Fuel Cells (MFCs) are robust devices capable of taping biological energy, converting pollutants into electricity through renewable biomass. The fabrication of nanostructured electrodes with good bio- and electrochemical activity, play a profound role in promoting power generation of MFCs. Au nanoparticles (AuNPs)-modified Boron-Doped Diamond (BDD) electrodes are fabricated by layer-by-layer (LBL) self-assembly technique and used for the direct electrochemistry of Shewanella loihica PV-4 in an electrochemical cell. Experimental results show that the peak current densities generated on the Au/PAH multilayer-modified BDD electrodes increased from 1.25 to 2.93 microA/cm(-2) as the layer increased from 0 to 6. Different cell morphologies of S. loihica PV-4 were also observed on the electrodes and the highest density of cells was attached on the (Au/PAH)6/BDD electrode with well-formed three-dimensional nanostructure. The electrochemistry of S. loihica PV-4 was enhanced on the (Au/PAH)4/BDD electrode due to the appropriate amount of AuNPsand thickness of PAH layer.

Realization of deep 3D metal electrodes in diamond radiation detectors

NASA Astrophysics Data System (ADS)

Wulz, Thomas; Gerding, William; Lavrik, Nickolay; Briggs, Dayrl; Srijanto, Bernadeta; Lester, Kevin; Hensley, Dale; Spanier, Stefan; Lukosi, Eric

2018-05-01

A fabrication technique to create 3D diamond detectors is presented. Deep reactive ion etching was used to create an array of through-diamond vias (TDVs) in a 2 × 2 × 0.15 mm3 electronic grade single crystal diamond detector. The diameter of the TDVs was nominally 30 μm with a pitch of 100 μm between them. The TDVs were filled with chromium using hexavalent chromium electroplating to create 3D electrodes, which were connected electrically by interdigitated electrodes. The fabricated 3D diamond detector responded to both alpha particles and X-rays, exhibiting a charge collection efficiency of 52.3% at 200 V. Comparing to a diamond detector with the same interdigitated electrodes, but no 3D electrodes, confirms that the 3D electrodes are electrically active within the device. The average resistivity of the 3D electrodes is 2.89 ± 0.03 × 10-5 Ω cm, near that of bulk chromium. These results indicate that this fabrication technique is a potential option for 3D diamond detector fabrication.

Electrochemical Determination of Pentachlorophenol in Water on a Multi-Wall Carbon Nanotubes-Epoxy Composite Electrode

PubMed Central

Remes, Adriana; Pop, Aniela; Manea, Florica; Baciu, Anamaria; Picken, Stephen J.; Schoonman, Joop

2012-01-01

The aim of this study was the preparation, characterization, and application of a multi-wall carbon nanotubes-epoxy composite electrode (MWCNT-EP) with 25%, wt. MWCNTs loading for the voltammetric/amperometric determination of pentachlorophenol (PCP) in aqueous solutions. The structural and morphological aspects of the MWCNT-EP composite electrode were examined by scanning electron microscopy. The electrical properties were characterized by direct-current conductivity measurements in relation with the percolation threshold. The electrochemical behavior of PCP at the MWCNT-EP composite electrode was investigated using cyclic voltammetry in 0.1 M Na2SO4 supporting electrolyte in order to establish the parameters for amperometric/voltammetric determination of PCP. The linear dependence of current vs. PCP concentrations was reached in a wide concentration range from 0.2 to 12 μM PCP using cyclic voltammetry, differential-pulsed voltammetry, square-wave voltammetry, chronoamperometry, and multiple-pulsed amperometry techniques. The best electroanalytical performances of this composite electrode were achieved using a pre-concentration/square-wave voltammetric technique and also multiple-pulsed amperometry techniques envisaging the practical applications. The ease of preparation, high sensitivity, and stability of this composite electrode should open novel avenues and applications for fabricating robust sensors for detection of many important species. PMID:22969335

Transparent flexible nanogenerator as self-powered sensor for transportation monitoring

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Zhong Lin; Hu, Youfan; Lin, Long

2016-06-14

A traffic sensor includes a flexible substrate having a top surface. A piezoelectric structure extends from the first electrode layer. The piezoelectric structure has a top end. An insulating layer is infused into the piezoelectric structure. A first electrode layer is disposed on top of the insulating layer. A second electrode layer is disposed below the flexible substrate. A packaging layer is disposed around the substrate, the first electrode layer, the piezoelectric structure, the insulating layer and the second electrode layer. In a method of sensing a traffic parameter, a piezoelectric nanostructure-based traffic sensor is applied to a roadway. Anmore » electrical event generated by the piezoelectric nanostructure-based traffic sensor in response to a vehicle interacting with the piezoelectric nanostructure-based traffic sensor is detected. The electrical event is correlated with the traffic parameter.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Warren, Oden Lee; Asif, Syed Amanulla Syed; Oh, Yunje

A testing instrument for mechanical testing at nano or micron scale includes a transducer body, and a coupling shaft coupled with a probe tip. A transducer body houses a capacitor. The capacitor includes first and second counter electrodes and a center electrode assembly interposed therebetween. The center electrode assembly is movable with the coupling shaft relative to the first and second counter electrodes, for instance in one or more of dimensions including laterally and normally. The center electrode assembly includes a center plate coupled with the coupling shaft and one or more springs extending from the center plate. Upper andmore » lower plates are coupled with the center plate and cover the center plate and the one or more springs. A shaft support assembly includes one or more support elements coupled along the coupling shaft. The shaft support assembly provides lateral support to the coupling shaft.« less

Errors due to the truncation of the computational domain in static three-dimensional electrical impedance tomography.

PubMed

Vauhkonen, P J; Vauhkonen, M; Kaipio, J P

2000-02-01

In electrical impedance tomography (EIT), an approximation for the internal resistivity distribution is computed based on the knowledge of the injected currents and measured voltages on the surface of the body. The currents spread out in three dimensions and therefore off-plane structures have a significant effect on the reconstructed images. A question arises: how far from the current carrying electrodes should the discretized model of the object be extended? If the model is truncated too near the electrodes, errors are produced in the reconstructed images. On the other hand if the model is extended very far from the electrodes the computational time may become too long in practice. In this paper the model truncation problem is studied with the extended finite element method. Forward solutions obtained using so-called infinite elements, long finite elements and separable long finite elements are compared to the correct solution. The effects of the truncation of the computational domain on the reconstructed images are also discussed and results from the three-dimensional (3D) sensitivity analysis are given. We show that if the finite element method with ordinary elements is used in static 3D EIT, the dimension of the problem can become fairly large if the errors associated with the domain truncation are to be avoided.

Frangible electrochemical cell and sealing technique

NASA Technical Reports Server (NTRS)

Halpert, G.; Haynos, J.; Sherfey, J.

1969-01-01

Electrochemical cell assembly, which includes a positive electrode plate between two negative electrode plates, is both flexible and compact, and frangible under severe shock conditions. Leak-tight integrity of the housing is maintained by polymer-to-polymer fusion bonds through holes in the expanded metal electrode terminals.

Feasibility of imaging evoked activity throughout the rat brain using electrical impedance tomography.

PubMed

Faulkner, Mayo; Hannan, Sana; Aristovich, Kirill; Avery, James; Holder, David

2018-05-10

Electrical Impedance Tomography (EIT) is an emerging technique which has been used to image evoked activity during whisker displacement in the cortex of an anaesthetised rat with a spatiotemporal resolution of 200 μm and 2 ms. The aim of this work was to extend EIT to image not only from the cortex but also from deeper structures active in somatosensory processing, specifically the ventral posterolateral (VPL) nucleus of the thalamus. The direct response in the cortex and VPL following 2 Hz forepaw stimulation were quantified using a 57-channel epicortical electrode array and a 16-channel depth electrode. Impedance changes of -0.16 ± 0.08% at 12.9 ± 1.4 ms and -0.41 ± 0.14% at 8.8±1.9 ms were recorded from the cortex and VPL respectively. For imaging purposes, two 57-channel epicortical electrode arrays were used with one placed on each hemisphere of the rat brain. Despite using parameters optimised toward measuring thalamic activity and undertaking extensive averaging, reconstructed activity was constrained to the cortical somatosensory forepaw region and no significant activity at a depth greater than 1.6 mm below the surface of the cortex could be reconstructed. An evaluation of the depth sensitivity of EIT was investigated in simulations using estimates of the conductivity change and noise levels derived from experiments. These indicate that EIT imaging with epicortical electrodes is limited to activity occurring 2.5 mm below the surface of the cortex. This depth includes the hippocampus and so EIT has the potential to image activity, such as epilepsy, originating from this structure. To image deeper activity, however, alternative methods such as the additional implementation of depth electrodes will be required to gain the necessary depth resolution. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

The Importance of the Numerical Resolution of the Laplace Equation in the optimization of a Neuronal Stimulation Technique

NASA Astrophysics Data System (ADS)

Faria, Paula

2010-09-01

For the past few years, the potential of transcranial direct current stimulation (tDCS) for the treatment of several pathologies has been investigated. Knowledge of the current density distribution is an important factor in optimizing such applications of tDCS. For this goal, we used the finite element method to solve the Laplace equation in a spherical head model in order to investigate the three dimensional distribution of the current density and the variation of its intensity with depth using different electrodes montages: the traditional one with two sponge electrodes and new electrode montages: with sponge and EEG electrodes and with EEG electrodes varying the numbers of electrodes. The simulation results confirm the effectiveness of the mixed system which may allow the use of tDCS and EEG recording concomitantly and may help to optimize this neuronal stimulation technique. The numerical results were used in a promising application of tDCS in epilepsy.

Air-cooled, hydrogen-air fuel cell

NASA Technical Reports Server (NTRS)

Shelekhin, Alexander B. (Inventor); Bushnell, Calvin L. (Inventor); Pien, Michael S. (Inventor)

1999-01-01

An air-cooled, hydrogen-air solid polymer electrolyte (SPE) fuel cell with a membrane electrode assembly operatively associated with a fluid flow plate having at least one plate cooling channel extending through the plate and at least one air distribution hole extending from a surface of the cathode flow field into the plate cooling channel.

Nondestructive evaluation of epoxy-coated reinforcing bars in concrete using bi-electrode half-cell potential techniques.

DOT National Transportation Integrated Search

2006-01-01

This study evaluated two half-cell mapping methods for nondestructive evaluation of epoxy-coated rebar (ECR) in concrete: the semi-fixed bi-electrode and the moving bi-electrode methods. These methods were expected to provide early detection of corro...

Therapeutic intraspinal microstimulation improves forelimb function after cervical contusion injury

NASA Astrophysics Data System (ADS)

Kasten, M. R.; Sunshine, M. D.; Secrist, E. S.; Horner, P. J.; Moritz, C. T.

2013-08-01

Objective. Intraspinal microstimulation (ISMS) is a promising method for activating the spinal cord distal to an injury. The objectives of this study were to examine the ability of chronically implanted stimulating wires within the cervical spinal cord to (1) directly produce forelimb movements, and (2) assess whether ISMS stimulation could improve subsequent volitional control of paretic extremities following injury. Approach. We developed a technique for implanting intraspinal stimulating electrodes within the cervical spinal cord segments C6-T1 of Long-Evans rats. Beginning 4 weeks after a severe cervical contusion injury at C4-C5, animals in the treatment condition received therapeutic ISMS 7 hours/day, 5 days/week for the following 12 weeks. Main results. Over 12 weeks of therapeutic ISMS, stimulus-evoked forelimb movements were relatively stable. We also explored whether therapeutic ISMS promoted recovery of forelimb reaching movements. Animals receiving daily therapeutic ISMS performed significantly better than unstimulated animals during behavioural tests conducted without stimulation. Quantitative video analysis of forelimb movements showed that stimulated animals performed better in the movements reinforced by stimulation, including extending the elbow to advance the forelimb and opening the digits. While threshold current to elicit forelimb movement gradually increased over time, no differences were observed between chronically stimulated and unstimulated electrodes suggesting that no additional tissue damage was produced by the electrical stimulation. Significance. The results indicate that therapeutic intraspinal stimulation delivered via chronic microwire implants within the cervical spinal cord confers benefits extending beyond the period of stimulation, suggesting future strategies for neural devices to promote sustained recovery after injury.

Therapeutic intraspinal microstimulation improves forelimb function after cervical contusion injury

PubMed Central

Kasten, M.R.; Sunshine, M.D.; Secrist, E.S.; Horner, P.J.; Moritz, C.T.

2013-01-01

Objective Intraspinal microstimulation (ISMS) is a promising method for activating the spinal cord distal to an injury. The objectives of this study were to examine the ability of chronically implanted stimulating wires within the cervical spinal cord to (1) directly produce forelimb movements, and (2) assess whether ISMS stimulation improved subsequent volitional control of paretic extremities following injury. Approach We developed a technique for implanting intraspinal stimulating electrodes within the cervical spinal cord segments C6-T1 of Long-Evans rats. Beginning 4 weeks after a severe cervical contusion injury at C4–C5, animals in the treatment condition received therapeutic ISMS 7 hours/day, 5 days/week for the following 12 weeks. Main Results Over 12 weeks of therapeutic ISMS, stimulus-evoked forelimb movements were relatively stable. We also explored whether therapeutic ISMS promotes recovery of forelimb reaching movements. Animals receiving daily therapeutic ISMS performed significantly better than unstimulated animals during behavioral tests conducted without stimulation. Quantitative video analysis of forelimb movements showed that stimulated animals performed better in the movements reinforced by stimulation, including extending the elbow to advance the forelimb and opening the digits. While threshold current to elicit forelimb movement gradually increased over time, no differences were observed between chronically stimulated and unstimulated electrodes suggesting that no additional tissue damage was produced by the electrical stimulation. Significance The results indicate that therapeutic intraspinal stimulation delivered via chronic microwire implants within the cervical spinal cord confers benefits extending beyond the period of stimulation, suggesting future strategies for neural devices to promote sustained recovery after injury. PMID:23715242

Modeling of Nickel Hydroxide Electrode Containing Multiple Phases

NASA Technical Reports Server (NTRS)

Timmerman, P.; Ratnakumar, B. V.; Di Stefano, S.

1996-01-01

Mathematical models of alkaline rechargeable nickel cell systems (e.g., Ni-Cd, Ni-H(sub 2) and Ni-MH) have so far been developed based on the assumption that the active material at Ni electrode exists primarily in a single phase as Beta-NiOOH -- Beta-Ni(OH)(sub 2), despite enough experimental evidence for the second phase, i.e., Gamma-NiOOH -- Alpha-Ni(OH)(sub 2), especially under conditions of extended coverage. Here, we have incorporated the additional couple of Gamma-NiOOH -- Alpha-Ni(OH)(sub 2) into the modeling of the Ni electrode.

Recent advances in graphite powder-based electrodes.

PubMed

Bellido-Milla, Dolores; Cubillana-Aguilera, Laura Ma; El Kaoutit, Mohammed; Hernández-Artiga, Ma Purificación; Hidalgo-Hidalgo de Cisneros, José Luis; Naranjo-Rodríguez, Ignacio; Palacios-Santander, José Ma

2013-04-01

Graphite powder-based electrodes have the electrochemical performance of quasi-noble metal electrodes with intrinsic advantages related to the possibility of modification to enhance selectivity and their easily renewable surface, with no need for hazardous acids or bases for their cleaning. In contrast with commercial electrodes, for example screen-printed or sputtered-chip electrodes, graphite powder-based electrodes can also be fabricated in any laboratory with the form and characteristics desired. They are also readily modified with advanced materials, with relatively high reproducibility. All these characteristics make them a very interesting option for obtaining a large variety of electrodes to resolve different kinds of analytical problems. This review summarizes the state-of-the-art, advantages, and disadvantages of graphite powder-based electrodes in electrochemical analysis in the 21st century. It includes recent trends in carbon paste electrodes, devoting special attention to the use of emergent materials as new binders and to the development of other composite electrodes. The most recent advances in the use of graphite powder-modified sol-gel electrodes are also described. The development of sonogel-carbon electrodes and their use in electrochemical sensors and biosensors is included. These materials extend the possibilities of applications, especially for industrial technology-transfer purposes, and their development could affect not only electroanalytical green chemistry but other interesting areas also, for example catalysis and energy conversion and storage.

Insulated electrocardiographic electrodes. [without paste electrolyte

NASA Technical Reports Server (NTRS)

David, R. M.; Portnoy, W. A. (Inventor)

1975-01-01

An integrated system is disclosed including an insulated electrode and an impedance transformer which can be assembled in a small plastic housing and used for the acquisition of electrocardiographic data. The electrode may be employed without a paste electrolyte and may be attached to the body for extended usage without producing skin reaction. The electrode comprises a thin layer of suitable nontoxic dielectric material preferably deposited by radio frequency sputtering onto a conductive substrate. The impedance transformer preferably comprises an operational amplifier having an FET input stage connected in the unity gain configuration which provides a very low lower cut-off frequency, a high input impedance with a very small input bias current, a low output impedance, and a high signal-to-noise ratio.

Hybrid deposition of thin film solid oxide fuel cells and electrolyzers

DOEpatents

Jankowski, A.F.; Makowiecki, D.M.; Rambach, G.D.; Randich, E.

1998-05-19

The use of vapor deposition techniques enables synthesis of the basic components of a solid oxide fuel cell (SOFC); namely, the electrolyte layer, the two electrodes, and the electrolyte-electrode interfaces. Such vapor deposition techniques provide solutions to each of the three critical steps of material synthesis to produce a thin film solid oxide fuel cell (TFSOFC). The electrolyte is formed by reactive deposition of essentially any ion conducting oxide, such as defect free, yttria stabilized zirconia (YSZ) by planar magnetron sputtering. The electrodes are formed from ceramic powders sputter coated with an appropriate metal and sintered to a porous compact. The electrolyte-electrode interface is formed by chemical vapor deposition of zirconia compounds onto the porous electrodes to provide a dense, smooth surface on which to continue the growth of the defect-free electrolyte, whereby a single fuel cell or multiple cells may be fabricated. 8 figs.

A multilayer membrane amperometric glucose sensor fabricated using planar techniques for large-scale production.

PubMed

Matsumoto, T; Saito, S; Ikeda, S

2006-03-23

This paper reports on a multilayer membrane amperometric glucose sensor fabricated using planar techniques. It is characterized by good reproducibility and suitable for large-scale production. The glucose sensor has 82 electrode sets formed on a single glass substrate, each with a platinum working electrode (WE), a platinum counter electrode (CE) and an Ag/AgCl reference electrode (RE). The electrode sets are coated with a membrane consisting of five layers: gamma-aminopropyltriethoxysilane (gamma-APTES), Nafion, glucose oxidase (GOX), gamma-APTES and perfluorocarbon polymer (PFCP), in that order. Tests have shown that the sensor has acceptably low dispersion (relative standard deviation, R.S.D.=42.9%, n=82), a wide measurement range (1.11-111 mM) and measurement stability over a 27-day period. Measurements of the glucose concentration in a control human urine sample demonstrated that the sensor has very low dispersion (R.S.D.=2.49%, n=10).

Hybrid deposition of thin film solid oxide fuel cells and electrolyzers

DOEpatents

Jankowski, Alan F.; Makowiecki, Daniel M.; Rambach, Glenn D.; Randich, Erik

1999-01-01

The use of vapor deposition techniques enables synthesis of the basic components of a solid oxide fuel cell (SOFC); namely, the electrolyte layer, the two electrodes, and the electrolyte-electrode interfaces. Such vapor deposition techniques provide solutions to each of the three critical steps of material synthesis to produce a thin film solid oxide fuel cell (TFSOFC). The electrolyte is formed by reactive deposition of essentially any ion conducting oxide, such as defect free, yttria stabilized zirconia (YSZ) by planar magnetron sputtering. The electrodes are formed from ceramic powders sputter coated with an appropriate metal and sintered to a porous compact. The electrolyte-electrode interface is formed by chemical vapor deposition of zirconia compounds onto the porous electrodes to provide a dense, smooth surface on which to continue the growth of the defect-free electrolyte, whereby a single fuel cell or multiple cells may be fabricated.

Hybrid deposition of thin film solid oxide fuel cells and electrolyzers

DOEpatents

Jankowski, Alan F.; Makowiecki, Daniel M.; Rambach, Glenn D.; Randich, Erik

1998-01-01

The use of vapor deposition techniques enables synthesis of the basic components of a solid oxide fuel cell (SOFC); namely, the electrolyte layer, the two electrodes, and the electrolyte-electrode interfaces. Such vapor deposition techniques provide solutions to each of the three critical steps of material synthesis to produce a thin film solid oxide fuel cell (TFSOFC). The electrolyte is formed by reactive deposition of essentially any ion conducting oxide, such as defect free, yttria stabilized zirconia (YSZ) by planar magnetron sputtering. The electrodes are formed from ceramic powders sputter coated with an appropriate metal and sintered to a porous compact. The electrolyte-electrode interface is formed by chemical vapor deposition of zirconia compounds onto the porous electrodes to provide a dense, smooth surface on which to continue the growth of the defect-free electrolyte, whereby a single fuel cell or multiple cells may be fabricated.

Method of fabrication of electrodes and electrolytes

DOEpatents

Jankowski, Alan F.; Morse, Jeffrey D.

2004-01-06

Fuel cell stacks contain an electrolyte layer surrounded on top and bottom by an electrode layer. Porous electrodes are prepared which enable fuel and oxidant to easily flow to the respective electrode-electrolyte interface without the need for high temperatures or pressures to assist the flow. Rigid, inert microspheres in combination with thin-film metal deposition techniques are used to fabricate porous anodes, cathodes, and electrolytes. Microshperes contained in a liquid are randomly dispersed onto a host structure and dried such that the microsperes remain in position. A thin-film deposition technique is subsequently employed to deposit a metal layer onto the microsperes. After such metal layer deposition, the microspheres are removed leaving voids, i.e. pores, in the metal layer, thus forming a porous electrode. Successive repetitions of the fabrication process result in the formation of a continuous fuel cell stack. Such stacks may produce power outputs ranging from about 0.1 Watt to about 50 Watts.

Domestic and Industrial Water Disinfection Using Boron-Doped Diamond Electrodes

NASA Astrophysics Data System (ADS)

Rychen, Philippe; Provent, Christophe; Pupunat, Laurent; Hermant, Nicolas

This chapter first describes main properties and manufacturing process (production using HF-CVD, quality-control measurements, etc.) of diamond electrodes and more specifically boron-doped diamond (BDD) electrodes. Their exceptional properties make such electrodes particularly suited for many disinfection applications as thanks to their wide working potential window and their high anodic potential, they allow generating a mixture of powerful oxidizing species mainly based on active oxygen and peroxides. Such mixture of disinfecting agents is far more efficient than conventional chemical or physical known techniques. Their efficiency was tested against numerous microorganisms and then proved to be greater than conventional methods. All bacteria and viruses tested up to date were inactivated 3-5 times faster with a treatment based on with BDD electrodes and the DiaCellⓇ technology than with other techniques. Several applications, either industrial or private (wellness and home use), are discussed with a focus on the dedicated products and the main technology advantages.

Influence of surface topology and electrostatic potential on water/electrode systems

NASA Astrophysics Data System (ADS)

Siepmann, J. Ilja; Sprik, Michiel

1995-01-01

We have used the classical molecular dynamics technique to simulate the ordering of a water film adsorbed on an atomic model of a tip of a scanning tunneling microscope approaching a planar metal surface. For this purpose, we have developed a classical model for the water-substrate interactions that solely depends on the coordinates of the particles and does not require the definition of geometrically smooth boundary surfaces or image planes. The model includes both an electrostatic induction for the metal atoms (determined by means of an extended Lagrangian technique) and a site-specific treatment of the water-metal chemisorption. As a validation of the model we have investigated the structure of water monolayers on metal substrates of various topology [the (111), (110), and (100) crystallographic faces] and composition (Pt, Ag, Cu, and Ni), and compared the results to experiments. The modeling of the electrostatic induction is compatible with a finite external potential imposed on the metal. This feature is used to investigate the structural rearrangements of the water bilayer between the pair of scanning tunneling microscope electrodes in response to an applied external voltage difference. We find significant asymmetry in the dependence on the sign of the applied voltage. Another result of the calculation is an estimate of the perturbation to the work function caused by the wetting film. For the conditions typical for operation of a scanning tunneling microscope probe, the change in the work function is found to be comparable to the applied voltage (a few hundred millivolts).

Linear-sweep voltammetry of a soluble redox couple in a cylindrical electrode

NASA Technical Reports Server (NTRS)

Weidner, John W.

1991-01-01

An approach is described for using the linear sweep voltammetry (LSV) technique to study the kinetics of flooded porous electrodes by assuming a porous electrode as a collection of identical noninterconnected cylindrical pores that are filled with electrolyte. This assumption makes possible to study the behavior of this ideal electrode as that of a single pore. Alternatively, for an electrode of a given pore-size distribution, it is possible to predict the performance of different pore sizes and then combine the performance values.

Machining of AISI D2 Tool Steel with Multiple Hole Electrodes by EDM Process

NASA Astrophysics Data System (ADS)

Prasad Prathipati, R.; Devuri, Venkateswarlu; Cheepu, Muralimohan; Gudimetla, Kondaiah; Uzwal Kiran, R.

2018-03-01

In recent years, with the increasing of technology the demand for machining processes is increasing for the newly developed materials. The conventional machining processes are not adequate to meet the accuracy of the machining of these materials. The non-conventional machining processes of electrical discharge machining is one of the most efficient machining processes is being widely used to machining of high accuracy products of various industries. The optimum selection of process parameters is very important in machining processes as that of an electrical discharge machining as they determine surface quality and dimensional precision of the obtained parts, even though time consumption rate is higher for machining of large dimension features. In this work, D2 high carbon and chromium tool steel has been machined using electrical discharge machining with the multiple hole electrode technique. The D2 steel has several applications such as forming dies, extrusion dies and thread rolling. But the machining of this tool steel is very hard because of it shard alloyed elements of V, Cr and Mo which enhance its strength and wear properties. However, the machining is possible by using electrical discharge machining process and the present study implemented a new technique to reduce the machining time using a multiple hole copper electrode. In this technique, while machining with multiple holes electrode, fin like projections are obtained, which can be removed easily by chipping. Then the finishing is done by using solid electrode. The machining time is reduced to around 50% while using multiple hole electrode technique for electrical discharge machining.

Validation of a technique for accurate fine-wire electrode placement into posterior gluteus medius using real-time ultrasound guidance.

PubMed

Hodges, P W; Kippers, V; Richardson, C A

1997-01-01

Fine-wire electromyography is primarily utilised for the recording of activity of the deep musculature, however, due to the location of these muscles, accurate electrode placement is difficult. Real-time ultrasound imaging (RTUI) of muscle tissue has been used for the guidance of the needle insertion for the placement of electrodes into the muscles of the abdominal wall. The validity of RTUI guidance of needle insertion into the deep muscles has not been determined. A cadaveric study was conducted to evaluate the accuracy with which RTUI can be used to guide fine-wire electrode placement using the posterior fibres of gluteus medius (PGM) as an example. Pilot studies revealed that the ultrasound resolution of cadaveric tissue is markedly reduced making it impossible to directly evaluate the technique, therefore, three studies were conducted. An initial study involved the demarcation of the anatomical boundaries of PGM using RTUI to define a technique based on an anatomical landmark that was consisent with the in vivo RTUI guided needle placement technique. This anatomical landmark was then used as the guide for the cadaveric needle insertion. Once the needle was positioned 0.05 ml of dye was introduced and the specimen dissected. The dye was accurately placed in PGM in 100% of the specimens. Finally, fine-wire electrodes were inserted into the PGM of five volunteers and manoeuvres performed indicating the accuracy of placement. This study supports the use of ultrasound imaging for the accurate guidance of needle insertion for fine-wire and needle EMG electrodes.

2014 NEPP Tasks Update for Ceramic and Tantalum Capacitors

NASA Technical Reports Server (NTRS)

Teverovsky, Alexander A.

2014-01-01

Presentation describes recent development in research on MnO2, wet, and polymer tantalum capacitors. Low-voltage failures in multilayer ceramic capacitors and techniques to reveal precious metal electrode (PME) and base metal electrode (BME) capacitors with cracks are discussed. A voltage breakdown technique is suggested to select high quality low-voltage BME ceramic capacitors.

Classification of Spanish white wines using their electrophoretic profiles obtained by capillary zone electrophoresis with amperometric detection.

PubMed

Arribas, Alberto Sánchez; Martínez-Fernández, Marta; Moreno, Mónica; Bermejo, Esperanza; Zapardiel, Antonio; Chicharro, Manuel

2014-06-01

A method was developed for the simultaneous detection of eight polyphenols (t-resveratrol, (+)-catechin, quercetin and p-coumaric, caffeic, sinapic, ferulic, and gallic acids) by CZE with electrochemical detection. Separation of these polyphenols was achieved within 25 min using a 200 mM borate buffer (pH 9.4) containing 10% methanol as separation electrolyte. Amperometric detection of polyphenols was carried out with a glassy carbon electrode (GCE) modified with a multiwalled carbon nanotubes (CNT) layer obtained from a dispersion of CNT in polyethylenimine. The excellent electrochemical properties of this modified electrode allowed the detection and quantification of the selected polyphenols in white wines without any pretreatment step, showing remarkable signal stability despite the presence of potential fouling substances in wine. The electrophoretic profiles of white wines, obtained using this methodology, have proven to be useful for the classification of these wines by means of chemometric multivariate techniques. Principal component analysis and discriminant analysis allowed accurate classification of wine samples on the basis of their grape varietal (verdejo and airén) using the information contained in selected zones of the electropherogram. The utility of the proposed CZE methodology based on the electrochemical response of CNT-modified electrodes appears to be promising in the field of wine industry and it is expected to be successfully extended to classification of a wider range of wines made of other grape varietals. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Electron transport in dipyridazine and dipyridimine molecular junctions: a first-principles investigation

NASA Astrophysics Data System (ADS)

Parashar, Sweta

2018-05-01

We present density functional theory-nonequilibrium Green’s function method for electron transport of dipyridazine and dipyridimine molecular junctions with gold, copper and nickel electrodes. Our investigation reveals that the junctions formed with gold and copper electrodes bridging dipyridazine molecule through thiol anchoring group enhance current as compared to the junctions in which the molecule and electrode were coupled directly. Further, nickel electrode displays weak decrease of current with increase of voltage at about 1.2 V. The result is fully rationalized by means of the distribution of molecular orbitals as well as shift in molecular energy levels and HOMO-LUMO gap with applied bias voltage. Our findings are compared with theoretical and experimental results available for other molecular junctions. Present results predict potential avenues for changing the transport behavior by not only changing the electrodes, but also the position of nitrogen atom and type of anchoring-atom that connect molecule and electrodes, thus extending applications of dipyridazine and dipyridimine molecule in future integrated circuits.

Fabrication of nanoindented electrodes for glucose detection.

PubMed

Slaughter, Gymama

2010-03-01

The objective of this article was to design, fabricate, and evaluate a novel type of glucose biosensors based on the use of atomic force microscopy to create nanoindented electrodes (NIDEs) for the selective detection of glucose. Atomic force microscopy nanoindentation techniques were extended to covalently immobilized glucose oxidase on NIDEs via composite hydrogel membranes composed of interpenetrating networks of inherently conductive poly(3,4-ethylenedioxythiophene) tetramethacrylate grown within ultraviolet cross-linked hydroxyethylmethacrylate-based hydrogels to produce an in vitro amperometric NIDE biosensor for the long-term monitoring of glucose. The calibration curve for glucose was linear from 0.25 to 20 mM. Results showed that the NIDE glucose biosensor has a much higher detection sensitivity of 0.32 microA/mM and rapid response times (<5 seconds). There was no interference from the competing interferent (fructose) present; the only interference was from species that react with H(2)O(2) (ascorbic acid). The linear equation was B(response) (microA) = 0.323 [glucose] (mM) + 0.634 (microA); n = 24, r(2) = 0.994. Results showed that the resultant NIDE glucose biosensor increases the dynamic range, device sensitivity, and response time and has excellent detecting performance for glucose. (c) 2010 Diabetes Technology Society.

Subliminal Salience Search Illustrated: EEG Identity and Deception Detection on the Fringe of Awareness

PubMed Central

Bowman, Howard; Filetti, Marco; Janssen, Dirk; Su, Li; Alsufyani, Abdulmajeed; Wyble, Brad

2013-01-01

We propose a novel deception detection system based on Rapid Serial Visual Presentation (RSVP). One motivation for the new method is to present stimuli on the fringe of awareness, such that it is more difficult for deceivers to confound the deception test using countermeasures. The proposed system is able to detect identity deception (by using the first names of participants) with a 100% hit rate (at an alpha level of 0.05). To achieve this, we extended the classic Event-Related Potential (ERP) techniques (such as peak-to-peak) by applying Randomisation, a form of Monte Carlo resampling, which we used to detect deception at an individual level. In order to make the deployment of the system simple and rapid, we utilised data from three electrodes only: Fz, Cz and Pz. We then combined data from the three electrodes using Fisher's method so that each participant was assigned a single p-value, which represents the combined probability that a specific participant was being deceptive. We also present subliminal salience search as a general method to determine what participants find salient by detecting breakthrough into conscious awareness using EEG. PMID:23372697

A novel MEMS inertial switch with a reinforcing rib structure and electrostatic power assist to prolong the contact time

NASA Astrophysics Data System (ADS)

Li, Jian; Wang, Yan; Yang, Zhuoqing; Ding, Guifu; Zhao, Xiaolin; Wang, Hong

2018-03-01

The MEMS inertial switch is widely used in various industries owing to its advantage of small size, high integration, low power consumption and low costs, especially in the timing of Internet of things, such as toys, handheld devices, accessories and vibration testing. This paper provided a novel inertial switch with a reinforcing rib structure and electrostatic power assist. The designed inertial switch can reduce the complexity of the post-processing circuit and broaden its application prospect. The continuous electrostatic force can extend the contact time of the designed inertia switch before the leakage of electricity ends. The moving electrode with a reinforcing rib structure can effectively restrain the bending of the lower surface of moving electrode caused by residual stress. The array-type fixed electrode can ensure stable contact between the electrodes when the device is sensitive to external shocks. The dynamic displacement-time curve can be simulated by the COMSOL finite element simulation software. The laminated plating process is used to produce the designed inertial switch and the drop hammer acceleration monitoring system is used to test the fabricated device. The results indicate that, compared with the traditional design, the bouncing phenomenon can be prevented and extend the contact time to 336μs.

Plasma Sheet Velocity Measurement Techniques for the Pulsed Plasma Thruster SIMP-LEX

NASA Technical Reports Server (NTRS)

Nawaz, Anuscheh; Lau, Matthew

2011-01-01

The velocity of the first plasma sheet was determined between the electrodes of a pulsed plasma thruster using three measurement techniques: time of flight probe, high speed camera and magnetic field probe. Further, for time of flight probe and magnetic field probe, it was possible to determine the velocity distribution along the electrodes, as the plasma sheet is accelerated. The results from all three techniques are shown, and are compared for one thruster geometry.

Gynecologic electrical impedance tomograph

NASA Astrophysics Data System (ADS)

Korjenevsky, A.; Cherepenin, V.; Trokhanova, O.; Tuykin, T.

2010-04-01

Electrical impedance tomography extends to the new and new areas of the medical diagnostics: lungs, breast, prostate, etc. The feedback from the doctors who use our breast EIT diagnostic system has induced us to develop the 3D electrical impedance imaging device for diagnostics of the cervix of the uterus - gynecologic impedance tomograph (GIT). The device uses the same measuring approach as the breast imaging system: 2D flat array of the electrodes arranged on the probe with handle is placed against the body. Each of the 32 electrodes of the array is connected in turn to the current source while the rest electrodes acquire the potentials on the surface. The current flows through the electrode of the array and returns through the remote electrode placed on the patient's limb. The voltages are measured relative to another remote electrode. The 3D backprojection along equipotential surfaces is used to reconstruct conductivity distribution up to approximately 1 cm in depth. Small number of electrodes enables us to implement real time imaging with a few frames per sec. rate. The device is under initial testing and evaluation of the imaging capabilities and suitability of usage.

Screen-Printed Electrodes Modified with “Green” Metals for Electrochemical Stripping Analysis of Toxic Elements

PubMed Central

Economou, Anastasios

2018-01-01

This work reviews the field of screen-printed electrodes (SPEs) modified with “green” metals for electrochemical stripping analysis of toxic elements. Electrochemical stripping analysis has been established as a useful trace analysis technique offering many advantages compared to competing optical techniques. Although mercury has been the preferred electrode material for stripping analysis, the toxicity of mercury and the associated legal requirements in its use and disposal have prompted research towards the development of “green” metals as alternative electrode materials. When combined with the screen-printing technology, such environment-friendly metals can lead to disposable sensors for trace metal analysis with excellent operational characteristics. This review focuses on SPEs modified with Au, Bi, Sb, and Sn for stripping analysis of toxic elements. Different modification approaches (electroplating, bulk modification, use of metal precursors, microengineering techniques) are considered and representative applications are described. A developing related field, namely biosensing based on stripping analysis of metallic nanoprobe labels, is also briefly mentioned. PMID:29596391

Screen-Printed Electrodes Modified with "Green" Metals for Electrochemical Stripping Analysis of Toxic Elements.

PubMed

Economou, Anastasios

2018-03-29

This work reviews the field of screen-printed electrodes (SPEs) modified with "green" metals for electrochemical stripping analysis of toxic elements. Electrochemical stripping analysis has been established as a useful trace analysis technique offering many advantages compared to competing optical techniques. Although mercury has been the preferred electrode material for stripping analysis, the toxicity of mercury and the associated legal requirements in its use and disposal have prompted research towards the development of "green" metals as alternative electrode materials. When combined with the screen-printing technology, such environment-friendly metals can lead to disposable sensors for trace metal analysis with excellent operational characteristics. This review focuses on SPEs modified with Au, Bi, Sb, and Sn for stripping analysis of toxic elements. Different modification approaches (electroplating, bulk modification, use of metal precursors, microengineering techniques) are considered and representative applications are described. A developing related field, namely biosensing based on stripping analysis of metallic nanoprobe labels, is also briefly mentioned.

Reactivating the Ni-YSZ electrode in solid oxide cells and stacks by infiltration

NASA Astrophysics Data System (ADS)

Skafte, Theis Løye; Hjelm, Johan; Blennow, Peter; Graves, Christopher

2018-02-01

The solid oxide cell (SOC) could play a vital role in energy storage when the share of intermittent electricity production is high. However, large-scale commercialization of the technology is still hindered by the limited lifetime. Here, we address this issue by examining the potential for repairing various failure and degradation mechanisms occurring in the fuel electrode, thereby extending the potential lifetime of a SOC system. We successfully infiltrated the nickel and yttria-stabilized zirconia cermet electrode in commercial cells with Gd-doped ceria after operation. By this method we fully reactivated the fuel electrode after simulated reactant starvation and after carbon formation. Furthermore, by infiltrating after 900 h of operation, the degradation of the fuel electrode was reduced by a factor of two over the course of 2300 h. Lastly, the scalability of the concept is demonstrated by reactivating an 8-cell stack based on a commercial design.

Carbon deposition behaviour in metal-infiltrated gadolinia doped ceria electrodes for simulated biogas upgrading in solid oxide electrolysis cells

NASA Astrophysics Data System (ADS)

Duboviks, V.; Lomberg, M.; Maher, R. C.; Cohen, L. F.; Brandon, N. P.; Offer, G. J.

2015-10-01

One of the attractive applications for reversible Solid Oxide Cells (SOCs) is to convert CO2 into CO via high temperature electrolysis, which is particularly important for biogas upgrading. To improve biogas utility, the CO2 component can be converted into fuel via electrolysis. A significant issue for SOC operation on biogas is carbon-induced catalyst deactivation. Nickel is widely used in SOC electrodes for reasons of cost and performance, but it has a low tolerance to carbon deposition. Two different modes of carbon formation on Ni-based electrodes are proposed in the present work based on ex-situ Raman measurements which are in agreement with previous studies. While copper is known to be resistant towards carbon formation, two significant issues have prevented its application in SOC electrodes - namely its relatively low melting temperature, inhibiting high temperature sintering, and low catalytic activity for hydrogen oxidation. In this study, the electrodes were prepared through a low temperature metal infiltration technique. Since the metal infiltration technique avoids high sintering temperatures, Cu-Ce0.9Gd0.1O2-δ (Cu-CGO) electrodes were fabricated and tested as an alternative to Ni-CGO electrodes. We demonstrate that the performance of Cu-CGO electrodes is equivalent to Ni-CGO electrodes, whilst carbon formation is fully suppressed when operated on biogas mixture.

In situ electrochemical investigations of the kinetic and thermodynamic properties of nickel-metal hydride traction batteries

NASA Astrophysics Data System (ADS)

Yang, Xiao Guang; Liaw, Bor Yann

Although large ampere hour nickel-metal hydride (Ni-MH) traction batteries are in the stage of being commercialized for electric and hybrid vehicle applications, little is known about their performance characteristics. By using a standard Hg/HgO reference electrode in a commercial Ni-MH battery, we were able to conduct in situ measurements to determine both kinetic and thermodynamic properties of the system, including the characteristics of individual electrodes. Using the galvanostatic intermittent titration technique (GITT), we simultaneously and effectively determined the open-circuit voltage of the battery, the equilibrium electrode potentials, and the diffusion coefficient of proton and hydrogen in the nickel and metal hydride electrode, respectively, as a function of the states of charge (SOC). Using the current-step excitation technique, we found that the internal resistance of the battery primarily comes from the metal hydride electrode, which is greater by one order of magnitude than that of the Ni electrode. The cyclic linear micro-polarization experiments, on the other hand, showed that the charge-transfer resistance of the electrochemical reaction at the metal hydride electrode is about twice larger than that of the Ni counterpart above 20% SOC. In comparison, the internal resistance is an order of magnitude smaller than those of the electrochemical charge-transfer reactions. The micro-polarization technique also allowed us to calculate the exchange current densities of the respective electrode electrochemical reactions and the associated specific exchange current densities. These in situ, simple but detailed, characterizations of the thermodynamic and kinetic properties of the Ni-MH system provided valuable information for better understanding of the battery performance.

Added clinical value of the inferior temporal EEG electrode chain.

PubMed

Bach Justesen, Anders; Eskelund Johansen, Ann Berit; Martinussen, Noomi Ida; Wasserman, Danielle; Terney, Daniella; Meritam, Pirgit; Gardella, Elena; Beniczky, Sándor

2018-01-01

To investigate the diagnostic added value of supplementing the 10-20 EEG array with six electrodes in the inferior temporal chain. EEGs were recorded with 25 electrodes: 19 positions of the 10-20 system, and six additional electrodes in the inferior temporal chain (F9/10, T9/10, P9/10). Five-hundred consecutive standard and sleep EEG recordings were reviewed using the 10-20 array and the extended array. We identified the recordings with EEG abnormalities that had peak negativities at the inferior temporal electrodes, and those that only were visible at the inferior temporal electrodes. From the 286 abnormal recordings, the peak negativity was at the inferior temporal electrodes in 81 cases (28.3%) and only visible at the inferior temporal electrodes in eight cases (2.8%). In the sub-group of patients with temporal abnormalities (n = 134), these represented 59% (peak in the inferior chain) and 6% (only seen at the inferior chain). Adding six electrodes in the inferior temporal electrode chain to the 10-20 array improves the localization and identification of EEG abnormalities, especially those located in the temporal region. Our results suggest that inferior temporal electrodes should be added to the EEG array, to increase the diagnostic yield of the recordings. Copyright © 2017 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.

Evaluation of high-perimeter electrode designs for deep brain stimulation

NASA Astrophysics Data System (ADS)

Howell, Bryan; Grill, Warren M.

2014-08-01

Objective. Deep brain stimulation (DBS) is an effective treatment for movement disorders and a promising therapy for treating epilepsy and psychiatric disorders. Despite its clinical success, complications including infections and mis-programing following surgical replacement of the battery-powered implantable pulse generator adversely impact the safety profile of this therapy. We sought to decrease power consumption and extend battery life by modifying the electrode geometry to increase stimulation efficiency. The specific goal of this study was to determine whether electrode contact perimeter or area had a greater effect on increasing stimulation efficiency. Approach. Finite-element method (FEM) models of eight prototype electrode designs were used to calculate the electrode access resistance, and the FEM models were coupled with cable models of passing axons to quantify stimulation efficiency. We also measured in vitro the electrical properties of the prototype electrode designs and measured in vivo the stimulation efficiency following acute implantation in anesthetized cats. Main results. Area had a greater effect than perimeter on altering the electrode access resistance; electrode (access or dynamic) resistance alone did not predict stimulation efficiency because efficiency was dependent on the shape of the potential distribution in the tissue; and, quantitative assessment of stimulation efficiency required consideration of the effects of the electrode-tissue interface impedance. Significance. These results advance understanding of the features of electrode geometry that are important for designing the next generation of efficient DBS electrodes.

Assessment of Boron Doped Diamond Electrode Quality and Application to In Situ Modification of Local pH by Water Electrolysis.

PubMed

Read, Tania L; Macpherson, Julie V

2016-01-06

Boron doped diamond (BDD) electrodes have shown considerable promise as an electrode material where many of their reported properties such as extended solvent window, low background currents, corrosion resistance, etc., arise from the catalytically inert nature of the surface. However, if during the growth process, non-diamond-carbon (NDC) becomes incorporated into the electrode matrix, the electrochemical properties will change as the surface becomes more catalytically active. As such it is important that the electrochemist is aware of the quality and resulting key electrochemical properties of the BDD electrode prior to use. This paper describes a series of characterization steps, including Raman microscopy, capacitance, solvent window and redox electrochemistry, to ascertain whether the BDD electrode contains negligible NDC i.e. negligible sp(2) carbon. One application is highlighted which takes advantage of the catalytically inert and corrosion resistant nature of an NDC-free surface i.e. stable and quantifiable local proton and hydroxide production due to water electrolysis at a BDD electrode. An approach to measuring the local pH change induced by water electrolysis using iridium oxide coated BDD electrodes is also described in detail.

Assessment of Boron Doped Diamond Electrode Quality and Application to In Situ Modification of Local pH by Water Electrolysis

PubMed Central

Read, Tania L.; Macpherson, Julie V.

2016-01-01

Boron doped diamond (BDD) electrodes have shown considerable promise as an electrode material where many of their reported properties such as extended solvent window, low background currents, corrosion resistance, etc., arise from the catalytically inert nature of the surface. However, if during the growth process, non-diamond-carbon (NDC) becomes incorporated into the electrode matrix, the electrochemical properties will change as the surface becomes more catalytically active. As such it is important that the electrochemist is aware of the quality and resulting key electrochemical properties of the BDD electrode prior to use. This paper describes a series of characterization steps, including Raman microscopy, capacitance, solvent window and redox electrochemistry, to ascertain whether the BDD electrode contains negligible NDC i.e. negligible sp2 carbon. One application is highlighted which takes advantage of the catalytically inert and corrosion resistant nature of an NDC-free surface i.e. stable and quantifiable local proton and hydroxide production due to water electrolysis at a BDD electrode. An approach to measuring the local pH change induced by water electrolysis using iridium oxide coated BDD electrodes is also described in detail. PMID:26779959

Fabrication of hollow nanorod electrodes based on RuO2//Fe2O3 for an asymmetric supercapacitor.

PubMed

Wang, Qiufan; Liang, Xiao; Ma, Yun; Zhang, Daohong

2018-06-12

In this work, hollow RuO2 nanotube arrays were successfully grown on carbon cloth by using a facile two-step method to fabricate a binder-free electrode. The well-aligned electrode displays excellent electrochemical performance. By using RuO2 hollow nanotube arrays as the positive electrode and Fe2O3 as the negative electrode, a flexible solid-state asymmetric supercapacitor (ASC) has been fabricated which exhibited excellent electrochemical performance, such as a high capacitance of 4.9 F cm-3, a high energy density of 1.5 mW h cm-3 and a high power density of 9.1 mW cm-3. In addition, the two-electrode SC shows high cycling stability with 97% capacitance retention after 5000 charge-discharge cycles. These excellent electrochemical performances are ascribed to the unique hollow structural design of electrodes, which can shorten the ion diffusion length, provide a fast ion transport channel, and offer a large electrode/electrolyte interface for the charge-transfer reaction. The structural design and the synthesis approach are general and can be extended to synthesizing a broad range of materials systems.

Extended range chemical sensing apparatus

DOEpatents

Hughes, Robert C.; Schubert, W. Kent

1994-01-01

An apparatus for sensing chemicals over extended range of concentrations. In particular, first and second sensors each having separate, but overlapping ranges for sensing concentrations of hydrogen are provided. Preferably, the first sensor is a MOS solid state device wherein the metal electrode or gate is a nickel alloy. The second sensor is a chemiresistor comprising a nickel alloy.

A Gas-Sensor-Based Urea Enzyme Electrode: Its Construction and Use in the Undergraduate Laboratory.

ERIC Educational Resources Information Center

Riechel, Thomas L.

1984-01-01

Describes an undergraduate experiment for the potentiometric determination of urea based on the physical entrapment of urease on the tip of an ammonia gas sensor. An advantage of this technique is the ease with which the ammonia electrode can be converted to a urea electrode. (JN)

Reversibly immobilized biological materials in monolayer films on electrodes

DOEpatents

Weaver, P.F.; Frank, A.J.

1993-05-04

Methods and techniques are described for reversibly binding charged biological particles in a fluid medium to an electrode surface. The methods are useful in a variety of applications. The biological materials may include microbes, proteins, and viruses. The electrode surface may consist of reversibly electroactive materials such as polyvinylferrocene, silicon-linked ferrocene or quinone.

Reversibly immobilized biological materials in monolayer films on electrodes

DOEpatents

Weaver, Paul F.; Frank, Arthur J.

1993-01-01

Methods and techniques are described for reversibly binding charged biological particles in a fluid medium to an electrode surface. The methods are useful in a variety of applications. The biological materials may include microbes, proteins, and viruses. The electrode surface may consist of reversibly electroactive materials such as polyvinylferrocene, silicon-linked ferrocene or quinone.

Prototype for Automatable, Dielectrophoretically-Accessed Intracellular Membrane–Potential Measurements by Metal Electrodes

PubMed Central

Sukhorukov, Vladimir L.; Zimmermann, Dirk

2013-01-01

Abstract Functional access to membrane proteins, for example, ion channels, of individual cells is an important prerequisite in drug discovery studies. The highly sophisticated patch-clamp method is widely used for electrogenic membrane proteins, but is demanding for the operator, and its automation remains challenging. The dielectrophoretically-accessed, intracellular membrane–potential measurement (DAIMM) method is a new technique showing high potential for automation of electrophysiological data recording in the whole-cell configuration. A cell suspension is brought between a mm-scaled planar electrode and a μm-scaled tip electrode, placed opposite to each other. Due to the asymmetric electrode configuration, the application of alternating electric fields (1–5 MHz) provokes a dielectrophoretic force acting on the target cell. As a consequence, the cell is accelerated and pierced by the tip electrode, hence functioning as the internal (working) electrode. We used the light-gated cation channel Channelrhodopsin-2 as a reporter protein expressed in HEK293 cells to characterize the DAIMM method in comparison with the patch-clamp technique. PMID:22994967

Potentiodynamic Corrosion Testing.

PubMed

Munir, Selin; Pelletier, Matthew H; Walsh, William R

2016-09-04

Different metallic materials have different polarization characteristics as dictated by the open circuit potential, breakdown potential, and passivation potential of the material. The detection of these electrochemical parameters identifies the corrosion factors of a material. A reliable and well-functioning corrosion system is required to achieve this. Corrosion of the samples was achieved via a potentiodynamic polarization technique employing a three-electrode configuration, consisting of reference, counter, and working electrodes. Prior to commencement a baseline potential is obtained. Following the stabilization of the corrosion potential (Ecorr), the applied potential is ramped at a slow rate in the positive direction relative to the reference electrode. The working electrode was a stainless steel screw. The reference electrode was a standard Ag/AgCl. The counter electrode used was a platinum mesh. Having a reliable and well-functioning in vitro corrosion system to test biomaterials provides an in-expensive technique that allows for the systematic characterization of the material by determining the breakdown potential, to further understand the material's response to corrosion. The goal of the protocol is to set up and run an in vitro potentiodynamic corrosion system to analyze pitting corrosion for small metallic medical devices.

Electrochemically active biofilms: facts and fiction. A review

PubMed Central

Babauta, Jerome; Renslow, Ryan; Lewandowski, Zbigniew; Beyenal, Haluk

2014-01-01

This review examines the electrochemical techniques used to study extracellular electron transfer in the electrochemically active biofilms that are used in microbial fuel cells and other bioelectrochemical systems. Electrochemically active biofilms are defined as biofilms that exchange electrons with conductive surfaces: electrodes. Following the electrochemical conventions, and recognizing that electrodes can be considered reactants in these bioelectrochemical processes, biofilms that deliver electrons to the biofilm electrode are called anodic, ie electrode-reducing, biofilms, while biofilms that accept electrons from the biofilm electrode are called cathodic, ie electrode-oxidizing, biofilms. How to grow these electrochemically active biofilms in bioelec-trochemical systems is discussed and also the critical choices made in the experimental setup that affect the experimental results. The reactor configurations used in bioelectrochemical systems research are also described and the authors demonstrate how to use selected voltammetric techniques to study extracellular electron transfer in bioelectrochemical systems. Finally, some critical concerns with the proposed electron transfer mechanisms in bioelectrochemical systems are addressed together with the prospects of bioelectrochemical systems as energy-converting and energy-harvesting devices. PMID:22856464

Chromophore Poling in Thin Films of Organic Glasses. 2. Two-Electrode Corona Discharge Setup

NASA Astrophysics Data System (ADS)

Vilitis, O.; Muzikante, I.; Rutkis, M.; Vembris, A.

2012-01-01

In Part 1 of the article we provided description of the corona discharge physics and overview of the methods used for corona poling in thin organic films. Subsequent sections describe comparatively simple technical methods for poling the organic nonlinear optical polymers using a two-electrode (point-to-plate or wire-to-plate) technique. The polarization build-up was studied by the DC positive corona method for poling the nonlinear optical (NLO) polymers. The experimental setup provides the corona discharge current from 0.5 μA up to 3 μA by applying 3 kV - 12 kV voltage to the corona electrode and makes possible selection among the types of corona electrodes (needle, multi-needle, wire, etc.). The results of experimental testing of the poling setup show that at fixed optimal operational parameters of poling - the sample orientation temperature and the discharge current - the corona charging of polymeric materials can successfully be performed applying the two-electrode technique. To study the dynamics of both poling and charge transport processes the three-electrode charging system - a corona triode - should be applied.

Microcurrent therapeutic technique for treatment of radiation toxicity

DOEpatents

Lennox, Arlene; Funder, Sandra

2000-01-01

The present technique provides a method of remediating the toxicities associated with radiation therapy. A conductive gel is applied to the affected bodily area. A sinusoidally pulsed biphasic DC current is then applied to the affected bodily area using at least one electrode. The electrode is manipulated using active tactile manipulation by for a predetermined time and the frequency of the sinusoidally pulsed biphasic DC current is decreased during the course of the treatment. The method also includes applying a spiked pulsed biphasic DC current to the affected bodily area using at least one electrode. This electrode is also manipulated using active tactile manipulation by for a predetermined time and the frequency of the spiked pulsed biphasic DC current is also decreased during the course of the treatment.

Investigation of subdural electrode displacement in invasive epilepsy surgery workup using neuronavigation and intraoperative MRI.

PubMed

Sommer, Bjoern; Rampp, Stefan; Doerfler, Arnd; Stefan, Hermann; Hamer, Hajo M; Buchfelder, Michael; Roessler, Karl

2018-06-19

One of the main obstacles of electrode implantation in epilepsy surgery is the electrode shift between implantation and the day of explantation. We evaluated this possible electrode displacement using intraoperative MRI (iopMRI) data and CT/MRI reconstruction. Thirteen patients (nine female, four male, median age 26 ± 9.4 years) suffering from drug-resistant epilepsy were examined. After implantation, the position of subdural electrodes was evaluated by 3.0 T-MRI and thin-slice CCT for 3D reconstruction. Localization of electrodes was performed with the volume-rendering technique. Post-implantation and pre-explantation 1.5 T-iopMRI scans were coregistered with the 3D reconstructions to determine the extent of electrode dislocation. Intraoperative MRI at the time of explantation revealed a relevant electrode shift in one patient (8%) of 10 mm. Median electrode displacement was 1.7 ± 2.6 mm with a coregistration error of 1.9 ± 0.7 mm. The median accuracy of the neuronavigation system was 2.2 ± 0.9 mm. Six of twelve patients undergoing resective surgery were seizure free (Engel class 1A, median follow-up 37.5 ± 11.8 months). Comparison of pre-explantation and post-implantation iopMRI scans with CT/MRI data using the volume-rendering technique resulted in an accurate placement of electrodes. In one patient with a considerable electrode dislocation, the surgical approach and extent was changed due to the detected electrode shift. ECoG: electrocorticography; EZ: epileptogenic zone; iEEG: invasive EEG; iopMRI: intraoperative MRI; MEG: magnetoencephalography; PET: positron emission tomography; SPECT: single photon emission computed tomography; 3D: three-dimensional.

Self-Assembled Films of Dendrimers and Metallophthalocyanines as FET-Based Glucose Biosensors

PubMed Central

Vieira, Nirton C.S.; Figueiredo, Alessandra; de Queiroz, Alvaro A.A.; Zucolotto, Valtencir; Guimarães, Francisco E.G.

2011-01-01

Separative extended gate field effect transistor (SEGFET) type devices have been used as an ion sensor or biosensor as an alternative to traditional ion sensitive field effect transistors (ISFETs) due to their robustness, ease of fabrication, low cost and possibility of FET isolation from the chemical environment. The layer-by-layer technique allows the combination of different materials with suitable properties for enzyme immobilization on simple platforms such as the extended gate of SEGFET devices enabling the fabrication of biosensors. Here, glucose biosensors based on dendrimers and metallophthalocyanines (MPcs) in the form of layer-by-layer (LbL) films, assembled on indium tin oxide (ITO) as separative extended gate material, has been produced. NH3+ groups in the dendrimer allow electrostatic interactions or covalent bonds with the enzyme (glucose oxidase). Relevant parameters such as optimum pH, buffer concentration and presence of serum bovine albumin (BSA) in the immobilization process were analyzed. The relationship between the output voltage and glucose concentration shows that upon detection of a specific analyte, the sub-products of the enzymatic reaction change the pH locally, affecting the output signal of the FET transducer. In addition, dendritic layers offer a nanoporous environment, which may be permeable to H+ ions, improving the sensibility as modified electrodes for glucose biosensing. PMID:22163704

High power density fuel cell comprising an array of microchannels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sopchak, David A; Morse, Jeffrey D; Upadhye, Ravindra S

2014-05-06

A phosphoric acid fuel cell according to one embodiment includes an array of microchannels defined by a porous electrolyte support structure extending between bottom and upper support layers, the microchannels including fuel and oxidant microchannels; fuel electrodes formed along some of the microchannels; and air electrodes formed along other of the microchannels. A method of making a phosphoric acid fuel cell according to one embodiment includes etching an array of microchannels in a substrate, thereby forming walls between the microchannels; processing the walls to make the walls porous, thereby forming a porous electrolyte support structure; forming anode electrodes along somemore » of the walls; forming cathode electrodes along other of the walls; and filling the porous electrolyte support structure with a phosphoric acid electrolyte. Additional embodiments are also disclosed.« less

Cell structure for electrochemical devices and method of making same

DOEpatents

Kaun, Thomas D.

2007-03-27

An electrochemical device comprising alternating layers of positive and negative electrodes separated from each other by separator layers. The electrode layers extend beyond the periphery of the separator layers providing superior contact between the electrodes and battery terminals, eliminating the need for welding the electrode to the terminal. Electrical resistance within the battery is decreased and thermal conductivity of the cell is increased allowing for superior heat removal from the battery and increased efficiency. Increased internal pressure within the battery can be alleviated without damaging or removing the battery from service while keeping the contents of the battery sealed off from the atmosphere by a pressure release system. Nonoperative cells within a battery assembly can also be removed from service by shorting the nonoperative cell thus decreasing battery life.

Electrochemical impedance spectroscopy of lithium-titanium disulfide rechargeable cells

NASA Technical Reports Server (NTRS)

Narayanan, S. R.; Shen, D. H.; Surampudi, S.; Attia, A. I.; Halpert, G.

1993-01-01

The two-terminal alternating current impedance of Li/TiS2 rechargeable cells was studied as a function of frequency, state-of-charge, and extended cycling. Analysis based on a plausible equivalent circuit model for the Li/TiS2 cell leads to evaluation of kinetic parameters for the various physicochemical processes occurring at the electrode/electrolyte interfaces. To investigate the causes of cell degradation during extended cycling, the parameters evaluated for cells cycled 5 times were compared with the parameters of cells cycled over 600 times. The findings are that the combined ohmic resistance of the electrolyte and electrodes suffers a tenfold increase after extended cycling, while the charge-transfer resistance and diffusional impedance at the TiS2/electrolyte interface are not significantIy affected. The results reflect the morphological change and increase in area of the anode due to cycling. The study also shows that overdischarge of a cathode-limited cell causes a decrease in the diffusion coefficient of the lithium ion in the cathode.

Extended Gate Field-Effect Transistor Biosensors for Point-Of-Care Testing of Uric Acid.

PubMed

Guan, Weihua; Reed, Mark A

2017-01-01

An enzyme-free redox potential sensor using off-chip extended-gate field effect transistor (EGFET) with a ferrocenyl-alkanethiol modified gold electrode has been used to quantify uric acid concentration in human serum and urine. Hexacyanoferrate (II) and (III) ions are used as redox reagent. The potentiometric sensor measures the interface potential on the ferrocene immobilized gold electrode, which is modulated by the redox reaction between uric acid and hexacyanoferrate ions. The device shows a near Nernstian response to uric acid and is highly specific to uric acid in human serum and urine. The interference that comes from glucose, bilirubin, ascorbic acid, and hemoglobin is negligible in the normal concentration range of these interferents. The sensor also exhibits excellent long term reliability and is regenerative. This extended gate field effect transistor based sensor is promising for point-of-care detection of uric acid due to the small size, low cost, and low sample volume consumption.

The role of upstream distal electrodes in mitigating electrochemical degradation of ionic liquid ion sources

NASA Astrophysics Data System (ADS)

Brikner, Natalya; Lozano, Paulo C.

2012-11-01

Ionic liquid ion sources produce molecular ions from micro-tip emitters wetted with room-temperature molten salts. When a single ion polarity is extracted, counterions accumulate and generate electrochemical reactions that limit the source lifetime. The dynamics of double layer formation are reviewed and distal electrode contacts are introduced to resolve detrimental electrochemical decomposition effects at the micro-tip apex. By having the emitter follow the ionic liquid potential, operation can be achieved for an extended period of time with no apparent degradation of the material, indicating that electrochemistry can be curtailed and isolated to the upstream distal electrode.

Dry electrode bio-potential recordings.

PubMed

Gargiulo, Gaetano; Bifulco, Paolo; McEwan, Alistair; Nasehi Tehrani, Joubin; Calvo, Rafael A; Romano, Maria; Ruffo, Mariano; Shephard, Richard; Cesarelli, Mario; Jin, Craig; Mohamed, Armin; van Schaik, André

2010-01-01

As wireless bio-medical long term monitoring moves towards personal monitoring it demands very high input impedance systems capable to extend the reading of bio-signal during the daily activities offering a kind of "stress free", convenient connection, with no need for skin preparation. In particular we highlight the development and broad applications of our own circuits for wearable bio-potential sensor systems enabled by the use of an FET based amplifier circuit with sufficiently high impedance to allow the use of passive dry electrodes which overcome the significant barrier of gel based contacts. In this paper we present the ability of dry electrodes in long term monitoring of ECG, EEG and fetal ECG.

Extremely high resolution 3D electrical resistivity tomography to depict archaeological subsurface structures

NASA Astrophysics Data System (ADS)

Al-Saadi, Osamah; Schmidt, Volkmar; Becken, Michael; Fritsch, Thomas

2017-04-01

Electrical resistivity tomography (ERT) methods have been increasingly used in various shallow depth archaeological prospections in the last few decades. These non-invasive techniques are very useful in saving time, costs, and efforts. Both 2D and 3D ERT techniques are used to obtain detailed images of subsurface anomalies. In two surveyed areas near Nonnweiler (Germany), we present the results of the full 3D setup with a roll-along technique and of the quasi-3D setup (parallel and orthogonal profiles in dipole-dipole configuration). In area A, a dipole-dipole array with 96 electrodes in a uniform rectangular survey grid has been used in full 3D to investigate a presumed Roman building. A roll-along technique has been utilized to cover a large part of the archaeological site with an electrode spacing of 1 meter and with 0.5 meter for a more detailed image. Additional dense parallel 2D profiles have been carried out in dipole-dipole array with 0.25 meter electrode spacing and 0.25 meter between adjacent profiles in both direction for higher- resolution subsurface images. We have designed a new field procedure, which used an electrode array fixed in a frame. This facilitates efficient field operation, which comprised 2376 electrode positions. With the quasi 3D imaging, we confirmed the full 3D inversion model but at a much better resolution. In area B, dense parallel 2D profiles were directly used to survey the second target with also 0.25 meter electrode spacing and profiles separation respectively. The same field measurement design has been utilized and comprised 9648 electrode positions in total. The quasi-3D inversion results clearly revealed the main structures of the Roman construction. These ERT inversion results coincided well with the archaeological excavation, which has been done in some parts of this area. The ERT result successfully images parts from the walls and also smaller internal structures of the Roman building.

Residual water bactericide monitor development program

NASA Technical Reports Server (NTRS)

1973-01-01

A silver-ion bactericidal monitor is considered for the Space Shuttle Potable Water System. Potentiometric measurement using an ion-selective electrode is concluded to be the most feasible of available techniques. Four commercially available electrodes and a specially designed, solid-state, silver-sulfide electrode were evaluated for their response characteristics and suitability for space use. The configuration of the solid-state electrode with its Nernstian response of 10 to 10,000 ppb silver shows promise for use in space. A pressurized double-junction reference electrode with a quartz-fiber junction and a replaceable bellows electrolyte reservoir was designed verification-tested, and paired with a solid-state silver-sulfide electrode in a test fixture.

Surgical implications of perimodiolar cochlear implant electrode design: avoiding intracochlear damage and scala vestibuli insertion.

PubMed

Briggs, R J; Tykocinski, M; Saunders, E; Hellier, W; Dahm, M; Pyman, B; Clark, G M

2001-09-01

To review the mechanisms and nature of intracochlear damage associated with cochlear implant electrode array insertion, in particular, the various perimodiolar electrode designs. Make recommendations regarding surgical techniques for the Nucleus Contour electrode to ensure correct position and minimal insertion trauma. The potential advantages of increased modiolar proximity of intracochlear multichannel electrode arrays are a reduction in stimulation thresholds, an increase in dynamic range and more localized neural excitation. This may improve speech perception and reduce power consumption. These advantages may be negated if increased intracochlear damage results from the method used to position the electrodes close to the modiolus. A review of the University of Melbourne Department of Otolaryngology experience with temporal bone safety studies using the Nucleus standard straight electrode array and a variety of perimodiolar electrode array designs; comparison with temporal bone insertion studies from other centres and postmortem histopathology studies reported in the literature. Review of our initial clinical experience using the Nucleus Contour electrode array. The nature of intracochlear damage resulting from electrode insertion trauma ranges from minor, localized, spiral ligament tear to diffuse organ of Corti disruption and osseous spiral lamina fracture. The type of damage depends on the mechanical characteristics of the electrode array, the stiffness, curvature and size of the electrode in relation to the scala, and the surgical technique. The narrow, flexible, straight arrays are the least traumatic. Pre-curved or stiffer arrays are associated with an incidence of basilar membrane perforation. The cochleostomy must be correctly sited in relation to the round window to ensure scala tympani insertion. A cochleostomy anterior to the round window rather than inferior may lead to scala media or scala vestibuli insertion. Proximity of electrodes to the modiolus can be achieved without intracochlear damage provided the electrode array is a free fit within the scala, of appropriate size and shape, and accurate scala tympani insertion is performed.

Fabrication and characterization of microsieve electrode array (µSEA) enabling cell positioning on 3D electrodes

NASA Astrophysics Data System (ADS)

Schurink, B.; Tiggelaar, R. M.; Gardeniers, J. G. E.; Luttge, R.

2017-01-01

Here the fabrication and characterization of a novel microelectrode array for electrophysiology applications is described, termed a micro sieve electrode array (µSEA). This silicon based µSEA device allows for hydrodynamic parallel positioning of single cells on 3D electrodes realized on the walls of inverted pyramidal shaped pores. To realize the µSEA, a previously realized silicon sieving structure is provided with a patterned boron doped poly-silicon, connecting the contact electrodes with the 3D sensing electrodes in the pores. A LPCVD silicon-rich silicon nitride layer was used as insulation. The selective opening of this insulation layer at the ends of the wiring lines allows to generate well-defined contact and sensing electrodes according to the layout used in commercial microelectrode array readers. The main challenge lays in the simultaneously selective etching of material at both the planar surface (contact electrode) as well as in the sieving structure containing the (3D) pores (sensing electrodes). For the generation of 3D electrodes in the pores a self-aligning technique was developed using the pore geometry to our advantage. This technique, based on sacrificial layer etching, allows for the fine tuning of the sensing electrode surface area and thus supports the positioning and coupling of single cells on the electrode surface in relation to the cell size. Furthermore, a self-aligning silicide is formed on the sensing electrodes to favour the electrical properties. Experiments were performed to demonstrate the working principle of the µSEA using different types of neuronal cells. Capture efficiency in the pores was  >70% with a 70% survival rate of the cell maintained for up to 14 DIV. The TiSi2-boron-doped-poly-silicon sensing electrodes of the µSEA were characterized, which indicated noise levels of  <15 µV and impedance values of 360 kΩ. These findings potentially allow for future electrophysiological measurements using the µSEA.

Brief review: Preparation techniques of biomass based activated carbon monolith electrode for supercapacitor applications

NASA Astrophysics Data System (ADS)

Taer, Erman; Taslim, Rika

2018-02-01

The synthesis of activated carbon monolith electrode made from a biomass material using the hydrolytic pressure or the pelletization technique of pre-carbonized materials is one of standard reported methods. Several steps such as pre-carbonization, milling, chemical activation, hydraulic press, carbonization, physical activation, polishing and washing need to be accomplished in the production of electrodes by this method. This is relatively a long process that need to be simplified. In this paper we present the standard method and proceed with the introduction to several alternative methods in the synthesis of activated carbon monolith electrodes. The alternative methods were emphasized on the selection of suitable biomass materials. All of carbon electrodes prepared by different methods will be analyzed for physical and electrochemical properties. The density, degree of crystallinity, surface morphology are examples for physical study and specific capacitance was an electrochemical properties that has been analysed. This alternative method has offered a specific capacitance in the range of 10 to 171 F/g.

Operando analysis of lithium profiles in Li-ion batteries using nuclear microanalysis

NASA Astrophysics Data System (ADS)

Surblé, S.; Paireau, C.; Martin, J.-F.; Tarnopolskiy, V.; Gauthier, M.; Khodja, H.; Daniel, L.; Patoux, S.

2018-07-01

A wide variety of analytical methods are used for studying the behavior of lithium-ion batteries and particularly the lithium ion distribution in the electrodes. However, the development of in situ/operando techniques proved powerful to understand the mechanisms responsible for the lithium trapping and then the aging phenomenon. Herein, we report the design of an electrochemical cell to profile operando lithium concentration in LiFePO4 electrodes using Ion Beam Analysis techniques. The specificity of the cell resides in its ability to not only provide qualitative information about the elements present but above all to measure quantitatively their content in the electrode at different states of charge of the battery. The nuclear methods give direct information about the degradation of the electrolyte and particularly reveal inhomogeneous distributions of lithium and fluorine along the entire thickness of the electrode. Higher concentrations of fluorine is detected near the electrode/electrolyte interface while a depletion of lithium is observed near the current collector at high states of charge.

Assembly of a Robust and Economical MnO[subscript2]-Based Reference Electrode

ERIC Educational Resources Information Center

Masse´, Robert C.; Gerken, James B.

2015-01-01

There is a dearth of base-stable reference electrodes that are suitable for use by students in a teaching laboratory or undergraduate research context. To remedy this, we have developed a technique to produce reference electrodes suitable for alkaline environments. By utilizing components of a commercially available alkaline-type battery, an…

Deep Brain Stimulation of Heschl Gyrus: Implantation Technique, Intraoperative Localization, and Effects of Stimulation.

PubMed

Donovan, Chris; Sweet, Jennifer; Eccher, Matthew; Megerian, Cliff; Semaan, Maroun; Murray, Gail; Miller, Jonathan

2015-12-01

Tinnitus is a source of considerable morbidity, and neuromodulation has been shown to be a potential treatment option. However, the location of the primary auditory cortex within Heschl gyrus in the temporal operculum presents challenges for targeting and electrode implantation. To determine whether anatomic targeting with intraoperative verification using evoked potentials can be used to implant electrodes directly into the Heschl gyrus (HG). Nine patients undergoing stereo-electroencephalogram evaluation for epilepsy were enrolled. HG was directly targeted on volumetric magnetic resonance imaging, and framed stereotaxy was used to implant an electrode parallel to the axis of the gyrus by using an oblique anterolateral-posteromedial trajectory. Intraoperative evoked potentials from auditory stimuli were recorded from multiple electrode contacts. Postoperatively, stimulation of each electrode was performed and participants were asked to describe the percept. Audiometric analysis was performed for 2 participants during subthreshold stimulation. Sounds presented to the contralateral and ipsilateral ears produced evoked potentials in HG electrodes in all participants intraoperatively. Stimulation produced a reproducible sensation of sound in all participants with perceived volume proportional to amplitude. Four participants reported distinct sounds when different electrodes were stimulated, with more medial contacts producing tones perceived as higher in pitch. Stimulation was not associated with adverse audiometric effects. There were no complications of electrode implantation. Direct anatomic targeting with physiological verification can be used to implant electrodes directly into primary auditory cortex. If deep brain stimulation proves effective for intractable tinnitus, this technique may be useful to assist with electrode implantation. DBS, deep brain stimulatorEEG, electroencephalographyHG, Heschl gyrus.

Inkjet printing of carbon black electrodes for dielectric elastomer actuators

NASA Astrophysics Data System (ADS)

Schlatter, Samuel; Rosset, Samuel; Shea, Herbert

2017-04-01

Inkjet printing is an appealing technique to print electrodes for Dielectric Elastomer Actuators (DEAs). Here we present the preparation and ink-jet printing of a carbon black electrode mixture and characterise its properties. Carbon black has been used extensively in the past because it is very compliant; however, it has a high resistance and can be very dirty to work with. In this paper we show that carbon black remains an appropriate electrode material, and when inkjet printed can be used to fabricate devices meeting today's demanding requirements. DEAs are becoming thinner to decrease actuation voltages and are shrinking in size to match the scale of the devices in the biomedical field, tuneable optics, and microfluidics. Inkjet printing addresses both of these problems. Firstly, Inkjet printing is a non-contact technique and can print on very thin freestanding membranes. Secondly, the high precision of inkjet printers makes it possible to print complex electrode geometries in the millimetre scale. We demonstrate the advantages of inkjet printing and carbon black electrodes by conducting a full characterisation of the printed electrodes. The printed carbon black electrodes have resistances as low as 13kΩ/□, an elastic modulus of approximately 1MPa, and a cyclic resistance swing which increases by 7% over 1500 cycles at 50% stretch. We also demonstrate a DEA with printed carbon black electrodes with a diametral stretch of 8.8% at an electric field of approximately 94V/μm. Finally a qualitative test is conducted to show that the printed carbon black electrode is extremely hardwearing.

Accuracy of frame-based stereotactic depth electrode implantation during craniotomy for subdural grid placement.

PubMed

Munyon, Charles N; Koubeissi, Mohamad Z; Syed, Tanvir U; Lüders, Hans O; Miller, Jonathan P

2013-01-01

Frame-based stereotaxy and open craniotomy may seem mutually exclusive, but invasive electrophysiological monitoring can require broad sampling of the cortex and precise targeting of deeper structures. The purpose of this study is to describe simultaneous frame-based insertion of depth electrodes and craniotomy for placement of subdural grids through a single surgical field and to determine the accuracy of depth electrodes placed using this technique. A total of 6 patients with intractable epilepsy underwent placement of a stereotactic frame with the center of the planned cranial flap equidistant from the fixation posts. After volumetric imaging, craniotomy for placement of subdural grids was performed. Depth electrodes were placed using frame-based stereotaxy. Postoperative CT determined the accuracy of electrode placement. A total of 31 depth electrodes were placed. Mean distance of distal electrode contact from the target was 1.0 ± 0.15 mm. Error was correlated to distance to target, with an additional 0.35 mm error for each centimeter (r = 0.635, p < 0.001); when corrected, there was no difference in accuracy based on target structure or method of placement (prior to craniotomy vs. through grid, p = 0.23). The described technique for craniotomy through a stereotactic frame allows placement of subdural grids and depth electrodes without sacrificing the accuracy of a frame or requiring staged procedures.

Extended range chemical sensing apparatus

DOEpatents

Hughes, R.C.; Schubert, W.K.

1994-01-18

An apparatus is described for sensing chemicals over extended range of concentrations. In particular, first and second sensors each having separate, but overlapping ranges for sensing concentrations of hydrogen are provided. Preferably, the first sensor is a MOS solid state device wherein the metal electrode or gate is a nickel alloy. The second sensor is a chemiresistor comprising a nickel alloy. 6 figures.

Development of in vivo impedance spectroscopy techniques for measurement of micropore formation following microneedle insertion

PubMed Central

Brogden, Nicole K.; Ghosh, Priyanka; Hardi, Lucia; Crofford, Leslie J.; Stinchcomb, Audra L.

2013-01-01

Microneedles provide a minimally invasive means to enhance skin permeability by creating micron-scale channels (micropores) that provide a drug delivery pathway. Adequate formation of the micropores is critical to the success of this unique drug delivery technique. The objective of these studies was to develop sensitive and reproducible impedance spectroscopy techniques to monitor micropore formation in animal models and human subjects. Hairless guinea pigs, a Yucatan miniature pig, and human volunteers were treated with 100 microneedle insertions per site following an overnight pre-hydration period. Repeated measurements were made pre- and post-microneedle treatment using dry and gel Ag/AgCl electrodes applied with light vs. direct pressure to hold the electrode to the skin surface. Impedance measurements dropped significantly post-microneedle application at all sites (p < 0.05, irrespective of electrode type or gel application), confirming micropore formation. In the Yucatan pig and human subjects, gel electrodes with direct pressure yielded the lowest variability (demonstrated by lower %RSD), whereas dry electrodes with direct pressure were superior in the guinea pigs. These studies confirm that impedance measurements are suitable for use in both clinical and animal research environments to monitor formation of new micropores that will allow for drug delivery through the impermeable skin layers. PMID:23589356

Development of in vivo impedance spectroscopy techniques for measurement of micropore formation following microneedle insertion.

PubMed

Brogden, Nicole K; Ghosh, Priyanka; Hardi, Lucia; Crofford, Leslie J; Stinchcomb, Audra L

2013-06-01

Microneedles (MNs) provide a minimally invasive means to enhance skin permeability by creating micron-scale channels (micropores) that provide a drug delivery pathway. Adequate formation of the micropores is critical to the success of this unique drug delivery technique. The objective of the current work was to develop sensitive and reproducible impedance spectroscopy techniques to monitor micropore formation in animal models and human subjects. Hairless guinea pigs, a Yucatan miniature pig, and human volunteers were treated with 100 MN insertions per site following an overnight prehydration period. Repeated measurements were made pre- and post-MN treatment using dry and gel Ag/AgCl electrodes applied with light verses direct pressure to hold the electrode to the skin surface. Impedance measurements dropped significantly post-MN application at all sites (p < 0.05, irrespective of electrode type or gel application), confirming micropore formation. In the Yucatan pig and human subjects, gel electrodes with direct pressure yielded the lowest variability (demonstrated by lower %relative standard deviation), whereas dry electrodes with direct pressure were superior in the guinea pigs. These studies confirm that impedance measurements are suitable for use in both clinical and animal research environments to monitor the formation of new micropores that will allow for drug delivery through the impermeable skin layers. Copyright © 2013 Wiley Periodicals, Inc.

Dose measurement in heterogeneous phantoms with an extrapolation chamber

NASA Astrophysics Data System (ADS)

Deblois, Francois

A hybrid phantom-embedded extrapolation chamber (PEEC) made of Solid Water(TM) and bone-equivalent material was used for determining absolute dose in a bone-equivalent phantom irradiated with clinical radiation beams (cobalt-60 gamma rays; 6 and 18 MV x-rays; and 9 and 15 MeV electrons). The dose was determined with the Spencer-Attix cavity theory, using ionization gradient measurements and an indirect determination of the chamber air-mass through measurements of chamber capacitance. The air gaps used were between 2 and 3 mm and the sensitive air volume of the extrapolation chamber was remotely controlled through the motion of the motorized piston with a precision of +/-0.0025 mm. The collected charge was corrected for ionic recombination and diffusion in the chamber air volume following the standard two-voltage technique. Due to the hybrid chamber design, correction factors accounting for scatter deficit and electrode composition were determined and applied in the dose equation to obtain dose data for the equivalent homogeneous bone phantom. Correction factors for graphite electrodes were calculated with Monte Carlo techniques and the calculated results were verified through relative air cavity dose measurements for three different polarizing electrode materials: graphite, steel, and brass in conjunction with a graphite collecting electrode. Scatter deficit, due mainly to loss of lateral scatter in the hybrid chamber, reduces the dose to the air cavity in the hybrid PEEC in comparison with full bone PEEC from 0.7 to ˜2% depending on beam quality and energy. In megavoltage photon and electron beams, graphite electrodes do not affect the dose measurement in the Solid Water(TM) PEEC but decrease the cavity dose by up to 5% in the bone-equivalent PEEC even for very thin graphite electrodes (<0.0025 cm). The collecting electrode material in comparison with the polarizing electrode material has a larger effect on the electrode correction factor; the thickness of thin electrodes, on the other hand, has a negligible effect on dose determination. The uncalibrated hybrid PEEC is an accurate and absolute device for measuring the dose directly in bone material in conjunction with appropriate correction factors determined with Monte Carlo techniques.

An Electrochemical Experiment Using an Optically Transparent Thin Layer Electrode

ERIC Educational Resources Information Center

DeAngelis, Thomas P.; Heineman, William R.

1976-01-01

Describes a unified experiment in which an optically transparent thin layer electrode is used to illustrate the techniques of thin layer electrochemistry, cyclic voltammetry, controlled potential coulometry, and spectroelectrochemistry. (MLH)

Requirements for optimization of electrodes and electrolyte for the iron/chromium Redox flow cell

NASA Technical Reports Server (NTRS)

Jalan, V.; Stark, H.; Giner, J.

1981-01-01

Improved catalyzation techniques that included a pretreatment of carbon substrate and provided normalized carbon surface for uniform gold deposition were developed. This permits efficient use of different batches of carbon felt materials which initially vary significantly in their physical and surface chemical properties, as well as their electrochemical behavior. Further modification of gold impregnation technique gave the best performing electrodes. In addition to the linear sweep voltammetry, cyclic voltammetry was used to determine the effects of different activation procedures on the Cr(3)/Cr(2) Redox and H2 evolution reactions. The roles of carbon, gold and lead in the overall Redox cycle are identified. The behavior of the electrodes at both normal battery operating potentials and more extreme potentials is discussed preparing efficient and stable electrodes for the energy storage battery is implicated.

Investigation on Electrochemical Properties of Polythiophene Nanocomposite with Graphite Derivatives as Supercapacitor Material on Breath Figure-Decorated PMMA Electrode

NASA Astrophysics Data System (ADS)

Azimi, Mona; Abbaspour, Mohsen; Fazli, Ali; Setoodeh, Hamideh; Pourabbas, Behzad

2018-03-01

Breath figures have been formed by the direct breath figure method on polymethyl methacrylate electrode sand hexagonal oriented holes with 0.5- to 10- μm2 surface area have been created. Deposition of materials on the electrodes has been performed by the spray-coating method. polythiophene (PTh) nanoparticles, polythiophene-graphene oxide (PTh-GO) and polythiophene-reduced graphene oxide (PTh-G) nanocomposites were synthesized by emulsion polymerization, while characterization of synthetic materials have been carried out by Fourier transform infrared, Χ-ray diffraction, transmission electron microscopy, UV-Vis spectroscopy and field emission scanning electron microscopy techniques. Also, the electrochemical properties of the designed electrodes were investigated by cyclic voltammetry, galvanostatic charge-discharge and electrochemical impedance spectroscopy techniques. Specific capacitance of porous electrodes coated by PTh nanoparticles, PTh-GO and PTh-G nanocomposites were calculated from cyclic voltammetry curves at 5 mV/s scan rate, andthe values are 3.5 F/g, 16.39 F/g, and 28.68 F/g, respectively. Also, the energy density of each electrode at 5 mV/s scan rate has been calculated and the results show that incorporation of GO and G nanolayers with PTh nanoparticles enhances the electrochemical properties of electrodes.

A PDMS-Based Conical-Well Microelectrode Array for Surface Stimulation and Recording of Neural Tissues

PubMed Central

Guo, Liang; Meacham, Kathleen W.; Hochman, Shawn

2012-01-01

A method for fabricating polydimethylsiloxane (PDMS)-based microelectrode arrays (MEAs) featuring novel conical-well microelectrodes is described. The fabrication technique is reliable and efficient, and facilitates controllability over both the depth and the slope of the conical wells. Because of the high PDMS elasticity (as compared to other MEA substrate materials), this type of compliant MEA is promising for acute and chronic implantation in applications that benefit from conformable device contact with biological tissue surfaces and from minimal tissue damage. The primary advantage of the conical-well microelectrodes—when compared to planar electrodes—is that they provide an improved contact on tissue surface, which potentially provides isolation of the electrode microenvironment for better electrical interfacing. The raised wells increase the uniformity of current density distributions at both the electrode and tissue surfaces, and they also protect the electrode material from mechanical damage (e.g. from rubbing against the tissue). Using this technique, electrodes have been fabricated with diameters as small as 10µm and arrays have been fabricated with center-to-center electrode spacings of 60µm. Experimental results are presented, describing electrode-profile characterization, electrode-impedance measurement, and MEA-performance evaluation on fiber bundle recruitment in spinal cord white matter. PMID:20550983

Nanostructured mesophase electrode materials: modulating charge-storage behavior by thermal treatment.

PubMed

Kong, Hye Jeong; Kim, Saerona; Le, Thanh-Hai; Kim, Yukyung; Park, Geunsu; Park, Chul Soon; Kwon, Oh Seok; Yoon, Hyeonseok

2017-11-16

3D nanostructured carbonaceous electrode materials with tunable capacitive phases were successfully developed using graphene/particulate polypyrrole (PPy) nanohybrid (GPNH) precursors without a separate process for incorporating heterogeneous species. The electrode material, namely carbonized GPNHs (CGPNHs) featured a mesophase capacitance consisting of both electric double-layer (EDL) capacitive and pseudocapacitive elements at the molecular level. The ratio of EDL capacitive element to pseudocapacitive element (E-to-P) in the mesophase electrode materials was controlled by varying the PPy-to-graphite weight (P w /G w ) ratio and by heat treatment (T H ), which was demonstrated by characterizing the CGPNHs with elemental analysis, cyclic voltammetry, and a charge/discharge test. The concept of the E-to-P ratio (EPR) index was first proposed to easily identify the capacitive characteristics of the mesophase electrode using a numerical algorithm, which was reasonably consistent with the experimental findings. Finally, the CGPNHs were integrated into symmetric two-electrode capacitor cells, which rendered excellent energy and power densities in both aqueous and ionic liquid electrolytes. It is anticipated that our approach could be widely extended to fabricating versatile hybrid electrode materials with estimation of their capacitive characteristics.

The Joule heating problem in silver nanowire transparent electrodes

NASA Astrophysics Data System (ADS)

Khaligh, H. H.; Xu, L.; Khosropour, A.; Madeira, A.; Romano, M.; Pradére, C.; Tréguer-Delapierre, M.; Servant, L.; Pope, M. A.; Goldthorpe, I. A.

2017-10-01

Silver nanowire transparent electrodes have shown considerable potential to replace conventional transparent conductive materials. However, in this report we show that Joule heating is a unique and serious problem with these electrodes. When conducting current densities encountered in organic solar cells, the average surface temperature of indium tin oxide (ITO) and silver nanowire electrodes, both with sheet resistances of 60 ohms/square, remains below 35 °C. However, in contrast to ITO, the temperature in the nanowire electrode is very non-uniform, with some localized points reaching temperatures above 250 °C. These hotspots accelerate nanowire degradation, leading to electrode failure after 5 days of continuous current flow. We show that graphene, a commonly used passivation layer for these electrodes, slows nanowire degradation and creates a more uniform surface temperature under current flow. However, the graphene does not prevent Joule heating in the nanowires and local points of high temperature ultimately shift the failure mechanism from nanowire degradation to melting of the underlying plastic substrate. In this paper, surface temperature mapping, lifetime testing under current flow, post-mortem analysis, and modelling illuminate the behaviour and failure mechanisms of nanowires under extended current flow and provide guidelines for managing Joule heating.

Electro-active device using radial electric field piezo-diaphragm for sonic applications

NASA Technical Reports Server (NTRS)

Bryant, Robert G. (Inventor); Fox, Robert L. (Inventor)

2005-01-01

An electro-active transducer for sonic applications includes a ferroelectric material sandwiched by first and second electrode patterns to form a piezo-diaphragm coupled to a mounting frame. When the device is used as a sonic actuator, the first and second electrode patterns are configured to introduce an electric field into the ferroelectric material when voltage is applied to the electrode patterns. When the device is used as a sonic sensor, the first and second electrode patterns are configured to introduce an electric field into the ferroelectric material when the ferroelectric material experiences deflection in a direction substantially perpendicular thereto. In each case, the electrode patterns are designed to cause the electric field to: i) originate at a region of the ferroelectric material between the first and second electrode patterns, and ii) extend radially outward from the region of the ferroelectric material (at which the electric field originates) and substantially parallel to the plane of the ferroelectric material. The mounting frame perimetrically surrounds the peizo-diaphragm and enables attachment of the piezo-diaphragm to a housing.

Direct writing electrodes using a ball pen for paper-based point-of-care testing.

PubMed

Li, Zedong; Li, Fei; Hu, Jie; Wee, Wei Hong; Han, Yu Long; Pingguan-Murphy, Belinda; Lu, Tian Jian; Xu, Feng

2015-08-21

The integration of paper with an electrochemical device has attracted growing attention for point-of-care testing, where it is of great importance to fabricate electrodes on paper in a low-cost, easy and versatile way. In this work, we report a simple strategy for directly writing electrodes on paper using a pressure-assisted ball pen to form a paper-based electrochemical device (PED). This method is demonstrated to be capable of fabricating electrodes on paper with good electrical conductivity and electrochemical performance, holding great potential to be employed in point-of-care applications, such as in human health diagnostics and food safety detection. As examples, the PEDs fabricated using the developed method are applied for detection of glucose in artificial urine and melamine in sample solutions. Furthermore, our developed strategy is also extended to fabricate PEDs with multi-electrode arrays and write electrodes on non-planar surfaces (e.g., paper cup, human skin), indicating the potential application of our method in other fields, such as fabricating biosensors, paper electronics etc.

Electrode Plate For An Eletrlchemical Cell And Having A Metal Foam Type Support, And A Method Of Obtaining Such An Electrode

DOEpatents

Verhoog, Roelof; Precigout, Claude; Stewart, Donald

1996-05-21

The electrode plate includes an active portion that is pasted with active material, and a plate head that is made up of three layers of compressed metal foam comprising: a non-pasted portion of height G of the support of the electrode plate; and two strips of non-pasted metal foam of height R on either side of the non-pasted portion of height G of the support and also extending for an overlap height h.sub.2 over the pasted portion of the support. The plate head includes a zone of reduced thickness including a portion that is maximally compressed, and a transitional portion between said maximally compressed portion and the remainder of the electrode which is of thickness e.sub.2. A portion of said plate head forms a connection tab. The method of obtaining the electrode consists in simultaneously rolling all three layers of metal foam in the plate head, and then in cutting matter away from the plates so as to obtain respective connection tabs.

Toward lithium ion batteries with enhanced thermal conductivity.

PubMed

Koo, Bonil; Goli, Pradyumna; Sumant, Anirudha V; dos Santos Claro, Paula Cecilia; Rajh, Tijana; Johnson, Christopher S; Balandin, Alexander A; Shevchenko, Elena V

2014-07-22

As batteries become more powerful and utilized in diverse applications, thermal management becomes one of the central problems in their application. We report the results on thermal properties of a set of different Li-ion battery electrodes enhanced with multiwalled carbon nanotubes. Our measurements reveal that the highest in-plane and cross-plane thermal conductivities achieved in the carbon-nanotube-enhanced electrodes reached up to 141 and 3.6 W/mK, respectively. The values for in-plane thermal conductivity are up to 2 orders of magnitude higher than those for conventional electrodes based on carbon black. The electrodes were synthesized via an inexpensive scalable filtration method, and we demonstrate that our approach can be extended to commercial electrode-active materials. The best performing electrodes contained a layer of γ-Fe2O3 nanoparticles on carbon nanotubes sandwiched between two layers of carbon nanotubes and had in-plane and cross-plane thermal conductivities of ∼50 and 3 W/mK, respectively, at room temperature. The obtained results are important for thermal management in Li-ion and other high-power-density batteries.

Nanoscale visualization of redox activity at lithium-ion battery cathodes.

PubMed

Takahashi, Yasufumi; Kumatani, Akichika; Munakata, Hirokazu; Inomata, Hirotaka; Ito, Komachi; Ino, Kosuke; Shiku, Hitoshi; Unwin, Patrick R; Korchev, Yuri E; Kanamura, Kiyoshi; Matsue, Tomokazu

2014-11-17

Intercalation and deintercalation of lithium ions at electrode surfaces are central to the operation of lithium-ion batteries. Yet, on the most important composite cathode surfaces, this is a rather complex process involving spatially heterogeneous reactions that have proved difficult to resolve with existing techniques. Here we report a scanning electrochemical cell microscope based approach to define a mobile electrochemical cell that is used to quantitatively visualize electrochemical phenomena at the battery cathode material LiFePO4, with resolution of ~100 nm. The technique measures electrode topography and different electrochemical properties simultaneously, and the information can be combined with complementary microscopic techniques to reveal new perspectives on structure and activity. These electrodes exhibit highly spatially heterogeneous electrochemistry at the nanoscale, both within secondary particles and at individual primary nanoparticles, which is highly dependent on the local structure and composition.

Automated detection and labeling of high-density EEG electrodes from structural MR images.

PubMed

Marino, Marco; Liu, Quanying; Brem, Silvia; Wenderoth, Nicole; Mantini, Dante

2016-10-01

Accurate knowledge about the positions of electrodes in electroencephalography (EEG) is very important for precise source localizations. Direct detection of electrodes from magnetic resonance (MR) images is particularly interesting, as it is possible to avoid errors of co-registration between electrode and head coordinate systems. In this study, we propose an automated MR-based method for electrode detection and labeling, particularly tailored to high-density montages. Anatomical MR images were processed to create an electrode-enhanced image in individual space. Image processing included intensity non-uniformity correction, background noise and goggles artifact removal. Next, we defined a search volume around the head where electrode positions were detected. Electrodes were identified as local maxima in the search volume and registered to the Montreal Neurological Institute standard space using an affine transformation. This allowed the matching of the detected points with the specific EEG montage template, as well as their labeling. Matching and labeling were performed by the coherent point drift method. Our method was assessed on 8 MR images collected in subjects wearing a 256-channel EEG net, using the displacement with respect to manually selected electrodes as performance metric. Average displacement achieved by our method was significantly lower compared to alternative techniques, such as the photogrammetry technique. The maximum displacement was for more than 99% of the electrodes lower than 1 cm, which is typically considered an acceptable upper limit for errors in electrode positioning. Our method showed robustness and reliability, even in suboptimal conditions, such as in the case of net rotation, imprecisely gathered wires, electrode detachment from the head, and MR image ghosting. We showed that our method provides objective, repeatable and precise estimates of EEG electrode coordinates. We hope our work will contribute to a more widespread use of high-density EEG as a brain-imaging tool.

Automated detection and labeling of high-density EEG electrodes from structural MR images

NASA Astrophysics Data System (ADS)

Marino, Marco; Liu, Quanying; Brem, Silvia; Wenderoth, Nicole; Mantini, Dante

2016-10-01

Objective. Accurate knowledge about the positions of electrodes in electroencephalography (EEG) is very important for precise source localizations. Direct detection of electrodes from magnetic resonance (MR) images is particularly interesting, as it is possible to avoid errors of co-registration between electrode and head coordinate systems. In this study, we propose an automated MR-based method for electrode detection and labeling, particularly tailored to high-density montages. Approach. Anatomical MR images were processed to create an electrode-enhanced image in individual space. Image processing included intensity non-uniformity correction, background noise and goggles artifact removal. Next, we defined a search volume around the head where electrode positions were detected. Electrodes were identified as local maxima in the search volume and registered to the Montreal Neurological Institute standard space using an affine transformation. This allowed the matching of the detected points with the specific EEG montage template, as well as their labeling. Matching and labeling were performed by the coherent point drift method. Our method was assessed on 8 MR images collected in subjects wearing a 256-channel EEG net, using the displacement with respect to manually selected electrodes as performance metric. Main results. Average displacement achieved by our method was significantly lower compared to alternative techniques, such as the photogrammetry technique. The maximum displacement was for more than 99% of the electrodes lower than 1 cm, which is typically considered an acceptable upper limit for errors in electrode positioning. Our method showed robustness and reliability, even in suboptimal conditions, such as in the case of net rotation, imprecisely gathered wires, electrode detachment from the head, and MR image ghosting. Significance. We showed that our method provides objective, repeatable and precise estimates of EEG electrode coordinates. We hope our work will contribute to a more widespread use of high-density EEG as a brain-imaging tool.

Electrochemical and in situ spectroscopic studies of materials of relevance to energy storage and electrocatalysis

NASA Astrophysics Data System (ADS)

Mo, Yibo

In situ X-ray absorption (XAS), surface enhanced Raman spectroscopy (SERS) and rotating ring disk electrode techniques have been employed for the characterization of materials of relevance to electrochemical energy storage and electrocatalysis. In particular, analysis of in situ Ir LIII-edge extended X-ray absorption fine structure (EXAFS) of IrO2 films electrodeposited on Au substrates yielded Ir-O bond lengths decreasing in the sequence 2.02, 1.97 and 1.93 A, for Ir3+, Ir4+ and Ir5+ sites, respectively. Although features consistent with the presence of crystalline IrO2 in the highly hydrated films were found from in situ SERS, the lack of intense shells in the FT of the EXAFS function beyond the nearest oxygen neighbors indicates that the films by and large do not display long range order. In similar studies, the Fourier transform of the k3-weighted Ru K-edge EXAFS of electrodeposited RuO2 films recorded in situ were characterized by two shells attributed to Ru-O and Ru-Ru interactions at 1.94(1) and 3.12(2) A, in agreement with results obtained ex situ for Ru4+ in hydrous RuO2, whereas films in the reduced state yielded a single Ru-O interaction shell at 2.02(1) A. Extensions of these in situ XAS to the study of electrocatalysts for the nitrite reduction made it possible to identify and characterize the electronic and structural properties of a nitrosyl iron porphyrin adduct adsorbed on an electrode surface via the analysis of Fe K-edge XAS data. The effects of Se and S ad-atoms on the electrocatalytic activity of Pt electrodes have been examined using RRDE techniques. In acid, within a rather narrow range of coverages, both S- and Se-modified Pt surfaces promote the 2-electron reduction of dioxygen to hydrogen peroxide at ca. 100% faradaic efficiency over a wide potential region. Also developed were methods for immobilizing unsupported dispersed high area Pt particles a glassy carbon (GC) disk of a rotating Pt(ring)/GC(disk) electrode assembly allowing electrochemical measurements to be performed under forced convection with only minimal losses of Pt from the surface.

Interpenetrating polyaniline-gold electrodes for SERS and electrochemical measurements

NASA Astrophysics Data System (ADS)

West, R. M.; Semancik, S.

2016-11-01

Facile fabrication of nanostructured electrode arrays is critical for development of bimodal SERS and electrochemical biosensors. In this paper, the variation of applied potential at a polyaniline-coated Pt electrode is used to selectivity deposit Au on the polyaniline amine sites or on the underlying Pt electrode. By alternating the applied potential, the Au is grown simultaneously from the top and the bottom of the polyaniline film, leading to an interpenetrated, nanostructured polymer-metal composite extending from the Pt electrode to the electrolyte solution. The resulting films have unique pH-dependent electrochemical properties, e.g. they retain electrochemical activity in both acidic and neutral solutions, and they also include SERS-active nanostructures. By varying the concentration of chloroaurate used during deposition, Au nanoparticles, nanodendrites, or nanosheets can be selectively grown. For the films deposited under optimal conditions, using 5 mmol/L chloroaurate, the SERS enhancement factor for Rhodamine 6G was found to be as high as 1.1 × 106 with spot-to-spot and electrode-to-electrode relative standard deviations as low as 8% and 12%, respectively. The advantages of the reported PANI-Au composite electrodes lie in their facile fabrication, enabling the targeted deposition of tunable nanostructures on sensing arrays, and their ability to produce orthogonal optical and electrochemical analytical results.

Space- and time-resolved resistive measurements of liquid metal wall thickness

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mirhoseini, S. M. H.; Volpe, F. A., E-mail: fvolpe@columbia.edu

In a fusion reactor internally coated with liquid metal, it will be important to diagnose the thickness of the liquid at various locations in the vessel, as a function of time, and possibly respond to counteract undesired bulging or depletion. The electrical conductance between electrodes immersed in the liquid metal can be used as a simple proxy for the local thickness. Here a matrix of electrodes is shown to provide spatially and temporally resolved measurements of liquid metal thickness in the absence of plasma. First a theory is developed for m × n electrodes, and then it is experimentally demonstratedmore » for 3 × 1 electrodes, as the liquid stands still or is agitated by means of a shaker. The experiments were carried out with Galinstan, but are easily extended to lithium or other liquid metals.« less

Space- and time-resolved resistive measurements of liquid metal wall thickness.

PubMed

Mirhoseini, S M H; Volpe, F A

2016-11-01

In a fusion reactor internally coated with liquid metal, it will be important to diagnose the thickness of the liquid at various locations in the vessel, as a function of time, and possibly respond to counteract undesired bulging or depletion. The electrical conductance between electrodes immersed in the liquid metal can be used as a simple proxy for the local thickness. Here a matrix of electrodes is shown to provide spatially and temporally resolved measurements of liquid metal thickness in the absence of plasma. First a theory is developed for m × n electrodes, and then it is experimentally demonstrated for 3 × 1 electrodes, as the liquid stands still or is agitated by means of a shaker. The experiments were carried out with Galinstan, but are easily extended to lithium or other liquid metals.

An advanced model framework for solid electrolyte intercalation batteries.

PubMed

Landstorfer, Manuel; Funken, Stefan; Jacob, Timo

2011-07-28

Recent developments of solid electrolytes, especially lithium ion conductors, led to all solid state batteries for various applications. In addition, mathematical models sprout for different electrode materials and battery types, but are missing for solid electrolyte cells. We present a mathematical model for ion flux in solid electrolytes, based on non-equilibrium thermodynamics and functional derivatives. Intercalated ion diffusion within the electrodes is further considered, allowing the computation of the ion concentration at the electrode/electrolyte interface. A generalized Frumkin-Butler-Volmer equation describes the kinetics of (de-)intercalation reactions and is here extended to non-blocking electrodes. Using this approach, numerical simulations were carried out to investigate the space charge region at the interface. Finally, discharge simulations were performed to study different limitations of an all solid state battery cell. This journal is © the Owner Societies 2011

Examining of the segmented electrode use from the viewpoint of the electrolyte volatilizing in molten carbonate fuel cell

NASA Astrophysics Data System (ADS)

Sugiura, Kimihiko; Yamauchi, Makoto; Soga, Masatsugu; Tanimoto, Kazumi

Molten carbonate fuel cells (MCFCs) have entered the pre-commercialization phase, and have been experimentally demonstrated in real world applications, including beer brewery, etc. However, though MCFCs have a high potential and an enough operating experience as an energy supply system, they are not explosively widespread. One of these reasons is cost of cell components. Because the thickness of both electrodes is 0.8 mm and both electrodes are made of porous plates of 1 m 2 of the electrode area, they are often broken by a thermal stress in the sintering process of an electrode and by a worker's carelessness at the cell assembly process. Generally, because these cracking electrodes can potentially cause electrolyte leakage and gas crossover, they are not used to a MCFC stack and are disposed of. Therefore, it made the cost of MCFC be raised. The performance of a cell that uses a mosaic electrode has been evaluated. However, the causal relation between the cracking of an electrode and an electrolyte-leakage has not been yet confirmed. If this causal relationship is elucidated, a cracking electrode or a mosaic electrode can be used to MCFC, such that the cost of MCFC systems would consequently decrease. Therefore, we studied the causal relation between the cracking of an electrode and electrolyte leakage and gas crossover using a visualization technique. In the case of an anode electrode where the centre section of a cell has crack of about 1 mm, the electrolyte leakage from this crack could not be observed by the visualization technique. Moreover, the gas crossover could not be also observed by the visualization technique, and nitrogen in the anode exhaust gas was not detected by a gas chromatography. However, the electrolyte leakage observed from the wet-seal section though the gap between the separator and the electrode was always 1 mm or less. Therefore, electrolyte leakage hardly occurs, even if a cracked anode electrode is installed into the centre section of the cell. On the other hand, although the volatile substance gushes from the wet seal section, the electrolyte leakage/volatilization phenomenon does not occur at the centre of the cell or at the gap between each segmented cathode. The volatile substance in the cathode gas-distributor-channel is composed of the electrolyte mist and the electrolyte volatile substance, and the rate of release is about 2.5 times that of anode side. Although the segmented electrode can be applied to the anode in a MCFC, it cannot be applied to a cathode from the viewpoint of the electrolyte leakage/volatilization.

Continuous piecewise-linear, reduced-order electrochemical model for lithium-ion batteries in real-time applications

NASA Astrophysics Data System (ADS)

Farag, Mohammed; Fleckenstein, Matthias; Habibi, Saeid

2017-02-01

Model-order reduction and minimization of the CPU run-time while maintaining the model accuracy are critical requirements for real-time implementation of lithium-ion electrochemical battery models. In this paper, an isothermal, continuous, piecewise-linear, electrode-average model is developed by using an optimal knot placement technique. The proposed model reduces the univariate nonlinear function of the electrode's open circuit potential dependence on the state of charge to continuous piecewise regions. The parameterization experiments were chosen to provide a trade-off between extensive experimental characterization techniques and purely identifying all parameters using optimization techniques. The model is then parameterized in each continuous, piecewise-linear, region. Applying the proposed technique cuts down the CPU run-time by around 20%, compared to the reduced-order, electrode-average model. Finally, the model validation against real-time driving profiles (FTP-72, WLTP) demonstrates the ability of the model to predict the cell voltage accurately with less than 2% error.

Design and Manufacturing of Desalination System Powered by Solar Energy Using CDI Technique

NASA Astrophysics Data System (ADS)

Rostami, Mohammad Sajjad; Khashehchi, Morteza; Pipelzadeh, Ehsan

2017-11-01

Capacitive deionization (CDI) is an emerging energy efficient, low pressure and low capital intensive desalination process where ions are separated by a pure electrostatic force imposed by a small bias potential as low as 1 V That funded by an external Renewable (Solar) power supply to materials with high specific surface area. The main objective of this configuration is to separate the cation and anions on oppositely charged electrodes. One of the key parameters for commercial realization of CDI is the salt adsorption capacity of the electrodes. State-of-the-art electrode materials are based on porous activated carbon particles or carbon aerogels. Various electrode materials have been developed in the past, which have suffered from instability and lack of performance. Preliminary experimental results using carbon black, graphite powder, graphene ∖ graphite ∖ PTFE (Active ∖ Conductive ∖ binder) show that the graphene reduced via urea method is a suitable method to develop CDI electrode materials. Although some progress has been made, production of efficient and stable carbon based electrode materials for large scale desalination has not been fully realized. A new desalination technique using capacitive deionization.

Low resistivity contacts to YBa2Cu3O(7-x) superconductors

NASA Technical Reports Server (NTRS)

Hsi, Chi-Shiung; Haertling, Gene H.

1991-01-01

Silver, gold, platinum, and palladium metals were investigated as electroding materials for the YBa2Cu3O(7-x) superconductors. Painting, embedding, and melting techniques were used to apply the electrodes. Contact resistivities were determined by: (1) type of electrode; (2) firing conditions; and (3) application method. Electrodes fired for long times exhibited lower contact resistivities than those fired for short times. Low-resistivity contacts were found for silver and gold electrodes. Silver, which made good ohmic contact to the YBa2Cu3O(7-x) superconductor with low contact resistivities was found to be the best electroding material among the materials evaluated in this investigation.

Fuel cell plates with skewed process channels for uniform distribution of stack compression load

DOEpatents

Granata, Jr., Samuel J.; Woodle, Boyd M.

1989-01-01

An electrochemical fuel cell includes an anode electrode, a cathode electrode, an electrolyte matrix sandwiched between electrodes, and a pair of plates above and below the electrodes. The plate above the electrodes has a lower surface with a first group of process gas flow channels formed thereon and the plate below the electrodes has an upper surface with a second group of process gas flow channels formed thereon. The channels of each group extend generally parallel to one another. The improvement comprises the process gas flow channels on the lower surface of the plate above the anode electrode and the process gas flow channels on the upper surface of the plate below the cathode electrode being skewed in opposite directions such that contact areas of the surfaces of the plates through the electrodes are formed in crisscross arrangements. Also, the plates have at least one groove in areas of the surfaces thereof where the channels are absent for holding process gas and increasing electrochemical activity of the fuel cell. The groove in each plate surface intersects with the process channels therein. Also, the opposite surfaces of a bipolar plate for a fuel cell contain first and second arrangements of process gas flow channels in the respective surfaces which are skewed the same amount in opposite directions relative to the longitudinal centerline of the plate.

Hydrogen substituted graphdiyne as carbon-rich flexible electrode for lithium and sodium ion batteries.

PubMed

He, Jianjiang; Wang, Ning; Cui, Zili; Du, Huiping; Fu, Lin; Huang, Changshui; Yang, Ze; Shen, Xiangyan; Yi, Yuanping; Tu, Zeyi; Li, Yuliang

2017-10-27

Organic electrodes are potential alternatives to current inorganic electrode materials for lithium ion and sodium ion batteries powering portable and wearable electronics, in terms of their mechanical flexibility, function tunability and low cost. However, the low capacity, poor rate performance and rapid capacity degradation impede their practical application. Here, we concentrate on the molecular design for improved conductivity and capacity, and favorable bulk ion transport. Through an in situ cross-coupling reaction of triethynylbenzene on copper foil, the carbon-rich frame hydrogen substituted graphdiyne film is fabricated. The organic film can act as free-standing flexible electrode for both lithium ion and sodium ion batteries, and large reversible capacities of 1050 mAh g -1 for lithium ion batteries and 650 mAh g -1 for sodium ion batteries are achieved. The electrode also shows a superior rate and cycle performances owing to the extended π-conjugated system, and the hierarchical pore bulk with large surface area.

Fabrication of fuel cell electrodes and other catalytic structures

DOEpatents

Smith, J.L.

1987-02-11

A porous layer of catalyst material suitable for use as an electrode in a molten carbonate fuel cell includes elongated pores substantially extending across the layer thickness. The catalyst layer is prepared by depositing particulate catalyst material into polymeric flocking on a substrate surface by a procedure such as tape casting. The loaded substrate is heated in a series of steps with rising temperatures to set the tape, thermally decompose the substrate with flocking and sinter bond the catalyst particles into a porous catalytic layer with elongated pores across its thickness. Employed as an electrode, the elongated pores provide distribution of reactant gas into contact with catalyst particles wetted by molten electrolyte. 1 fig.

Fabrication of catalytic electrodes for molten carbonate fuel cells

DOEpatents

Smith, James L.

1988-01-01

A porous layer of catalyst material suitable for use as an electrode in a molten carbonate fuel cell includes elongated pores substantially extending across the layer thickness. The catalyst layer is prepared by depositing particulate catalyst material into polymeric flocking on a substrate surface by a procedure such as tape casting. The loaded substrate is heated in a series of steps with rising temperatures to set the tape, thermally decompose the substrate with flocking and sinter bond the catalyst particles into a porous catalytic layer with elongated pores across its thickness. Employed as an electrode, the elongated pores provide distribution of reactant gas into contact with catalyst particles wetted by molten electrolyte.

Fuel cell stack with internal manifolds for reactant gases

DOEpatents

Schnacke, Arthur W.

1985-01-01

A fuel cell stack includes a plurality of plate-like fuel cells arranged along an axis generally parallel to cell thickness with electrically conductive separator plates between each pair of cells. A plurality of axial manifolds are provided at opposite sides of the stack in outer marginal portions beyond the edges of electrodes and electrolyte tiles. Sealing rings prevent cross-leakage of oxidant fuel gases through use of pairs of outwardly extending lips from opposite tile surfaces bonded to first and second electrode frames respectively. The frames provide transition between electrode edges and manifold perimeters. The pairs of extension lips are sealingly bonded together through an electrically insulative sealing ring with wedge shaped fastening members.

Fuel cell stack with internal manifolds for reactant gases

DOEpatents

Schnacke, A.W.

1983-10-12

A fuel cell stack includes a plurality of plate-like fuel cells arranged along an axis generally parallel to cell thickness with electrically conductive separator plates between each pair of cells. A plurality of axial manifolds are provided at opposite sides of the stack in outer marginal portions beyond the edges of electrodes and electrolyte tiles. Sealing rings prevent cross-leakage of oxidant fuel gases through use of pairs of outwardly extending lips from opposite tile surfaces bonded to first and second electrode frames respectively. The frames provide transition between electrode edges and manifold perimeters. The pairs of extension lips are sealingly bonded together through an electrically insulative sealing ring with wedge shaped fastening members.

Enhanced control of electrochemical response in metallic materials in neural stimulation electrode applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watkins, K.G.; Steen, W.M.; Manna, I.

New means have been investigated for the production of electrode devices (stimulation electrodes) which could be implanted in the human body in order to control pain, activate paralysed limbs or provide electrode arrays for cochlear implants for the deaf or for the relief of tinitus. To achieve this ion implantation and laser materials processing techniques were employed. Ir was ion implanted in Ti-6Al-4V alloy and the surface subsequently enriched in the noble metal by dissolution in sulphuric acid. For laser materials processing techniques, investigation has been carried out on the laser cladding and laser alloying of Ir in Ti wire.more » A particular aim has been the determination of conditions required for the formation of a two phase Ir, Ir-rich, and Ti-rich microstructure which would enable subsequent removal of the non-noble phase to leave a highly porous noble metal with large real surface area and hence improved charge carrying capacity compared with conventional non porous electrodes. Evaluation of the materials produced has been carried out using repetitive cyclic voltammetry, amongst other techniques. For laser alloyed Ir on Ti wire, it has been found that differences in the melting point and density of the materials makes control of the cladding or alloying process difficult. Investigation of laser process parameters for the control of alloying and cladding in this system was carried out and a set of conditions for the successful production of two phase Ir-rich and Ti-rich components in a coating layer with strong metallurgical bonding to the Ti alloy substrate was derived. The laser processed material displays excellent potential for further development in providing stimulation electrodes with the current carrying capacity of Ir but in a form which is malleable and hence capable of formation into smaller electrodes with improved spatial resolution compared with presently employed electrodes.« less

Optimum electrode configuration selection for electrical resistance change based damage detection in composites using an effective independence measure

NASA Astrophysics Data System (ADS)

Escalona, Luis; Díaz-Montiel, Paulina; Venkataraman, Satchi

2016-04-01

Laminated carbon fiber reinforced polymer (CFRP) composite materials are increasingly used in aerospace structures due to their superior mechanical properties and reduced weight. Assessing the health and integrity of these structures requires non-destructive evaluation (NDE) techniques to detect and measure interlaminar delamination and intralaminar matrix cracking damage. The electrical resistance change (ERC) based NDE technique uses the inherent changes in conductive properties of the composite to characterize internal damage. Several works that have explored the ERC technique have been limited to thin cross-ply laminates with simple linear or circular electrode arrangements. This paper investigates a method of optimum selection of electrode configurations for delamination detection in thick cross-ply laminates using ERC. Inverse identification of damage requires numerical optimization of the measured response with a model predicted response. Here, the electrical voltage field in the CFRP composite laminate is calculated using finite element analysis (FEA) models for different specified delamination size and locations, and location of ground and current electrodes. Reducing the number of sensor locations and measurements is needed to reduce hardware requirements, and computational effort needed for inverse identification. This paper explores the use of effective independence (EI) measure originally proposed for sensor location optimization in experimental vibration modal analysis. The EI measure is used for selecting the minimum set of resistance measurements among all possible combinations of selecting a pair of electrodes among the n electrodes. To enable use of EI to ERC required, it is proposed in this research a singular value decomposition SVD to obtain a spectral representation of the resistance measurements in the laminate. The effectiveness of EI measure in eliminating redundant electrode pairs is demonstrated by performing inverse identification of damage using the full set of resistance measurements and the reduced set of measurements. The investigation shows that the EI measure is effective for optimally selecting the electrode pairs needed for resistance measurements in ERC based damage detection.

An equivalent network representation of a clamped bimorph piezoelectric micromachined ultrasonic transducer with circular and annular electrodes using matrix manipulation techniques.

PubMed

Sammoura, Firas; Smyth, Katherine; Kim, Sang-Gook

2013-09-01

An electric circuit model for a clamped circular bimorph piezoelectric micromachined ultrasonic transducer (pMUT) was developed for the first time. The pMUT consisted of two piezoelectric layers sandwiched between three thin electrodes. The top and bottom electrodes were separated into central and annular electrodes by a small gap. While the middle electrode was grounded, the central and annular electrodes were biased with two independent voltage sources. The strain mismatch between the piezoelectric layers caused the plate to vibrate and transmit a pressure wave, whereas the received echo generated electric charges resulting from plate deformation. The clamped pMUT plate was separated into a circular and an annular plate, and the respective electromechanical transformation matrices were derived. The force and velocity vectors were properly selected using Hamilton's principle and the necessary boundary conditions were invoked. The electromechanical transformation matrix for the clamped circular pMUT was deduced using simple matrix manipulation techniques. The pMUT performance under three biasing schemes was elaborated: 1) central electrode only, 2) central and annular electrodes with voltages of the same magnitude and polarity, and 3) central and annular electrodes with voltages of the same magnitude and opposite polarity. The circuit parameters of the pMUT were extracted for each biasing scheme, including the transformer ratio, the clamped electric impedance, and the open-circuit mechanical impedance. Each pMUT scheme was characterized under different acoustic loadings using the theoretically developed model, which was verified with finite element modeling (FEM) simulation. The electrode size was optimized to maximize the electromechanical transformer ratio. As such, the developed model could provide more insight into the design, optimization, and characterization of pMUTs and allow for performance comparison with their cMUT counterparts.

Insertion characteristics and placement of the Mid-Scala electrode array in human temporal bones using detailed cone beam computed tomography.

PubMed

Dietz, Aarno; Gazibegovic, Dzemal; Tervaniemi, Jyrki; Vartiainen, Veli-Matti; Löppönen, Heikki

2016-12-01

The aim of this study was to evaluate the insertion results and placement of the new Advanced Bionics HiFocus Mid-Scala (HFms) electrode array, inserted through the round window membrane, in eight fresh human temporal bones using cone beam computed tomography (CBCT). Pre- and post-insertion CBCT scans were registered to create a 3D reconstruction of the cochlea with the array inserted. With an image fusion technique both the bony edges of the cochlea and the electrode array in situ could accurately be determined, thus enabling to identify the exact position of the electrode array within the scala tympani. Vertical and horizontal scalar location was measured at four points along the cochlea base at an angular insertion depth of 90°, 180° and 270° and at electrode 16, the most basal electrode. Smooth insertion through the round window membrane was possible in all temporal bones. The imaging results showed that there were no dislocations from the scala tympani into the scala vestibule. The HFms electrode was positioned in the middle of the scala along the whole electrode array in three out of the eight bones and in 62 % of the individual locations measured along the base of the cochlea. In only one cochlea a close proximity of the electrode with the basilar membrane was observed, indicating possible contact with the basilar membrane. The results and assessments presented in this study appear to be highly accurate. Although a further validation including histopathology is needed, the image fusion technique described in this study represents currently the most accurate method for intracochlear electrode assessment obtainable with CBCT.

Frequency response of electrochemical cells

NASA Technical Reports Server (NTRS)

Thomas, Daniel L.

1989-01-01

Impedance concepts can be applied to the analysis of battery electrodes, yielding information about the structure of the electrode and the processes occurring in the electrode. Structural parameters such as the specific area (surface area per gram of electrode) can be estimated. Electrode variables such as surface overpotential, ohmic losses, and diffusion limitations may be studied. Nickel and cadmium electrodes were studied by measuring the ac impedance as a function of frequency, and the specific areas that were determined were well within the range of specific areas determined from BET measurements. Impedance spectra were measured for the nickel and cadmium electrodes, and for a 20 A-hr NiCd battery as functions of the state of charge. More work is needed to determine the feasibility of using frequency response as a nondestructive testing technique for batteries.

Active Laplacian electrode for the data-acquisition system of EHG

NASA Astrophysics Data System (ADS)

Li, G.; Wang, Y.; Lin, L.; Jiang, W.; Wang, L. L.; C-Y Lu, Stephen; Besio, Walter G.

2005-01-01

EHG (electrohysterogram) is the recording of uterine electromyogram with external electrodes located on the abdomen of pregnant woman. Derived from the electrical activity generated at the muscle fiber lever, it provides complementary information from the muscle, and appears to be a very promising technique for clinical or physiologic investigation of uterine activity, compared with current monitoring which can't give us complementary phase information of uterine activity. In this article we have shown the disadvantages of the conventional electrodes for EHG data-acquisition system and put forward a new type of electrode that is called active Laplacian electrode. It integrates concentric rings electrode with a bioelectricity preamplifier and is capable of acquiring localized information. We can localise the EHG signals source more easily by using this new electrode.

Laser patterning of platinum electrodes for safe neurostimulation

NASA Astrophysics Data System (ADS)

Green, R. A.; Matteucci, P. B.; Dodds, C. W. D.; Palmer, J.; Dueck, W. F.; Hassarati, R. T.; Byrnes-Preston, P. J.; Lovell, N. H.; Suaning, G. J.

2014-10-01

Objective. Laser surface modification of platinum (Pt) electrodes was investigated for use in neuroprosthetics. Surface modification was applied to increase the surface area of the electrode and improve its ability to transfer charge within safe electrochemical stimulation limits. Approach. Electrode arrays were laser micromachined to produce Pt electrodes with smooth surfaces, which were then modified with four laser patterning techniques to produce surface structures which were nanosecond patterned, square profile, triangular profile and roughened on the micron scale through structured laser interference patterning (SLIP). Improvements in charge transfer were shown through electrochemical impedance spectroscopy (EIS), cyclic voltammetry (CV) and biphasic stimulation at clinically relevant levels. A new method was investigated and validated which enabled the assessment of in vivo electrochemically safe charge injection limits. Main results. All of the modified surfaces provided electrical advantage over the smooth Pt. The SLIP surface provided the greatest benefit both in vitro and in vivo, and this surface was the only type which had injection limits above the threshold for neural stimulation, at a level shown to produce a response in the feline visual cortex when using an electrode array implanted in the suprachoroidal space of the eye. This surface was found to be stable when stimulated with more than 150 million clinically relevant pulses in physiological saline. Significance. Critical to the assessment of implant devices is accurate determination of safe usage limits in an in vivo environment. Laser patterning, in particular SLIP, is a superior technique for improving the performance of implant electrodes without altering the interfacial electrode chemistry through coating. Future work will require chronic in vivo assessment of these electrode patterns.

On-chip collection of particles and cells by AC electroosmotic pumping and dielectrophoresis using asymmetric microelectrodes.

PubMed

Melvin, Elizabeth M; Moore, Brandon R; Gilchrist, Kristin H; Grego, Sonia; Velev, Orlin D

2011-09-01

The recent development of microfluidic "lab on a chip" devices requiring sample sizes <100 μL has given rise to the need to concentrate dilute samples and trap analytes, especially for surface-based detection techniques. We demonstrate a particle collection device capable of concentrating micron-sized particles in a predetermined area by combining AC electroosmosis (ACEO) and dielectrophoresis (DEP). The planar asymmetric electrode pattern uses ACEO pumping to induce equal, quadrilateral flow directed towards a stagnant region in the center of the device. A number of system parameters affecting particle collection efficiency were investigated including electrode and gap width, chamber height, applied potential and frequency, and number of repeating electrode pairs and electrode geometry. The robustness of the on-chip collection design was evaluated against varying electrolyte concentrations, particle types, and particle sizes. These devices are amenable to integration with a variety of detection techniques such as optical evanescent waveguide sensing.

Vacuum-free laminated top electrode with conductive tapes for scalable manufacturing of efficient perovskite solar cells

DOE PAGES

Shao, Yuchuan; Wang, Qi; Dong, Qingfeng; ...

2015-06-25

The efficiency of organometal trihalide perovskites (OTP) solar cells have reached that parity of single crystal silicon, and its nature abundant raw material and solution-process capability promise a bright future for commercialization. However, the vacuum based techniques for metal electrode deposition and additional encapsulation layer increase the cost of the perovskite solar cells dramatically and impede their commercialization process. Here, we report a vacuum-free low temperature lamination technique to fabricate the top electrode by commercial conductive tapes (C-tape). The simple fabrication method yields good quality contact and high efficiency device of 12.7%. The C-tapes also encapsulated the devices effectively, resultingmore » in greatly improved device stability. As a result, the combination of lamination of electrodes and encapsulation layers into a single step significantly reduce the cost of device fabrication.« less

Laser-based surface preparation of composite laminates leads to improved electrodes for electrical measurements

NASA Astrophysics Data System (ADS)

Almuhammadi, Khaled; Selvakumaran, Lakshmi; Alfano, Marco; Yang, Yang; Bera, Tushar Kanti; Lubineau, Gilles

2015-12-01

Electrical impedance tomography (EIT) is a low-cost, fast and effective structural health monitoring technique that can be used on carbon fiber reinforced polymers (CFRP). Electrodes are a key component of any EIT system and as such they should feature low resistivity as well as high robustness and reproducibility. Surface preparation is required prior to bonding of electrodes. Currently this task is mostly carried out by traditional sanding. However this is a time consuming procedure which can also induce damage to surface fibers and lead to spurious electrode properties. Here we propose an alternative processing technique based on the use of pulsed laser irradiation. The processing parameters that result in selective removal of the electrically insulating resin with minimum surface fiber damage are identified. A quantitative analysis of the electrical contact resistance is presented and the results are compared with those obtained using sanding.

In-line monitoring of Li-ion battery electrode porosity and areal loading using active thermal scanning - modeling and initial experiment

DOE PAGES

Rupnowski, Przemyslaw; Ulsh, Michael J.; Sopori, Bhushan; ...

2017-08-18

This work focuses on a new technique called active thermal scanning for in-line monitoring of porosity and areal loading of Li-ion battery electrodes. In this technique a moving battery electrode is subjected to thermal excitation and the induced temperature rise is monitored using an infra-red camera. Static and dynamic experiments with speeds up to 1.5 m min -1 are performed on both cathodes and anodes and a combined micro- and macro-scale finite element thermal model of the system is developed. It is shown experimentally and through simulations that during thermal scanning the temperature profile generated in an electrode depends onmore » both coating porosity (or area loading) and thickness. Here, it is concluded that by inverting this relation the porosity (or areal loading) can be determined, if thermal response and thickness are simultaneously measured.« less

In-line monitoring of Li-ion battery electrode porosity and areal loading using active thermal scanning - modeling and initial experiment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rupnowski, Przemyslaw; Ulsh, Michael J.; Sopori, Bhushan

This work focuses on a new technique called active thermal scanning for in-line monitoring of porosity and areal loading of Li-ion battery electrodes. In this technique a moving battery electrode is subjected to thermal excitation and the induced temperature rise is monitored using an infra-red camera. Static and dynamic experiments with speeds up to 1.5 m min -1 are performed on both cathodes and anodes and a combined micro- and macro-scale finite element thermal model of the system is developed. It is shown experimentally and through simulations that during thermal scanning the temperature profile generated in an electrode depends onmore » both coating porosity (or area loading) and thickness. Here, it is concluded that by inverting this relation the porosity (or areal loading) can be determined, if thermal response and thickness are simultaneously measured.« less

In-line monitoring of Li-ion battery electrode porosity and areal loading using active thermal scanning - modeling and initial experiment

NASA Astrophysics Data System (ADS)

Rupnowski, Przemyslaw; Ulsh, Michael; Sopori, Bhushan; Green, Brian G.; Wood, David L.; Li, Jianlin; Sheng, Yangping

2018-01-01

This work focuses on a new technique called active thermal scanning for in-line monitoring of porosity and areal loading of Li-ion battery electrodes. In this technique a moving battery electrode is subjected to thermal excitation and the induced temperature rise is monitored using an infra-red camera. Static and dynamic experiments with speeds up to 1.5 m min-1 are performed on both cathodes and anodes and a combined micro- and macro-scale finite element thermal model of the system is developed. It is shown experimentally and through simulations that during thermal scanning the temperature profile generated in an electrode depends on both coating porosity (or area loading) and thickness. It is concluded that by inverting this relation the porosity (or areal loading) can be determined, if thermal response and thickness are simultaneously measured.

Wearable polyimide-PDMS electrodes for intrabody communication

NASA Astrophysics Data System (ADS)

Moon, Jin-Hee; Baek, Dong Hyun; Choi, Yoon Young; Lee, Kwang Ho; Kim, Hee Chan; Lee, Sang-Hoon

2010-02-01

In this paper, we introduce a novel wearable electrode for an intra-body area network (I-BAN) by employing the advantages of polyimide (PI) which is a well-known substrate material for flexible electrodes and polydimethylsiloxane (PDMS) which is a biocompatible and representative soft-lithography adaptable material. Electrodes were patterned onto thin and flexible PI substrates and encapsulated in PDMS to enhance skin compatibility. For this purpose, we developed an electrode fabrication process on thin PI substrates and a PDMS encapsulation technique by bonding two PDMS layers on the front and back surfaces of the PI electrode. The mechanical property and communication performance of electrodes were characterized through spectrum analysis to optimize the role as an I-BAN electrode. Skin-compatibility and cyto-toxicity tests using human mesenchymal stem cells (hMSCs) were carried out to demonstrate the non-toxicity of the electrode after continuous wearing. Sinusoidal signals of 45 MHz were successfully transmitted with high fidelity between electrodes separated by 30 cm.

Electro-Active Device Using Radial Electric Field Piezo-Diaphragm for Control of Fluid Movement

NASA Technical Reports Server (NTRS)

Bryant, Robert G. (Inventor); Working, Dennis C. (Inventor)

2005-01-01

A fluid-control electro-active device includes a piezo-diaphragm made from a ferroelectric material sandwiched by first and second electrode patterns configured to introduce an electric field into the ferroelectric material when voltage is applied thereto. The electric field originates at a region of the ferroelectric material between the first and second electrode patterns, and extends radially outward from this region of the ferroelectric material and substantially parallel to the plane of the ferroelectric material. The piezo-diaphragm deflects symmetrically about this region in a direction substantially perpendicular to the electric field. An annular region coupled to and extending radially outward from the piezo-diaphragm perimetrically borders the piezo-diaphragm, A housing is connected to the region and at least one fluid flow path with piezo-diaphragm disposed therein.

A multi-pad electrode based functional electrical stimulation system for restoration of grasp

PubMed Central

2012-01-01

Background Functional electrical stimulation (FES) applied via transcutaneous electrodes is a common rehabilitation technique for assisting grasp in patients with central nervous system lesions. To improve the stimulation effectiveness of conventional FES, we introduce multi-pad electrodes and a new stimulation paradigm. Methods The new FES system comprises an electrode composed of small pads that can be activated individually. This electrode allows the targeting of motoneurons that activate synergistic muscles and produce a functional movement. The new stimulation paradigm allows asynchronous activation of motoneurons and provides controlled spatial distribution of the electrical charge that is delivered to the motoneurons. We developed an automated technique for the determination of the preferred electrode based on a cost function that considers the required movement of the fingers and the stabilization of the wrist joint. The data used within the cost function come from a sensorized garment that is easy to implement and does not require calibration. The design of the system also includes the possibility for fine-tuning and adaptation with a manually controllable interface. Results The device was tested on three stroke patients. The results show that the multi-pad electrodes provide the desired level of selectivity and can be used for generating a functional grasp. The results also show that the procedure, when performed on a specific user, results in the preferred electrode configuration characteristics for that patient. The findings from this study are of importance for the application of transcutaneous stimulation in the clinical and home environments. PMID:23009589

Redox artifacts in electrophysiological recordings

PubMed Central

Berman, Jonathan M.

2013-01-01

Electrophysiological techniques make use of Ag/AgCl electrodes that are in direct contact with cells or bath. In the bath, electrodes are exposed to numerous experimental conditions and chemical reagents that can modify electrode voltage. We examined voltage offsets created in Ag/AgCl electrodes by exposure to redox reagents used in electrophysiological studies. Voltage offsets were measured in reference to an electrode separated from the solution by an agar bridge. The reducing reagents Tris-2-carboxyethly-phosphine, dithiothreitol (DTT), and glutathione, as well as the oxidizing agent H2O2 used at experimentally relevant concentrations reacted with Ag in the electrodes to produce voltage offsets. Chloride ions and strong acids and bases produced offsets at millimolar concentrations. Electrolytic depletion of the AgCl layer, to replicate voltage clamp and sustained use, resulted in increased sensitivity to flow and DTT. Offsets were sensitive to electrode silver purity and to the amount and method of chloride deposition. For example, exposure to 10 μM DTT produced a voltage offset between 10 and 284 mV depending on the chloride deposition method. Currents generated by these offsets are significant and dependent on membrane conductance and by extension the expression of ion channels and may therefore appear to be biological in origin. These data demonstrate a new source of artifacts in electrophysiological recordings that can affect measurements obtained from a variety of experimental techniques from patch clamp to two-electrode voltage clamp. PMID:23344161

A testbed for optimizing electrodes embedded in the skull or in artificial skull replacement pieces used after injury

PubMed Central

Jiang, JingLe; Marathe, Amar R.; Keene, Jennifer C.; Taylor, Dawn M.

2016-01-01

Background Custom-fitted skull replacement pieces are often used after a head injury or surgery to replace damaged bone. Chronic brain recordings are beneficial after injury/surgery for monitoring brain health and seizure development. Embedding electrodes directly in these artificial skull replacement pieces would be a novel, low-risk way to perform chronic brain monitoring in these patients. Similarly, embedding electrodes directly in healthy skull would be a viable minimally-invasive option for many other neuroscience and neurotechnology applications requiring chronic brain recordings. New Method We demonstrate a preclinical testbed that can be used for refining electrode designs embedded in artificial skull replacement pieces or for embedding directly into the skull itself. Options are explored to increase the surface area of the contacts without increasing recording contact diameter to maximize recording resolution. Results Embedding electrodes in real or artificial skull allows one to lower electrode impedance without increasing the recording contact diameter by making use of conductive channels that extend into the skull. The higher density of small contacts embedded in the artificial skull in this testbed enables one to optimize electrode spacing for use in real bone. Comparison with Existing Methods For brain monitoring applications, skull-embedded electrodes fill a gap between electroencephalograms recorded on the scalp surface and the more invasive epidural or subdural electrode sheets. Conclusions Embedding electrodes into the skull or in skull replacement pieces may provide a safe, convenient, minimally-invasive alternative for chronic brain monitoring. The manufacturing methods described here will facilitate further testing of skull-embedded electrodes in animal models. PMID:27979758

A testbed for optimizing electrodes embedded in the skull or in artificial skull replacement pieces used after injury.

PubMed

Jiang, JingLe; Marathe, Amar R; Keene, Jennifer C; Taylor, Dawn M

2017-02-01

Custom-fitted skull replacement pieces are often used after a head injury or surgery to replace damaged bone. Chronic brain recordings are beneficial after injury/surgery for monitoring brain health and seizure development. Embedding electrodes directly in these artificial skull replacement pieces would be a novel, low-risk way to perform chronic brain monitoring in these patients. Similarly, embedding electrodes directly in healthy skull would be a viable minimally-invasive option for many other neuroscience and neurotechnology applications requiring chronic brain recordings. We demonstrate a preclinical testbed that can be used for refining electrode designs embedded in artificial skull replacement pieces or for embedding directly into the skull itself. Options are explored to increase the surface area of the contacts without increasing recording contact diameter to maximize recording resolution. Embedding electrodes in real or artificial skull allows one to lower electrode impedance without increasing the recording contact diameter by making use of conductive channels that extend into the skull. The higher density of small contacts embedded in the artificial skull in this testbed enables one to optimize electrode spacing for use in real bone. For brain monitoring applications, skull-embedded electrodes fill a gap between electroencephalograms recorded on the scalp surface and the more invasive epidural or subdural electrode sheets. Embedding electrodes into the skull or in skull replacement pieces may provide a safe, convenient, minimally-invasive alternative for chronic brain monitoring. The manufacturing methods described here will facilitate further testing of skull-embedded electrodes in animal models. Published by Elsevier B.V.

Validated electrochemical and chromatographic quantifications of some antibiotic residues in pharmaceutical industrial waste water.

PubMed

Ibrahim, Heba K; Abdel-Moety, Mona M; Abdel-Gawad, Sherif A; Al-Ghobashy, Medhat A; Kawy, Mohamed Abdel

2017-03-01

Realistic implementation of ion selective electrodes (ISEs) into environmental monitoring programs has always been a challenging task. This could be largely attributed to difficulties in validation of ISE assay results. In this study, the electrochemical response of amoxicillin trihydrate (AMX), ciprofloxacin hydrochloride (CPLX), trimethoprim (TMP), and norfloxacin (NFLX) was studied by the fabrication of sensitive membrane electrodes belonging to two types of ISEs, which are polyvinyl chloride (PVC) membrane electrodes and glassy carbon (GC) electrodes. Linear response for the membrane electrodes was in the concentration range of 10 -5 -10 -2  mol/L. For the PVC membrane electrodes, Nernstian slopes of 55.1, 56.5, 56.5, and 54.0 mV/decade were achieved over a pH 4-8 for AMX, CPLX, and NFLX, respectively, and pH 3-6 for TMP. On the other hand, for GC electrodes, Nernstian slopes of 59.1, 58.2, 57.0, and 58.2 mV/decade were achieved over pH 4-8 for AMX, CPLX, and NFLX, respectively, and pH 3-6 for TMP. In addition to assay validation to international industry standards, the fabricated electrodes were also cross-validated relative to conventional separation techniques; high performance liquid chromatography (HPLC), and thin layer chromatography (TLC)-densitometry. The HPLC assay was applied in concentration range of 0.5-10.0 μg/mL, for all target analytes. The TLC-densitometry was adopted over a concentration range of 0.3-1.0 μg/band, for AMX, and 0.1-0.9 μg/band, for CPLX, NFLX, and TMP. The proposed techniques were successfully applied for quantification of the selected drugs either in pure form or waste water samples obtained from pharmaceutical plants. The actual waste water samples were subjected to solid phase extraction (SPE) for pretreatment prior to the application of chromatographic techniques (HPLC and TLC-densitometry). On the other hand, the fabricated electrodes were successfully applied for quantification of the antibiotic residues in actual waste water samples without any pretreatment. This finding assures the suitability of the fabricated ISEs for environmental analysis.

Large-Area Cross-Aligned Silver Nanowire Electrodes for Flexible, Transparent, and Force-Sensitive Mechanochromic Touch Screens.

PubMed

Cho, Seungse; Kang, Saewon; Pandya, Ashish; Shanker, Ravi; Khan, Ziyauddin; Lee, Youngsu; Park, Jonghwa; Craig, Stephen L; Ko, Hyunhyub

2017-04-25

Silver nanowire (AgNW) networks are considered to be promising structures for use as flexible transparent electrodes for various optoelectronic devices. One important application of AgNW transparent electrodes is the flexible touch screens. However, the performances of flexible touch screens are still limited by the large surface roughness and low electrical to optical conductivity ratio of random network AgNW electrodes. In addition, although the perception of writing force on the touch screen enables a variety of different functions, the current technology still relies on the complicated capacitive force touch sensors. This paper demonstrates a simple and high-throughput bar-coating assembly technique for the fabrication of large-area (>20 × 20 cm 2 ), highly cross-aligned AgNW networks for transparent electrodes with the sheet resistance of 21.0 Ω sq -1 at 95.0% of optical transmittance, which compares favorably with that of random AgNW networks (sheet resistance of 21.0 Ω sq -1 at 90.4% of optical transmittance). As a proof of concept demonstration, we fabricate flexible, transparent, and force-sensitive touch screens using cross-aligned AgNW electrodes integrated with mechanochromic spiropyran-polydimethylsiloxane composite film. Our force-sensitive touch screens enable the precise monitoring of dynamic writings, tracing and drawing of underneath pictures, and perception of handwriting patterns with locally different writing forces. The suggested technique provides a robust and powerful platform for the controllable assembly of nanowires beyond the scale of conventional fabrication techniques, which can find diverse applications in multifunctional flexible electronic and optoelectronic devices.

Electrocatalytic oxidation of hydrogen peroxide on a platinum electrode in the imitation of oxidative drug metabolism of lidocaine.

PubMed

Nouri-Nigjeh, Eslam; Bruins, Andries P; Bischoff, Rainer; Permentier, Hjalmar P

2012-10-21

Electrochemistry in combination with mass spectrometry has shown promise as a versatile technique not only in the analytical assessment of oxidative drug metabolism, but also for small-scale synthesis of drug metabolites. However, electrochemistry is generally limited to reactions initiated by direct electron transfer. In the case of substituted-aromatic compounds, oxidation proceeds through a Wheland-type intermediate where resonance stabilization of the positive charge determines the regioselectivity of the anodic substitution reaction, and hence limits the extent of generating drug metabolites in comparison with in vivo oxygen insertion reactions. In this study, we show that the electrocatalytic oxidation of hydrogen peroxide on a platinum electrode generates reactive oxygen species, presumably surface-bound platinum-oxo species, which are capable of oxygen insertion reactions in analogy to oxo-ferryl radical cations in the active site of Cytochrome P450. Electrochemical oxidation of lidocaine at constant potential in the presence of hydrogen peroxide produces both 3- and 4-hydroxylidocaine, suggesting reaction via an arene oxide rather than a Wheland-type intermediate. No benzylic hydroxylation was observed, thus freely diffusing radicals do not appear to be present. The results of the present study extend the possibilities of electrochemical imitation of oxidative drug metabolism to oxygen insertion reactions.

Weld repair of carbon-moly coke drums without postweld heat treatment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moore, D.E.

1996-06-01

Investigations to evaluate weld repair of C-{1/2}Mo coke drums without postweld heat treatment (PWHT) are discussed in this paper. These investigations showed that shielded metal-arc welding (SMAW) without PWHT produced heat-affected zones (HAZ) and weld deposits with Charpy V-notch (CVN) impact toughness that exceeded the toughness of ex-service plate material. PWHT de-embrittles strain age-embrittled ex-service plate material. However, warming of drums to 200 F before putting in feed compensates for the omission of the de-embrittling PWHT. Additional testing showed that the de-embrittling PWHT did not significantly improve the fatigue properties of the ex-service plate material. As-welded SMAW repairs were foundmore » to be feasible for coke drums, and repairs have now been in service successfully for up to 2 years. The as-welded SMAW repairs were qualified on the basis of a 300 F preheat using small diameter electrodes for the first pass followed by larger diameter electrodes to temper the HAZ of the first pass. A half-bead technique was not used. Heat input is not precisely controlled as would be required for controlled deposition welding. Following the implementation of SMAW repairs without PWHT, the author extended the work to include as-welded repairs with automatic gas metal-arc welding (GMAW).« less

Engineering novel synthetic strategy to develop mesocarbon microbeads for multi-functional applications

NASA Astrophysics Data System (ADS)

Chaudhary, Anisha; Teotia, Satish; Kumar, Rajeev; Ramesha, K.; Dhakate, Sanjay R.; Kumari, Saroj

2018-04-01

To assess the challenge of affordable technology, present synthetic strategies can be extended to new low-cost synthesis and processing methods that have potential to tailor the properties of the materials. Here we report, a novel method for the synthesis of mesocarbon microbeads (MCMB) through a pre-processing involved pyrolysis technique. The resulting MCMB is compressed into a product and effects of heat treatment temperature on different properties of MCMB is studied. The use of MCMB for the electromagnetic interference (EMI) shielding is new and hence, the effect of heat treatment temperature on EMI shielding effectiveness is studied in X-band. It is observed that EMI shielding effectiveness increases to ‑39.6 dB on increasing the heat treatment temperature. The high conductivity of MCMB plate heat treated upto 2500 °C contributes to highly conducting networks. Additionally, to investigate the electrochemical performance of MCMB as an anode material for lithium ion batteries, 2500 °C heat treated MCMB powder is used to fabricate the electrode. The MCMB electrode exhibits high discharge capacity of 345 mAh g‑1 with a stable capacity for over 50 cycles and good rate capability. Thus, MCMB synthesized by this novel approach can be used for the development of high performance anode materials for Li-ion batteries.

Surface degradation of Li1-xNi0.80Co0.15Al0.05O2 cathodes: Correlating charge transfer impedance with surface phase transformations

NASA Astrophysics Data System (ADS)

Sallis, S.; Pereira, N.; Mukherjee, P.; Quackenbush, N. F.; Faenza, N.; Schlueter, C.; Lee, T.-L.; Yang, W. L.; Cosandey, F.; Amatucci, G. G.; Piper, L. F. J.

2016-06-01

The pronounced capacity fade in Ni-rich layered oxide lithium ion battery cathodes observed when cycling above 4.1 V (versus Li/Li+) is associated with a rise in impedance, which is thought to be due to either bulk structural fatigue or surface reactions with the electrolyte (or combination of both). Here, we examine the surface reactions at electrochemically stressed Li1-xNi0.8Co0.15Al0.05O2 binder-free powder electrodes with a combination of electrochemical impedance spectroscopy, spatially resolving electron microscopy, and spatially averaging X-ray spectroscopy techniques. We circumvent issues associated with cycling by holding our electrodes at high states of charge (4.1 V, 4.5 V, and 4.75 V) for extended periods and correlate charge-transfer impedance rises observed at high voltages with surface modifications retained in the discharged state (2.7 V). The surface modifications involve significant cation migration (and disorder) along with Ni and Co reduction, and can occur even in the absence of significant Li2CO3 and LiF. These data provide evidence that surface oxygen loss at the highest levels of Li+ extraction is driving the rise in impedance.

Ozone production by a dc corona discharge in air contaminated by n-heptane

NASA Astrophysics Data System (ADS)

Pekárek, S.

2008-01-01

Beneficial purposes of ozone such as elimination of odours, harmful bacteria and mildew can be used for transportation of food, fruits and vegetables with the aim to extend their storage life. To date the main technique used for this purpose in the transportation of these commodities, e.g. by trucks, was cooling. Here a combination of cooling together with the supply of ozone into containers with these commodities is considered. For these purposes we studied the effect of air contamination by n-heptane (part of automotive fuels) and humidity on ozone production by a dc hollow needle to mesh corona discharge. We found that, for both polarities of the needle electrode, addition of n-heptane to air (a) decreases ozone production; (b) causes discharge poisoning to occur at lower current than for air; (c) does not substantially influence the current for which the ozone production reaches the maximum. Finally the maximum ozone production for the discharge in air occurs for the same current as the maximum ozone production for the discharge contaminated by n-heptane. We also found that humidity decreases ozone production from air contaminated by n-heptane irrespective of the polarity of the coronating needle electrode. This dependence is stronger for the discharge with the needle biased positively.

Tunable diode laser optogalvanic spectroscopy of molecules

NASA Technical Reports Server (NTRS)

Webster, C. R.; Menzies, R. T.

1983-01-01

The laser optogalvanic (LOG) technique for studying molecular spectra has been extended for the first time to the infrared wavelength region. Portions of the NH3 nu-2 band at 9.5 microns and the NO2 nu-3 band at 6.2 microns have been recorded at Doppler-limited resolution using CW tunable diode lasers to probe dc electrical discharges in pure NH3 and an NO2/He gas mixture. Using adjustable electrode positions and an orthogonal geometry between the probe laser and the discharge axis, two contributions to the optogalvanic signal are identified: one which corresponds to an increase in discharge impedance and is seen only for irradiation of the negative glow region; and a second which corresponds to a decrease in discharge impedance and is seen for irradiation of all other discharge regions.

A MEMS AlN transducer array with flexible interconnections for use as a cochlear implant

NASA Astrophysics Data System (ADS)

Knisely, Katherine; Zhao, Chuming; Grosh, Karl

2015-12-01

A completely implantable artificial organ of Corti (CIAO) was fabricated using batch MEMS processing techniques. A silicon backbone supports five piezoelectric cantilevers, each of which is designed to have an in vivo resonance corresponding to its tonotopic location in the guinea pig ST (20-40 kHz). An attachable polymer ribbon cable extends 4cm from the probe to an electrode bay, where electrical connections to each cantilever are accessed. The actuation responses of the fabricated devices were measured using laser vibrometry confirming the fluid-loaded resonance conforming to the straight section of the first turn of the guinea pig cochlea. First generation devices have been fabricated and the actuated resonances were measured to range from 80.3-134.2kHz in air and 24.3-41.0 kHz in water.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Jing; Hu, Enyuan; Nordlund, Dennis

The phase transition, charge compensation, and local chemical environment of Ni in LiNiO 2 were investigated to understand the degradation mechanism. The electrode was subjected to a variety of bulk and surface-sensitive characterization techniques under different charge–discharge cycling conditions. We observed the phase transition from the original hexagonal H1 phase to another two hexagonal phases (H2 and H3) upon Li deintercalation. Moreover, the gradual loss of H3-phase features was revealed during the repeated charges. The reduction in Ni redox activity occurred at both the charge and the discharge states, and it appeared both in the bulk and at the surfacemore » over the extended cycles. In conclusion, the degradation of crystal structure significantly contributes to the reduction of Ni redox activity, which in turn causes the cycling performance decay of LiNiO 2.« less

Recent Development of Advanced Electrode Materials by Atomic Layer Deposition for Electrochemical Energy Storage.

PubMed

Guan, Cao; Wang, John

2016-10-01

Electrode materials play a decisive role in almost all electrochemical energy storage devices, determining their overall performance. Proper selection, design and fabrication of electrode materials have thus been regarded as one of the most critical steps in achieving high electrochemical energy storage performance. As an advanced nanotechnology for thin films and surfaces with conformal interfacial features and well controllable deposition thickness, atomic layer deposition (ALD) has been successfully developed for deposition and surface modification of electrode materials, where there are considerable issues of interfacial and surface chemistry at atomic and nanometer scale. In addition, ALD has shown great potential in construction of novel nanostructured active materials that otherwise can be hardly obtained by other processing techniques, such as those solution-based processing and chemical vapor deposition (CVD) techniques. This review focuses on the recent development of ALD for the design and delivery of advanced electrode materials in electrochemical energy storage devices, where typical examples will be highlighted and analyzed, and the merits and challenges of ALD for applications in energy storage will also be discussed.

Recent Development of Advanced Electrode Materials by Atomic Layer Deposition for Electrochemical Energy Storage

PubMed Central

2016-01-01

Electrode materials play a decisive role in almost all electrochemical energy storage devices, determining their overall performance. Proper selection, design and fabrication of electrode materials have thus been regarded as one of the most critical steps in achieving high electrochemical energy storage performance. As an advanced nanotechnology for thin films and surfaces with conformal interfacial features and well controllable deposition thickness, atomic layer deposition (ALD) has been successfully developed for deposition and surface modification of electrode materials, where there are considerable issues of interfacial and surface chemistry at atomic and nanometer scale. In addition, ALD has shown great potential in construction of novel nanostructured active materials that otherwise can be hardly obtained by other processing techniques, such as those solution‐based processing and chemical vapor deposition (CVD) techniques. This review focuses on the recent development of ALD for the design and delivery of advanced electrode materials in electrochemical energy storage devices, where typical examples will be highlighted and analyzed, and the merits and challenges of ALD for applications in energy storage will also be discussed. PMID:27840793

Hydrometallurgical treatment of nickel-metal hydride battery electrodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyman, J.W.; Palmer, G.R.

1995-12-31

Nickel-metal hydride (Ni-MH) battery electrodes have been developed as a substitute for cadmium-containing negative electrodes. Use of NI-MH electrodes offers enhanced electrochemical properties in many instances as well as reduced environmental toxicity. Rechargeable batteries using NI-MH electrodes are also strong candidates for electric vehicles. During the production and secondary reclamation of these battery types, recycling procedures will be needed to prevent environmental impact caused by these wastes as well as to recover the value inherent in the scrap. The US Bureau of Mines (USBM) is investigating hydrometallurgical technology that separates and recovers purified metallic components from Ni-MH battery scrap ofmore » two types, AB{sub 2} and AB{sub 5}. An investigation of acid dissolution and metal recovery techniques has determined several processing alternatives that may be used to promote the successful recycling of much of the battery fabrication scrap and eventual secondary scrap. The metals recovered are Ni, Co, and rare earth metals. Although recovery techniques have been identified in principal, their applicability to mixed battery waste stream and economic attractiveness remain to be demonstrated.« less

Visualization and mechanisms of splashing erosion of electrodes in a DC air arc

NASA Astrophysics Data System (ADS)

Wu, Yi; Cui, Yufei; Rong, Mingzhe; Murphy, Anthony B.; Yang, Fei; Sun, Hao; Niu, Chunping; Fan, Shaodi

2017-11-01

The splashing erosion of electrodes in a DC atmospheric-pressure air arc has been investigated by visualization of the electrode surface and the sputtered droplets, and tracking of the droplet trajectories, using image processing techniques. A particle tracking velocimetry algorithm has been introduced to measure the sputtering velocity distribution. Erosion of both tungsten-copper and tungsten-ceria electrodes is studied; in both cases electrode erosion is found to be dominated by droplet splashing rather than metal evaporation. Erosion is directly influenced by both melting and the formation of plasma jets, and can be reduced by the tuning of the plasma jet and electrode material. The results provide an understanding of the mechanisms that lead to the long lifetime of tungsten-copper electrodes, and may provide a path for the design of the electrode system subjected to electric arc to minimize erosion.

A cochlear implant phantom for evaluating CT acquisition parameters

NASA Astrophysics Data System (ADS)

Chakravorti, Srijata; Bussey, Brian J.; Zhao, Yiyuan; Dawant, Benoit M.; Labadie, Robert F.; Noble, Jack H.

2017-03-01

Cochlear Implants (CIs) are surgically implantable neural prosthetic devices used to treat profound hearing loss. Recent literature indicates that there is a correlation between the positioning of the electrode array within the cochlea and the ultimate hearing outcome of the patient, indicating that further studies aimed at better understanding the relationship between electrode position and outcomes could have significant implications for future surgical techniques, array design, and processor programming methods. Post-implantation high resolution CT imaging is the best modality for localizing electrodes and provides the resolution necessary to visually identify electrode position, albeit with an unknown degree of accuracy depending on image acquisition parameters, like the HU range of reconstruction, radiation dose, and resolution of the image. In this paper, we report on the development of a phantom that will both permit studying which CT acquisition parameters are best for accurately identifying electrode position and serve as a ground truth for evaluating how different electrode localization methods perform when using different CT scanners and acquisition parameters. We conclude based on our tests that image resolution and HU range of reconstruction strongly affect how accurately the true position of the electrode array can be found by both experts and automatic analysis techniques. The results presented in this paper demonstrate that our phantom is a versatile tool for assessing how CT acquisition parameters affect the localization of CIs.

Composite substrate for bipolar electrodes

DOEpatents

Tekkanat, Bora; Bolstad, James J.

1992-12-22

Substrates for electrode systems, particularly those to be used for bipolar electrodes in zinc-bromine batteries, are disclosed. The substrates preferably include carbon-black as a conductive filler in a polymeric matrix, with reinforcing materials such as glass fibers. Warpage of the zinc-bromine electrodes which was experienced in the prior art and which was believed to be caused by physical expansion of the electrodes due to bromine absorption by the carbon-black, is substantially eliminated when new substrate fabrication techniques are employed. In the pesent invention, substrates are prepared using a lamination process known as glass mat reinforced thermoplastics technology or, in an alternate embodiment, the substrate is made using a slurry process.

Stacked vapor fed amtec modules

DOEpatents

Sievers, Robert K.

1989-01-01

The present invention pertains to a stacked AMTEC module. The invention includes a tubular member which has an interior. The member is comprised of a ion conductor that substantially conducts ions relative to electrons, preferably a beta"-alumina solid electrolyte, positioned about the interior. A porous electrode for conducting electrons and allowing sodium ions to pass therethrough, and wherein electrons and sodium ions recombine to form sodium is positioned about the beta"-alumina solid electrolyte. The electrode is operated at a temperature and a pressure that allows the recombined sodium to vaporize. Additionally, an outer current collector grid for distributing electrons throughout the porous electrode is positioned about and contacts the porous electrode. Also included in the invention is transporting means for transporting liquid sodium to the beta"-alumina solid electrolyte of the tubular member. A transition piece is positioned about the interior of the member and contacts the transporting means. The transition piece divides the member into a first cell and a second cell such that each first and second cell has a beta"-alumina solid electrolyte, a first and second porous electrode and a grid. The transition piece conducts electrons from the interior of the tubular member. There is supply means for supplying sodium to the transporting means. Preferably the supply means is a shell which surrounds the tubular member and is operated at a temperature such that the vaporized sodium condenses thereon. Returning means for returning the condensed sodium from the shell to the transporting means provides a continuous supply of liquid sodium to the transporting means. Also, there are first conducting means for conducting electric current from the transition piece which extends through the shell, and second conducting means for conducting electric current to the grid of the first cell which extends through the shell.

Silicon/copper dome-patterned electrodes for high-performance hybrid supercapacitors.

PubMed

Liu, Xuyan; Jung, Hun-Gi; Kim, Sang-Ok; Choi, Ho-Suk; Lee, Sangwha; Moon, Jun Hyuk; Lee, Joong Kee

2013-12-02

This study proposes a method for manufacturing high-performance electrode materials in which controlling the shape of the current collector and electrode material for a Li-ion capacitor (LIC). In particular, the proposed LIC manufacturing method maintains the high voltage of a cell by using a microdome-patterned electrode material, allowing for reversible reactions between the Li-ion and the active material for an extended period of time. As a result, the LICs exhibit initial capacities of approximately 42 F g⁻¹, even at 60 A g⁻¹. The LICs also exhibit good cycle performance up to approximately 15,000 cycles. In addition, these advancements allow for a considerably higher energy density than other existing capacitor systems. The energy density of the proposed LICs is approximately nine, two, and 1.5 times higher than those of the electrochemical double layer capacitor (EDLC), AC/LiMn₂O₄ hybrid capacitor, and intrinsic Si/AC LIC, respectively.

Silicon/copper dome-patterned electrodes for high-performance hybrid supercapacitors

NASA Astrophysics Data System (ADS)

Liu, Xuyan; Jung, Hun-Gi; Kim, Sang-Ok; Choi, Ho-Suk; Lee, Sangwha; Moon, Jun Hyuk; Lee, Joong Kee

2013-12-01

This study proposes a method for manufacturing high-performance electrode materials in which controlling the shape of the current collector and electrode material for a Li-ion capacitor (LIC). In particular, the proposed LIC manufacturing method maintains the high voltage of a cell by using a microdome-patterned electrode material, allowing for reversible reactions between the Li-ion and the active material for an extended period of time. As a result, the LICs exhibit initial capacities of approximately 42 F g-1, even at 60 A g-1. The LICs also exhibit good cycle performance up to approximately 15,000 cycles. In addition, these advancements allow for a considerably higher energy density than other existing capacitor systems. The energy density of the proposed LICs is approximately nine, two, and 1.5 times higher than those of the electrochemical double layer capacitor (EDLC), AC/LiMn2O4 hybrid capacitor, and intrinsic Si/AC LIC, respectively.

Demultiplexer circuit for neural stimulation

DOEpatents

Wessendorf, Kurt O; Okandan, Murat; Pearson, Sean

2012-10-09

A demultiplexer circuit is disclosed which can be used with a conventional neural stimulator to extend the number of electrodes which can be activated. The demultiplexer circuit, which is formed on a semiconductor substrate containing a power supply that provides all the dc electrical power for operation of the circuit, includes digital latches that receive and store addressing information from the neural stimulator one bit at a time. This addressing information is used to program one or more 1:2.sup.N demultiplexers in the demultiplexer circuit which then route neural stimulation signals from the neural stimulator to an electrode array which is connected to the outputs of the 1:2.sup.N demultiplexer. The demultiplexer circuit allows the number of individual electrodes in the electrode array to be increased by a factor of 2.sup.N with N generally being in a range of 2-4.

A systematic Monte Carlo simulation study of the primitive model planar electrical double layer over an extended range of concentrations, electrode charges, cation diameters and valences

NASA Astrophysics Data System (ADS)

Valiskó, Mónika; Kristóf, Tamás; Gillespie, Dirk; Boda, Dezső

2018-02-01

The purpose of this study is to provide data for the primitive model of the planar electrical double layer, where ions are modeled as charged hard spheres, the solvent as an implicit dielectric background (with dielectric constant ɛ = 78.5), and the electrode as a smooth, uniformly charged, hard wall. We use canonical and grand canonical Monte Carlo simulations to compute the concentration profiles, from which the electric field and electrostatic potential profiles are obtained by solving Poisson's equation. We report data for an extended range of parameters including 1:1, 2:1, and 3:1 electrolytes at concentrations c = 0.0001 - 1 M near electrodes carrying surface charges up to σ = ±0.5 Cm-2. The anions are monovalent with a fixed diameter d- = 3 Å, while the charge and diameter of cations are varied in the range z+ = 1, 2, 3 and d+ = 1.5, 3, 6, and 9 Å (the temperature is 298.15 K). We provide all the raw data in the supplementary material (ftp://ftp.aip.org/epaps/aip_advances/E-AAIDBI-8-084802">supplementary material).

Advanced electrodes for AMTEC

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fiebig, Brad; Schuller, Michael; Hudson, Patricia

1999-01-01

Texas A&M University has begun an investigation of materials and fabrication methods which will improve AMTEC electrode performance. The study currently involves gathering data on materials which meet the basic requirements of operating in an AMTEC cell, and sorting out candidates possessing characteristics conducive to efficient AMTEC operation. An initial assessment has shown Iridium as a promising metal electrode candidate. Sodium-containing double-oxides, with melting temperatures above AMTEC operating temperatures, including NaNbO{sub 3} and Na{sub 2}Ti{sub 3}O{sub 7}, have been identified as possible electrode dopants, to enhance the sodium conductivity of an electrode. Photo-deposition and Evaporative-deposition will be investigated further asmore » electrode fabrication techniques. {copyright} {ital 1999 American Institute of Physics.}« less

Technical tips: Electrode application and preventing skin breakdown techniques.

PubMed

Berlin, Fira; Carlile, Jennifer A; de Burgo, Maria I; Rochon, Adrienne; Wagner, Esperanza E; Sellers, Martha C; Worrell, Amanda R; Andal, E Lauren C; Woods, Latina R

2011-09-01

The recording electrodes including their precise location, their ability to record during movements that can be intense during a convulsive seizure, and their capability to record for several days without causing skin breakdown are an integral part of long-term EEG recording. Many of the facets of EEG technology have changed dramatically with the introduction of digital EEG. But the electrode and the electrode/skin interface have not had many dramatic changes. The technologist still looks for ways to ensure correct electrode placement, good recording capabilities, and a patient with healthy skin when the electrodes are removed. This Technical Tips features ideas and experiences from several technologists. These technologists express suggestions and opinions which are accepted in Technical Tips.

Analytical Electrochemistry: Methodology and Applications of Dynamic Techniques.

ERIC Educational Resources Information Center

Heineman, William R.; Kissinger, Peter T.

1980-01-01

Reports developments involving the experimental aspects of finite and current analytical electrochemistry including electrode materials (97 cited references), hydrodynamic techniques (56), spectroelectrochemistry (62), stripping voltammetry (70), voltammetric techniques (27), polarographic techniques (59), and miscellany (12). (CS)

Calligraphic Poling of Ferroelectric Material

NASA Technical Reports Server (NTRS)

Mohageg, Makan; Strekalov, Dmitry; Savchenkov, Anatoliy; Matsko, Adrey; Maleki, Lute; Iltchenko, Vladimir

2007-01-01

Calligraphic poling is a technique for generating an arbitrary, possibly complex pattern of localized reversal in the direction of permanent polarization in a wafer of LiNbO3 or other ferroelectric material. The technique is so named because it involves a writing process in which a sharp electrode tip is moved across a surface of the wafer to expose the wafer to a polarizing electric field in the desired pattern. The technique is implemented by use of an apparatus, denoted a calligraphic poling machine (CPM), that includes the electrode and other components as described in more detail below.

Effect of radiofrequency energy emitted from monopolar "Bovie" instruments on cardiac implantable electronic devices.

PubMed

Robinson, Thomas N; Varosy, Paul D; Guillaume, Girard; Dunning, James E; Townsend, Nicole T; Jones, Edward L; Paniccia, Alessandro; Stiegmann, Greg V; Weyer, Christopher; Rozner, Marc A

2014-09-01

The monopolar "Bovie" instrument emits radiofrequency energy that can disrupt the function of other implanted electronic devices through a phenomenon termed electromagnetic interference. The purpose of this study was to quantify the electromagnetic interference occurring on cardiac implantable devices (CIEDs) resulting from monopolar instrument use in common, modifiable clinical scenarios. Three anesthetized pigs underwent CIED placement (1 pacemaker and 2 defibrillators). Electromagnetic interference was quantified when changing the monopolar instrument parameters of generator power, generator mode, surgical technique, orientation of active electrode cord, pathway of current vector, and proximity of active electrode to the CIED. Monopolar instrument parameters that decreased the electromagnetic interference occurring on the CIED included decreasing generator power from 60 W to 30 W (p < 0.001), using cut mode rather than coag mode (p < 0.001), using desiccation technique rather than fulguration technique (p < 0.001), orienting the active electrode cord from the feet rather than across the chest wall (p < 0.001), and avoiding the current vector from crossing the CIED system (p < 0.001). Increasing the distance between the active electrode tool and the CIED system decreased electromagnetic interference occurring on the CIED in a dose-response fashion up to a distance of 10 cm (ANOVA, p < 0.001), after which the magnitude of electromagnetic interference remained constant. Electromagnetic interference occurring on CIEDs resulting from monopolar instruments is minimized by decreasing generator power, using cut mode, using desiccation technique, orienting the active electrode cord from the feet, avoiding the current vector for crossing the CIED system, and increasing the distance between the active electrode and the CIED. Surgeons and operating room staff can minimize electromagnetic interference on CIEDs during monopolar instrument use by accounting for these modifiable clinical factors. Copyright © 2014 American College of Surgeons. Published by Elsevier Inc. All rights reserved.

A Palladium-Tin Modified Microband Electrode Array for Nitrate Determination

PubMed Central

Fu, Yexiang; Bian, Chao; Kuang, Jian; Wang, Jinfen; Tong, Jianhua; Xia, Shanhong

2015-01-01

A microband electrode array modified with palladium-tin bimetallic composite has been developed for nitrate determination. The microband electrode array was fabricated by Micro Electro-Mechanical System (MEMS) technique. Palladium and tin were electrodeposited successively on the electrode, forming a double-layer structure. The effect of the Pd-Sn composite was investigated and its enhancement of catalytic activity and lifetime was revealed. The Pd-Sn modified electrode showed good linearity (R2 = 0.998) from 1 mg/L to 20 mg/L for nitrate determination with a sensitivity of 398 μA/(mg∙L−1∙cm2). The electrode exhibited a satisfying analytical performance after 60 days of storage, indicating a long lifetime. Good repeatability was also displayed by the Pd-Sn modified electrodes. The results provided an option for nitrate determination in water. PMID:26389904

Methods and systems for in-situ electroplating of electrodes

DOEpatents

Zappi, Guillermo Daniel; Zarnoch, Kenneth Paul; Huntley, Christian Andrew; Swalla, Dana Ray

2015-06-02

The present techniques provide electrochemical devices having enhanced electrodes with surfaces that facilitate operation, such as by formation of a porous nickel layer on an operative surface, particularly of the cathode. The porous metal layer increases the surface area of the electrode, which may result in increasing the efficiency of the electrochemical devices. The formation of the porous metal layer is performed in situ, that is, after the assembly of the electrodes into an electrochemical device. The in situ process offers a number of advantages, including the ability to protect the porous metal layer on the electrode surface from damage during assembly of the electrochemical device. The enhanced electrode and the method for its processing may be used in any number of electrochemical devices, and is particularly well suited for electrodes in an electrolyzer useful for splitting water into hydrogen and oxygen.

Mirror Langmuir probe: a technique for real-time measurement of magnetized plasma conditions using a single Langmuir electrode.

PubMed

LaBombard, B; Lyons, L

2007-07-01

A new method for the real-time evaluation of the conditions in a magnetized plasma is described. The technique employs an electronic "mirror Langmuir probe" (MLP), constructed from bipolar rf transistors and associated high-bandwidth electronics. Utilizing a three-state bias wave form and active feedback control, the mirror probe's I-V characteristic is continuously adjusted to be a scaled replica of the "actual" Langmuir electrode immersed in a plasma. Real-time high-bandwidth measurements of the plasma's electron temperature, ion saturation current, and floating potential can thereby be obtained using only a single electrode. Initial tests of a prototype MLP system are reported, proving the concept. Fast-switching metal-oxide-semiconductor field-effect transistors produce the required three-state voltage bias wave form, completing a full cycle in under 1 mus. Real-time outputs of electron temperature, ion saturation current, and floating potential are demonstrated, which accurately track an independent computation of these values from digitally stored I-V characteristics. The MLP technique represents a significant improvement over existing real-time methods, eliminating the need for multiple electrodes and sampling all three plasma parameters at a single spatial location.

Utilizing neuronavigation for virtual electrode representation and safe resection following SEEG; a technical report.

PubMed

Brandmeir, Nicholas; Sather, Michael

2018-02-20

One of the most effective treatments for epilepsy is resection, but it remains underutilized. Efforts must be made to increase the ease, safety, and efficacy of epilepsy resection to improve utilization. Studies have shown an improved risk profile of stereoelectroencephalography (SEEG) over subdural grids (SDG) for invasive monitoring. One limitation to increased adoption of SEEG at epilepsy centers is the theoretical difficulty of planning a delayed resection once electrodes are removed. Our objective was to develop and present a technique using readily available neuronavigation technology to guide a cortical, non-lesional epilepsy resection with co-registration of imaging during invasive monitoring to imaging in an explanted patient, allowing for virtual visualization of electrodes. An example case taking advantage of the technique described above as an adjunct for an anatomically guided resection is presented with technical details and images. Intraoperative neuronavigation was successfully used to virtually represent previously removed SEEG electrodes and accuracy could be easily verified by examining scars on the scalp, bone, dura and pia. The simple technique presented can be a useful adjunct to resection following SEEG. This may help increase the adoption of SEEG, even when resection is planned.

Future Power Production by LENR with Thin-Film Electrodes

NASA Astrophysics Data System (ADS)

Miley, George H.; Hora, Heinz; Lipson, Andrei; Luo, Nie; Shrestha, P. Joshi

2007-03-01

PdD cluster reaction theory was recently proposed to explain a wide range of Low energy Nuclear Reaction (LENR) experiments. If understood and optimized, cluster reactions could lead to a revolutionary new power source of nuclear energy. The route is two-fold. First, the excess heat must be obtained reproducibly and over extended run times. Second, the percentage of excess must be significantly (order of magnitude or more) higher than the 20-50% typically today. The thin film methods described here have proven to be quite reproducible, e.g. providing excess heat of 20-30% in nine consecutive runs of several weeks each. However, mechanical separation of the films occurs over long runs due to the severe mechanical stresses created.. Techniques to overcome these problems are possible using graded bonding techniques similar to that used in high temperature solid oxide fuel cells. Thus the remaining key issue is to increase the excess heat. The cluster model provides import insight into this. G. H. Miley, H. Hora, et al., 233rd Amer Chem Soc Meeting, Chicago, IL, March 25-29, 2007.

Variable energy constant current accelerator structure

DOEpatents

Anderson, Oscar A.

1990-01-01

A variable energy, constant current ion beam accelerator structure is disclosed comprising an ion source capable of providing the desired ions, a pre-accelerator for establishing an initial energy level, a matching/pumping module having means for focusing means for maintaining the beam current, and at least one main accelerator module for continuing beam focus, with means capable of variably imparting acceleration to the beam so that a constant beam output current is maintained independent of the variable output energy. In a preferred embodiment, quadrupole electrodes are provided in both the matching/pumping module and the one or more accelerator modules, and are formed using four opposing cylinder electrodes which extend parallel to the beam axis and are spaced around the beam at 90.degree. intervals with opposing electrodes maintained at the same potential. Adjacent cylinder electrodes of the quadrupole structure are maintained at different potentials to thereby reshape the cross section of the charged particle beam to an ellipse in cross section at the mid point along each quadrupole electrode unit in the accelerator modules. The beam is maintained in focus by alternating the major axis of the ellipse along the x and y axis respectively at adjacent quadrupoles. In another embodiment, electrostatic ring electrodes may be utilized instead of the quadrupole electrodes.

Lifetime studies of high power rhodium/tungsten and molybdenum electrodes for application to AMTEC (alkali metal thermal-to-electric converter)

NASA Technical Reports Server (NTRS)

Williams, R. M.; Jeffries-Nakamura, B.; Underwood, M. L.; O'Connor, D.; Ryan, M. A.; Kikkert, S.; Bankston, C. P.

1990-01-01

A detailed and fundamental model for the electrochemical behavior of AMTEC electrodes is developed which can aid in interpreting the processes which occur during prolonged operation of these electrodes. Because the sintering and grain growth of metal particles is also a well-understood phenomenon, the changes in electrode performance which accompany its morphological evolution may be anticipated and modeled. The grain growth rate observed for porous Mo AMTEC electrodes is significantly higher than that predicted from surface diffusion data obtained at higher temperatures and incorporated into the grain growth model. The grain growth observed under AMTEC conditions is also somewhat higher than that measured for Mo films on BASE (beta-alumina solid electrolyte) substrates in vacuum or at similar temperatures. Results of modeling indicate that thin Mo electrodes may show significant performance degradation for extended operation (greater than 10,000 h) at higher operating temperatures (greater than 1150 K), whereas W/Rh and W/Pt electrodes are expected to show adequate performance at 1200 K for lifetimes greater than 10,000 h. It is pointed out that current collection grids and leads must consist of refractory metals such as Mo and W which do not accelerate sintering or metal migration.

Current-induced transition from particle-by-particle to concurrent intercalation in phase-separating battery electrodes.

PubMed

Li, Yiyang; El Gabaly, Farid; Ferguson, Todd R; Smith, Raymond B; Bartelt, Norman C; Sugar, Joshua D; Fenton, Kyle R; Cogswell, Daniel A; Kilcoyne, A L David; Tyliszczak, Tolek; Bazant, Martin Z; Chueh, William C

2014-12-01

Many battery electrodes contain ensembles of nanoparticles that phase-separate on (de)intercalation. In such electrodes, the fraction of actively intercalating particles directly impacts cycle life: a vanishing population concentrates the current in a small number of particles, leading to current hotspots. Reports of the active particle population in the phase-separating electrode lithium iron phosphate (LiFePO4; LFP) vary widely, ranging from near 0% (particle-by-particle) to 100% (concurrent intercalation). Using synchrotron-based X-ray microscopy, we probed the individual state-of-charge for over 3,000 LFP particles. We observed that the active population depends strongly on the cycling current, exhibiting particle-by-particle-like behaviour at low rates and increasingly concurrent behaviour at high rates, consistent with our phase-field porous electrode simulations. Contrary to intuition, the current density, or current per active internal surface area, is nearly invariant with the global electrode cycling rate. Rather, the electrode accommodates higher current by increasing the active particle population. This behaviour results from thermodynamic transformation barriers in LFP, and such a phenomenon probably extends to other phase-separating battery materials. We propose that modifying the transformation barrier and exchange current density can increase the active population and thus the current homogeneity. This could introduce new paradigms to enhance the cycle life of phase-separating battery electrodes.

The effect of electrodes on 11 acene molecular spin valve: Semi-empirical study

NASA Astrophysics Data System (ADS)

Aadhityan, A.; Preferencial Kala, C.; John Thiruvadigal, D.

2017-10-01

A new revolution in electronics is molecular spintronics, with the contemporary evolution of the two novel disciplines of spintronics and molecular electronics. The key point is the creation of molecular spin valve which consists of a diamagnetic molecule in between two magnetic leads. In this paper, non-equilibrium Green's function (NEGF) combined with Extended Huckel Theory (EHT); a semi-empirical approach is used to analyse the electron transport characteristics of 11 acene molecular spin valve. We examine the spin-dependence transport on 11 acene molecular junction with various semi-infinite electrodes as Iron, Cobalt and Nickel. To analyse the spin-dependence transport properties the left and right electrodes are joined to the central region in parallel and anti-parallel configurations. We computed spin polarised device density of states, projected device density of states of carbon and the electrode element, and transmission of these devices. The results demonstrate that the effect of electrodes modifying the spin-dependence behaviours of these systems in a controlled way. In Parallel and anti-parallel configuration the separation of spin up and spin down is lager in the case of iron electrode than nickel and cobalt electrodes. It shows that iron is the best electrode for 11 acene spin valve device. Our theoretical results are reasonably impressive and trigger our motivation for comprehending the transport properties of these molecular-sized contacts.

A novel method of fabricating carbon nanotubes-polydimethylsiloxane composite electrodes for electrocardiography.

PubMed

Liu, Benyan; Chen, Yingmin; Luo, Zhangyuan; Zhang, Wenzan; Tu, Quan; Jin, Xun

2015-01-01

Polymer-based flexible electrodes are receiving much attention in medical applications due to their good wearing comfort. The current fabrication methods of such electrodes are not widely applied. In this study, polydimethylsiloxane (PDMS) and conductive additives of carbon nanotubes (CNTs) were employed to fabricate composite electrodes for electrocardiography (ECG). A three-step dispersion process consisting of ultrasonication, stirring, and in situ polymerization was developed to yield homogenous CNTs-PDMS mixtures. The CNTs-PDMS mixtures were used to fabricate CNTs-PDMS composite electrodes by replica technology. The influence of ultrasonication time and CNT concentration on polymer electrode performance was evaluated by impedance and ECG measurements. The signal amplitude of the electrodes prepared using an ultrasonication time of 12 h and CNT content of 5 wt% was comparable to that of commercial Ag/AgCl electrodes. The polymer electrodes were easily fabricated by conventional manufacturing techniques, indicating a potential advantage of reduced cost for mass production.

Comparative study of organic transistors with different graphene electrodes fabricated using a simple patterning method

NASA Astrophysics Data System (ADS)

Kang, Narae; Smith, Christian W.; Ishigami, Masa; Khondaker, Saiful I.

2017-12-01

The performance of organic field-effect transistors (OFETs) can be greatly limited due to the inefficient charge injection caused by the large interfacial barrier at the metal/organic semiconductor interface. To improve this, two-dimensional graphene films have been suggested as alternative electrode materials; however, a comparative study of OFET performances using different types of graphene electrodes has not been systematically investigated. Here, we present a comparative study on the performance of pentacene OFETs using chemical vapor deposition (CVD) grown graphene and reduced graphene oxide (RGO) as electrodes. The large area electrodes were patterned using a simple and environmentally benign patterning technique. Although both the CVD graphene and RGO electrodes showed enhanced device performance compared to metal electrodes, we found the maximum performance enhancement from CVD grown graphene electrodes. Our study suggests that, in addition to the strong π-π interaction at the graphene/organic interface, the higher conductivity of the electrodes also plays an important role in the performance of OFETs.

Electrostatic-Force-Assisted Dispensing Printing to Construct High-Aspect-Ratio of 0.79 Electrodes on a Textured Surface with Improved Adhesion and Contact Resistivity

PubMed Central

Shin, Dong-Youn; Yoo, Sung-Soo; Song, Hee-eun; Tak, Hyowon; Byun, Doyoung

2015-01-01

As a novel route to construct fine and abnormally high-aspect-ratio electrodes with excellent adhesion and reduced contact resistivity on a textured surface, an electrostatic-force-assisted dispensing printing technique is reported and compared with conventional dispensing and electrohydrodynamic jet printing techniques. The electrostatic force applied between a silver paste and the textured surface of a crystalline silicon solar cell wafer significantly improves the physical adhesion of the electrodes, whereas those fabricated using a conventional dispensing printing technique peel off with a silver paste containing 2 wt% of a fluorosurfactant. Moreover, the contact resistivity and dimensionless deviation of total resistance are significantly reduced from 2.19 ± 1.53 mΩ·cm2 to 0.98 ± 0.92 mΩ·cm2 and from 0.10 to 0.03, respectively. By utilizing electrodes with an abnormally high-aspect-ratio of 0.79 (the measured thickness and width are 30.4 μm and 38.3 μm, respectively), the cell efficiency is 17.2% on a polycrystalline silicon solar cell with an emitter sheet resistance of 60 Ω/sq. This cell efficiency is considerably higher than previously reported values obtained using a conventional electrohydrodynamic jet printing technique, by +0.48–3.5%p. PMID:26576857

A microelectromechanical accelerometer fabricated using printed circuit processing techniques

NASA Astrophysics Data System (ADS)

Rogers, J. E.; Ramadoss, R.; Ozmun, P. M.; Dean, R. N.

2008-01-01

A microelectromechanical systems (MEMS) capacitive-type accelerometer fabricated using printed circuit processing techniques is presented. A Kapton polymide film is used as the structural layer for fabricating the MEMS accelerometer. The accelerometer proof mass along with four suspension beams is defined in the Kapton polyimide film. The proof mass is suspended above a Teflon substrate using a spacer. The deflection of the proof mass is detected using a pair of capacitive sensing electrodes. The top electrode of the accelerometer is defined on the top surface of the Kapton film. The bottom electrode is defined in the metallization on the Teflon substrate. The initial gap height is determined by the distance between the bottom electrode and the Kapton film. For an applied external acceleration (normal to the proof mass), the proof mass deflects toward or away from the fixed bottom electrode due to inertial force. This deflection causes either a decrease or increase in the air-gap height thereby either increasing or decreasing the capacitance between the top and the bottom electrodes. An example PCB MEMS accelerometer with a square proof mass of membrane area 6.4 mm × 6.4 mm is reported. The measured resonant frequency is 375 Hz and the Q-factor in air is 0.52.

Combining operando synchrotron X-ray tomographic microscopy and scanning X-ray diffraction to study lithium ion batteries

PubMed Central

Pietsch, Patrick; Hess, Michael; Ludwig, Wolfgang; Eller, Jens; Wood, Vanessa

2016-01-01

We present an operando study of a lithium ion battery combining scanning X-ray diffraction (SXRD) and synchrotron radiation X-ray tomographic microscopy (SRXTM) simultaneously for the first time. This combination of techniques facilitates the investigation of dynamic processes in lithium ion batteries containing amorphous and/or weakly attenuating active materials. While amorphous materials pose a challenge for diffraction techniques, weakly attenuating material systems pose a challenge for attenuation-contrast tomography. Furthermore, combining SXRD and SRXTM can be used to correlate processes occurring at the atomic level in the crystal lattices of the active materials with those at the scale of electrode microstructure. To demonstrate the benefits of this approach, we investigate a silicon powder electrode in lithium metal half-cell configuration. Combining SXRD and SRXTM, we are able to (i) quantify the dissolution of the metallic lithium electrode and the expansion of the silicon electrode, (ii) better understand the formation of the Li15Si4 phase, and (iii) non-invasively probe kinetic limitations within the silicon electrode. A simple model based on the 1D diffusion equation allows us to qualitatively understand the observed kinetics and demonstrates why high-capacity electrodes are more prone to inhomogeneous lithiation reactions. PMID:27324109

Combining operando synchrotron X-ray tomographic microscopy and scanning X-ray diffraction to study lithium ion batteries

NASA Astrophysics Data System (ADS)

Pietsch, Patrick; Hess, Michael; Ludwig, Wolfgang; Eller, Jens; Wood, Vanessa

2016-06-01

We present an operando study of a lithium ion battery combining scanning X-ray diffraction (SXRD) and synchrotron radiation X-ray tomographic microscopy (SRXTM) simultaneously for the first time. This combination of techniques facilitates the investigation of dynamic processes in lithium ion batteries containing amorphous and/or weakly attenuating active materials. While amorphous materials pose a challenge for diffraction techniques, weakly attenuating material systems pose a challenge for attenuation-contrast tomography. Furthermore, combining SXRD and SRXTM can be used to correlate processes occurring at the atomic level in the crystal lattices of the active materials with those at the scale of electrode microstructure. To demonstrate the benefits of this approach, we investigate a silicon powder electrode in lithium metal half-cell configuration. Combining SXRD and SRXTM, we are able to (i) quantify the dissolution of the metallic lithium electrode and the expansion of the silicon electrode, (ii) better understand the formation of the Li15Si4 phase, and (iii) non-invasively probe kinetic limitations within the silicon electrode. A simple model based on the 1D diffusion equation allows us to qualitatively understand the observed kinetics and demonstrates why high-capacity electrodes are more prone to inhomogeneous lithiation reactions.

Scalable Dry Printing Manufacturing to Enable Long-Life and High Energy Lithium-Ion Batteries

DOE PAGES

Liu, Jin; Ludwig, Brandon; Liu, Yangtao; ...

2017-08-22

Slurry casting method dominates the electrode manufacture of lithium-ion batteries. The entire procedure is similar to the newspaper printing that includes premixing of cast materials into solvents homogeneously, and continuously transferring and drying the slurry mixture onto the current collector. As a market approaching US $80 billion by 2024, the optimization of manufacture process is crucial and attractive. However, the organic solvent remains irreplaceable in the wet method for making slurries, even though it is capital-intensive and toxic. In this paper, an advanced powder printing technique is demonstrated that is completely solvent-free and dry. Through removing the solvent and relatedmore » procedures, this method is anticipated to statistically save 20% of the cost at a remarkably shortened production cycle (from hours to minutes). The dry printed electrodes outperform commercial slurry cast ones in 650 cycles (80% capacity retention in 500 cycles), and thick electrodes are successfully fabricated to increase the energy density. Furthermore, microscopy techniques are utilized to characterize the difference of electrode microstructure between dry and wet methods, and distinguish dry printing's advantages on controlling the microstructure. Finally, this study proves a practical fabrication method for lithium-ion electrodes with lowered cost and favorable performance, and allows more advanced electrode designs potentially.« less

Electrophoretic deposition of thermites onto micro-engineered electrodes prepared by direct-ink writing.

PubMed

Sullivan, K T; Zhu, C; Tanaka, D J; Kuntz, J D; Duoss, E B; Gash, A E

2013-02-14

This work combines electrophoretic deposition (EPD) with direct-ink writing (DIW) to prepare thin films of Al/CuO thermites onto patterned two- and three-dimensional silver electrodes. DIW was used to write the electrodes using a silver nanoparticle ink, and EPD was performed in a subsequent step to deposit the thermite onto the conductive electrodes. Unlike conventional lithographic techniques, DIW is a low-cost and versatile alternative to print fine-featured electrodes, and adds the benefit of printing self-supported three-dimensional structures. EPD provides a method for depositing the composite thermite only onto the conductive electrodes, and with controlled thicknesses, which provides fine spatial and mass control, respectively. EPD has previously been shown to produce well-mixed thermite composites which can pack to reasonably high densities without the need for any postprocessing. Homogeneous mixing is particularly important in reactive composities, where good mixing can enhance the reaction kinetics by decreasing the transport distance between the components. Several two- and three-dimensional designs were investigated to highlight the versatility of using DIW and EPD together. In addition to energetic applications, we anticipate that this combination of techniques will have a variety of other applications, which would benefit from the controlled placement of a thin film of one material onto a conductive architecture of a second material.

Scalable Dry Printing Manufacturing to Enable Long-Life and High Energy Lithium-Ion Batteries

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Jin; Ludwig, Brandon; Liu, Yangtao

Slurry casting method dominates the electrode manufacture of lithium-ion batteries. The entire procedure is similar to the newspaper printing that includes premixing of cast materials into solvents homogeneously, and continuously transferring and drying the slurry mixture onto the current collector. As a market approaching US $80 billion by 2024, the optimization of manufacture process is crucial and attractive. However, the organic solvent remains irreplaceable in the wet method for making slurries, even though it is capital-intensive and toxic. In this paper, an advanced powder printing technique is demonstrated that is completely solvent-free and dry. Through removing the solvent and relatedmore » procedures, this method is anticipated to statistically save 20% of the cost at a remarkably shortened production cycle (from hours to minutes). The dry printed electrodes outperform commercial slurry cast ones in 650 cycles (80% capacity retention in 500 cycles), and thick electrodes are successfully fabricated to increase the energy density. Furthermore, microscopy techniques are utilized to characterize the difference of electrode microstructure between dry and wet methods, and distinguish dry printing's advantages on controlling the microstructure. Finally, this study proves a practical fabrication method for lithium-ion electrodes with lowered cost and favorable performance, and allows more advanced electrode designs potentially.« less

Large-strain, multiform movements from designable electrothermal actuators based on large highly anisotropic carbon nanotube sheets.

PubMed

Li, Qingwei; Liu, Changhong; Lin, Yuan-Hua; Liu, Liang; Jiang, Kaili; Fan, Shoushan

2015-01-27

Many electroactive polymer (EAP) actuators use diverse configurations of carbon nanotubes (CNTs) as pliable electrodes to realize discontinuous, agile movements, for CNTs are conductive and flexible. However, the reported CNT-based EAP actuators could only accomplish simple, monotonous actions. Few actuators were extended to complex devices because efficiently preparing a large-area CNT electrode was difficult, and complex electrode design has not been carried out. In this work, we successfully prepared large-area CNT paper (buckypaper, BP) through an efficient approach. The BP is highly anisotropic, strong, and suitable as flexible electrodes. By means of artful graphic design and processing on BP, we fabricated various functional BP electrodes and developed a series of BP-polymer electrothermal actuators (ETAs). The prepared ETAs can realize various controllable movements, such as large-stain bending (>180°), helical curling (∼ 630°), or even bionic actuations (imitating human-hand actions). These functional and interesting movements benefit from flexible electrode design and the anisotropy of BP material. Owing to the advantages of low driving voltage (20-200 V), electrolyte-free and long service life (over 10000 times), we think the ETAs will have great potential applications in the actuator field.

Tracking boundary movement and exterior shape modelling in lung EIT imaging.

PubMed

Biguri, A; Grychtol, B; Adler, A; Soleimani, M

2015-06-01

Electrical impedance tomography (EIT) has shown significant promise for lung imaging. One key challenge for EIT in this application is the movement of electrodes during breathing, which introduces artefacts in reconstructed images. Various approaches have been proposed to compensate for electrode movement, but no comparison of these approaches is available. This paper analyses boundary model mismatch and electrode movement in lung EIT. The aim is to evaluate the extent to which various algorithms tolerate movement, and to determine if a patient specific model is required for EIT lung imaging. Movement data are simulated from a CT-based model, and image analysis is performed using quantitative figures of merit. The electrode movement is modelled based on expected values of chest movement and an extended Jacobian method is proposed to make use of exterior boundary tracking. Results show that a dynamical boundary tracking is the most robust method against any movement, but is computationally more expensive. Simultaneous electrode movement and conductivity reconstruction algorithms show increased robustness compared to only conductivity reconstruction. The results of this comparative study can help develop a better understanding of the impact of shape model mismatch and electrode movement in lung EIT.

A biofilm microreactor system for simultaneous electrochemical and nuclear magnetic resonance techniques.

PubMed

Renslow, R S; Babauta, J T; Majors, P D; Mehta, H S; Ewing, R J; Ewing, T W; Mueller, K T; Beyenal, H

2014-01-01

Nuclear magnetic resonance (NMR) techniques are ideally suited for the study of biofilms and for probing their microenvironments because these techniques allow for noninvasive interrogation and in situ monitoring with high resolution. By combining NMR with simultaneous electrochemical techniques, it is possible to sustain and study live biofilms respiring on electrodes. Here, we describe a biofilm microreactor system, including a reusable and a disposable reactor, that allows for simultaneous electrochemical and NMR techniques (EC-NMR) at the microscale. Microreactors were designed with custom radio frequency resonator coils, which allowed for NMR measurements of biofilms growing on polarized gold electrodes. For an example application of this system we grew Geobacter sulfurreducens biofilms on electrodes. EC-NMR was used to investigate growth medium flow velocities and depth-resolved acetate concentration inside the biofilm. As a novel contribution we used Monte Carlo error analysis to estimate the standard deviations of the acetate concentration measurements. Overall, we found that the disposable EC-NMR microreactor provided a 9.7 times better signal-to-noise ratio over the reusable reactor. The EC-NMR biofilm microreactor system can ultimately be used to correlate extracellular electron transfer rates with metabolic reactions and explore extracellular electron transfer mechanisms.

Place-pitch manipulations with cochlear implants

PubMed Central

Macherey, Olivier; Carlyon, Robert P.

2012-01-01

Pitch can be conveyed to cochlear implant (CI) listeners via both place of excitation and temporal cues. The transmission of place cues may be hampered by several factors including limitations on the insertion depth and number of implanted electrodes, and the broad current spread produced by monopolar stimulation. The following series of experiments investigate several methods to partially overcome these limitations. Experiment 1 compares two recently published techniques that aim to activate more apical fibers than produced by monopolar or bipolar stimulation of the most apical contacts. The first technique (phantom stimulation) manipulates the current spread by simultaneously stimulating two electrodes with opposite-polarity pulses of different amplitudes. The second technique manipulates the neural spread of excitation by using asymmetric pulses and exploiting the polarity-sensitive properties of auditory nerve fibers. The two techniques yielded similar results and were shown to produce lower place pitch percepts than stimulation of monopolar and bipolar symmetric pulses. Furthermore, combining these two techniques may be advantageous in a clinical setting. Experiment 2 proposes a novel method to create place pitches intermediate to those produced by physical electrodes by using charge-balanced asymmetric pulses in bipolar mode with different degrees of asymmetry. PMID:22423718

Electrocatalytic oxidation of Epinephrine and Norepinephrine at metal oxide doped phthalocyanine/MWCNT composite sensor

PubMed Central

Mphuthi, Ntsoaki G.; Adekunle, Abolanle S.; Ebenso, Eno E.

2016-01-01

Glassy carbon electrode (GCE) was modified with metal oxides (MO = Fe3O4, ZnO) nanoparticles doped phthalocyanine (Pc) and functionalized MWCNTs, and the electrocatalytic properties were studied. Successful synthesis of the metal oxide nanoparticles and the MO/Pc/MWCNT composite were confirmed using FTIR, Raman and SEM techniques. The electrodes were characterized using cyclic voltammetry (CV) technique. The electrocatalytic behaviour of the electrode towards epinephrine (EP) and norepinephrine (NE) oxidation was investigated using CV and DPV. Result showed that GCE-MWCNT/Fe3O4/2,3-Nc, GCE-MWCNT/Fe3O429H,31H-Pc, GCE-MWCNT/ZnO/2,3-Nc and GCE-MWCNT/ZnO/29H,31H-Pc electrodes gave enhanced EP and NE current response. Stability study indicated that the four GCE-MWCNT/MO/Pc modified electrodes were stable against electrode fouling effect with the percentage NE current drop of 5.56–5.88% after 20 scans. GCE-MWCNT/Fe3O4/29H,31H-Pc gave the lowest limit of detection (4.6 μM) towards EP while MWCNT/ZnO/29H,31H-Pc gave the lowest limit of detection (1.7 μM) towards NE. The limit of detection and sensitivity of the electrodes compared well with literature. Electrocatalytic oxidation of EP and NE on GCE-MWCNT/MO/Pc electrodes was diffusion controlled with some adsorption of electro-oxidation reaction intermediates products. The electrodes were found to be electrochemically stable, reusable and can be used for the analysis of EP and NE in real life samples. PMID:27245690

Integrated field emission array for ion desorption

DOEpatents

Resnick, Paul J; Hertz, Kristin L.; Holland, Christopher; Chichester, David

2016-08-23

An integrated field emission array for ion desorption includes an electrically conductive substrate; a dielectric layer lying over the electrically conductive substrate comprising a plurality of laterally separated cavities extending through the dielectric layer; a like plurality of conically-shaped emitter tips on posts, each emitter tip/post disposed concentrically within a laterally separated cavity and electrically contacting the substrate; and a gate electrode structure lying over the dielectric layer, including a like plurality of circular gate apertures, each gate aperture disposed concentrically above an emitter tip/post to provide a like plurality of annular gate electrodes and wherein the lower edge of each annular gate electrode proximate the like emitter tip/post is rounded. Also disclosed herein are methods for fabricating an integrated field emission array.

Integrated field emission array for ion desorption

DOEpatents

Resnick, Paul J; Hertz, Kristin L; Holland, Christopher; Chichester, David; Schwoebel, Paul

2013-09-17

An integrated field emission array for ion desorption includes an electrically conductive substrate; a dielectric layer lying over the electrically conductive substrate comprising a plurality of laterally separated cavities extending through the dielectric layer; a like plurality of conically-shaped emitter tips on posts, each emitter tip/post disposed concentrically within a laterally separated cavity and electrically contacting the substrate; and a gate electrode structure lying over the dielectric layer, including a like plurality of circular gate apertures, each gate aperture disposed concentrically above an emitter tip/post to provide a like plurality of annular gate electrodes and wherein the lower edge of each annular gate electrode proximate the like emitter tip/post is rounded. Also disclosed herein are methods for fabricating an integrated field emission array.

Rechargeable lithium-ion cell

DOEpatents

Bechtold, Dieter; Bartke, Dietrich; Kramer, Peter; Kretzschmar, Reiner; Vollbert, Jurgen

1999-01-01

The invention relates to a rechargeable lithium-ion cell, a method for its manufacture, and its application. The cell is distinguished by the fact that it has a metallic housing (21) which is electrically insulated internally by two half shells (15), which cover electrode plates (8) and main output tabs (7) and are composed of a non-conductive material, where the metallic housing is electrically insulated externally by means of an insulation coating. The cell also has a bursting membrane (4) which, in its normal position, is located above the electrolyte level of the cell (1). In addition, the cell has a twisting protection (6) which extends over the entire surface of the cover (2) and provides centering and assembly functions for the electrode package, which comprises the electrode plates (8).

Design, fabrication and skin-electrode contact analysis of polymer microneedle-based ECG electrodes

NASA Astrophysics Data System (ADS)

O'Mahony, Conor; Grygoryev, Konstantin; Ciarlone, Antonio; Giannoni, Giuseppe; Kenthao, Anan; Galvin, Paul

2016-08-01

Microneedle-based ‘dry’ electrodes have immense potential for use in diagnostic procedures such as electrocardiography (ECG) analysis, as they eliminate several of the drawbacks associated with the conventional ‘wet’ electrodes currently used for physiological signal recording. To be commercially successful in such a competitive market, it is essential that dry electrodes are manufacturable in high volumes and at low cost. In addition, the topographical nature of these emerging devices means that electrode performance is likely to be highly dependent on the quality of the skin-electrode contact. This paper presents a low-cost, wafer-level micromoulding technology for the fabrication of polymeric ECG electrodes that use microneedle structures to make a direct electrical contact to the body. The double-sided moulding process can be used to eliminate post-process via creation and wafer dicing steps. In addition, measurement techniques have been developed to characterize the skin-electrode contact force. We perform the first analysis of signal-to-noise ratio dependency on contact force, and show that although microneedle-based electrodes can outperform conventional gel electrodes, the quality of ECG recordings is significantly dependent on temporal and mechanical aspects of the skin-electrode interface.

Characterizing nonlinearity in invasive EEG recordings from temporal lobe epilepsy

NASA Astrophysics Data System (ADS)

Casdagli, M. C.; Iasemidis, L. D.; Sackellares, J. C.; Roper, S. N.; Gilmore, R. L.; Savit, R. S.

Invasive electroencephalographic (EEG) recordings from depth and subdural electrodes, performed in eight patients with temporal lobe epilepsy, are analyzed using a variety of nonlinear techniques. A surrogate data technique is used to find strong evidence for nonlinearities in epileptogenic regions of the brain. Most of these nonlinearities are characterized as “spiking” by a wavelet analysis. A small fraction of the nonlinearities are characterized as “recurrent” by a nonlinear prediction algorithm. Recurrent activity is found to occur in spatio-temporal patterns related to the location of the epileptogenic focus. Residual delay maps, used to characterize “lag-one nonlinearity”, are remarkably stationary for a given electrode, and exhibit striking variations among electrodes. The clinical and theoretical implications of these results are discussed.

Microfabricated FSCV-Compatible Microelectrode Array for Real-time Monitoring of Heterogeneous Dopamine Release

PubMed Central

Zachek, Matthew K.; Park, Jinwoo; Takmakov, Pavel; Wightman, R. Mark; McCarty, Gregory S.

2010-01-01

Fast scan cyclic voltammetry (FSCV) has been used previously to detect neurotransmitter release and reuptake in vivo. An advantage that FSCV has over other electrochemical techniques is its ability to distinguish neurotransmitters of interest (i.e. monoamines) from their metabolites using their respective characteristic cyclic voltammogram. While much has been learned with this technique, it has generally only been used in a single working electrode arrangement. Additionally, traditional electrode fabrication techniques tend to be difficult and somewhat irreproducible. Described in this report is a fabrication method for a FSCV compatible microelectrode array (FSCV-MEA) that is capable of functioning in vivo. The microfabrication techniques employed here allow for better reproducibility than traditional fabrication methods of carbon fiber microelectrodes, and enable batch fabrication of electrode arrays. The reproducibility and electrochemical qualities of the probes were assessed along with cross talk in vitro. Heterogeneous release of electrically stimulated dopamine was observed in real-time in the striatum of an anesthetized rat using the FSCV-MEA. The heterogeneous effects of pharmacology on the striatum was also observed and shown to be consistent across multiple animals. PMID:20464031

Surface mapping of spike potential fields: experienced EEGers vs. computerized analysis.

PubMed

Koszer, S; Moshé, S L; Legatt, A D; Shinnar, S; Goldensohn, E S

1996-03-01

An EEG epileptiform spike focus recorded with scalp electrodes is clinically localized by visual estimation of the point of maximal voltage and the distribution of its surrounding voltages. We compared such estimated voltage maps, drawn by experienced electroencephalographers (EEGers), with a computerized spline interpolation technique employed in the commercially available software package FOCUS. Twenty-two spikes were recorded from 15 patients during long-term continuous EEG monitoring. Maps of voltage distribution from the 28 electrodes surrounding the points of maximum change in slope (the spike maximum) were constructed by the EEGer. The same points of maximum spike and voltage distributions at the 29 electrodes were mapped by computerized spline interpolation and a comparison between the two methods was made. The findings indicate that the computerized spline mapping techniques employed in FOCUS construct voltage maps with similar maxima and distributions as the maps created by experienced EEGers. The dynamics of spike activity, including correlations, are better visualized using the computerized technique than by manual interpretation alone. Its use as a technique for spike localization is accurate and adds information of potential clinical value.

A novel method of placing right ventricular leads in patients with persistent left superior vena cava using a conventional j stylet.

PubMed

Mora, Guillermo

2014-03-01

Locating pacemaker electrodes can become complicated by congenital abnormalities such as persistent left superior vena cava (LSVC). To evaluate a technique for the implanting of ventricular electrode in patients with persistent LSVC. The study was carried out from June 2001 to June 2010 involving all patients who were admitted to the Hospital Universitario Mayor, Instituto de Corazon de Bogota and Hospital Universitario Clinica San Rafael (Bogota-Colombia) for implanting pacemakers or cardiac defibrillators. LSVC was diagnosed by fluoroscopic observation (anterior-posterior view) of the course of the stylet. Four steps were followed: 1) Move the electrode with a straight stylet to the right atrium. 2) Change the straight stylet by a conventional J stylet and push the electrode to the lateral or anterolateral wall of the right atrium. 3) Remove the guide 3-5 cm and 4) Push the electrode which crosses the tricuspid valve into the right ventricle and finally deploy the active fixation mechanism. A total of 1198 patients were admitted for pacemaker or cardiac defibrillator implant during the 9-year study period, 1114 received a left subclavian venous approach. There were 573 males and 541 females. Persistent LSVC was found in five patients (0.45%) Fluoroscopy time for implanting the ventricular electrode ranged from 60 to 250 seconds, 40 to 92 minutes being taken to complete the whole procedure. We present a simple and rapid technique for electrode placement in patients with LSVC using usual J guide and active fixation electrodes with high success.

Electrolytic treatment of colorectal liver tumour deposits in a rat model: a technique with potential for patients with unresectable liver tumours.

PubMed

Wemyss-Holden, S A; Robertson, G S; Hall, P D; Dennison, A R; Maddern, G J

2000-01-01

Patients with unresectable malignant liver tumours have a poor prognosis. A technique is needed which improves long-term survival. Previous studies in the rat have shown that electrolysis is a safe, predictable and reproducible method for creating areas of necrosis in the normal rat liver. This study examined the effects of electrolysis on colorectal liver 'metastases' in the rat. Tumours of colorectal origin were implanted into the livers of Wistar-WAG rats. Two weeks after implantation the tumours were treated with electrolysis. A direct current generator, connected to 2 platinum intrahepatic electrodes was used to examine the effects of various electrode configurations on the extent of tumour necrosis. Significant (p<0.001) tumour ablation was achieved with all electrode configurations. Tumour necrosis was more complete (p<0.05) with the electrodes positioned on either side of the tumour than with both electrodes placed in the centre of the tumour. Liver enzymes (AST and ALT) were significantly (p<0.001) elevated after treatment, but returned towards normal by 2 days. This study has shown that colorectal liver 'metastasis' can be ablated by electrolysis in a rat model. Two separate mechanisms of tumour ablation were observed: With the electrodes directly in or adjacent to the tumour, necrosis resulted from the action of cytotoxic electrode products, whereas by positioning the electrodes proximal to the tumour, necrosis was induced by a 'secondary' ischaemic effect. The findings confirm the view that electrolysis has great potential for treating patients with unresectable malignant liver tumours.

Molybdenum oxide electrodes for thermoelectric generators

DOEpatents

Schmatz, Duane J.

1989-01-01

The invention is directed to a composite article suitable for use in thermoelectric generators. The article comprises a thin film comprising molybdenum oxide as an electrode deposited by physical deposition techniques onto solid electrolyte. The invention is also directed to the method of making same.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ruther, Rose E.; Sun, Che -Nan; Holliday, Adam

A simple electrolyte consisting of NaPF 6 salt in 1,2-dimethoxyethane (DME) can extend the voltage window of electric double-layer capacitors (EDLCs) to >3.5 V. DME does not passivate carbon electrodes at very negative potentials (near Na/Na +), extending the practical voltage window by about 1.0 V compared to standard, non-aqueous electrolytes based on acetonitrile. The voltage window is demonstrated in two- and three-electrode cells using a combination of electrochemical impedance spectroscopy (EIS), charge-discharge cycling, and measurements of leakage current. DME-based electrolytes cannot match the high conductivity of acetonitrile solutions, but they can satisfy applications that demand high energy density atmore » moderate power. The conductivity of NaPF 6 in DME is comparable to commercial lithium-ion battery electrolytes and superior to most ionic liquids. Lastly, factors that limit the voltage window and EDLC energy density are discussed, and strategies to further boost energy density are proposed.« less

T-load microchannel array and fabrication method

DOEpatents

Swierkowski, Stefan P.

2000-01-01

A three-dimensional (3-D) T-load for planar microchannel arrays for electrophoresis, for example, which enables sample injection directly onto a plane perpendicular to the microchannels' axis, at their ends. This is accomplished by forming input wells that extend beyond the ends of the microchannel thereby eliminating the right angle connection from the input well into the end of the microchannel. In addition, the T-load input well eases the placement of electrode in or adjacent the well and thus enables very efficient reproducible electrokinetic (ek) injection. The T-load input well eliminates the prior input well/microchannel alignment concerns, since the input well can be drilled after the top and bottom microchannel plates are bonded together. The T-load input well may extend partially or entirely through the bottom microchannel plate which enables more efficient gel and solution flushing, and also enables placement of multiple electrodes to assist in the ek sample injection.

Scrape-off-layer characterization and current-control of kink modes in HBT-EP

NASA Astrophysics Data System (ADS)

Brooks, John; Stewart, Ian; Levesque, Jeffrey; Mauel, Mike; Navratil, Gerald

2017-10-01

Scrape-off layer (SOL) currents and their paths through tokamaks are not well understood, but their control may prove crucial to the success of ITER and future fusion energy devices. We extend Columbia University's High Beta Tokamak-Extended Pulse (HBT-EP) experiment and active GPU feedback system to study the SOL and control MHD kink instabilities by actively controlling these currents. First, the radial plasma profiles and the edge structure of kink instabilities are measured with two triple probes. Second, we use active feedback control of a radially adjustable biased electrode to change the rotation and magnitude of slowly growing kink instabilities. By changing the phase between the probe's voltage and the edge instability with active feedback, we study its ability to influence and control plasma MHD structures. This work is in preparation for a planned 2018 multi-electrode SOL control upgrade. Supported by U.S. DOE Grant DE-FG02-86ER53222.

Assessing a novel polymer-wick based electrode for EEG neurophysiological research.

PubMed

Pasion, Rita; Paiva, Tiago O; Pedrosa, Paulo; Gaspar, Hugo; Vasconcelos, Beatriz; Martins, Ana C; Amaral, Maria H; Nóbrega, João M; Páscoa, Ricardo; Fonseca, Carlos; Barbosa, Fernando

2016-07-15

The EEG technique has decades of valid applications in clinical and experimental neurophysiology. EEG equipment and data analysis methods have been characterized by remarkable developments, but the skin-to-electrode signal transfer remains a challenge for EEG recording. A novel quasi-dry system - the polymer wick-based electrode - was developed to overcome the limitations of conventional dry and wet silver/silver-chloride (Ag/AgCl) electrodes for EEG recording. Nine participants completed an auditory oddball protocol with simultaneous EEG acquisition using both the conventional Ag/AgCl and the wick electrodes. Wick system successfully recorded the expected P300 modulation. Standard ERP analysis, residual random noise analysis, and single-trial analysis of the P300 wave were performed in order to compare signal acquired by both electrodes. It was found that the novel wick electrode performed similarly to the conventional Ag/AgCl electrodes. The developed wick electrode appears to be a reliable alternative for EEG research, representing a promising halfway alternative between wet and dry electrodes. Copyright © 2016 Elsevier B.V. All rights reserved.

Internal corrosion monitoring of subsea oil and gas production equipment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joosten, M.W.; Fischer, K.P.; Strommen, R.

1995-04-01

Nonintrusive techniques will dominate subsea corrosion monitoring compared with the intrusive methods because such methods do not interfere with pipeline operations. The long-term reliability of the nonintrusive techniques in general is considered to be much better than that of intrusive-type probes. The nonintrusive techniques based on radioactive tracers (TLA, NA) and FSM and UT are expected to be the main types of subsea corrosion monitoring equipment in the coming years. Available techniques that could be developed specifically for subsea applications are: electrochemical noise, corrosion potentials (using new types of reference electrodes), multiprobe system for electrochemical measurements, and video camera inspectionmore » (mini-video camera with light source). The following innovative techniques have potential but need further development: ion selective electrodes, radioactive tracers, and Raman spectroscopy.« less

Active Electrodes for Wearable EEG Acquisition: Review and Electronics Design Methodology.

PubMed

Xu, Jiawei; Mitra, Srinjoy; Van Hoof, Chris; Yazicioglu, Refet Firat; Makinwa, Kofi A A

2017-01-01

Active electrodes (AEs), i.e., electrodes with built-in readout circuitry, are increasingly being implemented in wearable healthcare and lifestyle applications due to AEs' robustness to environmental interference. An AE locally amplifies and buffers μV-level EEG signals before driving any cabling. The low output impedance of an AE mitigates cable motion artifacts, thus enabling the use of high-impedance dry electrodes for greater user comfort. However, developing a wearable EEG system, with medical grade signal quality on noise, electrode offset tolerance, common-mode rejection ratio, input impedance, and power dissipation, remains a challenging task. This paper reviews state-of-the-art bio-amplifier architectures and low-power analog circuits design techniques intended for wearable EEG acquisition, with a special focus on an AE system interfaced with dry electrodes.

Improved lifetime high voltage switch electrode

NASA Astrophysics Data System (ADS)

Halverson, W.

1985-06-01

In this Phase 1 Small Business Innovation Research (SBIR) program, preliminary tests of ion implantation to increase the lifetime of spark switch electrodes have indicated that a 185 keV carbon ion implant into a tungsten-copper composite has reduced electrode erosion by a factor of two to four. Apparently, the thin layer of tungsten carbide (WC) has better thermal properties than pure tungsten; the WC may have penetrated into the unimplanted body of the electrode by liquid and/or solid phase diffusion during erosion testing. These encouraging results should provide the basis for a Phase 2 SBIR program to investigate further the physical and chemical effects of ion implantation on spark gap electrodes and to optimize the technique for applications.

Composite substrate for bipolar electrodes

DOEpatents

Tekkanat, B.; Bolstad, J.J.

1992-12-22

Substrates for electrode systems, particularly those to be used for bipolar electrodes in zinc-bromine batteries, are disclosed. The substrates preferably include carbon-black as a conductive filler in a polymeric matrix, with reinforcing materials such as glass fibers. Warpage of the zinc-bromine electrodes which was experienced in the prior art and which was believed to be caused by physical expansion of the electrodes due to bromine absorption by the carbon-black, is substantially eliminated when new substrate fabrication techniques are employed. In the present invention, substrates are prepared using a lamination process known as glass mat reinforced thermoplastics technology or, in an alternate embodiment, the substrate is made using a slurry process. 4 figs.

Preparation of AN Electrode Modified with a Thermostable Enzyme BACILLUS Subtilis COTA by Electrodeposition

NASA Astrophysics Data System (ADS)

Watanabe, Toshio; Yamada, Yohei; Motonaka, Junko; Yabutani, Tomoki; Sakuraba, Haruhiko; Yasuzawa, Mikito

In this study, electrodeposition of thermostable enzyme Bacillus subtilis CotA, which is a laccase and has a bilirubin oxidase (BOD) activity, was investigated. The electrodeposition was operated in a mixture of Bacillus subtilis CotA in the PBS (pH 8.0) and TritonX-100 under applying potential (1100 mV vs. Ag/AgCl for 5 min.). The current response was measured by linear sweep voltammetry technique (LSV). The thermostable enzyme Bacillus subtilis CotA electrodeposited electrode was compared with a mesophile BOD electrodeposited electrode. As a result, the Bacillus subtilis CotA modified electrode showed better sensitivity and long-term stability than the mesophile BOD modified electrode.

Measurement of absorbed dose with a bone-equivalent extrapolation chamber.

PubMed

DeBlois, François; Abdel-Rahman, Wamied; Seuntjens, Jan P; Podgorsak, Ervin B

2002-03-01

A hybrid phantom-embedded extrapolation chamber (PEEC) made of Solid Water and bone-equivalent material was used for determining absorbed dose in a bone-equivalent phantom irradiated with clinical radiation beams (cobalt-60 gamma rays; 6 and 18 MV x rays; and 9 and 15 MeV electrons). The dose was determined with the Spencer-Attix cavity theory, using ionization gradient measurements and an indirect determination of the chamber air-mass through measurements of chamber capacitance. The collected charge was corrected for ionic recombination and diffusion in the chamber air volume following the standard two-voltage technique. Due to the hybrid chamber design, correction factors accounting for scatter deficit and electrode composition were determined and applied in the dose equation to obtain absorbed dose in bone for the equivalent homogeneous bone phantom. Correction factors for graphite electrodes were calculated with Monte Carlo techniques and the calculated results were verified through relative air cavity dose measurements for three different polarizing electrode materials: graphite, steel, and brass in conjunction with a graphite collecting electrode. Scatter deficit, due mainly to loss of lateral scatter in the hybrid chamber, reduces the dose to the air cavity in the hybrid PEEC in comparison with full bone PEEC by 0.7% to approximately 2% depending on beam quality and energy. In megavoltage photon and electron beams, graphite electrodes do not affect the dose measurement in the Solid Water PEEC but decrease the cavity dose by up to 5% in the bone-equivalent PEEC even for very thin graphite electrodes (<0.0025 cm). In conjunction with appropriate correction factors determined with Monte Carlo techniques, the uncalibrated hybrid PEEC can be used for measuring absorbed dose in bone material to within 2% for high-energy photon and electron beams.

Numerical analysis of finite Debye-length effects in induced-charge electro-osmosis.

PubMed

Gregersen, Misha Marie; Andersen, Mathias Baekbo; Soni, Gaurav; Meinhart, Carl; Bruus, Henrik

2009-06-01

For a microchamber filled with a binary electrolyte and containing a flat unbiased center electrode at one wall, we employ three numerical models to study the strength of the resulting induced-charge electro-osmotic (ICEO) flow rolls: (i) a full nonlinear continuum model resolving the double layer, (ii) a linear slip-velocity model not resolving the double layer and without tangential charge transport inside this layer, and (iii) a nonlinear slip-velocity model extending the linear model by including the tangential charge transport inside the double layer. We show that, compared to the full model, the slip-velocity models significantly overestimate the ICEO flow. This provides a partial explanation of the quantitative discrepancy between observed and calculated ICEO velocities reported in the literature. The discrepancy increases significantly for increasing Debye length relative to the electrode size, i.e., for nanofluidic systems. However, even for electrode dimensions in the micrometer range, the discrepancies in velocity due to the finite Debye length can be more than 10% for an electrode of zero height and more than 100% for electrode heights comparable to the Debye length.

Functionalized graphene oxide for clinical glucose biosensing in urine and serum samples

PubMed Central

Veerapandian, Murugan; Seo, Yeong-Tai; Shin, Hyunkyung; Yun, Kyusik; Lee, Min-Ho

2012-01-01

A novel clinical glucose biosensor fabricated using functionalized metalloid-polymer (silver-silica coated with polyethylene glycol) hybrid nanoparticles on the surface of a graphene oxide nanosheet is reported. The cyclic voltammetric response of glucose oxidase modification on the surface of a functionalized graphene oxide electrode showed a surface-confined reaction and an effective redox potential near zero volts, with a wide linearity of 0.1–20 mM and a sensitivity of 7.66 μA mM−1 cm−2. The functionalized graphene oxide electrode showed a better electrocatalytic response toward oxidation of H2O2 and reduction of oxygen. The practical applicability of the functionalized graphene oxide electrode was demonstrated by measuring the peak current against multiple urine and serum samples from diabetic patients. This new hybrid nanoarchitecture combining a three-dimensional metalloid-polymer hybrid and two-dimensional graphene oxide provided a thin solid laminate on the electrode surface. The easy fabrication process and retention of bioactive immobilized enzymes on the functionalized graphene oxide electrode could potentially be extended to detection of other biomolecules, and have broad applications in electrochemical biosensing. PMID:23269871

Functionalized graphene oxide for clinical glucose biosensing in urine and serum samples.

PubMed

Veerapandian, Murugan; Seo, Yeong-Tai; Shin, Hyunkyung; Yun, Kyusik; Lee, Min-Ho

2012-01-01

A novel clinical glucose biosensor fabricated using functionalized metalloid-polymer (silver-silica coated with polyethylene glycol) hybrid nanoparticles on the surface of a graphene oxide nanosheet is reported. The cyclic voltammetric response of glucose oxidase modification on the surface of a functionalized graphene oxide electrode showed a surface-confined reaction and an effective redox potential near zero volts, with a wide linearity of 0.1-20 mM and a sensitivity of 7.66 μA mM(-1) cm(-2). The functionalized graphene oxide electrode showed a better electrocatalytic response toward oxidation of H(2)O(2) and reduction of oxygen. The practical applicability of the functionalized graphene oxide electrode was demonstrated by measuring the peak current against multiple urine and serum samples from diabetic patients. This new hybrid nanoarchitecture combining a three-dimensional metalloid-polymer hybrid and two-dimensional graphene oxide provided a thin solid laminate on the electrode surface. The easy fabrication process and retention of bioactive immobilized enzymes on the functionalized graphene oxide electrode could potentially be extended to detection of other biomolecules, and have broad applications in electrochemical biosensing.

Avoiding chromium transport from stainless steel interconnects into contact layers and oxygen electrodes in intermediate temperature solid oxide electrolysis stacks

NASA Astrophysics Data System (ADS)

Schlupp, Meike V. F.; Kim, Ji Woo; Brevet, Aude; Rado, Cyril; Couturier, Karine; Vogt, Ulrich F.; Lefebvre-Joud, Florence; Züttel, Andreas

2014-12-01

We investigated the ability of (La0.8Sr0.2)(Mn0.5Co0.5)O3-δ (LSMC) and La(Ni0.6Fe0.4)O3-δ (LNF) contact coatings to avoid the transport of Cr from steel interconnects to solid oxide electrolysis electrodes, especially to the anode. The transport of chromium from commercial Crofer 22 APU (ThyssenKrupp) and K41X (AISI441, Aperam Isbergues) steels through LSMC and LNF contact coatings into adjacent (La0.8Sr0.2)MnO3-δ (LSM) oxygen electrodes was investigated in an oxygen atmosphere at 700 °C. Chromium concentrations of up to 4 atom% were detected in the contact coatings after thermal treatments for 3000 h, which also lead to the presence of chromium in adjacent LSM electrodes. Introduction of a dense (Co,Mn)3O4 coating between steel and contact coating was necessary to prevent the diffusion of chromium into contact coatings and electrodes and should lead to extended stack performance and lifetime.

Application of gas diffusion electrodes in bioelectrochemical syntheses and energy conversion.

PubMed

Horst, Angelika E W; Mangold, Klaus-Michael; Holtmann, Dirk

2016-02-01

Combining the advantages of biological components (e.g., reaction specificity, self-replication) and electrochemical techniques in bioelectrochemical systems offers the opportunity to develop novel efficient and sustainable processes for the production of a number of valuable products. The choice of electrode material has a great impact on the performance of bioelectrochemical systems. In addition to the redox process at the electrodes, interactions of biocatalysts with electrodes (e.g., enzyme denaturation or biofouling) need to be considered. In recent years, gas diffusion electrodes (GDEs) have proved to be very attractive electrodes for bioelectrochemical purposes. GDEs are porous electrodes, that posses a large three-phase boundary surface. At this interface, a solid catalyst supports the electrochemical reaction between gaseous and liquid phase. This mini-review discusses the application of GDEs in microbial and enzymatic fuel cells, for microbial electrolysis, in biosensors and for electroenzymatic synthesis reactions. © 2015 Wiley Periodicals, Inc.

Improved plaque materials for aerospace nickel-cadmium cells

NASA Technical Reports Server (NTRS)

Luksha, E.; Gordy, D. J.

1971-01-01

Improved cadmium electrode substrates with precisely controlled microstructures for possible use in aerospace nickel-cadmium cells were prepared. The preparative technique was a powder metallurgical process in which a fugitive pore-former and a nickel powder were blended, then isostatically compacted, and subsequently sintered. Cadmium electrodes prepared from such substrates were cycle tested using an accelerated tortuous test regime. It was discovered that plaques of 60% or 80% porosity prepared with a 25 micron pore-former were better than state-of-the-art electrodes in terms of efficienty and/or mechanical strength. The 60% structures were particularly outstanding in this respect in that they had efficiencies only 5-10 percentage points lower than state-of-the-art electrodes and vastly superior mechanical properties. This added strength was observed to eliminate cracking and physical degradation of the electrodes during processing and cycling. The cadmium electrodes prepared from the 80% porous substrates proved to be the best electrodes made during the course of the work from the point of view of highest efficiency. Three-point bend tests were used to measure mechanical properties of the plaques produced and also as a general characterization tool. In addition, the BET surface areas of selected specimens was determined. The SEM was used for judging microscopic uniformity and quantitatively determining the induced pore size and various other fine structures in the substrates. The technique of X-ray radiography was used to follow the bulk uniformity of the substrates at various stages of their processing.

The synthesis of multifunctional porous honey comb-like La2O3 thin film for supercapacitor and gas sensor applications.

PubMed

Yadav, A A; Lokhande, A C; Pujari, R B; Kim, J H; Lokhande, C D

2016-12-15

The porous honey comb-like La 2 O 3 thin films have been synthesized using one step spray pyrolysis method. The influence of sprayed solution quantity on properties of La 2 O 3 thin films is studied using X-ray diffraction, Fourier transform spectroscopy, X-ray photoelectron spectroscopy, scanning electron microscopy, optical absorption and Brunauer-Emmett-Teller techniques. Morphology of La 2 O 3 electrode is controlled with sprayed solution quantity. The supercapacitive properties of La 2 O 3 thin film electrode are investigated using cyclic voltammetry, galvanostatic charge-discharge and electrochemical impedance techniques. The La 2 O 3 film electrode exhibited the specific capacitance of the 166Fg -1 with 85% stability for the 3000 cycles. The La 2 O 3 film electrode exhibited sensitivity of 68 at 523K for 500ppm CO 2 gas concentration. The possible CO 2 sensing mechanism is discussed. Copyright © 2016 Elsevier Inc. All rights reserved.

Advances in radio frequency tumor ablation therapy: technical considerations, strategies for increasing coagulation necrosis volume, and preliminary clinical results

NASA Astrophysics Data System (ADS)

Goldberg, S. Nahum; Gazelle, G. Scott

1998-04-01

Radiofrequency (RF) tumor ablation has been demonstrated as a reliable method for creating thermally induced coagulation necrosis using either a percutaneous approach with image- guidance or direct surgical application of thin electrodes into treated tissues. Early clinical trials with this technology have studied the treatment of hepatic, cerebral, and bony malignancies. The extent of coagulation necrosis induced with conventional monopolar radiofrequency electrodes is dependent on overall energy deposition, the duration of RF application, and RF electrode tip length and gauge. This article will discuss these technical considerations with the goal of defining optimal parameters for RF ablation. Strategies to further increase induced coagulation necrosis including: multiprobe and bipolar arrays, and internally-cooled RF electrodes, with or without pulsed-RF or cluster technique will be presented. The development and laboratory results for many of these radiofrequency techniques, initial clinical results, and potential biophysical limitations to RF induced coagulation, such as perfusion mediated tissue cooling (vascular flow) will likewise be discussed.

Glucose Fuel Cells with a MicroChannel Fabricated on Flexible Polyimide Film

NASA Astrophysics Data System (ADS)

Sano, Ryohei; Fukushi, Yudai; Sasaki, Tsubasa; Mogi, Hiroshi; Koide, Syohei; Ikoma, Ryuta; Akatsuka, Wataru; Tsujimura, Seiya; Nishioka, Yasushiro

2013-12-01

In this work, a glucose fuel cell was fabricated using microfabrication processes assigned for microelectromechanical systems. The fuel cell was equipped with a microchannel to flow an aqueous solution of glucose. The cell was fabricated on a flexible polyimide substrate, and its porous carbon-coated aluminum (Al) electrodes of 2.8 mm in width and 11 mm in length were formed using photolithography and screen printing techniques. Porous carbon was deposited by screen printing of carbon black ink on the Al electrode surfaces in order to increase the effective electrode surface area and to absorb more enzymes on the electrode surfaces. The microchannel with a depth of 200 μm was fabricated using a hot embossing technique. A maximum power of 0.45 μW at 0.5 V that corresponds to a power density of 1.45 μW/cm2 was realized by introducing a 200 mM concentrated glucose solution at room temperature.

In situ NMR and electrochemical quartz crystal microbalance techniques reveal the structure of the electrical double layer in supercapacitors

NASA Astrophysics Data System (ADS)

Griffin, John M.; Forse, Alexander C.; Tsai, Wan-Yu; Taberna, Pierre-Louis; Simon, Patrice; Grey, Clare P.

2015-08-01

Supercapacitors store charge through the electrosorption of ions on microporous electrodes. Despite major efforts to understand this phenomenon, a molecular-level picture of the electrical double layer in working devices is still lacking as few techniques can selectively observe the ionic species at the electrode/electrolyte interface. Here, we use in situ NMR to directly quantify the populations of anionic and cationic species within a working microporous carbon supercapacitor electrode. Our results show that charge storage mechanisms are different for positively and negatively polarized electrodes for the electrolyte tetraethylphosphonium tetrafluoroborate in acetonitrile; for positive polarization charging proceeds by exchange of the cations for anions, whereas for negative polarization, cation adsorption dominates. In situ electrochemical quartz crystal microbalance measurements support the NMR results and indicate that adsorbed ions are only partially solvated. These results provide new molecular-level insight, with the methodology offering exciting possibilities for the study of pore/ion size, desolvation and other effects on charge storage in supercapacitors.

On-chip collection of particles and cells by AC electroosmotic pumping and dielectrophoresis using asymmetric microelectrodes

PubMed Central

Melvin, Elizabeth M.; Moore, Brandon R.; Gilchrist, Kristin H.; Grego, Sonia; Velev, Orlin D.

2011-01-01

The recent development of microfluidic “lab on a chip” devices requiring sample sizes <100 μL has given rise to the need to concentrate dilute samples and trap analytes, especially for surface-based detection techniques. We demonstrate a particle collection device capable of concentrating micron-sized particles in a predetermined area by combining AC electroosmosis (ACEO) and dielectrophoresis (DEP). The planar asymmetric electrode pattern uses ACEO pumping to induce equal, quadrilateral flow directed towards a stagnant region in the center of the device. A number of system parameters affecting particle collection efficiency were investigated including electrode and gap width, chamber height, applied potential and frequency, and number of repeating electrode pairs and electrode geometry. The robustness of the on-chip collection design was evaluated against varying electrolyte concentrations, particle types, and particle sizes. These devices are amenable to integration with a variety of detection techniques such as optical evanescent waveguide sensing. PMID:22662040

Catalyst evaluation for oxygen reduction reaction in concentrated phosphoric acid at elevated temperatures

NASA Astrophysics Data System (ADS)

Hu, Yang; Jiang, Yiliang; Jensen, Jens Oluf; Cleemann, Lars N.; Li, Qingfeng

2018-01-01

Phosphoric acid is the common electrolyte for high-temperature polymer electrolyte fuel cells (HT-PEMFCs) that have advantages such as enhanced CO tolerance and simplified heat and water management. The currently used rotating disk electrode technique is limited to tests in dilute solutions at low temperatures and hence is not suitable for catalyst evaluation for HT-PEMFCs. In this study, we have designed and constructed a half-cell setup to measure the intrinsic activities of catalysts towards the oxygen reduction reaction (ORR) in conditions close to HT-PEMFC cathodes. By optimization of the hydrophobic characteristics of electrodes and the catalyst layer thickness, ORR activities of typical Pt/C catalysts are successfully measured in concentrated phosphoric acid at temperatures above 100 °C. In terms of mass-specific activities, the catalyst exhibits about two times higher activity in the half-cell electrode than that observed in fuel cells, indicating the feasibility of the technique as well as the potential for further improvement of fuel cell electrode performance.

Synthesis of a fine neurological electrode by plasma polymerization processing.

PubMed

Cannon, J G; Dillon, R O; Bunshah, R F; Crandall, P H; Dymond, A M

1980-05-01

This research is part of a continuing program for the development of a coaxial depth electrode for research and diagnostic studies of neurological diseases. The requirements for this electrode include (1) strength and resistance to buckling sufficient to ensure self-forced penetration of brain tissue to a depth of 6 cm; (2) biocompatibility of the materials employed; (3) resistance to brittle fracture; and (4) a total diameter of less than 200 micrometer to minimize tissue damage. Earlier synthesis efforts using chemical vapor deposition techniques have been successful, although the process yield was 40% and an outer insulating layer had yet to be deposited. Plasma polymerization processes have been employed to realize an increase in the yield and provide an outer insulating layer. The starting material is W-26 at.% Re wire, nominally 125 micrometer in diameter. Hexamethyldisilazane(CH3)3SiNHSi(CH3)3 is used to deposit the insulating layers. The paper describes factors influencing the choice of materials, deposition techniques, and properties of electrodes.

High temperature sealed electrochemical cell

DOE Office of Scientific and Technical Information (OSTI.GOV)

Valentin Chung, Brice Hoani; Burke, Paul J.; Sadoway, Donald R.

2015-10-06

A cell for high temperature electrochemical reactions is provided. The cell includes a container, at least a portion of the container acting as a first electrode. An extension tube has a first end and a second end, the extension tube coupled to the container at the second end forming a conduit from the container to said first end. A second electrode is positioned in the container and extends out of the container via the conduit. A seal is positioned proximate the first end of the extension tube, for sealing the cell.

Long wavelength, high gain InAsSb strained-layer superlattice photoconductive detectors

DOEpatents

Biefeld, Robert M.; Dawson, L. Ralph; Fritz, Ian J.; Kurtz, Steven R.; Zipperian, Thomas E.

1991-01-01

A high gain photoconductive device for 8 to 12 .mu.m wavelength radiation including an active semiconductor region extending from a substrate to an exposed face, the region comprising a strained-layer superlattice of alternating layers of two different InAs.sub.1-x Sb.sub.x compounds having x>0.75. A pair of spaced electrodes are provided on the exposed face, and changes in 8 to 12 .mu.m radiation on the exposed face cause a large photoconductive gain between the spaced electrodes.

Membrane with internal passages to permit fluid flow and an electrochemical cell containing the same

NASA Technical Reports Server (NTRS)

Cisar, Alan J. (Inventor); Murphy, Oliver J. (Inventor); Gonzalez-Martin, Anuncia (Inventor); Hitchens, G. Duncan (Inventor)

1997-01-01

The invention provides an improved proton exchange membrane for use in electrochemical cells having internal passages parallel to the membrane surface, an apparatus and process for making the membrane, membrane and electrode assemblies fabricated using the membrane, and the application of the membrane and electrode assemblies to a variety of devices, both electrochemical and otherwise. The passages in the membrane extend from one edge of the membrane to another and allow fluid flow through the membrane and give access directly to the membrane for purposes of hydration.

CALUTRON ION SOURCE

DOEpatents

Oppenheimer, F.

1958-08-19

The construction of an ion source is descrtbed wherein a uniform and elongated arc is established for employment in a calutron. The novel features of the . source include the positioning of a cathode at one end of an elongated extt slit of an arc chamber. and anode electrodes defintng the longitudinal margins of the exit opening. When the exit slit is orientated in a parallel relation to a magnetic field, the arc extends in the direction of the magnetic field along and between the anode electrodes, which are held at a positsve potential with respect to the cathode.

Tunnel magnetoresistance of ferrocene molecules

NASA Astrophysics Data System (ADS)

Matsuura, Yukihito

2018-01-01

The spin transport in ferrocene molecules has been examined by using the nonequilibrium Green's function formalism with density functional theory. The ferrocene molecules were sandwiched between the two nickel electrodes in a parallel magnetic configuration, which enhanced the current in comparison with that in an antiparallel spin state and resulting in tunnel magnetoresistance (TMR). The current, having an opposite spin state to that of the ferromagnetic electrode, was the main channel for electron transport. In addition, it became clear that ferrocenylene molecules, having a fulvalene structure with an extended π-conjugation, enhanced the TMR effect.

iElectrodes: A Comprehensive Open-Source Toolbox for Depth and Subdural Grid Electrode Localization.

PubMed

Blenkmann, Alejandro O; Phillips, Holly N; Princich, Juan P; Rowe, James B; Bekinschtein, Tristan A; Muravchik, Carlos H; Kochen, Silvia

2017-01-01

The localization of intracranial electrodes is a fundamental step in the analysis of invasive electroencephalography (EEG) recordings in research and clinical practice. The conclusions reached from the analysis of these recordings rely on the accuracy of electrode localization in relationship to brain anatomy. However, currently available techniques for localizing electrodes from magnetic resonance (MR) and/or computerized tomography (CT) images are time consuming and/or limited to particular electrode types or shapes. Here we present iElectrodes, an open-source toolbox that provides robust and accurate semi-automatic localization of both subdural grids and depth electrodes. Using pre- and post-implantation images, the method takes 2-3 min to localize the coordinates in each electrode array and automatically number the electrodes. The proposed pre-processing pipeline allows one to work in a normalized space and to automatically obtain anatomical labels of the localized electrodes without neuroimaging experts. We validated the method with data from 22 patients implanted with a total of 1,242 electrodes. We show that localization distances were within 0.56 mm of those achieved by experienced manual evaluators. iElectrodes provided additional advantages in terms of robustness (even with severe perioperative cerebral distortions), speed (less than half the operator time compared to expert manual localization), simplicity, utility across multiple electrode types (surface and depth electrodes) and all brain regions.

iElectrodes: A Comprehensive Open-Source Toolbox for Depth and Subdural Grid Electrode Localization

PubMed Central

Blenkmann, Alejandro O.; Phillips, Holly N.; Princich, Juan P.; Rowe, James B.; Bekinschtein, Tristan A.; Muravchik, Carlos H.; Kochen, Silvia

2017-01-01

The localization of intracranial electrodes is a fundamental step in the analysis of invasive electroencephalography (EEG) recordings in research and clinical practice. The conclusions reached from the analysis of these recordings rely on the accuracy of electrode localization in relationship to brain anatomy. However, currently available techniques for localizing electrodes from magnetic resonance (MR) and/or computerized tomography (CT) images are time consuming and/or limited to particular electrode types or shapes. Here we present iElectrodes, an open-source toolbox that provides robust and accurate semi-automatic localization of both subdural grids and depth electrodes. Using pre- and post-implantation images, the method takes 2–3 min to localize the coordinates in each electrode array and automatically number the electrodes. The proposed pre-processing pipeline allows one to work in a normalized space and to automatically obtain anatomical labels of the localized electrodes without neuroimaging experts. We validated the method with data from 22 patients implanted with a total of 1,242 electrodes. We show that localization distances were within 0.56 mm of those achieved by experienced manual evaluators. iElectrodes provided additional advantages in terms of robustness (even with severe perioperative cerebral distortions), speed (less than half the operator time compared to expert manual localization), simplicity, utility across multiple electrode types (surface and depth electrodes) and all brain regions. PMID:28303098

Excess Heat in Molten Salts of (LiCl - KCl) + (LiD + LiF) at the Titanium Electrode during Electrolysis

NASA Astrophysics Data System (ADS)

Tsvetkov, S. A.; Filatov, E. S.; Khokhlov, V. A.

2005-12-01

The electrochemical cell and a technique for precision calorimetric measurements has been developed. Experiments with molten salts containing lithium deuteride were carried out. Calorimetric measurements made on the titanium electrode during experiments. Measurements were made in an inert atmosphere of helium and in an atmosphere of deuterium at various density of an electrolysis current. Excess heat was obtained on the titanium electrode in a deuterium atmosphere during electrolysis. An x-ray diffraction analysis was made on the used titanium electrode. The analysis of the results obtained is discussed.

Numerical Modeling of Electrode Degradation During Resistance Spot Welding Using CuCrZr Electrodes

NASA Astrophysics Data System (ADS)

Gauthier, Elise; Carron, Denis; Rogeon, Philippe; Pilvin, Philippe; Pouvreau, Cédric; Lety, Thomas; Primaux, François

2014-05-01

Resistance spot welding is a technique widely used by the automotive industry to assemble thin steel sheets. The cyclic thermo-mechanical loading associated with the accumulation of weld spots progressively deteriorates the electrodes. This study addresses the development of a comprehensive multi-physical model that describes the sequential deterioration. Welding tests achieved on uncoated and Zn-coated steel sheets are analyzed. Finite element analysis is performed using an electrical-thermal-metallurgical model. A numerical experimental design is carried out to highlight the main process parameters and boundary conditions which affect electrode degradation.

Ion Monitoring

DOEpatents

Orr, Christopher Henry; Luff, Craig Janson; Dockray, Thomas; Macarthur, Duncan Whittemore

2003-11-18

The apparatus and method provide a technique for significantly reducing capacitance effects in detector electrodes arising due to movement of the instrument relative to the item/location being monitored in ion detection based techniques. The capacitance variations are rendered less significant by placing an electrically conducting element between the detector electrodes and the monitored location/item. Improved sensitivity and reduced noise signals arise as a result. The technique also provides apparatus and method suitable for monitoring elongate items which are unsuited to complete enclosure in one go within a chamber. The items are monitored part by part as the pass through the instrument, so increasing the range of items or locations which can be successfully monitored.

Diode-rectified multiphase AC arc for the improvement of electrode erosion characteristics

NASA Astrophysics Data System (ADS)

Tanaka, Manabu; Hashizume, Taro; Saga, Koki; Matsuura, Tsugio; Watanabe, Takayuki

2017-11-01

An innovative multiphase AC arc (MPA) system was developed on the basis of a diode-rectification technique to improve electrode erosion characteristics. Conventionally, electrode erosion in AC arc is severer than that in DC arc. This originated from the fact that the required properties for the cathode and anode are different, although an AC electrode works as the cathode and the anode periodically. To solve this problem, a separation of AC electrodes into pairs of thoriated tungsten cathode and copper anode by diode-rectification was attempted. A diode-rectified multiphase AC arc (DRMPA) system was then successfully established, resulting in a drastic improvement of the erosion characteristics. The electrode erosion rate in the DRMPA was less than one-third of that in the conventional MPA without the diode rectification. In order to clarify its erosion mechanism, electrode phenomena during discharge were visualized by a high-speed camera system with appropriate band-pass filters. Fluctuation characteristics of the electrode temperature in the DRMPA were revealed.

Reducing electrocoagulation harvesting costs for practical microalgal biodiesel production.

PubMed

Dassey, Adam J; Theegala, Chandra S

2014-01-01

Electrocoagulation has shown potential to be a primary microalgae harvesting technique for biodiesel production. However, methods to reduce energy and electrode costs are still necessary for practical application. Electrocoagulation tests were conducted on Nannochloris sp. and Dunaliella sp. using perforated aluminium and iron electrodes under various charge densities. Aluminium electrodes were shown to be more efficient than iron electrodes when harvesting both algal species. Despite the lower harvesting efficiency, however, the iron electrodes were more energy and cost efficient. Operational costs of less than $0.03/L oil were achieved when harvesting Nannochloris sp. with iron electrodes at 35% harvest efficiency, whereas aluminium electrodes cost $0.75/L oil with 42% harvesting efficiency. Increasing the harvesting efficiencies for both aluminium and iron electrodes also increased the overall cost per litre of oil, therefore lower harvesting efficiencies with lower energy inputs was recommended. Also, increasing the culturing salinity to 2 ppt sodium chloride for freshwater Nannochloris sp. was determined practical to improve the electrocoagulation energy efficiency despite a 25% reduction in cell growth.

Automated MRI segmentation for individualized modeling of current flow in the human head.

PubMed

Huang, Yu; Dmochowski, Jacek P; Su, Yuzhuo; Datta, Abhishek; Rorden, Christopher; Parra, Lucas C

2013-12-01

High-definition transcranial direct current stimulation (HD-tDCS) and high-density electroencephalography require accurate models of current flow for precise targeting and current source reconstruction. At a minimum, such modeling must capture the idiosyncratic anatomy of the brain, cerebrospinal fluid (CSF) and skull for each individual subject. Currently, the process to build such high-resolution individualized models from structural magnetic resonance images requires labor-intensive manual segmentation, even when utilizing available automated segmentation tools. Also, accurate placement of many high-density electrodes on an individual scalp is a tedious procedure. The goal was to develop fully automated techniques to reduce the manual effort in such a modeling process. A fully automated segmentation technique based on Statical Parametric Mapping 8, including an improved tissue probability map and an automated correction routine for segmentation errors, was developed, along with an automated electrode placement tool for high-density arrays. The performance of these automated routines was evaluated against results from manual segmentation on four healthy subjects and seven stroke patients. The criteria include segmentation accuracy, the difference of current flow distributions in resulting HD-tDCS models and the optimized current flow intensities on cortical targets. The segmentation tool can segment out not just the brain but also provide accurate results for CSF, skull and other soft tissues with a field of view extending to the neck. Compared to manual results, automated segmentation deviates by only 7% and 18% for normal and stroke subjects, respectively. The predicted electric fields in the brain deviate by 12% and 29% respectively, which is well within the variability observed for various modeling choices. Finally, optimized current flow intensities on cortical targets do not differ significantly. Fully automated individualized modeling may now be feasible for large-sample EEG research studies and tDCS clinical trials.

Improved performance of inkjet-printed Ag source/drain electrodes for organic thin-film transistors by overcoming the coffee ring effects

NASA Astrophysics Data System (ADS)

Liu, Cheng-Fang; Lin, Yan; Lai, Wen-Yong; Huang, Wei

2017-11-01

Inkjet printing is a promising technology for the scalable fabrication of organic electronics because of the material conservation and facile patterning as compared with other solution processing techniques. In this study, we have systematically investigated the cross-sectional profile control of silver (Ag) electrode via inkjet printing. A facile methodology for achieving inkjet-printed Ag source/drain with improved profiles is developed. It is demonstrated that the printing conditions such as substrate temperature, drop spacing and printing layers affect the magnitude of the droplet deposition and the rate of evaporation, which can be optimized to greatly reduce the coffee ring effects for improving the inkjet-printed electrode profiles. Ag source/drain electrodes with uniform profiles were successfully inkjet-printed and incorporated into organic thin-film transistors (OTFTs). The resulting devices showed superior electrical performance than those without special treatments. It is noted to mention that the strategy for modulating the inkjet-printed Ag electrodes in this work does not demand the ink formulation or complicated steps, which is beneficial for scaling up the printing techniques for potential large-area/mass manufacturing.

Generation of patterned cell co-cultures in silicone tubing using a microelectrode technique and electrostatic assembly.

PubMed

Kaji, Hirokazu; Sekine, Soichiro; Hashimoto, Masahiko; Kawashima, Takeaki; Nishizawa, Matsuhiko

2007-01-01

We report a method for producing patterned cell adhesion inside silicone tubing. A platinum needle microelectrode was inserted through the wall of the tubing and an oxidizing agent electrochemically generated at the inserted electrode. This agent caused local detachment of the anti-biofouling heparin layer from the inner surface of the tubing. The cell-adhesive protein fibronectin selectively adsorbed onto the newly exposed surface, making it possible to initiate a localized cell culture. The electrode could be readily set in place without breaking the tubular structure and, importantly, almost no culture solution leaked from the electrode insertion site after the electrode was removed. Ionic adsorption of poly-L-lysine at the tubular region retaining a heparin coating was used to switch the heparin surface from cell-repellent to cell-adhesive, thereby facilitating the adhesion of a second cell type. The combination of the electrode-based technique with electrostatic deposition enabled the formation of patterned co-cultures within the semi-closed tubular structure. The controlled co-cultures inside the elastic tubing should be of value for cell-cell interaction studies following application of chemical or mechanical stimuli and for tissue engineering-based bioreactors.

Studies on Creep Deformation and Rupture Behavior of 316LN SS Multi-Pass Weld Joints Fabricated with Two Different Electrode Sizes

NASA Astrophysics Data System (ADS)

Vijayanand, V. D.; Kumar, J. Ganesh; Parida, P. K.; Ganesan, V.; Laha, K.

2017-02-01

Effect of electrode size on creep deformation and rupture behavior has been assessed by carrying out creep tests at 923 K (650 °C) over the stress range 140 to 225 MPa on 316LN stainless steel weld joints fabricated employing 2.5 and 4 mm diameter electrodes. The multi-pass welding technique not only changes the morphology of delta ferrite from vermicular to globular in the previous weld bead region near to the weld bead interface, but also subjects the region to thermo-mechanical heat treatment to generate appreciable strength gradient. Electron backscatter diffraction analysis revealed significant localized strain gradients in regions adjoining the weld pass interface for the joint fabricated with large electrode size. Larger electrode diameter joint exhibited higher creep rupture strength than the smaller diameter electrode joint. However, both the joints had lower creep rupture strength than the base metal. Failure in the joints was associated with microstructural instability in the fusion zone, and the vermicular delta ferrite zone was more prone to creep cavitation. Larger electrode diameter joint was found to be more resistant to failure caused by creep cavitation than the smaller diameter electrode joint. This has been attributed to the larger strength gradient between the beads and significant separation between the cavity prone vermicular delta ferrite zones which hindered the cavity growth. Close proximity of cavitated zones in smaller electrode joint facilitated their faster coalescence leading to more reduction in creep rupture strength. Failure location in the joints was found to depend on the electrode size and applied stress. The change in failure location has been assessed on performing finite element analysis of stress distribution across the joint on incorporating tensile and creep strengths of different constituents of joints, estimated by ball indentation and impression creep testing techniques.

Final Technical Report: Application of in situ Neutron Diffraction to Understand the Mechanism of Phase Transitions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandran, Ravi

In this research, phase transitions in the bulk electrodes for Li-ion batteries were investigated using neutron diffraction (ND) as well as neutron imaging techniques. The objectives of this research is to design of a novel in situ electrochemical cell to obtain Rietveld refinable neutron diffraction experiments using small volume electrodes of various laboratory/research-scale electrodes intended for Li-ion batteries. This cell is also to be used to investigate the complexity of phase transitions in Li(Mg) alloy electrodes, either by diffraction or by neutron imaging, which occur under electrochemical lithiation and delithiation, and to determine aspects of phase transition that enable/limit energymore » storage capacity. Additional objective is to investigate the phase transitions in electrodes made of etched micro-columns of silicon and investigate the effect of particle/column size on phase transitions and nonequilibrium structures. An in situ electrochemical cell was designed successfully and was used to study the phase transitions under in-situ neutron diffraction in both the electrodes (anode/cathode) simultaneously in graphite/LiCoO 2 and in graphite/LiMn 2O 4 cells each with two cells. The diffraction patterns fully validated the working of the in situ cell. Additional experimental were performed using the Si micro-columnar electrodes. The results revealed new lithiation phenomena, as evidenced by mosaicity formation in silicon electrode. These experiments were performed in Vulcan diffractometer at SNS, Oak Ridge National Laboratory. In parallel, the spatial distribution of Li during lithiation and delithiation processes in Li-battery electrodes were investigated. For this purpose, neutron tomographic imaging technique has been used for 3D mapping of Li distribution in bulk Li(Mg) alloy electrodes. It was possible to observe the phase boundary of Li(Mg) alloy indicating phase transition from Li-rich BCC β-phase to Li-lean α-phase. These experiments have been performed at CG-1D Neutron Imaging Prototype Station at SNS.« less

Spraying Techniques for Large Scale Manufacturing of PEM-FC Electrodes

NASA Astrophysics Data System (ADS)

Hoffman, Casey J.

Fuel cells are highly efficient energy conversion devices that represent one part of the solution to the world's current energy crisis in the midst of global climate change. When supplied with the necessary reactant gasses, fuel cells produce only electricity, heat, and water. The fuel used, namely hydrogen, is available from many sources including natural gas and the electrolysis of water. If the electricity for electrolysis is generated by renewable energy (e.g., solar and wind power), fuel cells represent a completely 'green' method of producing electricity. The thought of being able to produce electricity to power homes, vehicles, and other portable or stationary equipment with essentially zero environmentally harmful emissions has been driving academic and industrial fuel cell research and development with the goal of successfully commercializing this technology. Unfortunately, fuel cells cannot achieve any appreciable market penetration at their current costs. The author's hypothesis is that: the development of automated, non-contact deposition methods for electrode manufacturing will improve performance and process flexibility, thereby helping to accelerate the commercialization of PEMFC technology. The overarching motivation for this research was to lower the cost of manufacturing fuel cell electrodes and bring the technology one step closer to commercial viability. The author has proven this hypothesis through a detailed study of two non-contact spraying methods. These scalable deposition systems were incorporated into an automated electrode manufacturing system that was designed and built by the author for this research. The electrode manufacturing techniques developed by the author have been shown to produce electrodes that outperform a common lab-scale contact method that was studied as a baseline, as well as several commercially available electrodes. In addition, these scalable, large scale electrode manufacturing processes developed by the author are also flexible and can be used to fabricate almost any fuel cell electrodes on the market today. This dissertation provides a description of the entire electrode manufacturing process as well as an analysis of the accuracy, performance and repeatability of the methods.

Embedded 32-bit Differential Pulse Voltammetry (DPV) Technique for 3-electrode Cell Sensing

NASA Astrophysics Data System (ADS)

N, Aqmar N. Z.; Abdullah, W. F. H.; Zain, Z. M.; Rani, S.

2018-03-01

This paper addresses the development of differential pulse voltammetry (DPV) embedded algorithm using an ARM cortex processor with new developed potentiostat circuit design for in-situ 3-electrode cell sensing. This project is mainly to design a low cost potentiostat for the researchers in laboratories. It is required to develop an embedded algorithm for analytical technique to be used with the designed potentiostat. DPV is one of the most familiar pulse technique method used with 3-electrode cell sensing in chemical studies. Experiment was conducted on 10mM solution of Ferricyanide using the designed potentiostat and the developed DPV algorithm. As a result, the device can generate an excitation signal of DPV from 0.4V to 1.2V and produced a peaked voltammogram with relatively small error compared to the commercial potentiostat; which is only 6.25% difference in peak potential reading. The design of potentiostat device and its DPV algorithm is verified.

Simultaneous Voltammetric Detection of Carbaryl and Paraquat Pesticides on Graphene-Modified Boron-Doped Diamond Electrode

PubMed Central

Pop, Aniela; Manea, Florica; Flueras, Adriana; Schoonman, Joop

2017-01-01

Monitoring of pesticide residues in food, beverages, and the environment requires fast, versatile, and sensitive analyzing methods. Direct electrochemical detection of pesticides could represent an efficient solution. Adequate electrode material, electrochemical technique, and optimal operation parameters define the detection method for practical application. In this study, cyclic voltammetric and differential pulse voltammetric techniques were used in order to individually and simultaneously detect two pesticides, i.e., carbaryl (CR) and paraquat (PQ), from an acetate buffer solution and also from natural apple juice. A graphene-modified boron-doped diamond electrode, denoted BDDGR, was obtained and successfully applied in the simultaneous detection of CR and PQ pesticides, using the differential pulse voltammetric technique with remarkable electroanalytical parameters in terms of sensitivity: 33.27 μA μM−1 cm−2 for CR and 31.83 μA μM−1 cm−2 for PQ. These outstanding results obtained in the acetate buffer supporting electrolyte allowed us to simultaneously detect the targeted pesticides in natural apple juice. PMID:28878151

Comparative quantification of oxygen release by wetland plants: electrode technique and oxygen consumption model.

PubMed

Wu, Haiming; Liu, Jufeng; Zhang, Jian; Li, Cong; Fan, Jinlin; Xu, Xiaoli

2014-01-01

Understanding oxygen release by plants is important to the design of constructed wetlands for wastewater treatment. Lab-scale systems planted with Phragmites australis were studied to evaluate the amount of oxygen release by plants using electrode techniques and oxygen consumption model. Oxygen release rate (0.14 g O2/m(2)/day) measured using electrode techniques was much lower than that (3.94-25.20 gO2/m(2)/day) calculated using the oxygen consumption model. The results revealed that oxygen release by plants was significantly influenced by the oxygen demand for the degradation of pollutants, and the oxygen release rate increased with the rising of the concentration of degradable materials in the solution. The summary of the methods in qualifying oxygen release by wetland plants demonstrated that variations existed among different measuring methods and even in the same measuring approach. The results would be helpful for understanding the contribution of plants in constructed wetlands toward actual wastewater treatment.

The Rise of Voltammetry: From Polarography to the Scanning Electrochemical Microscope

ERIC Educational Resources Information Center

Bard, Allen J.

2007-01-01

The drooping mercury electrode (DME) was previously used to carry out electrochemical experiments but invention of polarography technique changed this. Voltammetry with DME was given the term polarography and are used in measurement of current as a function of potential at small electrodes.

Molybdenum-platinum-oxide electrodes for thermoelectric generators

DOEpatents

Schmatz, Duane J.

1990-01-01

The invention is directed to a composite article suitable for use in thermoelectric generators. The article comprises a solid electrolyte carrying a thin film comprising molybdenum-platinum-oxide as an electrode deposited by physical deposition techniques. The invention is also directed to the method of making same.

Trans-falcine and contralateral sub-frontal electrode placement in pediatric epilepsy surgery: technical note.

PubMed

Pindrik, Jonathan; Hoang, Nguyen; Tubbs, R Shane; Rocque, Brandon J; Rozzelle, Curtis J

2017-08-01

Phase II monitoring with intracranial electroencephalography (ICEEG) occasionally requires bilateral placement of subdural (SD) strips, grids, and/or depth electrodes. While phase I monitoring often demonstrates a preponderance of unilateral findings, individual studies (video EEG, single photon emission computed tomography [SPECT], and positron emission tomography [PET]) can suggest or fail to exclude a contralateral epileptogenic onset zone. This study describes previously unreported techniques of trans-falcine and sub-frontal insertion of contralateral SD grids and depth electrodes for phase II monitoring in pediatric epilepsy surgery patients when concern about bilateral abnormalities has been elicited during phase I monitoring. Pediatric patients with medically refractory epilepsy undergoing stage I surgery for phase II monitoring involving sub-frontal and/or trans-falcine insertion of SD grids and/or depth electrodes at the senior author's institution were retrospectively reviewed. Intra-operative technical details of sub-frontal and trans-falcine approaches were studied, while intra-operative complications or events were noted. Operative techniques included gentle subfrontal retraction and elevation of the olfactory tracts (while preserving the relationship between the olfactory bulb and cribriform plate) to insert SD grids across the midline for coverage of the contralateral orbito-frontal regions. Trans-falcine approaches involved accessing the inter-hemispheric space, bipolar cauterization of the anterior falx cerebri below the superior sagittal sinus, and sharp dissection using a blunt elevator and small blade scalpel. The falcine window allowed contralateral SD strip, grid, and depth electrodes to be inserted for coverage of the contralateral frontal regions. The study cohort included seven patients undergoing sub-frontal and/or trans-falcine insertion of contralateral SD strip, grid, and/or depth electrodes from February 2012 through June 2015. Five patients (71%) experienced no intra-operative events related to contralateral ICEEG electrode insertion. Intra-operative events of frontal territory venous engorgement (1/7, 14%) due to sacrifice of anterior bridging veins draining into the SSS and avulsion of a contralateral bridging vein (1/7, 14%), probably due to prior anterior corpus callosotomy, each occurred in one patient. There were no intra-operative or peri-operative complications in any of the patients studied. Two patients required additional surgery for supplemental SD strip and/or depth electrodes via burr hole craniectomy to enhance phase II monitoring. All patients proceeded to stage II surgery for resection of ipsilateral epileptogenic onset zones without adverse events. Trans-falcine and sub-frontal insertion of contralateral SD strip, grid, and depth electrodes are previously unreported techniques for achieving bilateral frontal coverage in phase II monitoring in pediatric epilepsy surgery. This technique obviates the need for contralateral craniotomy and parenchymal exposure with limited, remediable risks. Larger case series using the method described herein are now necessary.

Emerging Carbon and Post-Carbon Nanomaterial Inks for Printed Electronics.

PubMed

Secor, Ethan B; Hersam, Mark C

2015-02-19

Carbon and post-carbon nanomaterials present desirable electrical, optical, chemical, and mechanical attributes for printed electronics, offering low-cost, large-area functionality on flexible substrates. In this Perspective, recent developments in carbon nanomaterial inks are highlighted. Monodisperse semiconducting single-walled carbon nanotubes compatible with inkjet and aerosol jet printing are ideal channels for thin-film transistors, while inkjet, gravure, and screen-printable graphene-based inks are better-suited for electrodes and interconnects. Despite the high performance achieved in prototype devices, additional effort is required to address materials integration issues encountered in more complex systems. In this regard, post-carbon nanomaterial inks (e.g., electrically insulating boron nitride and optically active transition-metal dichalcogenides) present promising opportunities. Finally, emerging work to extend these nanomaterial inks to three-dimensional printing provides a path toward nonplanar devices. Overall, the superlative properties of these materials, coupled with versatile assembly by printing techniques, offer a powerful platform for next-generation printed electronics.

Non-invasive toluene sensor for early diagnosis of lung cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saxena, Rahul; Srivastava, Sudha, E-mail: sudha.srivastava@jiit.ac.in

Here we present, quantification of volatile organic compounds in human breath for early detection of lung cancer to increase survival probability. Graphene oxide nanosheets synthesized by modified Hummer’s method were employed as a sensing element to detect the presence of toluene in the sample. Optical and morphological characterization of synthesized nanomaterial was performed by UV-Visible spectroscopy and scanning electron microscopy (SEM) respectively. Spectroscopic assay shows a linearly decreasing intensity of GO absorption peak with increasing toluene concentration with a linear range from 0-200 pM. While impedimetric sensor developed on a graphene oxide nanosheetsmodified screen printed electrodes displayed a decreasing electronmore » transfer resistance increasing toluene with much larger linear range of 0-1000 pM. Reported techniques are advantageous as these are simple, sensitive and cost effective, which can easily be extended for primary screening of other VOCs.« less

A database for the static dielectric constant of water and steam

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fernandez, D.P.; Mulev, Y.; Goodwin, A.R.H.

All reliable sources of data for the static dielectric constant or relative permittivity of water and steam, many of them unpublished or inaccessible, have been collected, evaluated, corrected when required, and converted to the ITS-90 temperature scale. The data extend over a temperature range from 238 to 873 K and over a pressure range from 0.1 MPa up to 1189 MPa. The evaluative part of this work includes a review of the different types of measurement techniques, and the corrections for frequency dependence due to the impedance of circuit components, and to electrode polarization. It also includes a detailed assessmentmore » of the uncertainty of each particular data source, as compared to other sources in the same range of pressure and temperature. Both the raw and the corrected data have been tabulated, and are also available on diskette. A comprehensive list of references to the literature is included.« less

Understanding the Degradation Mechanism of Lithium Nickel Oxide Cathodes for Li-Ion Batteries

DOE PAGES

Xu, Jing; Hu, Enyuan; Nordlund, Dennis; ...

2016-11-01

The phase transition, charge compensation, and local chemical environment of Ni in LiNiO 2 were investigated to understand the degradation mechanism. The electrode was subjected to a variety of bulk and surface-sensitive characterization techniques under different charge–discharge cycling conditions. We observed the phase transition from the original hexagonal H1 phase to another two hexagonal phases (H2 and H3) upon Li deintercalation. Moreover, the gradual loss of H3-phase features was revealed during the repeated charges. The reduction in Ni redox activity occurred at both the charge and the discharge states, and it appeared both in the bulk and at the surfacemore » over the extended cycles. In conclusion, the degradation of crystal structure significantly contributes to the reduction of Ni redox activity, which in turn causes the cycling performance decay of LiNiO 2.« less

Linear Phase Sharp Transition BPF to Detect Noninvasive Maternal and Fetal Heart Rate.

PubMed

Marchon, Niyan; Naik, Gourish; Pai, K R

2018-01-01

Fetal heart rate (FHR) detection can be monitored using either direct fetal scalp electrode recording (invasive) or by indirect noninvasive technique. Weeks before delivery, the invasive method poses a risk factor to the fetus, while the latter provides accurate fetal ECG (FECG) information which can help diagnose fetal's well-being. Our technique employs variable order linear phase sharp transition (LPST) FIR band-pass filter which shows improved stopband attenuation at higher filter orders. The fetal frequency fiduciary edges form the band edges of the filter characterized by varying amounts of overlap of maternal ECG (MECG) spectrum. The one with the minimum maternal spectrum overlap was found to be optimum with no power line interference and maximum fetal heart beats being detected. The improved filtering is reflected in the enhancement of the performance of the fetal QRS detector (FQRS). The improvement has also occurred in fetal heart rate obtained using our algorithm which is in close agreement with the true reference (i.e., invasive fetal scalp ECG). The performance parameters of the FQRS detector such as sensitivity (Se), positive predictive value (PPV), and accuracy (F 1 ) were found to improve even for lower filter order. The same technique was extended to evaluate maternal QRS detector (MQRS) and found to yield satisfactory maternal heart rate (MHR) results.

Properties of mechanically alloyed Mg-Ni-Ti ternary hydrogen storage alloys for Ni-MH batteries

NASA Astrophysics Data System (ADS)

Ruggeri, Stéphane; Roué, Lionel; Huot, Jacques; Schulz, Robert; Aymard, Luc; Tarascon, Jean-Marie

MgNiTi x, Mg 1- xTi xNi and MgNi 1- xTi x (with x varying from 0 to 0.5) alloys have been prepared by high energy ball milling and tested as hydrogen storage electrodes. The initial discharge capacities of the Mg-Ni-Ti ternary alloys are inferior to the MgNi electrode capacity. However, an exception is observed with MgNi 0.95Ti 0.05, which has an initial discharge capacity of 575 mAh/g compared to 522 mAh/g for the MgNi electrode. The Mg-Ni-Ti ternary alloys show improved cycle life compared to Mg-Ni binary alloys with the same Mg/Ni atomic ratio. The best cycle life is observed with Mg 0.5Ti 0.5Ni electrode which retains 75% of initial capacity after 10 cycles in comparison to 39% for MgNi electrodes, in addition to improved high-rate dischargeability (HRD). According to the XPS analysis, the cycle life improvement of the Mg 0.5Ti 0.5Ni electrode can be related to the formation of TiO 2 which limits Mg(OH) 2 formation. The anodic polarization curve of Mg 0.5Ti 0.5Ni electrode shows that the current related to the active/passive transition is much less important and that the passive region is more extended than for the MgNi electrode but the corrosion of the electrode is still significant. This suggests that the cycle life improvement would be also associated with a decrease of the particle pulverization upon cycling.

Nanopatterned conductive polymer films as a Pt, TCO-free counter electrode for low-cost dye-sensitized solar cells.

PubMed

Kwon, Jeong; Ganapathy, Veerappan; Kim, Young Hun; Song, Kyung-Deok; Park, Hong-Gyu; Jun, Yongseok; Yoo, Pil J; Park, Jong Hyeok

2013-09-07

A low-cost nanopatterned highly conductive poly(3,4-ethylenedioxythiophene) (PEDOT) thin film was fabricated on a flexible plastic substrate via a chemical polymerization method combined with a nanoimprinting technique and used as a platinum (Pt), TCO-free counter electrode for dye-sensitized solar cells (DSSCs). The catalytic properties of the nanopatterned PEDOT as the counter electrode in DSSCs were studied using cyclic voltammetry, J-V measurements, impedance spectroscopy, and finite-difference time-domain (FDTD) simulations. The nanopatterned PEDOT counter electrodes exhibit better functionality as a counter electrode for tri-iodide reduction when compared to non-patterned PEDOT-based counter electrodes. The Pt and TCO-free DSSCs with a nanopatterned PEDOT-based counter electrode exhibited a power conversion efficiency of 7.1% under one sunlight illumination (100 mW cm(-2)), which is comparable to that of conventional DSSCs with standard platinum Pt/FTO paired counter electrodes. The ability to modulate catalytic functionality with changes in nanoscale morphology represents a promising route for developing new counter electrodes of Pt and TCO-free DSSCs.

The cell-in-series method: A technique for accelerated electrode degradation in redox flow batteries

DOE PAGES

Pezeshki, Alan M.; Sacci, Robert L.; Veith, Gabriel M.; ...

2015-11-21

Here, we demonstrate a novel method to accelerate electrode degradation in redox flow batteries and apply this method to the all-vanadium chemistry. Electrode performance degradation occurred seven times faster than in a typical cycling experiment, enabling rapid evaluation of materials. This method also enables the steady-state study of electrodes. In this manner, it is possible to delineate whether specific operating conditions induce performance degradation; we found that both aggressively charging and discharging result in performance loss. Post-mortem x-ray photoelectron spectroscopy of the degraded electrodes was used to resolve the effects of state of charge (SoC) and current on the electrodemore » surface chemistry. For the electrode material tested in this work, we found evidence that a loss of oxygen content on the negative electrode cannot explain decreased cell performance. Furthermore, the effects of decreased electrode and membrane performance on capacity fade in a typical cycling battery were decoupled from crossover; electrode and membrane performance decay were responsible for a 22% fade in capacity, while crossover caused a 12% fade.« less

Corrosion, stress corrosion cracking, and electrochemistry of the iron and nickel base alloys in caustic environments. Progress report, 1 March 1977--28 February 1978

DOE Office of Scientific and Technical Information (OSTI.GOV)

Staehle, R.W.; Agrawal, A.K.

1978-01-01

The straining electrode technique was used to evaluate the stress corrosion cracking (SCC) susceptibility of AISI 304 stainless steel in 20N NaOH solution, and of Inconel 600 Alloy and Incoloy 800 Alloy in boiling 17.5N NaOH solution. The crack propagation rate estimated from the straining experiments correlated well with the previous constant load experiments. It was found that the straining electrode technique is a useful method for estimating, through short term experiments, parameters like crack propagation rate, crack morphology, and repassivation rate, as a function of the electrode potential. The role of alloying elements on the crack propagation rate inmore » the above alloys are also discussed.« less

Preparation of PEMFC Electrodes from Milligram-Amounts of Catalyst Powder

DOE PAGES

Yarlagadda, Venkata; McKinney, Samuel E.; Keary, Cristin L.; ...

2017-06-03

Development of electrocatalysts with higher activity and stability is one of the highest priorities in enabling cost-competitive hydrogen-air fuel cells. Although the rotating disk electrode (RDE) technique is widely used to study new catalyst materials, it has been often shown to be an unreliable predictor of catalyst performance in actual fuel cell operation. Fabrication of membrane electrode assemblies (MEA) for evaluation which are more representative of actual fuel cells generally requires relatively large amounts (>1 g) of catalyst material which are often not readily available in early stages of development. In this study, we present two MEA preparation techniques usingmore » as little as 30 mg of catalyst material, providing methods to conduct more meaningful MEA-based tests using research-level catalysts amounts.« less

Robust solder joint attachment of coaxial cable leads to piezoelectric ceramic electrodes.

PubMed

Vianco, P T

1993-01-01

A technique was developed for the solder attachment of coaxial cable leads to silver-bearing thick-film electrodes on piezoelectric ceramics. Soldering the cable leads directly to the thick film caused bonds with low mechanical strength due to poor solder joint geometry. A barrier coating of 1.5 mum Cu/1.5 mum Ni/1.0 mum Sn deposited on the thick-film layer improved the strength of the solder joints by eliminating the adsorption of Ag from the thick film, which was responsible for the improper solder joint geometry. The procedure does not require special preparation of the electrode surface and is cost effective due to the use of nonprecious metal films and the batch processing capabilities of the electron beam deposition technique.

Integrated TiN coated porous silicon supercapacitor with large capacitance per foot print

NASA Astrophysics Data System (ADS)

Grigoras, Kestutis; Grönberg, Leif; Ahopelto, Jouni; Prunnila, Mika

2017-05-01

We have fabricated a micro-supercapacitor with porous silicon electrodes coated with TiN by atomic layer deposition technique. The coating provides an efficient surface passivation and high electrical conductivity of the electrodes, resulting in stable and almost ideal electrochemical double layer capacitor behavior with characteristics comparable to the best carbon based micro-supercapacitors. Stability of the supercapacitor is verified by performing 50 000 voltammetry cycles with high capacitance retention obtained. Silicon microfabrication techniques facilitate integration of both supercapacitor electrodes inside the silicon substrate and, in this work, such in-chip supercapacitor is demonstrated. This approach allows realization of very high capacitance per foot print area. The in-chip micro-supercapacitor can be integrated with energy harvesting elements and can be used in wearable and implantable microdevices.

High-performance flexible electrode based on electrodeposition of polypyrrole/MnO2 on carbon cloth for supercapacitors

NASA Astrophysics Data System (ADS)

Fan, Xingye; Wang, Xiaolei; Li, Ge; Yu, Aiping; Chen, Zhongwei

2016-09-01

A highly flexible electrodes based on electrodeposited MnO2 and polypyrrole composite on carbon cloth is designed and developed by a facile in-situ electrodeposition technique. Such flexible composite electrodes with multiply layered structure possess a high specific capacitance of 325 F g-1 at a current density of 0.2 A g-1, and an excellent rate capability with a capacitance retention of 70% at a high current density of 5.0 A g-1. The superior electrochemical performance is mainly due to the unique electrode with improved ion- and electron-transportation pathways as well as the efficient utilization of active materials and electrode robustness. The excellent electrochemical performance and the low cost property endow this flexible nanocomposite electrode with great promise in applications of flexible supercapacitors.

Gold leaf counter electrodes for dye-sensitized solar cells

NASA Astrophysics Data System (ADS)

Shimada, Kazuhiro; Toyoda, Takeshi

2018-03-01

In this study, a gold leaf 100 nm thin film is used as the counter electrode in dye-sensitized solar cells. The traditional method of hammering gold foil to obtain a thin gold leaf, which requires only small amounts of gold, was employed. The gold leaf was then attached to the substrate using an adhesive to produce the gold electrode. The proposed approach for fabricating counter electrodes is demonstrated to be facile and cost-effective, as opposed to existing techniques. Compared with electrodes prepared with gold foil and sputtered gold, the gold leaf counter electrode demonstrates higher catalytic activity with a cobalt-complex electrolyte and higher cell efficiency. The origin of the improved performance was investigated by surface morphology examination (scanning electron microscopy), various electrochemical analyses (cyclic voltammetry, linear sweep voltammetry, and electrochemical impedance spectroscopy), and crystalline analysis (X-ray diffractometry).

Quasi-reference electrodes in confined electrochemical cells can result in in situ production of metallic nanoparticles.

PubMed

Perera, Rukshan T; Rosenstein, Jacob K

2018-01-31

Nanoscale working electrodes and miniaturized electroanalytical devices are valuable platforms to probe molecular phenomena and perform chemical analyses. However, the inherent close distance of metallic electrodes integrated into a small volume of electrolyte can complicate classical electroanalytical techniques. In this study, we use a scanning nanopipette contact probe as a model miniaturized electrochemical cell to demonstrate measurable side effects of the reaction occurring at a quasi-reference electrode. We provide evidence for in situ generation of nanoparticles in the absence of any electroactive species and we critically analyze the origin, nucleation, dissolution and dynamic behavior of these nanoparticles as they appear at the working electrode. It is crucial to recognize the implications of using quasi-reference electrodes in confined electrochemical cells, in order to accurately interpret the results of nanoscale electrochemical experiments.

Beam based measurement of beam position monitor electrode gains

NASA Astrophysics Data System (ADS)

Rubin, D. L.; Billing, M.; Meller, R.; Palmer, M.; Rendina, M.; Rider, N.; Sagan, D.; Shanks, J.; Strohman, C.

2010-09-01

Low emittance tuning at the Cornell Electron Storage Ring (CESR) test accelerator depends on precision measurement of vertical dispersion and transverse coupling. The CESR beam position monitors (BPMs) consist of four button electrodes, instrumented with electronics that allow acquisition of turn-by-turn data. The response to the beam will vary among the four electrodes due to differences in electronic gain and/or misalignment. This variation in the response of the BPM electrodes will couple real horizontal offset to apparent vertical position, and introduce spurious measurements of coupling and vertical dispersion. To alleviate this systematic effect, a beam based technique to measure the relative response of the four electrodes has been developed. With typical CESR parameters, simulations show that turn-by-turn BPM data can be used to determine electrode gains to within ˜0.1%.

Boron-doped diamond electrode: synthesis, characterization, functionalization and analytical applications.

PubMed

Luong, John H T; Male, Keith B; Glennon, Jeremy D

2009-10-01

In recent years, conductive diamond electrodes for electrochemical applications have been a major focus of research and development. The impetus behind such endeavors could be attributed to their wide potential window, low background current, chemical inertness, and mechanical durability. Several analytes can be oxidized by conducting diamond compared to other carbon-based materials before the breakdown of water in aqueous electrolytes. This is important for detecting and/or identifying species in solution since oxygen and hydrogen evolution do not interfere with the analysis. Thus, conductive diamond electrodes take electrochemical detection into new areas and extend their usefulness to analytes which are not feasible with conventional electrode materials. Different types of diamond electrodes, polycrystalline, microcrystalline, nanocrystalline and ultrananocrystalline, have been synthesized and characterized. Of particular interest is the synthesis of boron-doped diamond (BDD) films by chemical vapor deposition on various substrates. In the tetrahedral diamond lattice, each carbon atom is covalently bonded to its neighbors forming an extremely robust crystalline structure. Some carbon atoms in the lattice are substituted with boron to provide electrical conductivity. Modification strategies of doped diamond electrodes with metallic nanoparticles and/or electropolymerized films are of importance to impart novel characteristics or to improve the performance of diamond electrodes. Biofunctionalization of diamond films is also feasible to foster several useful bioanalytical applications. A plethora of opportunities for nanoscale analytical devices based on conducting diamond is anticipated in the very near future.

Directly Grown Nanostructured Electrodes for High Volumetric Energy Density Binder-Free Hybrid Supercapacitors: A Case Study of CNTs//Li4Ti5O12

NASA Astrophysics Data System (ADS)

Zuo, Wenhua; Wang, Chong; Li, Yuanyuan; Liu, Jinping

2015-01-01

Hybrid supercapacitor (HSC), which typically consists of a Li-ion battery electrode and an electric double-layer supercapacitor electrode, has been extensively investigated for large-scale applications such as hybrid electric vehicles, etc. Its application potential for thin-film downsized energy storage systems that always prefer high volumetric energy/power densities, however, has not yet been explored. Herein, as a case study, we develop an entirely binder-free HSC by using multiwalled carbon nanotube (MWCNT) network film as the cathode and Li4Ti5O12 (LTO) nanowire array as the anode and study the volumetric energy storage capability. Both the electrode materials are grown directly on carbon cloth current collector, ensuring robust mechanical/electrical contacts and flexibility. Our 3 V HSC device exhibits maximum volumetric energy density of ~4.38 mWh cm-3, much superior to those of previous supercapacitors based on thin-film electrodes fabricated directly on carbon cloth and even comparable to the commercial thin-film lithium battery. It also has volumetric power densities comparable to that of the commercial 5.5 V/100 mF supercapacitor (can be operated within 3 s) and has excellent cycling stability (~92% retention after 3000 cycles). The concept of utilizing binder-free electrodes to construct HSC for thin-film energy storage may be readily extended to other HSC electrode systems.

The efficacy of two electrodes radiofrequency technique: comparison study using a cadaveric interspinous ligament and temperature measurement using egg white.

PubMed

Lee, Chang-Hyung; Derby, Richard; Choi, Hyun-Seok; Lee, Sang-Heon; Kim, Se Hoon; Kang, Yoon Kyu

2010-01-01

One technique in radiofrequency neurotomies uses 2 electrodes that are simultaneously placed to lie parallel to one another. Comparing lesions on cadaveric interspinous ligament tissue and measuring the temperature change in egg white allows us to accurately measure quantitatively the area of the lesion. Fresh cadaver spinal tissue and egg white tissue were used. A series of samples were prepared with the electrodes placed 1 to 7 mm apart. Using radiofrequency, the needle electrodes were heated in sequential or simultaneous order and the distance of the escaped lesion area and temperature were measured. Samples of cadaver interspinous ligament showed sequential heating of the needles limits the placement of the needle electrodes up to 2 mm apart from each other and up to 4 mm apart when heated simultaneously. The temperature at the escaped lesion area decreased according to the distance for egg white. There was a significant difference in temperature at the escaped lesion area up to 6 mm apart and the temperature was above 50 degrees celsius up to 5 mm in simultaneous lesion and 3 mm in the sequential lesion. The limitations of this study include cadaveric experimentation and use of intraspinous ligament rather than medial branch of the dorsal ramus which is difficult to identify. Heating the 2 electrodes simultaneously appears to coagulate a wider area and potentially produce better results in less time.

Complexity Optimization and High-Throughput Low-Latency Hardware Implementation of a Multi-Electrode Spike-Sorting Algorithm

PubMed Central

Dragas, Jelena; Jäckel, David; Hierlemann, Andreas; Franke, Felix

2017-01-01

Reliable real-time low-latency spike sorting with large data throughput is essential for studies of neural network dynamics and for brain-machine interfaces (BMIs), in which the stimulation of neural networks is based on the networks' most recent activity. However, the majority of existing multi-electrode spike-sorting algorithms are unsuited for processing high quantities of simultaneously recorded data. Recording from large neuronal networks using large high-density electrode sets (thousands of electrodes) imposes high demands on the data-processing hardware regarding computational complexity and data transmission bandwidth; this, in turn, entails demanding requirements in terms of chip area, memory resources and processing latency. This paper presents computational complexity optimization techniques, which facilitate the use of spike-sorting algorithms in large multi-electrode-based recording systems. The techniques are then applied to a previously published algorithm, on its own, unsuited for large electrode set recordings. Further, a real-time low-latency high-performance VLSI hardware architecture of the modified algorithm is presented, featuring a folded structure capable of processing the activity of hundreds of neurons simultaneously. The hardware is reconfigurable “on-the-fly” and adaptable to the nonstationarities of neuronal recordings. By transmitting exclusively spike time stamps and/or spike waveforms, its real-time processing offers the possibility of data bandwidth and data storage reduction. PMID:25415989

Complexity optimization and high-throughput low-latency hardware implementation of a multi-electrode spike-sorting algorithm.

PubMed

Dragas, Jelena; Jackel, David; Hierlemann, Andreas; Franke, Felix

2015-03-01

Reliable real-time low-latency spike sorting with large data throughput is essential for studies of neural network dynamics and for brain-machine interfaces (BMIs), in which the stimulation of neural networks is based on the networks' most recent activity. However, the majority of existing multi-electrode spike-sorting algorithms are unsuited for processing high quantities of simultaneously recorded data. Recording from large neuronal networks using large high-density electrode sets (thousands of electrodes) imposes high demands on the data-processing hardware regarding computational complexity and data transmission bandwidth; this, in turn, entails demanding requirements in terms of chip area, memory resources and processing latency. This paper presents computational complexity optimization techniques, which facilitate the use of spike-sorting algorithms in large multi-electrode-based recording systems. The techniques are then applied to a previously published algorithm, on its own, unsuited for large electrode set recordings. Further, a real-time low-latency high-performance VLSI hardware architecture of the modified algorithm is presented, featuring a folded structure capable of processing the activity of hundreds of neurons simultaneously. The hardware is reconfigurable “on-the-fly” and adaptable to the nonstationarities of neuronal recordings. By transmitting exclusively spike time stamps and/or spike waveforms, its real-time processing offers the possibility of data bandwidth and data storage reduction.

Electrochemical biosensor for Mycobacterium tuberculosis DNA detection based on gold nanotubes array electrode platform.

PubMed

Torati, Sri Ramulu; Reddy, Venu; Yoon, Seok Soo; Kim, CheolGi

2016-04-15

The template assisted electrochemical deposition technique was used for the synthesis of gold nanotubes array (AuNTsA). The morphological structure of the synthesized AuNTsA was observed by scanning electron microscopy and found that the individual nanotubes are around 1.5 μm in length with a diameter of 200 nm. Nanotubes are vertically aligned to the Au thick film, which is formed during the synthesis process of nanotubes. The electrochemical performance of the AuNTsA was compared with the bare Au electrode and found that AuNTsA has better electron transfer surface than bare Au electrode which is due to the high surface area. Hence, the AuNTsA was used as an electrode for the fabrication of DNA hybridization biosensor for detection of Mycobacterium Tuberculosis DNA. The DNA hybridization biosensor constructed by AuNTsA electrode was characterized by cyclic voltammetry technique with Fe(CN)6(3-/4-) as an electrochemical redox indicator. The selectivity of the fabricated biosensor was illustrated by hybridization with complementary DNA and non-complementary DNA with probe DNA immobilized AuNTsA electrode using methylene blue as a hybridization indicator. The developed electrochemical DNA biosensor shows good linear range of complementary DNA concentration from 0.01 ng/μL to 100 ng/μL with high detection limit. Copyright © 2015 Elsevier B.V. All rights reserved.

Powder processing of hybrid titanium neural electrodes

NASA Astrophysics Data System (ADS)

Lopez, Jose Luis, Jr.

A preliminary investigation into the powder production of a novel hybrid titanium neural electrode for EEG is presented. The rheological behavior of titanium powder suspensions using sodium alginate as a dispersant are examined for optimal slip casting conditions. Electrodes were slip cast and sintered at 950°C for 1 hr, 1000°C for 1, 3, and 6 hrs, and 1050°C for 1 hr. Residual porosities from sintering are characterized using Archimedes' technique and image analysis. The pore network is gel impregnated by submerging the electrodes in electrically conductive gel and placing them in a chamber under vacuum. Gel evaporation of the impregnated electrodes is examined. Electrodes are characterized in the dry and gelled states using impedance spectrometry and compared to a standard silver- silver chloride electrode. Power spectral densities for the sensors in the dry and gelled state are also compared. Residual porosities for the sintered specimens were between 50.59% and 44.81%. Gel evaporation tests show most of the impregnated gel evaporating within 20 min of exposure to atmospheric conditions with prolonged evaporation times for electrodes with higher impregnated gel mass. Impedance measurements of the produced electrodes indicate the low impedance of the hybrid electrodes are due to the increased contact area of the porous electrode. Power spectral densities of the titanium electrode behave similar to a standard silver-silver chloride electrode. Tests suggest the powder processed hybrid titanium electrode's performance is better than current dry contact electrodes and comparable to standard gelled silver-silver chloride electrodes.

Radiofrequency electrode vibration-induced shear wave imaging for tissue modulus estimation: a simulation study.

PubMed

Bharat, Shyam; Varghese, Tomy

2010-10-01

Quasi-static electrode displacement elastography, used for in-vivo imaging of radiofrequency ablation-induced lesions in abdominal organs such as the liver and kidney, is extended in this paper to dynamic vibrational perturbations of the ablation electrode. Propagation of the resulting shear waves into adjoining regions of tissue can be tracked and the shear wave velocity used to quantify the shear (and thereby Young's) modulus of tissue. The algorithm used utilizes the time-to-peak displacement data (obtained from finite element analyses) to calculate the speed of shear wave propagation in the material. The simulation results presented illustrate the feasibility of estimating the Young's modulus of tissue and is promising for characterizing the stiffness of radiofrequency-ablated thermal lesions and surrounding normal tissue.

A new bioimpedance research device (BIRD) for measuring the electrical impedance of acupuncture meridians.

PubMed

Wong, Felix Wu Shun; Lim, Chi Eung Danforn; Smith, Warren

2010-03-01

The aim of this article is to introduce an electrical bioimpedance device that uses an old and little-known impedance measuring technique to study the impedance of the meridian and nonmeridian tissue segments. Three (3) pilot experimental studies involving both a tissue phantom (a cucumber) and 3 human subjects were performed using this BIRD-I (Bioimpedance Research Device) device. This device consists of a Fluke RCL meter, a multiplexer box, a laptop computer, and a medical-grade isolation transformer. Segment and surface sheath (or local) impedances were estimated using formulae first published in the 1930s, in an approach that differs from that of the standard four-electrode technique used in most meridian studies to date. Our study found that, when using a quasilinear four-electrode arrangement, the reference electrodes should be positioned at least 10 cm from the test electrodes to ensure that the segment (or core) impedance estimation is not affected by the proximity of the reference electrodes. A tissue phantom was used to determine the repeatability of segment (core) impedance measurement by the device. An applied frequency of 100 kHz was found to produce the best repeatability among the various frequencies tested. In another preliminary study, with a segment of the triple energizer meridian on the lower arm selected as reference segment, core resistance-based profiles around the lower arm showed three of the other five meridians to exist as local resistance minima relative to neighboring nonmeridian segments. The profiles of the 2 subjects tested were very similar, suggesting that the results are unlikely to be spurious. In electrical bioimpedance studies, it is recommended that the measuring technique and device be clearly defined and standardized to provide optimal working conditions. In our study using the BIRD I device, we defined our standard experimental conditions as a test frequency of 100 kHz and the position of the reference electrodes of at least 10 cm from the test electrodes. Our device has demonstrated potential for use in quantifying the degree of electrical interconnection between any two surface-defined test meridian or nonmeridian segments. Issues arising from use of this device and the measurement Horton and van Ravenswaay technique were also presented.

Preparation and Application of Electrodes in Capacitive Deionization (CDI): a State-of-Art Review.

PubMed

Jia, Baoping; Zhang, Wei

2016-12-01

As a promising desalination technology, capacitive deionization (CDI) have shown practicality and cost-effectiveness in brackish water treatment. Developing more efficient electrode materials is the key to improving salt removal performance. This work reviewed current progress on electrode fabrication in application of CDI. Fundamental principal (e.g. EDL theory and adsorption isotherms) and process factors (e.g. pore distribution, potential, salt type and concentration) of CDI performance were presented first. It was then followed by in-depth discussion and comparison on properties and fabrication technique of different electrodes, including carbon aerogel, activated carbon, carbon nanotubes, graphene and ordered mesoporous carbon. Finally, polyaniline as conductive polymer and its potential application as CDI electrode-enhancing materials were also discussed.

Evaluation studies on carbon supported catalysts for oxygen reduction in alkaline medium

NASA Technical Reports Server (NTRS)

Srinivasan, Vakula S.; Singer, Joseph

1986-01-01

This paper describes tests designed to predict the performance of fuel cell electrodes, as applied to an alkaline oxygen-fuel cell having specially fabricated porous-carbon electrodes with various amounts of dispersed platinum or gold as active catalysts. The tests are based on information obtained from the techniques of cyclic voltammetry and polarization. The parameters obtained from cyclic voltammetry were of limited use in predicting fuel cell performance of the cathode. On the other hand, half-cell polarization measurements offered close simulation of the oxygen electrode, although a predictor of the electrode life is still lacking. The very low polarization of the Au-10 percent Pt catalytic electrode suggests that single-phase catalysts should be considered.

Beyond the double banana: improved recognition of temporal lobe seizures in long-term EEG.

PubMed

Rosenzweig, Ivana; Fogarasi, András; Johnsen, Birger; Alving, Jørgen; Fabricius, Martin Ejler; Scherg, Michael; Neufeld, Miri Y; Pressler, Ronit; Kjaer, Troels W; van Emde Boas, Walter; Beniczky, Sándor

2014-02-01

To investigate whether extending the 10-20 array with 6 electrodes in the inferior temporal chain and constructing computed montages increases the diagnostic value of ictal EEG activity originating in the temporal lobe. In addition, the accuracy of computer-assisted spectral source analysis was investigated. Forty EEG samples were reviewed by 7 EEG experts in various montages (longitudinal and transversal bipolar, common average, source derivation, source montage, current source density, and reference-free montages) using 2 electrode arrays (10-20 and the extended one). Spectral source analysis used source montage to calculate density spectral array, defining the earliest oscillatory onset. From this, phase maps were calculated for localization. The reference standard was the decision of the multidisciplinary epilepsy surgery team on the seizure onset zone. Clinical performance was compared with the double banana (longitudinal bipolar montage, 10-20 array). Adding the inferior temporal electrode chain, computed montages (reference free, common average, and source derivation), and voltage maps significantly increased the sensitivity. Phase maps had the highest sensitivity and identified ictal activity at earlier time-point than visual inspection. There was no significant difference concerning specificity. The findings advocate for the use of these digital EEG technology-derived analysis methods in clinical practice.

Maximally reliable spatial filtering of steady state visual evoked potentials.

PubMed

Dmochowski, Jacek P; Greaves, Alex S; Norcia, Anthony M

2015-04-01

Due to their high signal-to-noise ratio (SNR) and robustness to artifacts, steady state visual evoked potentials (SSVEPs) are a popular technique for studying neural processing in the human visual system. SSVEPs are conventionally analyzed at individual electrodes or linear combinations of electrodes which maximize some variant of the SNR. Here we exploit the fundamental assumption of evoked responses--reproducibility across trials--to develop a technique that extracts a small number of high SNR, maximally reliable SSVEP components. This novel spatial filtering method operates on an array of Fourier coefficients and projects the data into a low-dimensional space in which the trial-to-trial spectral covariance is maximized. When applied to two sample data sets, the resulting technique recovers physiologically plausible components (i.e., the recovered topographies match the lead fields of the underlying sources) while drastically reducing the dimensionality of the data (i.e., more than 90% of the trial-to-trial reliability is captured in the first four components). Moreover, the proposed technique achieves a higher SNR than that of the single-best electrode or the Principal Components. We provide a freely-available MATLAB implementation of the proposed technique, herein termed "Reliable Components Analysis". Copyright © 2015 Elsevier Inc. All rights reserved.

Close-field electroporation gene delivery using the cochlear implant electrode array enhances the bionic ear.

PubMed

Pinyon, Jeremy L; Tadros, Sherif F; Froud, Kristina E; Y Wong, Ann C; Tompson, Isabella T; Crawford, Edward N; Ko, Myungseo; Morris, Renée; Klugmann, Matthias; Housley, Gary D

2014-04-23

The cochlear implant is the most successful bionic prosthesis and has transformed the lives of people with profound hearing loss. However, the performance of the "bionic ear" is still largely constrained by the neural interface itself. Current spread inherent to broad monopolar stimulation of the spiral ganglion neuron somata obviates the intrinsic tonotopic mapping of the cochlear nerve. We show in the guinea pig that neurotrophin gene therapy integrated into the cochlear implant improves its performance by stimulating spiral ganglion neurite regeneration. We used the cochlear implant electrode array for novel "close-field" electroporation to transduce mesenchymal cells lining the cochlear perilymphatic canals with a naked complementary DNA gene construct driving expression of brain-derived neurotrophic factor (BDNF) and a green fluorescent protein (GFP) reporter. The focusing of electric fields by particular cochlear implant electrode configurations led to surprisingly efficient gene delivery to adjacent mesenchymal cells. The resulting BDNF expression stimulated regeneration of spiral ganglion neurites, which had atrophied 2 weeks after ototoxic treatment, in a bilateral sensorineural deafness model. In this model, delivery of a control GFP-only vector failed to restore neuron structure, with atrophied neurons indistinguishable from unimplanted cochleae. With BDNF therapy, the regenerated spiral ganglion neurites extended close to the cochlear implant electrodes, with localized ectopic branching. This neural remodeling enabled bipolar stimulation via the cochlear implant array, with low stimulus thresholds and expanded dynamic range of the cochlear nerve, determined via electrically evoked auditory brainstem responses. This development may broadly improve neural interfaces and extend molecular medicine applications.

A Comparative evaluation of Graphene oxide based materials for Electrochemical non-enzymatic sensing of Curcumin

NASA Astrophysics Data System (ADS)

Dey, Nibedita; Devasena, T.; Sivalingam, Tamilarasu

2018-02-01

This work reports a comparative study on the development of a sensitive voltammetric method for the assay of diferuloylmethane which is fabricated using cost-effective sensing material graphene oxide (GO modified electrode) and reduced graphene oxide (rGO modified electrode) modified on glassy carbon electrode respectively. The prepared materials were characterized using SEM, XRD, FTIR, and Raman techniques to understand the formation. Between the both modified electrodes, rGO modified electrode demonstrated a lower limit detection of 0.9 pM and good signal quality. But, the better linear dynamic range for detection was found to be 1 nm to 100 nM for GO and 0.1 nM to 10 nM for rGO modified electrodes respectively. The repeatability is checked for seven cycles and interference studies were also performed for checking the sensors’ selectivity to curcumin. rGO modified electrode and GO modified electrode both shows specific signals for Diferuloylmethane under conditions similar to physiology. But, with better properties over GO modified electrode, rGO modified electrode is suggested a better candidate for real-time usability in sensing. The detection limit reported is the lowest till date for the given plant drug using any sensing assay.

Multiple input electrode gap controller

DOEpatents

Hysinger, C.L.; Beaman, J.J.; Melgaard, D.K.; Williamson, R.L.

1999-07-27

A method and apparatus for controlling vacuum arc remelting (VAR) furnaces by estimation of electrode gap based on a plurality of secondary estimates derived from furnace outputs. The estimation is preferably performed by Kalman filter. Adaptive gain techniques may be employed, as well as detection of process anomalies such as glows. 17 figs.

Multiple input electrode gap controller

DOEpatents

Hysinger, Christopher L.; Beaman, Joseph J.; Melgaard, David K.; Williamson, Rodney L.

1999-01-01

A method and apparatus for controlling vacuum arc remelting (VAR) furnaces by estimation of electrode gap based on a plurality of secondary estimates derived from furnace outputs. The estimation is preferably performed by Kalman filter. Adaptive gain techniques may be employed, as well as detection of process anomalies such as glows.

Optical alignment of electrodes on electrical discharge machines

NASA Technical Reports Server (NTRS)

Boissevain, A. G.; Nelson, B. W.

1972-01-01

Shadowgraph system projects magnified image on screen so that alignment of small electrodes mounted on electrical discharge machines can be corrected and verified. Technique may be adapted to other machine tool equipment where physical contact cannot be made during inspection and access to tool limits conventional runout checking procedures.

AN EVALUATION OF ELECTRODE INSERTION TECHNIQUES FOR MEASUREMENT OF REDOX POTENTIAL IN ESTUARINE SEDIMENTS

EPA Science Inventory

Eh measurements by electrodes are commonly used to characterize redox status of sediments in freshwater, marine and estuarine studies, due to the relative ease and rapidity of data collection. In our studies of fine-grained estuarine seabeds, we observed that Eh values measured i...

Two-dimensional heterostructures for energy storage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gogotsi, Yury G.; Pomerantseva, Ekaterina

Two-dimensional (2D) materials provide slit-shaped ion diffusion channels that enable fast movement of lithium and other ions. However, electronic conductivity, the number of intercalation sites, and stability during extended cycling are also crucial for building high-performance energy storage devices. While individual 2D materials, such as graphene, show some of the required properties, none of them can offer all properties needed to maximize energy density, power density, and cycle life. Here we argue that stacking different 2D materials into heterostructured architectures opens an opportunity to construct electrodes that would combine the advantages of the individual building blocks while eliminating the associatedmore » shortcomings. We discuss characteristics of common 2D materials and provide examples of 2D heterostructured electrodes that showed new phenomena leading to superior electrochemical performance. As a result, we also consider electrode fabrication approaches and finally outline future steps to create 2D heterostructured electrodes that could greatly expand current energy storage technologies.« less

Facile preparation and enhanced capacitance of the polyaniline/sodium alginate nanofiber network for supercapacitors.

PubMed

Li, Yingzhi; Zhao, Xin; Xu, Qian; Zhang, Qinghua; Chen, Dajun

2011-05-17

A porous and mat-like polyaniline/sodium alginate (PANI/SA) composite with excellent electrochemical properties was polymerized in an aqueous solution with sodium sulfate as a template. Ultraviolet-visible spectra, X-ray diffraction pattern, and Fourier transform infrared spectra were employed to characterize the PANI/SA composite, indicating that the PANI/SA composite was successfully prepared. The PANI/SA nanofibers with uniform diameters from 50 to 100 nm can be observed on scanning electron microscopy. Cyclic voltammetry and galvanostatic charge/discharge tests were carried out to investigate the electrochemical properties. The PANI/SA nanostructure electrode exhibits an excellent specific capacitance as high as 2093 F g(-1), long cycle life, and fast reflect of oxidation/reduction on high current changes. The remarkable electrochemical characteristic is attributed to the nanostructured electrode materials, which generates a high electrode/electrolyte contact area and short path lengths for electronic transport and electrolyte ion. The approach is simple and can be easily extended to fabricate nanostructural composites for supercapacitor electrode materials.

Dielectric-wall linear accelerator with a high voltage fast rise time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators

DOEpatents

Caporaso, G.J.; Sampayan, S.E.; Kirbie, H.C.

1998-10-13

A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface. 12 figs.

Dielectric-wall linear accelerator with a high voltage fast rise time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators

DOEpatents

Caporaso, George J.; Sampayan, Stephen E.; Kirbie, Hugh C.

1998-01-01

A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

Polyphase alloys as rechargeable electrodes in advanced battery systems

NASA Technical Reports Server (NTRS)

Huggins, Robert A.

1987-01-01

The rechargeability of electrochemical cells is often limited by negative electrode problems. These may include loss of capacity, increased impedance, macroscopic shape change, dendrite growth, or a tendency for filamentary or whisker growth. In principle, these problems can be reduced or eliminated by the use of alloys that undergo either displacement or insertion reactions at reactant species activities less than unity, rather than pure elements. The fundamental reasons for some of these problems with elemental electrodes, as well as the basic principles involved in the different behavior of alloys, are briefly discussed. More information is now available concerning the thermodynamic and kinetic properties of a number of alloys of potential interest for use as electrodes in elevated temperature lithium battery systems. Recent results have extended these results down to ambient temperatures, indicating that some such materials may be of interest for use with new low temperature molten salt electrolytes, or with organic solvent electrolytes. The all solid mixed conductor matrix concept is also reviewed.

A coated-wire ion-selective electrode for ionic calcium measurements

NASA Technical Reports Server (NTRS)

Hines, John W.; Arnaud, Sara; Madou, Marc; Joseph, Jose; Jina, Arvind

1991-01-01

A coated-wire ion-selective electrode for measuring ionic calcium was developed, in collaboration with Teknektron Sensor Development Corporation (TSDC). This coated wire electrode sensor makes use of advanced, ion-responsive polyvinyl chloride (PVC) membrane technology, whereby the electroactive agent is incorporated into a polymeric film. The technology greatly simplifies conventional ion-selective electrode measurement technology, and is envisioned to be used for real-time measurement of physiological and environment ionic constituents, initially calcium. A primary target biomedical application is the real-time measurement of urinary and blood calcium changes during extended exposure to microgravity, during prolonged hospital or fracture immobilization, and for osteoporosis research. Potential advanced life support applications include monitoring of calcium and other ions, heavy metals, and related parameters in closed-loop water processing and management systems. This technology provides a much simplified ionic calcium measurement capability, suitable for both automated in-vitro, in-vivo, and in-situ measurement applications, which should be of great interest to the medical, scientific, chemical, and space life sciences communities.

Silicon/copper dome-patterned electrodes for high-performance hybrid supercapacitors

PubMed Central

Liu, Xuyan; Jung, Hun-Gi; Kim, Sang-Ok; Choi, Ho-Suk; Lee, Sangwha; Moon, Jun Hyuk; Lee, Joong Kee

2013-01-01

This study proposes a method for manufacturing high-performance electrode materials in which controlling the shape of the current collector and electrode material for a Li-ion capacitor (LIC). In particular, the proposed LIC manufacturing method maintains the high voltage of a cell by using a microdome-patterned electrode material, allowing for reversible reactions between the Li-ion and the active material for an extended period of time. As a result, the LICs exhibit initial capacities of approximately 42 F g−1, even at 60 A g−1. The LICs also exhibit good cycle performance up to approximately 15,000 cycles. In addition, these advancements allow for a considerably higher energy density than other existing capacitor systems. The energy density of the proposed LICs is approximately nine, two, and 1.5 times higher than those of the electrochemical double layer capacitor (EDLC), AC/LiMn2O4 hybrid capacitor, and intrinsic Si/AC LIC, respectively. PMID:24292725

Two-dimensional simulation of discharge channels in atmospheric-pressure single dielectric barrier discharges

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Jiao; Wang, Yanhui, E-mail: wangyh@dlut.edu.cn; Wang, Dezhen, E-mail: wangdez@dlut.edu.cn

A two-dimensional fluid model is developed to study the filaments (or discharge channels) in atmospheric-pressure discharge with one plate electrode covered by a dielectric layer. Under certain discharge parameters, one or more stable filaments with wide radii could be regularly arranged in the discharge space. Different from the short-lived randomly distributed microdischarges, this stable and thick filament can carry more current and have longer lifetime. Because only one electrode is covered by a dielectric layer in the simulation, the formed discharge channel extends outwards near the dielectric layer and shrinks inwards near the naked electrode, agreeing with the experimental results.more » In this paper, the evolution of channel is studied, and its behavior is like a streamer or an ionization wave, but the propagation distance is short. The discharge parameters such as voltage amplitude, electrode width, and N{sub 2} impurities content could significantly influence the number of discharge channel, which is discussed in the paper.« less

A Robust, Water-Based, Functional Binder Framework for High-Energy Lithium-Sulfur Batteries.

PubMed

Lacey, Matthew J; Österlund, Viking; Bergfelt, Andreas; Jeschull, Fabian; Bowden, Tim; Brandell, Daniel

2017-07-10

We report here a water-based functional binder framework for the lithium-sulfur battery systems, based on the general combination of a polyether and an amide-containing polymer. These binders are applied to positive electrodes optimised towards high-energy electrochemical performance based only on commercially available materials. Electrodes with up to 4 mAh cm -2 capacity and 97-98 % coulombic efficiency are achievable in electrodes with a 65 % total sulfur content and a poly(ethylene oxide):poly(vinylpyrrolidone) (PEO:PVP) binder system. Exchange of either binder component for a different polymer with similar functionality preserves the high capacity and coulombic efficiency. The improvement in coulombic efficiency from the inclusion of the coordinating amide group was also observed in electrodes where pyrrolidone moieties were covalently grafted to the carbon black, indicating the role of this functionality in facilitating polysulfide adsorption to the electrode surface. The mechanical properties of the electrodes appear not to significantly influence sulfur utilisation or coulombic efficiency in the short term but rather determine retention of these properties over extended cycling. These results demonstrate the robustness of this very straightforward approach, as well as the considerable scope for designing binder materials with targeted properties. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Design of a porous cobalt sulfide nanosheet array on Ni foam from zeolitic imidazolate frameworks as an advanced electrode for supercapacitors.

PubMed

Han, Xue; Tao, Kai; Wang, Ding; Han, Lei

2018-02-08

Porous nanosheet-structured electrode materials are very attractive for the high efficiency storage of electrochemical energy. Herein, a porous cobalt sulfide nanosheet array on Ni foam (Co 9 S 8 -NSA/NF) is successfully fabricated by a facile method, which involves the uniform growth of 2D Co-based leaf-like zeolitic imidazole frameworks (Co-ZIF-L) on Ni foam followed by subsequent sulfurization with thioacetamide (TAA). Benefiting from the unique porous nanosheet array architecture and conductive substrate, the Co 9 S 8 -NSA/NF exhibits excellent electrochemical performance with a high capacitance (1098.8 F g -1 at 0.5 A g -1 ), good rate capacity (54.6% retention at 10 A g -1 ) and long-term stability (87.4% retention over 1000 cycles), when acted as a binder-free electrode for supercapacitors. Furthermore, an assembled asymmetric supercapacitor device using the as-fabricated Co 9 S 8 -NSA as the positive electrode and activated carbon (AC) as the negative electrode also exhibits a high energy density of 20.0 W h kg -1 at a high power density of 828.5 W kg -1 . The method developed here can be extended to the construction of other structured metal (mono or mixed) sulfide electrode materials for more efficient energy storage.

Design, fabrication and performance of small, graphite electrode, multistage depressed collectors with 200-W, CW, 8- to 18-GHz traveling-wave tubes

NASA Technical Reports Server (NTRS)

Ebihara, Ben T.; Ramins, Peter

1987-01-01

Small multistage depressed collectors (MDC's) which used pyrolytic graphite, ion-beam-textured pyrolytic graphite, and isotropic graphite electrodes were designed, fabricated, and evaluated in conjuntion with 200-W, continuous wave (CW), 8- to 18-GHz traveling-wave tubes (TWT's). The design, construction, and performance of the MDC's are described. The bakeout performance of the collectors, in terms of gas evolution, was indistinguishable from that of typical production tubes with copper collectors. However, preliminary results indicate that some additional radiofrequency (RF) and dc beam processing time (and/or longer or higher temperature bakeouts) may be needed beyond that of typical copper electrode collectors. This is particularly true for pyrolytic graphite electrodes and for TWT's without appendage ion pumps. Extended testing indicated good long-term stability of the textured pyrolytic graphite and isotropic graphite electrode surfaces. The isotropic graphite in particular showed considerable promise as an MDC electrode material because of its high purity, low cost, simple construction, potential for very compact overall size, and relatively low secondary electron emission yield characteristics in the as-machined state. However, considerably more testing experience is required before definitive conclusions on its suitability for electronic countermeasure systems and space TWT's can be made.

Dispersion of nanocrystalline Fe 3O 4 within composite electrodes: Insights on battery-related electrochemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

David C. Bock; Takeuchi, Kenneth J.; Pelliccione, Christopher J.

2016-04-20

Aggregation of nanosized materials in composite lithium-ion-battery electrodes can be a significant factor influencing electrochemical behavior. In this study, aggregation was controlled in magnetite, Fe 3O 4, composite electrodes via oleic acid capping and subsequent dispersion in a carbon black matrix. A heat treatment process was effective in the removal of the oleic acid capping agent while preserving a high degree of Fe 3O 4 dispersion. Electrochemical testing showed that Fe 3O 4 dispersion is initially beneficial in delivering a higher functional capacity, in agreement with continuum model simulations. However, increased capacity fade upon extended cycling was observed for themore » dispersed Fe 3O 4 composites relative to the aggregated Fe 3O 4 composites. X-ray absorption spectroscopy measurements of electrodes post cycling indicated that the dispersed Fe 3O 4 electrodes are more oxidized in the discharged state, consistent with reduced reversibility compared with the aggregated sample. Higher charge-transfer resistance for the dispersed sample after cycling suggests increased surface-film formation on the dispersed, high-surface-area nanocrystalline Fe 3O 4 compared to the aggregated materials. Furthermore, this study provides insight into the specific effects of aggregation on electrochemistry through a multiscale view of mechanisms for magnetite composite electrodes.« less

Dispersion of Nanocrystalline Fe 3 O 4 within Composite Electrodes: Insights on Battery-Related Electrochemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bock, David C.; Pelliccione, Christopher J.; Zhang, Wei

2016-04-20

Aggregation of nanosized materials in composite lithium-ion-battery electrodes can be a significant factor influencing electrochemical behavior. In this study, aggregation was controlled in magnetite, Fe 3O 4, composite electrodes via oleic acid capping and subsequent dispersion in a carbon black matrix. A heat treatment process was effective in the removal of the oleic acid capping agent while preserving a high degree of Fe 3O 4 dispersion. Electrochemical testing showed that Fe 3O 4 dispersion is initially beneficial in delivering a higher functional capacity, in agreement with continuum model simulations. However, increased capacity fade upon extended cycling was observed for themore » dispersed Fe 3O 4 composites relative to the aggregated Fe 3O 4 composites. X-ray absorption spectroscopy measurements of electrodes post cycling indicated that the dispersed Fe 3O 4 electrodes are more oxidized in the discharged state, consistent with reduced reversibility compared with the aggregated sample. Higher charge-transfer resistance for the dispersed sample after cycling suggests increased surface-film formation on the dispersed, high-surface-area nanocrystalline Fe 3O 4 compared to the aggregated materials. This study provides insight into the specific effects of aggregation on electrochemistry through a multiscale view of mechanisms for magnetite composite electrodes.« less

Ultimate scaling of TiN/ZrO2/TiN capacitors: Leakage currents and limitations due to electrode roughness

NASA Astrophysics Data System (ADS)

Jegert, Gunther; Kersch, Alfred; Weinreich, Wenke; Lugli, Paolo

2011-01-01

In this paper, we investigate the influence of electrode roughness on the leakage current in TiN/high-κ ZrO2/TiN (TZT) thin-film capacitors which are used in dynamic random access memory cells. Based on a microscopic transport model, which is expanded to incorporate electrode roughness, we assess the ultimate scaling potential of TZT capacitors in terms of equivalent oxide thickness, film smoothness, thickness fluctuations, defect density and distribution, and conduction band offset (CBO). The model is based on three-dimensional, fully self-consistent, kinetic Monte Carlo transport simulations. Tunneling transport in the bandgap of the dielectric is treated, which includes defect-assisted transport mechanisms. Electrode roughness is described in the framework of fractal geometry. While the short-range roughness of the electrodes is found not to influence significantly the leakage current, thickness fluctuations of the dielectric have a major impact. For thinner dielectric films they cause a transformation of the dominant transport mechanism from Poole-Frenkel conduction to trap-assisted tunneling. Consequently, the sensitivity of the leakage current on electrode roughness drastically increases on downscaling. Based on the simulations, optimization of the CBO is suggested as the most viable strategy to extend the scalability of TZT capacitors over the next chip generations.

Preparation of alanine and tyrosine functionalized graphene oxide nanoflakes and their modified carbon paste electrodes for the determination of dopamine

NASA Astrophysics Data System (ADS)

Kumar, Mohan; Swamy, B. E. Kumara; Asif, M. H. Mohammed; Viswanath, C. C.

2017-03-01

Herein, established the synthesis of graphene oxide (GO) by Hummers Method with addition of KMnO4 followed by thermal heating at 80 °C. The obtained GO was further functionalized by alanine and tyrosine. The prepared GO, alanine functionalized GO nanoflakes (AGONF) and tyrosine functionalized GO nanoflakes (TGONF) were characterized by spectroscopic technique using energy-dispersive spectroscopy (EDS), quantitatively by scanning electron microscopy (SEM) and structural studies along with interlayer distance verified through X-ray diffraction technique. Afterwards, the prepared AGONF and TGONF were used as the modifier for the carbon paste electrode (CPE). The electrochemical behavior of the AGONF and TGONF modified carbon paste electrodes (MCPEs) towards dopamine (DA) in phosphate buffer solution (PBS) were examined by cyclic voltammetric (CV) technique and the obtained consequences showed good electrocatalytic activity of MCPEs by increasing the redox peak current with a lower potential difference compared to the bare CPE (BCPE). The AGONF and TGONF MCPEs were further used for the optimization studies. From the pH studies, it was found that the equal number of proton and electron transfer reaction involved in both the modified electrodes. The scan rate studies demonstrate the adsorption controlled electrode process at AGONF MCPE and diffusion controlled at TGONF MCPE. The oxidation peak current increased linearly with two concentration interval of DA at a range of 2-7 μM and 10-30 μM in presence of PBS (pH 7.4) at MCPEs and the limit of detection (LOD) were found to be 0.84 μM and 0.96 μM for first interval DA concentration range (2-7 μM) at AGONF and TGONF MCPE. The stability, repeatability and reproducibility of functionalized GO nanoflakes MCPEs at DA were studied and established excellent characteristics. The newly developed functionalized GO nanoflake electrodes were successfully tested in DA injection sample. Furthermore the functionalized GO and surfactant (Sodium Alpha Olefin Sulphonate (SAOS)) immobilized functionalized GO MCPEs were examined for simultaneous determination of DA and ascorbic acid (AA) by differential pulse voltammetric technique.

EME 192 Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mora, J.; Pascall, A.; Dudoff, J.

I spent the quarter working in Lawrence Livermore National Laboratory’s (LLNL) Materials Engineering Division. The group I have been working with (I’ve been here for two summers already) focuses on advanced manufacturing techniques such as stereolithography, electrophoretic deposition, and the printing of silicon based inks. Part of the goal of what is done in our group is to create designer materials not by altering the composition but by altering the micro-architecture. Our technology can create shapes that are not possible with traditional manufacturing techniques. This allows us to create structures that are light, yet very strong and stiff. It alsomore » allows us to create materials with property gradients. In other words, we can make structures and parts that are stronger in some locations than others. I have been working with electrophoretic deposition for the duration of my stay and have focused on advancing the technology from a thin-film technique to a true additive manufacturing paradigm. Put succinctly, electrophoretic deposition is the deposition of particles in suspension with electric fields. Particles have a potential on the surface which allows them to be driven to an electrode using an electric field. The particles then deposit onto the conductive regions of the substrate, traditionally, the entire surface. Electrophoretic deposition is powerful in that it can handle a wide variety of materials (ceramics, metals, bacteria), create material gradients in the deposits, and create layered deposition of multiple materials. A drawback of traditional electrophoretic deposition is that patterned deposits are only possible with a non-reconfigurable patterned electrode. A technique was developed at LLNL that allows for the arbitrary patterning of the electric field using photoconductive electrodes and light. This way, you can create interesting shapes and reconfigure the pattern of the deposit using the same electrode. A photoconductive electrode is made by hydrothermally growing titania nanorods onto a transparent current collector. A photomask is used to block incoming some light and only allow the desired pattern of light through. The photoconductive electrode then activates when and where the light hits, once an electric field is applied. Particles will migrate to the areas of illumation and deposit.« less

A Spark Chamber With Thin Electrodes and a Study of the Position of the Alignment Point; KAMERA S TONKIMI ELEKTRODAMI IZUCHENIE POLOZHENIYA TOCHKI SPRYAMLENIYA ISKRY

DOE Office of Scientific and Technical Information (OSTI.GOV)

Legar, F.; Nikanorov, V.I.; Peter, G.

1964-01-01

A technique for making the foil electrodes with twosided working surface for spark chambers is described. Some characteristics of spark chambers with thin electrodes are given. The variation of the distance from the negative electrode to the alignment point of a spark with the energy of the detected particles and the angie of their passage through the charaber was studied. It is shown that with the increasing initial density of the gas ionization in the chamber the Townsend coefficient a becomes greater due to the charge interaction of avalanches. (auth)

3D printed e-tongue

NASA Astrophysics Data System (ADS)

Gaál, Gabriel; da Silva, Tatiana A.; Gaál, Vladimir; Hensel, Rafael C.; Amaral, Lucas R.; Rodrigues, Varlei; Riul, Antonio

2018-05-01

Nowadays, one of the biggest issues addressed to electronic sensor fabrication is the build-up of efficient electrodes as an alternative way to the expensive, complex and multistage processes required by traditional techniques. Printed electronics arises as an interesting alternative to fulfill this task due to the simplicity and speed to stamp electrodes on various surfaces. Within this context, the Fused Deposition Modeling 3D printing is an emerging, cost-effective and alternative technology to fabricate complex structures that potentiates several fields with more creative ideas and new materials for a rapid prototyping of devices. We show here the fabrication of interdigitated electrodes using a standard home-made CoreXY 3D printer using transparent and graphene-based PLA filaments. Macro 3D printed electrodes were easily assembled within 6 minutes with outstanding reproducibility. The electrodes were also functionalized with different nanostructured thin films via dip-coating Layer-by-Layer technique to develop a 3D printed e-tongue setup. As a proof of concept, the printed e-tongue was applied to soil analysis. A control soil sample was enriched with several macro-nutrients to the plants (N, P, K, S, Mg and Ca) and the discrimination was done by electrical impedance spectroscopy of water solution of the soil samples. The data was analyzed by Principal Component Analysis and the 3D printed sensor distinguished clearly all enriched samples despite the complexity of the soil chemical composition. The 3D printed e-tongue successfully used in soil analysis encourages further investments in developing new sensory tools for precision agriculture and other fields exploiting the simplicity and flexibility offered by the 3D printing techniques.

A Novel Cell-Based Hybrid Acoustic Wave Biosensor with Impedimetric Sensing Capabilities

PubMed Central

Liu, Fei; Li, Fang; Nordin, Anis Nurashikin; Voiculescu, Ioana

2013-01-01

A novel multiparametric biosensor system based on living cells will be presented. The biosensor system includes two biosensing techniques on a single device: resonant frequency measurements and electric cell-substrate impedance sensing (ECIS). The multiparametric sensor system is based on the innovative use of the upper electrode of a quartz crystal microbalance (QCM) resonator as working electrode for the ECIS technique. The QCM acoustic wave sensor consists of a thin AT-cut quartz substrate with two gold electrodes on opposite sides. For integration of the QCM with the ECIS technique a semicircular counter electrode was fabricated near the upper electrode on the same side of the quartz crystal. Bovine aortic endothelial live cells (BAECs) were successfully cultured on this hybrid biosensor. Finite element modeling of the bulk acoustic wave resonator using COMSOL simulations was performed. Simultaneous gravimetric and impedimetric measurements performed over a period of time on the same cell culture were conducted to validate the device's sensitivity. The time necessary for the BAEC cells to attach and form a compact monolayer on the biosensor was 35∼45 minutes for 1.5 × 104 cells/cm2 BAECs; 60 minutes for 2.0 × 104 cells/cm2 BAECs; 70 minutes for 3.0 × 104 cells/cm2 BAECs; and 100 minutes for 5.0 × 104 cells/cm2 BAECs. It was demonstrated that this time is the same for both gravimetric and impedimetric measurements. This hybrid biosensor will be employed in the future for water toxicity detection. PMID:23459387

Oxygen Reduction Reaction Activity of Platinum Thin Films with Different Densities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ergul, Busra; Begum, Mahbuba; Kariuki, Nancy

Platinum thin films with different densities were grown on glassy carbon electrodes by high pressure sputtering deposition and evaluated as oxygen reduction reaction catalysts for polymer electrolyte fuel cells using cyclic voltammetry and rotating disk electrode techniques in aqueous perchloric acid electrolyte. The electrochemically active surface area, ORR mass activity (MA) and specific activity (SA) of the thin film electrodes were obtained. MA and SA were found to be higher for low-density films than for high-density film.

High voltage performance of a dc photoemission electron gun with centrifugal barrel-polished electrodes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hernandez-Garcia, C.; Bullard, D.; Hannon, F.

The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain <10 MV/m at the desired operating voltage aiming at little or no field emission once conditioned. Typical electrode surface preparation involves diamond-paste polishing by skilled personnel, requiring several weeks of effort per electrode. In this work, we describe a centrifugal barrel-polishing techniquemore » commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (~11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Here, tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.« less

High voltage performance of a dc photoemission electron gun with centrifugal barrel-polished electrodes

DOE PAGES

Hernandez-Garcia, C.; Bullard, D.; Hannon, F.; ...

2017-09-11

The design and fabrication of electrodes for direct current (dc) high voltage photoemission electron guns can significantly influence their performance, most notably in terms of maximum achievable bias voltage. Proper electrostatic design of the triple-point junction shield electrode minimizes the risk of electrical breakdown (arcing) along the insulator-cable plug interface, while the electrode shape is designed to maintain <10 MV/m at the desired operating voltage aiming at little or no field emission once conditioned. Typical electrode surface preparation involves diamond-paste polishing by skilled personnel, requiring several weeks of effort per electrode. In this work, we describe a centrifugal barrel-polishing techniquemore » commonly used for polishing the interior surface of superconducting radio frequency cavities but implemented here for the first time to polish electrodes for dc high voltage photoguns. The technique reduced polishing time from weeks to hours while providing surface roughness comparable to that obtained with diamond-paste polishing and with unprecedented consistency between different electrode samples. We present electrode design considerations and high voltage conditioning results to 360 kV (~11 MV/m), comparing barrel-polished electrode performance to that of diamond-paste polished electrodes. Here, tests were performed using a dc high voltage photogun with an inverted-geometry ceramic insulator design.« less

Performance assessments of vertically aligned carbon nanotubes multi-electrode arrays using Cath.a-differentiated (CAD) cells

NASA Astrophysics Data System (ADS)

Jeong, Du Won; Jung, Jongjin; Kim, Gook Hwa; Yang, Cheol-Soo; Kim, Ju Jin; Jung, Sang Don; Lee, Jeong-O.

2015-08-01

In this work, Cath.a-differentiated (CAD) cells were used in place of primary neuronal cells to assess the performance of vertically aligned carbon nanotubes (VACNTs) multi-electrode arrays (MEA). To fabricate high-performance MEA, VACNTs were directly grown on graphene/Pt electrodes via plasma enhanced chemical deposition technique. Here, graphene served as an intermediate layer lowering contact resistance between VACNTs and Pt electrode. In order to lower the electrode impedance and to enhance the cell adhesion, VACNTs-MEAs were treated with UV-ozone for 20 min. Impedance of VACNTs electrode at 1 kHz frequency exhibits a reasonable value (110 kΩ) for extracellular signal recording, and the signal to noise ratio the is good enough to measure low signal amplitude (15.7). Spontaneous firing events from CAD cells were successfully measured with VACNTs MEAs that were also found to be surprisingly robust toward the biological interactions.

Performance assessments of vertically aligned carbon nanotubes multi-electrode arrays using Cath.a-differentiated (CAD) cells.

PubMed

Jeong, Du Won; Jung, Jongjin; Kim, Gook Hwa; Yang, Cheol-Soo; Kim, Ju Jin; Jung, Sang Don; Lee, Jeong-O

2015-08-21

In this work, Cath.a-differentiated (CAD) cells were used in place of primary neuronal cells to assess the performance of vertically aligned carbon nanotubes (VACNTs) multi-electrode arrays (MEA). To fabricate high-performance MEA, VACNTs were directly grown on graphene/Pt electrodes via plasma enhanced chemical deposition technique. Here, graphene served as an intermediate layer lowering contact resistance between VACNTs and Pt electrode. In order to lower the electrode impedance and to enhance the cell adhesion, VACNTs-MEAs were treated with UV-ozone for 20 min. Impedance of VACNTs electrode at 1 kHz frequency exhibits a reasonable value (110 kΩ) for extracellular signal recording, and the signal to noise ratio the is good enough to measure low signal amplitude (15.7). Spontaneous firing events from CAD cells were successfully measured with VACNTs MEAs that were also found to be surprisingly robust toward the biological interactions.

Negative differential resistance observation in complex convoluted fullerene junctions

NASA Astrophysics Data System (ADS)

Kaur, Milanpreet; Sawhney, Ravinder Singh; Engles, Derick

2018-04-01

In this work, we simulated the smallest fullerene molecule, C20 in a two-probe device model with gold electrodes. The gold electrodes comprised of (011) miller planes were carved to construct the novel geometry based four unique shapes, which were strung to fullerene molecules through mechanically controlled break junction techniques. The organized devices were later scrutinized using non-equilibrium Green's function based on the density functional theory to calculate their molecular orbitals, energy levels, charge transfers, and electrical parameters. After intense scrutiny, we concluded that five-edged and six-edged devices have the lowest and highest current-conductance values, which result from their electrode-dominating and electrode-subsidiary effects, respectively. However, an interesting observation was that the three-edged and four-edged electrodes functioned as semi-metallic in nature, allowing the C20 molecule to demonstrate its performance with the complementary effect of these electrodes in the electron conduction process of a two-probe device.

Titanyl phthalocyanine ambipolar thin film transistors making use of carbon nanotube electrodes

NASA Astrophysics Data System (ADS)

Coppedè, Nicola; Valitova, Irina; Mahvash, Farzaneh; Tarabella, Giuseppe; Ranzieri, Paolo; Iannotta, Salvatore; Santato, Clara; Martel, Richard; Cicoira, Fabio

2014-12-01

The capability of efficiently injecting charge carriers into organic films and finely tuning their morphology and structure is crucial to improve the performance of organic thin film transistors (OTFTs). In this work, we investigate OTFTs employing carbon nanotubes (CNTs) as the source-drain electrodes and, as the organic semiconductor, thin films of titanyl phthalocyanine (TiOPc) grown by supersonic molecular beam deposition (SuMBD). While CNT electrodes have shown an unprecedented ability to improve charge injection in OTFTs, SuMBD is an effective technique to tune film morphology and structure. Varying the substrate temperature during deposition, we were able to grow both amorphous (low substrate temperature) and polycrystalline (high substrate temperature) films of TiOPc. Regardless of the film morphology and structure, CNT electrodes led to superior charge injection and transport performance with respect to benchmark Au electrodes. Vacuum annealing of polycrystalline TiOPc films with CNT electrodes yielded ambipolar OTFTs.

Structural and thermal response of 30 cm diameter ion thruster optics

NASA Technical Reports Server (NTRS)

Macrae, G. S.; Zavesky, R. J.; Gooder, S. T.

1989-01-01

Tabular and graphical data are presented which are intended for use in calibrating and validating structural and thermal models of ion thruster optics. A 30 cm diameter, two electrode, mercury ion thruster was operated using two different electrode assembly designs. With no beam extraction, the transient and steady state temperature profiles and center electrode gaps were measured for three discharge powers. The data showed that the electrode mount design had little effect on the temperatures, but significantly impacted the motion of the electrode center. Equilibrium electrode gaps increased with one design and decreased with the other. Equilibrium displacements in excess of 0.5 mm and gap changes of 0.08 mm were measured at 450 W discharge power. Variations in equilibrium gaps were also found among assemblies of the same design. The presented data illustrate the necessity for high fidelity ion optics models and development of experimental techniques to allow their validation.

Pencil Graphite Electrodes: A Versatile Tool in Electroanalysis

PubMed Central

2017-01-01

Due to their electrochemical and economical characteristics, pencil graphite electrodes (PGEs) gained in recent years a large applicability to the analysis of various types of inorganic and organic compounds from very different matrices. The electrode material of this type of working electrodes is constituted by the well-known and easy commercially available graphite pencil leads. Thus, PGEs are cheap and user-friendly and can be employed as disposable electrodes avoiding the time-consuming step of solid electrodes surface cleaning between measurements. When compared to other working electrodes PGEs present lower background currents, higher sensitivity, good reproducibility, and an adjustable electroactive surface area, permitting the analysis of low concentrations and small sample volumes without any deposition/preconcentration step. Therefore, this paper presents a detailed overview of the PGEs characteristics, designs and applications of bare, and electrochemically pretreated and chemically modified PGEs along with the corresponding performance characteristics like linear range and detection limit. Techniques used for bare or modified PGEs surface characterization are also reviewed. PMID:28255500

Ethanol oxidation on Pt single-crystal electrodes: surface-structure effects in alkaline medium.

PubMed

Busó-Rogero, Carlos; Herrero, Enrique; Feliu, Juan M

2014-07-21

Ethanol oxidation in 0.1 M NaOH on single-crystal electrodes has been studied using electrochemical and FTIR techniques. The results show that the activity order is the opposite of that found in acidic solutions. The Pt(111) electrode displays the highest currents and also the highest onset potential of all the electrodes. The onset potential for the oxidation of ethanol is linked to the adsorption of OH on the electrode surface. However, small (or even negligible) amounts of CO(ads) and carbonate are detected by FTIR, which implies that cleavage of the C-C bond is not favored in this medium. The activity of the electrodes diminishes quickly upon cycling. The diminution of the activity is proportional to the measured currents and is linked to the formation and polymerization of acetaldehyde, which adsorbs onto the electrode surface and prevents further oxidation. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Quantifying microstructural dynamics and electrochemical activity of graphite and silicon-graphite lithium ion battery anodes

NASA Astrophysics Data System (ADS)

Pietsch, Patrick; Westhoff, Daniel; Feinauer, Julian; Eller, Jens; Marone, Federica; Stampanoni, Marco; Schmidt, Volker; Wood, Vanessa

2016-09-01

Despite numerous studies presenting advances in tomographic imaging and analysis of lithium ion batteries, graphite-based anodes have received little attention. Weak X-ray attenuation of graphite and, as a result, poor contrast between graphite and the other carbon-based components in an electrode pore space renders data analysis challenging. Here we demonstrate operando tomography of weakly attenuating electrodes during electrochemical (de)lithiation. We use propagation-based phase contrast tomography to facilitate the differentiation between weakly attenuating materials and apply digital volume correlation to capture the dynamics of the electrodes during operation. After validating that we can quantify the local electrochemical activity and microstructural changes throughout graphite electrodes, we apply our technique to graphite-silicon composite electrodes. We show that microstructural changes that occur during (de)lithiation of a pure graphite electrode are of the same order of magnitude as spatial inhomogeneities within it, while strain in composite electrodes is locally pronounced and introduces significant microstructural changes.

Influence of electrode width of interdigital transducer on third-order nonlinearity of surface acoustic wave devices on 42°YX-LiTaO3 substrate

NASA Astrophysics Data System (ADS)

Nakagawa, Ryo; Hashimoto, Ken-ya

2018-07-01

In this paper, we discuss the influence of the electrode width of an interdigital transducer on the third-order nonlinearity of surface acoustic wave (SAW) devices. First, an estimation technique of third-order nonlinear signals based on the linear finite element method is proposed, and the variation of nonlinear signal level with electrode width is estimated. Then, several one-port SAW resonators with different electrode widths are fabricated, and measured nonlinear signal levels are compared with simulation. As predicted by the numerical simulation, nonlinear signal levels became large with electrode width. However, harmonics takes a minimum at a certain electrode width. This tendency disagrees with the simulation. The variation of nonlinear coefficients is evaluated by numerical fitting for the measured data using the nonlinear signal simulator proposed by the authors. As the result, it is concluded that the generation mechanism is not limited to the acoustic strain in electrodes.

Correcting electrode modelling errors in EIT on realistic 3D head models.

PubMed

Jehl, Markus; Avery, James; Malone, Emma; Holder, David; Betcke, Timo

2015-12-01

Electrical impedance tomography (EIT) is a promising medical imaging technique which could aid differentiation of haemorrhagic from ischaemic stroke in an ambulance. One challenge in EIT is the ill-posed nature of the image reconstruction, i.e., that small measurement or modelling errors can result in large image artefacts. It is therefore important that reconstruction algorithms are improved with regard to stability to modelling errors. We identify that wrongly modelled electrode positions constitute one of the biggest sources of image artefacts in head EIT. Therefore, the use of the Fréchet derivative on the electrode boundaries in a realistic three-dimensional head model is investigated, in order to reconstruct electrode movements simultaneously to conductivity changes. We show a fast implementation and analyse the performance of electrode position reconstructions in time-difference and absolute imaging for simulated and experimental voltages. Reconstructing the electrode positions and conductivities simultaneously increased the image quality significantly in the presence of electrode movement.

Electrochemical Detectors in HPLC and Ion Chromatography.

PubMed

Horvai, George; Pungor, ErnÕ

1989-01-01

Back in 1952, the renowned Polish electrochemist Wiktor Kemula introduced chromato-polarography, 1 i.e., polaro-graphic detection for liquid chromatography. This technique continued to develop slowly until the early 1970s (for a review see Reference 2) when modem high-performance liquid chromatography (HPLC) emerged. This new, highly efficient chromatographc method could only be. used with detectors ensuring low dispersion. It was not easy to modify the dropping mercury electrode cells to satisfy this requirement. However, at the same time, electroanalytical chemists, who already had much experience in using carbon-based electrodes for oxidative detection in flow analysis, put forward the idea of oxidative amperometric detection in liquid chromatography. 3,4 In this technique, solid or quasi-solid (paste) electrodes were used and this made possible the construction of miniaturized cells with just a few microliter volume.

A novel fabrication method of carbon electrodes using 3D printing and chemical modification process.

PubMed

Tian, Pan; Chen, Chaoyang; Hu, Jie; Qi, Jin; Wang, Qianghua; Chen, Jimmy Ching-Ming; Cavanaugh, John; Peng, Yinghong; Cheng, Mark Ming-Cheng

2017-11-23

Three-dimensional (3D) printing is an emerging technique in the field of biomedical engineering and electronics. This paper presents a novel biofabrication method of implantable carbon electrodes with several advantages including fast prototyping, patient-specific and miniaturization without expensive cleanroom. The method combines stereolithography in additive manufacturing and chemical modification processes to fabricate electrically conductive carbon electrodes. The stereolithography allows the structures to be 3D printed with very fine resolution and desired shapes. The resin is then chemically modified to carbon using pyrolysis to enhance electrochemical performance. The electrochemical characteristics of 3D printing carbon electrodes are assessed by cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). The specific capacitance of 3D printing carbon electrodes is much higher than the same sized platinum (Pt) electrode. In-vivo electromyography (EMG) recording, 3D printing carbon electrodes exhibit much higher signal-to-noise ratio (40.63 ± 7.73) than Pt electrodes (14.26 ± 6.83). The proposed biofabrication method is envisioned to enable 3D printing in many emerging applications in biomedical engineering and electronics.

Comparison of the shock artifacts induced by tripolar and bipolar electrical stimulation techniques.

PubMed

Wee, A S; Jiles, K; Brennan, R

2001-01-01

Tripolar and bipolar electrical stimulation procedures were performed on the upper limbs of eight subjects. The mid-forearm was stimulated electrically (tripolar or bipolar) by surface electrodes, and the induced stimulus shock artifacts were recorded simultaneously from the wrist and elbow. During tripolar stimulation, two types of stimulating configurations were utilized: with the center electrode designated as the cathode and the two outermost electrodes connected to a common anode, and vice versa. During bipolar stimulation, the center electrode served as one pole of the stimulator, and one of the two outermost electrodes of the tripolar stimulator was disconnected. The stimulus intensity was kept constant in all stimulating procedures. Artifacts were reduced significantly during tripolar compared to bipolar stimulation, if the outermost electrodes of the tripolar stimulator (which were facing the recording electrodes) were also oriented toward the recording sites during bipolar stimulation and had the same stimulus polarity. Artifacts were slightly reduced in amplitude from tripolar stimulation, if the center electrode were oriented toward the recording sites during bipolar stimulation and had the same stimulus polarity as previously used during tripolar stimulation.

Conducting Polymer 3D Microelectrodes

PubMed Central

Sasso, Luigi; Vazquez, Patricia; Vedarethinam, Indumathi; Castillo-León, Jaime; Emnéus, Jenny; Svendsen, Winnie E.

2010-01-01

Conducting polymer 3D microelectrodes have been fabricated for possible future neurological applications. A combination of micro-fabrication techniques and chemical polymerization methods has been used to create pillar electrodes in polyaniline and polypyrrole. The thin polymer films obtained showed uniformity and good adhesion to both horizontal and vertical surfaces. Electrodes in combination with metal/conducting polymer materials have been characterized by cyclic voltammetry and the presence of the conducting polymer film has shown to increase the electrochemical activity when compared with electrodes coated with only metal. An electrochemical characterization of gold/polypyrrole electrodes showed exceptional electrochemical behavior and activity. PC12 cells were finally cultured on the investigated materials as a preliminary biocompatibility assessment. These results show that the described electrodes are possibly suitable for future in-vitro neurological measurements. PMID:22163508

High power density proton exchange membrane fuel cells

NASA Technical Reports Server (NTRS)

Murphy, Oliver J.; Hitchens, G. Duncan; Manko, David J.

1993-01-01

Proton exchange membrane (PEM) fuel cells use a perfluorosulfonic acid solid polymer film as an electrolyte which simplifies water and electrolyte management. Their thin electrolyte layers give efficient systems of low weight, and their materials of construction show extremely long laboratory lifetimes. Their high reliability and their suitability for use in a microgravity environment makes them particularly attractive as a substitute for batteries in satellites utilizing high-power, high energy-density electrochemical energy storage systems. In this investigation, the Dow experimental PEM (XUS-13204.10) and unsupported high platinum loading electrodes yielded very high power densities, of the order of 2.5 W cm(exp -2). A platinum black loading of 5 mg per cm(exp 2) was found to be optimum. On extending the three-dimensional reaction zone of fuel cell electrodes by impregnating solid polymer electrolyte into the electrode structures, Nafion was found to give better performance than the Dow experimental PEM. The depth of penetration of the solid polymer electrolyte into electrode structures was 50-70 percent of the thickness of the platinum-catalyzed active layer. However, the degree of platinum utilization was only 16.6 percent and the roughness factor of a typical electrode was 274.