Development of the Los Alamos National Laboratory Cryogenic Pressure Loader

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ebey, Peter S.; Dole, James M.; Hoffer, James K.

2003-05-15

Targets for inertial fusion research and ignition at OMEGA, the National Ignition Facility, LMJ, and future facilities rely on beta-radiation-driven layering of spherical cryogenic DT ice layers contained within plastic or metal shells. Plastic shells will be permeation filled at room temperature then cooled to cryogenic temperatures before removal of the overpressure. The cryogenic pressure loader (CPL) was recently developed at Los Alamos National Laboratory as a testbed for studying the filling and layering of plastic target shells with DT. A technical description of the CPL is provided. The CPL consists of a cryostat, which contains a high-pressure permeation cell,more » and has optical access for investigating beta layering. The cryostat is housed within a tritium glovebox that contains manifolds for supplying high-pressure DT. The CPL shares some design elements with the cryogenic target handling system at the OMEGA facility to allow testing of tritium issues related to that system. The CPL has the capability to fill plastic targets by permeation to pressures up to 100 MPa and to cool them to 15 K. The CPL will accommodate a range of targets and may be modified for future experiments.« less

Numerical studies of the use of thin high-Z layers for reducing laser imprint in direct-drive inertial-fusion targets

NASA Astrophysics Data System (ADS)

Bates, Jason; Schmitt, Andrew; Karasik, Max; Obenschain, Steve

2012-10-01

Using the FAST code, we present numerical studies of the effect of thin metallic layers with high atomic number (high-Z) on the hydrodynamics of directly-driven inertial-confinement-fusion (ICF) targets. Previous experimental work on the NIKE Laser Facility at the U.S. Naval Research Laboratory demonstrated that the use of high-Z layers may be efficacious in reducing laser non-uniformities imprinted on the target during the start-up phase of the implosion. Such a reduction is highly desirable in a direct-drive ICF scenario because laser non-uniformities seed hydrodynamic instabilities that can amplify during the implosion process, prevent uniform compression and spoil high gain. One of the main objectives of the present work is to assess the utility of high-Z layers for achieving greater laser uniformity in polar-drive target designs planned for the National Ignition Facility. To address this problem, new numerical routines have recently been incorporated in the FAST code, including an improved radiation-transfer package and a three-dimensional ray-tracing algorithm. We will discuss these topics, and present initial simulation results for high-Z planar-target experiments planned on the NIKE Laser Facility later this year.

Novel Characterization of Capsule X-Ray Drive at the National Ignition Facility [Using ViewFactor Experiments to Measure Hohlraum X-Radiation Drive from the Capsule Point-of-View in Ignition Experiments on the National Ignition Facility

DOE PAGES

MacLaren, S. A.; Schneider, M. B.; Widmann, K.; ...

2014-03-13

Here, indirect drive experiments at the National Ignition Facility are designed to achieve fusion by imploding a fuel capsule with x rays from a laser-driven hohlraum. Previous experiments have been unable to determine whether a deficit in measured ablator implosion velocity relative to simulations is due to inadequate models of the hohlraum or ablator physics. ViewFactor experiments allow for the first time a direct measure of the x-ray drive from the capsule point of view. The experiments show a 15%–25% deficit relative to simulations and thus explain nearly all of the disagreement with the velocity data. In addition, the datamore » from this open geometry provide much greater constraints on a predictive model of laser-driven hohlraum performance than the nominal ignition target.« less

Hohlraum-Driven Ignition-Like Double-Shell Implosion Experiments on Omega: Analysis and Interpretation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Amendt, P; Robey, H F; Park, H-S

2003-08-22

An experimental campaign to study hohlraum-driven ignition-like double-shell target performance using the Omega laser facility has begun. These targets are intended to incorporate as many ignition-like properties of the proposed National Ignition Facility (NIF) double-shell ignition design [1,2] as possible, given the energy constraints of the Omega laser. In particular, this latest generation of Omega double-shells is nominally predicted to produce over 99% of the (clean) DD neutron yield from the compressional or stagnation phase of the implosion as required in the NIF ignition design. By contrast, previous double-shell experience on Omega [3] was restricted to cases where a significantmore » fraction of the observed neutron yield was produced during the earlier shock convergence phase where the effects of mix are deemed negligibly small. These new targets are specifically designed to have optimized fall-line behavior for mitigating the effects of pusher-fuel mix after deceleration onset and, thereby, providing maximum neutron yield from the stagnation phase. Experimental results from this recent Omega ignition-like double-shell implosion campaign show favorable agreement with two-dimensional integrated hohlraum simulation studies when enhanced (gold) hohlraum M-band (2-5 keV) radiation is included at a level consistent with observations.« less

The NDCX-II engineering design

NASA Astrophysics Data System (ADS)

Waldron, W. L.; Abraham, W. J.; Arbelaez, D.; Friedman, A.; Galvin, J. E.; Gilson, E. P.; Greenway, W. G.; Grote, D. P.; Jung, J.-Y.; Kwan, J. W.; Leitner, M.; Lidia, S. M.; Lipton, T. M.; Reginato, L. L.; Regis, M. J.; Roy, P. K.; Sharp, W. M.; Stettler, M. W.; Takakuwa, J. H.; Volmering, J.; Vytla, V. K.

2014-01-01

The Neutralized Drift Compression Experiment (NDCX-II) is a user facility located at Lawrence Berkeley National Laboratory which is uniquely designed for ion-beam-driven high energy density laboratory physics and heavy ion fusion research. Construction was completed in March 2012 and the facility is now in the commissioning phase. A significant amount of engineering was carried out in order to meet the performance parameters required for a wide range of target heating experiments while making the most cost-effective use of high-value hardware available from a decommissioned high current electron induction accelerator. The technical challenges and design of this new ion induction accelerator facility are described.

Target materials for exotic ISOL beams

NASA Astrophysics Data System (ADS)

Gottberg, A.

2016-06-01

The demand for intensity, purity, reliability and availability of short-lived isotopes far from stability is steadily high, and considerably exceeding the supply. In many cases the ISOL (Isotope Separation On-Line) method can provide beams of high intensity and purity. Limitations in terms of accessible chemical species and minimum half-life are driven mainly by chemical reactions and physical processes inside of the thick target. A wide range of materials are in use, ranging from thin metallic foils and liquids to refractory ceramics, while poly-phasic mixed uranium carbides have become the reference target material for most ISOL facilities world-wide. Target material research and development is often complex and especially important post-irradiation analyses are hindered by the high intrinsic radiotoxicity of these materials. However, recent achievements have proven that these investigations are possible if the effort of different facilities is combined, leading to the development of new material matrices that can supply new beams of unprecedented intensity and beam current stability.

Generation of ultra-high-pressure shocks by collision of a fast plasma projectile driven in the laser-induced cavity pressure acceleration scheme with a solid target

DOE Office of Scientific and Technical Information (OSTI.GOV)

Badziak, J.; Rosiński, M.; Krousky, E.

2015-03-15

A novel, efficient method of generating ultra-high-pressure shocks is proposed and investigated. In this method, the shock is generated by collision of a fast plasma projectile (a macro-particle) driven by laser-induced cavity pressure acceleration (LICPA) with a solid target placed at the LICPA accelerator channel exit. Using the measurements performed at the kilojoule PALS laser facility and two-dimensional hydrodynamic simulations, it is shown that the shock pressure ∼ Gbar can be produced with this method at the laser driver energy of only a few hundred joules, by an order of magnitude lower than the energy needed for production of suchmore » pressure with other laser-based methods known so far.« less

A 1-D Study of the Ignition Space for Magnetic Indirect (X-ray) Drive Targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cobble, James Allen; Sinars, Daniel Brian

The ICF program today is investigating three approaches to achieving multi-MJ fusion yields and ignition: (1) laser indirect (x-ray) drive on the National Ignition Facility (NIF), (2) laser direct drive (primarily on the Omega laser facility at the University of Rochester), and (3) magnetic direct drive on the Z pulsed power facility. In this white paper we briefly consider a fourth approach, magnetic indirect drive, in which pulsedpower- driven x-ray sources are used in place of laser driven sources. We first look at some of the x-ray sources studied on Z prior to 2007 before the pulsed power ICF programmore » shifted to magnetic direct drive. We then show results from a series of 1D Helios calculations of double-shell capsules that suggest that these sources, scaled to higher temperatures, could be a promising path to achieving multi-MJ fusion yields and ignition. We advocate here that more detailed design calculations with widely accepted 2D/3D ICF codes should be conducted for a better assessment of the prospects.« less

Suppression of laser nonuniformity imprinting using a thin high-z coating.

PubMed

Karasik, Max; Weaver, J L; Aglitskiy, Y; Oh, J; Obenschain, S P

2015-02-27

Imprinting of laser nonuniformity is a limiting factor in direct-drive inertial confinement fusion experiments, particularly when available laser smoothing is limited. A thin (∼400  Å) high-Z metal coating is found to substantially suppress laser imprint for planar targets driven by pulse shapes and intensities relevant to implosions on the National Ignition Facility while retaining low adiabat target acceleration. A hybrid of indirect and direct drive, this configuration results in initial ablation by x rays from the heated high-Z layer, creating a large standoff for perturbation smoothing.

Double shell planar experiments on OMEGA

NASA Astrophysics Data System (ADS)

Dodd, E. S.; Merritt, E. C.; Palaniyappan, S.; Montgomery, D. S.; Daughton, W. S.; Schmidt, D. W.; Cardenas, T.; Wilson, D. C.; Loomis, E. N.; Batha, S. H.; Ping, Y.; Smalyuk, V. A.; Amendt, P. A.

2017-10-01

The double shell project is aimed at fielding neutron-producing capsules at the National Ignition Facility (NIF), in which an outer low-Z ablator collides with an inner high-Z shell to compress the fuel. However, understanding these targets experimentally can be challenging when compared with conventional single shell targets. Halfraum-driven planar targets at OMEGA are being used to study physics issues important to double shell implosions outside of a convergent geometry. Both VISAR and radiography through a tube have advantages over imaging through the hohlraum and double-shell capsule at NIF. A number physics issues are being studied with this platform that include 1-d and higher dimensional effects such as defect-driven hydrodynamic instabilities from engineering features. Additionally, the use of novel materials with controlled density gradients require study in easily diagnosed 1-d systems. This work ultimately feeds back into the NIF capsule platform through manufacturing tolerances set using data from OMEGA. Supported under the US DOE by the LANS, LLC under contract DE-AC52-06NA25396. LA-UR-17-25386.

Compact hohlraum configuration with parallel planar-wire-array x-ray sources at the 1.7-MA Zebra generator.

PubMed

Kantsyrev, V L; Chuvatin, A S; Rudakov, L I; Velikovich, A L; Shrestha, I K; Esaulov, A A; Safronova, A S; Shlyaptseva, V V; Osborne, G C; Astanovitsky, A L; Weller, M E; Stafford, A; Schultz, K A; Cooper, M C; Cuneo, M E; Jones, B; Vesey, R A

2014-12-01

A compact Z-pinch x-ray hohlraum design with parallel-driven x-ray sources is experimentally demonstrated in a configuration with a central target and tailored shine shields at a 1.7-MA Zebra generator. Driving in parallel two magnetically decoupled compact double-planar-wire Z pinches has demonstrated the generation of synchronized x-ray bursts that correlated well in time with x-ray emission from a central reemission target. Good agreement between simulated and measured hohlraum radiation temperature of the central target is shown. The advantages of compact hohlraum design applications for multi-MA facilities are discussed.

The first target experiments on the National Ignition Facility

NASA Astrophysics Data System (ADS)

Landen, O. L.; Glenzer, S. H.; Froula, D. H.; Dewald, E. L.; Suter, L. J.; Schneider, M. B.; Hinkel, D. E.; Fernandez, J. C.; Kline, J. L.; Goldman, S. R.; Braun, D. G.; Celliers, P. M.; Moon, S. J.; Robey, H. S.; Lanier, N. E.; Glendinning, S. G.; Blue, B. E.; Wilde, B. H.; Jones, O. S.; Schein, J.; Divol, L.; Kalantar, D. H.; Campbell, K. M.; Holder, J. P.; McDonald, J. W.; Niemann, C.; MacKinnon, A. J.; Collins, G. W.; Bradley, D. K.; Eggert, J. H.; Hicks, D. G.; Gregori, G.; Kirkwood, R. K.; Young, B. K.; Foster, J. M.; Hansen, J. F.; Perry, T. S.; Munro, D. H.; Baldis, H. A.; Grim, G. P.; Heeter, R. F.; Hegelich, M. B.; Montgomery, D. S.; Rochau, G. A.; Olson, R. E.; Turner, R. E.; Workman, J. B.; Berger, R. L.; Cohen, B. I.; Kruer, W. L.; Langdon, A. B.; Langer, S. H.; Meezan, N. B.; Rose, H. A.; Still, C. H.; Williams, E. A.; Dodd, E. S.; Edwards, M. J.; Monteil, M.-C.; Stevenson, R. M.; Thomas, B. R.; Coker, R. F.; Magelssen, G. R.; Rosen, P. A.; Stry, P. E.; Woods, D.; Weber, S. V.; Young, P. E.; Alvarez, S.; Armstrong, G.; Bahr, R.; Bourgade, J.-L.; Bower, D.; Celeste, J.; Chrisp, M.; Compton, S.; Cox, J.; Constantin, C.; Costa, R.; Duncan, J.; Ellis, A.; Emig, J.; Gautier, C.; Greenwood, A.; Griffith, R.; Holdner, F.; Holtmeier, G.; Hargrove, D.; James, T.; Kamperschroer, J.; Kimbrough, J.; Landon, M.; Lee, F. D.; Malone, R.; May, M.; Montelongo, S.; Moody, J.; Ng, E.; Nikitin, A.; Pellinen, D.; Piston, K.; Poole, M.; Rekow, V.; Rhodes, M.; Shepherd, R.; Shiromizu, S.; Voloshin, D.; Warrick, A.; Watts, P.; Weber, F.; Young, P.; Arnold, P.; Atherton, L.; Bardsley, G.; Bonanno, R.; Borger, T.; Bowers, M.; Bryant, R.; Buckman, S.; Burkhart, S.; Cooper, F.; Dixit, S. N.; Erbert, G.; Eder, D. C.; Ehrlich, R. E.; Felker, B.; Fornes, J.; Frieders, G.; Gardner, S.; Gates, C.; Gonzalez, M.; Grace, S.; Hall, T.; Haynam, C. A.; Heestand, G.; Henesian, M. A.; Hermann, M.; Hermes, G.; Huber, S.; Jancaitis, K.; Johnson, S.; Kauffman, B.; Kelleher, T.; Kohut, T.; Koniges, A. E.; Labiak, T.; Latray, D.; Lee, A.; Lund, D.; Mahavandi, S.; Manes, K. R.; Marshall, C.; McBride, J.; McCarville, T.; McGrew, L.; Menapace, J.; Mertens, E.; Murray, J.; Neumann, J.; Newton, M.; Opsahl, P.; Padilla, E.; Parham, T.; Parrish, G.; Petty, C.; Polk, M.; Powell, C.; Reinbachs, I.; Rinnert, R.; Riordan, B.; Ross, G.; Robert, V.; Tobin, M.; Sailors, S.; Saunders, R.; Schmitt, M.; Shaw, M.; Singh, M.; Spaeth, M.; Stephens, A.; Tietbohl, G.; Tuck, J.; van Wonterghem, B. M.; Vidal, R.; Wegner, P. J.; Whitman, P.; Williams, K.; Winward, K.; Work, K.; Wallace, R.; Nobile, A.; Bono, M.; Day, B.; Elliott, J.; Hatch, D.; Louis, H.; Manzenares, R.; O'Brien, D.; Papin, P.; Pierce, T.; Rivera, G.; Ruppe, J.; Sandoval, D.; Schmidt, D.; Valdez, L.; Zapata, K.; MacGowan, B. J.; Eckart, M. J.; Hsing, W. W.; Springer, P. T.; Hammel, B. A.; Moses, E. I.; Miller, G. H.

2007-08-01

A first set of shock timing, laser-plasma interaction, hohlraum energetics and hydrodynamic experiments have been performed using the first 4 beams of the National Ignition Facility (NIF), in support of indirect drive Inertial Confinement Fusion (ICF) and High Energy Density Physics (HEDP). In parallel, a robust set of optical and X-ray spectrometers, interferometer, calorimeters and imagers have been activated. The experiments have been undertaken with laser powers and energies of up to 8 TW and 17 kJ in flattop and shaped 1 9 ns pulses focused with various beam smoothing options. The experiments have demonstrated excellent agreement between measured and predicted laser-target coupling in foils and hohlraums, even when extended to a longer pulse regime unattainable at previous laser facilities, validated the predicted effects of beam smoothing on intense laser beam propagation in long scale-length plasmas and begun to test 3D codes by extending the study of laser driven hydrodynamic jets to 3D geometries.

Ion Source Development at the SNS

NASA Astrophysics Data System (ADS)

Welton, R. F.; Stockli, M. P.; Murray, S. N.; Carr, J.; Carmichael, J.; Goulding, R. H.; Baity, F. W.

2007-08-01

The US Spallation Neutron Source (SNS) has recently begun producing neutrons and is currently on track to becoming a world-leading facility for material science based on neutron scattering. The facility is comprised of an H- ion source, a linear accelerator, an accumulator ring, a liquid-Hg target and a suite of neutron scattering instruments. Over the next several years the average H- current from the ion source will be increased in order to meet the baseline facility requirement of providing 1.4 MW of beam-power to the target and the SNS power upgrade power requirement of 2+ MW on target. Meeting the latter goal will require H- currents of 70-100 mA with an RMS emittance of 0.20-0.35 π mm mrad and a ˜7% duty-factor. To date, the RF-driven-multicusp SNS ion source has only been able to demonstrate sustained operation at 33 mA of beam current at a ˜7% duty-factor. This report details our efforts to develop variations of the current ion source which can meet these requirements. Designs and experimental results are presented for helicon plasma drivers, high-power external antennas, glow-discharge plasma guns and advanced Cs systems.

Energy deposition and neutron flux study in a gravity-driven dense granular target (DGT) with GEANT4 toolkit

NASA Astrophysics Data System (ADS)

Zhao, Qiang; Cui, Wenjuan; He, Zhiyong; Zhang, Xueying; Ma, Wenjing

2018-07-01

China initiative Accelerator Driven System (CiADS) has been approved as a strategic plan to build an ADS demonstration facility in the next few years. It proposed a new concept for a high-power spallation target: the gravity-driven dense granular target (DGT). As the same with a monolithic target (MT), both solid and liquid target, energy deposition and neutron flux are two critical issues. In this paper, we focus on these two issues and long for some valuable results for the project. Unlike a solid target, the internal geometry structure of a DGT is very complicated. To be as much as closer with the reality, we designed an algorithm and firstly packed the grains randomly in a cylindrical container in GEANT4 software. The packing result was in great agreement with the experimentally measured results. It shows that the algorithm is practicable. In the next step, all the simulations about energy deposition and neutron flux of a DGT were performed with the GEANT4 codes, and the results were compared with the data of a MT. Compared to a MT, a DGT has inarguable advantages in both terms of energy deposition and neutron flux. In addition, the simulations with different radius of grains were also performed. Finally, we found that both the energy deposition and neutron flux are nearly irrelevant to the radius of the grains in the range of 0.5 mm-5 mm when the packing density is same by analyzing the results meticulously.

Ultrafast probing of magnetic field growth inside a laser-driven solenoid

NASA Astrophysics Data System (ADS)

Goyon, C.; Pollock, B. B.; Turnbull, D. P.; Hazi, A.; Divol, L.; Farmer, W. A.; Haberberger, D.; Javedani, J.; Johnson, A. J.; Kemp, A.; Levy, M. C.; Grant Logan, B.; Mariscal, D. A.; Landen, O. L.; Patankar, S.; Ross, J. S.; Rubenchik, A. M.; Swadling, G. F.; Williams, G. J.; Fujioka, S.; Law, K. F. F.; Moody, J. D.

2017-03-01

We report on the detection of the time-dependent B-field amplitude and topology in a laser-driven solenoid. The B-field inferred from both proton deflectometry and Faraday rotation ramps up linearly in time reaching 210 ± 35 T at the end of a 0.75-ns laser drive with 1 TW at 351 nm. A lumped-element circuit model agrees well with the linear rise and suggests that the blow-off plasma screens the field between the plates leading to an increased plate capacitance that converts the laser-generated hot-electron current into a voltage source that drives current through the solenoid. ALE3D modeling shows that target disassembly and current diffusion may limit the B-field increase for longer laser drive. Scaling of these experimental results to a National Ignition Facility (NIF) hohlraum target size (˜0.2 cm3 ) indicates that it is possible to achieve several tens of Tesla.

Ultrafast probing of magnetic field growth inside a laser-driven solenoid.

PubMed

Goyon, C; Pollock, B B; Turnbull, D P; Hazi, A; Divol, L; Farmer, W A; Haberberger, D; Javedani, J; Johnson, A J; Kemp, A; Levy, M C; Grant Logan, B; Mariscal, D A; Landen, O L; Patankar, S; Ross, J S; Rubenchik, A M; Swadling, G F; Williams, G J; Fujioka, S; Law, K F F; Moody, J D

2017-03-01

We report on the detection of the time-dependent B-field amplitude and topology in a laser-driven solenoid. The B-field inferred from both proton deflectometry and Faraday rotation ramps up linearly in time reaching 210 ± 35 T at the end of a 0.75-ns laser drive with 1 TW at 351 nm. A lumped-element circuit model agrees well with the linear rise and suggests that the blow-off plasma screens the field between the plates leading to an increased plate capacitance that converts the laser-generated hot-electron current into a voltage source that drives current through the solenoid. ALE3D modeling shows that target disassembly and current diffusion may limit the B-field increase for longer laser drive. Scaling of these experimental results to a National Ignition Facility (NIF) hohlraum target size (∼0.2cm^{3}) indicates that it is possible to achieve several tens of Tesla.

Simulated performance of the optical Thomson scattering diagnostic designed for the National Ignition Facility.

PubMed

Ross, J S; Datte, P; Divol, L; Galbraith, J; Froula, D H; Glenzer, S H; Hatch, B; Katz, J; Kilkenny, J; Landen, O; Manuel, A M; Molander, W; Montgomery, D S; Moody, J D; Swadling, G; Weaver, J

2016-11-01

An optical Thomson scattering diagnostic has been designed for the National Ignition Facility to characterize under-dense plasmas. We report on the design of the system and the expected performance for different target configurations. The diagnostic is designed to spatially and temporally resolve the Thomson scattered light from laser driven targets. The diagnostic will collect scattered light from a 50 × 50 × 200 μm volume. The optical design allows operation with different probe laser wavelengths. A deep-UV probe beam (λ 0 = 210 nm) will be used to Thomson scatter from electron plasma densities of ∼5 × 10 20 cm -3 while a 3ω probe will be used for plasma densities of ∼1 × 10 19 cm -3 . The diagnostic package contains two spectrometers: the first to resolve Thomson scattering from ion acoustic wave fluctuations and the second to resolve scattering from electron plasma wave fluctuations. Expected signal levels relative to background will be presented for typical target configurations (hohlraums and a planar foil).

SECOND TARGET STATION MODERATOR PERFORMANCE WITH A ROTATING TARGET

DOE Office of Scientific and Technical Information (OSTI.GOV)

Remec, Igor; Gallmeier, Franz X; Rennich, Mark J

2016-01-01

Oak Ridge National Laboratory manages and operates the Spallation Neutron Source and the High Flux Isotope Reactor, two of the world's most advanced neutron scattering facilities. Both facilities are funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Science, and are available to researchers from all over the world. Delivering cutting edge science requires continuous improvements and development of the facilities and instruments. The SNS was designed from the outset to accommodate an additional target station, or Second Target Station (STS), and an upgraded accelerator feeding proton beams to STS and the existing First Targetmore » Station (FTS). Upgrade of the accelerator and the design and construction of STS are being proposed. The presently considered STS configuration is driven with short (<1 s) proton pulses at 10 Hz repetition rate and 467 kW proton beam power, and is optimized for high intensity and high resolution long wavelength neutron applications. STS will allow installation of 22 beamlines and will expand and complement the current national neutron scattering capabilities. In 2015 the STS studies were performed for a compact tungsten target; first a stationary tungsten plate target was analyzed to considerable details and then dropped in favor of a rotating target. For both target options the proton beam footprint as small as acceptable from mechanical and heat removal aspects is required to arrive at a compact-volume neutron production zone in the target, which is essential for tight coupling of target and moderators and for achieving high-intensity peak neutron fluxes. This paper will present recent STS work with the emphasis on neutronics and moderator performance.« less

Shock-induced perturbation evolution in planar laser targets

NASA Astrophysics Data System (ADS)

Aglitskiy, Y.; Karasik, M.; Velikovich, A. L.; Serlin, V.; Weaver, J. L.; Kessler, T. J.; Schmitt, A. J.; Obenschain, S. P.; Metzler, N.; Oh, J.

2013-10-01

Experimental studies of hydrodynamic perturbation evolution triggered by a laser-driven shock wave in a planar target done on the KrF Nike laser facility are reported. The targets were made of solid plastic and/or plastic foam with single mode sinusoidal perturbation on the front or back surface or plastic/foam interface. Two specific cases are discussed. When a planar solid plastic target rippled at the front side is irradiated with a 350 ps long laser pulse, ablative Richtmyer-Meshkov (RM) oscillation of its areal mass modulation amplitude is detected while the laser is on, followed by observed strong oscillations of the areal mass in the unsupported shock flow after the laser pulse ends. When the target is rippled at the rear side, the nature of the perturbation evolution after the shock breakout is determined by the strength of the laser-driven shock wave. At pressure below 1 Mbar shock interaction with rear-surface ripples produces planar collimated jets manifesting the development of a classical RM instability in a weakly compressible shocked fluid. At shock pressure ~ 8 Mbar sufficient for vaporizing the shocked target material we observed instead the strong areal mass oscillations characteristic of a rippled centered rarefaction wave. Work supported by US DOE, Defense Programs.

Laser-driven proton acceleration with nanostructured targets

NASA Astrophysics Data System (ADS)

Vallières, Simon; Morabito, Antonia; Veltri, Simona; Scisciò, Massimiliano; Barberio, Marianna; Antici, Patrizio

2017-05-01

Laser-driven particle acceleration has become a growing field of research, in particular for its numerous interesting applications. One of the most common proton acceleration mechanism that is obtained on typically available multi-hundred TW laser systems is based on the irradiation of thin solid metal foils by the intense laser, generating the proton acceleration on its rear target surface. The efficiency of this acceleration scheme strongly depends on the type of target used. Improving the acceleration mechanism, i.e. enhancing parameters such as maximum proton energy, laminarity, efficiency, monocromaticy, and number of accelerated particles, is heavily depending on the laser-to-target absorption, where obviously cheap and easy to implement targets are best candidates. In this work, we present nanostructured targets that are able to increase the absorption of light compared to what can be achieved with a classical solid (non-nanostructured) target and are produced with a method that is much simpler and cheaper than conventional lithographic processes. Several layers of gold nanoparticles were deposited on solid targets (aluminum, Mylar and multiwalled carbon nanotube buckypaper) and allow for an increased photon absorption. This ultimately permits to increase the laser-to-particle energy transfer, and thus to enhance the yield in proton production. Experimental characterization results on the nanostructured films are presented (UV-Vis spectroscopy and AFM), along with preliminary experimental proton spectra obtained at the JLF-TITAN laser facility at LLNL.

Radiation Challenges for Electronics in the Vision for Space Exploration

NASA Technical Reports Server (NTRS)

LaBel, Kenneth A.

2006-01-01

The slides present a brief snapshot discussing electronics and exploration-related challenges. Radiation effects have been the prime target, however, electronic parts reliability issues must also be considered. Modern electronics are designed with a 3-5 year lifetime. Upscreening does not improve reliability, merely determines inherent levels. Testing costs are driven by device complexity; they increase tester complexity, beam requirements, and facility choices. Commercial devices may improve performance, but are not cost panaceas. There is need for a more cost-effective access to high energy heavy ion facilities such as NSCL and NSRL. Costs for capable test equipment can run more than $1M for full testing.

Shock-driven Rayleigh-Taylor / Richtmyer-Meshkov 2D multimode ripple evolution before and after re-shock

NASA Astrophysics Data System (ADS)

Nagel, Sabrina; Huntington, Channing; Bender, Jason; Raman, Kumar; Baumann, Ted; MacLaren, Stephan; Prisbrey, Shon; Zhou, Ye

2017-10-01

Laser-driven hydrodynamic experiments allow for the precise control over several important experimental parameters, including the timing of the laser irradiation delivered and the initial conditions of the laser-driven target. Our experimental platform at the National Ignition Facility enables the investigation of the physics of instability growth after the passage of a second shock (``reshock''). This is done by varying the laser to change the strength and timing of the secondary shock. Here we present x-ray images capturing the rapid post-reshock instability growth for a set of reshock strengths. The radiation hydrodynamics simulations used to design these experiments are also introduced. This work was performed under the auspices of the Lawrence Livermore National Security, LLC, (LLNS) under Contract No. DE-AC52-07NA27344. LLNL-ABS-734509.

Solid hydrogen target for laser driven proton acceleration

NASA Astrophysics Data System (ADS)

Perin, J. P.; Garcia, S.; Chatain, D.; Margarone, D.

2015-05-01

The development of very high power lasers opens up new horizons in various fields, such as laser plasma acceleration in Physics and innovative approaches for proton therapy in Medicine. Laser driven proton acceleration is commonly based on the so-called Target Normal Sheath Acceleration (TNSA) mechanisms: a high power laser is focused onto a solid target (thin metallic or plastic foil) and interact with matter at very high intensity, thus generating a plasma; as a consequence "hot" electrons are produced and move into the forward direction through the target. Protons are generated at the target rear side, electrons try to escape from the target and an ultra-strong quasi-electrostatic field (~1TV/m) is generated. Such a field can accelerate protons with a wide energy spectrum (1-200 MeV) in a few tens of micrometers. The proton beam characteristics depend on the laser parameters and on the target geometry and nature. This technique has been validated experimentally in several high power laser facilities by accelerating protons coming from hydrogenated contaminant (mainly water) at the rear of metallic target, however, several research groups are investigating the possibility to perform experiments by using "pure" hydrogen targets. In this context, the low temperature laboratory at CEA-Grenoble has developed a cryostat able to continuously produce a thin hydrogen ribbon (from 40 to 100 microns thick). A new extrusion concept, without any moving part has been carried out, using only the thermodynamic properties of the fluid. First results and perspectives are presented in this paper.

Radiological Protection and Nuclear Engineering Studies in Multi-MW Target Systems

NASA Astrophysics Data System (ADS)

Luis, Raul Fernandes

Several innovative projects involving nuclear technology have emerged around the world in recent years, for applications such as spallation neutron sources, accelerator-driven systems for the transmutation of nuclear waste and radioactive ion beam (RIB) production. While the available neutron Wuxes from nuclear reactors did not increase substantially in intensity over the past three decades, the intensities of neutron sources produced in spallation targets have increased steadily, and should continue to do so during the 21st century. Innovative projects like ESS, MYRRHA and EURISOL lie at the forefront of the ongoing pursuit for increasingly bright neutron sources; driven by proton beams with energies up to 2 GeV and intensities up to several mA, the construction of their proposed facilities involves complex Nuclear Technology and Radiological Protection design studies executed by multidisciplinary teams of scientists and engineers from diUerent branches of Science. The intense neutron Wuxes foreseen for those facilities can be used in several scientiVc research Velds, such as Nuclear Physics and Astrophysics, Medicine and Materials Science. In this work, the target systems of two facilitites for the production of RIBs using the Isotope Separation On-Line (ISOL) method were studied in detail: ISOLDE, operating at CERN since 1967, and EURISOL, the next-generation ISOL facility to be built in Europe. For the EURISOL multi-MW target station, a detailed study of Radiological Protection was carried out using the Monte Carlo code FLUKA. Simulations were done to assess neutron Wuences, Vssion rates, ambient dose equivalent rates during operation and after shutdown and the production of radioactive nuclei in the targets and surrounding materials. DiUerent materials were discussed for diUerent components of the target system, aiming at improving its neutronics performance while keeping the residual activities resulting from material activation as low as possible. The second goal of this work was to perform an optimisation study for the ISOLDE neutron converter and Vssion target system. The target system was simulated using FLUKA and the cross section codes TALYS and ABRABLA, with the objective of maximising the performance of the system for the production of pure beams of neutron-rich isotopes, suppressing the contaminations by undesired neutron-deficient isobars. Two alternative target systems were proposed in the optimisation studies; the simplest of the two, with some modiVcations, was built as a prototype and tested at ISOLDE. The experimental results clearly show that it is possible, with simple changes in the layouts of the target systems, to produce purer beams of neutron-rich isotopes around the doubly magic nuclei 78Ni and 132Sn. A study of Radiological Protection was also performed, comparing the performances of the prototype target system and the standard ISOLDE target system. None

High-Flux Neutron Generator Facility for Geochronology and Nuclear Physics Research

NASA Astrophysics Data System (ADS)

Waltz, Cory; HFNG Collaboration

2015-04-01

A facility based on a next-generation, high-flux D-D neutron generator (HFNG) is being commissioned at UC Berkeley. The generator is designed to produce monoenergetic 2.45 MeV neutrons at outputs exceeding 1011 n/s. The HFNG is designed around two RF-driven multi-cusp ion sources that straddle a titanium-coated copper target. D + ions, accelerated up to 150 keV from the ion sources, self-load the target and drive neutron generation through the d(d,n)3 He fusion reaction. A well-integrated cooling system is capable of handling beam power reaching 120 kW impinging on the target. The unique design of the HFNG target permits experimental samples to be placed inside the target volume, allowing the samples to receive the highest neutron flux (1011 cm-2 s-1) possible from the generator. In addition, external beams of neutrons will be available simultaneously, ranging from thermal to 2.45 MeV. Achieving the highest neutron yields required carefully designed schemes to mitigate back-streaming of high energy electrons liberated from the cathode target by deuteron bombardment. The proposed science program is focused on pioneering advances in the 40 Ar/39 Ar dating technique for geochronology, new nuclear data measurements, basic nuclear science, and education. An end goal is to become a user facility for researchers. This work is supported by NSF Grant No. EAR-0960138, U.S. DOE LBNL Contract No. DE-AC02-05CH11231, U.S. DOE LLNL Contract No. DE-AC52-07NA27344, and UC Office of the President Award 12-LR-238745.

Shock timing experiments on the National Ignition Facility: Initial results and comparison with simulation

NASA Astrophysics Data System (ADS)

Robey, H. F.; Boehly, T. R.; Celliers, P. M.; Eggert, J. H.; Hicks, D.; Smith, R. F.; Collins, R.; Bowers, M. W.; Krauter, K. G.; Datte, P. S.; Munro, D. H.; Milovich, J. L.; Jones, O. S.; Michel, P. A.; Thomas, C. A.; Olson, R. E.; Pollaine, S.; Town, R. P. J.; Haan, S.; Callahan, D.; Clark, D.; Edwards, J.; Kline, J. L.; Dixit, S.; Schneider, M. B.; Dewald, E. L.; Widmann, K.; Moody, J. D.; Döppner, T.; Radousky, H. B.; Throop, A.; Kalantar, D.; DiNicola, P.; Nikroo, A.; Kroll, J. J.; Hamza, A. V.; Horner, J. B.; Bhandarkar, S. D.; Dzenitis, E.; Alger, E.; Giraldez, E.; Castro, C.; Moreno, K.; Haynam, C.; LaFortune, K. N.; Widmayer, C.; Shaw, M.; Jancaitis, K.; Parham, T.; Holunga, D. M.; Walters, C. F.; Haid, B.; Mapoles, E. R.; Sater, J.; Gibson, C. R.; Malsbury, T.; Fair, J.; Trummer, D.; Coffee, K. R.; Burr, B.; Berzins, L. V.; Choate, C.; Brereton, S. J.; Azevedo, S.; Chandrasekaran, H.; Eder, D. C.; Masters, N. D.; Fisher, A. C.; Sterne, P. A.; Young, B. K.; Landen, O. L.; Van Wonterghem, B. M.; MacGowan, B. J.; Atherton, J.; Lindl, J. D.; Meyerhofer, D. D.; Moses, E.

2012-04-01

Capsule implosions on the National Ignition Facility (NIF) [Lindl et al., Phys. Plasmas 11, 339 (2004)] are underway with the goal of compressing deuterium-tritium (DT) fuel to a sufficiently high areal density (ρR) to sustain a self-propagating burn wave required for fusion power gain greater than unity. These implosions are driven with a carefully tailored sequence of four shock waves that must be timed to very high precision in order to keep the DT fuel on a low adiabat. Initial experiments to measure the strength and relative timing of these shocks have been conducted on NIF in a specially designed surrogate target platform known as the keyhole target. This target geometry and the associated diagnostics are described in detail. The initial data are presented and compared with numerical simulations. As the primary goal of these experiments is to assess and minimize the adiabat in related DT implosions, a methodology is described for quantifying the adiabat from the shock velocity measurements. Results are contrasted between early experiments that exhibited very poor shock timing and subsequent experiments where a modified target geometry demonstrated significant improvement.

Computational investigation of reshock strength in hydrodynamic instability growth at the National Ignition Facility

NASA Astrophysics Data System (ADS)

Bender, Jason; Raman, Kumar; Huntington, Channing; Nagel, Sabrina; Morgan, Brandon; Prisbrey, Shon; MacLaren, Stephan

2017-10-01

Experiments at the National Ignition Facility (NIF) are studying Richtmyer-Meshkov and Rayleigh-Taylor hydrodynamic instabilities in multiply-shocked plasmas. Targets feature two different-density fluids with a multimode initial perturbation at the interface, which is struck by two X-ray-driven shock waves. Here we discuss computational hydrodynamics simulations investigating the effect of second-shock (``reshock'') strength on instability growth, and how these simulations are informing target design for the ongoing experimental campaign. A Reynolds-Averaged Navier Stokes (RANS) model was used to predict motion of the spike and bubble fronts and the mixing-layer width. In addition to reshock strength, the reshock ablator thickness and the total length of the target were varied; all three parameters were found to be important for target design, particularly for ameliorating undesirable reflected shocks. The RANS data are compared to theoretical models that predict multimode instability growth proportional to the shock-induced change in interface velocity, and to currently-available data from the NIF experiments. Work performed under the auspices of the U.S. D.O.E. by Lawrence Livermore National Laboratory under Contract No. DE-AC52-07NA27344. LLNL-ABS-734611.

The role of hot electrons in the dynamics of a laser-driven strong converging shock

DOE PAGES

Llor Aisa, E.; Ribeyre, X.; Duchateau, G.; ...

2017-11-30

Experiments on strong shock excitation in spherical plastic targets conducted at the Omega Laser Facility are interpreted with the radiation–hydrodynamics code CHIC to account for parametric instabilities excitation and hot-electron generation. The effects of hot electrons on the shock-pressure amplification and upstream preheat are analyzed. In this study, it is demonstrated that both effects contribute to an increase in shock velocity. Comparison of the measured laser reflectivity and shock flash time with numerical simulations make it possible to reconstitute the time history of the ablation and shock pressures. Finally, consequences of this analysis for the shock-ignition target design are discussed.

The role of hot electrons in the dynamics of a laser-driven strong converging shock

DOE Office of Scientific and Technical Information (OSTI.GOV)

Llor Aisa, E.; Ribeyre, X.; Duchateau, G.

Experiments on strong shock excitation in spherical plastic targets conducted at the Omega Laser Facility are interpreted with the radiation–hydrodynamics code CHIC to account for parametric instabilities excitation and hot-electron generation. The effects of hot electrons on the shock-pressure amplification and upstream preheat are analyzed. In this study, it is demonstrated that both effects contribute to an increase in shock velocity. Comparison of the measured laser reflectivity and shock flash time with numerical simulations make it possible to reconstitute the time history of the ablation and shock pressures. Finally, consequences of this analysis for the shock-ignition target design are discussed.

Simulated performance of the optical Thomson scattering diagnostic designed for the National Ignition Facility

DOE PAGES

Ross, J. S.; Datte, P.; Divol, L.; ...

2016-07-28

An optical Thomson scattering diagnostic has been designed for the National Ignition Facility to characterize under-dense plasmas. Here, we report on the design of the system and the expected performance for different target configurations. The diagnostic is designed to spatially and temporally resolve the Thomson scattered light from laser driven targets. The diagnostic will collect scattered light from a 50 × 50 × 200 μm volume. The optical design allows operation with different probe laser wavelengths. A deep-UV probe beam (λ 0 = 210 nm) will be used to Thomson scatter from electron plasma densities of ~5 × 10 20more » cm -3 while a 3ω probe will be used for plasma densities of ~1 × 10 19 cm -3. The diagnostic package contains two spectrometers: the first to resolve Thomson scattering from ion acoustic wave fluctuations and the second to resolve scattering from electron plasma wave fluctuations. Expected signal levels relative to background will be presented for typical target configurations (hohlraums and a planar foil).« less

Simulated performance of the optical Thomson scattering diagnostic designed for the National Ignition Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ross, J. S., E-mail: ross36@llnl.gov; Datte, P.; Divol, L.

2016-11-15

An optical Thomson scattering diagnostic has been designed for the National Ignition Facility to characterize under-dense plasmas. We report on the design of the system and the expected performance for different target configurations. The diagnostic is designed to spatially and temporally resolve the Thomson scattered light from laser driven targets. The diagnostic will collect scattered light from a 50 × 50 × 200 μm volume. The optical design allows operation with different probe laser wavelengths. A deep-UV probe beam (λ{sub 0} = 210 nm) will be used to Thomson scatter from electron plasma densities of ∼5 × 10{sup 20} cm{supmore » −3} while a 3ω probe will be used for plasma densities of ∼1 × 10{sup 19} cm{sup −3}. The diagnostic package contains two spectrometers: the first to resolve Thomson scattering from ion acoustic wave fluctuations and the second to resolve scattering from electron plasma wave fluctuations. Expected signal levels relative to background will be presented for typical target configurations (hohlraums and a planar foil).« less

KSC-08pd2290

NASA Image and Video Library

2008-08-05

CAPE CANAVERAL, Fla. – The Multi-Use Lightweight Equipment (MULE) carrier is driven from the Canister Rotation Facility to the Payload Hazardous Servicing Facility at NASA's Kennedy Space Center after the shipping container was pressure cleaned. The MULE is part of the payload for the fifth and final shuttle servicing mission to NASA's Hubble Space Telescope, STS-125. The MULE carrier will join the Flight Support System, the Super Lightweight Interchangeable Carrier and the Orbital Replacement Unit Carrier in the Payload Hazardous Servicing Facility where the Hubble payload is being prepared for launch. The Relative Navigation Sensors and the New Outer Blanket Layers will be on the MULE. The payload is scheduled to go to Launch Pad 39A in mid-September to be installed into Atlantis' payload bay. Atlantis is targeted to launch Oct. 8 at 1:34 a.m. EDT. .Photo credit: NASA/Amanda Diller

Simulation of the hohlraum for a laser facility of Megajoule scale

NASA Astrophysics Data System (ADS)

Chizhkov, M. N.; Kozmanov, M. Y. U.; Lebedev, S. N.; Lykov, V. A.; Rykovanova, V. V.; Seleznev, V. N.; Selezneva, K. I.; Stryakhnina, O. V.; Shestakov, A. A.; Vronskiy, A. V.

2010-08-01

2D calculations of the promising laser hohlraums were performed with using of the Sinara computer code. These hohlraums are intended for achievement of indirectly-driven thermonuclear ignition at laser energy above 1 MJ. Two calculation variants of the laser assembly with the form close to a rugby ball were carried out: with laser entrance hole shields and without shields. Time dependent hohlraum radiation temperature and x-ray flux asymmetry on a target were obtained.

Scientific and technological advancements in inertial fusion energy

DOE PAGES

Hinkel, D. E.

2013-09-26

Scientific advancements in inertial fusion energy (IFE) were reported on at the IAEA Fusion Energy Conference, October 2012. Results presented transect the different ways to assemble the fuel, different scenarios for igniting the fuel, and progress in IFE technologies. The achievements of the National Ignition Campaign within the USA, using the National Ignition Facility (NIF) to indirectly drive laser fusion, have found beneficial the achievements in other IFE arenas such as directly driven laser fusion and target fabrication. Moreover, the successes at NIF have pay-off to alternative scenarios such as fast ignition, shock ignition, and heavy-ion fusion as well asmore » to directly driven laser fusion. As a result, this synergy is summarized here, and future scientific studies are detailed.« less

Quantification of uncertainty in photon source spot size inference during laser-driven radiography experiments at TRIDENT

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tobias, Benjamin John; Palaniyappan, Sasikumar; Gautier, Donald Cort

Images of the R2DTO resolution target were obtained during laser-driven-radiography experiments performed at the TRIDENT laser facility, and analysis of these images using the Bayesian Inference Engine (BIE) determines a most probable full-width half maximum (FWHM) spot size of 78 μm. However, significant uncertainty prevails due to variation in the measured detector blur. Propagating this uncertainty in detector blur through the forward model results in an interval of probabilistic ambiguity spanning approximately 35-195 μm when the laser energy impinges on a thick (1 mm) tantalum target. In other phases of the experiment, laser energy is deposited on a thin (~100more » nm) aluminum target placed 250 μm ahead of the tantalum converter. When the energetic electron beam is generated in this manner, upstream from the bremsstrahlung converter, the inferred spot size shifts to a range of much larger values, approximately 270-600 μm FWHM. This report discusses methods applied to obtain these intervals as well as concepts necessary for interpreting the result within a context of probabilistic quantitative inference.« less

Vibration isolation in a free-piston driven expansion tube facility

NASA Astrophysics Data System (ADS)

Gildfind, D. E.; Jacobs, P. A.; Morgan, R. G.

2013-09-01

The stress waves produced by rapid piston deceleration are a fundamental feature of free-piston driven expansion tubes, and wave propagation has to be considered in the design process. For lower enthalpy test conditions, these waves can traverse the tube ahead of critical flow processes, severely interfering with static pressure measurements of the passing flow. This paper details a new device which decouples the driven tube from the free-piston driver, and thus prevents transmission of stress waves. Following successful incorporation of the concept in the smaller X2 facility, it has now been applied to the larger X3 facility, and results for both facilities are presented.

A laboratory facility for research on wind-driven rain intrusion in building envelope assemblies

Treesearch

Samuel V. Glass

2010-01-01

Moisture management is critical for durable, energy-efficient buildings. To address the need for research on wind-driven rain intrusion in wall assemblies, the U.S. Forest Products Laboratory is developing a new facility. This paper describes the underlying principle of this facility and its capabilities.

A continuously self regenerating high-flux neutron-generator facility

NASA Astrophysics Data System (ADS)

Rogers, A. M.; Becker, T. A.; Bernstein, L. A.; van Bibber, K.; Bleuel, D. L.; Chen, A. X.; Daub, B. H.; Goldblum, B. L.; Firestone, R. B.; Leung, K.-N.; Renne, P. R.; Waltz, C.

2013-10-01

A facility based on a next-generation, high-flux D-D neutron generator (HFNG) is being constructed at UC Berkeley. The current generator, designed around two RF-driven multicusp deuterium ion sources, is capable of producing a neutron output of >1011 n/s. A specially designed titanium-coated copper target located between the ion sources accelerates D+ ions up to 150 keV, generating 2.45 MeV neutrons through the d(d,3He)n fusion reaction. Deuterium in the target is self loaded and regenerating through ion implantation, enabling stable and continuous long-term operation. The proposed science program is focused on pioneering advances in the 40Ar/39Ar dating technique for geochronology, new nuclear data measurements, basic nuclear science research including statistical model studies of radiative-strength functions and level densities, and education. An overview of the facility and its unique capabilities as well as first measurements from the HFNG commissioning will be presented. Work supported by NSF Grant No. EAR-0960138, U.S. DOE LBL Contract No. DE-AC02-05CH11231, and U.S. DOE LLNL Contract No. DE-AC52-07NA27344.

The US ICF Ignition Program and the Inertial Fusion Program

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindl, J D; Hammel, B A; Logan, B G

2003-07-02

There has been rapid progress in inertial fusion in the past few years. This progress spans the construction of ignition facilities, a wide range of target concepts, and the pursuit of integrated programs to develop fusion energy using lasers, ion beams and z-pinches. Two ignition facilities are under construction (NIF in the U.S. and LMJ in France) and both projects are progressing toward an initial experimental capability. The LIL prototype beamline for LMJ and the first 4 beams of NIF will be available for experiments in 2003. The full 192 beam capability of NIF will be available in 2009 andmore » ignition experiments are expected to begin shortly after that time. There is steady progress in the target science and target fabrication in preparation for indirect drive ignition experiments on NIF. Advanced target designs may lead to 5-10 times more yield than initial target designs. There has also been excellent progress on the science of ion beam and z-pinch driven indirect drive targets. Excellent progress on direct-drive targets has been obtained on the Omega laser at the University of Rochester. This includes improved performance of targets with a pulse shape predicted to result in reduced hydrodynamic instability. Rochester has also obtained encouraging results from initial cryogenic implosions. There is widespread interest in the science of fast ignition because of its potential for achieving higher target gain with lower driver energy and relaxed target fabrication requirements. Researchers from Osaka have achieved outstanding implosion and heating results from the Gekko XII Petawatt facility and implosions suitable for fast ignition have been tested on the Omega laser. A broad based program to develop lasers and ions beams for IFE is under way with excellent progress in drivers, chambers, target fabrication and target injection. KrF and Diode Pumped Solid-State lasers (DPSSL) are being developed in conjunction with drywall chambers and direct drive targets. Induction accelerators for heavy ions are being developed in conjunction with thick-liquid protected wall chambers and indirect-drive targets.« less

Target design optimization for an electron accelerator driven subcritical facility with circular and square beam profiles.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gohar, M. Y. A; Sofu, T.; Zhong, Z.

2008-10-30

A subcritical facility driven by an electron accelerator is planned at the Kharkov Institute of Physics and Technology (KIPT) in Ukraine for medical isotope production, materials research, training, and education. The conceptual design of the facility is being pursued through collaborations between ANL and KIPT. As part of the design effort, the high-fidelity analyses of various target options are performed with formulations to reflect the realistic configuration and the three dimensional geometry of each design. This report summarizes the results of target design optimization studies for electron beams with two different beam profiles. The target design optimization is performed viamore » the sequential neutronic, thermal-hydraulic, and structural analyses for a comprehensive assessment of each configuration. First, a target CAD model is developed with proper emphasis on manufacturability to provide a basis for separate but consistent models for subsequent neutronic, thermal-hydraulic, and structural analyses. The optimizations are pursued for maximizing the neutron yield, streamlining the flow field to avoid hotspots, and minimizing the thermal stresses to increase the durability. In addition to general geometric modifications, the inlet/outlet channel configurations, target plate partitioning schemes, flow manipulations and rates, electron beam diameter/width options, and cladding material choices are included in the design optimizations. The electron beam interactions with the target assembly and the neutronic response of the subcritical facility are evaluated using the MCNPX code. the results for the electron beam energy deposition, neutron generation, and utilization in the subcritical pile are then used to characterize the axisymmetric heat generation profiles in the target assembly with explicit simulations of the beam tube, the coolant, the clad, and the target materials. Both tungsten and uranium are considered as target materials. Neutron spectra from tungsten and uranium are very similar allowing the use of either material in the subcritical assembly without changing its characteristics. However, the uranium target has a higher neutron yield, which increases the neutron flux of the subcritical assembly. Based on the considered dimensions and heat generation profiles, the commercial CFD software Star-CD is used for the thermal-hydraulic analysis of each target design to satisfy a set of thermal criteria, the most limiting of which being to maintain the water temperature 50 below the boiling point. It is found that the turbulence in the inlet channels dissipates quickly in narrow gaps between the target plates and, as a result, the heat transfer is limited by the laminar flow conditions. On average, 3-D CFD analyses of target assemblies agree well with 1-D calculations using RELAP (performed by KIPT). However, the recirculation and stagnation zones predicted with the CFD models prove the importance of a 3-D analysis to avoid the resulting hotspots. The calculated temperatures are subsequently used for the structural analysis of each target configuration to satisfy the other engineering design requirements. The thermo-structural calculations are performed mostly with NASTRAN and the results occasionally compared with the results from MARC. Both, NASTRAN and MARC are commercially available structural-mechanics analysis software. Although, a significant thermal gradient forms in target elements along the beam direction, the high thermal stresses are generally observed peripherally around the edge of thin target disks/plates. Due to its high thermal conductivity, temperatures and thermal stresses in tungsten target are estimated to be significantly lower than in uranium target. The deformations of the target disks/plates are found to be insignificant, which eliminate concerns for flow blockages in narrow coolant channels. Consistent with the specifications of the KIPT accelerator to be used in this facility, the electron beam power is 100-kW with electron energy in the range of 100 to 200 MeV. As expected, the 100 MeV electrons deposit their energy faster while the 200-MeV electrons spread their energy deposition further along the beam direction. However in that electron energy range, the energy deposition profiles near the beam window require very thin target plates/disks to limit the temperatures and thermal stresses.« less

Laser-driven ion acceleration at BELLA

NASA Astrophysics Data System (ADS)

Bin, Jianhui; Steinke, Sven; Ji, Qing; Nakamura, Kei; Treffert, Franziska; Bulanov, Stepan; Roth, Markus; Toth, Csaba; Schroeder, Carl; Esarey, Eric; Schenkel, Thomas; Leemans, Wim

2017-10-01

BELLA is a high repetiton rate PW laser and we used it for high intensity laser plasma acceleration experiments. The BELLA-i program is focused on relativistic laser plasma interaction such as laser driven ion acceleration, aiming at establishing an unique collaborative research facility providing beam time to selected external groups for fundamental physics and advanced applications. Here we present our first parameter study of ion acceleration driven by the BELLA-PW laser with truly high repetition rate. The laser repetition rate of 1Hz allows for scanning the laser pulse duration, relative focus location and target thickness for the first time at laser peak powers of above 1 PW. Furthermore, the long focal length geometry of the experiment (f ∖65) and hence, large focus size provided ion beams of reduced divergence and unprecedented charge density. This work was supported by the Director, Office of Science, of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231.

Autonomous Electrothermal Facility for Oil Recovery Intensification Fed by Wind Driven Power Unit

NASA Astrophysics Data System (ADS)

Belsky, Aleksey A.; Dobush, Vasiliy S.

2017-10-01

This paper describes the structure of autonomous facility fed by wind driven power unit for intensification of viscous and heavy crude oil recovery by means of heat impact on productive strata. Computer based service simulation of this facility was performed. Operational energy characteristics were obtained for various operational modes of facility. The optimal resistance of heating element of the downhole heater was determined for maximum operating efficiency of wind power unit.

SINQ layout, operation, applications and R&D to high power

NASA Astrophysics Data System (ADS)

Bauer, G. S.; Dai, Y.; Wagner, W.

2002-09-01

Since 1997, the Paul Scherrer Institut (PSI) is operating a 1 MW class research spallation neutron source, named SINQ. SINQ is driven by a cascade of three accelerators, the final stage being a 590 MeV isochronous ring cyclotron which delivers a beam current of 1.8 mA at an rf-frequency of 51 MHz. Since for neutron production this is essentially a dc-device, SINQ is a continuous neutron source and is optimized in its design for high time average neutron flux. This makes the facility similar to a research reactor in terms of utilization, but, in terms of beam power, it is, by a large margin, the most powerful spallation neutron source currently in operation world wide. As a consequence, target load levels prevail in SINQ which are beyond the realm of existing experience, demanding a careful approach to the design and operation of a high power target. While the best neutronic performance of the source is expected for a liquid lead-bismuth eutectic target, no experience with such systems exists. For this reason a staged approach has been embarked upon, starting with a heavy water cooled rod target of Zircaloy-2 and proceeding via steel clad lead rods towards the final goal of a target optimised in both, neutronic performance and service life time. Experience currently accruing with a test target containing sample rods with different materials specimens will help to select the proper structural material and make dependable life time estimates accounting for the real operating conditions that prevail in the facility. In parallel, both theoretical and experimental work is going on within the MEGAPIE (MEGAwatt Pilot Experiment) project, a joint initiative by six European research institutions and JAERI (Japan), DOE (USA) and KAERI (Korea), to design, build, operate and explore a liquid lead-bismuth spallation target for 1MW of beam power, taking advantage of the existing spallation neutron facility SINQ.

LLE Review 118 (January-March 2009)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bittle, W., editor

2009-08-03

This issue has the following articles: (1) Applied Plasma Spectroscopy: Laser-Fusion Experiments; (2) Relativistic Electron-Beam Transport Studies Using High-Resolution, Coherent Transition Radiation Imaging; (3) Pressure-Driven, Resistive Magnetohydrodynamic Interchange Instabilities in Laser-Produced, High-Energy-Density Plasmas; (4) Extended Model for Polymer Cholesteric Liquid Crystal Flake Reorientation and Relaxation; (5) Modeling the Effects of Microencapsulation on the Electro-Optic Behavior of Polymer Cholesteric Liquid Crystal Flakes; (6) Capillarity and Dielectrophoresis of Liquid Deuterium; and (7) A Stable Mid-IR, GaSb-Based Diode Laser Source for Cryogenic Target Layering at the OMEGA Laser Facility.

X-ray and gamma ray emission from petawatt laser-driven nanostructured metal targets

NASA Astrophysics Data System (ADS)

Hill, Matthew; Allan, Peter; Brown, Colin; Hoarty, David; Hobbs, Lauren; James, Steven; Bargsten, Clayton; Hollinger, Reed; Rocca, Jorge; Park, Jaebum; Chen, Hui; London, Richard; Shepherd, Ronnie; Tommasini, Riccardo; Vinko, Sam; Wark, Justin; Marjoribanks, Robin; Neely, David; Spindloe, Chris

2016-10-01

Nano-wire arrays of nickel and gold have been fired at the Orion laser facility using high contrast 1 ω and 2 ω short pulse beams (0.7 ps pulse length, >1020 W cm-2 intensity). Time-resolved and time-integrated K-shell and M-shell emission have been characterized and compared to those of flat foils, investigating the capability of these metamaterial coatings to enhance laser-target coupling and X-ray emission. Bremsstrahlung emission of gamma rays and associated pair production via the Bethe-Heitler process have also been investigated by use of 1 mm-thick gold substrates attached to the gold nanowires. We present our latest experimental data and outline some potential future applications.

Safe design of healthcare facilities

PubMed Central

Reiling, J

2006-01-01

The physical environment has a significant impact on health and safety; however, hospitals have not been designed with the explicit goal of enhancing patient safety through facility design. In April 2002, St Joseph's Community Hospital of West Bend, a member of SynergyHealth, brought together leaders in healthcare and systems engineering to develop a set of safety‐driven facility design recommendations and principles that would guide the design of a new hospital facility focused on patient safety. By introducing safety‐driven innovations into the facility design process, environmental designers and healthcare leaders will be able to make significant contributions to patient safety. PMID:17142606

Development of large-aperture electro-optical switch for high power laser at CAEP

NASA Astrophysics Data System (ADS)

Zhang, Xiongjun; Wu, Dengsheng; Zhang, Jun; Lin, Donghui; Zheng, Jiangang; Zheng, Kuixing

2015-02-01

Large-aperture electro-optical switch based on plasma Pockels cell (PPC) is one of important components for inertial confinement fusion (ICF) laser facility. We have demonstrated a single-pulse driven 4×1 PPC with 400mm×400mm aperture for SGIII laser facility. And four 2×1 PPCs modules with 350mm×350mm aperture have been operated in SGII update laser facility. It is different to the PPC of NIF and LMJ for its simple operation to perform Pockels effect. With optimized operation parameters, the PPCs meet the SGII-U laser requirement of four-pass amplification control. Only driven by one high voltage pulser, the simplified PPC system would be provided with less associated diagnostics, and higher reliability. To farther reduce the insert loss of the PPC, research on the large-aperture PPC based on DKDP crystal driven by one pulse is developed. And several single-pulse driven PPCs with 80mm×80mm DKDP crystal have been manufactured and operated in laser facilities.

Study of transport phenomena in laser-driven, non- equilibrium plasmas in the presence of external magnetic fields

NASA Astrophysics Data System (ADS)

Kemp, G. Elijah; Mariscal, D. A.; Williams, G. J.; Blue, B. E.; Colvin, J. D.; Fears, T. M.; Kerr, S. M.; May, M. J.; Moody, J. D.; Strozzi, D. J.; Lefevre, H. J.; Klein, S. R.; Kuranz, C. C.; Manuel, M. J.-E.; Gautier, D. C.; Montgomery, D. S.

2017-10-01

We present experimental and simulation results from a study of thermal transport inhibition in laser-driven, mid-Z, non-equilibrium plasmas in the presence external magnetic fields. The experiments were performed at the Jupiter Laser Facility at LLNL, where x-ray spectroscopy, proton radiography, and Brillouin backscatter data were simultaneously acquired from sub-critical-density, Ti-doped silica aerogel foams driven by a 2 ω laser at 5 ×1014 W /cm2 . External B-field strengths up to 20 T (aligned antiparallel to the laser propagation axis) were provided by a capacitor-bank-driven Helmholtz coil. Pre-shot simulations with Hydra, a radiation-magnetohydrodyanmics code, showed increasing electron plasma temperature with increasing B-field strength - the result of thermal transport inhibition perpendicular to the B-field. The influence of this thermal transport inhibition on the experimental observables as a function of external field strength and target density will be shown and compared with simulations. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract No. DE-AC52-07NA27344 and funded by LDRD project 17-ERD-027.

Weibel instability mediated collisionless shocks using intense laser-driven plasmas

NASA Astrophysics Data System (ADS)

Palaniyappan, Sasikumar; Fiuza, Federico; Huang, Chengkun; Gautier, Donald; Ma, Wenjun; Schreiber, Jorg; Raymer, Abel; Fernandez, Juan; Shimada, Tom; Johnson, Randall

2017-10-01

The origin of cosmic rays remains a long-standing challenge in astrophysics and continues to fascinate physicists. It is believed that ``collisionless shocks'' - where the particle Coulomb mean free path is much larger that the shock transition - are a dominant source of energetic cosmic rays. These shocks are ubiquitous in astrophysical environments such as gamma-ray bursts, supernova remnants, pulsar wind nebula and coronal mass ejections from the sun. A particular type of electromagnetic plasma instability known as Weibel instability is believed to be the dominant mechanism behind the formation of these collisionless shocks in the cosmos. The understanding of the microphysics behind collisionless shocks and their particle acceleration is tightly related with nonlinear basic plasma processes and remains a grand challenge. In this poster, we will present results from recent experiments at the LANL Trident laser facility studying collisionless shocks using intense ps laser (80J, 650 fs - peak intensity of 1020 W/cm2) driven near-critical plasmas using carbon nanotube foam targets. A second short pulse laser driven protons from few microns thick gold foil is used to radiograph the main laser-driven plasma. Work supported by the LDRD program at LANL.

Weibel instability mediated collisionless shocks using intense laser-driven plasmas

NASA Astrophysics Data System (ADS)

Palaniyappan, Sasi; Huang, Chengkun; Gautier, Donald; Fernandez, Juan; Ma, Wenjun; Schreiber, Jorg; LANL Collaboration; LMU Team

2016-10-01

The origin of cosmic rays remains a long-standing challenge in astrophysics and continues to fascinate physicists. It is believed that ``collisionless shocks'' - where the particle Coulomb mean free path is much larger that the shock transition - are a dominant source of energetic cosmic rays. These shocks are ubiquitous in astrophysical environments such as gamma-ray bursts, supernova remnants, pulsar wind nebula and coronal mass ejections from the sun. Several spacecraft observations have revealed acceleration of charged particles, mostly electrons, to very high energies with in the shock front. There is now also clear observational evidence that supernova remnant shocks accelerate both protons and electrons. The understanding of the microphysics behind collisionless shocks and their particle acceleration is tightly related with nonlinear basic plasma processes and remains a grand challenge. In this poster, we will present results from recent experiments at the LANL Trident laser facility studying collisionless shocks using intense ps laser (80J, 650 fs - peak intensity of 1020 W/cm2) driven near-critical plasmas using carbon nanotube foam targets. A second short pulse laser driven protons from few microns thick aluminum foil is used to image the laser-driven plasma.

Development Of Hard X-Ray Sources With High Radiative Power Output At The National Ignition Facility Utilizing Molybdenum and Silver Cavities

NASA Astrophysics Data System (ADS)

Widmann, Klaus; Benjamin, Russ; May, Mark; Thorn, Daniel; Colvin, Jeff; Barrios, Maria; Kemp, G. Elijah; Fournier, Kevin; Blue, Brent

2016-10-01

In our on-going x-ray source development campaign at the National Ignition Facility, we have recently extended the energy range of our laser-driven cavity sources to the 20 keV range by utilizing molybdenum-lined and silver-lined cavity targets. Using a variety of spectroscopic and power diagnostics we determined that almost 1% of the nearly 1 MJ total laser energy used for heating the cavity target was converted to Mo K-shell x rays using our standard cavity design. The same laser drive for silver-lined cavities yielded about 0.4% conversion efficiency for the Ag K-shell emission. Comparison with HYDRA simulations are used to further optimize the x-rays conversion efficiency. The simulations indicate that minor changes in the aspect ratio of the cavity and the layer thickness may double the radiative power of the K-shell emission. This work was performed under the auspices of the U.S. Department of Energy by LLNL under Contract DE-AC52-07NA27344.

Hypervelocity Impact Test Facility: A gun for hire

NASA Technical Reports Server (NTRS)

Johnson, Calvin R.; Rose, M. F.; Hill, D. C.; Best, S.; Chaloupka, T.; Crawford, G.; Crumpler, M.; Stephens, B.

1994-01-01

An affordable technique has been developed to duplicate the types of impacts observed on spacecraft, including the Shuttle, by use of a certified Hypervelocity Impact Facility (HIF) which propels particulates using capacitor driven electric gun techniques. The fully operational facility provides a flux of particles in the 10-100 micron diameter range with a velocity distribution covering the space debris and interplanetary dust particle environment. HIF measurements of particle size, composition, impact angle and velocity distribution indicate that such parameters can be controlled in a specified, tailored test designed for or by the user. Unique diagnostics enable researchers to fully describe the impact for evaluating the 'targets' under full power or load. Users regularly evaluate space hardware, including solar cells, coatings, and materials, exposing selected portions of space-qualified items to a wide range of impact events and environmental conditions. Benefits include corroboration of data obtained from impact events, flight simulation of designs, accelerated aging of systems, and development of manufacturing techniques.

The Manchester Fly Facility: Implementing an objective-driven long-term science communication initiative.

PubMed

Patel, Sanjai; Prokop, Andreas

2017-10-01

Science communication is increasingly important for scientists, although research, teaching and administration activities tend to eat up our time already, and budgets for science communication are usually low. It appears impossible to combine all these tasks and, in addition, to develop engagement activities to a quality and impact that would make the efforts worth their while. Here we argue that these challenges are easier addressed when centering science communication initiatives on a long-term vision with a view to eventually forming outreach networks where the load can be shared whilst being driven to higher momentum. As one example, we explain the science communication initiative of the Manchester Fly Facility. It aims to promote public awareness of research using the model organism Drosophila, which is a timely, economic and most efficient experimental strategy to drive discovery processes in the biomedical sciences and must have a firm place in the portfolios of funding organisations. Although this initiative by the Manchester Fly Facility is sustained on a low budget, its long-term vision has allowed gradual development into a multifaceted initiative: (1) targeting university students via resources and strategies for the advanced training in fly genetics; (2) targeting the general public via science fairs, educational YouTube videos, school visits, teacher seminars and the droso4schools project; (3) disseminating and marketing strategies and resources to the public as well as fellow scientists via dedicated websites, blogs, journal articles, conference presentations and workshops - with a view to gradually forming networks of drosophilists that will have a greater potential to drive the science communication objective to momentum and impact. Here we explain the rationales and implementation strategies for our various science communication activities - which are similarly applicable to other model animals and other areas of academic science - and share our experiences and resources to provide ideas and readily available means to those who are actively engaging or intend to do so. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Scaling laws between population and facility densities.

PubMed

Um, Jaegon; Son, Seung-Woo; Lee, Sung-Ik; Jeong, Hawoong; Kim, Beom Jun

2009-08-25

When a new facility like a grocery store, a school, or a fire station is planned, its location should ideally be determined by the necessities of people who live nearby. Empirically, it has been found that there exists a positive correlation between facility and population densities. In the present work, we investigate the ideal relation between the population and the facility densities within the framework of an economic mechanism governing microdynamics. In previous studies based on the global optimization of facility positions in minimizing the overall travel distance between people and facilities, it was shown that the density of facility D and that of population rho should follow a simple power law D approximately rho(2/3). In our empirical analysis, on the other hand, the power-law exponent alpha in D approximately rho(alpha) is not a fixed value but spreads in a broad range depending on facility types. To explain this discrepancy in alpha, we propose a model based on economic mechanisms that mimic the competitive balance between the profit of the facilities and the social opportunity cost for populations. Through our simple, microscopically driven model, we show that commercial facilities driven by the profit of the facilities have alpha = 1, whereas public facilities driven by the social opportunity cost have alpha = 2/3. We simulate this model to find the optimal positions of facilities on a real U.S. map and show that the results are consistent with the empirical data.

National Ignition Facility Control and Information System Operational Tools

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marshall, C D; Beeler, R G; Bowers, G A

The National Ignition Facility (NIF) in Livermore, California, is the world's highest-energy laser fusion system and one of the premier large scale scientific projects in the United States. The system is designed to setup and fire a laser shot to a fusion ignition or high energy density target at rates up to a shot every 4 hours. NIF has 192 laser beams delivering up to 1.8 MJ of energy to a {approx}2 mm target that is planned to produce >100 billion atm of pressure and temperatures of >100 million degrees centigrade. NIF is housed in a ten-story building footprint themore » size of three football fields as shown in Fig. 1. Commissioning was recently completed and NIF will be formally dedicated at Lawrence Livermore National Laboratory on May 29, 2009. The control system has 60,000 hardware controls points and employs 2 million lines of control system code. The control room has highly automated equipment setup prior to firing laser system shots. This automation has a data driven implementation that is conducive to dynamic modification and optimization depending on the shot goals defined by the end user experimenters. NIF has extensive facility machine history and infrastructure maintenance workflow tools both under development and deployed. An extensive operational tools suite has been developed to support facility operations including experimental shot setup, machine readiness, machine health and safety, and machine history. The following paragraphs discuss the current state and future upgrades to these four categories of operational tools.« less

Shock ignition targets: gain and robustness vs ignition threshold factor

NASA Astrophysics Data System (ADS)

Atzeni, Stefano; Antonelli, Luca; Schiavi, Angelo; Picone, Silvia; Volponi, Gian Marco; Marocchino, Alberto

2017-10-01

Shock ignition is a laser direct-drive inertial confinement fusion scheme, in which the stages of compression and hot spot formation are partly separated. The hot spot is created at the end of the implosion by a converging shock driven by a final ``spike'' of the laser pulse. Several shock-ignition target concepts have been proposed and relevant gain curves computed (see, e.g.). Here, we consider both pure-DT targets and more facility-relevant targets with plastic ablator. The investigation is conducted with 1D and 2D hydrodynamic simulations. We determine ignition threshold factors ITF's (and their dependence on laser pulse parameters) by means of 1D simulations. 2D simulations indicate that robustness to long-scale perturbations increases with ITF. Gain curves (gain vs laser energy), for different ITF's, are generated using 1D simulations. Work partially supported by Sapienza Project C26A15YTMA, Sapienza 2016 (n. 257584), Eurofusion Project AWP17-ENR-IFE-CEA-01.

Fast neutron production from lithium converters and laser driven protons

DOE Office of Scientific and Technical Information (OSTI.GOV)

Storm, M.; Jiang, S.; Wertepny, D.

2013-05-15

Experiments to generate neutrons from the {sup 7}Li(p,n){sup 7}Be reaction with 60 J, 180 fs laser pulses have been performed at the Texas Petawatt Laser Facility at the University of Texas at Austin. The protons were accelerated from the rear surface of a thin target membrane using the target-normal-sheath-acceleration mechanism. The neutrons were generated in nuclear reactions caused by the subsequent proton bombardment of a pure lithium foil of natural isotopic abundance. The neutron energy ranged up to 2.9 MeV. The total yield was estimated to be 1.6 × 10{sup 7} neutrons per steradian. An extreme ultra-violet light camera, usedmore » to image the target rear surface, correlated variations in the proton yield and peak energy to target rear surface ablation. Calculations using the hydrodynamics code FLASH indicated that the ablation resulted from a laser pre-pulse of prolonged intensity. The ablation severely limited the proton acceleration and neutron yield.« less

A geophysical shock and air blast simulator at the National Ignition Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fournier, K. B.; Brown, C. G.; May, M. J.

2014-09-15

The energy partitioning energy coupling experiments at the National Ignition Facility (NIF) have been designed to measure simultaneously the coupling of energy from a laser-driven target into both ground shock and air blast overpressure to nearby media. The source target for the experiment is positioned at a known height above the ground-surface simulant and is heated by four beams from the NIF. The resulting target energy density and specific energy are equal to those of a low-yield nuclear device. The ground-shock stress waves and atmospheric overpressure waveforms that result in our test system are hydrodynamically scaled analogs of full-scale seismicmore » and air blast phenomena. This report summarizes the development of the platform, the simulations, and calculations that underpin the physics measurements that are being made, and finally the data that were measured. Agreement between the data and simulation of the order of a factor of two to three is seen for air blast quantities such as peak overpressure. Historical underground test data for seismic phenomena measured sensor displacements; we measure the stresses generated in our ground-surrogate medium. We find factors-of-a-few agreement between our measured peak stresses and predictions with modern geophysical computer codes.« less

A geophysical shock and air blast simulator at the National Ignition Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fournier, K. B.; Brown, C. G.; May, M. J.

2014-09-01

The energy partitioning energy coupling experiments at the National Ignition Facility (NIF) have been designed to measure simultaneously the coupling of energy from a laser-driven target into both ground shock and air blast overpressure to nearby media. The source target for the experiment is positioned at a known height above the ground-surface simulant and is heated by four beams from the NIF. The resulting target energy density and specific energy are equal to those of a low-yield nuclear device. The ground-shock stress waves and atmospheric overpressure waveforms that result in our test system are hydrodynamically scaled analogs of full-scale seismicmore » and air blast phenomena. This report summarizes the development of the platform, the simulations, and calculations that underpin the physics measurements that are being made, and finally the data that were measured. Agreement between the data and simulation of the order of a factor of two to three is seen for air blast quantities such as peak overpressure. Historical underground test data for seismic phenomena measured sensor displacements; we measure the stresses generated in our ground-surrogate medium. We find factors-of-a-few agreement between our measured peak stresses and predictions with modern geophysical computer codes.« less

Magnetic Fields on the National Ignition Facility (MagNIF)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mason, D.; Folta, J.

2016-08-12

A magnetized target capability on the National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) has been investigated. Stakeholders’ needs and project feasibility analysis were considered in order to down-select from a wide variety of different potential magnetic field magnitudes and volumes. From the large range of different target platforms, laser configurations, and diagnostics configurations of interest to the stakeholders, the gas-pipe platform has been selected for the first round of magnetized target experiments. Gas pipe targets are routinely shot on the NIF and provide unique value for external collaborators. High-level project goals have been established including an experimentallymore » relevant 20Tesla magnetic field magnitude. The field will be achieved using pulsed power-driven coils. A system architecture has been proposed. The pulsed power drive system will be located in the NIF target bay. This decision provides improved maintainability and mitigates equipment safety risks associated with explosive failure of the drive capacitor. High-level and first-level subsystem requirements have been established. Requirements have been included for two distinct coil designs – full solenoid and quasi-Helmholtz. A Failure Modes and Effects Analysis (FMEA) has been performed and documented. Additional requirements have been derived from the mitigations included in the FMEA document. A project plan is proposed. The plan includes a first phase of electromagnetic simulations to assess whether the design will meet performance requirements, then a second phase of risk mitigation projects to address the areas of highest technical risk. The duration from project kickoff to the first magnetized target shot is approximately 29 months.« less

Hohlraum modeling for opacity experiments on the National Ignition Facility

NASA Astrophysics Data System (ADS)

Dodd, E. S.; DeVolder, B. G.; Martin, M. E.; Krasheninnikova, N. S.; Tregillis, I. L.; Perry, T. S.; Heeter, R. F.; Opachich, Y. P.; Moore, A. S.; Kline, J. L.; Johns, H. M.; Liedahl, D. A.; Cardenas, T.; Olson, R. E.; Wilde, B. H.; Urbatsch, T. J.

2018-06-01

This paper discusses the modeling of experiments that measure iron opacity in local thermodynamic equilibrium (LTE) using laser-driven hohlraums at the National Ignition Facility (NIF). A previous set of experiments fielded at Sandia's Z facility [Bailey et al., Nature 517, 56 (2015)] have shown up to factors of two discrepancies between the theory and experiment, casting doubt on the validity of the opacity models. The purpose of the new experiments is to make corroborating measurements at the same densities and temperatures, with the initial measurements made at a temperature of 160 eV and an electron density of 0.7 × 1022 cm-3. The X-ray hot spots of a laser-driven hohlraum are not in LTE, and the iron must be shielded from a direct line-of-sight to obtain the data [Perry et al., Phys. Rev. B 54, 5617 (1996)]. This shielding is provided either with the internal structure (e.g., baffles) or external wall shapes that divide the hohlraum into a laser-heated portion and an LTE portion. In contrast, most inertial confinement fusion hohlraums are simple cylinders lacking complex gold walls, and the design codes are not typically applied to targets like those for the opacity experiments. We will discuss the initial basis for the modeling using LASNEX, and the subsequent modeling of five different hohlraum geometries that have been fielded on the NIF to date. This includes a comparison of calculated and measured radiation temperatures.

High-resolution monochromatic x-ray imaging system based on spherically bent crystals.

PubMed

Aglitskiy, Y; Lehecka, T; Obenschain, S; Bodner, S; Pawley, C; Gerber, K; Sethian, J; Brown, C M; Seely, J; Feldman, U; Holland, G

1998-08-01

We have developed an improved x-ray imaging system based on spherically curved crystals. It is designed and used for diagnostics of targets ablatively accelerated by the Nike KrF laser. A spherically curved quartz crystal (d = .?, R = mm) has been used to produce monochromatic backlit images with the He-like Si resonance line (1865 eV) as the source of radiation. The spatial resolution of the x-ray optical system is 1.7 mum in selected places and 2-3 mum over a larger area. Time-resolved backlit monochromatic images of polystyrene planar targets driven by the Nike facility have been obtained with a spatial resolution of 2.5 mum in selected places and 5 mum over the focal spot of the Nike laser.

Nuclear Methods for Transmutation of Nuclear Waste: Problems, Perspextives, Cooperative Research - Proceedings of the International Workshop

NASA Astrophysics Data System (ADS)

Khankhasayev, Zhanat B.; Kurmanov, Hans; Plendl, Mikhail Kh.

1996-12-01

The Table of Contents for the full book PDF is as follows: * Preface * I. Review of Current Status of Nuclear Transmutation Projects * Accelerator-Driven Systems — Survey of the Research Programs in the World * The Los Alamos Accelerator-Driven Transmutation of Nuclear Waste Concept * Nuclear Waste Transmutation Program in the Czech Republic * Tentative Results of the ISTC Supported Study of the ADTT Plutonium Disposition * Recent Neutron Physics Investigations for the Back End of the Nuclear Fuel Cycle * Optimisation of Accelerator Systems for Transmutation of Nuclear Waste * Proton Linac of the Moscow Meson Factory for the ADTT Experiments * II. Computer Modeling of Nuclear Waste Transmutation Methods and Systems * Transmutation of Minor Actinides in Different Nuclear Facilities * Monte Carlo Modeling of Electro-nuclear Processes with Nonlinear Effects * Simulation of Hybrid Systems with a GEANT Based Program * Computer Study of 90Sr and 137Cs Transmutation by Proton Beam * Methods and Computer Codes for Burn-Up and Fast Transients Calculations in Subcritical Systems with External Sources * New Model of Calculation of Fission Product Yields for the ADTT Problem * Monte Carlo Simulation of Accelerator-Reactor Systems * III. Data Basis for Transmutation of Actinides and Fission Products * Nuclear Data in the Accelerator Driven Transmutation Problem * Nuclear Data to Study Radiation Damage, Activation, and Transmutation of Materials Irradiated by Particles of Intermediate and High Energies * Radium Institute Investigations on the Intermediate Energy Nuclear Data on Hybrid Nuclear Technologies * Nuclear Data Requirements in Intermediate Energy Range for Improvement of Calculations of ADTT Target Processes * IV. Experimental Studies and Projects * ADTT Experiments at the Los Alamos Neutron Science Center * Neutron Multiplicity Distributions for GeV Proton Induced Spallation Reactions on Thin and Thick Targets of Pb and U * Solid State Nuclear Track Detector and Radiochemical Studies on the Transmutation of Nuclei Using Relativistic Heavy Ions * Experimental and Theoretical Study of Radionuclide Production on the Electronuclear Plant Target and Construction Materials Irradiated by 1.5 GeV and 130 MeV Protons * Neutronics and Power Deposition Parameters of the Targets Proposed in the ISTC Project 17 * Multicycle Irradiation of Plutonium in Solid Fuel Heavy-Water Blanket of ADS * Compound Neutron Valve of Accelerator-Driven System Sectioned Blanket * Subcritical Channel-Type Reactor for Weapon Plutonium Utilization * Accelerator Driven Molten-Fluoride Reactor with Modular Heat Exchangers on PB-BI Eutectic * A New Conception of High Power Ion Linac for ADTT * Pions and Accelerator-Driven Transmutation of Nuclear Waste? * V. Problems and Perspectives * Accelerator-Driven Transmutation Technologies for Resolution of Long-Term Nuclear Waste Concerns * Closing the Nuclear Fuel-Cycle and Moving Toward a Sustainable Energy Development * Workshop Summary * List of Participants

Design and testing of a magnetically driven implosion peak current diagnostic

NASA Astrophysics Data System (ADS)

Hess, M. H.; Peterson, K. J.; Ampleford, D. J.; Hutsel, B. T.; Jennings, C. A.; Gomez, M. R.; Dolan, D. H.; Robertson, G. K.; Payne, S. L.; Stygar, W. A.; Martin, M. R.; Sinars, D. B.

2018-04-01

A critical component of the magnetically driven implosion experiments at Sandia National Laboratories is the delivery of high-current, 10s of MA, from the Z pulsed power facility to a target. In order to assess the performance of the experiment, it is necessary to measure the current delivered to the target. Recent Magnetized Liner Inertial Fusion (MagLIF) experiments have included velocimetry diagnostics, such as PDV (Photonic Doppler Velocimetry) or Velocity Interferometer System for Any Reflector, in the final power feed section in order to infer the load current as a function of time. However, due to the nonlinear volumetrically distributed magnetic force within a velocimetry flyer, a complete time-dependent load current unfold is typically a time-intensive process and the uncertainties in the unfold can be difficult to assess. In this paper, we discuss how a PDV diagnostic can be simplified to obtain a peak current by sufficiently increasing the thickness of the flyer. This effectively keeps the magnetic force localized to the flyer surface, resulting in fast and highly accurate measurements of the peak load current. In addition, we show the results of experimental peak load current measurements from the PDV diagnostic in recent MagLIF experiments.

Flexible cue combination in the guidance of attention in visual search

PubMed Central

Brand, John; Oriet, Chris; Johnson, Aaron P.; Wolfe, Jeremy M.

2014-01-01

Hodsoll and Humphreys (2001) have assessed the relative contributions of stimulus-driven and user-driven knowledge on linearly- and nonlinearly separable search. However, the target feature used to determine linear separability in their task (i.e., target size) was required to locate the target. In the present work, we investigated the contributions of stimulus-driven and user-driven knowledge when a linearly- or nonlinearly-separable feature is available but not required for target identification. We asked observers to complete a series of standard color X orientation conjunction searches in which target size was either linearly- or nonlinearly separable from the size of the distractors. When guidance by color X orientation and by size information are both available, observers rely on whichever information results in the best search efficiency. This is the case irrespective of whether we provide target foreknowledge by blocking stimulus conditions, suggesting that feature information is used in both a stimulus-driven and user-driven fashion. PMID:25463553

Capsule performance optimization in the National Ignition Campaigna)

NASA Astrophysics Data System (ADS)

Landen, O. L.; Boehly, T. R.; Bradley, D. K.; Braun, D. G.; Callahan, D. A.; Celliers, P. M.; Collins, G. W.; Dewald, E. L.; Divol, L.; Glenzer, S. H.; Hamza, A.; Hicks, D. G.; Hoffman, N.; Izumi, N.; Jones, O. S.; Kirkwood, R. K.; Kyrala, G. A.; Michel, P.; Milovich, J.; Munro, D. H.; Nikroo, A.; Olson, R. E.; Robey, H. F.; Spears, B. K.; Thomas, C. A.; Weber, S. V.; Wilson, D. C.; Marinak, M. M.; Suter, L. J.; Hammel, B. A.; Meyerhofer, D. D.; Atherton, J.; Edwards, J.; Haan, S. W.; Lindl, J. D.; MacGowan, B. J.; Moses, E. I.

2010-05-01

A capsule performance optimization campaign will be conducted at the National Ignition Facility [G. H. Miller et al., Nucl. Fusion 44, 228 (2004)] to substantially increase the probability of ignition by laser-driven hohlraums [J. D. Lindl et al., Phys. Plasmas 11, 339 (2004)]. The campaign will experimentally correct for residual uncertainties in the implosion and hohlraum physics used in our radiation-hydrodynamic computational models before proceeding to cryogenic-layered implosions and ignition attempts. The required tuning techniques using a variety of ignition capsule surrogates have been demonstrated at the OMEGA facility under scaled hohlraum and capsule conditions relevant to the ignition design and shown to meet the required sensitivity and accuracy. In addition, a roll-up of all expected random and systematic uncertainties in setting the key ignition laser and target parameters due to residual measurement, calibration, cross-coupling, surrogacy, and scale-up errors has been derived that meets the required budget.

Capsule performance optimization in the National Ignition Campaign

DOE Office of Scientific and Technical Information (OSTI.GOV)

Landen, O. L.; Bradley, D. K.; Braun, D. G.

2010-05-15

A capsule performance optimization campaign will be conducted at the National Ignition Facility [G. H. Miller et al., Nucl. Fusion 44, 228 (2004)] to substantially increase the probability of ignition by laser-driven hohlraums [J. D. Lindl et al., Phys. Plasmas 11, 339 (2004)]. The campaign will experimentally correct for residual uncertainties in the implosion and hohlraum physics used in our radiation-hydrodynamic computational models before proceeding to cryogenic-layered implosions and ignition attempts. The required tuning techniques using a variety of ignition capsule surrogates have been demonstrated at the OMEGA facility under scaled hohlraum and capsule conditions relevant to the ignition designmore » and shown to meet the required sensitivity and accuracy. In addition, a roll-up of all expected random and systematic uncertainties in setting the key ignition laser and target parameters due to residual measurement, calibration, cross-coupling, surrogacy, and scale-up errors has been derived that meets the required budget.« less

Instability growth seeded by oxygen in CH shells on the National Ignition Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haan, S. W., E-mail: haan1@llnl.gov; Johnson, M. A.; Stadermann, M.

Fusion targets imploded on the National Ignition Facility are subject to hydrodynamic instabilities. These have generally been assumed to be seeded primarily by surface roughness, as existing work had suggested that internal inhomogeneity was small enough not to contribute significantly. New simulations presented here examine this in more detail, and consider modulations in internal oxygen content in CH plastic ablators. The oxygen is configured in a way motivated by measurement of oxygen in the shells. We find that plausible oxygen nonuniformity, motivated by target characterization experiments, seeds instability growth that is 3–5× bigger than expected from surface roughness. Pertinent existingmore » capsule characterization is discussed, which suggests the presence of internal modulations that could be oxygen at levels large enough to be the dominant seed for hydrodynamic instability growth. Oxygen-seeded growth is smaller for implosions driven by high-foot pulse shapes, consistent with the performance improvement seen with these pulse shapes. Growth is somewhat smaller for planned future pulse shapes that were optimized to minimize growth of surface ripples. A possible modified specification for oxygen modulations is discussed, which is about 1/5 of the current requirement.« less

Technique for Forming Solid D2 and D-T Layers for Shock Timing Experiments at the National Ignition Facility

DOE PAGES

Sater, J. D.; Espinosa-Loza, F.; Kozioziemski, B.; ...

2016-07-11

Capsule implosion experiments on the National Ignition Facility (NIF) are driven with a carefully tailored laser pulse that delivers a sequence of shocks to the ablator and fuel. In order to ensure the shocks converge at the desired position, the shock strength and velocity are measured in experimental platforms referred to as keyhole targets. We made shock measurements on capsules completely filled with liquid deuterium for the solid deuterium tritide (D-T) layer campaigns. Modeling has been used to extend these results to form an estimate of the shock properties in solid D-T layers. Furthermore, to verify and improve the surrogacymore » of the liquid-filled keyhole measurements, we have developed a technique to form a solid layer inside the keyhole capsule. The layer is typically uniform over a 400-μm-diameter area. This is sufficient to allow direct measurement of the shock velocity. This layering technique has been successfully applied to 13 experiments on the NIF. The technique may also be applicable to fast-igniter experiments since some proposed designs resemble keyhole targets. We discuss our method in detail and give representative results.« less

Alternate operating scenarios for NDCX-II

NASA Astrophysics Data System (ADS)

Sharp, W. M.; Friedman, A.; Grote, D. P.; Cohen, R. H.; Lund, S. M.; Vay, J.-L.; Waldron, W. L.

2014-01-01

NDCX-II is a newly completed accelerator facility at LBNL, built to study ion-heated warm dense matter, as well as aspects of ion-driven targets and intense-beam dynamics for inertial-fusion energy. The baseline design calls for using 12 induction cells to accelerate 30-50 nC of Li+ ions to 1.2 MeV. During commissioning, though, we plan to extend the source lifetime by extracting less total charge. Over time, we expect that NDCX-II will be upgraded to substantially higher energies, necessitating the use of heavier ions to keep a suitable deposition range in targets. For operational flexibility, the option of using a helium plasma source is also being investigated. Each of these options requires development of an alternate acceleration schedule. The schedules here are worked out with a fast-running 1-D particle-in-cell code ASP.

Observation of LPI Thresholds for the Nike Laser

NASA Astrophysics Data System (ADS)

Weaver, J. L.; Oh, J.; Afeyan, B.; Charbonneau-Lefort, M.; Phillips, L.; Seely, J.; Kehne, D.; Brown, C.; Obenschain, S.; Schmitt, A. J.; Feldman, U.; Holland, G.; Lehmberg, R. H.; McLean, E.; Manka, C.

2008-11-01

The Nike laser is being used to study thresholds for laser plasma instabilities (LPI) at intensities (10^15-10^16 W/cm^2) relevant to advanced implosion designs for direct drive inertial confinement fusion. The combination of short wavelength (248 nm), large bandwidth (1-2 THz), and beam smoothing by induced spatial incoherence available with this krypton-fluoride laser make these experiments unique among current facilities. This talk will present an overview of results with an emphasis on the two-plasmon decay instability (2φp). Measurements of x-rays and emission near ^1/2φo and ^3/2 φo harmonics of the laser wavelength have been collected over a wide range of intensities for both solid and foam targets. Data indicate collective multiple-angle driven excitation compatible with previous observations using solid planar targets.

Stimulus-driven and knowledge-driven processes in attention to warbles

NASA Astrophysics Data System (ADS)

Dowling, W. Jay; Tillmann, Barbara

2003-10-01

Listeners identified warbles differing in amplitude-modulation rate (3-10 Hz). And measured RT while listeners maintained above 90% correct responses. After a practice session listeners identified target warbles following stimulus-driven or knowledge-driven cues. The stimulus-driven cue was a 250-ms ``beep'' at the target pitch (valid) or another pitch (invalid); the knowledge-driven cue was a midrange ``melody'' pointing to the target pitch (always valid). A 500-ms target warble followed the cue after delays of 0-500 ms (250-750 ms SOA). The listener pressed a key to indicate ``slow'' or ``fast.'' RTs were shortest at the briefest delay. In contrast to results from a memory task, RTs here were much shorter, and we found no evidence for IOR or attentional blink. Listeners began generating responses while the target was still sounding. Invalid ``beeps'' slowed responses at the briefest (but not the longer) delays; adding a valid ``beep'' to the valid ``melody'' did not speed responses.

Benchmarking shielding simulations for an accelerator-driven spallation neutron source

DOE PAGES

Cherkashyna, Nataliia; Di Julio, Douglas D.; Panzner, Tobias; ...

2015-08-09

The shielding at an accelerator-driven spallation neutron facility plays a critical role in the performance of the neutron scattering instruments, the overall safety, and the total cost of the facility. Accurate simulation of shielding components is thus key for the design of upcoming facilities, such as the European Spallation Source (ESS), currently in construction in Lund, Sweden. In this paper, we present a comparative study between the measured and the simulated neutron background at the Swiss Spallation Neutron Source (SINQ), at the Paul Scherrer Institute (PSI), Villigen, Switzerland. The measurements were carried out at several positions along the SINQ monolithmore » wall with the neutron dosimeter WENDI-2, which has a well-characterized response up to 5 GeV. The simulations were performed using the Monte-Carlo radiation transport code Geant4, and include a complete transport from the proton beam to the measurement locations in a single calculation. An agreement between measurements and simulations is about a factor of 2 for the points where the measured radiation dose is above the background level, which is a satisfactory result for such simulations spanning many energy regimes, different physics processes and transport through several meters of shielding materials. The neutrons contributing to the radiation field emanating from the monolith were confirmed to originate from neutrons with energies above 1 MeV in the target region. The current work validates Geant4 as being well suited for deep-shielding calculations at accelerator-based spallation sources. We also extrapolate what the simulated flux levels might imply for short (several tens of meters) instruments at ESS.« less

The measurement programme at the neutron time-of-flight facility n_TOF at CERN

NASA Astrophysics Data System (ADS)

Gunsing, F.; Aberle, O.; Andrzejewski, J.; Audouin, L.; Bécares, V.; Bacak, M.; Balibrea-Correa, J.; Barbagallo, M.; Barros, S.; Bečvář, F.; Beinrucker, C.; Belloni, F.; Berthoumieux, E.; Billowes, J.; Bosnar, D.; Brown, A.; Brugger, M.; Caamaño, M.; Calviño, F.; Calviani, M.; Cano-Ott, D.; Cardella, R.; Casanovas, A.; Castelluccio, D. M.; Cerutti, F.; Chen, Y. H.; Chiaveri, E.; Colonna, N.; Cortés-Giraldo, M. A.; Cortés, G.; Cosentino, L.; Damone, L. A.; Deo, K.; Diakaki, M.; Domingo-Pardo, C.; Dressler, R.; Dupont, E.; Durán, I.; Fernández-Domínguez, B.; Ferrari, A.; Ferreira, P.; Finocchiaro, P.; Frost, R. J. W.; Furman, V.; Ganesan, S.; García, A. R.; Gawlik, A.; Gheorghe, I.; Gilardoni, S.; Glodariu, T.; Gonçalves, I. F.; González, E.; Goverdovski, A.; Griesmayer, E.; Guerrero, C.; Göbel, K.; Harada, H.; Heftrich, T.; Heinitz, S.; Hernández-Prieto, A.; Heyse, J.; Jenkins, D. G.; Jericha, E.; Käppeler, F.; Kadi, Y.; Kalamara, A.; Katabuchi, T.; Kavrigin, P.; Ketlerov, V.; Khryachkov, V.; Kimura, A.; Kivel, N.; Kokkoris, M.; Krtička, M.; Kurtulgil, D.; Leal-Cidoncha, E.; Lederer, C.; Leeb, H.; Lerendegui, J.; Licata, M.; Meo, S. Lo; Lonsdale, S. J.; Losito, R.; Macina, D.; Marganiec, J.; Martínez, T.; Masi, A.; Massimi, C.; Mastinu, P.; Mastromarco, M.; Matteucci, F.; Maugeri, E. A.; Mazzone, A.; Mendoza, E.; Mengoni, A.; Milazzo, P. M.; Mingrone, F.; Mirea, M.; Montesano, S.; Musumarra, A.; Nolte, R.; Negret, A.; Oprea, A.; Palomo-Pinto, F. R.; Paradela, C.; Patronis, N.; Pavlik, A.; Perkowski, J.; Porras, I.; Praena, J.; Quesada, J. M.; Radeck, D.; Rajeev, K.; Rauscher, T.; Reifarth, R.; Riego-Perez, A.; Robles, M.; Rout, P.; Rubbia, C.; Ryan, J. A.; Sabaté-Gilarte, M.; Saxena, A.; Schillebeeckx, P.; Schmidt, S.; Schumann, D.; Sedyshev, P.; Smith, A. G.; Sosnin, N. V.; Stamatopoulos, A.; Suryanarayana, S. V.; Tagliente, G.; Tain, J. L.; Tarifeño-Saldivia, A.; Tarrío, D.; Tassan-Got, L.; Tsinganis, A.; Valenta, S.; Vannini, G.; Variale, V.; Vaz, P.; Ventura, A.; Vlachoudis, V.; Vlastou, R.; Wallner, A.; Warren, S.; Weigand, M.; Weiss, C.; Wolf, C.; Woods, P. J.; Wright, T.; Žugec, P.

2017-09-01

Neutron-induced reaction cross sections are important for a wide variety of research fields ranging from the study of nuclear level densities, nucleosynthesis to applications of nuclear technology like design, and criticality and safety assessment of existing and future nuclear reactors, radiation dosimetry, medical applications, nuclear waste transmutation, accelerator-driven systems and fuel cycle investigations. Simulations and calculations of nuclear technology applications largely rely on evaluated nuclear data libraries. The evaluations in these libraries are based both on experimental data and theoretical models. CERN's neutron time-of-flight facility n_TOF has produced a considerable amount of experimental data since it has become fully operational with the start of its scientific measurement programme in 2001. While for a long period a single measurement station (EAR1) located at 185 m from the neutron production target was available, the construction of a second beam line at 20 m (EAR2) in 2014 has substantially increased the measurement capabilities of the facility. An outline of the experimental nuclear data activities at n_TOF will be presented.

Impact of High-Z Coatings on the Ablation Pressure of Laser Driven Targets.

NASA Astrophysics Data System (ADS)

Mostovych, Andrew; Oh, Jaechul; Schmitt, Andrew; Weaver, James

2007-11-01

Recent hydrodynamic experiments [1] with planar high-Z coated targets at the Naval Research Laboratory and spherical implosion experiments with high-Z coated shell targets [2] at the Omega facility all show significant improvement in target stability as a result of the high-Z coatings. For better understanding of the hydrodynamic processes it is important to know the changes in ablation pressure as a result of the high-Z layers. Using the Nike Laser, we have conducted new experiments to measure the change in shock speed of planar CH targets that are irradiated with and without the presence of a 200 Ang. gold high-Z coating. The evolution of shock propagation inside the targets is diagnosed with VISAR probing while average shock velocities are also measured by shock breakout detection from the stepped rear surface of the targets. We find that the high-Z layers produce a time dependent ablation pressure which is detected via the observation of non-steady shocks in the targets. Experimental results and comparisons to hydrodynamic simulations will be presented. Work supported by U. S. Department of Energy. [1] S.P. Obenschain et al., Phys. Plasmas 9, 2234 (2002). [2] A.N. Mostovych et al., APS Abstracts DPPFO3002M, (2005).

Ultra-High Gradient Channeling Acceleration in Nanostructures: Design/Progress of Proof-of-Concept (POC) Experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shin, Young Min; Green, A.; Lumpkin, A. H.

2016-09-16

A short bunch of relativistic particles or a short-pulse laser perturbs the density state of conduction electrons in a solid crystal and excites wakefields along atomic lattices in a crystal. Under a coupling condition the wakes, if excited, can accelerate channeling particles with TeV/m acceleration gradients in principle since the density of charge carriers (conduction electrons) in solids n 0 = ~ 10 20 – 10 23 cm -3 is significantly higher than what can be obtained in gaseous plasma. Nanostructures have some advantages over crystals for channeling applications of high power beams. The dechanneling rate can be reduced andmore » the beam acceptance increased by the large size of the channels. For beam-driven acceleration, a bunch length with a sufficient charge density would need to be in the range of the plasma wavelength to properly excite plasma wakefields, and channeled particle acceleration with the wakefields must occur before the ions in the lattices move beyond the restoring threshold. In the case of the excitation by short laser pulses, the dephasing length is appreciably increased with the larger channel, which enables channeled particles to gain sufficient amounts of energy. This paper describes simulation analyses on beam- and laser (X-ray)-driven accelerations in effective nanotube models obtained from Vsim and EPOCH codes. Experimental setups to detect wakefields are also outlined with accelerator facilities at Fermilab and NIU. In the FAST facility, the electron beamline was successfully commissioned at 50 MeV and it is being upgraded toward higher energies for electron accelerator R&D. The 50 MeV injector beamline of the facility is used for X-ray crystal-channeling radiation with a diamond target. It has been proposed to utilize the same diamond crystal for a channeling acceleration POC test. Another POC experiment is also designed for the NIU accelerator lab with time-resolved electron diffraction. Recently, a stable generation of single-cycle laser pulses with tens of Petawatt power based on thin film compression (TFC) technique has been investigated for target normal sheath acceleration (TNSA) and radiation pressure acceleration (RPA). The experimental plan with a nanometer foil is discussed with an available test facility such as Extreme Light Infrastructure – Nuclear Physics (ELI-NP).« less

Ultra-high gradient channeling acceleration in nanostructures: Design/progress of proof-of-concept (POC) experiments

NASA Astrophysics Data System (ADS)

Shin, Y. M.; Green, A.; Lumpkin, A. H.; Thurman-Keup, R. M.; Shiltsev, V.; Zhang, X.; Farinella, D. M.-A.; Taborek, P.; Tajima, T.; Wheeler, J. A.; Mourou, G.

2017-03-01

A short bunch of relativistic particles, or a short-pulse laser, perturb the density state of conduction electrons in a solid crystal and excite wakefields along atomic lattices in a crystal. Under a coupling condition between a driver and plasma, the wakes, if excited, can accelerate channeling particles with TeV/m acceleration gradients [1], in principle, since the density of charge carriers (conduction electrons) in solids n0 = 1020 - 1023 cm-3 is significantly higher than what was considered above in gaseous plasma. Nanostructures have some advantages over crystals for channeling applications of high power beams. The de-channeling rate can be reduced and the beam acceptance increased by the large size of the channels. For beam-driven acceleration, a bunch length with a sufficient charge density would need to be in the range of the plasma wavelength to properly excite plasma wakefields, and channeled particle acceleration with the wakefields must occur before the ions in the lattices move beyond the restoring threshold. In the case of the excitation by short laser pulses, the dephasing length is appreciably increased with the larger channel, which enables channeled particles to gain sufficient amounts of energy. This paper describes simulation analyses on beam- and laser (X-ray)-driven accelerations in effective nanotube models obtained from the Vsim and EPOCH codes. Experimental setups to detect wakefields are also outlined with accelerator facilities at Fermilab and Northern Illinois University (NIU). In the FAST facility, the electron beamline was successfully commissioned at 50 MeV, and it is being upgraded toward higher energies for electron accelerator R&D. The 50 MeV injector beamline of the facility is used for X-ray crystal-channeling radiation with a diamond target. It has been proposed to utilize the same diamond crystal for a channeling acceleration proof-of-concept (POC). Another POC experiment is also designed for the NIU accelerator lab with time-resolved electron diffraction. Recently, a stable generation of single-cycle laser pulses with tens of Petawatt power based on the thin film compression (TFC) technique has been investigated for target normal sheath acceleration (TNSA) and radiation pressure acceleration (RPA). The experimental plan with a nanometer foil is discussed with an available test facility such as Extreme Light Infrastructure - Nuclear Physics (ELI-NP).

2D hydrodynamic simulations of a variable length gas target for density down-ramp injection of electrons into a laser wakefield accelerator

NASA Astrophysics Data System (ADS)

Kononenko, O.; Lopes, N. C.; Cole, J. M.; Kamperidis, C.; Mangles, S. P. D.; Najmudin, Z.; Osterhoff, J.; Poder, K.; Rusby, D.; Symes, D. R.; Warwick, J.; Wood, J. C.; Palmer, C. A. J.

2016-09-01

In this work, two-dimensional (2D) hydrodynamic simulations of a variable length gas cell were performed using the open source fluid code OpenFOAM. The gas cell was designed to study controlled injection of electrons into a laser-driven wakefield at the Astra Gemini laser facility. The target consists of two compartments: an accelerator and an injector section connected via an aperture. A sharp transition between the peak and plateau density regions in the injector and accelerator compartments, respectively, was observed in simulations with various inlet pressures. The fluid simulations indicate that the length of the down-ramp connecting the sections depends on the aperture diameter, as does the density drop outside the entrance and the exit cones. Further studies showed, that increasing the inlet pressure leads to turbulence and strong fluctuations in density along the axial profile during target filling, and consequently, is expected to negatively impact the accelerator stability.

MEASUREMENTS OF NEUTRON SPECTRA IN 0.8-GEV AND 1.6-GEV PROTON-IRRADIATED<2 OF 2>NA THICK TARGETS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Titarenko, Y. E.; Batyaev, V. F.; Zhivun, V. M.

2001-01-01

Measurements of neutron spectra in W, and Na targets irradiated by 0.8 GeV and 1.6 GeV protons are presented. Measurements were made by the TOF techniques using the proton beam from ITEP U-10 synchrotron. Neutrons were detected with BICRON-511 liquid scintillator-based detectors. The neutron detection efficiency was calculated via the SCINFUL and CECIL codes. The W results are compared with the similar data obtained elsewhere. The measured neutron spectra are compared with the LAHET and CEM2k code simulations results. Attempt is made to explain some observed disagreements between experiments and simulations. The presented results are of interest both in termsmore » of nuclear data buildup and as a benchmark of the up-to-date predictive power of the simulation codes used in designing the hybrid accelerator-driven system (ADS) facilities with sodium-cooled tungsten targets.« less

Bright betatron X-ray radiation from a laser-driven-clustering gas target

PubMed Central

Chen, L. M.; Yan, W. C.; Li, D. Z.; Hu, Z. D.; Zhang, L.; Wang, W. M.; Hafz, N.; Mao, J. Y.; Huang, K.; Ma, Y.; Zhao, J. R.; Ma, J. L.; Li, Y. T.; Lu, X.; Sheng, Z. M.; Wei, Z. Y.; Gao, J.; Zhang, J.

2013-01-01

Hard X-ray sources from femtosecond (fs) laser-produced plasmas, including the betatron X-rays from laser wakefield-accelerated electrons, have compact sizes, fs pulse duration and fs pump-probe capability, making it promising for wide use in material and biological sciences. Currently the main problem with such betatron X-ray sources is the limited average flux even with ultra-intense laser pulses. Here, we report ultra-bright betatron X-rays can be generated using a clustering gas jet target irradiated with a small size laser, where a ten-fold enhancement of the X-ray yield is achieved compared to the results obtained using a gas target. We suggest the increased X-ray photon is due to the existence of clusters in the gas, which results in increased total electron charge trapped for acceleration and larger wiggling amplitudes during the acceleration. This observation opens a route to produce high betatron average flux using small but high repetition rate laser facilities for applications. PMID:23715033

YALINA facility a sub-critical Accelerator- Driven System (ADS) for nuclear energy research facility description and an overview of the research program (1997-2008).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gohar, Y.; Smith, D. L.; Nuclear Engineering Division

2010-04-28

The YALINA facility is a zero-power, sub-critical assembly driven by a conventional neutron generator. It was conceived, constructed, and put into operation at the Radiation Physics and Chemistry Problems Institute of the National Academy of Sciences of Belarus located in Minsk-Sosny, Belarus. This facility was conceived for the purpose of investigating the static and dynamic neutronics properties of accelerator driven sub-critical systems, and to serve as a neutron source for investigating the properties of nuclear reactions, in particular transmutation reactions involving minor-actinide nuclei. This report provides a detailed description of this facility and documents the progress of research carried outmore » there during a period of approximately a decade since the facility was conceived and built until the end of 2008. During its history of development and operation to date (1997-2008), the YALINA facility has hosted several foreign groups that worked with the resident staff as collaborators. The participation of Argonne National Laboratory in the YALINA research programs commenced in 2005. For obvious reasons, special emphasis is placed in this report on the work at YALINA facility that has involved Argonne's participation. Attention is given here to the experimental program at YALINA facility as well as to analytical investigations aimed at validating codes and computational procedures and at providing a better understanding of the physics and operational behavior of the YALINA facility in particular, and ADS systems in general, during the period 1997-2008.« less

Organizational and environmental correlates of the adoption of a focus strategy in U.S. hospices.

PubMed

Apenteng, Bettye A; Nayar, Preethy; Yu, Fang; Adams, John; Opoku, Samuel T

2015-01-01

The hospice industry has experienced rapid growth in the last decade and has become a prominent component of the U.S. health care delivery system. In recent decades, the number of hospices serving nursing facility residents has increased. However, there is paucity of research on the organizational and environmental determinants of this strategic behavior. The aim of this study was to empirically identify the factors associated with the adoption of a nursing facility focus strategy in U.S. hospices. A nursing facility focus strategy was defined in this study as a strategic choice to target the provision of hospice services to skilled nursing facility or nursing home residents. This study employed a longitudinal study design with lagged independent variables in answering its research questions. Data for the study's dependent variables are obtained for the years 2005-2008, whereas data for the independent variables are obtained for the years 2004-2007, representing a 1-year lag. Mixed effects regression models were used in the multivariate regression analyses. Using a resource dependence framework, the findings from this study indicate that organizational size, community wealth, competition, and ownership type are important predictors of the adoption of a nursing facility focus strategy. Hospices may be adopting a nursing facility focus strategy in response to increasing competition. The decision to focus the provision of care to nursing facility residents may be driven by the need to secure stability in referrals. Further empirical exploration of the performance implications of adopting a nursing facility focus strategy is warranted.

On the potential of laser driven isotope generation at ELI-NP for positron emission tomography

NASA Astrophysics Data System (ADS)

Cucoanes, A. S.; Balabanski, D. L.; Canova, F.; Cuong, P.; Negoita, F.; Puicea, F.; Tanaka, K. A.

2017-05-01

The huge progress made in the laser driven ion acceleration had open the possibility of using ions generated in high power laser interactions with solid targets for the production of medical isotopes. Indeed, lasers could provide several key features with respect to the traditional method where the target activation is produced by particle beams delivered by cyclotrons. The price and the dimensions of high power lasers are on a descendant slope and the quality of the produced ion beams is continuously increasing. However, in order to compete with cyclotrons, the average proton current intensity has to be increased for example by increasing the frequency of the laser pulses. In our contribution, we review the general ideas of the laser-based radioisotope production and we present our analysis on the potential of the medical isotope generation at ELI-NP with a focus on 18F. We use estimations of the proton beam parameters and a code implemented in Geant4 for computing the yield of the main production channel taking into account the experimental conditions available soon at ELI-NP. The obtained results are compatible with previous studies and will be verified by experiments foreseen at the future ELI-NP facility, under construction now in Magurele, Romania.

Design of a line-VISAR interferometer system for the Sandia Z Machine

NASA Astrophysics Data System (ADS)

Galbraith, J.; Austin, K.; Baker, J.; Bettencourt, R.; Bliss, E.; Celeste, J.; Clancy, T.; Cohen, S.; Crosley, M.; Datte, P.; Fratanduono, D.; Frieders, G.; Hammer, J.; Jackson, J.; Johnson, D.; Jones, M.; Koen, D.; Lusk, J.; Martinez, A.; Massey, W.; McCarville, T.; McLean, H.; Raman, K.; Rodriguez, S.; Spencer, D.; Springer, P.; Wong, J.

2017-08-01

A joint team comprised of Lawrence Livermore National Laboratory (LLNL) and Sandia National Laboratory (SNL) personnel is designing a line-VISAR (Velocity Interferometer System for Any Reflector) for the Sandia Z Machine, Z Line-VISAR. The diagnostic utilizes interferometry to assess current delivery as a function of radius during a magnetically-driven implosion. The Z Line-VISAR system is comprised of the following: a two-leg line-VISAR interferometer, an eight-channel Gated Optical Imager (GOI), and a fifty-meter transport beampath to/from the target of interest. The Z Machine presents unique optomechanical design challenges. The machine utilizes magnetically driven pulsed power to drive a target to elevated temperatures and pressures useful for high energy density science. Shock accelerations exceeding 30g and a strong electromagnetic pulse (EMP) are generated during the shot event as the machine discharges currents of over 25 million amps. Sensitive optical components must be protected from shock loading, and electrical equipment must be adequately shielded from the EMP. The optical design must accommodate temperature and humidity fluctuations in the facility as well as airborne hydrocarbons from the pulsed power components. We will describe the engineering design and concept of operations of the Z Line-VISAR system. Focus will be on optomechanical design.

Studies of bandwidth dependence of laser plasma instabilities driven by the Nike laser

NASA Astrophysics Data System (ADS)

Weaver, J.; Kehne, D.; Obenschain, S.; Serlin, V.; Schmitt, A. J.; Oh, J.; Lehmberg, R. H.; Brown, C. M.; Seely, J.; Feldman, U.

2012-10-01

Experiments at the Nike laser facility of the Naval Research Laboratory are exploring the influence of laser bandwidth on laser plasma instabilities (LPI) driven by a deep ultraviolet pump (248 nm) that incorporates beam smoothing by induced spatial incoherence (ISI). In early ISI studies with longer wavelength Nd:glass lasers (1054 nm and 527 nm),footnotetextObenschain, PRL 62(1989);Mostovych, PRL 62(1987);Peyser, Phys. Fluids B 3(1991). stimulated Raman scattering, stimulated Brillouin scattering, and the two plasmon decay instability were reduced when wide bandwidth ISI (δν/ν˜0.03-0.19%) pulses irradiated targets at moderate to high intensities (10^14-10^15 W/cm^2). The current studies will compare the emission signatures of LPI from planar CH targets during Nike operation at large bandwidth (δν˜1THz) to observations for narrower bandwidth operation (δν˜0.1-0.3THz). These studies will help clarify the relative importance of the short wavelength and wide bandwidth to the increased LPI intensity thresholds observed at Nike. New pulse shapes are being used to generate plasmas with larger electron density scale-lengths that are closer to conditions during pellet implosions for direct drive inertial confinement fusion.

Calculations vs. Measurements for Remnant Dose Rates from SNS Spent Structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Popova, Irina I.; Gallmeier, Franz X.; Trotter, Steven M.

The Spallation Neutron Source (SNS) in Oak Ridge, Tennessee, is an accelerator driven neutron scattering facility for materials research. Presently SNS is capable to operate at 1.4 MW proton beam power incident on a mercury target with a proton beam energy of 1 GeV and 60 Hz repetition rate. SNS target system components are periodically replaced because they reach their end-of-life due to radiation induced material damage. Target vessel, which houses mercury target, is exchanged about two-three times per year and the proton beam window (PBW) is exchanged every two – three years.Each spent structure that leaves the SNS sitemore » requires supporting documentation with radionuclide inventory and dose rate prediction for the time of the transportation. Neutronics analyses are performed, assuming realistic irradiation history and decay case to ensure that the container/package, housing the structure, is compliant with the waste management regulations. Analyses are complex due to geometry, multi-code usage and following data treatment.To validate analyses, measurements of dose rates from the spent target vessel # 13 and PBW module #5 were performed. Neutronics analyses were performed to calculate residual dose rates from both structures for the time of measurements.« less

Improving agreement between static method and dynamic formula for driven cast-in-place piles : [technical brief].

DOT National Transportation Integrated Search

2013-08-01

Many transportation facility structures in Wisconsin are founded on driven round, closed-end, steel, pipe piles. The piles are driven to capacity and then filled with concrete. The Wisconsin Department of Transportation (WisDOT) has designed and driv...

Time-resolved measurements of the hot-electron population in ignition-scale experiments on the National Ignition Facility (invited)

NASA Astrophysics Data System (ADS)

Hohenberger, M.; Albert, F.; Palmer, N. E.; Lee, J. J.; Döppner, T.; Divol, L.; Dewald, E. L.; Bachmann, B.; MacPhee, A. G.; LaCaille, G.; Bradley, D. K.; Stoeckl, C.

2014-11-01

In laser-driven inertial confinement fusion, hot electrons can preheat the fuel and prevent fusion-pellet compression to ignition conditions. Measuring the hot-electron population is key to designing an optimized ignition platform. The hot electrons in these high-intensity, laser-driven experiments, created via laser-plasma interactions, can be inferred from the bremsstrahlung generated by hot electrons interacting with the target. At the National Ignition Facility (NIF) [G. H. Miller, E. I. Moses, and C. R. Wuest, Opt. Eng. 43, 2841 (2004)], the filter-fluorescer x-ray (FFLEX) diagnostic-a multichannel, hard x-ray spectrometer operating in the 20-500 keV range-has been upgraded to provide fully time-resolved, absolute measurements of the bremsstrahlung spectrum with ˜300 ps resolution. Initial time-resolved data exhibited significant background and low signal-to-noise ratio, leading to a redesign of the FFLEX housing and enhanced shielding around the detector. The FFLEX x-ray sensitivity was characterized with an absolutely calibrated, energy-dispersive high-purity germanium detector using the high-energy x-ray source at NSTec Livermore Operations over a range of K-shell fluorescence energies up to 111 keV (U Kβ). The detectors impulse response function was measured in situ on NIF short-pulse (˜90 ps) experiments, and in off-line tests.

Proton deflectometry of laser-driven relativistic electron jet from thin foil target

NASA Astrophysics Data System (ADS)

Huang, Chengkun; Palaniyappan, S.; Gautier, D. C.; Johnson, R. P.; Shimada, T.; Fernandez, J. C.; Tsung, F. S.; Mori, W. B.

2017-10-01

Near critical density relativistic electron jets from laser solid interaction carry currents approaching the Alfvén-limit and tens of kilo-Tesla magnetic fields. Such jets are often found in kinetic simulations with low areal density targets, but have not been confirmed experimentally. They may be used for X/gamma-ray generation and is also important for the understanding of post-transparency plasma dynamics. With a short-pulse probe beam at the Trident laser facility, we employed proton deflectometry to infer the jet's properties, structure and the long-time dynamics. We develop corresponding GEANT4 simulation model of the proton deflectometry, with input from the kinetic PIC simulations in 2D and quasi-3D geometry, to compare with the experimental radiography images. Detail comparison of the experimental and simulation features in the deflectometry will be discussed. Work supported by the LDRD program at LANL.

Working memory-driven attention improves spatial resolution: Support for perceptual enhancement.

PubMed

Pan, Yi; Luo, Qianying; Cheng, Min

2016-08-01

Previous research has indicated that attention can be biased toward those stimuli matching the contents of working memory and thereby facilitates visual processing at the location of the memory-matching stimuli. However, whether this working memory-driven attentional modulation takes place on early perceptual processes remains unclear. Our present results showed that working memory-driven attention improved identification of a brief Landolt target presented alone in the visual field. Because the suprathreshold target appeared without any external noise added (i.e., no distractors or masks), the results suggest that working memory-driven attention enhances the target signal at early perceptual stages of visual processing. Furthermore, given that performance in the Landolt target identification task indexes spatial resolution, this attentional facilitation indicates that working memory-driven attention can boost early perceptual processing via enhancement of spatial resolution at the attended location.

Laboratory study of hyper-elocity impact-driven chemical reactions and surface evolution in icy targets.

NASA Astrophysics Data System (ADS)

Ulibarri, Z.; Munsat, T.; Dee, R.; Horanyi, M.; James, D.; Kempf, S.; Nagle, M.; Sternovsky, Z.

2017-12-01

Although ice is prevalent in the solar system and the long-term evolution of many airless icy bodies is affected by hypervelocity micrometeoroid bombardment, there has been little experimental investigation into these impact phenomena, especially at the impact speeds encountered in space. For example, there is little direct information about how dust impacts alter the local chemistry, and dust impacts may be an important mechanism for creating complex organic molecules necessary for life. Laser ablation and light-gas gun experiments simulating dust impacts have successfully created amino acid precursors from base components in ice surfaces. Additionally, the Cassini mission revealed CO2 deposits in icy satellites of Saturn, which may have been created by dust impacts. With the creation of a cryogenically cooled ice target for the dust accelerator facility at the NASA SSERVI-funded Institute for Modeling Plasma, Atmospheres, and Cosmic Dust (IMPACT), it is now possible to study the effects of micrometeoroid impacts in a controlled environment under conditions and at energies typically encountered in nature. Complex ice-target mixtures are created with a flash-freezing target which allows for homogeneous mixtures to be frozen in place even with salt mixtures that otherwise would form inhomogeneous ice surfaces. Coupled with the distinctive capabilities of the IMPACT dust facility, highly valuable data concerning the evolution of icy bodies under hypervelocity bombardment and the genesis of complex organic chemistry on these icy bodies can be gathered in unique and tightly controlled experiments. Results from recent and ongoing investigations will be presented.

Medical Isotope Production Analyses In KIPT Neutron Source Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Talamo, Alberto; Gohar, Yousry

Medical isotope production analyses in Kharkov Institute of Physics and Technology (KIPT) neutron source facility were performed to include the details of the irradiation cassette and the self-shielding effect. An updated detailed model of the facility was used for the analyses. The facility consists of an accelerator-driven system (ADS), which has a subcritical assembly using low-enriched uranium fuel elements with a beryllium-graphite reflector. The beryllium assemblies of the reflector have the same outer geometry as the fuel elements, which permits loading the subcritical assembly with different number of fuel elements without impacting the reflector performance. The subcritical assembly is drivenmore » by an external neutron source generated from the interaction of 100-kW electron beam with a tungsten target. The facility construction was completed at the end of 2015, and it is planned to start the operation during the year of 2016. It is the first ADS in the world, which has a coolant system for removing the generated fission power. Argonne National Laboratory has developed the design concept and performed extensive design analyses for the facility including its utilization for the production of different radioactive medical isotopes. 99Mo is the parent isotope of 99mTc, which is the most commonly used medical radioactive isotope. Detailed analyses were performed to define the optimal sample irradiation location and the generated activity, for several radioactive medical isotopes, as a function of the irradiation time.« less

MYRRHA: A multipurpose nuclear research facility

NASA Astrophysics Data System (ADS)

Baeten, P.; Schyns, M.; Fernandez, Rafaël; De Bruyn, Didier; Van den Eynde, Gert

2014-12-01

MYRRHA (Multi-purpose hYbrid Research Reactor for High-tech Applications) is a multipurpose research facility currently being developed at SCK•CEN. MYRRHA is based on the ADS (Accelerator Driven System) concept where a proton accelerator, a spallation target and a subcritical reactor are coupled. MYRRHA will demonstrate the ADS full concept by coupling these three components at a reasonable power level to allow operation feedback. As a flexible irradiation facility, the MYRRHA research facility will be able to work in both critical as subcritical modes. In this way, MYRRHA will allow fuel developments for innovative reactor systems, material developments for GEN IV and fusion reactors, and radioisotope production for medical and industrial applications. MYRRHA will be cooled by lead-bismuth eutectic and will play an important role in the development of the Pb-alloys technology needed for the LFR (Lead Fast Reactor) GEN IV concept. MYRRHA will also contribute to the study of partitioning and transmutation of high-level waste. Transmutation of minor actinides (MA) can be completed in an efficient way in fast neutron spectrum facilities, so both critical reactors and subcritical ADS are potential candidates as dedicated transmutation systems. However critical reactors heavily loaded with fuel containing large amounts of MA pose reactivity control problems, and thus safety problems. A subcritical ADS operates in a flexible and safe manner, even with a core loading containing a high amount of MA leading to a high transmutation rate. In this paper, the most recent developments in the design of the MYRRHA facility are presented.

Are Improvements in Measured Performance Driven by Better Treatment or "Denominator Management"?

PubMed

Harris, Alex H S; Chen, Cheng; Rubinsky, Anna D; Hoggatt, Katherine J; Neuman, Matthew; Vanneman, Megan E

2016-04-01

Process measures of healthcare quality are usually formulated as the number of patients who receive evidence-based treatment (numerator) divided by the number of patients in the target population (denominator). When the systems being evaluated can influence which patients are included in the denominator, it is reasonable to wonder if improvements in measured quality are driven by expanding numerators or contracting denominators. In 2003, the US Department of Veteran Affairs (VA) based executive compensation in part on performance on a substance use disorder (SUD) continuity-of-care quality measure. The first goal of this study was to evaluate if implementing the measure in this way resulted in expected improvements in measured performance. The second goal was to examine if the proportion of patients with SUD who qualified for the denominator contracted after the quality measure was implemented, and to describe the facility-level variation in and correlates of denominator contraction or expansion. Using 40 quarters of data straddling the implementation of the performance measure, an interrupted time series design was used to evaluate changes in two outcomes. All veterans with an SUD diagnosis in all VA facilities from fiscal year 2000 to 2009. The two outcomes were 1) measured performance-patients retained/patients qualified and 2) denominator prevalence-patients qualified/patients with SUD program contact. Measured performance improved over time (P < 0.001). Notably, the proportion of patients with SUD program contact who qualified for the denominator decreased more rapidly after the measure was implemented (p = 0.02). Facilities with higher pre-implementation denominator prevalence had steeper declines in denominator prevalence after implementation (p < 0.001). These results should motivate the development of measures that are less vulnerable to denominator management, and also the exploration of "shadow measures" to monitor and reduce undesirable denominator management.

Bioeconomic analysis of child-targeted subsidies for artemisinin combination therapies: a cost-effectiveness analysis

PubMed Central

Klein, Eili Y.; Smith, David L.; Cohen, Justin M.; Laxminarayan, Ramanan

2015-01-01

The Affordable Medicines Facility for malaria (AMFm) was conceived as a global market-based mechanism to increase access to effective malaria treatment and prolong effectiveness of artemisinin. Although results from a pilot implementation suggested that the subsidy was effective in increasing access to high-quality artemisinin combination therapies (ACTs), the Global Fund has converted AMFm into a country-driven mechanism whereby individual countries could choose to fund the subsidy from within their country envelopes. Because the initial costs of the subsidy in the pilot countries was higher than expected, countries are also exploring alternatives to a universal subsidy, such as subsidizing only child doses. We examined the incremental cost-effectiveness of a child-targeted policy using an age-structured bioeconomic model of malaria from the provider perspective. Because the vast majority of malaria deaths occur in children, targeting children could potentially improve the cost-effectiveness of the subsidy, though it would avert significantly fewer deaths. However, the benefits of a child-targeted subsidy (i.e. deaths averted) are eroded as leakage (i.e. older individuals taking young child-targeted doses) increases, with few of the benefits of a universal subsidy gained (i.e. reductions in overall prevalence). Although potentially more cost-effective, a child-targeted subsidy must contain measures to reduce the possibility of leakage. PMID:25994293

Observed transition from Richtmyer-Meshkov jet formation through feedout oscillations to Rayleigh-Taylor instability in a laser target

NASA Astrophysics Data System (ADS)

Aglitskiy, Y.; Karasik, M.; Velikovich, A. L.; Serlin, V.; Weaver, J. L.; Kessler, T. J.; Schmitt, A. J.; Obenschain, S. P.; Nikitin, S. P.; Metzler, N.; Oh, J.

2012-10-01

Experimental study of hydrodynamic perturbation evolution triggered by a laser-driven shock wave breakout at the free rippled rear surface of a plastic target is reported. We observed a transition between two qualitatively distinct types of perturbation evolution: jet formation at low shock pressure and areal mass oscillations at high shock pressure, which correspond respectively to high and low values of effective adiabatic index. The experiments were done on the KrF Nike laser facility with laser wavelength 248 nm and a 4 ns pulse. We varied the number of beams overlapped on the plastic target to change the ablative pressure driving the shock wave through the target: 36 beams produce pressure of ˜8 Mbar, whereas a single beam irradiation reduces the pressure to ˜0.7 Mbar. With the help of side-on monochromatic x-ray imaging, planar jets manifesting the development of the Richtmyer-Meshkov-type instability in a non-accelerated target are observed at sub-megabar shock pressure. As the shock pressure exceeds 1 Mbar, instead of jet formation an oscillatory rippled expansion wave is observed, followed by the ``feedout'' of the rear-surface perturbations to the ablation front and the development of the Rayleigh-Taylor instability, which breaks up the accelerated target.

Comparison of short-lived medical isotopes activation by laser thin target induced protons and conventional cyclotron proton beams

NASA Astrophysics Data System (ADS)

Murray, Joseph; Dudnikova, Galina; Liu, Tung-Chang; Papadopoulos, Dennis; Sagdeev, Roald; Su, J. J.; UMD MicroPET Team

2014-10-01

Production diagnostic or therapeutic nuclear medicines are either by nuclear reactors or by ion accelerators. In general, diagnostic nuclear radioisotopes have a very short half-life varying from tens of minutes for PET tracers and few hours for SPECT tracers. Thus supplies of PET and SPECT radiotracers are limited by regional production facilities. For example 18F-fluorodeoxyglucose (FDG) is the most desired tracer for positron emission tomography because its 110 minutes half-life is sufficient long for transport from production facilities to nearby users. From nuclear activation to completing image taking must be done within 4 hours. Decentralized production of diagnostic radioisotopes will be idea to make high specific activity radiotracers available to researches and clinicians. 11 C, 13 N, 15 O and 18 F can be produced in the energy range from 10-20 MeV by protons. Protons of energies up to tens of MeV generated by intense laser interacting with hydrogen containing targets have been demonstrated by many groups in the past decade. We use 2D PIC code for proton acceleration, Geant4 Monte Carlo code for nuclei activation to compare the yields and specific activities of short-lived isotopes produced by cyclotron proton beams and laser driven protons.

The ideal neutrino beams

NASA Astrophysics Data System (ADS)

Lindroos, Mats

2009-06-01

The advance in neutrino oscillation physics is driven by the availability of well characterized and high flux neutrino beams. The three present options for the next generation neutrino oscillation facility are super beams, neutrino factories and beta-beams. A super-beam is a very high intensity classical neutrino beam generated by protons impinging on a target where the neutrinos are generated by the secondary particles decaying in a tunnel down streams of the target. In a neutrino factory the neutrinos are generated from muons decaying in a storage ring with long straight sections pointing towards the detectors. In a beta-beam the neutrinos are also originating from decay in a storage ring but the decaying particles are radioactive ions rather than muons. I will in this presentation review the three options and discuss the pros and cons of each. The present joint design effort for a future high intensity neutrino oscillation in Europe within a common EU supported design study, EURONU, will also be presented. The design study will explore the physics reach, the detectors, the feasibility, the safety issues and the cost for each of the options so that the the community can take a decision on what to build when the facilities presently under exploitation and construction have to be replaced.

Laser parametric instability experiments of a 3ω, 15 kJ, 6-ns laser pulse in gas-filled hohlraums at the Ligne d'Intégration Laser facility

NASA Astrophysics Data System (ADS)

Rousseaux, C.; Huser, G.; Loiseau, P.; Casanova, M.; Alozy, E.; Villette, B.; Wrobel, R.; Henry, O.; Raffestin, D.

2015-02-01

Experimental investigation of stimulated Raman (SRS) and Brillouin (SBS) scattering have been obtained at the Ligne-d'Intégration-Laser facility (LIL, CEA-Cesta, France). The parametric instabilities (LPI) are driven by firing four laser beamlets (one quad) into millimeter size, gas-filled hohlraum targets. A quad delivers energy on target of 15 kJ at 3ω in a 6-ns shaped laser pulse. The quad is focused by means of 3ω gratings and is optically smoothed with a kinoform phase plate and with smoothing by spectral dispersion-like 2 GHz and/or 14 GHz laser bandwidth. Open- and closed-geometry hohlraums have been used, all being filled with 1-atm, neo-pentane (C5H12) gas. For SRS and SBS studies, the light backscattered into the focusing optics is analyzed with spectral and time resolutions. Near-backscattered light at 3ω and transmitted light at 3ω are also monitored in the open geometry case. Depending on the target geometry (plasma length and hydrodynamic evolution of the plasma), it is shown that, at maximum laser intensity about 9 × 1014 W/cm2, Raman reflectivity noticeably increases up to 30% in 4-mm long plasmas while SBS stays below 10%. Consequently, laser transmission through long plasmas drops to about 10% of incident energy. Adding 14 GHz bandwidth to the laser always reduces LPI reflectivities, although this reduction is not dramatic.

Development of in situ time-resolved Raman spectroscopy facility for dynamic shock loading in materials

NASA Astrophysics Data System (ADS)

Chaurasia, S.; Rastogi, V.; Rao, U.; Sijoy, C. D.; Mishra, V.; Deo, M. N.

2017-11-01

The transient state of excitation and relaxation processes in materials under shock compression can be investigated by coupling the laser driven shock facility with Raman spectroscopy. For this purpose, a time resolved Raman spectroscopy setup has been developed to monitor the physical and the chemical changes such as phase transitions, chemical reactions, molecular kinetics etc., under shock compression with nanosecond time resolution. This system consist of mainly three parts, a 2 J/8 ns Nd:YAG laser system used for generation of pump and probe beams, a Raman spectrometer with temporal and spectral resolution of 1.2 ns and 3 cm-1 respectively and a target holder in confinement geometry assembly. Detailed simulation for the optimization of confinement geometry targets is performed. Time resolved measurement of polytetrafluoroethylene (PTFE) targets at focused laser intensity of 2.2 GW/cm2 has been done. The corresponding pressure in the Aluminum and PTFE are 3.6 and 1.7 GPa respectively. At 1.7 GPa in PTFE, a red shift of 5 cm-1 is observed for the CF2 twisting mode (291 cm-1). Shock velocity in PTFE is calculated by measuring rate of change of ratios of the intensity of Raman lines scattered from shocked volume to total volume of sample in the laser focal spot along the laser axis. The calculated shock velocity in PTFE is found to be 1.64 ± 0.16 km/s at shock pressure of 1.7 GPa, for present experimental conditions.

The physics of sub-critical lattices in accelerator driven hybrid systems: The MUSE experiments in the MASURCA facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chauvin, J. P.; Lebrat, J. F.; Soule, R.

Since 1991, the CEA has studied the physics of hybrid systems, involving a sub-critical reactor coupled with an accelerator. These studies have provided information on the potential of hybrid systems to transmute actinides and, long lived fission products. The potential of such a system remains to be proven, specifically in terms of the physical understanding of the different phenomena involved and their modelling, as well as in terms of experimental validation of coupled systems, sub-critical environment/accelerator. This validation must be achieved through mock-up studies of the sub-critical environments coupled to a source of external neutrons. The MUSE-4 mock-up experiment ismore » planed at the MASURCA facility and will use an accelerator coupled to a tritium target. The great step between the generator used in the past and the accelerator will allow to increase the knowledge in hybrid physic and to decrease the experimental biases and the measurement uncertainties.« less

Three-Dimensional Simulations of Flat-Foil Laser-Imprint Experiments at the National Ignition Facility

NASA Astrophysics Data System (ADS)

Shvydky, A.; Radha, P. B.; Rosenberg, M. J.; Anderson, K. S.; Goncharov, V. N.; Marozas, J. A.; Marshall, F. J.; McKenty, P. W.; Regan, S. P.; Sangster, T. C.; Hohenberger, M.; di Nicola, J. M.; Koning, J. M.; Marinak, M. M.; Masse, L.; Karasik, M.

2017-10-01

Control of shell nonuniformities imprinted by the laser and amplified by hydrodynamic instabilities in the imploding target is critical for the success of direct-drive ignition at the National Ignition Facility (NIF). To measure a level of imprint and its reduction by the NIF smoothing by spectral dispersion (SSD), we performed experiments that employed flat CH foils driven with a single NIF beam with either no SSD or the NIF indirect-drive SSD applied to the laser pulse. Face-on x-ray radiography was used to measure optical depth variations, from which the amplitudes of the foil areal-density modulations were obtained. Results of 3-D, radiation-hydrodynamic code HYDRA simulations of the growth of the imprint-seeded perturbations are presented and compared with the experimental data. This work was supported by the U.S. Department of Energy National Nuclear Security Administration under Award Number DE-NA0001944 and under the auspices of the Lawrence Livermore National Security, LLC, (LLNS) under Contract Number DE-AC52-07NA27344.

A survey of the three-dimensional high Reynolds number transonic wind tunnel

NASA Technical Reports Server (NTRS)

Takashima, K.; Sawada, H.; Aoki, T.

1982-01-01

The facilities for aerodynamic testing of airplane models at transonic speeds and high Reynolds numbers are surveyed. The need for high Reynolds number testing is reviewed, using some experimental results. Some approaches to high Reynolds number testing such as the cryogenic wind tunnel, the induction driven wind tunnel, the Ludwieg tube, the Evans clean tunnel and the hydraulic driven wind tunnel are described. The level of development of high Reynolds number testing facilities in Japan is discussed.

The composition of M-type asteroids: Synthesis of spectroscopic and radar observations

NASA Astrophysics Data System (ADS)

Neeley, J. R.; Ockert-Bell, M. E.; Clark, B. E.; Shepard, M. K.; Cloutis, E. A.; Fornasier, S.; Bus, S. J.

2011-10-01

This work updates our and expands our long term radar-driven observational campaign of 27 main-belt asteroids (MBAs) focused on Bus-DeMeo Xc- and Xk-type objects (Tholen X and M class asteroids) using the Arecibo radar and NASA Infrared Telescope Facilities (IRTF). Seventeen of our targets were near-simultaneously observed with radar and those observations are described in companion paper (Shepard et al., 2010). We utilized visible wavelength for a more complete compositional analysis of our targets. Compositional evidence is derived from our target asteroid spectra using three different methods: 1) a χ2 search for spectral matches in the RELAB database, 2) parametric comparisons with meteorites and 3) linear discriminant analysis. This paper synthesizes the results of the RELAB search, parametric comparisons, and linear discriminant analysis with compositional suggestions based on radar observations. We find that for six of seventeen targets with radar data, our spectral results are consistent with their radar analog (16 Psyche, 21 Lutetia, 69 Hesperia, 135 Hertha, 216 Kleopatra, and 497 Iva). For twenty out of twenty-seven objects our statistical comparisons with RELAB meteorites result in consistent analog identification, providing a degree of confidence in our parametric methods.

Energy transport in short-pulse-laser-heated targets measured using extreme ultraviolet laser backlighting.

PubMed

Wilson, L A; Tallents, G J; Pasley, J; Whittaker, D S; Rose, S J; Guilbaud, O; Cassou, K; Kazamias, S; Daboussi, S; Pittman, M; Delmas, O; Demailly, J; Neveu, O; Ros, D

2012-08-01

The accurate characterization of thermal electron transport and the determination of heating by suprathermal electrons in laser driven solid targets are both issues of great importance to the current experiments being performed at the National Ignition Facility, which aims to achieve thermonuclear fusion ignition using lasers. Ionization, induced by electronic heat conduction, can cause the opacity of a material to drop significantly once bound-free photoionization is no longer energetically possible. We show that this drop in opacity enables measurements of the transmission of extreme ultraviolet (EUV) laser pulses at 13.9 nm to act as a signature of the heating of thin (50 nm) iron layers with a 50-nm thick parylene-N (CH) overlay irradiated by 35-fs pulses at irradiance 3×10(16) Wcm(-2). Comparing EUV transmission measurements at different times after irradiation to fluid code simulations shows that the target is instantaneously heated by hot electrons (with approximately 10% of the laser energy), followed by thermal conduction with a flux limiter of ≈0.05.

Simulation study of 3-5 keV x-ray conversion efficiency from Ar K-shell vs. Ag L-shell targets on the National Ignition Facility laser

NASA Astrophysics Data System (ADS)

Kemp, G. E.; Colvin, J. D.; Fournier, K. B.; May, M. J.; Barrios, M. A.; Patel, M. V.; Scott, H. A.; Marinak, M. M.

2015-05-01

Tailored, high-flux, multi-keV x-ray sources are desirable for studying x-ray interactions with matter for various civilian, space and military applications. For this study, we focus on designing an efficient laser-driven non-local thermodynamic equilibrium 3-5 keV x-ray source from photon-energy-matched Ar K-shell and Ag L-shell targets at sub-critical densities (˜nc/10) to ensure supersonic, volumetric laser heating with minimal losses to kinetic energy, thermal x rays and laser-plasma instabilities. Using Hydra, a multi-dimensional, arbitrary Lagrangian-Eulerian, radiation-hydrodynamics code, we performed a parameter study by varying initial target density and laser parameters for each material using conditions readily achievable on the National Ignition Facility (NIF) laser. We employ a model, benchmarked against Kr data collected on the NIF, that uses flux-limited Lee-More thermal conductivity and multi-group implicit Monte-Carlo photonics with non-local thermodynamic equilibrium, detailed super-configuration accounting opacities from Cretin, an atomic-kinetics code. While the highest power laser configurations produced the largest x-ray yields, we report that the peak simulated laser to 3-5 keV x-ray conversion efficiencies of 17.7% and 36.4% for Ar and Ag, respectively, occurred at lower powers between ˜100-150 TW. For identical initial target densities and laser illumination, the Ag L-shell is observed to have ≳10× higher emissivity per ion per deposited laser energy than the Ar K-shell. Although such low-density Ag targets have not yet been demonstrated, simulations of targets fabricated using atomic layer deposition of Ag on silica aerogels (˜20% by atomic fraction) suggest similar performance to atomically pure metal foams and that either fabrication technique may be worth pursuing for an efficient 3-5 keV x-ray source on NIF.

Can contracted out health facilities improve access, equity, and quality of maternal and newborn health services? Evidence from Pakistan.

PubMed

Zaidi, Shehla; Riaz, Atif; Rabbani, Fauziah; Azam, Syed Iqbal; Imran, Syeda Nida; Pradhan, Nouhseen Akber; Khan, Gul Nawaz

2015-11-25

The case of contracting out government health services to non-governmental organizations (NGOs) has been weak for maternal, newborn, and child health (MNCH) services, with documented gains being mainly in curative services. We present an in-depth assessment of the comparative advantages of contracting out on MNCH access, quality, and equity, using a case study from Pakistan. An end-line, cross-sectional assessment was conducted of government facilities contracted out to a large national NGO and government-managed centres serving as controls, in two remote rural districts of Pakistan. Contracting out was specific for augmenting MNCH services but without contractual performance incentives. A household survey, a health facility survey, and focus group discussions with client and spouses were used for assessment. Contracted out facilities had a significantly higher utilization as compared to control facilities for antenatal care, delivery, postnatal care, emergency obstetric care, and neonatal illness. Contracted facilities had comparatively better quality of MNCH services but not in all aspects. Better household practices were also seen in the district where contracting involved administrative control over outreach programs. Contracting was also faced with certain drawbacks. Facility utilization was inequitably higher amongst more educated and affluent clients. Contracted out catchments had higher out-of-pocket expenses on MNCH services, driven by steeper transport costs and user charges for additional diagnostics. Contracting out did not influence higher MNCH service coverage rates across the catchment. Physical distances, inadequate transport, and low demand for facility-based care in non-emergency settings were key client-reported barriers. Contracting out MNCH services at government health facilities can improve facility utilization and bring some improvement in  quality of services. However, contracting out of health facilities is insufficient to increase service access across the catchment in remote rural contexts and requires accompanying measures for demand enhancement, transportation access, and targeting of the more disadvantaged clientele.

Laser driven plasmas based incoherent x-ray sources at PALS and ELI Beamlines (Conference Presentation)

NASA Astrophysics Data System (ADS)

Kozlová, Michaela

2017-05-01

We will present data on a various X-ray production schemes from laser driven plasmas at the PALS Research Center and discuss the plan for the ELI Beamlines project. One of the approaches, how to generate ultrashort pulses of incoherent X-ray radiation, is based on interaction of femtosecond laser pulses with solid or liquid targets. So-called K-alpha source depending on used targets emits in hard X-ray region from micrometric source size. The source exhibits sufficient spatial coherence to observe phase contrast. Detailed characterization of various sources including the x-ray spectrum and the x-ray average yield along with phase contrast images of test objects will be presented. Other method, known as laser wakefield electron acceleration (LWFA), can produce up to GeV electron beams emitting radiation in collimated beam with a femtosecnond pulse duration. This approach was theoretically and experimentally examined at the PALS Center. The parameters of the PALS Ti:S laser interaction were studied by extensive particle-in-cell simulations with radiation post-processors in order to evaluate the capabilities of our system in this field. The extensions of those methods at the ELI Beamlines facility will enable to generate either higher X-ray energies or higher repetition rate. The architecture of such sources and their considered applications will be proposed.

Laser-driven magnetized liner inertial fusion

DOE PAGES

Davies, J. R.

2017-06-05

A laser-driven, magnetized liner inertial fusion (MagLIF) experiment is designed in this paper for the OMEGA Laser System by scaling down the Z point design to provide the first experimental data on MagLIF scaling. OMEGA delivers roughly 1000× less energy than Z, so target linear dimensions are reduced by factors of ~10. Magneto-inertial fusion electrical discharge system could provide an axial magnetic field of 10 T. Two-dimensional hydrocode modeling indicates that a single OMEGA beam can preheat the fuel to a mean temperature of ~200 eV, limited by mix caused by heat flow into the wall. One-dimensional magnetohydrodynamic (MHD) modelingmore » is used to determine the pulse duration and fuel density that optimize neutron yield at a fuel convergence ratio of roughly 25 or less, matching the Z point design, for a range of shell thicknesses. A relatively thinner shell, giving a higher implosion velocity, is required to give adequate fuel heating on OMEGA compared to Z because of the increase in thermal losses in smaller targets. Two-dimensional MHD modeling of the point design gives roughly a 50% reduction in compressed density, temperature, and magnetic field from 1-D because of end losses. Finally, scaling up the OMEGA point design to the MJ laser energy available on the National Ignition Facility gives a 500-fold increase in neutron yield in 1-D modeling.« less

Laser-driven magnetized liner inertial fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Davies, J. R.

A laser-driven, magnetized liner inertial fusion (MagLIF) experiment is designed in this paper for the OMEGA Laser System by scaling down the Z point design to provide the first experimental data on MagLIF scaling. OMEGA delivers roughly 1000× less energy than Z, so target linear dimensions are reduced by factors of ~10. Magneto-inertial fusion electrical discharge system could provide an axial magnetic field of 10 T. Two-dimensional hydrocode modeling indicates that a single OMEGA beam can preheat the fuel to a mean temperature of ~200 eV, limited by mix caused by heat flow into the wall. One-dimensional magnetohydrodynamic (MHD) modelingmore » is used to determine the pulse duration and fuel density that optimize neutron yield at a fuel convergence ratio of roughly 25 or less, matching the Z point design, for a range of shell thicknesses. A relatively thinner shell, giving a higher implosion velocity, is required to give adequate fuel heating on OMEGA compared to Z because of the increase in thermal losses in smaller targets. Two-dimensional MHD modeling of the point design gives roughly a 50% reduction in compressed density, temperature, and magnetic field from 1-D because of end losses. Finally, scaling up the OMEGA point design to the MJ laser energy available on the National Ignition Facility gives a 500-fold increase in neutron yield in 1-D modeling.« less

Extracting a mix parameter from 2D radiography of variable density flow

NASA Astrophysics Data System (ADS)

Kurien, Susan; Doss, Forrest; Livescu, Daniel

2017-11-01

A methodology is presented for extracting quantities related to the statistical description of the mixing state from the 2D radiographic image of a flow. X-ray attenuation through a target flow is given by the Beer-Lambert law which exponentially damps the incident beam intensity by a factor proportional to the density, opacity and thickness of the target. By making reasonable assumptions for the mean density, opacity and effective thickness of the target flow, we estimate the contribution of density fluctuations to the attenuation. The fluctuations thus inferred may be used to form the correlation of density and specific-volume, averaged across the thickness of the flow in the direction of the beam. This correlation function, denoted by b in RANS modeling, quantifies turbulent mixing in variable density flows. The scheme is tested using DNS data computed for variable-density buoyancy-driven mixing. We quantify the deficits in the extracted value of b due to target thickness, Atwood number, and modeled noise in the incident beam. This analysis corroborates the proposed scheme to infer the mix parameter from thin targets at moderate to low Atwood numbers. The scheme is then applied to an image of counter-shear flow obtained from experiments at the National Ignition Facility. US Department of Energy.

The roles of vibration analysis and infrared thermography in monitoring air-handling equipment

NASA Astrophysics Data System (ADS)

Wurzbach, Richard N.

2003-04-01

Industrial and commercial building equipment maintenance has not historically been targeted for implementation of PdM programs. The focus instead has been on manufacturing, aerospace and energy industries where production interruption has significant cost implications. As cost-effectiveness becomes more pervasive in corporate culture, even office space and labor activities housed in large facilities are being scrutinized for cost-cutting measures. When the maintenance costs for these facilities are reviewed, PdM can be considered for improving the reliability of the building temperature regulation, and reduction of maintenance repair costs. An optimized program to direct maintenance resources toward a cost effective and pro-active management of the facility can result in reduced operating budgets, and greater occupant satisfaction. A large majority of the significant rotating machinery in a large building environment are belt-driven air handling units. These machines are often poorly designed or utilized within the facility. As a result, the maintenance staff typically find themselves scrambling to replace belts and bearings, going from one failure to another. Instead of the reactive-mode maintenance, some progressive and critical institutions are adopting predictive and proactive technologies of infrared thermography and vibration analysis. Together, these technologies can be used to identify design and installation problems, that when corrected, significantly reduce maintenance and increase reliability. For critical building use, such as laboratories, research facilities, and other high value non-industrial settings, the cost-benefits of more reliable machinery can contribute significantly to the operational success.

First results of radiation-driven, layered deuterium-tritium implosions with a 3-shock adiabat-shaped drive at the National Ignition Facility

DOE PAGES

Smalyuk, V. A.; Robey, H. F.; Döppner, T.; ...

2015-08-27

Radiation-driven, layered deuterium-tritium plastic capsule implosions were carried out using a new, 3-shock “adiabat-shaped” drive on the National Ignition Facility. The purpose of adiabat shaping is to use a stronger first shock, reducing hydrodynamic instability growth in the ablator. The shock can decay before reaching the deuterium-tritium fuel leaving it on a low adiabat and allowing higher fuel compression. The fuel areal density was improved by ~25% with this new drive compared to similar “high-foot” implosions, while neutron yield was improved by more than 4 times, compared to “low-foot” implosions driven at the same compression and implosion velocity.

Neutron imaging with the short-pulse laser driven neutron source at the TRIDENT Laser Facility

DOE PAGES

Guler, Nevzat; Volegov, Petr Lvovich; Favalli, Andrea; ...

2016-10-17

Emerging approaches to short-pulse laser-driven neutron production offer a possible gateway to compact, low cost, and intense broad spectrum sources for a wide variety of applications. They are based on energetic ions, driven by an intense short-pulse laser, interacting with a converter material to produce neutrons via breakup and nuclear reactions. Recent experiments performed with the high-contrast laser at the Trident laser facility of Los Alamos National Laboratory have demonstrated a laser-driven ion acceleration mechanism operating in the regime of relativistic transparency, featuring a volumetric laser-plasma interaction. This mechanism is distinct from previously studied ones that accelerate ions at themore » laser-target surface. The Trident experiments produced an intense beam of deuterons with an energy distribution extending above 100 MeV. This deuteron beam, when directed at a beryllium converter, produces a forward-directed neutron beam with ~5x10 9 n/sr, in a single laser shot, primarily due to deuteron breakup. The neutron beam has a pulse duration on the order of a few nanoseconds with an energy distribution extending from a few hundreds of keV to almost 80 MeV. For the experiments on neutron-source spot-size measurements, our gated neutron imager was setup to select neutrons in the energy range of 2.5 to 35 MeV. The spot size of neutron emission at the converter was measured by two different imaging techniques, using a knife-edge and a penumbral aperture, in two different experimental campaigns. The neutron-source spot size is measured ~1 mm for both experiments. The measurements and analysis reported here give a spatial characterization for this type of neutron source for the first time. In addition, the forward modeling performed provides an empirical estimate of the spatial characteristics of the deuteron ion-beam. Finally, these experimental observations, taken together, provide essential yet unique data to benchmark and verify theoretical work into the basic acceleration mechanism, which remains an ongoing challenge.« less

Neutron imaging with the short-pulse laser driven neutron source at the TRIDENT Laser Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guler, Nevzat; Volegov, Petr Lvovich; Favalli, Andrea

Emerging approaches to short-pulse laser-driven neutron production offer a possible gateway to compact, low cost, and intense broad spectrum sources for a wide variety of applications. They are based on energetic ions, driven by an intense short-pulse laser, interacting with a converter material to produce neutrons via breakup and nuclear reactions. Recent experiments performed with the high-contrast laser at the Trident laser facility of Los Alamos National Laboratory have demonstrated a laser-driven ion acceleration mechanism operating in the regime of relativistic transparency, featuring a volumetric laser-plasma interaction. This mechanism is distinct from previously studied ones that accelerate ions at themore » laser-target surface. The Trident experiments produced an intense beam of deuterons with an energy distribution extending above 100 MeV. This deuteron beam, when directed at a beryllium converter, produces a forward-directed neutron beam with ~5x10 9 n/sr, in a single laser shot, primarily due to deuteron breakup. The neutron beam has a pulse duration on the order of a few nanoseconds with an energy distribution extending from a few hundreds of keV to almost 80 MeV. For the experiments on neutron-source spot-size measurements, our gated neutron imager was setup to select neutrons in the energy range of 2.5 to 35 MeV. The spot size of neutron emission at the converter was measured by two different imaging techniques, using a knife-edge and a penumbral aperture, in two different experimental campaigns. The neutron-source spot size is measured ~1 mm for both experiments. The measurements and analysis reported here give a spatial characterization for this type of neutron source for the first time. In addition, the forward modeling performed provides an empirical estimate of the spatial characteristics of the deuteron ion-beam. Finally, these experimental observations, taken together, provide essential yet unique data to benchmark and verify theoretical work into the basic acceleration mechanism, which remains an ongoing challenge.« less

Efficient Solar-Thermal Energy Harvest Driven by Interfacial Plasmonic Heating-Assisted Evaporation.

PubMed

Chang, Chao; Yang, Chao; Liu, Yanming; Tao, Peng; Song, Chengyi; Shang, Wen; Wu, Jianbo; Deng, Tao

2016-09-07

The plasmonic heating effect of noble nanoparticles has recently received tremendous attention for various important applications. Herein, we report the utilization of interfacial plasmonic heating-assisted evaporation for efficient and facile solar-thermal energy harvest. An airlaid paper-supported gold nanoparticle thin film was placed at the thermal energy conversion region within a sealed chamber to convert solar energy into thermal energy. The generated thermal energy instantly vaporizes the water underneath into hot vapors that quickly diffuse to the thermal energy release region of the chamber to condense into liquids and release the collected thermal energy. The condensed water automatically flows back to the thermal energy conversion region under the capillary force from the hydrophilic copper mesh. Such an approach simultaneously realizes efficient solar-to-thermal energy conversion and rapid transportation of converted thermal energy to target application terminals. Compared to conventional external photothermal conversion design, the solar-thermal harvesting device driven by the internal plasmonic heating effect has reduced the overall thermal resistance by more than 50% and has demonstrated more than 25% improvement of solar water heating efficiency.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Robey, H. F.; MacGowan, B. J.; Landen, O. L.

Indirectly driven capsule implosions on the National Ignition Facility (NIF) [Moses et al., Phys. Plasmas 16, 041006 (2009)] are being performed with the goal of compressing a layer of cryogenic deuterium-tritium (DT) fuel to a sufficiently high areal density (ρR) to sustain the self-propagating burn wave that is required for fusion power gain greater than unity. These implosions are driven with a temporally shaped laser pulse that is carefully tailored to keep the DT fuel on a low adiabat (ratio of fuel pressure to the Fermi degenerate pressure). In this report, the impact of variations in the laser pulse shapemore » (both intentionally and unintentionally imposed) on the in-flight implosion adiabat is examined by comparing the measured shot-to-shot variations in ρR from a large ensemble of DT-layered ignition target implosions on NIF spanning a two-year period. A strong sensitivity to variations in the early-time, low-power foot of the laser pulse is observed. It is shown that very small deviations (∼0.1% of the total pulse energy) in the first 2 ns of the laser pulse can decrease the measured ρR by 50%.« less

Observation of parametric instabilities in the quarter critical density region driven by the Nike KrF laser

NASA Astrophysics Data System (ADS)

Weaver, J. L.; Oh, J.; Phillips, L.; Afeyan, B.; Seely, J.; Kehne, D.; Brown, C. M.; Obenschain, S. P.; Serlin, V.; Schmitt, A. J.; Feldman, U.; Lehmberg, R. H.; Mclean, E.; Manka, C.

2013-02-01

The krypton-fluoride (KrF) laser is an attractive choice for inertial confinement fusion due to its combination of short wavelength (λ =248 nm), large bandwidth (up to 3 THz), and superior beam smoothing by induced spatial incoherence. These qualities improve the overall hydrodynamics of directly driven pellet implosions and should allow use of increased laser intensity due to higher thresholds for laser plasma instabilities when compared to frequency tripled Nd:glass lasers (λ =351 nm). Here, we report the first observations of the two-plasmon decay instability using a KrF laser. The experiments utilized the Nike laser facility to irradiate solid plastic planar targets over a range of pulse lengths (0.35 ns≤τ≤1.25 ns) and intensities (up to 2×1015 W/cm2). Variation of the laser pulse created different combinations of electron temperature and electron density scale length. The observed onset of instability growth was consistent with the expected scaling that KrF lasers have a higher intensity threshold for instabilities in the quarter critical density region.

DOE High Performance Computing Operational Review (HPCOR): Enabling Data-Driven Scientific Discovery at HPC Facilities

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gerber, Richard; Allcock, William; Beggio, Chris

2014-10-17

U.S. Department of Energy (DOE) High Performance Computing (HPC) facilities are on the verge of a paradigm shift in the way they deliver systems and services to science and engineering teams. Research projects are producing a wide variety of data at unprecedented scale and level of complexity, with community-specific services that are part of the data collection and analysis workflow. On June 18-19, 2014 representatives from six DOE HPC centers met in Oakland, CA at the DOE High Performance Operational Review (HPCOR) to discuss how they can best provide facilities and services to enable large-scale data-driven scientific discovery at themore » DOE national laboratories. The report contains findings from that review.« less

Division x: Radio Astronomy

NASA Astrophysics Data System (ADS)

Taylor, Russ; Chapman, Jessica; Rendong, Nan; Carilli, Christopher; Giovannini, Gabriele; Hills, Richard; Hirabayashi, Hisashi; Jonas, Justin; Lazio, Joseph; Morganti, Raffaella; Rubio, Monica; Shastri, Prajval

2012-04-01

This triennium has seen a phenomenal investment in development of observational radio astronomy facilities in all parts of the globe at a scale that significantly impacts the international community. This includes both major enhancements such as the transition from the VLA to the EVLA in North America, and the development of new facilities such as LOFAR, ALMA, FAST, and Square Kilometre Array precursor telescopes in Australia and South Africa. These developments are driven by advances in radio-frequency, digital and information technologies that tremendously enhance the capabilities in radio astronomy. These new developments foreshadow major scientific advances driven by radio observations in the next triennium. We highlight these facility developments in section 3 of this report. A selection of science highlight from this triennium are summarized in section 2.

First experimental demonstration of magnetic-field assisted fast heating of a dense plasma core

NASA Astrophysics Data System (ADS)

Fujioka, Shinsuke; Sakata, Shohei; Lee, Seung Ho; Matsuo, Kazuki; Sawada, Hiroshi; Iwasa, Yuki; Law, King Fai Farley; Morita, Hitoki; Kojima, Sadaoki; Abe, Yuki; Yao, Akira; Hata, Masayasu; Johzaki, Tomoyuki; Sunahara, Atsushi; Ozaki, Tetsuo; Sakagami, Hitoshi; Morace, Alessio; Arikawa, Yasunobu; Yogo, Akifumi; Nishimura, Hiroaki; Nakai, Mitsuo; Shiraga, Hiroyuki; Sentoku, Yasuhiko; Nagatomo, Hideo; Azechi, Hiroshi; Firex Project Team

2016-10-01

Fast heating of a dense plasma core by an energetic electron beam is being studied on GEKKO-LFEX laser facility. Here, we introduce a laser-driven kilo-tesla external magnetic field to guide the diverging electron beam to the dense plasma core. This involve placing a spherical target in the magnetic field, compressing it with the GEKKO-XII laser beams and then using the LFEX laser beams injected into the dense plasma to generate the electron beam which do the fast heating. Cu-Ka emission is used to visualize transport or heating processes of a dense plasma. X-ray spectrum from a highly ionized Cu ions indicates several keV of the temperature increment induced by the LFEX.

Studies on Materials for Heavy-Liquid-Metal-Cooled Reactors in Japan

DOE Office of Scientific and Technical Information (OSTI.GOV)

Minoru Takahashi; Masayuki Igashira; Toru Obara

2002-07-01

Recent studies on materials for the development of lead-bismuth (Pb-Bi)-cooled fast reactors (FR) and accelerator-driven sub-critical systems (ADS) in Japan are reported. The measurement of the neutron cross section of Bi to produce {sup 210}Po, the removal experiment of Po contamination and steel corrosion test in Pb-Bi flow were performed in Tokyo Institute of Technology. A target material corrosion test was performed in the project of Transmutation Experimental Facility for ADS in Japan Atomic Energy Research Institute (JAERI). Steel corrosion test was started in Mitsui Engineering and Shipbuilding Co., LTD (MES). The feasibility study for FR cycle performed in Japanmore » Nuclear Cycle Institute (JNC) are described. (authors)« less

Alternate Operating Modes For NDCX-II

NASA Astrophysics Data System (ADS)

Sharp, W. M.; Friedman, A.; Grote, D. P.; Cohen, R. H.; Lund, S. M.; Vay, J.-L.; Waldron, W. L.

2012-10-01

NDCX-II is a newly completed accelerator facility at LBNL, built to study ion-heated warm dense matter and aspects of ion-driven targets for inertial-fusion energy. The baseline design calls for using twelve induction cells to accelerate 40 nC of Li+ ions to 1.2 MeV. During commissioning, though, we plan to extend the source lifetime by extracting less total charge. For operational flexibility, the option of using a helium plasma source is also being investigated. Over time, we expect that NDCX-II will be upgraded to substantially higher energies, necessitating the use of heavier ions to keep a suitable deposition range in targets. Each of these options requires development of an alternate acceleration schedule and the associated transverse focusing. The schedules here are first worked out with a fast-running 1-D particle-in-cell code ASP, then 2-D and 3-D Warp simulations are used to verify the 1-D results and to design transverse focusing.

Targeting nursing homes under the Quality Improvement Organization program's 9th statement of work.

PubMed

Stevenson, David G; Mor, Vincent

2009-09-01

In the Quality Improvement Organization (QIO) program's latest Statement of Work, the Centers for Medicare and Medicaid Services (CMS) is targeting its nursing home activities toward facilities that perform poorly on two quality measures-pressure ulcers and restraint use. The designation of target facilities is a shift in strategy for CMS and a direct response to criticism that QIO program resources were not being targeted effectively to facilities or clinical areas that most needed improvement. Using administrative data, this article analyzes implications of using narrowly defined criteria to identify facilities that need improvement, particularly in light of considerable evidence showing that nursing home quality is multidimensional and may change over time. The analyses show that one in four facilities is targeted for improvement nationally but that approximately half of some states' facilities are targeted while other states have almost none targeted. The analyses also convey deeper limitations to using threshold values on individual measures to identify poorly performing homes. Target facilities can be among the top performers on a range of other quality measures, and their performance on targeted measures themselves may change over time. The implication of these features is that a very different group of facilities would have been chosen had the QIO program targeted other measures or examined performance at a different point in time. Ultimately, CMS has chosen a blunt instrument to identify poorly performing nursing homes, and supplemental strategies-such as soliciting input from state survey agencies and more closely aligning quality improvement and quality assurance efforts-should be considered to address potential limitations.

Deuterium-Tritium Beta-Layering Within a National Ignition Facility Scale Polymer Target in the LANL Cryogenic Pressure Loader

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ebey, Peter S.; Dole, James M.; Geller, Drew A.

2005-11-15

Beta-layering, the process of beta-decay heat-driven mass redistribution, has been demonstrated in a deuterium-tritium (D-T)-filled polymer sphere of the type required for fusion ignition experiments at the National Ignition Facility. This is the first report, to the best of the authors' knowledge, of a D-T layer formed in a permeation-filled sphere. The 2-mm-diam sphere was filled with D-T by permeation; cooled to cryogenic temperatures while in the high-pressure permeation vessel; and, while cold, removed to an optical axis where the D-T was frozen, melted, and beta-layered in a series of experiments over several weeks' time. This work was performed inmore » the Los Alamos National Laboratory cryogenic pressure loader system. The beta-layering time constant was 24.0 {+-} 2.5 min, less than the theoretical value of 26.8 min, and not showing the significant increase due to build-up of {sup 3}He often observed in beta-layered samples. Supercooling of the liquid D-T was observed. Neither the polymer target nor its tenting material showed visual signs of degradation after 5 weeks of exposure to D-T. Small external thermal gradients were used to shift the D-T material back and forth within the sphere.« less

Improving district facility readiness: a 12-month evaluation of a data-driven health systems strengthening intervention in rural Rwanda.

PubMed

Iyer, Hari S; Kamanzi, Emmanuel; Mugunga, Jean Claude; Finnegan, Karen; Uwingabiye, Alice; Shyaka, Edward; Niyonzima, Saleh; Hirschhorn, Lisa R; Drobac, Peter C

2015-01-01

While health systems strengthening (HSS) interventions are recommended by global health policy experts to improve population health in resource-limited settings, few examples exist of evaluations of HSS interventions conducted at the district level. In 2009, a partnership between Partners In Health (PIH), a non-governmental organization, and the Rwandan Ministry of Health (RMOH) was provided funds to implement and evaluate a district-level HSS intervention in two rural districts of Rwanda. The partnership provided limited funds to 14 health centers for targeted systems support in 2010; six others received support prior to the intervention (reference). RMOH health systems norms were mapped across the WHO HSS framework, scored from 0 to 10 and incorporated into a rapid survey assessing 11 domains of facility readiness. Stakeholder meetings allowed partnership leaders to review results, set priorities, and allocate resources. Investments included salary support, infrastructure improvements, medical equipment, and social support for patients. We compared facility domain scores from the start of the intervention to 12 months and tested for correlation between change in score and change in funding allocation to assess equity in our approach. We found significant improvements among intervention facilities from baseline to 12 months across several domains [infrastructure (+4, p=0.0001), clinical services (+1.2, p=0.03), infection and sanitation control (+0.6, p=0.03), medical equipment (+1.0, p=0.02), information use (+2, p=0.002)]. Composite score across domains improved from 6.2 at baseline to 7.4 at 12 months (p=0.002). Across facilities, 50% had composite scores greater than the average score among reference facilities (7.4) at 12 months compared to none at baseline. Rapid facility surveys, stakeholder engagement, and information feedback can be used for gap analysis and resource allocation. This approach can achieve effective use of limited resources, improve facility readiness, and ensure consistency of facility capacity to provide quality care at the district level.

Improving district facility readiness: a 12-month evaluation of a data-driven health systems strengthening intervention in rural Rwanda

PubMed Central

Iyer, Hari S.; Kamanzi, Emmanuel; Mugunga, Jean Claude; Finnegan, Karen; Uwingabiye, Alice; Shyaka, Edward; Niyonzima, Saleh; Hirschhorn, Lisa R.; Drobac, Peter C.

2015-01-01

Background While health systems strengthening (HSS) interventions are recommended by global health policy experts to improve population health in resource-limited settings, few examples exist of evaluations of HSS interventions conducted at the district level. In 2009, a partnership between Partners In Health (PIH), a non-governmental organization, and the Rwandan Ministry of Health (RMOH) was provided funds to implement and evaluate a district-level HSS intervention in two rural districts of Rwanda. Design The partnership provided limited funds to 14 health centers for targeted systems support in 2010; six others received support prior to the intervention (reference). RMOH health systems norms were mapped across the WHO HSS framework, scored from 0 to 10 and incorporated into a rapid survey assessing 11 domains of facility readiness. Stakeholder meetings allowed partnership leaders to review results, set priorities, and allocate resources. Investments included salary support, infrastructure improvements, medical equipment, and social support for patients. We compared facility domain scores from the start of the intervention to 12 months and tested for correlation between change in score and change in funding allocation to assess equity in our approach. Results We found significant improvements among intervention facilities from baseline to 12 months across several domains [infrastructure (+4, p=0.0001), clinical services (+1.2, p=0.03), infection and sanitation control (+0.6, p=0.03), medical equipment (+1.0, p=0.02), information use (+2, p=0.002)]. Composite score across domains improved from 6.2 at baseline to 7.4 at 12 months (p=0.002). Across facilities, 50% had composite scores greater than the average score among reference facilities (7.4) at 12 months compared to none at baseline. Conclusions Rapid facility surveys, stakeholder engagement, and information feedback can be used for gap analysis and resource allocation. This approach can achieve effective use of limited resources, improve facility readiness, and ensure consistency of facility capacity to provide quality care at the district level. PMID:26140729

Design and construction of the X-2 two-stage free piston driven expansion tube

NASA Technical Reports Server (NTRS)

Doolan, Con

1995-01-01

This report outlines the design and construction of the X-2 two-stage free piston driven expansion tube. The project has completed its construction phase and the facility has been installed in the new impulsive research laboratory where commissioning is about to take place. The X-2 uses a unique, two-stage driver design which allows a more compact and lower overall cost free piston compressor. The new facility has been constructed in order to examine the performance envelope of the two-stage driver and how well it couple to sub-orbital and super-orbital expansion tubes. Data obtained from these experiments will be used for the design of a much larger facility, X-3, utilizing the same free piston driver concept.

New approaches in clinical application of laser-driven ionizing radiation

NASA Astrophysics Data System (ADS)

Hideghéty, Katalin; Szabó, Rita Emilia; Polanek, Róbert; Szabó, Zoltán.; Brunner, Szilvia; Tőkés, Tünde

2017-05-01

The planned laser-driven ionizing beams (photon, very high energy electron, proton, carbon ion) at laser facilities have the unique property of ultra-high dose rate (>Gy/s-10), short pulses, and at ELI-ALPS high repetition rate, carry the potential to develop novel laser-driven methods towards compact hospital-based clinical application. The enhanced flexibility in particle and energy selection, the high spatial and time resolution and extreme dose rate could be highly beneficial in radiotherapy. These approaches may increase significantly the therapeutic index over the currently available advanced radiation oncology methods. We highlight two nuclear reactionbased binary modalities and the planned radiobiology research. Boron Neutron Capture Therapy is an advanced cell targeted modality requiring 10B enriched boron carrier and appropriate neutron beam. The development of laser-based thermal and epithermal neutron source with as high as 1010 fluence rate could enhance the research activity in this promising field. Boron-Proton Fusion reaction is as well as a binary approach, where 11B containing compounds are accumulated into the cells, and the tumour selectively irradiated with protons. Due to additional high linear energy transfer alpha particle release of the BPFR and the maximum point of the Bragg-peak is increased, which result in significant biological effect enhancement. Research at ELI-ALPS on detection of biological effect differences of modified or different quality radiation will be presented using recently developed zebrafish embryo and rodent models.

A platform for studying the Rayleigh-Taylor and Richtmyer-Meshkov instabilities in a planar geometry at high energy density at the National Ignition Facility

NASA Astrophysics Data System (ADS)

Nagel, S. R.; Raman, K. S.; Huntington, C. M.; MacLaren, S. A.; Wang, P.; Barrios, M. A.; Baumann, T.; Bender, J. D.; Benedetti, L. R.; Doane, D. M.; Felker, S.; Fitzsimmons, P.; Flippo, K. A.; Holder, J. P.; Kaczala, D. N.; Perry, T. S.; Seugling, R. M.; Savage, L.; Zhou, Y.

2017-07-01

A new experimental platform has been developed at the National Ignition Facility (NIF) for studying the Rayleigh-Taylor (RT) and Richtmyer-Meshkov (RM) instabilities in a planar geometry at high-energy-densities. The platform uses 60 beams of the NIF laser to drive an initially solid shock tube containing a pre-machined interface between dense and light materials. The strong shock turns the initially solid target into a plasma and the material boundary into a fluid interface with the imprinted initial condition. The interface evolves by action of the RT and RM instabilities, and the growth is imaged with backlit x-ray radiography. We present our first data involving sinusoidal interface perturbations driven from the heavy side to the light side. Late-time radiographic images show the initial conditions reaching the deeply nonlinear regime, and an evolution of fine structure consistent with a transition to turbulence. We show preliminary comparisons with post-shot numerical simulations and discuss the implications for future campaigns.

Laser Acceleration of Ions for Radiation Therapy

NASA Astrophysics Data System (ADS)

Tajima, Toshiki; Habs, Dietrich; Yan, Xueqing

Ion beam therapy for cancer has proven to be a successful clinical approach, affording as good a cure as surgery and a higher quality of life. However, the ion beam therapy installation is large and expensive, limiting its availability for public benefit. One of the hurdles is to make the accelerator more compact on the basis of conventional technology. Laser acceleration of ions represents a rapidly developing young field. The prevailing acceleration mechanism (known as target normal sheath acceleration, TNSA), however, shows severe limitations in some key elements. We now witness that a new regime of coherent acceleration of ions by laser (CAIL) has been studied to overcome many of these problems and accelerate protons and carbon ions to high energies with higher efficiencies. Emerging scaling laws indicate possible realization of an ion therapy facility with compact, cost-efficient lasers. Furthermore, dense particle bunches may allow the use of much higher collective fields, reducing the size of beam transport and dump systems. Though ultimate realization of a laser-driven medical facility may take many years, the field is developing fast with many conceptual innovations and technical progress.

X-ray Thomson scattering measurements from hohlraum-driven spheres on the OMEGA laser [X-ray Thomson scattering measurements from hohlraum targets on the OMEGA laser

DOE PAGES

Saunders, A. M.; Jenei, A.; Doppner, T.; ...

2016-08-30

X-ray Thomson scattering (XRTS) is a powerful diagnostic for probing warm and hot dense matter. We present the design and results of the first XRTS experiments with hohlraum-driven CH 2 targets on the OMEGA laser. X-rays seen directly from the XRTS x-ray source overshadow the elastic scattering signal from the target capsule, but can be controlled in future experiments. From the inelastic scattering signal, an average plasma temperature is inferred that is in reasonable agreement with the temperatures predicted by simulations. Here, knowledge gained in this experiment show a promising future for further XRTS measurements on indirectly driven OMEGA targets.

X-ray Thomson scattering measurements from hohlraum-driven spheres on the OMEGA laser [X-ray Thomson scattering measurements from hohlraum targets on the OMEGA laser

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saunders, A. M.; Jenei, A.; Doppner, T.

X-ray Thomson scattering (XRTS) is a powerful diagnostic for probing warm and hot dense matter. We present the design and results of the first XRTS experiments with hohlraum-driven CH 2 targets on the OMEGA laser. X-rays seen directly from the XRTS x-ray source overshadow the elastic scattering signal from the target capsule, but can be controlled in future experiments. From the inelastic scattering signal, an average plasma temperature is inferred that is in reasonable agreement with the temperatures predicted by simulations. Here, knowledge gained in this experiment show a promising future for further XRTS measurements on indirectly driven OMEGA targets.

Mechanics of Interrill Erosion with Wind-Driven Rain (WDR)

USDA-ARS?s Scientific Manuscript database

This article provides an evaluation analysis for the performance of the interrill component of the Water Erosion Prediction Project (WEPP) model for Wind-Driven Rain (WDR) events. The interrill delivery rates (Di) were collected in the wind tunnel rainfall simulator facility of the International Cen...

Both Patient and Facility Contribute to Achieving the Centers for Medicare and Medicaid Services' Pay-for-Performance Target for Dialysis Adequacy

PubMed Central

Tighiouart, Hocine; Meyer, Klemens B.; Miskulin, Dana C.

2011-01-01

The Centers for Medicare and Medicaid Services (CMS) designated the achieved urea reduction ratio (URR) as a pay-for-performance measure, but to what extent this measure reflects patient characteristics and adherence instead of its intent to reflect facility performance is unknown. Here, we quantified the contributions of patient case-mix and adherence to the variability in achieving URR targets across dialysis facilities. We found that 92% of 10,069 hemodialysis patients treated at 173 facilities during the last quarter of 2004 achieved the target URR ≥65%. Mixed-effect models with random intercept for dialysis facility revealed a significant facility effect: 11.5% of the variation in achievement of target URR was attributable to the facility level. Adjusting for patient case-mix reduced the proportion of variation attributable to the facility level to 6.7%. Patient gender, body surface area, dialysis access, and adherence with treatment strongly associated with achievement of the URR target. We could not identify specific facility characteristics that explained the remaining variation between facilities. These data suggest that if adherence is not a modifiable patient characteristic, providers could be unfairly penalized for caring for these patients under current CMS policy. These penalties may have unintended consequences. PMID:22025629

Overview of the Neutron experimental facilities at LANSCE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mocko, Michal

2016-06-30

This presentation gives an overview of the neutron experimental facilities at LANSCE. The layout is mentioned in detail, with a map of the south-side experimental facilities, information on Target-4 and the Lujan Center. Then it goes into detail about neutron sources, specifically continuous versus pulsed. Target 4 is then discussed. In conclusion, we have introduced the south-side experimental facilities in operation at LANSCE. 1L target and Target 4 provide complementary neutron energy spectra. Two spallation neutron sources taken together cover more than 11 orders of magnitude in neutron energy.

Richtmyer-Meshkov jet formation from rear target ripples in plastic and plastic/aluminum laser targets

NASA Astrophysics Data System (ADS)

Aglitskiy, Y.; Velikovich, A. L.; Karasik, M.; Serlin, V.; Weaver, J. L.; Schmitt, A. J.; Obenschain, S. P.

2015-11-01

We report experimental observations of jets produced from the rear surface of laser targets after a passage of the laser-driven shock wave. As in our previous work, Aglitskiy et al., Phys. Plasmas (2012), the jets are produced via the shaped-charge mechanism, a manifestation of a Richtmyer-Meshkov instability for a particular case of the Atwood number A =-1. The experiments done on the KrF Nike laser facility with laser wavelength 248 nm, a 4 ns pulse, and low-energy drive regime that used only 1 to 3 overlapping Nike beams and generated ablative pressure below 1 Mbar. Our 50 um thick planar targets were rippled on the rear side with wavelength 45 μm and peak-to-valley amplitude 15 μm. The targets were made either of solid plastic or of aluminum with a 10 μm thick plastic ablator attached to avoid the radiation preheat. The jets were extremely well collimated, which made possible our side-on observations with monochromatic x-ray imaging. We saw a regular set of jets, clearly separated along the 500 μm line of sight. Aluminum jets were found to be slightly better collimated than plastic jets. A quasi-spherical late-time expansion of Al jets starting from the tips has not been previously seen in experiments or simulations. Work supported by the US DOE/NNSA.

On FAST3D simulations of directly-driven inertial-fusion targets with high-Z layers for reducing laser imprint and surface non-uniformity growth

NASA Astrophysics Data System (ADS)

Bates, Jason; Schmitt, Andrew; Klapisch, Marcel; Karasik, Max; Obenschain, Steve

2013-10-01

Modifications to the FAST3D code have been made to enhance its ability to simulate the dynamics of plastic ICF targets with high-Z overcoats. This class of problems is challenging computationally due in part to plasma conditions that are not in a state of local thermodynamic equilibrium and to the presence of mixed computational cells containing more than one material. Recently, new opacity tables for gold, palladium and plastic have been generated with an improved version of the STA code. These improved tables provide smoother, higher-fidelity opacity data over a wider range of temperature and density states than before, and contribute to a more accurate treatment of radiative transfer processes in FAST3D simulations. Furthermore, a new, more efficient subroutine known as ``MMEOS'' has been installed in the FAST3D code for determining pressure and temperature equilibrium conditions within cells containing multiple materials. We will discuss these topics, and present new simulation results for high-Z planar-target experiments performed recently on the NIKE Laser Facility. Work supported by DOE/NNSA.

Guiding of relativistic electron beams in dense matter by laser-driven magnetostatic fields.

PubMed

Bailly-Grandvaux, M; Santos, J J; Bellei, C; Forestier-Colleoni, P; Fujioka, S; Giuffrida, L; Honrubia, J J; Batani, D; Bouillaud, R; Chevrot, M; Cross, J E; Crowston, R; Dorard, S; Dubois, J-L; Ehret, M; Gregori, G; Hulin, S; Kojima, S; Loyez, E; Marquès, J-R; Morace, A; Nicolaï, Ph; Roth, M; Sakata, S; Schaumann, G; Serres, F; Servel, J; Tikhonchuk, V T; Woolsey, N; Zhang, Z

2018-01-09

Intense lasers interacting with dense targets accelerate relativistic electron beams, which transport part of the laser energy into the target depth. However, the overall laser-to-target energy coupling efficiency is impaired by the large divergence of the electron beam, intrinsic to the laser-plasma interaction. Here we demonstrate that an efficient guiding of MeV electrons with about 30 MA current in solid matter is obtained by imposing a laser-driven longitudinal magnetostatic field of 600 T. In the magnetized conditions the transported energy density and the peak background electron temperature at the 60-μm-thick target's rear surface rise by about a factor of five, as unfolded from benchmarked simulations. Such an improvement of energy-density flux through dense matter paves the ground for advances in laser-driven intense sources of energetic particles and radiation, driving matter to extreme temperatures, reaching states relevant for planetary or stellar science as yet inaccessible at the laboratory scale and achieving high-gain laser-driven thermonuclear fusion.

Sunlight-driven photocatalytic degradation of non-steroidal anti-inflammatory drug based on TiO₂ quantum dots.

PubMed

Kaur, Amandeep; Umar, Ahmad; Kansal, Sushil Kumar

2015-12-01

This paper reports the facile synthesis, characterization and solar-light driven photocatalytic degradation of TiO2 quantum dots (QDs). The TiO2 QDs were synthesized by a facile ultrasonic-assisted hydrothermal process and characterized in terms of their structural, morphological, optical and photocatalytic properties. The detailed studies confirmed that the prepared QDs are well-crystalline, grown in high density and exhibiting good optical properties. Further, the prepared QDs were efficiently used as effective photocatalyst for the sun-light driven photocatalytic degradation of ketorolac tromethamine, a well-known non-steroidal anti-inflammatory drug (NSAID). To optimize the photocatalytic degradation conditions, various dose-dependent, pH-dependent, and initial drug-concentration dependent experiments were performed. The detailed solar-light driven photocatalytic experiments revealed that ∼99% photodegradation of ketorolac tromethamine drug solution (10 mg L(-1)) was observed with optimized amount of TiO2 QDs and pH (0.5 g L(-1) and 4.4, respectively) under solar-light irradiations. The observed results demonstrate that simply synthesized TiO2 QDs can efficiently be used for the solar-light driven photocatalytic degradation of harmful drugs and chemicals. Copyright © 2015 Elsevier Inc. All rights reserved.

Passive Safety Features Evaluation of KIPT Neutron Source Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhong, Zhaopeng; Gohar, Yousry

2016-06-01

Argonne National Laboratory (ANL) of the United States and Kharkov Institute of Physics and Technology (KIPT) of Ukraine have cooperated on the development, design, and construction of a neutron source facility. The facility was constructed at Kharkov, Ukraine and its commissioning process is underway. It will be used to conduct basic and applied nuclear research, produce medical isotopes, and train young nuclear specialists. The facility has an electron accelerator-driven subcritical assembly. The electron beam power is 100 kW using 100 MeV electrons. Tungsten or natural uranium is the target material for generating neutrons driving the subcritical assembly. The subcritical assemblymore » is composed of WWR-M2 - Russian fuel assemblies with U-235 enrichment of 19.7 wt%, surrounded by beryllium reflector assembles and graphite blocks. The subcritical assembly is seated in a water tank, which is a part of the primary cooling loop. During normal operation, the water coolant operates at room temperature and the total facility power is ~300 KW. The passive safety features of the facility are discussed in in this study. Monte Carlo computer code MCNPX was utilized in the analyses with ENDF/B-VII.0 nuclear data libraries. Negative reactivity temperature feedback was consistently observed, which is important for the facility safety performance. Due to the design of WWR-M2 fuel assemblies, slight water temperature increase and the corresponding water density decrease produce large reactivity drop, which offset the reactivity gain by mistakenly loading an additional fuel assembly. The increase of fuel temperature also causes sufficiently large reactivity decrease. This enhances the facility safety performance because fuel temperature increase provides prompt negative reactivity feedback. The reactivity variation due to an empty fuel position filled by water during the fuel loading process is examined. Also, the loading mistakes of removing beryllium reflector assemblies and replacing them with dummy assemblies were analyzed. In all these circumstances, the reactivity change results do not cause any safety concerns.« less

76 FR 77565 - Biweekly Notice; Applications and Amendments to Facility Operating Licenses Involving No...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-13

... assure that the emergency diesel generator's diesel driven cooling water pumps perform their required... generators will provide required electrical power as assumed in the accident analyses and the cooling water... Technical Specifications to require an adequate emergency diesel generator and diesel driven cooling water...

Mixed signals: The effect of conflicting reward- and goal-driven biases on selective attention.

PubMed

Preciado, Daniel; Munneke, Jaap; Theeuwes, Jan

2017-07-01

Attentional selection depends on the interaction between exogenous (stimulus-driven), endogenous (goal-driven), and selection history (experience-driven) factors. While endogenous and exogenous biases have been widely investigated, less is known about their interplay with value-driven attention. The present study investigated the interaction between reward-history and goal-driven biases on perceptual sensitivity (d') and response time (RT) in a modified cueing paradigm presenting two coloured cues, followed by sinusoidal gratings. Participants responded to the orientation of one of these gratings. In Experiment 1, one cue signalled reward availability but was otherwise task irrelevant. In Experiment 2, the same cue signalled reward, and indicated the target's most likely location at the opposite side of the display. This design introduced a conflict between reward-driven biases attracting attention and goal-driven biases directing it away. Attentional effects were examined comparing trials in which cue and target appeared at the same versus opposite locations. Two interstimulus interval (ISI) levels were used to probe the time course of attentional effects. Experiment 1 showed performance benefits at the location of the reward-signalling cue and costs at the opposite for both ISIs, indicating value-driven capture. Experiment 2 showed performance benefits only for the long ISI when the target was at the opposite to the reward-associated cue. At the short ISI, only performance costs were observed. These results reveal the time course of these biases, indicating that reward-driven effects influence attention early but can be overcome later by goal-driven control. This suggests that reward-driven biases are integrated as attentional priorities, just as exogenous and endogenous factors.

The target vacuum storage facility at iThemba LABS

NASA Astrophysics Data System (ADS)

Neveling, R.; Kheswa, N. Y.; Papka, P.

2018-05-01

A number of nuclear physics experiments at iThemba LABS require target foils that consist of specific isotopes of elements which are reactive in air. Not only is it important to prepare these targets in a suitable environment to prevent oxidation, but consideration should also be given to the long term storage and handling facilities of such targets. The target vacuum storage facility at iThemba LABS, as well as additional hardware necessary to transport and install the target foils in the experimental chamber, will be discussed.

Onset of turbulence in accelerated high-Reynolds-number flow

NASA Astrophysics Data System (ADS)

Zhou, Ye; Robey, Harry F.; Buckingham, Alfred C.

2003-05-01

A new criterion, flow drive time, is identified here as a necessary condition for transition to turbulence in accelerated, unsteady flows. Compressible, high-Reynolds-number flows initiated, for example, in shock tubes, supersonic wind tunnels with practical limitations on dimensions or reservoir capacity, and high energy density pulsed laser target vaporization experimental facilities may not provide flow duration adequate for turbulence development. In addition, for critical periods of the overall flow development, the driving background flow is often unsteady in the experiments as well as in the physical flow situations they are designed to mimic. In these situations transition to fully developed turbulence may not be realized despite achievement of flow Reynolds numbers associated with or exceeding stationary flow transitional criteria. Basically our transitional criterion and prediction procedure extends to accelerated, unsteady background flow situations the remarkably universal mixing transition criterion proposed by Dimotakis [P. E. Dimotakis, J. Fluid Mech. 409, 69 (2000)] for stationary flows. This provides a basis for the requisite space and time scaling. The emphasis here is placed on variable density flow instabilities initiated by constant acceleration Rayleigh-Taylor instability (RTI) or impulsive (shock) acceleration Richtmyer-Meshkov instability (RMI) or combinations of both. The significant influences of compressibility on these developing transitional flows are discussed with their implications on the procedural model development. A fresh perspective for predictive modeling and design of experiments for the instability growth and turbulent mixing transitional interval is provided using an analogy between the well-established buoyancy-drag model with applications of a hierarchy of single point turbulent transport closure models. Experimental comparisons with the procedural results are presented where use is made of three distinctly different types of acceleration driven instability experiments: (1) classical, relatively low speed, constant acceleration RTI experiments; (2) shock tube, shockwave driven RMI flow mixing experiments; (3) laser target vaporization RTI and RMI mixing experiments driven at very high energy density. These last named experiments are of special interest as they provide scaleable flow conditions simulating those of astrophysical magnitude such as shock-driven hydrodynamic mixing in supernova evolution research.

Excluded Facility Financial Status and Options for Payment System Modification

PubMed Central

Schneider, John E.; Cromwell, Jerry; McGuire, Thomas P.

1993-01-01

Psychiatric, rehabilitation, long-term care, and children's facilities have remained under the reimbursement system established under the Tax Equity and Fiscal Responsibility Act (TEFRA) of 1982 (Public Law 97-248). The number of TEFRA facilities and discharges has been increasing while their average profit rates have been steadily declining. Modifying TEFRA would require either rebasing the target amount or adjusting cost sharing for facilities exceeding their cost target. Based on our simulations of alternative payment systems, we recommend rebasing facilities' target amounts using a 50/50 blend of own costs and national average costs. Cost sharing above the target amount could be increased to include more government sharing of losses. PMID:10135345

Improved Quantitative Plant Proteomics via the Combination of Targeted and Untargeted Data Acquisition

PubMed Central

Hart-Smith, Gene; Reis, Rodrigo S.; Waterhouse, Peter M.; Wilkins, Marc R.

2017-01-01

Quantitative proteomics strategies – which are playing important roles in the expanding field of plant molecular systems biology – are traditionally designated as either hypothesis driven or non-hypothesis driven. Many of these strategies aim to select individual peptide ions for tandem mass spectrometry (MS/MS), and to do this mixed hypothesis driven and non-hypothesis driven approaches are theoretically simple to implement. In-depth investigations into the efficacies of such approaches have, however, yet to be described. In this study, using combined samples of unlabeled and metabolically 15N-labeled Arabidopsis thaliana proteins, we investigate the mixed use of targeted data acquisition (TDA) and data dependent acquisition (DDA) – referred to as TDA/DDA – to facilitate both hypothesis driven and non-hypothesis driven quantitative data collection in individual LC-MS/MS experiments. To investigate TDA/DDA for hypothesis driven data collection, 7 miRNA target proteins of differing size and abundance were targeted using inclusion lists comprised of 1558 m/z values, using 3 different TDA/DDA experimental designs. In samples in which targeted peptide ions were of particularly low abundance (i.e., predominantly only marginally above mass analyser detection limits), TDA/DDA produced statistically significant increases in the number of targeted peptides identified (230 ± 8 versus 80 ± 3 for DDA; p = 1.1 × 10-3) and quantified (35 ± 3 versus 21 ± 2 for DDA; p = 0.038) per experiment relative to the use of DDA only. These expected improvements in hypothesis driven data collection were observed alongside unexpected improvements in non-hypothesis driven data collection. Untargeted peptide ions with m/z values matching those in inclusion lists were repeatedly identified and quantified across technical replicate TDA/DDA experiments, resulting in significant increases in the percentages of proteins repeatedly quantified in TDA/DDA experiments only relative to DDA experiments only (33.0 ± 2.6% versus 8.0 ± 2.7%, respectively; p = 0.011). These results were observed together with uncompromised broad-scale MS/MS data collection in TDA/DDA experiments relative to DDA experiments. Using our observations we provide guidelines for TDA/DDA method design for quantitative plant proteomics studies, and suggest that TDA/DDA is a broadly underutilized proteomics data acquisition strategy. PMID:29021799

Nuclear data activities at the n_TOF facility at CERN

NASA Astrophysics Data System (ADS)

Gunsing, F.; Aberle, O.; Andrzejewski, J.; Audouin, L.; Bécares, V.; Bacak, M.; Balibrea-Correa, J.; Barbagallo, M.; Barros, S.; Bečvář, F.; Beinrucker, C.; Belloni, F.; Berthoumieux, E.; Billowes, J.; Bosnar, D.; Brugger, M.; Caamaño, M.; Calviño, F.; Calviani, M.; Cano-Ott, D.; Cardella, R.; Casanovas, A.; Castelluccio, D. M.; Cerutti, F.; Chen, Y. H.; Chiaveri, E.; Colonna, N.; Cortés-Giraldo, M. A.; Cortés, G.; Cosentino, L.; Damone, L. A.; Deo, K.; Diakaki, M.; Domingo-Pardo, C.; Dressler, R.; Dupont, E.; Durán, I.; Fernández-Domínguez, B.; Ferrari, A.; Ferreira, P.; Finocchiaro, P.; Frost, R. J. W.; Furman, V.; Ganesan, S.; García, A. R.; Gawlik, A.; Gheorghe, I.; Glodariu, T.; Gonçalves, I. F.; González, E.; Goverdovski, A.; Griesmayer, E.; Guerrero, C.; Göbel, K.; Harada, H.; Heftrich, T.; Heinitz, S.; Hernández-Prieto, A.; Heyse, J.; Jenkins, D. G.; Jericha, E.; Käppeler, F.; Kadi, Y.; Katabuchi, T.; Kavrigin, P.; Ketlerov, V.; Khryachkov, V.; Kimura, A.; Kivel, N.; Kokkoris, M.; Krtička, M.; Leal-Cidoncha, E.; Lederer, C.; Leeb, H.; Lerendegui, J.; Licata, M.; Lo Meo, S.; Lonsdale, S. J.; Losito, R.; Macina, D.; Marganiec, J.; Martínez, T.; Masi, A.; Massimi, C.; Mastinu, P.; Mastromarco, M.; Matteucci, F.; Maugeri, E. A.; Mazzone, A.; Mendoza, E.; Mengoni, A.; Milazzo, P. M.; Mingrone, F.; Mirea, M.; Montesano, S.; Musumarra, A.; Nolte, R.; Oprea, A.; Palomo-Pinto, F. R.; Paradela, C.; Patronis, N.; Pavlik, A.; Perkowski, J.; Porras, I.; Praena, J.; Quesada, J. M.; Rajeev, K.; Rauscher, T.; Reifarth, R.; Riego-Perez, A.; Robles, M.; Rout, P.; Radeck, D.; Rubbia, C.; Ryan, J. A.; Sabaté-Gilarte, M.; Saxena, A.; Schillebeeckx, P.; Schmidt, S.; Schumann, D.; Sedyshev, P.; Smith, A. G.; Stamatopoulos, A.; Suryanarayana, S. V.; Tagliente, G.; Tain, J. L.; Tarifeño-Saldivia, A.; Tarrío, D.; Tassan-Got, L.; Tsinganis, A.; Valenta, S.; Vannini, G.; Variale, V.; Vaz, P.; Ventura, A.; Vlachoudis, V.; Vlastou, R.; Wallner, A.; Warren, S.; Weigand, M.; Weiss, C.; Wolf, C.; Woods, P. J.; Wright, T.; Žugec, P.

2016-10-01

Nuclear data in general, and neutron-induced reaction cross sections in particular, are important for a wide variety of research fields. They play a key role in the safety and criticality assessment of nuclear technology, not only for existing power reactors but also for radiation dosimetry, medical applications, the transmutation of nuclear waste, accelerator-driven systems, fuel cycle investigations and future reactor systems as in Generation IV. Applications of nuclear data are also related to research fields as the study of nuclear level densities and stellar nucleosynthesis. Simulations and calculations of nuclear technology applications largely rely on evaluated nuclear data libraries. The evaluations in these libraries are based both on experimental data and theoretical models. Experimental nuclear reaction data are compiled on a worldwide basis by the international network of Nuclear Reaction Data Centres (NRDC) in the EXFOR database. The EXFOR database forms an important link between nuclear data measurements and the evaluated data libraries. CERN's neutron time-of-flight facility n_TOF has produced a considerable amount of experimental data since it has become fully operational with the start of the scientific measurement programme in 2001. While for a long period a single measurement station (EAR1) located at 185 m from the neutron production target was available, the construction of a second beam line at 20 m (EAR2) in 2014 has substantially increased the measurement capabilities of the facility. An outline of the experimental nuclear data activities at CERN's neutron time-of-flight facility n_TOF will be presented.

Recent advances in laser-driven neutron sources

NASA Astrophysics Data System (ADS)

Alejo, A.; Ahmed, H.; Green, A.; Mirfayzi, S. R.; Borghesi, M.; Kar, S.

2016-11-01

Due to the limited number and high cost of large-scale neutron facilities, there has been a growing interest in compact accelerator-driven sources. In this context, several potential schemes of laser-driven neutron sources are being intensively studied employing laser-accelerated electron and ion beams. In addition to the potential of delivering neutron beams with high brilliance, directionality and ultra-short burst duration, a laser-driven neutron source would offer further advantages in terms of cost-effectiveness, compactness and radiation confinement by closed-coupled experiments. Some of the recent advances in this field are discussed, showing improvements in the directionality and flux of the laser-driven neutron beams.

Influence of field ionization effect on the divergence of laser-driven fast electrons

NASA Astrophysics Data System (ADS)

Lang, Y.; Yang, X. H.; Xu, H.; Jin, Z.; Zhuo, H. B.

2018-07-01

The effect of field ionization on the divergence of fast electrons (E k ≥ 50 keV), driven by ultrashort-ultraintense laser pulse interaction with plasma, is studied by using 2D3V particle-in-cell simulations. It is found that, due to temperature anisotropy of the fast electrons in the ionizing target, strong fluctuant magnetic fields in the preplasma region is generated through Weibel instability. In turn, the field induces an enhancement of the hot electron divergence for the target with ionization process. Meanwhile, compared with the target without an ionization process, larger divergence of hot electrons can also be seen in the ionizing target with laser intensity varying from 5 × 1019 W/cm2 to 5 × 1020 W/cm2 and the divergence is weakly dependent on target materials for a fixed profile of preplasma. The results here are useful for the application of laser-driven fast electron beams.

A novel laser-collider used to produce monoenergetic 13.3 MeV 7Li (d, n) neutrons

PubMed Central

Zhao, J. R.; Zhang, X. P.; Yuan, D. W.; Li, Y. T.; Li, D. Z.; Rhee, Y. J.; Zhang, Z.; Li, F.; Zhu, B. J.; Li, Yan F.; Han, B.; Liu, C.; Ma, Y.; Li, Yi F.; Tao, M. Z.; Li, M. H.; Guo, X.; Huang, X. G.; Fu, S. Z.; Zhu, J. Q.; Zhao, G.; Chen, L. M.; Fu, C. B.; Zhang, J.

2016-01-01

Neutron energy is directly correlated with the energy of the incident ions in experiments involving laser-driven nuclear reactions. Using high-energy incident ions reduces the energy concentration of the generated neutrons. A novel “laser-collider” method was used at the Shenguang II laser facility to produce monoenergetic neutrons via 7Li (d, n) nuclear reactions. The specially designed K-shaped target significantly increased the numbers of incident d and Li ions at the keV level. Ultimately, 13.3 MeV neutrons were obtained. Considering the time resolution of the neutron detector, we demonstrated that the produced neutrons were monoenergetic. Interferometry and a Multi hydro-dynamics simulation confirmed the monoenergetic nature of these neutrons. PMID:27250660

Hohlraum-driven mid-Z (SiO2) double-shell implosions on the omega laser facility and their scaling to NIF.

PubMed

Robey, H F; Amendt, P A; Milovich, J L; Park, H-S; Hamza, A V; Bono, M J

2009-10-02

High-convergence, hohlraum-driven implosions of double-shell capsules using mid-Z (SiO2) inner shells have been performed on the OMEGA laser facility [T. R. Boehly, Opt. Commun. 133, 495 (1997)]. These experiments provide an essential extension of the results of previous low-Z (CH) double-shell implosions [P. A. Amendt, Phys. Rev. Lett. 94, 065004 (2005)] to materials of higher density and atomic number. Analytic modeling, supported by highly resolved 2D numerical simulations, is used to account for the yield degradation due to interfacial atomic mixing. This extended experimental database from OMEGA enables a validation of the mix model, and provides a means for quantitatively assessing the prospects for high-Z double-shell implosions on the National Ignition Facility [Paisner, Laser Focus World 30, 75 (1994)].

Fatty Acid Synthase Activity as a Target for c-Met Driven Prostate Cancer

DTIC Science & Technology

2013-07-01

to aid future studies. Identification is a highly significant finding with regard to the potential for future therapeutic development targeted at...Met trafficking, stability, and ultimately oncogenic potential . Palmitoylation defective mutants will be used in animal models of c-Met driven tumor...growth (Aim 2). In addition, future work toward identifying the enzyme responsible for palmitoylation of c- Met will provide a new specific target

Thinshell symmetry surrogates for the National Ignition Facility: A rocket equation analysis

NASA Astrophysics Data System (ADS)

Amendt, Peter; Shestakov, A. I.; Landen, O. L.; Bradley, D. K.; Pollaine, S. M.; Suter, L. J.; Turner, R. E.

2001-06-01

Several techniques for inferring the degree of flux symmetry in indirectly driven cylindrical hohlraums have been developed over the past several years for eventual application to the National Ignition Facility (NIF) [Paisner et al., Laser Focus World 30, 75 (1994)]. These methods use various ignition capsule surrogates, including non-cryogenic imploded capsules [Hauer et al., Phys. Plasmas 2, 2488 (1995)], backlit aerogel foamballs [Amendt et al., Rev. Sci. Instrum. 66, 785 (1995)], reemission balls [Delamater, Magelssen, and Hauer, Phys. Rev. E 53, 5240 (1996)], and backlit thinshells [Pollaine et al., Phys. Plasmas 8, 2357 (2001)]. Recent attention has focussed on the backlit thinshells as a promising means for detecting higher-order Legendre flux asymmetries, e.g., P6 and P8, which are predicted to be important sources of target performance degradation on the NIF for levels greater than 1% [Haan et al., Phys. Plasmas 2, 2490 (1995)]. A key property of backlit thinshells is the strong amplification of modal flux asymmetry imprinting with shell convergence. A simple single-parameter analytic description based on a rocket model is presented which explores the degree of linearity of the shell response to an imposed flux asymmetry. Convergence and mass ablation effects introduce a modest level of nonlinearity in the shell response. The effect of target fabrication irregularities on shell distortion is assessed with the rocket model and particular sensitivity to shell thickness variations is shown. The model can be used to relate an observed or simulated backlit implosion trajectory to an ablation pressure asymmetry history. Ascertaining this history is an important element for readily establishing the degree of surrogacy of a symmetry target for a NIF ignition capsule.

Optical velocimetry at the Los Alamos Proton Radiography Facility

NASA Astrophysics Data System (ADS)

Tupa, Dale; Tainter, Amy; Neukirch, Levi; Hollander, Brian; Buttler, William; Holtkamp, David; The Los Alamos Proton Radiography Team Team

2016-05-01

The Los Alamos Proton Radiography Facility (pRad) employs a high-energy proton beam to image the properties and behavior of materials driven by high explosives. We will discuss features of pRad and describe some recent experiments, highlighting optical diagnostics for surface velocity measurements.

Targeting MYCN-Driven Transcription By BET-Bromodomain Inhibition.

PubMed

Henssen, Anton; Althoff, Kristina; Odersky, Andrea; Beckers, Anneleen; Koche, Richard; Speleman, Frank; Schäfers, Simon; Bell, Emma; Nortmeyer, Maike; Westermann, Frank; De Preter, Katleen; Florin, Alexandra; Heukamp, Lukas; Spruessel, Annika; Astrahanseff, Kathy; Lindner, Sven; Sadowski, Natalie; Schramm, Alexander; Astorgues-Xerri, Lucile; Riveiro, Maria E; Eggert, Angelika; Cvitkovic, Esteban; Schulte, Johannes H

2016-05-15

Targeting BET proteins was previously shown to have specific antitumoral efficacy against MYCN-amplified neuroblastoma. We here assess the therapeutic efficacy of the BET inhibitor, OTX015, in preclinical neuroblastoma models and extend the knowledge on the role of BRD4 in MYCN-driven neuroblastoma. The efficacy of OTX015 was assessed in in vitro and in vivo models of human and murine MYCN-driven neuroblastoma. To study the effects of BET inhibition in the context of high MYCN levels, MYCN was ectopically expressed in human and murine cells. The effect of OTX015 on BRD4-regulated transcriptional pause release was analyzed using BRD4 and H3K27Ac chromatin immunoprecipitation coupled with DNA sequencing (ChIP-Seq) and gene expression analysis in neuroblastoma cells treated with OTX015 compared with vehicle control. OTX015 showed therapeutic efficacy against preclinical MYCN-driven neuroblastoma models. Similar to previously described BET inhibitors, concurrent MYCN repression was observed in OTX015-treated samples. Ectopic MYCN expression, however, did not abrogate effects of OTX015, indicating that MYCN repression is not the only target of BET proteins in neuroblastoma. When MYCN was ectopically expressed, BET inhibition still disrupted MYCN target gene transcription without affecting MYCN expression. We found that BRD4 binds to super-enhancers and MYCN target genes, and that OTX015 specifically disrupts BRD4 binding and transcription of these genes. We show that OTX015 is effective against mouse and human MYCN-driven tumor models and that BRD4 not only targets MYCN, but specifically occupies MYCN target gene enhancers as well as other genes associated with super-enhancers. Clin Cancer Res; 22(10); 2470-81. ©2015 AACR. ©2015 American Association for Cancer Research.

Preliminary research on flow rate and free surface of the accelerator driven subcritical system gravity-driven dense granular-flow target

PubMed Central

Li, Xiaodong; Wan, Jiangfeng; Zhang, Sheng; Lin, Ping; Zhang, Yanshi; Yang, Guanghui; Wang, Mengke; Duan, Wenshan; Sun, Jian’an

2017-01-01

A spallation target is one of the three core parts of the accelerator driven subcritical system (ADS), which has already been investigated for decades. Recently, a gravity-driven Dense Granular-flow Target (DGT) is proposed, which consists of a cylindrical hopper and an internal coaxial cylindrical beam pipe. The research on the flow rate and free surface are important for the design of the target whether in Heavy Liquid Metal (HLM) targets or the DGT. In this paper, the relations of flow rate and the geometry of the DGT are investigated. Simulations based on the discrete element method (DEM) implementing on Graphics Processing Units (GPUs) and experiments are both performed. It is found that the existence of an internal pipe doesn’t influence the flow rate when the distance from the bottom of the pipe to orifice is large enough even in a larger system. Meanwhile, snapshots of the free surface formed just below the beam pipe are given. It is observed that the free surface is stable over time. The entire research is meaningful for the design of DGT. PMID:29095910

Preliminary research on flow rate and free surface of the accelerator driven subcritical system gravity-driven dense granular-flow target.

PubMed

Li, Xiaodong; Wan, Jiangfeng; Zhang, Sheng; Lin, Ping; Zhang, Yanshi; Yang, Guanghui; Wang, Mengke; Duan, Wenshan; Sun, Jian'an; Yang, Lei

2017-01-01

A spallation target is one of the three core parts of the accelerator driven subcritical system (ADS), which has already been investigated for decades. Recently, a gravity-driven Dense Granular-flow Target (DGT) is proposed, which consists of a cylindrical hopper and an internal coaxial cylindrical beam pipe. The research on the flow rate and free surface are important for the design of the target whether in Heavy Liquid Metal (HLM) targets or the DGT. In this paper, the relations of flow rate and the geometry of the DGT are investigated. Simulations based on the discrete element method (DEM) implementing on Graphics Processing Units (GPUs) and experiments are both performed. It is found that the existence of an internal pipe doesn't influence the flow rate when the distance from the bottom of the pipe to orifice is large enough even in a larger system. Meanwhile, snapshots of the free surface formed just below the beam pipe are given. It is observed that the free surface is stable over time. The entire research is meaningful for the design of DGT.

Interaction of laser beams with magnetized substance in a strong magnetic field

NASA Astrophysics Data System (ADS)

Kuzenov, V. V.

2018-03-01

Laser-driven magneto-inertial fusion assumed plasma and magnetic flux compression by quasisymmetric laser-driven implosion of magnetized target. We develop a 2D radiation magnetohydrodynamic code and a formulation for the one-fluid two-temperature equations for simulating compressible non-equilibrium magnetized target plasma. Laser system with pulse radiation with 10 ns duration is considered for numerical experiments. A numerical study of a scheme of magnetized laser-driven implosion in the external magnetic field is carried out.

NREL Research Support Facility (RSF) Documentary

DOE Office of Scientific and Technical Information (OSTI.GOV)

Glover, Bill; Pless, Shanti; Torcellini, Paul

2010-01-01

The ideas and innovations that define NREL are now shaping the next generation of commercial office buildings. DOE's Research Support Facility at NREL, will set a new benchmark for affordable, sustainable commercial design and construction. The unique form of the RSF is driven by energy-saving strategies, many researched and advanced at NREL.

NREL Research Support Facility (RSF) Documentary

ScienceCinema

Glover, Bill; Pless, Shanti; Torcellini, Paul; Judkoff, Ron; Detamore, Drew; Telesmanich, Eric

2017-12-09

The ideas and innovations that define NREL are now shaping the next generation of commercial office buildings. DOE's Research Support Facility at NREL, will set a new benchmark for affordable, sustainable commercial design and construction. The unique form of the RSF is driven by energy-saving strategies, many researched and advanced at NREL.

High coupling efficiency of foam spherical hohlraum driven by 2ω laser light

NASA Astrophysics Data System (ADS)

Chen, Yao-Hua; Lan, Ke; Zheng, Wanguo; Campbell, E. M.

2018-02-01

The majority of solid state laser facilities built for laser fusion research irradiate targets with third harmonic light (0.35 μm) up-converted from the fundamental Nd wavelength at 1.05 μm. The motivation for this choice of wavelength is improved laser-plasma coupling. Significant disadvantages to this choice of wavelength are the reduced damage threshold of optical components and the efficiency of energy conversion to third harmonic light. Both these issues are significantly improved if second harmonic (0.53 μm) radiation is used, but theory and experiments have shown lower optical to x-ray energy conversion efficiency and increased levels of laser-plasma instabilities, resulting in reduced laser-target coupling. In this letter, we propose to use a 0.53 μm laser for the laser ignition facilities and use a low density foam wall to increase the coupling efficiency from the laser to the capsule and present two-dimensional radiation-hydrodynamic simulations of 0.53 μm laser light irradiating an octahedral-spherical hohlraum with a low density foam wall. The simulations show that the reduced optical depth of the foam wall leads to an increased laser-light conversion into thermal x-rays and about 10% higher radiation flux on the capsule than that achieved with 0.35 μm light irradiating a solid density wall commonly used in laser indirect drive fusion research. The details of the simulations and their implications and suggestions for wavelength scaling coupled with innovative hohlraum designs will be discussed.

ARC-1964-A-33038-22

NASA Image and Video Library

1964-08-14

Aerial view of Gasdynamics facility in 1964 and the 20 inch helium tunnel Part of the Thermal Protection Laboratory used to research materials for heat shield applications and for aerodynamic heating and materials studies of vehicles in planetary atmospheres.  This laboratory is comprised of five separate facilities: an Aerodynamic Heating Tunnel, a Heat Transfer Tunnel, two Supersonic Turbulent Ducts, and a High-Power CO2 Gasdynamic Laser. All these facilities are driven by arc-heaters, with the exception of the large, combustion-type laser. The arc-heated facilities are powered by a 20 Megawatt DC power supply. Their effluent gas stream (test gases; Air, N2, He, CO2 and mixtures; flow rates from 0.05 to 5.0 lbs/sec) discharges into a five-stage stream-ejector-driven vacuum system. The vacuum system and power supply are common to the test faciities in building N-238. All of the facilities have high pressure water available at flow rates up to 4, 000 gals/min. The data obtained from these facilities are recorded on magnetic tape or oscillographs. All forms of data can be handled whether from thermo-couples, pressure cells, pyrometers, or radiometers, etc. in addition, closed circuit T. V. monitors and various film cameras are available. (operational since 1962)

Building v/s Exploring Models: Comparing Learning of Evolutionary Processes through Agent-based Modeling

NASA Astrophysics Data System (ADS)

Wagh, Aditi

Two strands of work motivate the three studies in this dissertation. Evolutionary change can be viewed as a computational complex system in which a small set of rules operating at the individual level result in different population level outcomes under different conditions. Extensive research has documented students' difficulties with learning about evolutionary change (Rosengren et al., 2012), particularly in terms of levels slippage (Wilensky & Resnick, 1999). Second, though building and using computational models is becoming increasingly common in K-12 science education, we know little about how these two modalities compare. This dissertation adopts agent-based modeling as a representational system to compare these modalities in the conceptual context of micro-evolutionary processes. Drawing on interviews, Study 1 examines middle-school students' productive ways of reasoning about micro-evolutionary processes to find that the specific framing of traits plays a key role in whether slippage explanations are cued. Study 2, which was conducted in 2 schools with about 150 students, forms the crux of the dissertation. It compares learning processes and outcomes when students build their own models or explore a pre-built model. Analysis of Camtasia videos of student pairs reveals that builders' and explorers' ways of accessing rules, and sense-making of observed trends are of a different character. Builders notice rules through available blocks-based primitives, often bypassing their enactment while explorers attend to rules primarily through the enactment. Moreover, builders' sense-making of observed trends is more rule-driven while explorers' is more enactment-driven. Pre and posttests reveal that builders manifest a greater facility with accessing rules, providing explanations manifesting targeted assembly. Explorers use rules to construct explanations manifesting non-targeted assembly. Interviews reveal varying degrees of shifts away from slippage in both modalities, with students who built models not incorporating slippage explanations in responses. Study 3 compares these modalities with a control using traditional activities. Pre and posttests reveal that the two modalities manifested greater facility with accessing and assembling rules than the control. The dissertation offers implications for the design of learning environments for evolutionary change, design of the two modalities based on their strengths and weaknesses, and teacher training for the same.

EDITORIAL: Inertial Fusion State of the Art---A Collection of Overview and Technical Papers from IFSA2003

NASA Astrophysics Data System (ADS)

Hogan, W. J.

2004-12-01

The Third International Conference on Inertial Fusion Sciences and Applications (IFSA2003) was held in Monterey, CA, USA, on 7--12 September 2003. The goal of IFSA2003 was to bring together scientists and engineers in the fields of inertial fusion sciences, high energy density physics, inertial fusion energy (IFE) and other related research and applications. By all measures IFSA2003 was a resounding success. IFSA2003 was hosted by the University of California, which was supported in organizing the conference by seven institutions: General Atomics, Lawrence Berkeley National Laboratory, Lawrence Livermore National Laboratory, Los Alamos National Laboratory, Naval Research Laboratory, Sandia National Laboratory and the University of Rochester, Laboratory for Laser Energetics. IFSA2003 was the largest IFSA conference yet with 405 participants from 17 countries. Approximately 430 papers were presented and 236 appeared in the Proceedings, published in July 2004 by the American Nuclear Society [1]. A subset of the Nuclear Fusion Board of Editors, those who work on inertial confinement fusion (ICF), recommended creating this special issue of Nuclear Fusion by selecting a representative cross-section of the papers presented at IFSA2003. Authors of the selected papers were asked to expand their papers and make them suitable for publication in it Nuclear Fusion. Nineteen papers are presented in this special issue. They represent a cross-section of the papers presented at IFSA2003. However, there was no attempt to represent the `feel' of the conference by having the same fraction of papers on each topic as existed at IFSA. There were far more detailed scientific papers at IFSA than are presented in this special issue. However, in the interest of giving the reader a cross-section of the papers and showing the entire breadth of ICF research going on, we have biased the selection process toward review papers. The first three papers here are based upon the keynote talks at IFSA2003 and are, therefore, overviews of all ICF research being done in the Americas, Asia, and Europe. The next two papers are also reviews but of a different sort. The Teller Medal is awarded at the IFSA conferences for pioneering work and leadership in inertial fusion and high energy density science. The two recipients for 2003 were H. Takabe of the Institute of Laser Engineering at Osaka University and L. Suter of Lawrence Livermore National Laboratory. These awardees were asked to deliver the two Teller Lectures at IFSA based upon the work for which they were being honoured. The papers presented here are expansions of those two review talks. Suter chose to focus his review on his recent work on ignition physics for targets driven by 0.54 m light. This is of interest because large facilities like the National Ignition Facility (NIF) will deliver much more energy in the frequency doubled wavelength than in the frequency tripled one. Takabe, on the other hand chose to give a historical perspective of his lifelong work. The other 14 papers were selected to represent a cross-section of the research being conducted in the science and engineering of inertial fusion. The papers by Haan et al and Holstein et al represent some of the recent progress in target design calculations for the ignition first experiments. Haan presents his team's work on indirect drive ignition targets (driven by 0.35 m) intended for the National Ignition Facility (NIF) when all the beamlines are activated. Holstein does the same for targets being design for the Laser MegaJoule (LMJ). Suter's paper, presented earlier as a Teller Lecture also falls into this ignition target physics category. The next four papers look at some of the exciting high energy density physics being studied in ICF facilities around the world. Glenzer et al looks at stimulated light scattering processes in hot dense plasmas. Pukhov et al look at relativistic laser-plasma interactions that produce energetic particles and x-rays. Peyrusse et al examine atomic physics and radiative processes in hot dense plasmas. Koenig et al examine ways to simulate planetary physics processes using high pressures generated in laser driven shocks. Non-laser approaches to inertial fusion were also fully represented at IFSA2003. The paper by Lebedev et al shows important physics developments in Z-pinch plasmas. Sharp et al present chamber transport modelling for heavy ion fusion drivers. Technology development studies were also well represented at IFSA2003. There was a special session on facility and driver developments that contained several papers. Presented here are the papers by Miller et al on the NIF, Danson et al on the Vulcan petawatt facility, and Myers et al on KrF lasers for IFE. A paper by Goodin et al shows progress in finding cost effective target manufacturing methods for IFE. Finally, there were many papers at IFSA2003 that focused upon the very promising but more immature field of fast ignition. Barty et al give an overview of the development issues for short pulse lasers that will be essential if fast ignition is to become mainstream. A paper by Kodama et al looks at target physics using cone focus targets. Fast ignition lasers and innovative target physics within this concept were a `hot topic' at IFSA2003. The IFSA conferences have become the principal forum for the exchange of research results in inertial fusion and high energy and density science. There is a unique blend of science and technology. All fields of inertial fusion are represented. This special issue is a snapshot and a cross-section of the field at this time. We hope the reader is encouraged to look into more of the papers in areas that interest them. References [1] Inertial Fusion Sciences and Applications: State of the Art 2003 ed B. Hammel, D. Meyerhofer, J. Meyer-ter-Vehn and H. Azechi American Nuclear Society (July 2004) These IFSA2003 proceedings may be purchased on-line at http://www.ans.org.

Optical Investigations of Powerful Laser Actions on Massive and Flyer Targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pisarczyk, T.; Borodziuk, S.; Kasperczuk, A.

2006-01-15

In this paper we present experimental, theoretical, and computer simulation studies of craters formation produced by high power lasers in single and double layer targets. The experimental investigation was carried out using the PALS (Prague Asterix Laser System) facility working with two different laser beam wavelengths: {lambda}1 = 1.315 {mu}m and {lambda}3 0.438 {mu}m. Two types of targets made of Al were used: single massive targets, and double targets consisting of a foil or disk (6 {mu}m thick for both cases) placed in front of the massive target part at a distance of 200-500 {mu}m. Experiments with single massive targetsmore » were performed at laser intensities in the range of 1013-1015 W/cm2 by varying the laser beam diameters on the target surface from 70 {mu}m up to 1200 {mu}m (i.e. moving the target away from the focus). The double targets were illuminated by laser energies EL = 100-500 J focused always on a diameter of 250 {mu}m. In all experiments performed the laser pulse duration was equal to 400 ps. 3-frame interferometry was employed to investigate the plasma dynamics through measurements of the electron density distribution time development as well as of the disks and foil fragments velocities. The dimensions and shapes of craters were obtained by crater replica technology and microscopy measurement. The experiments were complemented by a 2-D analytical theory and computer simulations, which helped at interpretation of the results. This way the values of laser energy absorption coefficient, ablation loading efficiency and efficiency of energy transfer, as well as two-dimensional shock wave generation at the laser-driven macroparticle impact were obtained from the measured crater parameters for both the wavelengths of laser radiation.« less

mTORC1-Mediated Inhibition of 4EBP1 Is Essential for Hedgehog Signaling-Driven Translation and Medulloblastoma.

PubMed

Wu, Chang-Chih; Hou, Shirui; Orr, Brent A; Kuo, Bryan R; Youn, Yong Ha; Ong, Taren; Roth, Fanny; Eberhart, Charles G; Robinson, Giles W; Solecki, David J; Taketo, Makoto M; Gilbertson, Richard J; Roussel, Martine F; Han, Young-Goo

2017-12-18

Mechanistic target of rapamycin (MTOR) cooperates with Hedgehog (HH) signaling, but the underlying mechanisms are incompletely understood. Here we provide genetic, biochemical, and pharmacologic evidence that MTOR complex 1 (mTORC1)-dependent translation is a prerequisite for HH signaling. The genetic loss of mTORC1 function inhibited HH signaling-driven growth of the cerebellum and medulloblastoma. Inhibiting translation or mTORC1 blocked HH signaling. Depleting 4EBP1, an mTORC1 target that inhibits translation, alleviated the dependence of HH signaling on mTORC1. Consistent with this, phosphorylated 4EBP1 levels were elevated in HH signaling-driven medulloblastomas in mice and humans. In mice, an mTORC1 inhibitor suppressed medulloblastoma driven by a mutant SMO that is inherently resistant to existing SMO inhibitors, prolonging the survival of the mice. Our study reveals that mTORC1-mediated translation is a key component of HH signaling and an important target for treating medulloblastoma and other cancers driven by HH signaling. Copyright © 2017 Elsevier Inc. All rights reserved.

Experimental realization of dynamo action: present status and prospects

NASA Astrophysics Data System (ADS)

Giesecke, André; Stefani, Frank; Gundrum, Thomas; Gerbeth, Gunter; Nore, Caroline; Léorat, Jacques

2013-07-01

In the last decades, the experimental study of dynamo action has made great progress. However, after the dynamo experiments in Karlsruhe and Riga, the von-Kármán-Sodium (VKS) dynamo is only the third facility that has been able to demonstrate fluid flow driven self-generation of magnetic fields in a laboratory experiment. Further progress in the experimental examination of dynamo action is expected from the planned precession driven dynamo experiment that will be designed in the framework of the liquid sodium facility DRESDYN (DREsden Sodium facility for DYNamo and thermohydraulic studies). In this paper, we briefly present numerical models of the VKS dynamo that demonstrate the close relation between the axisymmetric field observed in that experiment and the soft iron material used for the flow driving impellers. We further show recent results of preparatory water experiments and design studies related to the precession dynamo and delineate the scientific prospects for the final set-up.

Surveillance and response for high-risk populations: what can malaria elimination programmes learn from the experience of HIV?

PubMed

Jacobson, Jerry O; Cueto, Carmen; Smith, Jennifer L; Hwang, Jimee; Gosling, Roly; Bennett, Adam

2017-01-18

To eliminate malaria, malaria programmes need to develop new strategies for surveillance and response appropriate for the changing epidemiology that accompanies transmission decline, in which transmission is increasingly driven by population subgroups whose behaviours place them at increased exposure. Conventional tools of malaria surveillance and response are likely not sufficient in many elimination settings for accessing high-risk population subgroups, such as mobile and migrant populations (MMPs), given their greater likelihood of asymptomatic infections, illegal risk behaviours, limited access to public health facilities, and high mobility including extended periods travelling away from home. More adaptive, targeted strategies are needed to monitor transmission and intervention coverage effectively in these groups. Much can be learned from HIV programmes' experience with "second generation surveillance", including how to rapidly adapt surveillance and response strategies to changing transmission patterns, biological and behavioural surveys that utilize targeted sampling methods for specific behavioural subgroups, and methods for population size estimation. This paper reviews the strategies employed effectively for HIV programmes and offers considerations and recommendations for adapting them to the malaria elimination context.

Laser Plasma Instability (LPI) Driven Light Scattering Measurements with Nike KrF Laser

NASA Astrophysics Data System (ADS)

Oh, J.; Weaver, J. L.; Kehne, D. M.; Obenschain, S. P.; McLean, E. A.; Lehmberg, R. H.

2008-11-01

With the short wavelength (248 nm), large bandwidth (1˜2 THz), and ISI beam smoothing, Nike KrF laser is expected to have higher LPI thresholds than observed at other laser facilities. Previous measurements using the Nike laser [J. L. Weaver et al, Phys. Plasmas 14, 056316 (2007)] showed no LPI evidence from CH targets up to I˜2x10^15 W/cm^2. For further experiments to detect LPI excitation, Nike capabilities have been extended to achieve higher laser intensities by tighter beam focusing and higher power pulses. This talk will present results of a recent LPI experiment with the extended Nike capabilities focusing on light emission data in spectral ranges relevant to the Raman (SRS) and Two-Plasmon Decay (TPD) instabilities. The primary diagnostics were time-resolved spectrometers with an absolute-intensity-calibrated photodiode array in (0.4˜0.8)φ0 and a streak camera near 0.5φ0. The measurements were conducted at laser intensities of 10^15˜10^16 W/cm^2 on planar targets of CH solids and RF foams.

Update on developments at SNIF

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zacks, J., E-mail: jamie.zacks@ccfe.ac.uk; Turner, I.; Day, I.

The Small Negative Ion Facility (SNIF) at CCFE has been undergoing continuous development and enhancement to both improve operational reliability and increase diagnostic capability. SNIF uses a CW 13.56MHz, 5kW RF driven volume source with a 30kV triode accelerator. Improvement and characterisation work includes: Installation of a new “L” type RF matching unit, used to calculate the load on the RF generator. Use of the electron suppressing biased insert as a Langmuir probe under different beam extraction conditions. Measurement of the hydrogen Fulcher molecular spectrum, used to calculate gas temperature in the source. Beam optimisation through parameter scans, using coppermore » target plate and visible cameras, with results compared with AXCEL-INP to provide beam current estimate. Modelling of the beam power density profile on the target plate using ANSYS to estimate beam power and provide another estimate of beam current. This work is described, and has allowed an estimation of the extracted beam current of approximately 6mA (4mA/cm2) at 3.5kW RF power and a source pressure of 0.6Pa.« less

Quantitative Properties of the Macro Supply and Demand Structure for Care Facilities for Elderly in Japan.

PubMed

Nishino, Tatsuya

2017-12-01

As the Asian country with the most aged population, Japan, has been modifying its social welfare system. In 2000, the Japanese social care vision turned towards meeting the elderly's care needs in their own homes with proper formal care services. This study aims to understand the quantitative properties of the macro supply and demand structure for facilities for the elderly who require support or long-term care throughout Japan and present them as index values. Additionally, this study compares the targets for establishing long-term care facilities set by Japan's Ministry of Health, Labor and Welfare for 2025. In 2014, approximately 90% of all the people who were certified as requiring support and long-term care and those receiving preventive long-term care or long-term care services, were 75 years or older. The target increases in the number of established facilities by 2025 (for the 75-years-or-older population) were calculated to be 3.3% for nursing homes; 2.71% for long-term-care health facilities; 1.7% for group living facilities; and, 1.84% for community-based multi-care facilities. It was revealed that the establishment targets for 2025 also increase over current projections with the expected increase of the absolute number of users of group living facilities and community-based multi-care facilities. On the other hand, the establishment target for nursing homes remains almost the same as the current projection, whereas that for long-term-care health facilities decreases. These changes of facility ratios reveal that the Japanese social care system is shifting to realize 'Ageing in Place'. When considering households' tendencies, the target ratios for established facilities are expected to be applied to the other countries in Asia.

Quantitative Properties of the Macro Supply and Demand Structure for Care Facilities for Elderly in Japan

PubMed Central

Nishino, Tatsuya

2017-01-01

As the Asian country with the most aged population, Japan, has been modifying its social welfare system. In 2000, the Japanese social care vision turned towards meeting the elderly’s care needs in their own homes with proper formal care services. This study aims to understand the quantitative properties of the macro supply and demand structure for facilities for the elderly who require support or long-term care throughout Japan and present them as index values. Additionally, this study compares the targets for establishing long-term care facilities set by Japan’s Ministry of Health, Labor and Welfare for 2025. In 2014, approximately 90% of all the people who were certified as requiring support and long-term care and those receiving preventive long-term care or long-term care services, were 75 years or older. The target increases in the number of established facilities by 2025 (for the 75-years-or-older population) were calculated to be 3.3% for nursing homes; 2.71% for long-term-care health facilities; 1.7% for group living facilities; and, 1.84% for community-based multi-care facilities. It was revealed that the establishment targets for 2025 also increase over current projections with the expected increase of the absolute number of users of group living facilities and community-based multi-care facilities. On the other hand, the establishment target for nursing homes remains almost the same as the current projection, whereas that for long-term-care health facilities decreases. These changes of facility ratios reveal that the Japanese social care system is shifting to realize ‘Ageing in Place’. When considering households’ tendencies, the target ratios for established facilities are expected to be applied to the other countries in Asia. PMID:29194405

Investigating Wind-Driven Rain Intrusion in Walls with the CARWASh

Treesearch

C.R. Boardman; Samuel V. Glass

2013-01-01

Wind-driven rain provides the primary external moisture load for exterior walls.Water absorption by the cladding, runoff, and penetration through the cladding or at details determine how a wall system performs. In this paper we describe a new laboratory facility that can create controlled outdoor and indoor conditions and use it to investigate the water...

LLE Review Quarterly Report (January-March 2002). Volume 90

DOE Office of Scientific and Technical Information (OSTI.GOV)

Donaldson, William R.

2002-03-01

This volume of the LLE Review, covering January-March 2002, features “First Results from Cryogenic Target Implosions on OMEGA” by C. Stoeckl et al. (p. 49). This article describes initial results from direct-drive spherical cryogenic target implosions on the 60-beam OMEGA laser system. These experiments are part of the scientific base leading to direct-drive ignition implosions planned for the National Ignition Facility (NIF). Results shown include neutron yield, secondary-neutron and proton yields, the time of peak neutron emission, and both time-integrated and time-resolved x-ray images of the imploding core. The experimental values are compared with 1-D numerical simulations. The target withmore » an ice-layer nonuniformity of srms = 9 mm showed 30% of the 1-D predicted neutron yield. These initial results are encouraging for future cryogenic implosions on OMEGA and the NIF. Other articles in this issue are titled the following: Equation-of-State Measurements of Porous Materials on OMEGA: Numerical Modeling; Observations of Modulated Shock Waves in Solid Targets Driven by Spatially Modulated Laser Beams; Time-Dependent Electron Thermal Flux Inhibition in direct-Drive Laser Implosions; Precision Spectral Sculpting of Broadband FM Pulses Amplified in a Narrowband Medium; Electric-Field-Induced Motion of Polymer Cholesteric Liquid Crystal Flakes in a Moderately Conductive Fluid; and, Femtosecond Response of a Freestanding LT-GaAs Photoconductive Switch.« less

Polar-direct-drive experiments with contoured-shell targets on OMEGA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marshall, F. J.; Radha, P. B.; Bonino, M. J.

Polar-driven direct-drive experiments recently performed on the OMEGA Laser System have demonstrated the efficacy of using a target with a contoured shell with varying thickness to improve the symmetry and fusion performance of the implosion. The polar-driven contoured-shell implosions have substantially reduced low mode perturbations compared to polar-driven spherical-shell implosions as diagnosed by x-ray radiographs up to shell stagnation. As a result, fusion yields were increased by more than a factor of ~2 without increasing the energy of the laser by the use of contoured shells.

Polar-direct-drive experiments with contoured-shell targets on OMEGA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marshall, F. J.; Radha, P. B.; Bonino, M. J.

Polar-driven direct-drive experiments recently performed on the OMEGA Laser System have demonstrated the efficacy of using a target with a contoured shell with varying thickness to improve the symmetry and fusion performance of the implosion. The polar-driven contoured-shell implosions have substantially reduced low mode perturbations compared to polar-driven spherical-shell implosions as diagnosed by x-ray radiographs up to shell stagnation. Fusion yields were increased by more than a factor of ∼2 without increasing the energy of the laser by the use of contoured shells.

Polar-direct-drive experiments with contoured-shell targets on OMEGA

DOE PAGES

Marshall, F. J.; Radha, P. B.; Bonino, M. J.; ...

2016-01-28

Polar-driven direct-drive experiments recently performed on the OMEGA Laser System have demonstrated the efficacy of using a target with a contoured shell with varying thickness to improve the symmetry and fusion performance of the implosion. The polar-driven contoured-shell implosions have substantially reduced low mode perturbations compared to polar-driven spherical-shell implosions as diagnosed by x-ray radiographs up to shell stagnation. As a result, fusion yields were increased by more than a factor of ~2 without increasing the energy of the laser by the use of contoured shells.

Active machine learning-driven experimentation to determine compound effects on protein patterns.

PubMed

Naik, Armaghan W; Kangas, Joshua D; Sullivan, Devin P; Murphy, Robert F

2016-02-03

High throughput screening determines the effects of many conditions on a given biological target. Currently, to estimate the effects of those conditions on other targets requires either strong modeling assumptions (e.g. similarities among targets) or separate screens. Ideally, data-driven experimentation could be used to learn accurate models for many conditions and targets without doing all possible experiments. We have previously described an active machine learning algorithm that can iteratively choose small sets of experiments to learn models of multiple effects. We now show that, with no prior knowledge and with liquid handling robotics and automated microscopy under its control, this learner accurately learned the effects of 48 chemical compounds on the subcellular localization of 48 proteins while performing only 29% of all possible experiments. The results represent the first practical demonstration of the utility of active learning-driven biological experimentation in which the set of possible phenotypes is unknown in advance.

Generation of sub-gigabar-pressure shocks by a hyper-velocity impact in the collider driven by laser-induced cavity pressure

NASA Astrophysics Data System (ADS)

Badziak, J.; Kucharik, M.; Liska, R.

2018-02-01

The generation of high-pressure shocks in the newly proposed collider in which the projectile impacting a solid target is driven by the laser-induced cavity pressure acceleration (LICPA) mechanism is investigated using two-dimensional hydrodynamic simulations. The dependence of parameters of the shock generated in the target by the impact of a gold projectile on the impacted target material and the laser driver energy is examined. It is found that both in case of low-density (CH, Al) and high-density (Au, Cu) solid targets the shock pressures in the sub-Gbar range can be produced in the LICPA-driven collider with the laser energy of only a few hundreds of joules, and the laser-to-shock energy conversion efficiency can reach values of 10 - 20 %, by an order of magnitude higher than the conversion efficiencies achieved with other laser-based methods used so far.

Making Charter School Facilities More Affordable: State-driven Policy Approaches. Innovations in Education

ERIC Educational Resources Information Center

US Department of Education, 2008

2008-01-01

Securing appropriate facilities can be a significant challenge for those intending to open a charter school. Although, like all public schools, charter schools receive per-pupil dollars from the state, they generally receive considerably less. Additionally, because traditional public schools rely on their district to provide their school…

Five Recession-Driven Strategies for Planning and Managing Campus Facilities

ERIC Educational Resources Information Center

Rudden, Michael S.

2010-01-01

Colleges and universities continue to face significant fiscal challenges in the current recession. A review of ongoing campus facilities planning projects, coupled with a review of more than 30 recent campus master planning requests for proposals and the relevant literature, indicates that colleges and universities are finding innovative ways to…

Segmented beryllium target for a 2 MW super beam facility

DOE PAGES

Davenne, T.; Caretta, O.; Densham, C.; ...

2015-09-14

The Long Baseline Neutrino Facility (LBNF, formerly the Long Baseline Neutrino Experiment) is under design as a next generation neutrino oscillation experiment, with primary objectives to search for CP violation in the leptonic sector, to determine the neutrino mass hierarchy and to provide a precise measurement of θ 23. The facility will generate a neutrino beam at Fermilab by the interaction of a proton beam with a target material. At the ultimate anticipated proton beam power of 2.3 MW the target material must dissipate a heat load of between 10 and 25 kW depending on the target size. This paper presents amore » target concept based on an array of spheres and compares it to a cylindrical monolithic target such as that which currently operates at the T2K facility. Thus simulation results show that the proposed technology offers efficient cooling and lower stresses whilst delivering a neutrino production comparable with that of a conventional solid cylindrical target.« less

The impact of nurse-driven targeted HIV screening in 8 emergency departments: study protocol for the DICI-VIH cluster-randomized two-period crossover trial.

PubMed

Leblanc, Judith; Rousseau, Alexandra; Hejblum, Gilles; Durand-Zaleski, Isabelle; de Truchis, Pierre; Lert, France; Costagliola, Dominique; Simon, Tabassome; Crémieux, Anne-Claude

2016-02-01

In 2010, to reduce late HIV diagnosis, the French national health agency endorsed non-targeted HIV screening in health care settings. Despite these recommendations, non-targeted screening has not been implemented and only physician-directed diagnostic testing is currently performed. A survey conducted in 2010 in 29 French Emergency Departments (EDs) showed that non-targeted nurse-driven screening was feasible though only a few new HIV diagnoses were identified, predominantly among high-risk groups. A strategy targeting high-risk groups combined with current practice could be shown to be feasible, more efficient and cost-effective than current practice alone. DICI-VIH (acronym for nurse-driven targeted HIV screening) is a multicentre, cluster-randomized, two-period crossover trial. The primary objective is to compare the effectiveness of 2 strategies for diagnosing HIV among adult patients visiting EDs: nurse-driven targeted HIV screening combined with current practice (physician-directed diagnostic testing) versus current practice alone. Main secondary objectives are to compare access to specialist consultation and how early HIV diagnosis occurs in the course of the disease between the 2 groups, and to evaluate the implementation, acceptability and cost-effectiveness of nurse-driven targeted screening. The 2 strategies take place during 2 randomly assigned periods in 8 EDs of metropolitan Paris, where 42 % of France's new HIV patients are diagnosed every year. All patients aged 18 to 64, not presenting secondary to HIV exposure are included. During the intervention period, patients are invited to fill a 7-item questionnaire (country of birth, sexual partners and injection drug use) in order to select individuals who are offered a rapid test. If the rapid test is reactive, a follow-up visit with an infectious disease specialist is scheduled within 72 h. Assuming an 80 % statistical power and a 5 % type 1 error, with 1.04 and 3.38 new diagnoses per 10,000 patients in the control and targeted groups respectively, a sample size of 140,000 patients was estimated corresponding to 8,750 patients per ED and per period. Inclusions started in June 2014. Results are expected by mid-2016. The DICI-VIH study is the first large randomized controlled trial designed to assess nurse-driven targeted HIV screening. This study can provide valuable information on HIV screening in health care settings. ClinicalTrials.gov: NCT02127424 (29 April 2014).

Long duration X-ray drive hydrodynamics experiments relevant for laboratory astrophysics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Casner, A.; Martinez, D.; Smalyuk, V.

The advent of high-power lasers facilities such as the National Ignition Facility (NIF), and the Laser Megajoule (LMJ) in the near future, opens a new era in the field of High Energy Density Laboratory Astrophysics. These versatile laser facilities will provide unique platforms to study the rich physics of nonlinear and turbulent mixing flows. The extended laser pulse duration could be harnessed to accelerate targets over much larger distances and longer time periods than previously achieved. Here, we report on the first results acquired on NIF with the ablative Rayleigh–Taylor Instability (RTI) platform. A 20-ns X-ray drive is tailored tomore » accelerate planar modulated samples into the highly-nonlinear bubble merger regime. Based on the analogy between flames front and ablation front, highly nonlinear RTI measurements at ablation front can provide important insights into the initial deflagration stage of thermonuclear supernova of Type Ia. We also report on an innovative concept used to create even longer drive on multi-beam laser facilities. The multi-barrel hohlraum (Gattling Gun) approach consists, here, of three adjacent cavities, driven in succession in time. This novel concept has been validated on the Omega EP laser system. The three cavities were irradiated with three 6–10 ns pulse UV beams and a 30 ns, 90 eV X-ray radiation drive was measured with the time-resolved X-ray spectrometer μDMX. This concept is promising to investigate the pillar structures in the Eagle Nebula or for photoionization studies which require a steady light source of sufficient duration to recreate relevant physics.« less

Long duration X-ray drive hydrodynamics experiments relevant for laboratory astrophysics

DOE PAGES

Casner, A.; Martinez, D.; Smalyuk, V.; ...

2014-09-20

The advent of high-power lasers facilities such as the National Ignition Facility (NIF), and the Laser Megajoule (LMJ) in the near future, opens a new era in the field of High Energy Density Laboratory Astrophysics. These versatile laser facilities will provide unique platforms to study the rich physics of nonlinear and turbulent mixing flows. The extended laser pulse duration could be harnessed to accelerate targets over much larger distances and longer time periods than previously achieved. Here, we report on the first results acquired on NIF with the ablative Rayleigh–Taylor Instability (RTI) platform. A 20-ns X-ray drive is tailored tomore » accelerate planar modulated samples into the highly-nonlinear bubble merger regime. Based on the analogy between flames front and ablation front, highly nonlinear RTI measurements at ablation front can provide important insights into the initial deflagration stage of thermonuclear supernova of Type Ia. We also report on an innovative concept used to create even longer drive on multi-beam laser facilities. The multi-barrel hohlraum (Gattling Gun) approach consists, here, of three adjacent cavities, driven in succession in time. This novel concept has been validated on the Omega EP laser system. The three cavities were irradiated with three 6–10 ns pulse UV beams and a 30 ns, 90 eV X-ray radiation drive was measured with the time-resolved X-ray spectrometer μDMX. This concept is promising to investigate the pillar structures in the Eagle Nebula or for photoionization studies which require a steady light source of sufficient duration to recreate relevant physics.« less

Energetic metallic ion implantation in polymers via cost-effective laser-driven ion source

NASA Astrophysics Data System (ADS)

Tahir, Muhammad Bilal; Rafique, M. Shahid; Ahmed, Rabia; Rafique, M.; Iqbal, Tahir; Hasan, Ali

2017-07-01

This research work reports the ions emission from the plasma generated by Nd:YAG laser having wavelength 1.064 μm, power 1.1 MW, pulse energy 10 mJ and intensity 1011 W/cm2 irradiated at 70° with respect to the target normal to the ions. These ions were accelerated through a home-made extraction assembly by means of a high voltage DC power supply. The energy of these ions were measured using Thomson parabola technique which utilizes Solid State Nuclear Track Detector (CR-39) and confirmed by Faraday cup as well that exploits a well-known technique known as time of flight. Interestingly, a significant increase in energy (from 490 to 730 keV) was observed with a discrete increase in acceleration potential from 0 to 18 kV. Polyethylene terephthalate (PET) and polypropylene were exposed to this recently developed ion source facility, to authenticate the reliability of this facility. The surface of the polymer is affected when energy of the irradiated ion is increased, which is evident from the optical micrographs. An increase in electrical conductivity was also observed with the increase in ion energy.

International strategy for fusion materials development

NASA Astrophysics Data System (ADS)

Ehrlich, Karl; Bloom, E. E.; Kondo, T.

2000-12-01

In this paper, the results of an IEA-Workshop on Strategy and Planning of Fusion Materials Research and Development (R&D), held in October 1998 in Risø Denmark are summarised and further developed. Essential performance targets for materials to be used in first wall/breeding blanket components have been defined for the major materials groups under discussion: ferritic-martensitic steels, vanadium alloys and ceramic composites of the SiC/SiC-type. R&D strategies are proposed for their further development and qualification as reactor-relevant materials. The important role of existing irradiation facilities (mainly fission reactors) for materials testing within the next decade is described, and the limits for the transfer of results from such simulation experiments to fusion-relevant conditions are addressed. The importance of a fusion-relevant high-intensity neutron source for the development of structural as well as breeding and special purpose materials is elaborated and the reasons for the selection of an accelerator-driven D-Li-neutron source - the International Fusion Materials Irradiation Facility (IFMIF) - as an appropriate test bed are explained. Finally the necessity to execute the materials programme for fusion in close international collaboration, presently promoted by the International Energy Agency, IEA is emphasised.

Dynamics of laser-driven proton beam focusing and transport into solid density matter

NASA Astrophysics Data System (ADS)

Kim, J.; McGuffey, C.; Beg, F.; Wei, M.; Mariscal, D.; Chen, S.; Fuchs, J.

2016-10-01

Isochoric heating and local energy deposition capabilities make intense proton beams appealing for studying high energy density physics and the Fast Ignition of inertial confinement fusion. To study proton beam focusing that results in high beam density, experiments have been conducted using different target geometries irradiated by a kilojoule, 10 ps pulse of the OMEGA EP laser. The beam focus was measured by imaging beam-induced Cu K-alpha emission on a Cu foil that was positioned at a fixed distance. Compared to a free target, structured targets having shapes of wedge and cone show a brighter and narrower K-alpha radiation emission spot on a Cu foil indicating higher beam focusability. Experimentally observed images with proton radiography demonstrate the existence of transverse fields on the structures. Full-scale simulations including the contribution of a long pulse duration of the laser confirm that such fields can be caused by hot electrons moving through the structures. The simulated fields are strong enough to reflect the diverging main proton beam and pinch a transverse probe beam. Detailed simulation results including the beam focusing and transport of the focused intense proton beam in Cu foil will be presented. This work was supported by the National Laser User Facility Program through Award DE-NA0002034.

Target volume and artifact evaluation of a new data-driven 4D CT.

PubMed

Martin, Rachael; Pan, Tinsu

Four-dimensional computed tomography (4D CT) is often used to define the internal gross target volume (IGTV) for radiation therapy of lung cancer. Traditionally, this technique requires the use of an external motion surrogate; however, a new image, data-driven 4D CT, has become available. This study aims to describe this data-driven 4D CT and compare target contours created with it to those created using standard 4D CT. Cine CT data of 35 patients undergoing stereotactic body radiation therapy were collected and sorted into phases using standard and data-driven 4D CT. IGTV contours were drawn using a semiautomated method on maximum intensity projection images of both 4D CT methods. Errors resulting from reproducibility of the method were characterized. A comparison of phase image artifacts was made using a normalized cross-correlation method that assigned a score from +1 (data-driven "better") to -1 (standard "better"). The volume difference between the data-driven and standard IGTVs was not significant (data driven was 2.1 ± 1.0% smaller, P = .08). The Dice similarity coefficient showed good similarity between the contours (0.949 ± 0.006). The mean surface separation was 0.4 ± 0.1 mm and the Hausdorff distance was 3.1 ± 0.4 mm. An average artifact score of +0.37 indicated that the data-driven method had significantly fewer and/or less severe artifacts than the standard method (P = 1.5 × 10 -5 for difference from 0). On average, the difference between IGTVs derived from data-driven and standard 4D CT was not clinically relevant or statistically significant, suggesting data-driven 4D CT can be used in place of standard 4D CT without adjustments to IGTVs. The relatively large differences in some patients were usually attributed to limitations in automatic contouring or differences in artifacts. Artifact reduction and setup simplicity suggest a clinical advantage to data-driven 4D CT. Published by Elsevier Inc.

Attentional capture by alcohol-related stimuli may be activated involuntarily by top-down search goals.

PubMed

Brown, Chris R H; Duka, Theodora; Forster, Sophie

2018-04-25

Previous research has found that the attention of social drinkers is preferentially oriented towards alcohol-related stimuli (attentional capture). This is argued to play a role in escalating craving for alcohol that can result in hazardous drinking. According to incentive theories of drug addiction, the stimuli associated with the drug reward acquire learned incentive salience and grab attention. However, it is not clear whether the mechanism by which this bias is created is a voluntary or an automatic one, although some evidence suggests a stimulus-driven mechanism. Here, we test for the first time whether this attentional capture could reflect an involuntary consequence of a goal-driven mechanism. Across three experiments, participants were given search goals to detect either an alcoholic or a non-alcoholic object (target) in a stream of briefly presented objects unrelated to the target. Prior to the target, a task-irrelevant parafoveal distractor appeared. This could either be congruent or incongruent with the current search goal. Applying a meta-analysis, we combined the results across the three experiments and found consistent evidence of goal-driven attentional capture, whereby alcohol distractors impeded target detection when the search goal was for alcohol. By contrast, alcohol distractors did not interfere with target detection, whilst participants were searching for a non-alcoholic category. A separate experiment revealed that the goal-driven capture effect was not found when participants held alcohol features active in memory but did not intentionally search for them. These findings suggest a strong goal-driven account of attentional capture by alcohol cues in social drinkers.

Accommodation Responds to Optical Vergence and Not Defocus Blur Alone.

PubMed

Del Águila-Carrasco, Antonio J; Marín-Franch, Iván; Bernal-Molina, Paula; Esteve-Taboada, José J; Kruger, Philip B; Montés-Micó, Robert; López-Gil, Norberto

2017-03-01

To determine whether changes in wavefront spherical curvature (optical vergence) are a directional cue for accommodation. Nine subjects participated in this experiment. The accommodation response to a monochromatic target was measured continuously with a custom-made adaptive optics system while astigmatism and higher-order aberrations were corrected in real time. There were two experimental open-loop conditions: vergence-driven condition, where the deformable mirror provided sinusoidal changes in defocus at the retina between -1 and +1 diopters (D) at 0.2 Hz; and blur-driven condition, in which the level of defocus at the retina was always 0 D, but a sinusoidal defocus blur between -1 and +1 D at 0.2 Hz was simulated in the target. Right before the beginning of each trial, the target was moved to an accommodative demand of 2 D. Eight out of nine subjects showed sinusoidal responses for the vergence-driven condition but not for the blur-driven condition. Their average (±SD) gain for the vergence-driven condition was 0.50 (±0.28). For the blur-driven condition, average gain was much smaller at 0.07 (±0.03). The ninth subject showed little to no response for both conditions, with average gain <0.08. Vergence-driven condition gain was significantly different from blur-driven condition gain (P = 0.004). Accommodation responds to optical vergence, even without feedback, and not to changes in defocus blur alone. These results suggest the presence of a retinal mechanism that provides a directional cue for accommodation from optical vergence.

Optimizing Facility Configurations and Operating Conditions for Improved Performance in the NASA Ames 24 Inch Shock Tube

NASA Technical Reports Server (NTRS)

Bogdanoff, David W.; Cruden, Brett A.

2016-01-01

The Ames Electric Arc Shock Tube (EAST) is a shock tube wherein the driver gas can be heated by an electric arc discharge. The electrical energy is stored in a 1.2 MJ capacitor bank. Four inch and 24 inch diameter driven tubes are available. The facility is described and the need for testing in the 24 inch tube to better simulate low density NASA mission profiles is discussed. Three test entries, 53, 53B and 59, are discussed. Tests are done with air or Mars gas (95.7% CO2/2.7% N2/1.6% Ar) at pressures of 0.01 to 0.14 Torr. Velocities spanned 6.3-9.2 km/s, with a nominal center of 7 km/s. Many facility configurations are studied in an effort to improve data quality. Various driver and driven tube configurations and the use of a buffer section between the driver and the driven tube are studied. Diagnostics include test times, time histories of the shock light pulses and tilts of the shock wave off the plane normal to the tube axis. The report will detail the results of the various trials, give the best configuration/operating conditions found to date and provide recommendations for further improvements. Finally, diaphragm performance is discussed.

Capturing attention is not that simple: different mechanisms for stimulus-driven and contingent capture.

PubMed

Liao, Hsin-I; Yeh, Su-Ling

2013-11-01

Attentional orienting can be involuntarily directed to task-irrelevant stimuli, but it remains unsolved whether such attentional capture is contingent on top-down settings or could be purely stimulus-driven. We propose that attentional capture depends on the stimulus property because transient and static features are processed differently; thus, they might be modulated differently by top-down controls. To test this hybrid account, we adopted a spatial cuing paradigm in which a noninformative onset or color cue preceded an onset or color target with various stimulus onset asynchronies (SOAs). Results showed that the onset cue captured attention regardless of target type at short-but not long-SOAs. In contrast, the color cue captured attention at short and long SOAs, but only with a color target. The overall pattern of results corroborates our hypothesis, suggesting that different mechanisms are at work for stimulus-driven capture (by onset) and contingent capture (by color). Stimulus-driven capture elicits reflexive involuntary orienting, and contingent capture elicits voluntary feature-based enhancement.

Deformable registration of the inflated and deflated lung in cone-beam CT-guided thoracic surgery: Initial investigation of a combined model- and image-driven approach

PubMed Central

Uneri, Ali; Nithiananthan, Sajendra; Schafer, Sebastian; Otake, Yoshito; Stayman, J. Webster; Kleinszig, Gerhard; Sussman, Marc S.; Prince, Jerry L.; Siewerdsen, Jeffrey H.

2013-01-01

Purpose: Surgical resection is the preferred modality for curative treatment of early stage lung cancer, but localization of small tumors (<10 mm diameter) during surgery presents a major challenge that is likely to increase as more early-stage disease is detected incidentally and in low-dose CT screening. To overcome the difficulty of manual localization (fingers inserted through intercostal ports) and the cost, logistics, and morbidity of preoperative tagging (coil or dye placement under CT-fluoroscopy), the authors propose the use of intraoperative cone-beam CT (CBCT) and deformable image registration to guide targeting of small tumors in video-assisted thoracic surgery (VATS). A novel algorithm is reported for registration of the lung from its inflated state (prior to pleural breach) to the deflated state (during resection) to localize surgical targets and adjacent critical anatomy. Methods: The registration approach geometrically resolves images of the inflated and deflated lung using a coarse model-driven stage followed by a finer image-driven stage. The model-driven stage uses image features derived from the lung surfaces and airways: triangular surface meshes are morphed to capture bulk motion; concurrently, the airways generate graph structures from which corresponding nodes are identified. Interpolation of the sparse motion fields computed from the bounding surface and interior airways provides a 3D motion field that coarsely registers the lung and initializes the subsequent image-driven stage. The image-driven stage employs an intensity-corrected, symmetric form of the Demons method. The algorithm was validated over 12 datasets, obtained from porcine specimen experiments emulating CBCT-guided VATS. Geometric accuracy was quantified in terms of target registration error (TRE) in anatomical targets throughout the lung, and normalized cross-correlation. Variations of the algorithm were investigated to study the behavior of the model- and image-driven stages by modifying individual algorithmic steps and examining the effect in comparison to the nominal process. Results: The combined model- and image-driven registration process demonstrated accuracy consistent with the requirements of minimally invasive VATS in both target localization (∼3–5 mm within the target wedge) and critical structure avoidance (∼1–2 mm). The model-driven stage initialized the registration to within a median TRE of 1.9 mm (95% confidence interval (CI) maximum = 5.0 mm), while the subsequent image-driven stage yielded higher accuracy localization with 0.6 mm median TRE (95% CI maximum = 4.1 mm). The variations assessing the individual algorithmic steps elucidated the role of each step and in some cases identified opportunities for further simplification and improvement in computational speed. Conclusions: The initial studies show the proposed registration method to successfully register CBCT images of the inflated and deflated lung. Accuracy appears sufficient to localize the target and adjacent critical anatomy within ∼1–2 mm and guide localization under conditions in which the target cannot be discerned directly in CBCT (e.g., subtle, nonsolid tumors). The ability to directly localize tumors in the operating room could provide a valuable addition to the VATS arsenal, obviate the cost, logistics, and morbidity of preoperative tagging, and improve patient safety. Future work includes in vivo testing, optimization of workflow, and integration with a CBCT image guidance system. PMID:23298134

Deformable registration of the inflated and deflated lung in cone-beam CT-guided thoracic surgery: initial investigation of a combined model- and image-driven approach.

PubMed

Uneri, Ali; Nithiananthan, Sajendra; Schafer, Sebastian; Otake, Yoshito; Stayman, J Webster; Kleinszig, Gerhard; Sussman, Marc S; Prince, Jerry L; Siewerdsen, Jeffrey H

2013-01-01

Surgical resection is the preferred modality for curative treatment of early stage lung cancer, but localization of small tumors (<10 mm diameter) during surgery presents a major challenge that is likely to increase as more early-stage disease is detected incidentally and in low-dose CT screening. To overcome the difficulty of manual localization (fingers inserted through intercostal ports) and the cost, logistics, and morbidity of preoperative tagging (coil or dye placement under CT-fluoroscopy), the authors propose the use of intraoperative cone-beam CT (CBCT) and deformable image registration to guide targeting of small tumors in video-assisted thoracic surgery (VATS). A novel algorithm is reported for registration of the lung from its inflated state (prior to pleural breach) to the deflated state (during resection) to localize surgical targets and adjacent critical anatomy. The registration approach geometrically resolves images of the inflated and deflated lung using a coarse model-driven stage followed by a finer image-driven stage. The model-driven stage uses image features derived from the lung surfaces and airways: triangular surface meshes are morphed to capture bulk motion; concurrently, the airways generate graph structures from which corresponding nodes are identified. Interpolation of the sparse motion fields computed from the bounding surface and interior airways provides a 3D motion field that coarsely registers the lung and initializes the subsequent image-driven stage. The image-driven stage employs an intensity-corrected, symmetric form of the Demons method. The algorithm was validated over 12 datasets, obtained from porcine specimen experiments emulating CBCT-guided VATS. Geometric accuracy was quantified in terms of target registration error (TRE) in anatomical targets throughout the lung, and normalized cross-correlation. Variations of the algorithm were investigated to study the behavior of the model- and image-driven stages by modifying individual algorithmic steps and examining the effect in comparison to the nominal process. The combined model- and image-driven registration process demonstrated accuracy consistent with the requirements of minimally invasive VATS in both target localization (∼3-5 mm within the target wedge) and critical structure avoidance (∼1-2 mm). The model-driven stage initialized the registration to within a median TRE of 1.9 mm (95% confidence interval (CI) maximum = 5.0 mm), while the subsequent image-driven stage yielded higher accuracy localization with 0.6 mm median TRE (95% CI maximum = 4.1 mm). The variations assessing the individual algorithmic steps elucidated the role of each step and in some cases identified opportunities for further simplification and improvement in computational speed. The initial studies show the proposed registration method to successfully register CBCT images of the inflated and deflated lung. Accuracy appears sufficient to localize the target and adjacent critical anatomy within ∼1-2 mm and guide localization under conditions in which the target cannot be discerned directly in CBCT (e.g., subtle, nonsolid tumors). The ability to directly localize tumors in the operating room could provide a valuable addition to the VATS arsenal, obviate the cost, logistics, and morbidity of preoperative tagging, and improve patient safety. Future work includes in vivo testing, optimization of workflow, and integration with a CBCT image guidance system.

Electrophysiological correlates of stimulus-driven reorienting deficits after interference with right parietal cortex during a spatial attention task: a TMS-EEG study

PubMed Central

Capotosto, Paolo; Corbetta, Maurizio; Romani, Gian Luca; Babiloni, Claudio

2013-01-01

Transcranial magnetic stimulation (TMS) interference over right intraparietal sulcus (IPS) causally disrupts behaviorally and electroencephalographic (EEG) rhythmic correlates of endogenous spatial orienting prior to visual target presentation (Capotosto et al. 2009; 2011). Here we combine data from our previous studies to examine whether right parietal TMS during spatial orienting also impairs stimulus-driven re-orienting or the ability to efficiently process unattended stimuli, i.e. stimuli outside the current focus of attention. Healthy subjects (N=24) performed a Posner spatial cueing task while their EEG activity was being monitored. Repetitive TMS (rTMS) was applied for 150 milliseconds (ms) simultaneously to the presentation of a central arrow directing spatial attention to the location of an upcoming visual target. Right IPS-rTMS impaired target detection, especially for stimuli presented at unattended locations; it also caused a modulation of the amplitude of parieto-occipital positive ERPs peaking at about 480 ms (P3) post-target. The P3 significantly decreased for unattended targets, and significantly increased for attended targets after right IPS-rTMS as compared to Sham stimulation. Similar effects were obtained for left IPS stimulation albeit in a smaller group of subjects. We conclude that disruption of anticipatory processes in right IPS has prolonged effects that persist during target processing. The P3 decrement may reflect interference with post-decision processes that are part of stimulus-driven re-orienting. Right IPS is a node of functional interaction between endogenous spatial orienting and stimulus-driven re-orienting processes in human vision. PMID:22905824

Initial design for an experimental investigation of strongly coupled plasma behavior in the Atlas facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Munson, C.P.; Benage, J.F. Jr.; Taylor, A.J.

Atlas is a high current ({approximately} 30 MA peak, with a current risetime {approximately} 4.5 {micro}sec), high energy (E{sub stored} = 24 MJ, E{sub load} = 3--6 MJ), pulsed power facility which is being constructed at Los Alamos National Laboratory with a scheduled completion date in the year 2000. When operational, this facility will provide a platform for experiments in high pressure shocks (> 20 Mbar), adiabatic compression ({rho}/{rho}{sub 0} > 5, P > 10 Mbar), high magnetic fields ({approximately} 2,000 T), high strain and strain rates ({var_epsilon} > 200%, d{var_epsilon}/dt {approximately} 10{sup 4} to 10{sup 6} s{sup {minus}1}), hydrodynamicmore » instabilities of materials in turbulent regimes, magnetized target fusion, equation of state, and strongly coupled plasmas. For the strongly coupled plasma experiments, an auxiliary capacitor bank will be used to generate a moderate density (< 0.1 solid), relatively cold ({approximately} 1 eV) plasma by ohmic heating of a conducting material of interest such as titanium. This stargate plasma will be compressed against a central column containing diagnostic instrumentation by a cylindrical conducting liner that is driven radially inward by current from the main Atlas capacitor bank. The plasma is predicted to reach densities of {approximately} 1.1 times solid, achieve ion and electron temperatures of {approximately} 10 eV, and pressures of {approximately} 4--5 Mbar. This is a density/temperature regime which is expected to experience strong coupling, but only partial degeneracy. X-ray radiography is planned for measurements of the material density at discrete times during the experiments; diamond Raman measurements are anticipated for determination of the pressure. In addition, a neutron resonance spectroscopic technique is being evaluated for possible determination of the temperature (through low percentage doping of the titanium with a suitable resonant material). Initial target plasma formation experiments are being planned on an existing pulsed power facility at LANL and will be completed before the start of operation of Atlas.« less

Activity-based costing of health-care delivery, Haiti.

PubMed

McBain, Ryan K; Jerome, Gregory; Leandre, Fernet; Browning, Micaela; Warsh, Jonathan; Shah, Mahek; Mistry, Bipin; Faure, Peterson Abnis I; Pierre, Claire; Fang, Anna P; Mugunga, Jean Claude; Gottlieb, Gary; Rhatigan, Joseph; Kaplan, Robert

2018-01-01

To evaluate the implementation of a time-driven activity-based costing analysis at five community health facilities in Haiti. Together with stakeholders, the project team decided that health-care providers should enter start and end times of the patient encounter in every fifth patient's medical dossier. We trained one data collector per facility, who manually entered the time recordings and patient characteristics in a database and submitted the data to a cloud-based data warehouse each week. We calculated the capacity cost per minute for each resource used. An automated web-based platform multiplied reported time with capacity cost rate and provided the information to health-facilities administrators. Between March 2014 and June 2015, the project tracked the clinical services for 7162 outpatients. The cost of care for specific conditions varied widely across the five facilities, due to heterogeneity in staffing and resources. For example, the average cost of a first antenatal-care visit ranged from 6.87 United States dollars (US$) at a low-level facility to US$ 25.06 at a high-level facility. Within facilities, we observed similarly variation in costs, due to factors such as patient comorbidities, patient arrival time, stocking of supplies at facilities and type of visit. Time-driven activity-based costing can be implemented in low-resource settings to guide resource allocation decisions. However, the extent to which this information will drive observable changes at patient, provider and institutional levels depends on several contextual factors, including budget constraints, management, policies and the political economy in which the health system is situated.

Activity-based costing of health-care delivery, Haiti

PubMed Central

Jerome, Gregory; Leandre, Fernet; Browning, Micaela; Warsh, Jonathan; Shah, Mahek; Mistry, Bipin; Faure, Peterson Abnis I; Pierre, Claire; Fang, Anna P; Mugunga, Jean Claude; Gottlieb, Gary; Rhatigan, Joseph; Kaplan, Robert

2018-01-01

Abstract Objective To evaluate the implementation of a time-driven activity-based costing analysis at five community health facilities in Haiti. Methods Together with stakeholders, the project team decided that health-care providers should enter start and end times of the patient encounter in every fifth patient’s medical dossier. We trained one data collector per facility, who manually entered the time recordings and patient characteristics in a database and submitted the data to a cloud-based data warehouse each week. We calculated the capacity cost per minute for each resource used. An automated web-based platform multiplied reported time with capacity cost rate and provided the information to health-facilities administrators. Findings Between March 2014 and June 2015, the project tracked the clinical services for 7162 outpatients. The cost of care for specific conditions varied widely across the five facilities, due to heterogeneity in staffing and resources. For example, the average cost of a first antenatal-care visit ranged from 6.87 United States dollars (US$) at a low-level facility to US$ 25.06 at a high-level facility. Within facilities, we observed similarly variation in costs, due to factors such as patient comorbidities, patient arrival time, stocking of supplies at facilities and type of visit. Conclusion Time-driven activity-based costing can be implemented in low-resource settings to guide resource allocation decisions. However, the extent to which this information will drive observable changes at patient, provider and institutional levels depends on several contextual factors, including budget constraints, management, policies and the political economy in which the health system is situated. PMID:29403096

40 CFR 745.82 - Applicability.

Code of Federal Regulations, 2013 CFR

2013-07-01

... child-occupied facilities, except for the following: (1) Renovations in target housing or child-occupied...) Renovations in target housing or child-occupied facilities in which a certified renovator, using an EPA... to have been repainted or refinished separately. (3) Renovations in target housing or child-occupied...

40 CFR 745.82 - Applicability.

Code of Federal Regulations, 2014 CFR

2014-07-01

... child-occupied facilities, except for the following: (1) Renovations in target housing or child-occupied...) Renovations in target housing or child-occupied facilities in which a certified renovator, using an EPA... to have been repainted or refinished separately. (3) Renovations in target housing or child-occupied...

40 CFR 745.82 - Applicability.

Code of Federal Regulations, 2012 CFR

2012-07-01

... child-occupied facilities, except for the following: (1) Renovations in target housing or child-occupied...) Renovations in target housing or child-occupied facilities in which a certified renovator, using an EPA... to have been repainted or refinished separately. (3) Renovations in target housing or child-occupied...

Stimulus-driven attentional capture by subliminal onset cues.

PubMed

Schoeberl, Tobias; Fuchs, Isabella; Theeuwes, Jan; Ansorge, Ulrich

2015-04-01

In two experiments, we tested whether subliminal abrupt onset cues capture attention in a stimulus-driven way. An onset cue was presented 16 ms prior to the stimulus display that consisted of clearly visible color targets. The onset cue was presented either at the same side as the target (the valid cue condition) or on the opposite side of the target (the invalid cue condition). Because the onset cue was presented 16 ms before other placeholders were presented, the cue was subliminal to the participant. To ensure that this subliminal cue captured attention in a stimulus-driven way, the cue's features did not match the top-down attentional control settings of the participants: (1) The color of the cue was always different than the color of the non-singleton targets ensuring that a top-down set for a specific color or for a singleton would not match the cue, and (2) colored targets and distractors had the same objective luminance (measured by the colorimeter) and subjective lightness (measured by flicker photometry), preventing a match between the top-down set for target and cue contrast. Even though a match between the cues and top-down settings was prevented, in both experiments, the cues captured attention, with faster response times in valid than invalid cue conditions (Experiments 1 and 2) and faster response times in valid than the neutral conditions (Experiment 2). The results support the conclusion that subliminal cues capture attention in a stimulus-driven way.

Goal-driven modulation of stimulus-driven attentional capture in multiple-cue displays.

PubMed

Richard, Christian M; Wright, Richard D; Ward, Lawrence M

2003-08-01

Six location-cuing experiments were conducted to examine the goal-driven control of attentional capture in multiple-cue displays. In most of the experiments, the cue display consisted of the simultaneous presentation of a red direct cue that was highly predictive of the target location (the unique cue) and three gray direct cues (the standard cues) that were not predictive of the location. The results indicated that although target responses were faster at all cued locations relative to uncued locations, they were significantly faster at the unique-cue location than at the standard-cue locations. Other results suggest that the faster responses produced by direct cues may be associated with two different components: an attention-related component that can be modulated by goal-driven factors and a nonattentional component that occurs in parallel at multiple direct-cue locations and is minimally affected by the same goal-driven factors.

75 FR 51808 - Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-08-23

... Renovation, Repair and Painting Activities in Target Housing and Child Occupied Facilities; State of Rhode.... These rules already cover all lead-based paint activities that are conducted in target housing and child... in target housing and child-occupied facilities. These rules: 1. Establish the discipline of lead...

Marketing in the long-term care continuum.

PubMed

Laurence, J Nathan; Kash, Bita A

2010-04-01

Today, long-term care facilities are composed of independent, assisted living, and skilled nursing facilities along with many variations of those themes in between. The clientele for these various types of facilities differ because of the level of care the facility provides as well as the amenities long-term care consumers are looking for. However, there many similarities and common approaches to how reaching the target audience through effective marketing activities. Knowing who the target audience is, how to reach them, and how to communicate with them will serve any facility well in this competitive market. Developing marketing strategies for long-term care settings is as important as understanding what elements of care can be marketed individually as a niche market. Determining the market base for a facility is equally crucial since the target populations differ among the three types of facilities. By reviewing current marketing articles and applying marketing practices, we have crafted some general principles for which each facility type can learn from. Finally, we will discuss the types of marketing and how they related to the spectrum of long-term care facilities.

Requirements Doc for Refurb of JASPER Facility in B131HB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Knittel, Kenn M.

The Joint Actinide Shock Physics Experimental Research (JASPER) Program target fabrication facility is currently located in building 131 (B131) of the Lawrence Livermore National Laboratory (LLNL). A portion of this current facility has been committed to another program as part of a larger effort to consolidate LLNL capabilities into newer facilities. This facility assembles precision targets for scientific studies at the Nevada National Security Site (NNSS). B131 is also going through a modernization project to upgrade the infrastructure and abate asbestos. These activities will interrupt the continuous target fabrication efforts for the JASPER Program. Several options are explored to meetmore » the above conflicting requirements, with the final recommendation to prepare a new facility for JASPER target fabrication operations before modernization efforts begin in the current facility assigned to JASPER. This recommendation fits within all schedule constraints and minimizes the disruption to the JASPER Program. This option is not without risk, as it requires moving an aged, precision coordinate measuring machine, which is essential to the JASPER Program’s success. The selected option balances the risk to the machine with continuity of operations.« less

Method and apparatus for plasma source ion implantation

DOEpatents

Conrad, J.R.

1988-08-16

Ion implantation into surfaces of three-dimensional targets is achieved by forming an ionized plasma about the target within an enclosing chamber and applying a pulse of high voltage between the target and the conductive walls of the chamber. Ions from the plasma are driven into the target object surfaces from all sides simultaneously without the need for manipulation of the target object. Repetitive pulses of high voltage, typically 20 kilovolts or higher, causes the ions to be driven deeply into the target. The plasma may be formed of a neutral gas introduced into the evacuated chamber and ionized therein with ionizing radiation so that a constant source of plasma is provided which surrounds the target object during the implantation process. Significant increases in the surface hardness and wear characteristics of various materials are obtained with ion implantation in this manner. 7 figs.

Method and apparatus for plasma source ion implantation

DOEpatents

Conrad, John R.

1988-01-01

Ion implantation into surfaces of three-dimensional targets is achieved by forming an ionized plasma about the target within an enclosing chamber and applying a pulse of high voltage between the target and the conductive walls of the chamber. Ions from the plasma are driven into the target object surfaces from all sides simultaneously without the need for manipulation of the target object. Repetitive pulses of high voltage, typically 20 kilovolts or higher, causes the ions to be driven deeply into the target. The plasma may be formed of a neutral gas introduced into the evacuated chamber and ionized therein with ionizing radiation so that a constant source of plasma is provided which surrounds the target object during the implantation process. Significant increases in the surface hardness and wear characteristics of various materials are obtained with ion implantation in this manner.

Barriers to HIV and sexual and reproductive health care for female sex workers in Tete, Mozambique: results from a cross-sectional survey and focus group discussions.

PubMed

Lafort, Yves; Lessitala, Faustino; Candrinho, Balthazar; Greener, Letitia; Greener, Ross; Beksinska, Mags; Smit, Jenni A; Chersich, Matthew; Delva, Wim

2016-07-20

In the context of an operational research project in Tete, Mozambique, use of, and barriers to, HIV and sexual and reproductive health (HIV/SRH) commodities and services for female sex workers (FSWs) were assessed as part of a baseline situational analysis. In a cross-sectional survey 311 FSWs were recruited using respondent driven sampling and interviewed face-to-face, and three focus group discussions were held with respectively 6 full-time Mozambican, 7 occasional Mozambican and 9 full-time Zimbabwean FSWs, to investigate use of, and barriers to, HIV/SRH care. The cross-sectional survey showed that 71 % of FSWs used non-barrier contraception, 78 % sought care for their last sexually transmitted infection episode, 51 % of HIV-negative FSWs was tested for HIV in the last 6 months, 83 % of HIV-positive FSWs were in HIV care, 55 % sought help at a health facility for their last unwanted pregnancy and 48 % after sexual assault, and none was ever screened for cervical cancer. Local public health facilities were by far the most common place where care was sought, followed by an NGO-operated clinic targeting FSWs, and places outside the Tete area. In the focus group discussions, FSWs expressed dissatisfaction with the public health services, as a result of being asked for bribes, being badly attended by some care providers, stigmatisation and breaches of confidentiality. The service most lacking was said to be termination of unwanted pregnancies. The use of most HIV and SRH services is insufficient in this FSW population. The public health sector is the main provider, but access is hampered by several barriers. The reach of a FSW-specific NGO clinic is limited. Access to, and use of, HIV and SRH services should be improved by reducing barriers at public health facilities, broadening the range of services and expanding the reach of the targeted NGO clinic.

Estimation of marginal costs at existing waste treatment facilities.

PubMed

Martinez-Sanchez, Veronica; Hulgaard, Tore; Hindsgaul, Claus; Riber, Christian; Kamuk, Bettina; Astrup, Thomas F

2016-04-01

This investigation aims at providing an improved basis for assessing economic consequences of alternative Solid Waste Management (SWM) strategies for existing waste facilities. A bottom-up methodology was developed to determine marginal costs in existing facilities due to changes in the SWM system, based on the determination of average costs in such waste facilities as function of key facility and waste compositional parameters. The applicability of the method was demonstrated through a case study including two existing Waste-to-Energy (WtE) facilities, one with co-generation of heat and power (CHP) and another with only power generation (Power), affected by diversion strategies of five waste fractions (fibres, plastic, metals, organics and glass), named "target fractions". The study assumed three possible responses to waste diversion in the WtE facilities: (i) biomass was added to maintain a constant thermal load, (ii) Refused-Derived-Fuel (RDF) was included to maintain a constant thermal load, or (iii) no reaction occurred resulting in a reduced waste throughput without full utilization of the facility capacity. Results demonstrated that marginal costs of diversion from WtE were up to eleven times larger than average costs and dependent on the response in the WtE plant. Marginal cost of diversion were between 39 and 287 € Mg(-1) target fraction when biomass was added in a CHP (from 34 to 303 € Mg(-1) target fraction in the only Power case), between -2 and 300 € Mg(-1) target fraction when RDF was added in a CHP (from -2 to 294 € Mg(-1) target fraction in the only Power case) and between 40 and 303 € Mg(-1) target fraction when no reaction happened in a CHP (from 35 to 296 € Mg(-1) target fraction in the only Power case). Although average costs at WtE facilities were highly influenced by energy selling prices, marginal costs were not (provided a response was initiated at the WtE to keep constant the utilized thermal capacity). Failing to systematically address and include costs in existing waste facilities in decision-making may unintendedly lead to higher overall costs at societal level. To avoid misleading conclusions, economic assessment of alternative SWM solutions should not only consider potential costs associated with alternative treatment but also include marginal costs associated with existing facilities. Copyright © 2016 Elsevier Ltd. All rights reserved.

Two-Plasmon Decay Mitigation in Direct-Drive Inertial-Confinement-Fusion Experiments Using Multilayer Targets.

PubMed

Follett, R K; Delettrez, J A; Edgell, D H; Goncharov, V N; Henchen, R J; Katz, J; Michel, D T; Myatt, J F; Shaw, J; Solodov, A A; Stoeckl, C; Yaakobi, B; Froula, D H

2016-04-15

Multilayer direct-drive inertial-confinement-fusion targets are shown to significantly reduce two-plasmon decay (TPD) driven hot-electron production while maintaining high hydrodynamic efficiency. Implosion experiments on the OMEGA laser used targets with silicon layered between an inner beryllium and outer silicon-doped plastic ablator. A factor-of-5 reduction in hot-electron generation (>50  keV) was observed in the multilayer targets relative to pure CH targets. Three-dimensional simulations of the TPD-driven hot-electron production using a laser-plasma interaction code (lpse) that includes nonlinear and kinetic effects show good agreement with the measurements. The simulations suggest that the reduction in hot-electron production observed in the multilayer targets is primarily caused by increased electron-ion collisional damping.

Identity negotiation in roommate relationships: the self as architect and consequence of social reality.

PubMed

McNulty, S E; Swann, W B

1994-12-01

The authors report two longitudinal studies of new college roommates (Ns = 69 and 95 pairs). In both studies, targets' initial self-views predicted changes in perceivers' appraisals of them, and perceivers' initial appraisals predicted changes in targets' self-views, although few dyads displayed both effects. The perceiver-driven and target-driven effects occurred when appraisals and self-views were negative as well as positive. Implications for self-verification theory and symbolic interactionism are discussed, and a less restrictive model of how appraisals influence self-views is proposed.

Optimizing gene transfer to conventional outflow cells in living mouse eyes

PubMed Central

Li, G; Gonzalez, P; Camras, LJ; Navarro, I; Qiu, J; Challa, P; Stamer, WD

2013-01-01

The mouse eye has physiological and genetic advantages to study conventional outflow function. However, its small size and shallow anterior chamber presents technical challenges to efficient intracameral delivery of genetic material to conventional outflow cells. The goal of this study was to optimize methods to overcome this technical hurdle, without damaging ocular structures or compromising outflow function. Gene targeting was monitored by immunofluorescence microscopy after transduction of adenovirus encoding green fluorescent protein driven by a CMV promoter. Guided by a micromanipulator and stereomicroscope, virus was delivered intracamerally to anesthetized mice by bolus injection using 33 gauge needle attached to Hamilton syringe or infusion with glass micropipette connected to syringe pump. The total number of particles introduced remained constant, while volume of injected virus solution (3–10 µl) was varied for each method and time of infusion (3–40 min) tested. Outflow facility and intraocular pressure were monitored invasively using established techniques. Unlike bolus injections or slow infusions, introduction of virus intracamerally during rapid infusions (3 min) at any volume tested preferentially targeted trabecular meshwork and Schlemm's canal cells, with minimal transduction of neighboring cells. While infusions resulted in transient intraocular pressure spikes (commensurate with volume infused, Δ40–70 mmHg), eyes typically recovered within 60 minutes. Transduced eyes displayed normal outflow facility and tissue morphology 3–6 days after infusions. Taken together, fast infusion of virus solution in small volumes intracamerally is a novel and effective method to selectively deliver agents to conventional outflow cells in living mice. PMID:23337742

Study of Plasma Liner Driven Magnetized Target Fusion Via Advanced Simulations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Samulyak, Roman V.; Brookhaven National Lab.; Parks, Paul

The feasibility of the plasma liner driven Magnetized Target Fusion (MTF) via terascale numerical simulations will be assessed. In the MTF concept, a plasma liner, formed by merging of a number (60 or more) of radial, highly supersonic plasma jets, implodes on the target in the form of two compact plasma toroids, and compresses it to conditions of the fusion ignition. By avoiding major difficulties associated with both the traditional laser driven inertial confinement fusion and solid liner driven MTF, the plasma liner driven MTF potentially provides a low-cost and fast R&D path towards the demonstration of practical fusion energy.more » High fidelity numerical simulations of full nonlinear models associated with the plasma liner MTF using state-of-art numerical algorithms and terascale computing are necessary in order to resolve uncertainties and provide guidance for future experiments. At Stony Brook University, we have developed unique computational capabilities that ideally suite the MTF problem. The FronTier code, developed in collaboration with BNL and LANL under DOE funding including SciDAC for the simulation of 3D multi-material hydro and MHD flows, has beenbenchmarked and used for fundamental and engineering problems in energy science applications. We have performed 3D simulations of converging supersonic plasma jets, their merger and the formation of the plasma liner, and a study of the corresponding oblique shock problem. We have studied the implosion of the plasma liner on the magnetized plasma target by resolving Rayleigh-Taylor instabilities in 2D and 3D and other relevant physics and estimate thermodynamic conditions of the target at the moment of maximum compression and the hydrodynamic efficiency of the method.« less

Active machine learning-driven experimentation to determine compound effects on protein patterns

PubMed Central

Naik, Armaghan W; Kangas, Joshua D; Sullivan, Devin P; Murphy, Robert F

2016-01-01

High throughput screening determines the effects of many conditions on a given biological target. Currently, to estimate the effects of those conditions on other targets requires either strong modeling assumptions (e.g. similarities among targets) or separate screens. Ideally, data-driven experimentation could be used to learn accurate models for many conditions and targets without doing all possible experiments. We have previously described an active machine learning algorithm that can iteratively choose small sets of experiments to learn models of multiple effects. We now show that, with no prior knowledge and with liquid handling robotics and automated microscopy under its control, this learner accurately learned the effects of 48 chemical compounds on the subcellular localization of 48 proteins while performing only 29% of all possible experiments. The results represent the first practical demonstration of the utility of active learning-driven biological experimentation in which the set of possible phenotypes is unknown in advance. DOI: http://dx.doi.org/10.7554/eLife.10047.001 PMID:26840049

Compact compressive arc and beam switchyard for energy recovery linac-driven ultraviolet free electron lasers

NASA Astrophysics Data System (ADS)

Akkermans, J. A. G.; Di Mitri, S.; Douglas, D.; Setija, I. D.

2017-08-01

High gain free electron lasers (FELs) driven by high repetition rate recirculating accelerators have received considerable attention in the scientific and industrial communities in recent years. Cost-performance optimization of such facilities encourages limiting machine size and complexity, and a compact machine can be realized by combining bending and bunch length compression during the last stage of recirculation, just before lasing. The impact of coherent synchrotron radiation (CSR) on electron beam quality during compression can, however, limit FEL output power. When methods to counteract CSR are implemented, appropriate beam diagnostics become critical to ensure that the target beam parameters are met before lasing, as well as to guarantee reliable, predictable performance and rapid machine setup and recovery. This article describes a beam line for bunch compression and recirculation, and beam switchyard accessing a diagnostic line for EUV lasing at 1 GeV beam energy. The footprint is modest, with 12 m compressive arc diameter and ˜20 m diagnostic line length. The design limits beam quality degradation due to CSR both in the compressor and in the switchyard. Advantages and drawbacks of two switchyard lines providing, respectively, off-line and on-line measurements are discussed. The entire design is scalable to different beam energies and charges.

Optimisation of composite metallic fuel for minor actinide transmutation in an accelerator-driven system

NASA Astrophysics Data System (ADS)

Uyttenhove, W.; Sobolev, V.; Maschek, W.

2011-09-01

A potential option for neutralization of minor actinides (MA) accumulated in spent nuclear fuel of light water reactors (LWRs) is their transmutation in dedicated accelerator-driven systems (ADS). A promising fuel candidate dedicated to MA transmutation is a CERMET composite with Mo metal matrix and (Pu, Np, Am, Cm)O 2-x fuel particles. Results of optimisation studies of the CERMET fuel targeting to increasing the MA transmutation efficiency of the EFIT (European Facility for Industrial Transmutation) core are presented. In the adopted strategy of MA burning the plutonium (Pu) balance of the core is minimized, allowing a reduction in the reactivity swing and the peak power form-factor deviation and an extension of the cycle duration. The MA/Pu ratio is used as a variable for the fuel optimisation studies. The efficiency of MA transmutation is close to the foreseen theoretical value of 42 kg TW -1 h -1 when level of Pu in the actinide mixture is about 40 wt.%. The obtained results are compared with the reference case of the EFIT core loaded with the composite CERCER fuel, where fuel particles are incorporated in a ceramic magnesia matrix. The results of this study offer additional information for the EFIT fuel selection.

The accomplishments of lithium target and test facility validation activities in the IFMIF/EVEDA phase

NASA Astrophysics Data System (ADS)

Arbeiter, Frederik; Baluc, Nadine; Favuzza, Paolo; Gröschel, Friedrich; Heidinger, Roland; Ibarra, Angel; Knaster, Juan; Kanemura, Takuji; Kondo, Hiroo; Massaut, Vincent; Saverio Nitti, Francesco; Miccichè, Gioacchino; O'hira, Shigeru; Rapisarda, David; Sugimoto, Masayoshi; Wakai, Eiichi; Yokomine, Takehiko

2018-01-01

As part of the engineering validation and engineering design activities (EVEDA) phase for the international fusion materials irradiation facility IFMIF, major elements of a lithium target facility and the test facility were designed, prototyped and validated. For the lithium target facility, the EVEDA lithium test loop was built at JAEA and used to test the stability (waves and long term) of the lithium flow in the target, work out the startup procedures, and test lithium purification and analysis. It was confirmed by experiments in the Lifus 6 plant at ENEA that lithium corrosion on ferritic martensitic steels is acceptably low. Furthermore, complex remote handling procedures for the remote maintenance of the target in the test cell environment were successfully practiced. For the test facility, two variants of a high flux test module were prototyped and tested in helium loops, demonstrating their good capabilities of maintaining the material specimens at the desired temperature with a low temperature spread. Irradiation tests were performed for heated specimen capsules and irradiation instrumentation in the BR2 reactor at SCK-CEN. The small specimen test technique, essential for obtaining material test results with limited irradiation volume, was advanced by evaluating specimen shape and test technique influences.

The Alliance for Innovation in Maternal Health Care: A Way Forward.

PubMed

Mahoney, Jeanne

2018-06-01

The Alliance for Innovation in Maternal Health is a program supported by the Health Services Resource Administration to reduce maternal mortality and severe maternal morbidity in the United States. This program develops bundles of evidence based action steps for birth facilities to adapt. Progress is monitored at the facility, state and national levels to foster data-driven quality improvement efforts.

KSC-07pd0159

NASA Image and Video Library

2007-01-23

KENNEDY SPACE CENTER, FLA. -- The right-hand orbital maneuvering system pod is driven past the Vehicle Assembly Building on its way to Orbiter Processing Facility bay 2 for installation on the orbiter Endeavour. The orbital maneuvering system/reaction control system left- and right-hand pods are attached to the upper aft fuselage left and right sides. Each pod is fabricated primarily of graphite epoxy composite and aluminum. Each pod is 21.8 feet long and 11.37 feet wide at its aft end and 8.41 feet wide at its forward end, with a surface area of approximately 435 square feet. The orbiter is being prepared for its first launch in just over four years. The vehicle has undergone an extensive modification period, including the addition of all of the return-to-flight safety upgrades added to both Discovery and Atlantis. Endeavour is targeted for launch of mission STS-118 on June 28. Photo credit: NASA/Kim Shiflett

Effects of cryogenic temperature on dynamic fragmentation of laser shock-loaded metal foils

NASA Astrophysics Data System (ADS)

de Rességuier, T.; Lescoute, E.; Loison, D.; Chevalier, J. M.; Ducasse, F.

2011-12-01

Although shock-induced fracture and fragmentation of materials at low temperatures are issues of considerable interest for many applications, such as the protection from hypervelocity impacts in outer space or the ongoing development of high energy laser facilities aiming at inertial confinement fusion, little data can be found on the subject yet. In this paper, laser driven shock experiments are performed on gold and aluminum samples at both ambient and cryogenic (down to about 30 K) temperatures. Complementary techniques including transverse optical shadowgraphy, time-resolved velocity measurements, and post-recovery analyses are combined to assess the effects of target temperature upon the processes of microjetting, spallation, and dynamic punching, which are expected to govern fragments generation and ejection. The results indicate that cryogenic temperature tends to reduce the resistance to tensile and shear stresses, promotes brittle fracture, and leads to slightly higher fragments ejection velocities.

An Approach for Assessing Consequences of Potential Supply Chain and Insider Contributed Cyber Attacks on Nuclear Power Plants

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chu, Tsong L.

The Stuxnet attack at the Natanz facility is an example of a targeted and successful cyber attack on a nuclear facility. Snowden's release of National Security Agency documents demonstrated the consequences of the insider threat. More recently, the United States tried to attack North Korea but failed, South Korea was attempting to attack North Korea, and both applied Stuxnet-like approaches. These sophisticated targeted attacks differ from web-site hacking events that are reported almost daily in the news mainly because targeted attacks require detailed design and operation information of the systems attacked and/or are often carried out by insiders. For instance,more » in order to minimize disruption of facilities around the world, Stuxnet remained idle until it recognized the specific configuration of the Natanz facility, demonstrating that the attackers possessed extremely detailed information about the facility. Such targeted cyber attacks could become a national-level military weapon and be used in coercion of hostile countries.« less

Towards ion beam therapy based on laser plasma accelerators.

PubMed

Karsch, Leonhard; Beyreuther, Elke; Enghardt, Wolfgang; Gotz, Malte; Masood, Umar; Schramm, Ulrich; Zeil, Karl; Pawelke, Jörg

2017-11-01

Only few ten radiotherapy facilities worldwide provide ion beams, in spite of their physical advantage of better achievable tumor conformity of the dose compared to conventional photon beams. Since, mainly the large size and high costs hinder their wider spread, great efforts are ongoing to develop more compact ion therapy facilities. One promising approach for smaller facilities is the acceleration of ions on micrometre scale by high intensity lasers. Laser accelerators deliver pulsed beams with a low pulse repetition rate, but a high number of ions per pulse, broad energy spectra and high divergences. A clinical use of a laser based ion beam facility requires not only a laser accelerator providing beams of therapeutic quality, but also new approaches for beam transport, dosimetric control and tumor conformal dose delivery procedure together with the knowledge of the radiobiological effectiveness of laser-driven beams. Over the last decade research was mainly focused on protons and progress was achieved in all important challenges. Although currently the maximum proton energy is not yet high enough for patient irradiation, suggestions and solutions have been reported for compact beam transport and dose delivery procedures, respectively, as well as for precise dosimetric control. Radiobiological in vitro and in vivo studies show no indications of an altered biological effectiveness of laser-driven beams. Laser based facilities will hardly improve the availability of ion beams for patient treatment in the next decade. Nevertheless, there are possibilities for a need of laser based therapy facilities in future.

Nike Facility Diagnostics and Data Acquisition System

NASA Astrophysics Data System (ADS)

Chan, Yung; Aglitskiy, Yefim; Karasik, Max; Kehne, David; Obenschain, Steve; Oh, Jaechul; Serlin, Victor; Weaver, Jim

2013-10-01

The Nike laser-target facility is a 56-beam krypton fluoride system that can deliver 2 to 3 kJ of laser energy at 248 nm onto targets inside a two meter diameter vacuum chamber. Nike is used to study physics and technology issues related to laser direct-drive ICF fusion, including hydrodynamic and laser-plasma instabilities, material behavior at extreme pressures, and optical and x-ray diagnostics for laser-heated targets. A suite of laser and target diagnostics are fielded on the Nike facility, including high-speed, high-resolution x-ray and visible imaging cameras, spectrometers and photo-detectors. A centrally-controlled, distributed computerized data acquisition system provides robust data management and near real-time analysis feedback capability during target shots. Work supported by DOE/NNSA.

High performance capsule implosions on the OMEGA Laser facility with rugby hohlraumsa)

NASA Astrophysics Data System (ADS)

Robey, H. F.; Amendt, P.; Park, H.-S.; Town, R. P. J.; Milovich, J. L.; Döppner, T.; Hinkel, D. E.; Wallace, R.; Sorce, C.; Strozzi, D. J.; Philippe, F.; Casner, A.; Caillaud, T.; Landoas, O.; Liberatore, S.; Monteil, M.-C.; Séguin, F.; Rosenberg, M.; Li, C. K.; Petrasso, R.; Glebov, V.; Stoeckl, C.; Nikroo, A.; Giraldez, E.

2010-05-01

Rugby-shaped hohlraums have been proposed as a method for x-ray drive enhancement for indirectly driven capsule implosions. This concept has recently been tested in a series of shots on the OMEGA laser facility [T. R. Boehly, D. L. Brown, R. S. Craxton et al., Opt. Commun. 133, 495 (1997)]. In this paper, experimental results are presented comparing the performance of D2-filled capsules between standard cylindrical Au hohlraums and rugby-shaped hohlraums. The rugby hohlraums demonstrated 18% more x-ray drive energy as compared with the cylinders, and the high-performance design of these implosions (both cylinder and rugby) also provided ≈20× more deuterium (DD) neutrons than any previous indirectly driven campaign on OMEGA and ≈3× more than ever achieved on NOVA [E. M. Campbell, Laser Part. Beams 9, 209 (1991)] implosions driven with nearly twice the laser energy. This increase in performance enables, for the first time, a measurement of the neutron burn history and imaging of the neutron core shapes in an indirectly driven implosion. Previous DD neutron yields had been too low to register this key measurement of capsule performance and the effects of dynamic mix. A wealth of additional data on the fuel areal density from the suite of charged particle diagnostics was obtained on a subset of the shots that used D H3e rather than D2 fuel. Comparisons of the experimental results with numerical simulations are shown to be in very good agreement. The design techniques employed in this campaign, e.g., smaller laser entrance holes and hohlraum case-to-capsule ratios, provide added confidence in the pursuit of ignition on the National Ignition Facility [J. D. Lindl, P. Amendt, R. L. Berger et al., Phys. Plasmas 11, 339 (2004)].

High Performance Capsule Implosions on the Omega Laser Facility with Rugby Hohlraums

NASA Astrophysics Data System (ADS)

Robey, Harry F.

2009-11-01

Rugby-shaped hohlraums have been proposed as a method for x-ray drive enhancement for indirectly-driven capsule implosions [1]. This concept has recently been tested in a series of shots on the OMEGA laser facility at the Laboratory for Laser Energetics at the University of Rochester. In this talk, experimental results are presented comparing the performance of D2-filled capsules between standard cylindrical Au hohlraums and rugby-shaped hohlraums. Not only did the rugby hohlraums demonstrate 18% more x-ray drive energy as compared with the cylinders, but the high-performance design of these implosions (both cylinder and rugby) also provided 20X more DD neutrons than any previous indirectly-driven campaign on Omega (and 3X more than ever achieved on Nova implosions driven with nearly twice the laser energy). This increase in performance enables, for the first time, a measurement of the neutron burn history of an indirectly-driven implosion. Previous DD neutron yields had been too low to register this key measurement of capsule performance and the effects of dynamic mix. A wealth of additional data on the fuel areal density from the suite of charged particle diagnostics was obtained on a subset of the shots that used D^3He rather than D2 fuel. Comparisons of the experimental results with numerical simulations are shown to be in excellent agreement. The design techniques employed in this campaign, e.g., smaller NIF-like laser entrance holes and hohlraum case-to-capsule ratios, provide added confidence in the pursuit of ignition on the National Ignition Facility. [4pt] [1] P. Amendt, C. Cerjan, D. E. Hinkel, J. L. Milovich, H.-S. Park, and H. F. Robey, ``Rugby-like hohlraum experimental designs for demonstrating x-ray drive enhancement'', Phys. Plasmas 15, 012702 (2008).

D-Cluster Converter Foil for Laser-Accelerated Deuteron Beams: Towards Deuteron-Beam-Driven Fast Ignition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miley, George H.

Fast Ignition (FI) uses Petawatt laser generated particle beam pulse to ignite a small volume called a pre-compressed Inertial Confinement Fusion (ICF) target, and is the favored method to achieve the high energy gain per target burn needed for an attractive ICF power plant. Ion beams such as protons, deuterons or heavier carbon ions are especially appealing for FI as they have relative straight trajectory, and easier to focus on the fuel capsule. But current experiments have encountered problems with the 'converter-foil' which is irradiated by the Petawatt laser to produce the ion beams. The problems include depletion of themore » available ions in the convertor foils, and poor energy efficiency (ion beam energy/ input laser energy). We proposed to develop a volumetrically-loaded ultra-high-density deuteron deuterium cluster material as the basis for converter-foil for deuteron beam generation. The deuterons will fuse with the ICF DT while they slow down, providing an extra 'bonus' energy gain in addition to heating the hot spot. Also, due to the volumetric loading, the foil will provide sufficient energetic deuteron beam flux for 'hot spot' ignition, while avoiding the depletion problem encountered by current proton-driven FI foils. After extensive comparative studies, in Phase I, high purity PdO/Pd/PdO foils were selected for the high packing fraction D-Cluster converter foils. An optimized loading process has been developed to increase the cluster packing fraction in this type of foil. As a result, the packing fraction has been increased from 0.1% to 10% - meeting the original Phase I goal and representing a significant progress towards the beam intensities needed for both FI and pulsed neutron applications. Fast Ignition provides a promising approach to achieve high energy gain target performance needed for commercial Inertial Confinement Fusion (ICF). This is now a realistic goal for near term in view of the anticipated ICF target burn at the National Ignition Facility (NIF) in CA within a year. This will usher in the technology development Phase of ICF after years of research aimed at achieving breakeven experiment. Methods to achieve the high energy gain needed for a competitive power plant will then be a key developmental issue, and our D-cluster target for Fast Ignition (FI) is expected to meet that need.« less

Implosion of multilayered cylindrical targets driven by intense heavy ion beams.

PubMed

Piriz, A R; Portugues, R F; Tahir, N A; Hoffmann, D H H

2002-11-01

An analytical model for the implosion of a multilayered cylindrical target driven by an intense heavy ion beam has been developed. The target is composed of a cylinder of frozen hydrogen or deuterium, which is enclosed in a thick shell of solid lead. This target has been designed for future high-energy-density matter experiments to be carried out at the Gesellschaft für Schwerionenforschung, Darmstadt. The model describes the implosion dynamics including the motion of the incident shock and the first reflected shock and allows for calculation of the physical conditions of the hydrogen at stagnation. The model predicts that the conditions of the compressed hydrogen are not sensitive to significant variations in target and beam parameters. These predictions are confirmed by one-dimensional numerical simulations and thus allow for a robust target design.

Two-plasmon decay mitigation in direct-drive inertial-confinement-fusion experiments using multilayer targets

DOE PAGES

Follett, R. K.; Delettrez, J. A.; Edgell, D. H.; ...

2016-04-15

Multilayer direct-drive inertial-confinement-fusion (ICF) targets are shown to significantly reduce two-plasmon-decay (TPD) driven hot-electron production while maintaining high hydrodynamic efficiency. Implosion experiments on the OMEGA Laser used targets with silicon layered between an inner beryllium and outer silicon-doped plastic ablator. A factor of five reduction in hot-electron generation (> 50 keV) was observed in the multilayer targets relative to pure CH targets. Three-dimensional simulations of the TPD driven hot-electron production using a laser-plasma interaction code (LPSE) that includes nonlinear and kinetic effects show excellent agreement with the measurements. As a result, the simulations suggest that the reduction in hot-electron productionmore » observed in the multilayer targets is primarily due to increased electron-ion collisional damping.« less

UCx target preparations and characterizations

NASA Astrophysics Data System (ADS)

Andrighetto, Alberto; Corradetti, Stefano; Manzolaro, Mattia; Scarpa, Daniele; Monetti, Alberto; Rossignoli, Massimo; Borgna, Francesca; Ballan, Michele; Agostini, Mattia; D'Agostini, Fabio; Ferrari, Matteo; Zenoni, Aldo

2018-05-01

The Target-Ion Source unit is the core of an ISOL-RIB facility. Many international ISOL facilities have chosen different layouts of this unit. Many research groups are involved in research and development of targets capable of dissipating high power and, at the same time, be able to have a fast isotope release. This is mandatory in order to produce beams of short half-life isotopes. The research of new materials with advanced microstructural features is crucial in this field. The design of a proper target is indeed strictly related to the obtainment of porous refractory materials, which are capable to work under extreme conditions (temperatures up to 2000 °C in high vacuum) with a high release efficiency. For SPES, the second generation Italian ISOL-RIB Facility, the target will be made of uranium carbide (UCx) in which, by fission induced by a proton beam of 40 MeV of energy (8 kW of power), isotopes in the 60-160 amu mass region are produced. The current technological developments are also crucial in the study of third generation ISOL facilities.

Experimental investigation of nozzle/plume aerodynamics at hypersonic speeds

NASA Technical Reports Server (NTRS)

Bogdanoff, David W.; Cambier, Jean-Luc

1993-01-01

Work continued on the improvement of 16-Inch Shock Tunnel. This comprised studies of ways of improving driver gas ignition, an improved driver gas mixing system, an axial translation system for the driver tube, improved diaphragm materials (carbon steel vs. stainless steel), a copper liner for the part of the driven tube near the nozzle, the use of a buffer gas between the driver and driven gases, the use of N2O in the driven tube, the use of a converging driven tube, operation of the facility as a non-reflected shock tunnel and expansion tube, operation with heated hydrogen or helium driver gas, the use of detonations in the driver and the construction of an enlarged test section. Maintenance and developmental work continued on the scramjet combustor continued. New software which greatly speeds up data analysis has been written and brought on line. In particular, software which provides very rapid generation of model surface heat flux profiles has been brought on line. A considerable amount of theoretical work was performed in connection with upgrading the 16 Inch Shock Tunnel Facility. A one-dimensional Godunov code for very high velocities and any equation of state is intended to add viscous effects in studying the operation of the Shock Tunnel and also of two-stage light gas guns.

Visuospatial working memory mediates inhibitory and facilitatory guidance in preview search.

PubMed

Barrett, Doug J K; Shimozaki, Steven S; Jensen, Silke; Zobay, Oliver

2016-10-01

Visual search is faster and more accurate when a subset of distractors is presented before the display containing the target. This "preview benefit" has been attributed to separate inhibitory and facilitatory guidance mechanisms during search. In the preview task the temporal cues thought to elicit inhibition and facilitation provide complementary sources of information about the likely location of the target. In this study, we use a Bayesian observer model to compare sensitivity when the temporal cues eliciting inhibition and facilitation produce complementary, and competing, sources of information. Observers searched for T-shaped targets among L-shaped distractors in 2 standard and 2 preview conditions. In the standard conditions, all the objects in the display appeared at the same time. In the preview conditions, the initial subset of distractors either stayed on the screen or disappeared before the onset of the search display, which contained the target when present. In the latter, the synchronous onset of old and new objects negates the predictive utility of stimulus-driven capture during search. The results indicate observers combine memory-driven inhibition and sensory-driven capture to reduce spatial uncertainty about the target's likely location during search. In the absence of spatially predictive onsets, memory-driven inhibition at old locations persists despite irrelevant sensory change at previewed locations. This result is consistent with a bias toward unattended objects during search via the active suppression of irrelevant capture at previously attended locations. (PsycINFO Database Record (c) 2016 APA, all rights reserved).

Alternate Operating Scenarios for NDCX-II

NASA Astrophysics Data System (ADS)

Sharp, W. M.; Friedman, A.; Grote, D. P.; Cohen, R. H.; Lund, S. M.; Vay, J.-L.; Waldron, W. L.; Yeun, A.

2011-10-01

NDCX-II is an accelerator facility being built at LBNL to study ion-heated warm dense matter and aspects of ion-driven targets for inertial-fusion energy. The baseline design calls for using twelve induction cells to accelerate 40 nC of Li+ ions to 1.2 MeV. During commissioning, though, we plan to extend the source lifetime by extracting less total charge. For operational flexibility, the option of using a helium plasma source is also being investigated. Over time, we expect that NDCX-II will be upgraded to substantially higher energies, necessitating the use of heavier ions to keep a suitable deposition range in targets. Each of these options requires development of an alternate acceleration schedule and the associated transverse focusing. The schedules here are first worked out with a fast-running 1-D particle-in-cell code ASP, then 2-D and 3-D Warp simulations are used to verify the 1-D results and to design transverse focusing. Work performed under the auspices of U.S. Department of Energy by LLNL under Contract DE-AC52-07NA27344 and by LBNL under Contract DE-AC03-76SF00098.

High Energy electron and proton acceleration by circularly polarized laser pulse from near critical density hydrogen gas target.

PubMed

Sharma, Ashutosh

2018-02-01

Relativistic electron rings hold the possibility of very high accelerating rates, and hopefully a relatively cheap and compact accelerator/collimator for ultrahigh energy proton source. In this work, we investigate the generation of helical shaped quasi-monoenergetic relativistic electron beam and high-energy proton beam from near critical density plasmas driven by petawatt-circularly polarized-short laser pulses. We numerically observe the efficient proton acceleration from magnetic vortex acceleration mechanism by using the three dimensional particle-in-cell simulations; proton beam with peak energy 350 MeV, charge ~10nC and conversion efficiency more than 6% (which implies 2.4 J proton beam out of the 40 J incident laser energy) is reported. We detailed the microphysics involved in the ion acceleration mechanism, which requires investigating the role of self-generated plasma electric and magnetic fields. The concept of efficient generation of quasi-monoenergetic electron and proton beam from near critical density gas targets may be verified experimentally at advanced high power - high repetition rate laser facilities e.g. ELI-ALPS. Such study should be an important step towards the development of high quality electron and proton beam.

On the Value-Dependence of Value-Driven Attentional Capture

PubMed Central

Anderson, Brian A.; Halpern, Madeline

2017-01-01

Findings from an increasingly large number of studies have been used to argue that attentional capture can be dependent on the learned value of a stimulus, or value-driven. However, under certain circumstances attention can be biased to select stimuli that previously served as targets, independent of reward history. Value-driven attentional capture, as studied using the training phase-test phase design introduced by Anderson and colleagues, is widely presumed to reflect the combined influence of learned value and selection history. However, the degree to which attentional capture is at all dependent on value learning in this paradigm has recently been questioned. Support for value-dependence can be provided through one of two means: (1) greater attentional capture by prior targets following rewarded training than following unrewarded training, and (2) greater attentional capture by prior targets previously associated with high compared to low value. Using a variant of the original value-driven attentional capture paradigm, Sha and Jiang (2016) failed to find evidence of either, and raised criticisms regarding the adequacy of evidence provided by prior studies using this particular paradigm. To address this disparity, here we provided a stringent test of the value-dependence hypothesis using the traditional value-driven attentional capture paradigm. With a sufficiently large sample size, value-dependence was observed based on both criteria, with no evidence of attentional capture without rewards during training. Our findings support the validity of the traditional value-driven attentional capture paradigm in measuring what its name purports to measure. PMID:28176215

Target weight achievement and ultrafiltration rate thresholds: potential patient implications.

PubMed

Flythe, Jennifer E; Assimon, Magdalene M; Overman, Robert A

2017-06-02

Higher ultrafiltration (UF) rates and extracellular hypo- and hypervolemia are associated with adverse outcomes among maintenance hemodialysis patients. The Centers for Medicare and Medicaid Services recently considered UF rate and target weight achievement measures for ESRD Quality Incentive Program inclusion. The dual measures were intended to promote balance between too aggressive and too conservative fluid removal. The National Quality Forum endorsed the UF rate measure but not the target weight measure. We examined the proposed target weight measure and quantified weight gains if UF rate thresholds were applied without treatment time (TT) extension or interdialytic weight gain (IDWG) reduction. Data were taken from the 2012 database of a large dialysis organization. Analyses considered 152,196 United States hemodialysis patients. We described monthly patient and dialysis facility target weight achievement patterns and examined differences in patient characteristics across target weight achievement status and differences in facilities across target weight measure scores. We computed the cumulative, theoretical 1-month fluid-related weight gain that would occur if UF rates were capped at 13 mL/h/kg without concurrent TT extension or IDWG reduction. Target weight achievement patterns were stable over the year. Patients who did not achieve target weight (post-dialysis weight ≥ 1 kg above or below target weight) tended to be younger, black and dialyze via catheter, and had shorter dialysis vintage, greater body weight, higher UF rate and more missed treatments compared with patients who achieved target weight. Facilities had, on average, 27.1 ± 9.7% of patients with average post-dialysis weight ≥ 1 kg above or below the prescribed target weight. In adjusted analyses, facilities located in the midwest and south and facilities with higher proportions of black and Hispanic patients and higher proportions of patients with shorter TTs were more likely to have unfavorable facility target weight measure scores. Without TT extension or IDWG reduction, UF rate threshold (13 mL/h/kg) implementation led to an average theoretical 1-month, fluid-related weight gain of 1.4 ± 3.0 kg. Target weight achievement patterns vary across clinical subgroups. Implementation of a maximum UF rate threshold without adequate attention to extracellular volume status may lead to fluid-related weight gain.

The DE-PHARM Project: A Pharmacist-Driven Deprescribing Initiative in a Nursing Facility.

PubMed

Pruskowski, Jennifer; Handler, Steven M

2017-08-01

Many residents with life-limiting illnesses are being prescribed and taking potentially inappropriate medications (PIMs) and questionably beneficial medications either near or at the end of life. These medications can contribute to adverse drug reactions, increase morbidity, and increase unnecessary burden and cost. It is crucial that the process of deprescribing be incorporated into the care of these residents. After developing a clinical pharmacist-driven deprescribing initiative in the nursing facility, the objective of this project was to reduce the number of PIMs via accepted recommendations from the clinical pharmacist to the primary team. The Discussion to Ensure the Patient-centered, Health-focused, prognosis-Appropriate, and Rational Medication regimen (DE-PHARM) quality improvement-approved project was conducted in an urban, academic nursing facility in Pittsburgh, Pennsylvania. The pilot phase occurred between October 2015 and April 2016. To be included in this study, participants had to be a custodial resident of the nursing facility with a previously documented comfort-focused treatment plan. All medications used for the management of chronic comorbid diseases were eligible for review. Forty-seven residents managed by eight different primary teams met inclusion criteria. Thirty-nine recommendations for 23 residents were made by the clinical pharmacist, with an average of 0.82 and range of 0-5 recommendations per resident, respectively. Of those, only 10 (26%) were accepted, 1 (3%) was modified, 3 (7%) were rejected, and 25 (64%) had no response within the 120-day response period. Additionally, two residents died during the project, and one resident was readmitted to the hospital for a prolonged period of time. The pilot phase of the DE-PHARM project, a clinical pharmacist-driven deprescribing initiative, was designed and assessed. This project demonstrated the feasibility of such an initiative. Because of the complexity of such a process, special attention must be paid to eligible residents and medications, the need for interprofessional collaboration, and the operational process. This project is ongoing in other nursing facilities in Western Pennsylvania.

Implementing Genome-Driven Oncology

PubMed Central

Hyman, David M.; Taylor, Barry S.; Baselga, José

2017-01-01

Early successes in identifying and targeting individual oncogenic drivers, together with the increasing feasibility of sequencing tumor genomes, have brought forth the promise of genome-driven oncology care. As we expand the breadth and depth of genomic analyses, the biological and clinical complexity of its implementation will be unparalleled. Challenges include target credentialing and validation, implementing drug combinations, clinical trial designs, targeting tumor heterogeneity, and deploying technologies beyond DNA sequencing, among others. We review how contemporary approaches are tackling these challenges and will ultimately serve as an engine for biological discovery and increase our insight into cancer and its treatment. PMID:28187282

Applications of High Intensity Proton Accelerators

NASA Astrophysics Data System (ADS)

Raja, Rajendran; Mishra, Shekhar

2010-06-01

Superconducting radiofrequency linac development at Fermilab / S. D. Holmes -- Rare muon decay experiments / Y. Kuno -- Rare kaon decays / D. Bryman -- Muon collider / R. B. Palmer -- Neutrino factories / S. Geer -- ADS and its potential / J.-P. Revol -- ADS history in the USA / R. L. Sheffield and E. J. Pitcher -- Accelerator driven transmutation of waste: high power accelerator for the European ADS demonstrator / J. L. Biarrotte and T. Junquera -- Myrrha, technology development for the realisation of ADS in EU: current status & prospects for realisation / R. Fernandez ... [et al.] -- High intensity proton beam production with cyclotrons / J. Grillenberger and M. Seidel -- FFAG for high intensity proton accelerator / Y. Mori -- Kaon yields for 2 to 8 GeV proton beams / K. K. Gudima, N. V. Mokhov and S. I. Striganov -- Pion yield studies for proton driver beams of 2-8 GeV kinetic energy for stopped muon and low-energy muon decay experiments / S. I. Striganov -- J-Parc accelerator status and future plans / H. Kobayashi -- Simulation and verification of DPA in materials / N. V. Mokhov, I. L. Rakhno and S. I. Striganov -- Performance and operational experience of the CNGS facility / E. Gschwendtner -- Particle physics enabled with super-conducting RF technology - summary of working group 1 / D. Jaffe and R. Tschirhart -- Proton beam requirements for a neutrino factory and muon collider / M. S. Zisman -- Proton bunching options / R. B. Palmer -- CW SRF H linac as a proton driver for muon colliders and neutrino factories / M. Popovic, C. M. Ankenbrandt and R. P. Johnson -- Rapid cycling synchrotron option for Project X / W. Chou -- Linac-based proton driver for a neutrino factory / R. Garoby ... [et al.] -- Pion production for neutrino factories and muon colliders / N. V. Mokhov ... [et al.] -- Proton bunch compression strategies / V. Lebedev -- Accelerator test facility for muon collider and neutrino factory R&D / V. Shiltsev -- The superconducting RF linac for muon collider and neutrino factory - summary of working group 2 / J. Galambos, R. Garoby and S. Geer -- Prospects for a very high power CW SRF linac / R. A. Rimmer -- Indian accelerator program for ADS applications / V. C. Sahni and P. Singh -- Ion accelerator activities at VECC (particularly, operating at low temperature) / R. K. Bhandari -- Chinese efforts in high intensity proton accelerators / S. Fu, J. Wang and S. Fang -- ADSR activity in the UK / R. J. Barlow -- ADS development in Japan / K. Kikuchi -- Project-X, SRF, and very large power stations / C. M. Ankenbrandt, R. P. Johnson and M. Popovic -- Power production and ADS / R. Raja -- Experimental neutron source facility based on accelerator driven system / Y. Gohar -- Transmutation mission / W. S. Yang -- Safety performance and issues / J. E. Cahalan -- Spallation target design for accelerator-driven systems / Y. Gohar -- Design considerations for accelerator transmutation of waste system / W. S. Yang -- Japan ADS program / T. Sasa -- Overview of members states' and IAEA activities in the field of Accelerator Driven Systems (ADS) / A. Stanculescu -- Linac for ADS applications - accelerator technologies / R. W. Garnett and R. L. Sheffield -- SRF linacs and accelerator driven sub-critical systems - summary working groups 3 & 4 / J. Delayen -- Production of Actinium-225 via high energy proton induced spallation of Thorium-232 / J. Harvey ... [et al.] -- Search for the electric dipole moment of Radium-225 / R. J. Holt, Z.-T. Lu and R. Mueller -- SRF linac and material science and medicine - summary of working group 5 / J. Nolen, E. Pitcher and H. Kirk.

Laser-driven proton and deuteron acceleration from a pure solid-density H2/D2 cryogenic jet

NASA Astrophysics Data System (ADS)

Kim, Jongjin; Gauthier, Maxence; Aurand, Bastian; Curry, Chandra; Goede, Sebastian; Goyon, Clement; Williams, Jackson; Kerr, Shaun; Ruby, John; Propp, Adrienne; Ramakrishna, Bhuvanesh; Pak, Art; Hazi, Andy; Glenzer, Siegfried; Roedel, Christian

2015-11-01

Laser-driven proton acceleration has become of tremendous interest for the fundamental science and the potential applications in tumor therapy and proton radiography. We have developed a cryogenic liquid hydrogen jet, which can deliver a self-replenishing target of pure solid-density hydrogen or deuterium. This allows for a target compatible with high-repetition-rate experiments and results in a pure hydrogen plasma, facilitating comparison with simulations. A new modification has allowed for the formation of jets with rectangular profiles, facilitating comparison with foil targets. This jet was installed at the Titan laser and driven by laser pulses of 40-60 J of 527 nm laser light in 1 ps. The resulting proton and deuteron spectra were measured in multiple directions with Thomson parabola spectrometers and RCF stacks. The spectral and angular information suggest contribution from both the TNSA and RPA acceleration mechanisms.

Sensor modeling and demonstration of a multi-object spectrometer for performance-driven sensing

NASA Astrophysics Data System (ADS)

Kerekes, John P.; Presnar, Michael D.; Fourspring, Kenneth D.; Ninkov, Zoran; Pogorzala, David R.; Raisanen, Alan D.; Rice, Andrew C.; Vasquez, Juan R.; Patel, Jeffrey P.; MacIntyre, Robert T.; Brown, Scott D.

2009-05-01

A novel multi-object spectrometer (MOS) is being explored for use as an adaptive performance-driven sensor that tracks moving targets. Developed originally for astronomical applications, the instrument utilizes an array of micromirrors to reflect light to a panchromatic imaging array. When an object of interest is detected the individual micromirrors imaging the object are tilted to reflect the light to a spectrometer to collect a full spectrum. This paper will present example sensor performance from empirical data collected in laboratory experiments, as well as our approach in designing optical and radiometric models of the MOS channels and the micromirror array. Simulation of moving vehicles in a highfidelity, hyperspectral scene is used to generate a dynamic video input for the adaptive sensor. Performance-driven algorithms for feature-aided target tracking and modality selection exploit multiple electromagnetic observables to track moving vehicle targets.

Laser shock compression experiments on precompressed water in ``SG-II'' laser facility

NASA Astrophysics Data System (ADS)

Shu, Hua; Huang, Xiuguang; Ye, Junjian; Fu, Sizu

2017-06-01

Laser shock compression experiments on precompressed samples offer the possibility to obtain new hugoniot data over a significantly broader range of density-temperature phase than was previously achievable. This technique was developed in ``SG-II'' laser facility. Hugoniot data were obtained for water in 300 GPa pressure range by laser-driven shock compression of samples statically precompressed in diamond-anvil cells.

Managing patients with behavioral health problems in acute care: balancing safety and financial viability.

PubMed

Rape, Cyndy; Mann, Tammy; Schooley, John; Ramey, Jana

2015-01-01

With a recent decrease in community resources for the mental health population, acute care facilities must seek creative, cost-effective ways to protect and care for these vulnerable individuals. This article describes 1 facility's journey to maintaining patient and staff safety while reducing cost. Success factors of this program include staff engagement, environmental modifications, and a nurse-driven, sitter-reduction process.

Laser driven nuclear science and applications: The need of high efficiency, high power and high repetition rate Laser beams

NASA Astrophysics Data System (ADS)

Gales, S.

2015-10-01

Extreme Light Infrastructure (ELI) is a pan European research initiative selected on the European Strategy Forum on Research Infrastructures Roadmap that aims to close the gap between the existing laboratory-based laser driven research and international facility-grade research centre. The ELI-NP facility, one of the three ELI pillars under construction, placed in Romania and to be operational in 2018, has as core elements a couple of new generation 10 PW laser systems and a narrow bandwidth Compton backscattering gamma source with photon energies up to 19 MeV. ELI-NP will address nuclear photonics, nuclear astrophysics and quantum electrodynamics involving extreme photon fields. Prospective applications of high power laser in nuclear astrophysics, accelerator physics, in particular towards future Accelerator Driven System, as well as in nuclear photonics, for detection and characterization of nuclear material, and for nuclear medicine, will be discussed. Key issues in these research areas will be at reach with significant increase of the repetition rates and of the efficiency at the plug of the high power laser systems as proposed by the ICAN collaboration.

Advances in the computation of the Sjöstrand, Rossi, and Feynman distributions

DOE PAGES

Talamo, A.; Gohar, Y.; Gabrielli, F.; ...

2017-02-01

This study illustrates recent computational advances in the application of the Sjöstrand (area), Rossi, and Feynman methods to estimate the effective multiplication factor of a subcritical system driven by an external neutron source. The methodologies introduced in this study have been validated with the experimental results from the KUKA facility of Japan by Monte Carlo (MCNP6 and MCNPX) and deterministic (ERANOS, VARIANT, and PARTISN) codes. When the assembly is driven by a pulsed neutron source generated by a particle accelerator and delayed neutrons are at equilibrium, the Sjöstrand method becomes extremely fast if the integral of the reaction rate frommore » a single pulse is split into two parts. These two integrals distinguish between the neutron counts during and after the pulse period. To conclude, when the facility is driven by a spontaneous fission neutron source, the timestamps of the detector neutron counts can be obtained up to the nanosecond precision using MCNP6, which allows obtaining the Rossi and Feynman distributions.« less

75 FR 13127 - Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-18

... ENVIRONMENTAL PROTECTION AGENCY [EPA-R07-OPPT-2010-0155; FRL-9128-4] Lead-Based Paint Renovation, Repair and Painting Activities in Target Housing and Child Occupied Facilities; State of Iowa. Notice of... target housing and child-occupied facilities: 1. Establish the discipline of lead-safe renovator. 2...

Tamper asymmetry and its effect on transmission for x-ray driven opacity simulations

DOE PAGES

Morris, H. E.; Tregillis, I. L.; Hoffman, N. M.; ...

2017-08-01

This paper reports on synthetic transmission results from Lasnex [1] radiation-hydrodynamics simulations of opacity experiments carried out at Sandia National Laboratories' recently upgraded ZR facility. The focus is on experiments utilizing disk targets composed of a half-moon Fe/Mg mixture tamped on either end with 10- m CH and an additional 35- m beryllium tamper accessory on the end facing the spectrometer. Five x-ray sources with peak power ranging from 10 to 24 TW were used in the simulations to heat and backlight the opacity target. The dominant effect is that the beryllium behind the Fe/Mg mixture is denser and moremore » opaque than the beryllium unshielded by metal during the times of greatest importance for the transmission measurement for all drives. This causes the simulated transmission to be lower than expected, and this is most pronounced for the case using the lowest drive power. While beryllium has a low opacity, its areal density is sufficiently high such that the expected reduction of the measured transmission is significant. This situation leads to an overestimate of iron opacity by 10-215% for a photon energy range of 975- 1775 eV for the 10-TW case. It is shown that if the tamper conditions are known, the transmission through each component of the target can be calculated and the resulting opacity can be corrected.« less

Wake of a beam passing through a diffraction radiation target

NASA Astrophysics Data System (ADS)

Xiang, Dao; Huang, Wen-Hui; Lin, Yu-Zheng; Park, Sung-Ju; Ko, In Soo

2008-02-01

Diffraction radiation (DR) is one of the most promising candidates for electron beam diagnostics for International Linear Collider and x-ray free electron lasers due to its nonintercepting characteristic. One of the potential problems that may restrict its applications in real-time monitoring beam parameters is the wakefield generated by the presence of the DR target. In this paper, a comparative study of the wakefield and the backward DR (BDR) field is performed to clarify the relationship between them. The wakefield is studied with a particle-in-cell code MAGIC and the DR field is calculated based on virtual photon diffraction model. It is found that they have the same frequency spectrum and angular distribution, which indicates that the difference only exists in the subjective terminology. The longitudinal and transverse wake for a beam passing through a DR target is calculated for a general case when the beam’s velocity is smaller than that of light. The resulted emittance growth and energy spread growth due to the short range wakefield is estimated and found to be permissible. In real measurement where BDR propagates in the direction perpendicular to the trajectory, it may add a transverse kick to the beam as a requirement of momentum conservation. The kick is found to be large enough to degrade the performance of accelerator driven facilities and needs to be corrected.

New compact hohlraum configuration research at the 1.7 MA Z-pinch generator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kantsyrev, V. L., E-mail: victor@unr.edu; Shrestha, I. K.; Esaulov, A. A.

A new compact Z-pinch x-ray hohlraum design with parallel-driven x-ray sources was experimentally demonstrated in a full configuration with a central target and tailored shine shields (to provide a symmetric temperature distribution on the target) at the 1.7 MA Zebra generator. This presentation reports on the joint success of two independent lines of research. One of these was the development of new sources – planar wire arrays (PWAs). PWAs turned out to be a prolific radiator. Another success was the drastic improvement in energy efficiency of pulsed-power systems, such as the Load Current Multiplier (LCM). The Zebra/LCM generator almost doubledmore » the plasma load current to 1.7 MA. The two above-mentioned innovative approaches were used in combination to produce a new compact hohlraum design for ICF, as jointly proposed by SNL and UNR. Good agreement between simulated and measured radiation temperature of the central target is shown. Experimental comparison of PWAs with planar foil liners (PFL) - another viable alternative to wire array loads at multi-MA generators show promising data. Results of research at the University of Nevada Reno allowed for the study of hohlraum coupling physics at University-scale generators. The advantages of new hohlraum design applications for multi-MA facilities with W or Au double PWAs or PFL x-ray sources are discussed.« less

Superparamagnetic Iron Oxide Nanoparticle-Based Delivery Systems for Biotherapeutics

PubMed Central

Mok, Hyejung; Zhang, Miqin

2014-01-01

Introduction Superparamagnetic iron oxide nanoparticle (SPION)-based carrier systems have many advantages over other nanoparticle-based systems. They are biocompatible, biodegradable, facilely tunable, and superparamagnetic and thus controllable by an external magnetic field. These attributes enable their broad biomedical applications. In particular, magnetically-driven carriers are drawing considerable interest as an emerging therapeutic delivery system because of their superior delivery efficiency. Area covered This article reviews the recent advances in use of SPION-based carrier systems to improve the delivery efficiency and target specificity of biotherapeutics. We examine various formulations of SPION-based delivery systems, including SPION micelles, clusters, hydrogels, liposomes, and micro/nanospheres, as well as their specific applications in delivery of biotherapeutics. Expert opinion Recently, biotherapeutics including therapeutic cells, proteins and genes have been studied as alternative treatments to various diseases. Despite the advantages of high target specificity and low adverse effects, clinical translation of biotherapeutics has been hindered by the poor stability and low delivery efficiency compared to chemical drugs. Accordingly, biotherapeutic delivery systems that can overcome these limitations are actively pursued. SPION-based materials can be ideal candidates for developing such delivery systems because of their excellent biocompatibility and superparamagnetism that enables long-term accumulation/retention at target sites by utilization of a suitable magnet. In addition, synthesis technologies for production of finely-tuned, homogeneous SPIONs have been well developed, which may promise their rapid clinical translation. PMID:23199200

The impact of temporal contingencies between cue and target onset on spatial attentional capture by subliminal onset cues.

PubMed

Schoeberl, Tobias; Ansorge, Ulrich

2018-05-15

Prior research suggested that attentional capture by subliminal abrupt onset cues is stimulus driven. In these studies, reacting was faster when a searched-for target appeared at the location of a preceding abrupt onset cue compared to when the same target appeared at a location away from the cue (cueing effect), although the earlier onset of the cue was subliminal, because it appeared as one out of three horizontally aligned placeholders with a lead time that was too short to be noticed by the participants. Because the cueing effects seemed to be independent of top-down search settings for target features, the effect was attributed to stimulus-driven attentional capture. However, prior studies did not investigate if participants experienced the cues as useful temporal warning signals and, therefore, attended to the cues in a top-down way. Here, we tested to which extent search settings based on temporal contingencies between cue and target onset could be responsible for spatial cueing effects. Cueing effects were replicated, and we showed that removing temporal contingencies between cue and target onset did not diminish the cueing effects (Experiments 1 and 2). Neither presenting the cues in the majority of trials after target onset (Experiment 1) nor presenting cue and target unrelated to one another (Experiment 2) led to a significant reduction of the spatial cueing effects. Results thus support the hypothesis that the subliminal cues captured attention in a stimulus-driven way.

An RCT Investigating Patient-Driven Versus Physician-Driven Titration of BIAsp 30 in Patients with Type 2 Diabetes Uncontrolled Using NPH Insulin.

PubMed

Chraibi, Abdelmjid; Al-Herz, Shoorook; Nguyen, Bich Dao; Soeatmadji, Djoko W; Shinde, Anil; Lakshmivenkataraman, Balasubramanian; Assaad-Khalil, Samir H

2017-08-01

The aim of this study was to confirm the efficacy of patient-driven titration of BIAsp 30 in terms of glycemic control, by comparing it to physician-driven titration of BIAsp 30, in patients with type 2 diabetes in North Africa, the Middle East, and Asia. A 20-week, open-label, randomized, two-armed, parallel-group, multicenter study in Egypt, Indonesia, Morocco, Saudi Arabia, and Vietnam. Patients (n = 155) with type 2 diabetes inadequately controlled using neutral protamine Hagedorn (NPH) insulin were randomized to either patient-driven or physician-driven BIAsp 30 titration. The noninferiority of patient-driven compared to physician-driven titration with respect to the reduction in HbA1c was confirmed. The estimated mean change in HbA1c from baseline to week 20 was -1.27% in the patient-driven arm and -1.04% in the physician-driven arm, with an estimated treatment difference of -0.23% (95% confidence interval: -0.54; 0.08). After 20 weeks of treatment, the proportions of patients achieving the target of HbA1c <7.5% were similar between titration arms; the proportions of patients achieving the target of ≤6.5% were also similar. Both titration algorithms were well tolerated, and hypoglycemic episode rates were similar in both arms. Patient-driven titration of BIAsp 30 can be as effective and safe as physician-driven titration in non-Western populations. Overall, the switch from NPH insulin to BIAsp 30 was well tolerated in both titration arms and led to improved glycemic control. A limitation of the study was the relatively small number of patients recruited in each country. ClinicalTrials.gov NCT01589653. Novo Nordisk A/S, Denmark.

Facility Targeting, Protection and Mission Decision Making Using the VISAC Code

NASA Technical Reports Server (NTRS)

Morris, Robert H.; Sulfredge, C. David

2011-01-01

The Visual Interactive Site Analysis Code (VISAC) has been used by DTRA and several other agencies to aid in targeting facilities and to predict the associated collateral effects for the go, no go mission decision making process. VISAC integrates the three concepts of target geometric modeling, damage assessment capabilities, and an event/fault tree methodology for evaluating accident/incident consequences. It can analyze a variety of accidents/incidents at nuclear or industrial facilities, ranging from simple component sabotage to an attack with military or terrorist weapons. For nuclear facilities, VISAC predicts the facility damage, estimated downtime, amount and timing of any radionuclides released. Used in conjunction with DTRA's HPAC code, VISAC also can analyze transport and dispersion of the radionuclides, levels of contamination of the surrounding area, and the population at risk. VISAC has also been used by the NRC to aid in the development of protective measures for nuclear facilities that may be subjected to attacks by car/truck bombs.

Ultrathin TiO2 layer coated-CdS spheres core-shell nanocomposite with enhanced visible-light photoactivity.

PubMed

Chen, Zhang; Xu, Yi-Jun

2013-12-26

Development of various strategies for controllable fabrication of core-shell nanocomposites (CSNs) with highly active photocatalytic performance has been attracting ever-increasing research attention. In particular, control of the ultrathin layer TiO2 shell in constructing CSNs in an aqueous phase is a significant but technologically challenging issue. Here, this paper demonstrates the interface assembly synthesis of CdS nanospheres@TiO2 core-shell photocatalyst via the electrostatic interaction of negatively charged water-stable titania precursor with positively charged CdS nanospheres (CdS NSPs), followed by the formation of the ultrathin-layer TiO2 shell through a facile refluxing process in aqueous phase. The as-formed CdS NSPs@TiO2 core-shell nanohybrid exhibits a high visible-light-driven photoactivity for selective transformation and reduction of heavy metal ions. The ultrathin TiO2 layer coated on CdS NSPs results in excellent light transmission property, enhanced adsorption capacity, and improved transfer of charge carriers and lifespan of photoinduced electron-hole pairs, which would prominently contribute to the significant photoactivity enhancement. It is anticipated that this facile aqueous-phase synthesis strategy could be extended to design a variety of more efficient CSN photocatalysts with controllable morphology toward target applications in diverse photoredox processes.

Anomalous neutron yield in indirect-drive inertial-confinement-fusion due to the formation of collisionless shocks in the corona

NASA Astrophysics Data System (ADS)

Zhang, Wen-Shuai; Cai, Hong-Bo; Shan, Lian-Qiang; Zhang, Hua-Sen; Gu, Yu-Qiu; Zhu, Shao-Ping

2017-06-01

Observations of anomalous neutron yield in the indirect-drive inertial confinement fusion implosion experiments conducted at SG-III prototype and SG-II upgrade laser facilities are interpreted. The anomalous mechanism results in a neutron yield which is 100-times higher than that predicted by 1D radiation-hydrodynamic simulations. 2D radiation-hydrodynamic simulations show that the supersonic, radially directed gold (Au) plasma jets arising from the laser-hohlraum interactions can collide with the carbon-deuterium (CD) corona plasma of the compressed pellet. It is found that in the interaction front of the high-Z jet with the low-Z corona, with low density  ˜{{10}20}~\\text{c}{{\\text{m}}-3} and high temperature  ˜keV, kinetic effects become important. Particle-in-cell simulations indicate that an electrostatic shock wave can be driven when the high-temperature Au jet expands into the low-temperature CD corona. Deuterium ions with an amount of  ˜1015 can be accelerated to  ˜25 keV by the collisionless shock wave, thus causing efficient neutron productions though the beam-target method by stopping these energetic ions in the corona. The evaluated neutron yield is consistent with the experiments conducted at SG laser facilities.

Dual-mode capability for hardware-in-the-loop

NASA Astrophysics Data System (ADS)

Vamivakas, A. N.; Jackson, Ron L.

2000-07-01

This paper details a Hardware-in-the-Loop Facility (HIL) developed for evaluation and verification of a missile system with dual mode capability. The missile has the capability of tracking and intercepting a target using either an RF antenna or an IR sensor. The testing of a dual mode system presents a significant challenge in the development of the HIL facility. An IR and RF target environment must be presented simultaneously to the missile under test. These targets, simulated by IR and RF sources, must be presented to the missile under test without interference from each other. The location of each source is critical in the development of the HIL facility. The requirements for building a HIL facility with dual mode capability and the methodology for testing the dual mode system are defined within this paper. Methods for the verification and validation of the facility are discussed.

Overview: Development of the National Ignition Facility and the Transition to a User Facility for the Ignition Campaign and High Energy Density Scientific Research

DOE PAGES

Moses, E. I.; Lindl, J. D.; Spaeth, M. L.; ...

2017-03-23

The National Ignition Facility (NIF) at Lawrence Livermore National Laboratory has been operational since March 2009 and has been transitioning to a user facility supporting ignition science, high energy density stockpile science, national security applications, and fundamental science. The facility has achieved its design goal of 1.8 MJ and 500 TW of 3ω light on target, and has performed target experiments with 1.9 MJ at peak powers of 410 TW. The National Ignition Campaign (NIC), established by the U.S. National Nuclear Security Administration in 2005, was responsible for transitioning NIF from a construction project to a national user facility. Besidesmore » the operation and optimization of the use of the NIF laser, the NIC program was responsible for developing capabilities including target fabrication facilities; cryogenic layering capabilities; over 60 optical, X-ray, and nuclear diagnostic systems; experimental platforms; and a wide range of other NIF facility infrastructure. This study provides a summary of some of the key experimental results for NIF to date, an overview of the NIF facility capabilities, and the challenges that were met in achieving these capabilities. Finally, they are covered in more detail in the papers that follow.« less

Overview: Development of the National Ignition Facility and the Transition to a User Facility for the Ignition Campaign and High Energy Density Scientific Research

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moses, E. I.; Lindl, J. D.; Spaeth, M. L.

The National Ignition Facility (NIF) at Lawrence Livermore National Laboratory has been operational since March 2009 and has been transitioning to a user facility supporting ignition science, high energy density stockpile science, national security applications, and fundamental science. The facility has achieved its design goal of 1.8 MJ and 500 TW of 3ω light on target, and has performed target experiments with 1.9 MJ at peak powers of 410 TW. The National Ignition Campaign (NIC), established by the U.S. National Nuclear Security Administration in 2005, was responsible for transitioning NIF from a construction project to a national user facility. Besidesmore » the operation and optimization of the use of the NIF laser, the NIC program was responsible for developing capabilities including target fabrication facilities; cryogenic layering capabilities; over 60 optical, X-ray, and nuclear diagnostic systems; experimental platforms; and a wide range of other NIF facility infrastructure. This study provides a summary of some of the key experimental results for NIF to date, an overview of the NIF facility capabilities, and the challenges that were met in achieving these capabilities. Finally, they are covered in more detail in the papers that follow.« less

Combustion mode switching with a turbocharged/supercharged engine

DOEpatents

Mond, Alan; Jiang, Li

2015-09-22

A method for switching between low- and high-dilution combustion modes in an internal combustion engine having an intake passage with an exhaust-driven turbocharger, a crankshaft-driven positive displacement supercharger downstream of the turbocharger and having variable boost controllable with a supercharger bypass valve, and a throttle valve downstream of the supercharger. The current combustion mode and mass air flow are determined. A switch to the target combustion mode is commanded when an operating condition falls within a range of predetermined operating conditions. A target mass air flow to achieve a target air-fuel ratio corresponding to the current operating condition and the target combustion mode is determined. The degree of opening of the supercharger bypass valve and the throttle valve are controlled to achieve the target mass air flow. The amount of residual exhaust gas is manipulated.

A target development program for beamhole spallation neutron sources in the megawatt range

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bauer, G.S.; Atchison, F.

1995-10-01

Spallation sources as an alternative to fission neutron sources have been operating successfully up to 160 kW of beam power. With the next generation of these facilities aiming at the medium power range between 0.5 and 5 MW, loads on the targets will be high enough to make present experience of little relevance. With the 0.6 MW continuous facility SINQ under construction, and a 5 MW pulsed facility (ESS) under study in Europe, a research and development program is about to be started which aimes at assessing the limits of stationary and moving solid targets and the feasibility and potentialmore » benefits of flowing liquid metal targets. Apart from theoretical work and examination of existing irradiated material, including used targets from ISIS, it is intended to take advantage of the SINQ solid rod target design to improve the relevant data base by building the target in such a way that individual rods can be equipped as irradiation capsules.« less

Optimal pricing policies for services with consideration of facility maintenance costs

NASA Astrophysics Data System (ADS)

Yeh, Ruey Huei; Lin, Yi-Fang

2012-06-01

For survival and success, pricing is an essential issue for service firms. This article deals with the pricing strategies for services with substantial facility maintenance costs. For this purpose, a mathematical framework that incorporates service demand and facility deterioration is proposed to address the problem. The facility and customers constitute a service system driven by Poisson arrivals and exponential service times. A service demand with increasing price elasticity and a facility lifetime with strictly increasing failure rate are also adopted in modelling. By examining the bidirectional relationship between customer demand and facility deterioration in the profit model, the pricing policies of the service are investigated. Then analytical conditions of customer demand and facility lifetime are derived to achieve a unique optimal pricing policy. The comparative statics properties of the optimal policy are also explored. Finally, numerical examples are presented to illustrate the effects of parameter variations on the optimal pricing policy.

Enhancing the traditional hospital design process: a focus on patient safety.

PubMed

Reiling, John G; Knutzen, Barbara L; Wallen, Thomas K; McCullough, Susan; Miller, Ric; Chernos, Sonja

2004-03-01

In 2002 St. Joseph's Community Hospital (West Bend, WI), a member of SynergyHealth, brought together leaders in health care and systems engineering to develop a set of safety-driven facility design principles that would guide the hospital design process. DESIGNING FOR SAFETY: Hospital leadership recognized that a cross-departmental team approach would be needed and formed the 11-member Facility Design Advisory Council, which, with departmental teams and the aid of architects, was responsible for overseeing the design process and for ensuring that the safety considerations were met. The design process was a team approach, with input from national experts, patients and families, hospital staff and physicians, architects, contractors, and the community. The new facility, designed using safety-driven design principles, reflects many innovative design elements, including truly standardized patient rooms, new technology to minimize falls, and patient care alcoves for every patient room. The new hospital has been designed with maximum adaptability and flexibility in mind, to accommodate changes and provide for future growth. The architects labeled the innovative design. The Synergy Model, to describe the process of shaping the entire building and its spaces to work efficiently as a whole for the care and safety of patients. Construction began on the new facility in August 2003 and is expected to be completed in 2005.

Anaemia management protocols in the care of haemodialysis patients: examining patient outcomes.

PubMed

Saunders, Sushila; MacLeod, Martha L P; Salyers, Vince; MacMillan, Peter D; Ogborn, Malcolm R

2013-08-01

To determine whether the use of a nurse-driven protocol in the haemodialysis setting is as safe and effective as traditional physician-driven approaches to anaemia management. The role of haemodialysis nurses in renal anaemia management has evolved through the implementation of nurse-driven protocols, addressing the trend of exceeding haemoglobin targets and rising costs of erythropoietin-stimulating agents. Retrospective, non-equivalent case control group design. The sample was from three haemodialysis units in a control group (n = 64) and three haemodialysis units in a protocol group (n = 43). The protocol group used a nurse-driven renal anaemia management protocol, while the control group used a traditional physician-driven approach to renal anaemia management. All retrospective data were obtained from a provincial renal database. Data were analysed using chi-square tests and t-tests. Patient outcomes examined were haemoglobin levels, transferrin saturation levels, erythropoietin-stimulating agents use and intravenous iron use. Cost comparisons were determined using average use of erythropoietin-stimulating agents and intravenous iron. Control and protocol groups reached haemoglobin target levels. In the protocol group, 75% reached transferrin saturation target levels in comparison with 25% of the control group. Use and costs for iron was higher in the control group, while use and costs for erythropoietin was higher in the protocol group. The higher usage of erythropoietin-stimulating agents was potentially related to comorbid conditions amongst the protocol group. A nurse-driven protocol approach to renal anaemia management was as effective as the physician-driven approach in reaching haemoglobin and transferrin saturation levels. Further examination of the use and dosing of erythropoietin-stimulating agents and intravenous iron, their impact on haemoglobin levels related to patient comorbidities and subsequent cost effectiveness of protocols is required. Using a nurse-driven protocol in practice supports the independent nursing role while contributing to safe patient outcomes. © 2013 Blackwell Publishing Ltd.

A platform to integrate climate information and rural telemedicine in Malawi

NASA Astrophysics Data System (ADS)

Lowe, R.; Chadza, T.; Chirombo, J.; Fonda, C.; Muyepa, A.; Nkoloma, M.; Pietrosemoli, E.; Radicella, S. M.; Tompkins, A. M.; Zennaro, M.

2012-04-01

It is commonly accepted that climate plays a role in the transmission of many infectious diseases, particularly those transmitted by mosquitoes such as malaria, which is one of the most important causes of mortality and morbidity in developing countries. Due to time lags involved in the climate-disease transmission system, lagged observed climate variables could provide some predictive lead for forecasting disease epidemics. This lead time could be extended by using forecasts of the climate in disease prediction models. This project aims to implement a platform for the dissemination of climate-driven disease risk forecasts, using a telemedicine approach. A pilot project has been established in Malawi, where a 162 km wireless link has been installed, spanning from Blantyre City to remote health facilities in the district of Mangochi in the Southern region, bordering Lake Malawi. This long Wi-Fi technology allows rural health facilities to upload real-time disease cases as they occur to an online health information system (DHIS2); a national medical database repository administered by the Ministry of Health. This technology provides a real-time data logging system for disease incidence monitoring and facilitates the flow of information between local and national levels. This platform allows statistical and dynamical disease prediction models to be rapidly updated with real-time climate and epidemiological information. This permits health authorities to target timely interventions ahead of an imminent increase in malaria incidence. By integrating meteorological and health information systems in a statistical-dynamical prediction model, we show that a long-distance Wi-Fi link is a practical and inexpensive means to enable the rapid analysis of real-time information in order to target disease prevention and control measures and mobilise resources at the local level.

Enhanced Laser-Driven Ion Acceleration by Superponderomotive Electrons Generated from Near-Critical-Density Plasma

NASA Astrophysics Data System (ADS)

Bin, J. H.; Yeung, M.; Gong, Z.; Wang, H. Y.; Kreuzer, C.; Zhou, M. L.; Streeter, M. J. V.; Foster, P. S.; Cousens, S.; Dromey, B.; Meyer-ter-Vehn, J.; Zepf, M.; Schreiber, J.

2018-02-01

We report on the experimental studies of laser driven ion acceleration from a double-layer target where a near-critical density target with a few-micron thickness is coated in front of a nanometer-thin diamondlike carbon foil. A significant enhancement of proton maximum energies from 12 to ˜30 MeV is observed when a relativistic laser pulse impinges on the double-layer target under linear polarization. We attributed the enhanced acceleration to superponderomotive electrons that were simultaneously measured in the experiments with energies far beyond the free-electron ponderomotive limit. Our interpretation is supported by two-dimensional simulation results.

On the value-dependence of value-driven attentional capture.

PubMed

Anderson, Brian A; Halpern, Madeline

2017-05-01

Findings from an increasingly large number of studies have been used to argue that attentional capture can be dependent on the learned value of a stimulus, or value-driven. However, under certain circumstances attention can be biased to select stimuli that previously served as targets, independent of reward history. Value-driven attentional capture, as studied using the training phase-test phase design introduced by Anderson and colleagues, is widely presumed to reflect the combined influence of learned value and selection history. However, the degree to which attentional capture is at all dependent on value learning in this paradigm has recently been questioned. Support for value-dependence can be provided through one of two means: (1) greater attentional capture by prior targets following rewarded training than following unrewarded training, and (2) greater attentional capture by prior targets previously associated with high compared to low value. Using a variant of the original value-driven attentional capture paradigm, Sha and Jiang (Attention, Perception, and Psychophysics, 78, 403-414, 2016) failed to find evidence of either, and raised criticisms regarding the adequacy of evidence provided by prior studies using this particular paradigm. To address this disparity, here we provided a stringent test of the value-dependence hypothesis using the traditional value-driven attentional capture paradigm. With a sufficiently large sample size, value-dependence was observed based on both criteria, with no evidence of attentional capture without rewards during training. Our findings support the validity of the traditional value-driven attentional capture paradigm in measuring what its name purports to measure.

Comparison of bulk and pitcher-catcher targets for laser-driven neutron production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Willingale, L.; Maksimchuk, A.; Joglekar, A. S.

2011-08-15

Laser-driven d(d, n)-{sup 3}He beam-target fusion neutron production from bulk deuterated plastic (CD) targets is compared with a pitcher-catcher target scheme using an identical laser and detector arrangement. For laser intensities in the range of (1-3) x 10{sup 19} W cm{sup -2}, it was found that the bulk targets produced a high yield (5 x 10{sup 4} neutrons per steradian) beamed preferentially in the laser propagation direction. Numerical modeling shows the importance of considering the temperature adjusted stopping powers to correctly model the neutron production. The bulk CD targets have a high background target temperature leading to a reduced stoppingmore » power for the deuterons, which increases the probability of generating neutrons by fusion. Neutron production from the pitcher-catcher targets was not as efficient since it does not benefit from the reduced stopping power in the cold catcher target. Also, the inhibition of the deuteron acceleration by a proton rich contamination layer significantly reduces the pitcher-catcher neutron production.« less

Creation of Artificial Ionospheric Layers Using High-Power HF Waves

DTIC Science & Technology

2010-01-30

Program ( HAARP ) transmitter in Gakona, Alaska. The HF- driven ionization process is initiated near the 2nd electron gyroharmonic at 220 km altitude in...the 3.6 MW High-Frequency Active Auroral Program ( HAARP ) transmitter in Gakona, Alaska. The HF-driven ionization process is initiated near the 2nd...Maine. USA. Copyright 2010 by the American Geophysical Union. 0094-8276/I0/2009GLO41895SO5.0O Research Program ( HAARP ) transmitter facility, however

The Laser-Driven X-ray Big Area Backlighter (BABL): Design, Optimization, and Evolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Flippo, Kirk Adler; DeVolder, Barbara Gloria; Doss, Forrest William

The Big Area BackLigher (BABL) has been developed for large area laser-driven x-ray backlighting on the National Ignition Facility (NIF), which can be used for general High Energy Density (HED) experiments. The BABL has been optimized via hydrodynamic simulations to produce laser-to-x-ray conversion efficiencies of up to nearly 5%. Lastly, four BABL foil materials, Zn, Fe, V, and Cu, have been used for He-α x ray production.

Scope of Work for Integration Management and Installation Services of the National Ignition Facility Beampath Infrastructure System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coyle, P.D.

2000-04-25

The goal of the National Ignition Facility (NIF) project is to provide an aboveground experimental capability for maintaining nuclear competence and weapons effects simulation and to provide a facility capable of achieving fusion ignition using solid-state lasers as the energy driver. The facility will incorporate 192 laser beams, which will be focused onto a small target located at the center of a spherical target chamber--the energy from the laser beams will be deposited in a few billionths of a second. The target will then implode, forcing atomic nuclei to sufficiently high temperatures and densities necessary to achieve a miniature fusionmore » reaction. The NIF is under construction, at Livermore, California, located approximately 50 miles southeast of San Francisco, California.« less

Scope of Work for Integration Management and Installation Services of the National Ignition Facility Beampath Infrastructure System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coyle, P.D.

The goal of the National Ignition Facility (NIF) project is to provide an aboveground experimental capability for maintaining nuclear competence and weapons effects simulation and to provide a facility capable of achieving fusion ignition using solid-state lasers as the energy driver. The facility will incorporate 192 laser beams, which will be focused onto a small target located at the center of a spherical target chamber--the energy from the laser beams will be deposited in a few billionths of a second. The target will then implode, forcing atomic nuclei to sufficiently high temperatures and densities necessary to achieve a miniature fusionmore » reaction. The NIF is under construction, at Livermore, California, located approximately 50 miles southeast of San Francisco, California.« less

Laser imprint reduction for the critical-density foam buffered target driven by a relatively strong foot pulse at early stage of laser implosions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, J. W., E-mail: li-jiwei@iapcm.ac.cn; He, X. T.; Institute of Applied Physics and Computational Mathematics, P. O. Box 8009, Beijing 100094

In order to reduce the effect of laser imprint in direct-drive ignition scheme a low-density foam buffered target has been proposed. This target is driven by a laser pulse with a low-intensity foot at the early stage of implosion, which heats the foam and elongates the thermal conduction zone between the laser absorption region and ablation front, increasing the thermal smoothing effect. In this paper, a relatively strong foot pulse is adopted to irradiate the critical-density foam buffered target. The stronger foot, near 1 × 10{sup 14 }W/cm{sup 2}, is able to drive a radiative shock in the low-density foam, which helps smoothmore » the shock and further reduce the effect of laser imprint. The radiative shock also forms a double ablation front structure between the two ablation fronts to further stabilize the hydrodynamics, achieving the similar results to a target with a high-Z dopant in the ablator. 2D analysis shows that for the critical-density foam buffered target irradiated by the strong foot pulse, the laser imprint can be reduced due to the radiative shock in the foam and an increased thermal smoothing effect. It seems viable for the critical-density foam buffered target to be driven by a relatively strong foot pulse with the goal of reducing the laser imprint and achieving better implosion symmetry in the direct-drive laser fusion.« less

Minimizing scatter-losses during pre-heat for magneto-inertial fusion targets

NASA Astrophysics Data System (ADS)

Geissel, Matthias; Harvey-Thompson, Adam J.; Awe, Thomas J.; Bliss, David E.; Glinsky, Michael E.; Gomez, Matthew R.; Harding, Eric; Hansen, Stephanie B.; Jennings, Christopher; Kimmel, Mark W.; Knapp, Patrick; Lewis, Sean M.; Peterson, Kyle; Schollmeier, Marius; Schwarz, Jens; Shores, Jonathon E.; Slutz, Stephen A.; Sinars, Daniel B.; Smith, Ian C.; Speas, C. Shane; Vesey, Roger A.; Weis, Matthew R.; Porter, John L.

2018-02-01

The size, temporal and spatial shape, and energy content of a laser pulse for the pre-heat phase of magneto-inertial fusion affect the ability to penetrate the window of the laser-entrance-hole and to heat the fuel behind it. High laser intensities and dense targets are subject to laser-plasma-instabilities (LPI), which can lead to an effective loss of pre-heat energy or to pronounced heating of areas that should stay unexposed. While this problem has been the subject of many studies over the last decades, the investigated parameters were typically geared towards traditional laser driven Inertial Confinement Fusion (ICF) with densities either at 10% and above or at 1% and below the laser's critical density, electron temperatures of 3-5 keV, and laser powers near (or in excess of) 1 × 1015 W/cm2. In contrast, Magnetized Liner Inertial Fusion (MagLIF) [Slutz et al., Phys. Plasmas 17, 056303 (2010) and Slutz and Vesey, Phys. Rev. Lett. 108, 025003 (2012)] currently operates at 5% of the laser's critical density using much thicker windows (1.5-3.5 μm) than the sub-micron thick windows of traditional ICF hohlraum targets. This article describes the Pecos target area at Sandia National Laboratories using the Z-Beamlet Laser Facility [Rambo et al., Appl. Opt. 44(12), 2421 (2005)] as a platform to study laser induced pre-heat for magneto-inertial fusion targets, and the related progress for Sandia's MagLIF program. Forward and backward scattered light were measured and minimized at larger spatial scales with lower densities, temperatures, and powers compared to LPI studies available in literature.

The LICPA-driven collider—a novel efficient tool for the production of ultra-high pressures in condensed media

NASA Astrophysics Data System (ADS)

Badziak, J.; Krousky, E.; Kucharik, M.; Liska, R.

2016-03-01

Generation of strong shock waves for the production of Mbar or Gbar pressures is a topic of high relevance for contemporary research in various domains, including inertial confinement fusion, laboratory astrophysics, planetology and material science. The pressures in the multi-Mbar range can be produced by the shocks generated using chemical explosions, light-gas guns, Z-pinch machines or lasers. Higher pressures, in the sub-Gbar or Gbar range are attainable only with nuclear explosions or laser-based methods. Unfortunately, due to the low efficiency of energy conversion from a laser to the shock (below a few percent), multi-kJ, multi-beam lasers are needed to produce such pressures with these methods. Here, we propose and investigate a novel scheme for generating high-pressure shocks which is much more efficient than the laser-based schemes known so far. In the proposed scheme, the shock is generated in a dense target by the impact of a fast projectile driven by the laser-induced cavity pressure acceleration (LICPA) mechanism. Using two-dimensional hydrodynamic simulations and the measurements performed at the kilojoule PALS laser facility it is shown that in the LICPA-driven collider the laser-to-shock energy conversion efficiency can reach a very high value ~ 15-20 % and, as a result, the shock pressure ~ 0.5-1 Gbar can be produced using lasers of energy <= 0.5 kJ. On the other hand, the pressures in the multi-Mbar range could be produced in this collider with low-energy (~ 10 J) lasers available on the market. It would open up the possibility of conducting research in high energy-density science also in small, university-class laboratories.

Magnetic reconnection driven by Gekko XII lasers with a Helmholtz capacitor-coil target

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pei, X. X.; University of Chinese Academy of Sciences, Beijing 100049; Zhong, J. Y., E-mail: jyzhong@bnu.edu.cn, E-mail: gzhao@bao.ac.cn

2016-03-15

We demonstrate a novel plasma device for magnetic reconnection, driven by Gekko XII lasers irradiating a double-turn Helmholtz capacitor-coil target. Optical probing revealed an accumulated plasma plume near the magnetic reconnection outflow. The background electron density and magnetic field were measured to be approximately 10{sup 18 }cm{sup −3} and 60 T by using Nomarski interferometry and the Faraday effect, respectively. In contrast with experiments on magnetic reconnection constructed by the Biermann battery effect, which produced high beta values, our beta value was much lower than one, which greatly extends the parameter regime of laser-driven magnetic reconnection and reveals its potential in astrophysicalmore » plasma applications.« less

Seeding magnetic fields for laser-driven flux compression in high-energy-density plasmas.

PubMed

Gotchev, O V; Knauer, J P; Chang, P Y; Jang, N W; Shoup, M J; Meyerhofer, D D; Betti, R

2009-04-01

A compact, self-contained magnetic-seed-field generator (5 to 16 T) is the enabling technology for a novel laser-driven flux-compression scheme in laser-driven targets. A magnetized target is directly irradiated by a kilojoule or megajoule laser to compress the preseeded magnetic field to thousands of teslas. A fast (300 ns), 80 kA current pulse delivered by a portable pulsed-power system is discharged into a low-mass coil that surrounds the laser target. A >15 T target field has been demonstrated using a <100 J capacitor bank, a laser-triggered switch, and a low-impedance (<1 Omega) strip line. The device has been integrated into a series of magnetic-flux-compression experiments on the 60 beam, 30 kJ OMEGA laser [T. R. Boehly et al., Opt. Commun. 133, 495 (1997)]. The initial application is a novel magneto-inertial fusion approach [O. V. Gotchev et al., J. Fusion Energy 27, 25 (2008)] to inertial confinement fusion (ICF), where the amplified magnetic field can inhibit thermal conduction losses from the hot spot of a compressed target. This can lead to the ignition of massive shells imploded with low velocity-a way of reaching higher gains than is possible with conventional ICF.

A Space Station tethered orbital refueling facility

NASA Technical Reports Server (NTRS)

Fester, D. A.; Rudolph, L. K.; Kiefel, E. R.

1985-01-01

A planned function of the Space Station is to refurbish and refuel an advanced space-based LO2/LH2 orbit transfer vehicle. An alternative to propellant storage at the station is to use a remote facility tied to the station with a long tether. Preliminary design of such a facility is described with emphasis on fluid transfer and storage requirements. Using tether lengths of at least 300 ft, gravity gradient forces will dominate surface tension in such a system. Although gravity driven transfer is difficult because of line pressure drops, fluid settling over the tank outlet greatly alleviates acquisition concerns and will facilitate vented tank fills. The major concern with a tethered orbital refueling facility is its considerable operational complexity including transport of the OTV to and from the facility.

The unique contributions of perceiver and target characteristics in person perception.

PubMed

Hehman, Eric; Sutherland, Clare A M; Flake, Jessica K; Slepian, Michael L

2017-10-01

Models of person perception have long asserted that our impressions of others are guided by characteristics of both the target and perceiver. However, research has not yet quantified to what extent perceivers and targets contribute to different impressions. This quantification is theoretically critical, as it addresses how much an impression arises from "our minds" versus "others' faces." Here, we apply cross-classified random effects models to address this fundamental question in social cognition, using approximately 700,000 ratings of faces. With this approach, we demonstrate that (a) different trait impressions have unique causal processes, meaning that some impressions are largely informed by perceiver-level characteristics whereas others are driven more by physical target-level characteristics; (b) modeling of perceiver- and target-variance in impressions informs fundamental models of social perception; (c) Perceiver × Target interactions explain a substantial portion of variance in impressions; (d) greater emotional intensity in stimuli decreases the influence of the perceiver; and (e) more variable, naturalistic stimuli increases variation across perceivers. Important overarching patterns emerged. Broadly, traits and dimensions representing inferences of character (e.g., dominance) are driven more by perceiver characteristics than those representing appearance-based appraisals (e.g., youthful-attractiveness). Moreover, inferences made of more ambiguous traits (e.g., creative) or displays (e.g., faces with less extreme emotions, less-controlled stimuli) are similarly driven more by perceiver than target characteristics. Together, results highlight the large role that perceiver and target variability play in trait impressions, and develop a new topography of trait impressions that considers the source of the impression. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

ELIMED: a new hadron therapy concept based on laser driven ion beams

NASA Astrophysics Data System (ADS)

Cirrone, Giuseppe A. P.; Margarone, Daniele; Maggiore, Mario; Anzalone, Antonello; Borghesi, Marco; Jia, S. Bijan; Bulanov, Stepan S.; Bulanov, Sergei; Carpinelli, Massimo; Cavallaro, Salvatore; Cutroneo, Mariapompea; Cuttone, Giacomo; Favetta, Marco; Gammino, Santo; Klimo, Ondrej; Manti, Lorenzo; Korn, Georg; La Malfa, Giuseppe; Limpouch, Jiri; Musumarra, Agatino; Petrovic, Ivan; Prokupek, Jan; Psikal, Jan; Ristic-Fira, Aleksandra; Renis, Marcella; Romano, Francesco P.; Romano, Francesco; Schettino, Giuseppe; Schillaci, Francesco; Scuderi, Valentina; Stancampiano, Concetta; Tramontana, Antonella; Ter-Avetisyan, Sargis; Tomasello, Barbara; Torrisi, Lorenzo; Tudisco, Salvo; Velyhan, Andriy

2013-05-01

Laser accelerated proton beams have been proposed to be used in different research fields. A great interest has risen for the potential replacement of conventional accelerating machines with laser-based accelerators, and in particular for the development of new concepts of more compact and cheaper hadrontherapy centers. In this context the ELIMED (ELI MEDical applications) research project has been launched by INFN-LNS and ASCR-FZU researchers within the pan-European ELI-Beamlines facility framework. The ELIMED project aims to demonstrate the potential clinical applicability of optically accelerated proton beams and to realize a laser-accelerated ion transport beamline for multi-disciplinary user applications. In this framework the eye melanoma, as for instance the uveal melanoma normally treated with 62 MeV proton beams produced by standard accelerators, will be considered as a model system to demonstrate the potential clinical use of laser-driven protons in hadrontherapy, especially because of the limited constraints in terms of proton energy and irradiation geometry for this particular tumour treatment. Several challenges, starting from laser-target interaction and beam transport development up to dosimetry and radiobiology, need to be overcome in order to reach the ELIMED final goals. A crucial role will be played by the final design and realization of a transport beamline capable to provide ion beams with proper characteristics in terms of energy spectrum and angular distribution which will allow performing dosimetric tests and biological cell irradiation. A first prototype of the transport beamline has been already designed and other transport elements are under construction in order to perform a first experimental test with the TARANIS laser system by the end of 2013. A wide international collaboration among specialists of different disciplines like Physics, Biology, Chemistry, Medicine and medical doctors coming from Europe, Japan, and the US is growing up around the ELIMED project with the aim to work on the conceptual design, technical and experimental realization of this core beamline of the ELI Beamlines facility.

40 CFR 745.82 - Applicability.

Code of Federal Regulations, 2011 CFR

2011-07-01

... child-occupied facilities, except for the following: (1) Renovations in target housing or child-occupied...) Renovations in target housing or child-occupied facilities in which a certified renovator, using an EPA... with significant damage. Interim controls performed in response to an elevated blood lead level in a...

Thermal and log-normal distributions of plasma in laser driven Coulomb explosions of deuterium clusters

NASA Astrophysics Data System (ADS)

Barbarino, M.; Warrens, M.; Bonasera, A.; Lattuada, D.; Bang, W.; Quevedo, H. J.; Consoli, F.; de Angelis, R.; Andreoli, P.; Kimura, S.; Dyer, G.; Bernstein, A. C.; Hagel, K.; Barbui, M.; Schmidt, K.; Gaul, E.; Donovan, M. E.; Natowitz, J. B.; Ditmire, T.

2016-08-01

In this work, we explore the possibility that the motion of the deuterium ions emitted from Coulomb cluster explosions is highly disordered enough to resemble thermalization. We analyze the process of nuclear fusion reactions driven by laser-cluster interactions in experiments conducted at the Texas Petawatt laser facility using a mixture of D2+3He and CD4+3He cluster targets. When clusters explode by Coulomb repulsion, the emission of the energetic ions is “nearly” isotropic. In the framework of cluster Coulomb explosions, we analyze the energy distributions of the ions using a Maxwell-Boltzmann (MB) distribution, a shifted MB distribution (sMB), and the energy distribution derived from a log-normal (LN) size distribution of clusters. We show that the first two distributions reproduce well the experimentally measured ion energy distributions and the number of fusions from d-d and d-3He reactions. The LN distribution is a good representation of the ion kinetic energy distribution well up to high momenta where the noise becomes dominant, but overestimates both the neutron and the proton yields. If the parameters of the LN distributions are chosen to reproduce the fusion yields correctly, the experimentally measured high energy ion spectrum is not well represented. We conclude that the ion kinetic energy distribution is highly disordered and practically not distinguishable from a thermalized one.

Novel target design for enhanced laser driven proton acceleration

NASA Astrophysics Data System (ADS)

Dalui, Malay; Kundu, M.; Tata, Sheroy; Lad, Amit D.; Jha, J.; Ray, Krishanu; Krishnamurthy, M.

2017-09-01

We demonstrate a simple method of preparing structured target for enhanced laser-driven proton acceleration under target-normal-sheath-acceleration scheme. A few layers of genetically modified, clinically grown micron sized E. Coli bacteria cell coated on a thin metal foil has resulted in an increase in the maximum proton energy by about 1.5 times and the total proton yield is enhanced by approximately 25 times compared to an unstructured reference foil at a laser intensity of 1019 W/cm2. Particle-in-cell simulations on the system shows that the structures on the target-foil facilitates anharmonic resonance, contributing to enhanced hot electron production which leads to stronger accelerating field. The effect is observed to grow as the number of structures is increased in the focal area of the laser pulse.

Data-driven risk models could help target pipeline safety inspections

DOT National Transportation Integrated Search

2008-07-01

Federal safety agencies share a common problemthe : need to target resources effectively to reduce risk. One : way this targeting is commonly done is with a risk model : that uses safety data along with expert judgment to identify : and weight ris...

Magnetic Flyer Facility Correlation and UGT Simulation

DTIC Science & Technology

1978-05-01

AND UGT SIMULATION (U) Kaman Sciences Corporation L ~ P.O. Box 7463 I Colorado Springs, Colcerado 80933 ý4 May 1978DC Final Report CONTRACT No. DNA O01...selected underground test ( UGT ) environment on 3DQP; and, (2) To correlate the magnetically driven flyer plate facilities of VKSC with those of the...tailored to matcb the pressure vs. time anid total impulse measurements obtained on UGT events. This matching of experi- mental data required considerable

Repetition rates in heavy ion beam driven fusion reactors

NASA Astrophysics Data System (ADS)

Peterson, Robert R.

1986-01-01

The limits on the cavity gas density required for beam propagation and condensation times for material vaporized by target explosions can determine the maximum repetition rate of Heavy Ion Beam (HIB) driven fusion reactors. If the ions are ballistically focused onto the target, the cavity gas must have a density below roughly 10-4 torr (3×1012 cm-3) at the time of propagation; other propagation schemes may allow densities as high as 1 torr or more. In some reactor designs, several kilograms of material may be vaporized off of the target chamber walls by the target generated x-rays, raising the average density in the cavity to 100 tor or more. A one-dimensional combined radiation hydrodynamics and vaporization and condensation computer code has been used to simulate the behavior of the vaporized material in the target chambers of HIB fusion reactors.

Dynamics of Laser-Driven Shock Waves in Solid Targets

NASA Astrophysics Data System (ADS)

Aglitskiy, Y.; Karasik, M.; Velikovich, A. L.; Serlin, V.; Weaver, J.; Schmitt, A. J.; Obenschain, S. P.; Grun, J.; Metzler, N.; Zalesak, S. T.; Gardner, J. H.; Oh, J.; Harding, E. C.

2009-11-01

Accurate shock timing is a key issue of both indirect- and direct-drive laser fusions. The experiments on the Nike laser at NRL presented here were made possible by improvements in the imaging capability of our monochromatic x-ray diagnostics based on Bragg reflection from spherically curved crystals. Side-on imaging implemented on Nike makes it possible to observe dynamics of the shock wave and ablation front in laser-driven solid targets. We can choose to observe a sequence of 2D images or a continuous time evolution of an image resolved in one spatial dimension. A sequence of 300 ps snapshots taken using vanadium backlighter at 5.2 keV reveals propagation of a shock wave in a solid plastic target. The shape of the shock wave reflects the intensity distribution in the Nike beam. The streak records with continuous time resolution show the x-t trajectory of a laser-driven shock wave in a 10% solid density DVB foam.

A pulsed supersonic gas jet target for precision spectroscopy at the HITRAP facility at GSI

NASA Astrophysics Data System (ADS)

Tiedemann, D.; Stiebing, K. E.; Winters, D. F. A.; Quint, W.; Varentsov, V.; Warczak, A.; Malarz, A.; Stöhlker, Th.

2014-11-01

A pulsed supersonic gas jet target for experiments at the HITRAP facility at the GSI Helmholtzzentrum für Schwerionenforschung in Darmstadt has been designed and built as a multi-purpose installation for key experiments on fundamental atomic physics in strong fields. This setup is currently installed at the Institut für Kernphysik of Goethe-University, Frankfurt am Main (IKF), in order to explore its operation prior to its installation at the HITRAP facility. Design and performance of the target are described. The measured target densities of 5.9×1012 atoms/cm3 for helium and 8.1×1012 atoms/cm³ for argon at the stagnation pressure of 30 bar match the required values. The target-beam diameter of 0.9 mm and the pulsed operation mode (jet built-up-time ≤15 ms) are well suited for the use at HITRAP.

Hybrid-drive implosion system for ICF targets

DOEpatents

Mark, James W.

1988-08-02

Hybrid-drive implosion systems (20,40) for ICF targets (10,22,42) are described which permit a significant increase in target gain at fixed total driver energy. The ICF target is compressed in two phases, an initial compression phase and a final peak power phase, with each phase driven by a separate, optimized driver. The targets comprise a hollow spherical ablator (12) surroundingly disposed around fusion fuel (14). The ablator is first compressed to higher density by a laser system (24), or by an ion beam system (44), that in each case is optimized for this initial phase of compression of the target. Then, following compression of the ablator, energy is directly delivered into the compressed ablator by an ion beam driver system (30,48) that is optimized for this second phase of operation of the target. The fusion fuel (14) is driven, at high gain, to conditions wherein fusion reactions occur. This phase separation allows hydrodynamic efficiency and energy deposition uniformity to be individually optimized, thereby securing significant advantages in energy gain. In additional embodiments, the same or separate drivers supply energy for ICF target implosion.

Hybrid-drive implosion system for ICF targets

DOEpatents

Mark, James W.

1988-01-01

Hybrid-drive implosion systems (20,40) for ICF targets (10,22,42) are described which permit a significant increase in target gain at fixed total driver energy. The ICF target is compressed in two phases, an initial compression phase and a final peak power phase, with each phase driven by a separate, optimized driver. The targets comprise a hollow spherical ablator (12) surroundingly disposed around fusion fuel (14). The ablator is first compressed to higher density by a laser system (24), or by an ion beam system (44), that in each case is optimized for this initial phase of compression of the target. Then, following compression of the ablator, energy is directly delivered into the compressed ablator by an ion beam driver system (30,48) that is optimized for this second phase of operation of the target. The fusion fuel (14) is driven, at high gain, to conditions wherein fusion reactions occur. This phase separation allows hydrodynamic efficiency and energy deposition uniformity to be individually optimized, thereby securing significant advantages in energy gain. In additional embodiments, the same or separate drivers supply energy for ICF target implosion.

Hybrid-drive implosion system for ICF targets

DOEpatents

Mark, J.W.K.

1987-10-14

Hybrid-drive implosion systems for ICF targets are described which permit a significant increase in target gain at fixed total driver energy. The ICF target is compressed in two phases, an initial compression phase and a final peak power phase, with each phase driven by a separate, optimized driver. The targets comprise a hollow spherical ablator surroundingly disposed around fusion fuel. The ablator is first compressed to higher density by a laser system, or by an ion beam system, that in each case is optimized for this initial phase of compression of the target. Then, following compression of the ablator, energy is directly delivered into the compressed ablator by an ion beam driver system that is optimized for this second phase of operation of the target. The fusion fuel is driven, at high gain, to conditions wherein fusion reactions occur. This phase separation allows hydrodynamic efficiency and energy deposition uniformity to be individually optimized, thereby securing significant advantages in energy gain. In additional embodiments, the same or separate drivers supply energy for ICF target implosion. 3 figs.

National Biomedical Tracer Facility: Project definition study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heaton, R.; Peterson, E.; Smith, P.

The Los Alamos National Laboratory is an ideal institution and New Mexico is an ideal location for siting the National Biomedical Tracer Facility (NBTF). The essence of the Los Alamos proposal is the development of two complementary irradiation facilities that combined with our existing radiochemical processing hot cell facilities and waste handling and disposal facilities provide a low cost alternative to other proposals that seek to satisfy the objectives of the NBTF. We propose the construction of a 30 MeV cyclotron facility at the site of the radiochemical facilities, and the construction of a 100 MeV target station at LAMPFmore » to satisfy the requirements and objectives of the NBTF. We do not require any modifications to our existing radiochemical processing hot cell facilities or our waste treatment and disposal facilities to accomplish the objectives of the NBTF. The total capital cost for the facility defined by the project definition study is $15.2 M. This cost estimate includes $9.9 M for the cyclotron and associated facility, $2.0 M for the 100 MeV target station at LAMPF, and $3.3 M for design.« less

Laser-driven planar Rayleigh-Taylor instability experiments

DOE Office of Scientific and Technical Information (OSTI.GOV)

Glendinning, S.G.; Weber, S.V.; Bell, P.

1992-08-24

We have performed a series of experiments on the Nova Laser Facility to examine the hydrodynamic behavior of directly driven planar foils with initial perturbations of varying wavelength. The foils were accelerated with a single, frequency doubled, smoothed and temporally shaped laser beam at 0.8{times}10{sup 14} W/cm{sup 2}. The experiments are in good agreement with numerical simulations using the computer codes LASNEX and ORCHID which show growth rates reduced to about 70% of classical for this nonlinear regime.

Recent progress on the National Ignition Facility advanced radiographic capability

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wegner, P.; Bowers, M.; Chen, H.

2016-01-08

The National Ignition Facility (NIF) is a megajoule (million-joule)-class laser and experimental facility built for Stockpile Stewardship and High Energy Density (HED) science research [1]. Up to several times a day, 192 laser pulses from NIF's 192 laser beamlines converge on a millimeter-scale target located at the center of the facility's 10-meter diameter target chamber. The carefully synchronized pulses, typically a few nanoseconds (billionths of a second) in duration and co-times to better than 20 picoseconds (trillionths of a second), a deliver a combined energy of up to 1.8 megajoules and a peak power of 500 terawatts (trillion watts). Furthermore,more » this drives temperatures inside the target to tens of millions of degrees and pressures to many billion times greater than Earth's atmosphere.« less

Retinotopy and attention to the face and house images in the human visual cortex.

PubMed

Wang, Bin; Yan, Tianyi; Ohno, Seiichiro; Kanazawa, Susumu; Wu, Jinglong

2016-06-01

Attentional modulation of the neural activities in human visual areas has been well demonstrated. However, the retinotopic activities that are driven by face and house images and attention to face and house images remain unknown. In the present study, we used images of faces and houses to estimate the retinotopic activities that were driven by both the images and attention to the images, driven by attention to the images, and driven by the images. Generally, our results show that both face and house images produced similar retinotopic activities in visual areas, which were only observed in the attention + stimulus and the attention conditions, but not in the stimulus condition. The fusiform face area (FFA) responded to faces that were presented on the horizontal meridian, whereas parahippocampal place area (PPA) rarely responded to house at any visual field. We further analyzed the amplitudes of the neural responses to the target wedge. In V1, V2, V3, V3A, lateral occipital area 1 (LO-1), and hV4, the neural responses to the attended target wedge were significantly greater than those to the unattended target wedge. However, in LO-2, ventral occipital areas 1 and 2 (VO-1 and VO-2) and FFA and PPA, the differences were not significant. We proposed that these areas likely have large fields of attentional modulation for face and house images and exhibit responses to both the target wedge and the background stimuli. In addition, we proposed that the absence of retinotopic activity in the stimulus condition might imply no perceived difference between the target wedge and the background stimuli.

Calculations of high-power production target and beamdump for the GSI future Super-FRS for a fast extraction scheme at the FAIR Facility

NASA Astrophysics Data System (ADS)

Tahir, N. A.; Weick, H.; Iwase, H.; Geissel, H.; Hoffmann, D. H. H.; Kindler, B.; Lommel, B.; Radon, T.; Münzenberg, G.; Shutov, A.; Sümmerer, K.; Winkler, M.

2005-06-01

A superconducting fragment separator (Super-FRS) is being designed for the production and separation of radioactive isotopes at the future FAIR (Facility for Antiprotons and Ion Research) facility at Darmstadt. This paper discusses various aspects and requirements for the high-power production target that will be used in the Super-FRS experiments. The production target must survive over an extended period of time as it will be used during the course of many experiments. The specific power deposited by the high intensity beam that will be generated at the future FAIR facility will be high enough to destroy the target in most of the cases as a result of a single shot from the new heavy ion synchrotrons SIS100/300. By using an appropriate beam intensity and focal spot parameters, the target would survive after being irradiated once. However, the heat should be dissipated efficiently before the same target area is irradiated again. We have considered a wheel shaped solid carbon target that rotates around its axis so that different areas of the target are irradiated successively. This allows for cooling of the beam heated region by thermal conduction before the same part of the target is irradiated a second time. Another attractive option is to use a liquid jet target at the Super-FRS. First calculations of a possible liquid lithium target are also presented in this paper. One of the advantages of using lithium as a target is that it will survive even if one uses a smaller focal spot, which has half the area of that used for a solid carbon target. This will significantly improve the isotope resolution. A similar problem associated with these experiments will be safe deposition of the beam energy in a beamdump after its interaction with the production target. We also present calculations to study the suitability of a proposed beamdump.

The RIB production target for the SPES project

NASA Astrophysics Data System (ADS)

Monetti, Alberto; Andrighetto, Alberto; Petrovich, Carlo; Manzolaro, Mattia; Corradetti, Stefano; Scarpa, Daniele; Rossetto, Francesco; Martinez Dominguez, Fernando; Vasquez, Jesus; Rossignoli, Massimo; Calderolla, Michele; Silingardi, Roberto; Mozzi, Aldo; Borgna, Francesca; Vivian, Gianluca; Boratto, Enrico; Ballan, Michele; Prete, Gianfranco; Meneghetti, Giovanni

2015-10-01

Facilities making use of the Isotope Separator On-Line (ISOL) method for the production of Radioactive Ion Beams (RIB) attract interest because they can be used for nuclear structure and reaction studies, astrophysics research and interdisciplinary applications. The ISOL technique is based on the fast release of the nuclear reaction products from the chosen target material together with their ionization into short-lived nuclei beams. Within this context, the SPES (Selective Production of Exotic Species) facility is now under construction in Italy at INFN-LNL (Istituto Nazionale di Fisica Nucleare — Laboratori Nazionali di Legnaro). The SPES facility will produce RIBs mainly from n-rich isotopes obtained by a 40 MeV cyclotron proton beam (200 μA) directly impinging on a uranium carbide multi-foil fission target. The aim of this work is to describe and update, from a comprehensive point of view, the most important results obtained by the analysis of the on-line behavior of the SPES production target assembly. In particular an improved target configuration has been studied by comparing different codes and physics models: the thermal analyses and the isotope production are re-evaluated. Then some consequent radioprotection aspects, which are essential for the installation and operation of the facility, are presented.

Computational challenges in atomic, molecular and optical physics.

PubMed

Taylor, Kenneth T

2002-06-15

Six challenges are discussed. These are the laser-driven helium atom; the laser-driven hydrogen molecule and hydrogen molecular ion; electron scattering (with ionization) from one-electron atoms; the vibrational and rotational structure of molecules such as H(3)(+) and water at their dissociation limits; laser-heated clusters; and quantum degeneracy and Bose-Einstein condensation. The first four concern fundamental few-body systems where use of high-performance computing (HPC) is currently making possible accurate modelling from first principles. This leads to reliable predictions and support for laboratory experiment as well as true understanding of the dynamics. Important aspects of these challenges addressable only via a terascale facility are set out. Such a facility makes the last two challenges in the above list meaningfully accessible for the first time, and the scientific interest together with the prospective role for HPC in these is emphasized.

Iron Opacity Platform Performance Characterization at the National Ignition Facility

NASA Astrophysics Data System (ADS)

Opachich, Y. P.; Ross, P. W.; Heeter, R. F.; Barrios, M. A.; Liedahl, D. A.; May, M. J.; Schneider, M. B.; Craxton, R. S.; Garcia, E. M.; McKenty, P. W.; Zhang, R.; Weaver, J. L.; Flippo, K. A.; Kline, J. L.; Perry, T. S.; Los Alamos National Laboratory Collaboration; Naval Research Laboratory Collaboration; University of Rochester LaboratoryLaser Energetics Collaboration; Lawrence Livermore National Lab Collaboration; National Security Technologies, LLC Collaboration

2016-10-01

A high temperature opacity platform has been fielded at the National Ignition Facility (NIF). The platform will be used to study opacity in iron at a temperature of 160 eV. The platform uses a 6 mm diameter hohlraum driven by 128 laser beams with 530 kJ of energy in a 3 ns pulse to heat an iron sample. Absorption spectra of the heated sample are generated with a broadband pulsed X-ray backlighter produced by imploding a vacuum-filled CH shell. The shell is 2 mm in diameter and 20 microns thick, driven by 64 beams with 250 kJ in a 2.5 ns pulse. The hohlraum and backlighter performance have both been investigated recently and will be discussed in this presentation. This work was performed by National Security Technologies, LLC, under Contract No. DE-AC52-06NA25946 with the U.S. Department of Energy. DOE/NV/25946-2892.

The National Ignition Facility: Transition to a User Facility

NASA Astrophysics Data System (ADS)

Moses, E. I.; Atherton, J.; Lagin, L.; Larson, D.; Keane, C.; MacGowan, B.; Patterson, R.; Spaeth, M.; Van Wonterghem, B.; Wegner, P.; Kauffman, R.

2016-03-01

The National Ignition Facility (NIF) at Lawrence Livermore National Laboratory (LLNL) has been operational since March 2009 and has been transitioning to a user facility supporting ignition science, high energy density science (HEDS), national security applications, and fundamental science. The facility has achieved its design goal of 1.8 MJ and 500 TW of 3ω light on target, and has performed target experiments with 1.9 MJ at peak powers of 410 TW. The facility is on track to perform over 200 target shots this year in support of all of its user communities. The facility has nearly 60 diagnostic systems operational and has shown flexibility in laser pulse shape and performance to meet the requirements of its multiple users. Progress continues on its goal of demonstrating thermonuclear burn in the laboratory. It has performed over 40 indirect-drive experiments with cryogenic-layered capsules. New platforms are being developed for HEDS and fundamental science. Equation-of-state and material strength experiments have been done on a number of materials with pressures of over 50 MBars obtained in diamond, conditions never previously encountered in the laboratory and similar to those found in planetary interiors. Experiments are also in progress investigating radiation transport, hydrodynamic instabilities, and direct drive implosions. NIF continues to develop as an experimental facility. Advanced Radiographic Capability (ARC) is now being installed on NIF for producing high-energy radiographs of the imploded cores of ignition targets and for short pulse laser-plasma interaction experiments. One NIF beam is planned for conversion to two picosecond beams in 2014. Other new diagnostics such as x-ray Thomson scattering, low energy neutron spectrometer, and multi-layer reflecting x-ray optics are also planned. Incremental improvements in laser performance such as improved optics damage performance, beam balance, and back reflection control are being pursued.

Production of medical radioactive isotopes using KIPT electron driven subcritical facility.

PubMed

Talamo, Alberto; Gohar, Yousry

2008-05-01

Kharkov Institute of Physics and Technology (KIPT) of Ukraine in collaboration with Argonne National Laboratory (ANL) has a plan to construct an electron accelerator driven subcritical assembly. One of the facility objectives is the production of medical radioactive isotopes. This paper presents the ANL collaborative work performed for characterizing the facility performance for producing medical radioactive isotopes. First, a preliminary assessment was performed without including the self-shielding effect of the irradiated samples. Then, more detailed investigation was carried out including the self-shielding effect, which defined the sample size and location for producing each medical isotope. In the first part, the reaction rates were calculated as the multiplication of the cross section with the unperturbed neutron flux of the facility. Over fifty isotopes have been considered and all transmutation channels are used including (n, gamma), (n, 2n), (n, p), and (gamma, n). In the second part, the parent isotopes with high reaction rate were explicitly modeled in the calculations. Four irradiation locations were considered in the analyses to study the medical isotope production rate. The results show the self-shielding effect not only reduces the specific activity but it also changes the irradiation location that maximizes the specific activity. The axial and radial distributions of the parent capture rates have been examined to define the irradiation sample size of each parent isotope.

Radiological Aspects of Heavy Metal Liquid Targets for Accelerator-Driven Systems as Intense Neutron Sources

NASA Astrophysics Data System (ADS)

Gai, E. V.; Ignatyuk, A. V.; Lunev, V. P.; Shubin, Yu. N.

2001-11-01

General problems arising in development of intense neutron sources as a part of accelerator-driven systems and first experience accumulated in IPPE during last several years are briefly discussed. The calculation and analysis of nuclear-physical properties of the targets, such as the accumulation of spallation reaction products, activity and heat release for various versions of heavy liquid metal targets were performed in IPPE. The sensitivity of the results of calculations to the various sets of nuclear data was considered. The main radiology characteristics of the lead-bismuth target, which is now under construction in the frame of ISTC Project # 559, are briefly described. The production of short-lived nuclides was estimated, the total activity and volatile nuclide accumulation, residual heat release, the energies of various decay modes were analysed.

Isochoric heating and strong blast wave formation driven by fast electrons in solid-density targets

NASA Astrophysics Data System (ADS)

Santos, J. J.; Vauzour, B.; Touati, M.; Gremillet, L.; Feugeas, J.-L.; Ceccotti, T.; Bouillaud, R.; Deneuville, F.; Floquet, V.; Fourment, C.; Hadj-Bachir, M.; Hulin, S.; Morace, A.; Nicolaï, Ph; d'Oliveira, P.; Reau, F.; Samaké, A.; Tcherbakoff, O.; Tikhonchuk, V. T.; Veltcheva, M.; Batani, D.

2017-10-01

We experimentally investigate the fast (< 1 {ps}) isochoric heating of multi-layer metallic foils and subsequent high-pressure hydrodynamics induced by energetic electrons driven by high-intensity, high-contrast laser pulses. The early-time temperature profile inside the target is measured from the streaked optical pyrometry of the target rear side. This is further characterized from benchmarked simulations of the laser-target interaction and the fast electron transport. Despite a modest laser energy (< 1 {{J}}), the early-time high pressures and associated gradients launch inwards a strong compression wave developing over ≳ 10 ps into a ≈ 140 {Mbar} blast wave, according to hydrodynamic simulations, consistent with our measurements. These experimental and numerical findings pave the way to a short-pulse-laser-based platform dedicated to high-energy-density physics studies.

Color temperature measurement in laser-driven shock waves

NASA Astrophysics Data System (ADS)

Hall, T. A.; Benuzzi, A.; Batani, D.; Beretta, D.; Bossi, S.; Faral, B.; Koenig, M.; Krishnan, J.; Löautwer, Th.; Mahdieh, M.

1997-06-01

A simultaneous measurement of color temperature and shock velocity in laser-driven shocks is presented. The color temperature was measured from the target rear side emissivity, and the shock velocity by using stepped targets. A very good planarity of the shock was ensured by the phase zone plate smoothing technique. A simple model of the shock luminosity has been developed in order to estimate the shock temperature from the experimental rear side emissivity. Results have been compared to temperatures obtained from the shock velocity for a material of a known equation of state.

Proposed BISOL Facility - a Conceptual Design

NASA Astrophysics Data System (ADS)

Ye, Yanlin

2018-05-01

In China, a new large-scale nuclear-science research facility, namely the "Beijing Isotope-Separation-On-Line neutron-rich beam facility (BISOL)", has been proposed and reviewed by the governmental committees. This facility aims at both basic science and application goals, and is based on a double-driver concept. On the basic science side, the radioactive ion beams produced from the ISOL device, driven by a research reactor or by an intense deuteron-beam ac- celerator, will be used to study the new physics and technologies at the limit of the nuclear stability in the medium mass region. On the other side regarding to the applications, the facility will be devoted to the material research asso- ciated with the nuclear energy system, by using typically the intense neutron beams produced from the deuteron-accelerator driver. The initial design will be outlined in this report.

Extraterrestrial Virtual Field Experience: Water at Meridiani

NASA Astrophysics Data System (ADS)

Duggan-Haas, D.; Million, C.; Sullivan, R. J., Jr.; Hayes, A. G., Jr.; Ross, R. M.; St Clair, M.

2014-12-01

The Spacecraft Planetary Imaging Facility (SPIF) at Cornell University, in collaboration with Million Concepts and the Paleontological Research Institute (PRI), has developed the Extraterrestrial Virtual Field Experience (EVFE), a web-based, game-like and inquiry-driven classroom activity targeted to middle school through undergraduate introductory Earth science classrooms. Students play the role of mission scientists for a NASA rover mission, tasked with targeting the rover's scientific instruments to investigate a specific scientific question about the landing site. As with the real mission, the student operators must optimize the efficient use of limited resources and time against the need to make observations to address working hypotheses. The activity uses only real--not artificial or simulated--mission data, and students are guided throughout by a "Mission Manager" who provides hints and advice about the scientific meaning of observations within the broader context of the mission objectives. The MER Opportunity EVFE is a pilot effort, the first of five EVFE modules planned a rate of one per year that will feature different NASA missions and scientific topics. The MER Opportunity EVFE has already been developed and focuses on the investigation of the history of water on Mars at the Meridiani landing site of the Opportunity rover. The module includes a teacher guide and is currently available to educators through the SPIF website.

Drug-Coated Balloon Treatment of Femoropopliteal Lesions for Patients With Intermittent Claudication and Ischemic Rest Pain: 2-Year Results From the IN.PACT Global Study.

PubMed

Micari, Antonio; Brodmann, Marianne; Keirse, Koen; Peeters, Patrick; Tepe, Gunnar; Frost, Martin; Wang, Hong; Zeller, Thomas

2018-05-28

The IN.PACT Global Study is the largest prospective, multicenter, independently adjudicated trial to evaluate a paclitaxel drug-coated balloon in patients with lifestyle-limiting claudication and/or ischemic rest pain due to atherosclerotic disease of the femoropopliteal artery and includes complex lesions beyond what are typically included in randomized controlled trials. Randomized controlled trials have demonstrated the safety and efficacy of drug-coated balloons for the treatment of Trans-Atlantic Inter-Society Consensus Document II A and B lesions, but there is a need for large-scale prospective studies to evaluate a broader range of lesions. The IN.PACT Global Study enrolled 1,535 subjects, and 1,406 (1,773 lesions) were included in the pre-defined clinical cohort analysis. Freedom from clinically driven target lesion revascularization was evaluated at 24 months. The safety composite endpoint was freedom from device- and procedure-related death through 30 days and freedom from target limb major amputation and clinically driven target vessel revascularization within 24 months. Mean lesion length was 12.1 cm, 35.5% were total occlusions, and 18.0% had in-stent restenosis. Freedom from clinically driven target lesion revascularization at 24 months was 83.3%, the composite safety endpoint was met in 81.7%, the 2-year all-cause mortality rate was 7.0%, and the major target limb amputation rate was 0.7%. Increased lesion length and the presence of de novo in-stent restenosis or coronary artery disease were associated with increased risk for clinically driven target lesion revascularization by 24 months. This real-world study of femoropopliteal artery disease treatment with drug-coated balloons confirmed positive findings reported from more strictly designed randomized controlled trials and showed that outcomes are durable in this population up to 2 years after treatment. (IN.PACT Global Clinical Study; NCT01609296). Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Tamper asymmetry and its effect on transmission for x-ray driven opacity simulations

NASA Astrophysics Data System (ADS)

Morris, H. E.; Tregillis, I. L.; Hoffman, N. M.; Sherrill, M. E.; Fontes, C. J.; Marshall, A. J.; Urbatsch, T. J.; Bradley, P. A.

2017-09-01

This paper reports on synthetic transmission results from Lasnex [Zimmerman and Kruer, Comments Plasma Phys. 2, 51 (1975)] radiation-hydrodynamics simulations of opacity experiments carried out at Sandia National Laboratories' recently upgraded ZR facility. The focus is on experiments utilizing disk targets composed of a half-moon Fe/Mg mixture tamped on either end with 10-μm CH and an additional 35-μm beryllium tamper accessory on the end facing the spectrometer. Five x-ray sources with peak power ranging from 10 to 24 TW were used in the simulations to heat and backlight the opacity target. The dominant effect is that the beryllium behind the Fe/Mg mixture is denser and more opaque than the beryllium unshielded by metal during the times of greatest importance for the transmission measurement for all drives. This causes the simulated transmission to be lower than expected, and this is most pronounced for the case using the lowest drive power. While beryllium has a low opacity, its areal density is sufficiently high such that the expected reduction of the measured transmission is significant. This situation leads to an overestimate of iron opacity by 10%-215% for a photon energy range of 975-1775 eV for the 10-TW case. It is shown that if the tamper conditions are known, the transmission through each component of the target can be calculated and the resulting opacity can be corrected.

Increase of stagnation pressure and enthalpy in shock tunnels

NASA Technical Reports Server (NTRS)

Bogdanoff, David W.; Cambier, Jean-Luc

1992-01-01

High stagnation pressures and enthalpies are required for the testing of aerospace vehicles such as aerospace planes, aeroassist vehicles, and reentry vehicles. Among the most useful ground test facilities for performing such tests are shock tunnels. With a given driver gas condition, the enthalpy and pressure in the driven tube nozzle reservoir condition can be varied by changing the driven tube geometry and initial gas fill pressure. Reducing the driven tube diameter yields only very modest increases in reservoir pressure and enthalpy. Reducing the driven tube initial gas fill pressure can increase the reservoir enthalpy significantly, but at the cost of reduced reservoir pressure and useful test time. A new technique, the insertion of a converging section in the driven tube is found to produce substantial increases in both reservoir pressure and enthalpy. Using a one-dimensional inviscid full kinetics code, a number of different locations and shapes for the converging driven tube section were studied and the best cases found. For these best cases, for driven tube diameter reductions of factors of 2 and 3, the reservoir pressure can be increased by factors of 2.1 and 3.2, respectively and the enthalpy can be increased by factors of 1.5 and 2.1, respectively.

Do resource utilization and clinical measures still vary across dialysis chains after controlling for the local practices of facilities and physicians?

PubMed

Hirth, Richard A; Turenne, Marc N; Wheeler, John R C; Ma, Yu; Messana, Joseph M

2010-08-01

Because of adverse survival effects, anemia management and financial incentives to increase doses of erythropoiesis-stimulating agents (ESAs) have been controversial. Prior studies showed more aggressive anemia management in dialysis facilities owned by for-profit chains, but have been criticized for not accounting for practices of individual physicians and facilities. To improve understanding of how dialysis practices and resource utilization are influenced by physicians, facilities, and chains. Mixed models with chain fixed effects and facility and physician random effects. Medicare hemodialysis patients in 2004. A total of 234,158 patients, 3995 facilities, 4838 physicians, and 7 chain classifications were included. Spending per session for dialysis-related services billed separately from the dialysis treatment and for ESAs. Achievement of hematocrit (HCT) and urea reduction ratio (URR) targets. Of the 4 largest for-profit chains, 3 had higher resource use than independents, with differences up to $17.92 higher ESA/session. Utilization was positively associated with achieving target HCT. Despite incurring lower costs, patients treated by a large nonprofit chain were as likely as patients of independents to achieve the HCT target. The largest chains were more likely than independents to achieve the URR target. Substantial variation occurred across physicians and facilities, and adjustment for chain only modestly decreased this variation. Chains' methods of influencing practices were not directly observed. Chains appear to have the ability to implement protocols that shift practices, but not the ability to substantially reduce local variation. Assertions that chain effects found by earlier studies were spurious are not supported.

76 FR 77814 - Cameron LNG, LLC; Notice of Intent To Prepare an Environmental Assessment for the Proposed BOG...

Federal Register 2010, 2011, 2012, 2013, 2014

2011-12-14

... facilities: An electric-motor driven centrifugal refrigeration compressor; A cryogenic plate-fin heat... choose to appeal the Commission's final ruling. An intervenor formally participates in the proceeding by...

Computer-implemented security evaluation methods, security evaluation systems, and articles of manufacture

DOEpatents

Muller, George; Perkins, Casey J.; Lancaster, Mary J.; MacDonald, Douglas G.; Clements, Samuel L.; Hutton, William J.; Patrick, Scott W.; Key, Bradley Robert

2015-07-28

Computer-implemented security evaluation methods, security evaluation systems, and articles of manufacture are described. According to one aspect, a computer-implemented security evaluation method includes accessing information regarding a physical architecture and a cyber architecture of a facility, building a model of the facility comprising a plurality of physical areas of the physical architecture, a plurality of cyber areas of the cyber architecture, and a plurality of pathways between the physical areas and the cyber areas, identifying a target within the facility, executing the model a plurality of times to simulate a plurality of attacks against the target by an adversary traversing at least one of the areas in the physical domain and at least one of the areas in the cyber domain, and using results of the executing, providing information regarding a security risk of the facility with respect to the target.

Simulations for the future converter of the e-linac for the TRIUMF ARIEL facility

NASA Astrophysics Data System (ADS)

Lebois, M.; Bricault, P.

2011-09-01

In the next years, TRIUMF activity will be focused on building a new facility to produce very intense neutron rich radioactive ion beams. Unlike others ISOL facilities, the e-linac primary beam, that will induce the fission, is an intense electron beam (50 MeV energy and 10 mA intensity). This challenging choice, which make this installation unique, despite the ALTO facility, makes an average fission rate of 1013-14fissions/s in the target.This beam is sent on an uranium carbide target (UCx), but due to its power, it is essential to insert a "converter" on the beam path to avoid a target overheating. The purpose of this converter is to convert electrons into Bremsstralhung radiation. The γ rays produce excite the dipole resonance of 23892U (15 MeV) inducing fission. Energy deposition, fission rate and thermal behavior were simulated using Monte Carlo techniques are presented in this paper

LLE Review Quarterly Report July-September 2000

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

2000-12-01

This volume of the LLE Review, covering July-September 2000, begins with an article by T. R. Boehly, V. N. Goncharov, O. Gotchev, J. P. Knauer, D. D. Meyerhofer, D. Oron, S. P. Regan, Y. Srebro, W. Seka, D. Shvarts, S. Skupsky, and V.A. Smalyuk, who describe measurements of the effect of beam smoothing and pulse shape on imprinting. (Imprinting is defined as the imposition of pressure perturbations on the target by spatial variations in the laser intensity.) A principal result is the observation of reduced levels of imprint with the higher beam smoothing afforded by 1-THz smoothing by spectral dispersionmore » (SSD). Additional highlights of research presented in this issue are: (1) P. W. McKenty, V. N. Goncharov, R. P. J. Town, S. Skupsky, R. Betti, and R. L. McCrory describe calculations of directly driven ignition capsule performance on the National Ignition Facility (NIF). The authors detail how the various contributors to implosion disruption (laser imprint, power imbalance, and target roughness) affect target performance and final gain. The conclusions are obtained by examining the simulated target evolution with the two-dimensional hydrodynamics computer code ORCHID. (2) D. D. Meyerhofer, J. A. Delettrez, R. Epstein, V. Yu. Glebov, V. N. Goncharov, R. L. Keck, R. L. McCrory, P. W. McKenty, F. J. Marshall, P. B. Radha, S. P. Regan, S. Roberts, W. Seka, S. Skupsky, V. A. Smalyuk, C. Sorce, C. Stoeckl, J. M. Soures, R. P. J. Town, B. Yaakobi, J. D. Zuegel, J. Frenje, C. K. L1,R. D. Petrasso, F. Seguin, K. Fletcher, S. Padalino, C. Freeman, N. Izumi, R. Lerche, T. W. Phillips, and T. C. Sangster describe the results of a series of direct-drive implosions of gas-fusion-fuel-filled plastic shells performed on the OMEGA laser system. The experiments include those performed with 1-THZ SSD and high-quality power balance. (3) V. Yu. Glebov, D. D. Meyerhofer, C. Stoeckl, and J. D. Zuegel describe the technique of measuring secondary neutron yield (DT neutron yield from D{sub 2}-filled targets) using current-mode detectors (i.e., many detection events per unit time interval). They show that current-mode detectors can be configured to survey a much larger dynamic range than single-event neutron counters. (4) V. A. Smalyuk, T. R. Boehly, L. S. Iwan, T. J. Kessler, J. P. Knauer, F. J. Marshall, D. D. Meyerhofer, C. Stoeckl, B. Yaakobi, and D. K. Bradley detail a method of measuring the positional dependence of x-ray self-absorption with filtered x-ray framing cameras. They show how compressed shell nonuniformities can be measured by carefully modeling the imaging system. This volume concludes with the LLE's Summer High School Research Program, the FY00 Laser Facility Report, and the National Laser Users' Facility News.« less

Measuring Energy Scaling of Laser Driven Magnetic Fields

NASA Astrophysics Data System (ADS)

Williams, Jackson; Goyon, Clement; Mariscal, Derek; Pollock, Brad; Patankar, Siddharth; Moody, John

2016-10-01

Laser-driven magnetic fields are of interest in particle confinement, fast ignition, and ICF platforms as an alternative to pulsed power systems to achieve many times higher fields. A comprehensive model describing the mechanism responsible for creating and maintaining magnetic fields from laser-driven coils has not yet been established. Understanding the scaling of key experimental parameters such as spatial and temporal uniformity and duration are necessary to implement coil targets in practical applications yet these measurements prove difficult due to the highly transient nature of the fields. We report on direct voltage measurements of laser-driven coil targets in which the laser energy spans more than four orders of magnitude. Results suggest that at low energies, laser-driven coils can be modeled as an electric circuit; however, at higher energies plasma effects dominate and a simple circuit treatment is insufficient to describe all observed phenomenon. The favorable scaling with laser power and pulse duration, observed in the present study and others at kilojoule energies, has positive implications for sustained, large magnetic fields for applications on the NIF. This work was performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.

Implementing a user-driven online quality improvement toolkit for cancer care.

PubMed

Luck, Jeff; York, Laura S; Bowman, Candice; Gale, Randall C; Smith, Nina; Asch, Steven M

2015-05-01

Peer-to-peer collaboration within integrated health systems requires a mechanism for sharing quality improvement lessons. The Veterans Health Administration (VA) developed online compendia of tools linked to specific cancer quality indicators. We evaluated awareness and use of the toolkits, variation across facilities, impact of social marketing, and factors influencing toolkit use. A diffusion of innovations conceptual framework guided the collection of user activity data from the Toolkit Series SharePoint site and an online survey of potential Lung Cancer Care Toolkit users. The VA Toolkit Series site had 5,088 unique visitors in its first 22 months; 5% of users accounted for 40% of page views. Social marketing communications were correlated with site usage. Of survey respondents (n = 355), 54% had visited the site, of whom 24% downloaded at least one tool. Respondents' awareness of the lung cancer quality performance of their facility, and facility participation in quality improvement collaboratives, were positively associated with Toolkit Series site use. Facility-level lung cancer tool implementation varied widely across tool types. The VA Toolkit Series achieved widespread use and a high degree of user engagement, although use varied widely across facilities. The most active users were aware of and active in cancer care quality improvement. Toolkit use seemed to be reinforced by other quality improvement activities. A combination of user-driven tool creation and centralized toolkit development seemed to be effective for leveraging health information technology to spread disease-specific quality improvement tools within an integrated health care system. Copyright © 2015 by American Society of Clinical Oncology.

Novel neutron sources at the Radiological Research Accelerator Facility

PubMed Central

Xu, Yanping; Garty, Guy; Marino, Stephen A.; Massey, Thomas N.; Randers-Pehrson, Gerhard; Johnson, Gary W.; Brenner, David J.

2012-01-01

Since the 1960s, the Radiological Research Accelerator Facility (RARAF) has been providing researchers in biology, chemistry and physics with advanced irradiation techniques, using charged particles, photons and neutrons. We are currently developing a unique facility at RARAF, to simulate neutron spectra from an improvised nuclear device (IND), based on calculations of the neutron spectrum at 1.5 km from the epicenter of the Hiroshima atom bomb. This is significantly different from a standard fission spectrum, because the spectrum changes as the neutrons are transported through air, and is dominated by neutron energies between 0.05 and 8 MeV. This facility will be based on a mixed proton/deuteron beam impinging on a thick beryllium target. A second, novel facility under development is our new neutron microbeam. The neutron microbeam will, for the first time, provide a kinematically collimated neutron beam, 10–20 micron in diameter. This facility is based on a Proton Microbeam, impinging on a thin lithium target near the threshold of the 7Li(p,n)7Be reaction. This novel neutron microbeam will enable studies of neutron damage to small targets, such as single cells, individual organs within small animals or microelectronic components. PMID:22545061

Novel neutron sources at the Radiological Research Accelerator Facility.

PubMed

Xu, Yanping; Garty, Guy; Marino, Stephen A; Massey, Thomas N; Randers-Pehrson, Gerhard; Johnson, Gary W; Brenner, David J

2012-03-16

Since the 1960s, the Radiological Research Accelerator Facility (RARAF) has been providing researchers in biology, chemistry and physics with advanced irradiation techniques, using charged particles, photons and neutrons.We are currently developing a unique facility at RARAF, to simulate neutron spectra from an improvised nuclear device (IND), based on calculations of the neutron spectrum at 1.5 km from the epicenter of the Hiroshima atom bomb. This is significantly different from a standard fission spectrum, because the spectrum changes as the neutrons are transported through air, and is dominated by neutron energies between 0.05 and 8 MeV. This facility will be based on a mixed proton/deuteron beam impinging on a thick beryllium target.A second, novel facility under development is our new neutron microbeam. The neutron microbeam will, for the first time, provide a kinematically collimated neutron beam, 10-20 micron in diameter. This facility is based on a Proton Microbeam, impinging on a thin lithium target near the threshold of the (7)Li(p,n)(7)Be reaction. This novel neutron microbeam will enable studies of neutron damage to small targets, such as single cells, individual organs within small animals or microelectronic components.

Novel neutron sources at the Radiological Research Accelerator Facility

DOE PAGES

Xu, Yanping; Garty, G.; Marino, S. A.; ...

2012-03-16

Since the 1960s, the Radiological Research Accelerator Facility (RARAF) has been providing researchers in biology, chemistry and physics with advanced irradiation techniques, using charged particles, photons and neutrons. We are currently developing a unique facility at RARAF, to simulate neutron spectra from an improvised nuclear device (IND), based on calculations of the neutron spectrum at 1.5 km from the epicenter of the Hiroshima atom bomb. This is significantly different from a standard fission spectrum, because the spectrum changes as the neutrons are transported through air, and is dominated by neutron energies between 0.05 and 8 MeV. This facility will bemore » based on a mixed proton/deuteron beam impinging on a thick beryllium target. A second, novel facility under development is our new neutron microbeam. The neutron microbeam will, for the first time, provide a kinematically collimated neutron beam, 10-20 micron in diameter. This facility is based on a proton microbeam, impinging on a thin lithium target near the threshold of the Li-7(p,n)Be-7 reaction. Lastly, this novel neutron microbeam will enable studies of neutron damage to small targets, such as single cells, individual organs within small animals or microelectronic components.« less

Novel neutron sources at the Radiological Research Accelerator Facility

NASA Astrophysics Data System (ADS)

Xu, Y.; Garty, G.; Marino, S. A.; Massey, T. N.; Randers-Pehrson, G.; Johnson, G. W.; Brenner, D. J.

2012-03-01

Since the 1960s, the Radiological Research Accelerator Facility (RARAF) has been providing researchers in biology, chemistry and physics with advanced irradiation techniques, using charged particles, photons and neutrons. We are currently developing a unique facility at RARAF, to simulate neutron spectra from an improvised nuclear device (IND), based on calculations of the neutron spectrum at 1.5 km from the epicenter of the Hiroshima atom bomb. This is significantly different from a standard fission spectrum, because the spectrum changes as the neutrons are transported through air, and is dominated by neutron energies between 0.05 and 8 MeV. This facility will be based on a mixed proton/deuteron beam impinging on a thick beryllium target. A second, novel facility under development is our new neutron microbeam. The neutron microbeam will, for the first time, provide a kinematically collimated neutron beam, 10-20 micron in diameter. This facility is based on a proton microbeam, impinging on a thin lithium target near the threshold of the 7Li(p,n)7Be reaction. This novel neutron microbeam will enable studies of neutron damage to small targets, such as single cells, individual organs within small animals or microelectronic components.

Experimental demonstration of low laser-plasma instabilities in gas-filled spherical hohlraums at laser injection angle designed for ignition target

NASA Astrophysics Data System (ADS)

Lan, Ke; Li, Zhichao; Xie, Xufei; Chen, Yao-Hua; Zheng, Chunyang; Zhai, Chuanlei; Hao, Liang; Yang, Dong; Huo, Wen Yi; Ren, Guoli; Peng, Xiaoshi; Xu, Tao; Li, Yulong; Li, Sanwei; Yang, Zhiwen; Guo, Liang; Hou, Lifei; Liu, Yonggang; Wei, Huiyue; Liu, Xiangming; Cha, Weiyi; Jiang, Xiaohua; Mei, Yu; Li, Yukun; Deng, Keli; Yuan, Zheng; Zhan, Xiayu; Zhang, Haijun; Jiang, Baibin; Zhang, Wei; Deng, Xuewei; Liu, Jie; Du, Kai; Ding, Yongkun; Wei, Xiaofeng; Zheng, Wanguo; Chen, Xiaodong; Campbell, E. M.; He, Xian-Tu

2017-03-01

Octahedral spherical hohlraums with a single laser ring at an injection angle of 55∘ are attractive concepts for laser indirect drive due to the potential for achieving the x-ray drive symmetry required for high convergence implosions. Laser-plasma instabilities, however, are a concern given the long laser propagation path in such hohlraums. Significant stimulated Raman scattering has been observed in cylindrical hohlraums with similar laser propagation paths during the ignition campaign on the National Ignition Facility (NIF). In this Rapid Communication, experiments demonstrating low levels of laser-driven plasma instability (LPI) in spherical hohlraums with a laser injection angle of 55∘ are reported and compared to that observed with cylindrical hohlraums with injection angles of 28 .5∘ and 55∘, similar to that of the NIF. Significant LPI is observed with the laser injection of 28 .5∘ in the cylindrical hohlraum where the propagation path is similar to the 55∘ injection angle for the spherical hohlraum. The experiments are performed on the SGIII laser facility with a total 0.35 -μ m incident energy of 93 kJ in a 3 nsec pulse. These experiments demonstrate the role of hohlraum geometry in LPI and demonstrate the need for systematic experiments for choosing the optimal configuration for ignition studies with indirect drive inertial confinement fusion.

Experimental demonstration of low laser-plasma instabilities in gas-filled spherical hohlraums at laser injection angle designed for ignition target.

PubMed

Lan, Ke; Li, Zhichao; Xie, Xufei; Chen, Yao-Hua; Zheng, Chunyang; Zhai, Chuanlei; Hao, Liang; Yang, Dong; Huo, Wen Yi; Ren, Guoli; Peng, Xiaoshi; Xu, Tao; Li, Yulong; Li, Sanwei; Yang, Zhiwen; Guo, Liang; Hou, Lifei; Liu, Yonggang; Wei, Huiyue; Liu, Xiangming; Cha, Weiyi; Jiang, Xiaohua; Mei, Yu; Li, Yukun; Deng, Keli; Yuan, Zheng; Zhan, Xiayu; Zhang, Haijun; Jiang, Baibin; Zhang, Wei; Deng, Xuewei; Liu, Jie; Du, Kai; Ding, Yongkun; Wei, Xiaofeng; Zheng, Wanguo; Chen, Xiaodong; Campbell, E M; He, Xian-Tu

2017-03-01

Octahedral spherical hohlraums with a single laser ring at an injection angle of 55^{∘} are attractive concepts for laser indirect drive due to the potential for achieving the x-ray drive symmetry required for high convergence implosions. Laser-plasma instabilities, however, are a concern given the long laser propagation path in such hohlraums. Significant stimulated Raman scattering has been observed in cylindrical hohlraums with similar laser propagation paths during the ignition campaign on the National Ignition Facility (NIF). In this Rapid Communication, experiments demonstrating low levels of laser-driven plasma instability (LPI) in spherical hohlraums with a laser injection angle of 55^{∘} are reported and compared to that observed with cylindrical hohlraums with injection angles of 28.5^{∘} and 55^{∘}, similar to that of the NIF. Significant LPI is observed with the laser injection of 28.5^{∘} in the cylindrical hohlraum where the propagation path is similar to the 55^{∘} injection angle for the spherical hohlraum. The experiments are performed on the SGIII laser facility with a total 0.35-μm incident energy of 93 kJ in a 3 nsec pulse. These experiments demonstrate the role of hohlraum geometry in LPI and demonstrate the need for systematic experiments for choosing the optimal configuration for ignition studies with indirect drive inertial confinement fusion.

Private capital investments in health care provision through mergers and acquisitions: from long-term to acute care.

PubMed

Angeli, Federica; Maarse, Hans

2016-10-01

This work aims to test whether different segments of healthcare provision differentially attract private capital and thus offer heterogeneous opportunities for private investors' diversification strategies. Thomson Reuter's SDC Platinum database provided data on 2563 merger and acquisition (M&A) deals targeting healthcare providers in Western Europe between 1990 and 2010. Longitudinal trends of industrial and geographical characteristics of M&As' targets and acquirers are examined. Our analyses highlight: (i) a relative decrease of long-term care facilities as targets of M&As, replaced by an increasing prominence of general hospitals, (ii) a shrinking share of long-term care facilities as targets of financial service organizations' acquisitions, in favor of general hospitals, and (iii) an absolute and relative decrease of long-term care facilities' role as target of cross-border M&As. We explain the decreasing interest of private investors towards long-term care facilities along three lines of reasoning, which take into account the saturation of the long-term care market and the liberalization of acute care provision across Western European countries, regulatory interventions aimed at reducing private ownership to ensure resident outcomes and new cultural developments in favor of small-sized facilities, which strengthen the fragmentation of the sector. These findings advance the literature investigating the effect of private ownership on health outcomes in long-term facilities. Market, policy and cultural forces have emerged over two decades to jointly regulate the presence of privately owned, large-sized long-term care providers, seemingly contributing to safeguard residents' well-being. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

75 FR 54627 - Best Management Practices for Unused Pharmaceuticals at Health Care Facilities

Federal Register 2010, 2011, 2012, 2013, 2014

2010-09-08

... at Health Care Facilities AGENCY: Environmental Protection Agency (EPA). ACTION: Notice. SUMMARY: EPA... Unused Pharmaceuticals at Health Care Facilities. The guidance is targeted at hospitals, medical clinics... drafted a guidance document for health care facilities, which describes: Techniques for reducing or...

Plant model of KIPT neutron source facility simulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao, Yan; Wei, Thomas Y.; Grelle, Austin L.

2016-02-01

Argonne National Laboratory (ANL) of the United States and Kharkov Institute of Physics and Technology (KIPT) of Ukraine are collaborating on constructing a neutron source facility at KIPT, Kharkov, Ukraine. The facility has 100-kW electron beam driving a subcritical assembly (SCA). The electron beam interacts with a natural uranium target or a tungsten target to generate neutrons, and deposits its power in the target zone. The total fission power generated in SCA is about 300 kW. Two primary cooling loops are designed to remove 100-kW and 300-kW from the target zone and the SCA, respectively. A secondary cooling system ismore » coupled with the primary cooling system to dispose of the generated heat outside the facility buildings to the atmosphere. In addition, the electron accelerator has a low efficiency for generating the electron beam, which uses another secondary cooling loop to remove the generated heat from the accelerator primary cooling loop. One of the main functions the KIPT neutron source facility is to train young nuclear specialists; therefore, ANL has developed the KIPT Neutron Source Facility Simulator for this function. In this simulator, a Plant Control System and a Plant Protection System were developed to perform proper control and to provide automatic protection against unsafe and improper operation of the facility during the steady-state and the transient states using a facility plant model. This report focuses on describing the physics of the plant model and provides several test cases to demonstrate its capabilities. The plant facility model uses the PYTHON script language. It is consistent with the computer language of the plant control system. It is easy to integrate with the simulator without an additional interface, and it is able to simulate the transients of the cooling systems with system control variables changing on real-time.« less

IRON OPTIMIZATION FOR FENTON-DRIVEN OXIDATION OF MTBE-SPENT GRANULAR ACTIVATED CARBON

EPA Science Inventory

Fenton-driven chemical regeneration of granular activated carbon (GAC) is accomplished through the addition of H2O2 and iron (Fe) to spent GAC. The overall objective of this treatment process is to transform target contaminants into less toxic byproducts, re-establish the sorpti...

Dominance of hole-boring radiation pressure acceleration regime with thin ribbon of ionized solid hydrogen

NASA Astrophysics Data System (ADS)

Psikal, J.; Matys, M.

2018-04-01

Laser-driven proton acceleration from novel cryogenic hydrogen target of the thickness of tens of microns irradiated by multiPW laser pulse is investigated here for relevant laser parameters accessible in near future. It is demonstrated that the efficiency of proton acceleration from relatively thick hydrogen solid ribbon largely exceeds the acceleration efficiency for a thinner ionized plastic foil, which can be explained by enhanced hole boring (HB) driven by laser ponderomotive force in the case of light ions and lower target density. Three-dimensional particle-in-cell (PIC) simulations of laser pulse interaction with relatively thick hydrogen target show larger energies of protons accelerated in the target interior during the HB phase and reduced energies of protons accelerated from the rear side of the target by quasistatic electric field compared with the results obtained from two-dimensional PIC calculations. Linearly and circularly polarized multiPW laser pulses of duration exceeding 100 fs show similar performance in terms of proton acceleration from both the target interior as well as from the rear side of the target. When ultrashort pulse (∼30 fs) is assumed, the number of accelerated protons from the target interior is substantially reduced.

A combustion driven shock tunnel to complement the free piston shock tunnel T5 at GALCIT

NASA Technical Reports Server (NTRS)

Belanger, Jacques; Hornung, Hans G.

1992-01-01

A combustion driven shock tunnel was designed and built at GALCIT to supply the hypersonic facility T5 with 'hot' hydrogen for mixing and combustion experiments. This system was chosen over other options for better flexibility and for safety reasons. The shock tunnel is described and the overall efficiency of the system is discussed. The biggest challenge in the design was to synchronize the combustion driven shock tunnel with T5. To do so, the main diaphragm of the combustion driven shock tunnel is locally melted by an electrical discharge. This local melting is rapidly followed by the complete collapse of the diaphragm in a very repeatable way. A first set of experiments on supersonic hydrogen transverse jets over a flat plate have just been completed with the system and some of the preliminary results are presented.

The Wake Shield Facility: A space experiment platform

NASA Technical Reports Server (NTRS)

Allen, Joseph P.

1991-01-01

Information is given in viewgraph form on Wakeshield, a space experiment platform. The Wake Shield Facility (WSF) flight program objectives, product applications, commercial development approach, and cooperative experiments are listed. The program objectives are to produce new industry-driven electronic, magnetic, and superconducting thin-film materials and devices both in terrestrial laboratories and in space; utilize the ultra-vacuum of space for thin film epitaxial growth and materials processing; and develop commercial space hardware for research and development and enhanced access to space.

Gas detection for alternate-fuel vehicle facilities.

PubMed

Ferree, Steve

2003-05-01

Alternative fuel vehicles' safety is driven by local, state, and federal regulations in which fleet owners in key metropolitan [table: see text] areas convert much of their fleet to cleaner-burning fuels. Various alternative fuels are available to meet this requirement, each with its own advantages and requirements. This conversion to alternative fuels leads to special requirements for safety monitoring in the maintenance facilities and refueling stations. A comprehensive gas and flame monitoring system needs to meet the needs of both the user and the local fire marshal.

Molecular pathways: targeting RAC-p21-activated serine-threonine kinase signaling in RAS-driven cancers.

PubMed

Baker, Nicole M; Yee Chow, Hoi; Chernoff, Jonathan; Der, Channing J

2014-09-15

Cancers driven by oncogenic Ras proteins encompass some of the most deadly human cancer types, and there is a pressing need to develop therapies for these diseases. Although recent studies suggest that mutant Ras proteins may yet be druggable, the most promising and advanced efforts involve inhibitors of Ras effector signaling. Most efforts to target Ras signaling have been aimed at the ERK mitogen-activated protein kinase and the phosphoinositide 3-kinase signaling networks. However, to date, no inhibitors of these Ras effector pathways have been effective against RAS-mutant cancers. This ineffectiveness is due, in part, to the involvement of additional effectors in Ras-dependent cancer growth, such as the Rac small GTPase and the p21-activated serine-threonine kinases (PAK). PAK proteins are involved in many survival, cell motility, and proliferative pathways in the cell and may present a viable new target in Ras-driven cancers. In this review, we address the role and therapeutic potential of Rac and group I PAK proteins in driving mutant Ras cancers. ©2014 American Association for Cancer Research.

Dynamic control of laser driven proton beams by exploiting self-generated, ultrashort electromagnetic pulses

NASA Astrophysics Data System (ADS)

Kar, S.; Ahmed, H.; Nersisyan, G.; Brauckmann, S.; Hanton, F.; Giesecke, A. L.; Naughton, K.; Willi, O.; Lewis, C. L. S.; Borghesi, M.

2016-05-01

As part of the ultrafast charge dynamics initiated by high intensity laser irradiations of solid targets, high amplitude EM pulses propagate away from the interaction point and are transported along any stalks and wires attached to the target. The propagation of these high amplitude pulses along a thin wire connected to a laser irradiated target was diagnosed via the proton radiography technique, measuring a pulse duration of ˜20 ps and a pulse velocity close to the speed of light. The strong electric field associated with the EM pulse can be exploited for controlling dynamically the proton beams produced from a laser-driven source. Chromatic divergence control of broadband laser driven protons (upto 75% reduction in divergence of >5 MeV protons) was obtained by winding the supporting wire around the proton beam axis to create a helical coil structure. In addition to providing focussing and energy selection, the technique has the potential to post-accelerate the transiting protons by the longitudinal component of the curved electric field lines produced by the helical coil lens.

Dynamic control of laser driven proton beams by exploiting self-generated, ultrashort electromagnetic pulses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kar, S., E-mail: s.kar@qub.ac.uk; Ahmed, H.; Nersisyan, G.

As part of the ultrafast charge dynamics initiated by high intensity laser irradiations of solid targets, high amplitude EM pulses propagate away from the interaction point and are transported along any stalks and wires attached to the target. The propagation of these high amplitude pulses along a thin wire connected to a laser irradiated target was diagnosed via the proton radiography technique, measuring a pulse duration of ∼20 ps and a pulse velocity close to the speed of light. The strong electric field associated with the EM pulse can be exploited for controlling dynamically the proton beams produced from amore » laser-driven source. Chromatic divergence control of broadband laser driven protons (upto 75% reduction in divergence of >5 MeV protons) was obtained by winding the supporting wire around the proton beam axis to create a helical coil structure. In addition to providing focussing and energy selection, the technique has the potential to post-accelerate the transiting protons by the longitudinal component of the curved electric field lines produced by the helical coil lens.« less

Dense blocks of energetic ions driven by multi-petawatt lasers

PubMed Central

Weng, S. M.; Liu, M.; Sheng, Z. M.; Murakami, M.; Chen, M.; Yu, L. L.; Zhang, J.

2016-01-01

Laser-driven ion accelerators have the advantages of compact size, high density, and short bunch duration over conventional accelerators. Nevertheless, it is still challenging to simultaneously enhance the yield and quality of laser-driven ion beams for practical applications. Here we propose a scheme to address this challenge via the use of emerging multi-petawatt lasers and a density-modulated target. The density-modulated target permits its ions to be uniformly accelerated as a dense block by laser radiation pressure. In addition, the beam quality of the accelerated ions is remarkably improved by embedding the target in a thick enough substrate, which suppresses hot electron refluxing and thus alleviates plasma heating. Particle-in-cell simulations demonstrate that almost all ions in a solid-density plasma of a few microns can be uniformly accelerated to about 25% of the speed of light by a laser pulse at an intensity around 1022 W/cm2. The resulting dense block of energetic ions may drive fusion ignition and more generally create matter with unprecedented high energy density. PMID:26924793

DDB1-Mediated CRY1 Degradation Promotes FOXO1-Driven Gluconeogenesis in Liver.

PubMed

Tong, Xin; Zhang, Deqiang; Charney, Nicholas; Jin, Ethan; VanDommelen, Kyle; Stamper, Kenneth; Gupta, Neil; Saldate, Johnny; Yin, Lei

2017-10-01

Targeted protein degradation through ubiquitination is an important step in the regulation of glucose metabolism. Here, we present evidence that the DDB1-CUL4A ubiquitin E3 ligase functions as a novel metabolic regulator that promotes FOXO1-driven hepatic gluconeogenesis. In vivo, hepatocyte-specific Ddb1 deletion leads to impaired hepatic gluconeogenesis in the mouse liver but protects mice from high-fat diet-induced hyperglycemia. Lack of Ddb1 downregulates FOXO1 protein expression and impairs FOXO1-driven gluconeogenic response. Mechanistically, we discovered that DDB1 enhances FOXO1 protein stability via degrading the circadian protein cryptochrome 1 (CRY1), a known target of DDB1 E3 ligase. In the Cry1 depletion condition, insulin fails to reduce the nuclear FOXO1 abundance and suppress gluconeogenic gene expression. Chronic depletion of Cry1 in the mouse liver not only increases FOXO1 protein but also enhances hepatic gluconeogenesis. Thus, we have identified the DDB1-mediated CRY1 degradation as an important target of insulin action on glucose homeostasis. © 2017 by the American Diabetes Association.

The HEPCloud Facility: elastic computing for High Energy Physics - The NOvA Use Case

NASA Astrophysics Data System (ADS)

Fuess, S.; Garzoglio, G.; Holzman, B.; Kennedy, R.; Norman, A.; Timm, S.; Tiradani, A.

2017-10-01

The need for computing in the HEP community follows cycles of peaks and valleys mainly driven by conference dates, accelerator shutdown, holiday schedules, and other factors. Because of this, the classical method of provisioning these resources at providing facilities has drawbacks such as potential overprovisioning. As the appetite for computing increases, however, so does the need to maximize cost efficiency by developing a model for dynamically provisioning resources only when needed. To address this issue, the HEPCloud project was launched by the Fermilab Scientific Computing Division in June 2015. Its goal is to develop a facility that provides a common interface to a variety of resources, including local clusters, grids, high performance computers, and community and commercial Clouds. Initially targeted experiments include CMS and NOvA, as well as other Fermilab stakeholders. In its first phase, the project has demonstrated the use of the “elastic” provisioning model offered by commercial clouds, such as Amazon Web Services. In this model, resources are rented and provisioned automatically over the Internet upon request. In January 2016, the project demonstrated the ability to increase the total amount of global CMS resources by 58,000 cores from 150,000 cores - a 38 percent increase - in preparation for the Recontres de Moriond. In March 2016, the NOvA experiment has also demonstrated resource burst capabilities with an additional 7,300 cores, achieving a scale almost four times as large as the local allocated resources and utilizing the local AWS s3 storage to optimize data handling operations and costs. NOvA was using the same familiar services used for local computations, such as data handling and job submission, in preparation for the Neutrino 2016 conference. In both cases, the cost was contained by the use of the Amazon Spot Instance Market and the Decision Engine, a HEPCloud component that aims at minimizing cost and job interruption. This paper describes the Fermilab HEPCloud Facility and the challenges overcome for the CMS and NOvA communities.

Modulation of auditory spatial attention by visual emotional cues: differential effects of attentional engagement and disengagement for pleasant and unpleasant cues.

PubMed

Harrison, Neil R; Woodhouse, Rob

2016-05-01

Previous research has demonstrated that threatening, compared to neutral pictures, can bias attention towards non-emotional auditory targets. Here we investigated which subcomponents of attention contributed to the influence of emotional visual stimuli on auditory spatial attention. Participants indicated the location of an auditory target, after brief (250 ms) presentation of a spatially non-predictive peripheral visual cue. Responses to targets were faster at the location of the preceding visual cue, compared to at the opposite location (cue validity effect). The cue validity effect was larger for targets following pleasant and unpleasant cues compared to neutral cues, for right-sided targets. For unpleasant cues, the crossmodal cue validity effect was driven by delayed attentional disengagement, and for pleasant cues, it was driven by enhanced engagement. We conclude that both pleasant and unpleasant visual cues influence the distribution of attention across modalities and that the associated attentional mechanisms depend on the valence of the visual cue.

High density laser-driven target

DOEpatents

Lindl, John D.

1981-01-01

A high density target for implosion by laser energy composed of a central quantity of fuel surrounded by a high-Z pusher shell with a low-Z ablator-pusher shell spaced therefrom forming a region filled with low-density material.

Clinical proteomics-driven precision medicine for targeted cancer therapy: current overview and future perspectives.

PubMed

Zhou, Li; Wang, Kui; Li, Qifu; Nice, Edouard C; Zhang, Haiyuan; Huang, Canhua

2016-01-01

Cancer is a common disease that is a leading cause of death worldwide. Currently, early detection and novel therapeutic strategies are urgently needed for more effective management of cancer. Importantly, protein profiling using clinical proteomic strategies, with spectacular sensitivity and precision, offer excellent promise for the identification of potential biomarkers that would direct the development of targeted therapeutic anticancer drugs for precision medicine. In particular, clinical sample sources, including tumor tissues and body fluids (blood, feces, urine and saliva), have been widely investigated using modern high-throughput mass spectrometry-based proteomic approaches combined with bioinformatic analysis, to pursue the possibilities of precision medicine for targeted cancer therapy. Discussed in this review are the current advantages and limitations of clinical proteomics, the available strategies of clinical proteomics for the management of precision medicine, as well as the challenges and future perspectives of clinical proteomics-driven precision medicine for targeted cancer therapy.

Design and Fabrication of Opacity Targets for the National Ignition Facility

DOE PAGES

Cardenas, Tana; Schmidt, Derek William; Dodd, Evan S.; ...

2017-12-22

Accurate models for opacity of partially ionized atoms are important for modeling and understanding stellar interiors and other high-energy-density phenomena such as inertial confinement fusion. Lawrence Livermore National Laboratory is leading a multilaboratory effort to conduct experiments on the National Ignition Facility (NIF) to try to reproduce recent opacity tests at the Sandia National Laboratory Z-facility. Since 2015, the NIF effort has evolved several hohlraum designs that consist of multiple pieces joined together. The target also has three components attached to the main stalk over a long distance with high tolerances that have resulted in several design iterations. The targetmore » has made use of rapid prototyped features to attach a capsule and collimator under the hohlraum while avoiding interference with the beams. Furthermore, this paper discusses the evolution of the hohlraum and overall target design and the challenges involved with fabricating and assembling these targets.« less

Design and Fabrication of Opacity Targets for the National Ignition Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cardenas, Tana; Schmidt, Derek William; Dodd, Evan S.

Accurate models for opacity of partially ionized atoms are important for modeling and understanding stellar interiors and other high-energy-density phenomena such as inertial confinement fusion. Lawrence Livermore National Laboratory is leading a multilaboratory effort to conduct experiments on the National Ignition Facility (NIF) to try to reproduce recent opacity tests at the Sandia National Laboratory Z-facility. Since 2015, the NIF effort has evolved several hohlraum designs that consist of multiple pieces joined together. The target also has three components attached to the main stalk over a long distance with high tolerances that have resulted in several design iterations. The targetmore » has made use of rapid prototyped features to attach a capsule and collimator under the hohlraum while avoiding interference with the beams. Furthermore, this paper discusses the evolution of the hohlraum and overall target design and the challenges involved with fabricating and assembling these targets.« less

Joint Loads and Cartilage Stress in Intact Joints of Military Transtibial Amputees: Enhancing Quality of Life

DTIC Science & Technology

2017-04-01

crosstalk); analysis of tested subjects underway. 4) Developed analytical methods to obtain knee joint loads using EMG-driven inverse dynamics; analysis of...13/2018. Completion %: 40. Task 1.3: EMG-driven inverse dynamic (ID) analyses with OpenSim for amputee and control group subjects. Target date: 1...predicted by EMG-driven inverse dynamics. Two-three conference papers are being prepared for submission in February 2017. Other achievements. None

Data management integration for biomedical core facilities

NASA Astrophysics Data System (ADS)

Zhang, Guo-Qiang; Szymanski, Jacek; Wilson, David

2007-03-01

We present the design, development, and pilot-deployment experiences of MIMI, a web-based, Multi-modality Multi-Resource Information Integration environment for biomedical core facilities. This is an easily customizable, web-based software tool that integrates scientific and administrative support for a biomedical core facility involving a common set of entities: researchers; projects; equipments and devices; support staff; services; samples and materials; experimental workflow; large and complex data. With this software, one can: register users; manage projects; schedule resources; bill services; perform site-wide search; archive, back-up, and share data. With its customizable, expandable, and scalable characteristics, MIMI not only provides a cost-effective solution to the overarching data management problem of biomedical core facilities unavailable in the market place, but also lays a foundation for data federation to facilitate and support discovery-driven research.

Testability, Test Automation and Test Driven Development for the Trick Simulation Toolkit

NASA Technical Reports Server (NTRS)

Penn, John

2014-01-01

This paper describes the adoption of a Test Driven Development approach and a Continuous Integration System in the development of the Trick Simulation Toolkit, a generic simulation development environment for creating high fidelity training and engineering simulations at the NASA Johnson Space Center and many other NASA facilities. It describes the approach, and the significant benefits seen, such as fast, thorough and clear test feedback every time code is checked into the code repository. It also describes an approach that encourages development of code that is testable and adaptable.

Hard x-ray (>100 keV) imager to measure hot electron preheat for indirectly driven capsule implosions on the NIF.

PubMed

Döppner, T; Dewald, E L; Divol, L; Thomas, C A; Burns, S; Celliers, P M; Izumi, N; Kline, J L; LaCaille, G; McNaney, J M; Prasad, R R; Robey, H F; Glenzer, S H; Landen, O L

2012-10-01

We have fielded a hard x-ray (>100 keV) imager with high aspect ratio pinholes to measure the spatially resolved bremsstrahlung emission from energetic electrons slowing in a plastic ablator shell during indirectly driven implosions at the National Ignition Facility. These electrons are generated in laser plasma interactions and are a source of preheat to the deuterium-tritium fuel. First measurements show that hot electron preheat does not limit obtaining the fuel areal densities required for ignition and burn.

Cryogenic target system for hydrogen layering

DOE PAGES

Parham, T.; Kozioziemski, B.; Atkinson, D.; ...

2015-11-24

Here, a cryogenic target positioning system was designed and installed on the National Ignition Facility (NIF) target chamber. This instrument incorporates the ability to fill, form, and characterize the NIF targets with hydrogen isotopes needed for ignition experiments inside the NIF target bay then transport and position them in the target chamber. This effort brought to fruition years of research in growing and metrologizing high-quality hydrogen fuel layers and landed it in an especially demanding operations environment in the NIF facility. D-T (deuterium-tritium) layers for NIF ignition experiments have extremely tight specifications and must be grown in a very highlymore » constrained environment: a NIF ignition target inside a cryogenic target positioner inside the NIF target bay. Exquisite control of temperature, pressure, contaminant level, and thermal uniformity are necessary throughout seed formation and layer growth to create an essentially-groove-free single crystal layer.« less

Active Targets For Capacitive Proximity Sensors

NASA Technical Reports Server (NTRS)

Jenstrom, Del T.; Mcconnell, Robert L.

1994-01-01

Lightweight, low-power active targets devised for use with improved capacitive proximity sensors described in "Capacitive Proximity Sensor Has Longer Range" (GSC-13377), and "Capacitive Proximity Sensors With Additional Driven Shields" (GSC-13475). Active targets are short-distance electrostatic beacons; they generate known alternating electro-static fields used for alignment and/or to measure distances.

Targeting the human epidermal growth factor receptor 2 (HER2) oncogene in colorectal cancer

PubMed Central

Siena, S; Sartore-Bianchi, A; Marsoni, S; Hurwitz, H I; McCall, S J; Penault-Llorca, F; Srock, S; Bardelli, A; Trusolino, L

2018-01-01

Abstract Human epidermal growth factor receptor 2 (HER2) is an oncogenic driver, and a well-established therapeutic target in breast and gastric cancers. Using functional and genomic analyses of patient-derived xenografts, we previously showed that a subset (approximately 5%) of metastatic colorectal cancer (CRC) tumors is driven by amplification or mutation of HER2. This paper reviews the role of HER2 amplification as an oncogenic driver, a prognostic and predictive biomarker, and a clinically actionable target in CRC, considering the specifics of HER2 testing in this tumor type. While the role of HER2 as a biomarker for prognosis in CRC remains uncertain, its relevance as a therapeutic target has been established. Indeed, independent studies documented substantial clinical benefit in patients treated with biomarker-driven HER2-targeted therapies, with an impact on response rates and duration of response that compared favorably with immunotherapy and other examples of precision oncology. HER2-targeted therapeutic strategies have the potential to change the treatment paradigm for a clinically relevant subgroup of metastatic CRC patients. PMID:29659677

Multiple-Color Optical Activation, Silencing, and Desynchronization of Neural Activity, with Single-Spike Temporal Resolution

PubMed Central

Han, Xue; Boyden, Edward S.

2007-01-01

The quest to determine how precise neural activity patterns mediate computation, behavior, and pathology would be greatly aided by a set of tools for reliably activating and inactivating genetically targeted neurons, in a temporally precise and rapidly reversible fashion. Having earlier adapted a light-activated cation channel, channelrhodopsin-2 (ChR2), for allowing neurons to be stimulated by blue light, we searched for a complementary tool that would enable optical neuronal inhibition, driven by light of a second color. Here we report that targeting the codon-optimized form of the light-driven chloride pump halorhodopsin from the archaebacterium Natronomas pharaonis (hereafter abbreviated Halo) to genetically-specified neurons enables them to be silenced reliably, and reversibly, by millisecond-timescale pulses of yellow light. We show that trains of yellow and blue light pulses can drive high-fidelity sequences of hyperpolarizations and depolarizations in neurons simultaneously expressing yellow light-driven Halo and blue light-driven ChR2, allowing for the first time manipulations of neural synchrony without perturbation of other parameters such as spiking rates. The Halo/ChR2 system thus constitutes a powerful toolbox for multichannel photoinhibition and photostimulation of virally or transgenically targeted neural circuits without need for exogenous chemicals, enabling systematic analysis and engineering of the brain, and quantitative bioengineering of excitable cells. PMID:17375185

Casein kinase 1α–dependent feedback loop controls autophagy in RAS-driven cancers

PubMed Central

Cheong, Jit Kong; Zhang, Fuquan; Chua, Pei Jou; Bay, Boon Huat; Thorburn, Andrew; Virshup, David M.

2015-01-01

Activating mutations in the RAS oncogene are common in cancer but are difficult to therapeutically target. RAS activation promotes autophagy, a highly regulated catabolic process that metabolically buffers cells in response to diverse stresses. Here we report that casein kinase 1α (CK1α), a ubiquitously expressed serine/threonine kinase, is a key negative regulator of oncogenic RAS–induced autophagy. Depletion or pharmacologic inhibition of CK1α enhanced autophagic flux in oncogenic RAS–driven human fibroblasts and multiple cancer cell lines. FOXO3A, a master longevity mediator that transcriptionally regulates diverse autophagy genes, was a critical target of CK1α, as depletion of CK1α reduced levels of phosphorylated FOXO3A and increased expression of FOXO3A-responsive genes. Oncogenic RAS increased CK1α protein abundance via activation of the PI3K/AKT/mTOR pathway. In turn, elevated levels of CK1α increased phosphorylation of nuclear FOXO3A, thereby inhibiting transactivation of genes critical for RAS-induced autophagy. In both RAS-driven cancer cells and murine xenograft models, pharmacologic CK1α inactivation synergized with lysosomotropic agents to inhibit growth and promote tumor cell death. Together, our results identify a kinase feedback loop that influences RAS-dependent autophagy and suggest that targeting CK1α-regulated autophagy offers a potential therapeutic opportunity to treat oncogenic RAS–driven cancers. PMID:25798617

The radioactive beam facility ALTO

NASA Astrophysics Data System (ADS)

Essabaa, Saïd; Barré-Boscher, Nicole; Cheikh Mhamed, Maher; Cottereau, Evelyne; Franchoo, Serge; Ibrahim, Fadi; Lau, Christophe; Roussière, Brigitte; Saïd, Abdelhakim; Tusseau-Nenez, Sandrine; Verney, David

2013-12-01

The Transnational Access facility ALTO (TNA07-ENSAR/FP7) has been commissioned and received from the French safety authorities, the operation license. It is allowed to run at nominal intensity to produce 1011 fissions/s in a thick uranium carbide target by photo-fission using a 10 μA, 50 MeV electron beam. In addition the recent success in operating the selective laser ion source broadens the physics program with neutron-rich nuclear beams possible at this facility installed at IPN Orsay. The facility also aims at being a test bench for the SPIRAL2 project. In that framework an ambitious R&D program on the target ion source system is being developed.

Eyes On the Ground: Path Forward Analysis.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brost, Randolph; Little, Charles Q.; peter-stein, natacha

A previous report assesses our progress to date on the Eyes On the Ground project, and reviews lessons learned [1]. In this report, we address the implications of those lessons in defining the most productive path forward for the remainder of the project. We propose two main concepts: Interactive Diagnosis and Model-Driven Assistance. Among these, the Model-Driven Assistance concept appears the most promising. The Model-Driven Assistance concept is based on an approximate but useful model of a facility, which provides a unified representation for storing, viewing, and analyzing data that is known about the facility. This representation provides value tomore » both inspectors and IAEA headquarters, and facilitates communication between the two. The concept further includes a lightweight, portable field tool to aid the inspector in executing a variety of inspection tasks, including capture of images and 3-d scan data. We develop a detailed description of this concept, including its system components, functionality, and example use cases. The envisioned tool would provide value by reducing inspector cognitive load, streamlining inspection tasks, and facilitating communication between the inspector and teams at IAEA headquarters. We conclude by enumerating the top implementation priorities to pursue in the remaining limited time of the project. Approved for public release; further dissemination unlimited.« less

Modeling Laser-Driven Laboratory Astrophysics Experiments Using the CRASH Code

NASA Astrophysics Data System (ADS)

Grosskopf, Michael; Keiter, P.; Kuranz, C. C.; Malamud, G.; Trantham, M.; Drake, R.

2013-06-01

Laser-driven, laboratory astrophysics experiments can provide important insight into the physical processes relevant to astrophysical systems. The radiation hydrodynamics code developed by the Center for Radiative Shock Hydrodynamics (CRASH) at the University of Michigan has been used to model experimental designs for high-energy-density laboratory astrophysics campaigns on OMEGA and other high-energy laser facilities. This code is an Eulerian, block-adaptive AMR hydrodynamics code with implicit multigroup radiation transport and electron heat conduction. The CRASH model has been used on many applications including: radiative shocks, Kelvin-Helmholtz and Rayleigh-Taylor experiments on the OMEGA laser; as well as laser-driven ablative plumes in experiments by the Astrophysical Collisionless Shocks Experiments with Lasers (ACSEL) collaboration. We report a series of results with the CRASH code in support of design work for upcoming high-energy-density physics experiments, as well as comparison between existing experimental data and simulation results. This work is funded by the Predictive Sciences Academic Alliances Program in NNSA-ASC via grant DEFC52- 08NA28616, by the NNSA-DS and SC-OFES Joint Program in High-Energy-Density Laboratory Plasmas, grant number DE-FG52-09NA29548, and by the National Laser User Facility Program, grant number DE-NA0000850.

People, Process and Technology: Strategies for Assuring Sustainable Implementation of EMRs at Public-Sector Health Facilities in Kenya

PubMed Central

Kang’a, Samuel G.; Muthee, Veronica M.; Liku, Nzisa; Too, Diana; Puttkammer, Nancy

2016-01-01

The Ministry of Health (MoH) rollout of electronic medical record systems (EMRs) has continuously been embraced across health facilities in Kenya since 2012. This has been driven by a government led process supported by PEPFAR that recommended standardized systems for facilities. Various strategies were deployed to assure meaningful and sustainable EMRs implementation: sensitization of leadership; user training, formation of health facility-level multi-disciplinary teams; formation of county-level Technical Working Groups; data migration; routine data quality assessments; point of care adoption; successive release of software upgrades; and power provision. Successes recorded include goodwill and leadership from the county management (22 counties), growth in the number of EMR trained users (2561 health care workers), collaboration in among other things, data migration(90 health facilities completed) and establishment of county TWGs (13 TWGs). Sustenance of EMRs demand across facilities is possible through; county TWGs oversight, timely resolution of users’ issues and provision of reliable power. PMID:28269864

People, Process and Technology: Strategies for Assuring Sustainable Implementation of EMRs at Public-Sector Health Facilities in Kenya.

PubMed

Kang'a, Samuel G; Muthee, Veronica M; Liku, Nzisa; Too, Diana; Puttkammer, Nancy

2016-01-01

The Ministry of Health (MoH) rollout of electronic medical record systems (EMRs) has continuously been embraced across health facilities in Kenya since 2012. This has been driven by a government led process supported by PEPFAR that recommended standardized systems for facilities. Various strategies were deployed to assure meaningful and sustainable EMRs implementation: sensitization of leadership; user training, formation of health facility-level multi-disciplinary teams; formation of county-level Technical Working Groups; data migration; routine data quality assessments; point of care adoption; successive release of software upgrades; and power provision. Successes recorded include goodwill and leadership from the county management (22 counties), growth in the number of EMR trained users (2561 health care workers), collaboration in among other things, data migration(90 health facilities completed) and establishment of county TWGs (13 TWGs). Sustenance of EMRs demand across facilities is possible through; county TWGs oversight, timely resolution of users' issues and provision of reliable power.

Synchronizing the tracking eye movements with the motion of a visual target: Basic neural processes.

PubMed

Goffart, Laurent; Bourrelly, Clara; Quinet, Julie

2017-01-01

In primates, the appearance of an object moving in the peripheral visual field elicits an interceptive saccade that brings the target image onto the foveae. This foveation is then maintained more or less efficiently by slow pursuit eye movements and subsequent catch-up saccades. Sometimes, the tracking is such that the gaze direction looks spatiotemporally locked onto the moving object. Such a spatial synchronism is quite spectacular when one considers that the target-related signals are transmitted to the motor neurons through multiple parallel channels connecting separate neural populations with different conduction speeds and delays. Because of the delays between the changes of retinal activity and the changes of extraocular muscle tension, the maintenance of the target image onto the fovea cannot be driven by the current retinal signals as they correspond to past positions of the target. Yet, the spatiotemporal coincidence observed during pursuit suggests that the oculomotor system is driven by a command estimating continuously the current location of the target, i.e., where it is here and now. This inference is also supported by experimental perturbation studies: when the trajectory of an interceptive saccade is experimentally perturbed, a correction saccade is produced in flight or after a short delay, and brings the gaze next to the location where unperturbed saccades would have landed at about the same time, in the absence of visual feedback. In this chapter, we explain how such correction can be supported by previous visual signals without assuming "predictive" signals encoding future target locations. We also describe the basic neural processes which gradually yield the synchronization of eye movements with the target motion. When the process fails, the gaze is driven by signals related to past locations of the target, not by estimates to its upcoming locations, and a catch-up is made to reinitiate the synchronization. © 2017 Elsevier B.V. All rights reserved.

A Survey of Recent MARTe Based Systems

NASA Astrophysics Data System (ADS)

Neto, André C.; Alves, Diogo; Boncagni, Luca; Carvalho, Pedro J.; Valcarcel, Daniel F.; Barbalace, Antonio; De Tommasi, Gianmaria; Fernandes, Horácio; Sartori, Filippo; Vitale, Enzo; Vitelli, Riccardo; Zabeo, Luca

2011-08-01

The Multithreaded Application Real-Time executor (MARTe) is a data driven framework environment for the development and deployment of real-time control algorithms. The main ideas which led to the present version of the framework were to standardize the development of real-time control systems, while providing a set of strictly bounded standard interfaces to the outside world and also accommodating a collection of facilities which promote the speed and ease of development, commissioning and deployment of such systems. At the core of every MARTe based application, is a set of independent inter-communicating software blocks, named Generic Application Modules (GAM), orchestrated by a real-time scheduler. The platform independence of its core library provides MARTe the necessary robustness and flexibility for conveniently testing applications in different environments including non-real-time operating systems. MARTe is already being used in several machines, each with its own peculiarities regarding hardware interfacing, supervisory control configuration, operating system and target control application. This paper presents and compares the most recent results of systems using MARTe: the JET Vertical Stabilization system, which uses the Real Time Application Interface (RTAI) operating system on Intel multi-core processors; the COMPASS plasma control system, driven by Linux RT also on Intel multi-core processors; ISTTOK real-time tomography equilibrium reconstruction which shares the same support configuration of COMPASS; JET error field correction coils based on VME, PowerPC and VxWorks; FTU LH reflected power system running on VME, Intel with RTAI.

FDA 2011 process validation guidance: lifecycle compliance model.

PubMed

Campbell, Cliff

2014-01-01

This article has been written as a contribution to the industry's efforts in migrating from a document-driven to a data-driven compliance mindset. A combination of target product profile, control engineering, and general sum principle techniques is presented as the basis of a simple but scalable lifecycle compliance model in support of modernized process validation. Unit operations and significant variables occupy pole position within the model, documentation requirements being treated as a derivative or consequence of the modeling process. The quality system is repositioned as a subordinate of system quality, this being defined as the integral of related "system qualities". The article represents a structured interpretation of the U.S. Food and Drug Administration's 2011 Guidance for Industry on Process Validation and is based on the author's educational background and his manufacturing/consulting experience in the validation field. The U.S. Food and Drug Administration's Guidance for Industry on Process Validation (2011) provides a wide-ranging and rigorous outline of compliant drug manufacturing requirements relative to its 20(th) century predecessor (1987). Its declared focus is patient safety, and it identifies three inter-related (and obvious) stages of the compliance lifecycle. Firstly, processes must be designed, both from a technical and quality perspective. Secondly, processes must be qualified, providing evidence that the manufacturing facility is fully "roadworthy" and fit for its intended purpose. Thirdly, processes must be verified, meaning that commercial batches must be monitored to ensure that processes remain in a state of control throughout their lifetime.

Netwar

NASA Astrophysics Data System (ADS)

Keen, Arthur A.

2006-04-01

This paper describes technology being developed at 21st Century Technologies to automate Computer Network Operations (CNO). CNO refers to DoD activities related to Attacking and Defending Computer Networks (CNA & CND). Next generation cyber threats are emerging in the form of powerful Internet services and tools that automate intelligence gathering, planning, testing, and surveillance. We will focus on "Search-Engine Hacks", queries that can retrieve lists of router/switch/server passwords, control panels, accessible cameras, software keys, VPN connection files, and vulnerable web applications. Examples include "Titan Rain" attacks against DoD facilities and the Santy worm, which identifies vulnerable sites by searching Google for URLs containing application-specific strings. This trend will result in increasingly sophisticated and automated intelligence-driven cyber attacks coordinated across multiple domains that are difficult to defeat or even understand with current technology. One traditional method of CNO relies on surveillance detection as an attack predictor. Unfortunately, surveillance detection is difficult because attackers can perform search engine-driven surveillance such as with Google Hacks, and avoid touching the target site. Therefore, attack observables represent only about 5% of the attacker's total attack time, and are inadequate to provide warning. In order to predict attacks and defend against them, CNO must also employ more sophisticated techniques and work to understand the attacker's Motives, Means and Opportunities (MMO). CNO must use automated reconnaissance tools, such as Google, to identify information vulnerabilities, and then utilize Internet tools to observe the intelligence gathering, planning, testing, and collaboration activities that represent 95% of the attacker's effort.

PIE preparation of the MEGAPIE target

NASA Astrophysics Data System (ADS)

Wohlmuther, Michael; Wagner, Werner

2012-12-01

The MEGAPIE target, after successfully operating for 4 months at a beam power of 0.77 MW, is now being prepared for post irradiation examination PIE. The lead-bismuth eutectic (LBE) target was irradiated from August until December 2006, and in this period received a beam charge of 2.8 A h of 575 MeV protons. After that, the target was stored in the target storage facility of PSI, waiting for its post irradiation examination. In the meantime several campaigns of tests have been conducted by PSI and ZWILAG, the interim storage facility of Swiss nuclear power plants. In these tests the feasibility of the conditioning of the target and the extraction of sample material for the PIE has been proven. After transport to the hot cell facility at ZWILAG in June 2009, the dismantling of the MEGAPIE target started. It finally was cut into 21 pieces. Ten of these pieces will be shipped to the Hot Laboratory of PSI ('PSI hotlab') to extract samples from the structural materials as well as from the LBE. Currently it is foreseen that the sample extraction will start in the first half of 2011. The remaining parts of the MEGAPIE target were conditioned as radioactive waste. The present paper will mainly focus on the dismantling and first visual inspection of the MEGAPIE target. In addition an outlook on the PIE phase of MEGAPIE is given.

Enrichment Clusters: A Practical Plan for Real-World, Student-Driven Learning.

ERIC Educational Resources Information Center

Renzulli, Joseph S.; Gentry, Marcia; Reis, Sally M.

This guidebook provides a rationale and guidelines for implementing a student-driven learning approach using enrichment clusters. Enrichment clusters allow students who share a common interest to meet each week to produce a product, performance, or targeted service based on that common interest. Chapter 1 discusses different models of learning.…

Teachers' Response to Curriculum Change: Balancing External and Internal Change Forces

ERIC Educational Resources Information Center

Mellegård, Ingebjørg; Pettersen, Karin Dahlberg

2016-01-01

The present study investigates teachers' perceptions of curriculum change targeting the expanded freedom teachers were given as curriculum developers in the implementation process of the 2006 school reform in Norway. The new curriculum marks a distinct shift, moving from a content-driven to a learning outcomes-driven curriculum. Policy makers…

Unlearning Overgenerated "Be" through Data-Driven Learning in the Secondary EFL Classroom

ERIC Educational Resources Information Center

Moon, Soyeon; Oh, Sun-Young

2018-01-01

This paper reports on the cognitive and affective benefits of data-driven learning (DDL), in which Korean EFL learners at the secondary level notice and unlearn their "overgenerated 'be'" by comparing native English-speaker and learner corpora with guided induction. To select the target language item and compile learner-corpus-based…

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ammigan, K.; Hurh, P.

The Radiation Damage In Accelerator Target Environments (RaDIATE) collaboration was founded in 2012 and currently consists of over 50 participants and 11 institutions globally. Due to the increasing power of future proton accelerator sources in target facilities, there is a critical need to further understand the physical and thermo-mechanical radiation response of target facility materials. Thus, the primary objective of the RaDIATE collaboration is to draw on existing expertise in the nuclear materials and accelerator targets fields to generate new and useful materials data for application within the accelerator and fission/fusion communities. Current research activities of the collaboration include postmore » irradiation examination (PIE) of decommissioned components from existing beamlines such as the NuMI beryllium beam window and graphite NT-02 target material. PIE of these components includes advanced microstructural analyses (SEM/TEM, EBSD, EDS) and micro-mechanics technique such as nano-indentation, to help characterize any microstructural radiation damage incurred during operation. New irradiation campaigns of various candidate materials at both low and high energy beam facilities are also being pursued. Beryllium helium implantation studies at the University of Surrey as well as high energy proton irradiation of various materials at Brookhaven National Laboratory’s BLIP facility have been initiated. The program also extends to beam-induced thermal shock experiments using high intensity beam pulses at CERN’s HiRadMat facility, followed by advanced PIE activities to evaluate thermal shock resistance of the materials. Preliminary results from ongoing research activities, as well as the future plans of the RaDIATE collaboration R&D program will be discussed.« less

Temporally resolved proton radiography of rapidly varying electric and magnetic fields in laser-driven capacitor coil targets

NASA Astrophysics Data System (ADS)

Morace, A.; Santos, J. J.; Bailly-Grandvaux, M.; Ehret, M.; Alpinaniz, J.; Brabetz, C.; Schaumann, G.; Volpe, L.

2017-02-01

Understanding the dynamics of rapidly varying electromagnetic fields in intense short pulse laser plasma interactions is of key importance to understand the mechanisms at the basis of a wide variety of physical processes, from high energy density physics and fusion science to the development of ultrafast laser plasma devices to control laser-generated particle beams. Target normal sheath accelerated (TNSA) proton radiography represents an ideal tool to diagnose ultrafast electromagnetic phenomena, providing 2D spatially and temporally resolved radiographs with temporal resolution varying from 2-3 ps to few tens of ps. In this work we introduce the proton radiography technique and its application to diagnose the spatial and temporal evolution of electromagnetic fields in laser-driven capacitor coil targets.

CFD Analysis and Design of Detailed Target Configurations for an Accelerator-Driven Subcritical System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kraus, Adam; Merzari, Elia; Sofu, Tanju

2016-08-01

High-fidelity analysis has been utilized in the design of beam target options for an accelerator driven subcritical system. Designs featuring stacks of plates with square cross section have been investigated for both tungsten and uranium target materials. The presented work includes the first thermal-hydraulic simulations of the full, detailed target geometry. The innovative target cooling manifold design features many regions with complex flow features, including 90 bends and merging jets, which necessitate three-dimensional fluid simulations. These were performed using the commercial computational fluid dynamics code STAR-CCM+. Conjugate heat transfer was modeled between the plates, cladding, manifold structure, and fluid. Steady-statemore » simulations were performed but lacked good residual convergence. Unsteady simulations were then performed, which converged well and demonstrated that flow instability existed in the lower portion of the manifold. It was established that the flow instability had little effect on the peak plate temperatures, which were well below the melting point. The estimated plate surface temperatures and target region pressure were shown to provide sufficient margin to subcooled boiling for standard operating conditions. This demonstrated the safety of both potential target configurations during normal operation.« less

Overview of the ISOL facility for the RISP

NASA Astrophysics Data System (ADS)

Woo, H. J.; Kang, B. H.; Tshoo, K.; Seo, C. S.; Hwang, W.; Park, Y.-H.; Yoon, J. W.; Yoo, S. H.; Kim, Y. K.; Jang, D. Y.

2015-02-01

The key feature of the Isotope Separation On-Line (ISOL) facility is its ability to provide high-intensity and high-quality beams of neutron-rich isotopes with masses in the range of 80-160 by means of a 70-MeV proton beam directly impinging on uranium-carbide thin-disc targets to perform forefront research in nuclear structure, nuclear astrophysics, reaction dynamics and interdisciplinary fields like medical, biological and material sciences. The technical design of the 10-kW and the 35-kW direct fission targets with in-target fission rates of up to 1014 fissions/s has been finished, and for the development of the ISOL fission-target chemistry an initial effort has been made to produce porous lanthanum-carbide (LaCx) discs as a benchmark for the final production of porous UCx discs. For the production of various beams, three classes of ion sources are under development at RISP (Rare Isotope Science Project), the surface ion source, the plasma ion source (FEBIAD), the laser ion source, and the engineering design of the FEBIAD is in progress for prototype fabrication. The engineering design of the ISOL target/ion source front-end system is also in progress, and a prototype will be used for an off-line test facility in front of the pre-separator. The technical designs of other basic elements at the ISOL facility, such as the RF-cooler, the high-resolution mass separator, and the A/q separator, have been finished, and the results, along with the future plans, are introduced.

The ISOLDE facility

NASA Astrophysics Data System (ADS)

Catherall, R.; Andreazza, W.; Breitenfeldt, M.; Dorsival, A.; Focker, G. J.; Gharsa, T. P.; J, Giles T.; Grenard, J.-L.; Locci, F.; Martins, P.; Marzari, S.; Schipper, J.; Shornikov, A.; Stora, T.

2017-09-01

The ISOLDE facility has undergone numerous changes over the last 17 years driven by both the physics and technical community with a common goal to improve on beam variety, beam quality and safety. Improvements have been made in civil engineering and operational equipment while continuing developments aim to ensure operations following a potential increase in primary beam intensity and energy. This paper outlines the principal technical changes incurred at ISOLDE by building on a similar publication of the facility upgrades by Kugler (2000 Hyperfine Interact. 129 23-42). It also provides an insight into future perspectives through a brief summary issues addressed in the HIE-ISOLDE design study Catherall et al (2013 Nucl. Instrum. Methods Phys. Res. B 317 204-207).

Design and implementation of an inexpensive target scanner for the growth of thin films by the laser-ablation process

NASA Astrophysics Data System (ADS)

Rao, A. M.; Moodera, J. S.

1991-04-01

The design of a target scanner that is inexpensive and easy to construct is described. Our target scanner system does not require an expensive personal computer to raster the laser beam uniformily over the target material, unlike the computer driven target scanners that are currently being used in the thin-film industry. The main components of our target scanner comprise a bidirectional motor, a two-position switch, and a standard optical mirror mount.

Playing the Catch-Up Game: Accelerating the Scale-Up of Prevention of Mother-To-Child Transmission of HIV (PMTCT) Services to Eliminate New Pediatric HIV Infection in Nigeria.

PubMed

Oladele, Edward Adekola; Khamofu, Hadiza; Asala, Seun; Saleh, Mariya; Ralph-Opara, Uche; Nwosisi, Charles; Anyaike, Chukwuma; Gana, Catherine; Adedokun, Oluwasanmi; Dirks, Rebecca; Adebayo, Olufunsho; Oduwole, Modupe; Mandala, Justin; Torpey, Kwasi

2017-01-01

As the world is making progress towards elimination of mother-to-child transmission of HIV, poor coverage of PMTCT services in Nigeria remains a major challenge. In order to address this, scale-up was planned with activities organized into 3 phases. This paper describes the process undertaken in eight high burden Nigerian states to rapidly close PMTCT coverage gaps at facility and population levels between February 2013 and March 2014. Activities were grouped into three phases-pre-assessment phase (engagement of a wide range of stakeholders), assessment (rapid health facility assessment, a cross sectional survey using mixed methods conducted in the various states between Feb and May 2013 and impact modelling), and post-assessment (drawing up costed state operational plans to achieve eMTCT by 2015, data-driven smart scale-up). Over a period of 10 months starting June 2013, 2044 facilities were supported to begin provision of PMTCT services. This increased facility coverage from 8% to 50%. A 246% increase was also recorded in the number of pregnant women and their families who have access to HIV testing and counselling in the context of PMTCT. Similarly, access to antiretrovirals for PMTCT has witnessed a 152% increase in these eight states between October 2013 and October 2014. A data-driven and participatory approach can be used to rapidly scale-up PMTCT services at community and facility levels in this region. These results present us with hope for real progress in Nigeria. We are confident that the efforts described here will contribute significantly to eliminating new pediatric HIV infection in Nigeria.

Cognitive load privileges memory-based over data-driven processing, not group-level over person-level processing.

PubMed

Skorich, Daniel P; Mavor, Kenneth I

2013-09-01

In the current paper, we argue that categorization and individuation, as traditionally discussed and as experimentally operationalized, are defined in terms of two confounded underlying dimensions: a person/group dimension and a memory-based/data-driven dimension. In a series of three experiments, we unconfound these dimensions and impose a cognitive load. Across the three experiments, two with laboratory-created targets and one with participants' friends as the target, we demonstrate that cognitive load privileges memory-based over data-driven processing, not group- over person-level processing. We discuss the results in terms of their implications for conceptualizations of the categorization/individuation distinction, for the equivalence of person and group processes, for the ultimate 'purpose' and meaningfulness of group-based perception and, fundamentally, for the process of categorization, broadly defined. © 2012 The British Psychological Society.

[Segment analysis of the target market of physiotherapeutic services].

PubMed

Babaskin, D V

2010-01-01

The objective of the present study was to demonstrate the possibilities to analyse selected segments of the target market of physiotherapeutic services provided by medical and preventive-facilities of two major types. The main features of a target segment, such as provision of therapeutic massage, are illustrated in terms of two characteristics, namely attractiveness to the users and the ability of a given medical facility to satisfy their requirements. Based on the analysis of portfolio of the available target segments the most promising ones (winner segments) were selected for further marketing studies. This choice does not exclude the possibility of involvement of other segments of medical services in marketing activities.

Technology-Driven Planning: Principles to Practice.

ERIC Educational Resources Information Center

Boettcher, Judith V., Ed.; Doyle, Mary M., Ed.; Jensen, Richard W., Ed.

The selections in this collection explore topics related to the future of information technology and strategic, academic, resource, and facilities planning in institutions of higher education. Part 1, "Developing the Vision: Principles, Paradigms, Life Cycles, and Values," contains: (1) "Mega-Level Strategic Planning: Beyond Conventional Wisdom"…

Performance of indirectly driven capsule implosions on the National Ignition Facility using adiabat-shaping

DOE PAGES

Robey, H. F.; Smalyuk, V. A.; Milovich, J. L.; ...

2016-04-01

A series of indirectly driven capsule implosions has been performed on the National Ignition Facility to assess the relative contributions of ablation-front instability growth vs. fuel compression on implosion performance. Laser pulse shapes for both low and high-foot pulses were modified to vary ablation-front growth & fuel adiabat, separately and controllably. Two principal conclusions are drawn from this study: 1) It is shown that an increase in laser picket energy reduces ablation-front instability growth in low-foot implosions resulting in a substantial (3-10X) increase in neutron yield with no loss of fuel compression. 2.) It is shown that a decrease inmore » laser trough power reduces the fuel adiabat in high-foot implosions results in a significant (36%) increase in fuel compression together with no reduction in neutron yield. These results taken collectively bridge the space between the higher compression low-foot results and the higher yield high-foot results.« less

Database Driven 6-DOF Trajectory Simulation for Debris Transport Analysis

NASA Technical Reports Server (NTRS)

West, Jeff

2008-01-01

Debris mitigation and risk assessment have been carried out by NASA and its contractors supporting Space Shuttle Return-To-Flight (RTF). As a part of this assessment, analysis of transport potential for debris that may be liberated from the vehicle or from pad facilities prior to tower clear (Lift-Off Debris) is being performed by MSFC. This class of debris includes plume driven and wind driven sources for which lift as well as drag are critical for the determination of the debris trajectory. As a result, NASA MSFC has a need for a debris transport or trajectory simulation that supports the computation of lift effect in addition to drag without the computational expense of fully coupled CFD with 6-DOF. A database driven 6-DOF simulation that uses aerodynamic force and moment coefficients for the debris shape that are interpolated from a database has been developed to meet this need. The design, implementation, and verification of the database driven six degree of freedom (6-DOF) simulation addition to the Lift-Off Debris Transport Analysis (LODTA) software are discussed in this paper.

Gadolinium-148 and other spallation production cross section measurements for accelerator target facilities

NASA Astrophysics Data System (ADS)

Kelley, Karen Corzine

At the Los Alamos Neutron Science Center accelerator complex, protons are accelerated to 800 MeV and directed to two tungsten targets, Target 4 at the Weapons Neutron Research facility and the 1L target at the Lujan Center. The Department of Energy requires hazard classification analyses to be performed on these targets and places limits on certain radionuclide inventories in the targets to avoid characterizing the facilities as "nuclear facilities." Gadolinium-148 is a radionuclide created from the spallation of tungsten. Allowed isotopic inventories are particularly low for this isotope because it is an alpha-particle emitter with a 75-year half-life. The activity level of Gadolinium-148 is low, but it encompasses almost two-thirds of the total dose burden for the two tungsten targets based on present yield estimates. From a hazard classification standpoint, this severely limits the lifetime of these tungsten targets. The cross section is not well-established experimentally and this is the motivation for measuring the Gadolinium-148 production cross section from tungsten. In a series of experiments at the Weapons Neutron Research facility, Gadolinium-148 production was measured for 600- and 800-MeV protons on tungsten, tantalum, and gold. These experiments used 3 mum thin tungsten, tantalum, and gold foils and 10 mum thin aluminum activation foils. In addition, spallation yields were determined for many short-lived and long-lived spallation products with these foils using gamma and alpha spectroscopy and compared with predictions of the Los Alamos National Laboratory codes CEM2k+GEM2 and MCNPX. The cumulative Gadolinium-148 production cross section measured from tantalum, tungsten, and gold for incident 600-MeV protons were 15.2 +/- 4.0, 8.31 +/- 0.92, and 0.591 +/- 0.155, respectively. The average production cross sections measured at 800 MeV were 28.6 +/- 3.5, 19.4 +/- 1.8, and 3.69 +/- 0.50 for tantalum, tungsten, and gold, respectively. These cumulative measurements compared best with Bertini and were within a factor of two to three of CEM2k+GEM2.

Precision shock tuning on the national ignition facility.

PubMed

Robey, H F; Celliers, P M; Kline, J L; Mackinnon, A J; Boehly, T R; Landen, O L; Eggert, J H; Hicks, D; Le Pape, S; Farley, D R; Bowers, M W; Krauter, K G; Munro, D H; Jones, O S; Milovich, J L; Clark, D; Spears, B K; Town, R P J; Haan, S W; Dixit, S; Schneider, M B; Dewald, E L; Widmann, K; Moody, J D; Döppner, T D; Radousky, H B; Nikroo, A; Kroll, J J; Hamza, A V; Horner, J B; Bhandarkar, S D; Dzenitis, E; Alger, E; Giraldez, E; Castro, C; Moreno, K; Haynam, C; LaFortune, K N; Widmayer, C; Shaw, M; Jancaitis, K; Parham, T; Holunga, D M; Walters, C F; Haid, B; Malsbury, T; Trummer, D; Coffee, K R; Burr, B; Berzins, L V; Choate, C; Brereton, S J; Azevedo, S; Chandrasekaran, H; Glenzer, S; Caggiano, J A; Knauer, J P; Frenje, J A; Casey, D T; Johnson, M Gatu; Séguin, F H; Young, B K; Edwards, M J; Van Wonterghem, B M; Kilkenny, J; MacGowan, B J; Atherton, J; Lindl, J D; Meyerhofer, D D; Moses, E

2012-05-25

Ignition implosions on the National Ignition Facility [J. D. Lindl et al., Phys. Plasmas 11, 339 (2004)] are underway with the goal of compressing deuterium-tritium fuel to a sufficiently high areal density (ρR) to sustain a self-propagating burn wave required for fusion power gain greater than unity. These implosions are driven with a very carefully tailored sequence of four shock waves that must be timed to very high precision to keep the fuel entropy and adiabat low and ρR high. The first series of precision tuning experiments on the National Ignition Facility, which use optical diagnostics to directly measure the strength and timing of all four shocks inside a hohlraum-driven, cryogenic liquid-deuterium-filled capsule interior have now been performed. The results of these experiments are presented demonstrating a significant decrease in adiabat over previously untuned implosions. The impact of the improved shock timing is confirmed in related deuterium-tritium layered capsule implosions, which show the highest fuel compression (ρR~1.0 g/cm(2)) measured to date, exceeding the previous record [V. Goncharov et al., Phys. Rev. Lett. 104, 165001 (2010)] by more than a factor of 3. The experiments also clearly reveal an issue with the 4th shock velocity, which is observed to be 20% slower than predictions from numerical simulation.

Why do health workers give anti-malarials to patients with negative rapid test results? A qualitative study at rural health facilities in western Uganda.

PubMed

Altaras, Robin; Nuwa, Anthony; Agaba, Bosco; Streat, Elizabeth; Tibenderana, James K; Strachan, Clare E

2016-01-11

The large-scale introduction of malaria rapid diagnostic tests (RDTs) promises to improve management of fever patients and the rational use of valuable anti-malarials. However, evidence on the impact of RDT introduction on the overprescription of anti-malarials has been mixed. This study explored determinants of provider decision-making to prescribe anti-malarials following a negative RDT result. A qualitative study was conducted in a rural district in mid-western Uganda in 2011, ten months after RDT introduction. Prescriptions for all patients with negative RDT results were first audited from outpatient registers for a two month period at all facilities using RDTs (n = 30). Facilities were then ranked according to overall prescribing performance, defined as the proportion of patients with a negative RDT result prescribed any anti-malarial. Positive and negative deviant facilities were sampled for qualitative investigation; positive deviants (n = 5) were defined ex post facto as <0.75% and negative deviants (n = 7) as >5%. All prescribing clinicians were targeted for qualitative observation and in-depth interview; 55 fever cases were observed and 22 providers interviewed. Thematic analysis followed the 'framework' approach. 8344 RDT-negative patients were recorded at the 30 facilities (prescription audit); 339 (4.06%) were prescribed an anti-malarial. Of the 55 observed patients, 38 tested negative; one of these was prescribed an anti-malarial. Treatment decision-making was influenced by providers' clinical beliefs, capacity constraints, and perception of patient demands. Although providers generally trusted the accuracy of RDTs, anti-malarial prescription was driven by perceptions of treatment failure or undetectable malaria in patients who had already taken artemisinin-based combination therapy prior to facility arrival. Patient assessment and other diagnostic practices were minimal and providers demonstrated limited ability to identify alternative causes of fever. Provider perceptions of patient expectations sometimes appeared to influence treatment decisions. The study found high provider adherence to RDT results, but that providers believed in certain clinical exceptions and felt they lacked alternative options. Guidance on how the RDT works and testing following partial treatment, better methods for assisting providers in diagnostic decision-making, and a context-appropriate provider behaviour change intervention package are needed.

Summary of the XIII International Workshop on Polarized Sources, Targets and Polarimetry

NASA Astrophysics Data System (ADS)

Rathmann, F.

2011-01-01

The workshops on polarized sources, targets, and polarimetry are held every two years. The present meeting took place in Ferrara, Italy, and was organized by the University of Ferrara. Sessions on Polarized Proton and Deuterium Sources, Polarized Electron Sources, Polarimetry, Polarized Solid Targets, and Polarized Internal Targets, highlighted topics, recent developments, and progress in the field. A session decicated to Future Facilities provided an overview of a number of new activities in the spin-physics sector at facilities that are currently in the planning stage. Besides presenting a broad overview of polarized ion sources, electron sources, solid and gaseous targets, and their neighboring fields, the workshop also addressed the application of polarized atoms in applied sciences and medicine that is becoming increasingly important.

Laser-driven ion acceleration via target normal sheath acceleration in the relativistic transparency regime

DOE PAGES

Poole, P. L.; Obst, L.; Cochran, G. E.; ...

2018-01-11

Here we present an experimental study investigating laser-driven proton acceleration via target normal sheath acceleration (TNSA) over a target thickness range spanning the typical TNSA-dominant regime (~1 μm) down to below the onset of relativistic laser-transparency (<40 nm). This is done with a single target material in the form of freely adjustable films of liquid crystals along with high contrast (via plasma mirror) laser interaction (~2.65 J, 30 fs, I>1 x 10 21 W cm -2). Thickness dependent maximum proton energies scale well with TNSA models down to the thinnest targets, while those under ~40 nm indicate the influence ofmore » relativistic transparency on TNSA, observed via differences in light transmission, maximum proton energy, and proton beam spatial profile. Oblique laser incidence (45°) allowed the fielding of numerous diagnostics to determine the interaction quality and details: ion energy and spatial distribution was measured along the laser axis and both front and rear target normal directions; these along with reflected and transmitted light measurements on-shot verify TNSA as dominant during high contrast interaction, even for ultra-thin targets. Additionally, 3D particle-in-cell simulations qualitatively support the experimental observations of target-normal-directed proton acceleration from ultra-thin films.« less

Laser-driven ion acceleration via target normal sheath acceleration in the relativistic transparency regime

DOE Office of Scientific and Technical Information (OSTI.GOV)

Poole, P. L.; Obst, L.; Cochran, G. E.

Here we present an experimental study investigating laser-driven proton acceleration via target normal sheath acceleration (TNSA) over a target thickness range spanning the typical TNSA-dominant regime (~1 μm) down to below the onset of relativistic laser-transparency (<40 nm). This is done with a single target material in the form of freely adjustable films of liquid crystals along with high contrast (via plasma mirror) laser interaction (~2.65 J, 30 fs, I>1 x 10 21 W cm -2). Thickness dependent maximum proton energies scale well with TNSA models down to the thinnest targets, while those under ~40 nm indicate the influence ofmore » relativistic transparency on TNSA, observed via differences in light transmission, maximum proton energy, and proton beam spatial profile. Oblique laser incidence (45°) allowed the fielding of numerous diagnostics to determine the interaction quality and details: ion energy and spatial distribution was measured along the laser axis and both front and rear target normal directions; these along with reflected and transmitted light measurements on-shot verify TNSA as dominant during high contrast interaction, even for ultra-thin targets. Additionally, 3D particle-in-cell simulations qualitatively support the experimental observations of target-normal-directed proton acceleration from ultra-thin films.« less

Shaping Crystal-Crystal Phase Transitions

NASA Astrophysics Data System (ADS)

Du, Xiyu; van Anders, Greg; Dshemuchadse, Julia; Glotzer, Sharon

Previous computational and experimental studies have shown self-assembled structure depends strongly on building block shape. New synthesis techniques have led to building blocks with reconfigurable shape and it has been demonstrated that building block reconfiguration can induce bulk structural reconfiguration. However, we do not understand systematically how this transition happens as a function of building block shape. Using a recently developed ``digital alchemy'' framework, we study the thermodynamics of shape-driven crystal-crystal transitions. We find examples of shape-driven bulk reconfiguration that are accompanied by first-order phase transitions, and bulk reconfiguration that occurs without any thermodynamic phase transition. Our results suggest that for well-chosen shapes and structures, there exist facile means of bulk reconfiguration, and that shape-driven bulk reconfiguration provides a viable mechanism for developing functional materials.

Detection of facilities in satellite imagery using semi-supervised image classification and auxiliary contextual observables

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harvey, Neal R; Ruggiero, Christy E; Pawley, Norma H

2009-01-01

Detecting complex targets, such as facilities, in commercially available satellite imagery is a difficult problem that human analysts try to solve by applying world knowledge. Often there are known observables that can be extracted by pixel-level feature detectors that can assist in the facility detection process. Individually, each of these observables is not sufficient for an accurate and reliable detection, but in combination, these auxiliary observables may provide sufficient context for detection by a machine learning algorithm. We describe an approach for automatic detection of facilities that uses an automated feature extraction algorithm to extract auxiliary observables, and a semi-supervisedmore » assisted target recognition algorithm to then identify facilities of interest. We illustrate the approach using an example of finding schools in Quickbird image data of Albuquerque, New Mexico. We use Los Alamos National Laboratory's Genie Pro automated feature extraction algorithm to find a set of auxiliary features that should be useful in the search for schools, such as parking lots, large buildings, sports fields and residential areas and then combine these features using Genie Pro's assisted target recognition algorithm to learn a classifier that finds schools in the image data.« less

Assessment and Mitigation of Diagnostic-Generated Electromagnetic Interference at the National Ignition Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, C G; Ayers, M J; Felker, B

2012-04-20

Electromagnetic interference (EMI) is an ever-present challenge at laser facilities such as the National Ignition Facility (NIF). The major source of EMI at such facilities is laser-target interaction that can generate intense electromagnetic fields within, and outside of, the laser target chamber. In addition, the diagnostics themselves can be a source of EMI, even interfering with themselves. In this paper we describe EMI generated by ARIANE and DIXI, present measurements, and discuss effects of the diagnostic-generated EMI on ARIANE's CCD and on a PMT nearby DIXI. Finally we present some of the efforts we have made to mitigate the effectsmore » of diagnostic-generated EMI on NIF diagnostics.« less

Overview of laser systems for the Orion facility at the AWE.

PubMed

Hopps, Nicholas; Danson, Colin; Duffield, Stuart; Egan, David; Elsmere, Stephen; Girling, Mark; Harvey, Ewan; Hillier, David; Norman, Michael; Parker, Stefan; Treadwell, Paul; Winter, David; Bett, Thomas

2013-05-20

The commissioning of the Orion laser facility at the Atomic Weapons Establishment (AWE) in the UK has recently been completed. The facility is a twelve beam Nd:glass-based system for studying high energy density physics. It consists of ten frequency-tripled beam-lines operating with nanosecond pulses, synchronized with two beam-lines with subpicosecond pulses, each capable of delivering 500 J to target. One of the short pulse beams has the option of frequency doubling, at reduced aperture, to yield up to 100 J at 527 nm in a subpicosecond pulse with high temporal contrast. An extensive array of target diagnostics is provided. This article describes the laser design and commissioning and presents key performance data of the facility's laser systems.

HSR Model Deformation Measurements from Subsonic to Supersonic Speeds

NASA Technical Reports Server (NTRS)

Burner, A. W.; Erickson, G. E.; Goodman, W. L.; Fleming, G. A.

1999-01-01

This paper describes the video model deformation technique (VMD) used at five NASA facilities and the projection moire interferometry (PMI) technique used at two NASA facilities. Comparisons between the two techniques for model deformation measurements are provided. Facilities at NASA-Ames and NASA-Langley where deformation measurements have been made are presented. Examples of HSR model deformation measurements from the Langley Unitary Wind Tunnel, Langley 16-foot Transonic Wind Tunnel, and the Ames 12-foot Pressure Tunnel are presented. A study to improve and develop new targeting schemes at the National Transonic Facility is also described. The consideration of milled targets for future HSR models is recommended when deformation measurements are expected to be required. Finally, future development work for VMD and PMI is addressed.

Designing an upgrade of the Medley setup for light-ion production and fission cross-section measurements

NASA Astrophysics Data System (ADS)

Jansson, K.; Gustavsson, C.; Al-Adili, A.; Hjalmarsson, A.; Andersson-Sundén, E.; Prokofiev, A. V.; Tarrío, D.; Pomp, S.

2015-09-01

Measurements of neutron-induced fission cross-sections and light-ion production are planned in the energy range 1-40 MeV at the upcoming Neutrons For Science (NFS) facility. In order to prepare our detector setup for the neutron beam with continuous energy spectrum, a simulation software was written using the Geant4 toolkit for both measurement situations. The neutron energy range around 20 MeV is troublesome when it comes to the cross-sections used by Geant4 since data-driven cross-sections are only available below 20 MeV but not above, where they are based on semi-empirical models. Several customisations were made to the standard classes in Geant4 in order to produce consistent results over the whole simulated energy range. Expected uncertainties are reported for both types of measurements. The simulations have shown that a simultaneous precision measurement of the three standard cross-sections H(n,n), 235U(n,f) and 238U(n,f) relative to each other is feasible using a triple layered target. As high resolution timing detectors for fission fragments we plan to use Parallel Plate Avalanche Counters (PPACs). The simulation results have put some restrictions on the design of these detectors as well as on the target design. This study suggests a fissile target no thicker than 2 μm (1.7 mg/cm2) and a PPAC foil thickness preferably less than 1 μm. We also comment on the usability of Geant4 for simulation studies of neutron reactions in this energy range.

A variable-instar climate-driven individual beetle-based phenology model for the invasive Asian longhorned beetle (Coleoptera: Cerambycidae)

Treesearch

R. Talbot Trotter, III; Melody A. Keena

2016-01-01

Efforts to manage and eradicate invasive species can benefit from an improved understanding of the physiology, biology, and behavior of the target species, and ongoing efforts to eradicate the Asian longhorned beetle (Anoplophora glabripennis Motschulsky) highlight the roles this information may play. Here, we present a climate-driven phenology...

Recent and future liquid metal experiments on homogeneous dynamo action and magnetic instabilities

NASA Astrophysics Data System (ADS)

Stefani, Frank; Gerbeth, Gunter; Giesecke, Andre; Gundrum, Thomas; Kirillov, Oleg; Seilmayer, Martin; Gellert, Marcus; Rüdiger, Günther; Gailitis, Agris

2011-10-01

The present status of the Riga dynamo experiment is summarized and the prospects for its future exploitation are evaluated. We further discuss the plans for a large-scale precession driven dynamo experiment to be set-up in the framework of the new installation DRESDYN (DREsden Sodium facility for dynamo and thermohydraulic studies) at Helmholtz-Zentrum Dresden-Rossendorf. We report recent investigations of the magnetorotational instability and the Tayler instability and sketch the plans for another large-scale liquid sodium facility devoted to the combined study of both effects.

Impact of Family Planning and Business Trainings on Private-Sector Health Care Providers in Nigeria.

PubMed

Ugaz, Jorge; Leegwater, Anthony; Chatterji, Minki; Johnson, Doug; Baruwa, Sikiru; Toriola, Modupe; Kinnan, Cynthia

2017-06-01

Private health care providers are an important source of modern contraceptives in Sub-Saharan Africa, yet they face many challenges that might be addressed through targeted training. This study measures the impact of a package of trainings and supportive supervision activities targeted to private health care providers in Lagos State, Nigeria, on outcomes including range of contraceptive methods offered, providers' knowledge and quality of counseling, recordkeeping practices, access to credit and revenue. A total of 965 health care facilities were randomly assigned to treatment and control groups. Facilities in the treatment group-but not those in the control group-were offered a training package that included a contraceptive technology update and interventions to improve counseling and clinical skills and business practices. Multivariate regression analysis of data collected through facility and mystery client surveys was used to estimate effects. The training program had a positive effect on the range of contraceptive methods offered, with facilities in the treatment group providing more methods than facilities in the control group. The training program also had a positive impact on the quality of counseling services, especially on the range of contraceptive methods discussed by providers, their interpersonal skills and overall knowledge. Facilities in the treatment group were more likely than facilities in the control group to have good recordkeeping practices and to have obtained loans. No effect was found on revenue generation. Targeted training programs can be effective tools to improve the provision of family planning services through private providers.

Lateralization of spatial rather than temporal attention underlies the left hemifield advantage in rapid serial visual presentation.

PubMed

Asanowicz, Dariusz; Kruse, Lena; Śmigasiewicz, Kamila; Verleger, Rolf

2017-11-01

In bilateral rapid serial visual presentation (RSVP), the second of two targets, T1 and T2, is better identified in the left visual field (LVF) than in the right visual field (RVF). This LVF advantage may reflect hemispheric asymmetry in temporal attention or/and in spatial orienting of attention. Participants performed two tasks: the "standard" bilateral RSVP task (Exp.1) and its unilateral variant (Exp.1 & 2). In the bilateral task, spatial location was uncertain, thus target identification involved stimulus-driven spatial orienting. In the unilateral task, the targets were presented block-wise in the LVF or RVF only, such that no spatial orienting was needed for target identification. Temporal attention was manipulated in both tasks by varying the T1-T2 lag. The results showed that the LVF advantage disappeared when involvement of stimulus-driven spatial orienting was eliminated, whereas the manipulation of temporal attention had no effect on the asymmetry. In conclusion, the results do not support the hypothesis of hemispheric asymmetry in temporal attention, and provide further evidence that the LVF advantage reflects right hemisphere predominance in stimulus-driven orienting of spatial attention. These conclusions fit evidence that temporal attention is implemented by bilateral parietal areas and spatial attention by the right-lateralized ventral frontoparietal network. Copyright © 2017 Elsevier Inc. All rights reserved.

Facility target insert shielding assessment

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mocko, Michal

2015-10-06

Main objective of this report is to assess the basic shielding requirements for the vertical target insert and retrieval port. We used the baseline design for the vertical target insert in our calculations. The insert sits in the 12”-diameter cylindrical shaft extending from the service alley in the top floor of the facility all the way down to the target location. The target retrieval mechanism is a long rod with the target assembly attached and running the entire length of the vertical shaft. The insert also houses the helium cooling supply and return lines each with 2” diameter. In themore » present study we focused on calculating the neutron and photon dose rate fields on top of the target insert/retrieval mechanism in the service alley. Additionally, we studied a few prototypical configurations of the shielding layers in the vertical insert as well as on the top.« less

Observation of Gigawatt-Class THz Pulses from a Compact Laser-Driven Particle Accelerator

NASA Astrophysics Data System (ADS)

Gopal, A.; Herzer, S.; Schmidt, A.; Singh, P.; Reinhard, A.; Ziegler, W.; Brömmel, D.; Karmakar, A.; Gibbon, P.; Dillner, U.; May, T.; Meyer, H.-G.; Paulus, G. G.

2013-08-01

We report the observation of subpicosecond terahertz (T-ray) pulses with energies ≥460μJ from a laser-driven ion accelerator, thus rendering the peak power of the source higher even than that of state-of-the-art synchrotrons. Experiments were performed with intense laser pulses (up to 5×1019W/cm2) to irradiate thin metal foil targets. Ion spectra measured simultaneously showed a square law dependence of the T-ray yield on particle number. Two-dimensional particle-in-cell simulations show the presence of transient currents at the target rear surface which could be responsible for the strong T-ray emission.

Role of attentional tags in working memory-driven attentional capture.

PubMed

Kuo, Chun-Yu; Chao, Hsuan-Fu

2014-08-01

Recent studies have demonstrated that the contents of working memory capture attention when performing a visual search task. However, it remains an intriguing and unresolved question whether all kinds of items stored in working memory capture attention. The present study investigated this issue by manipulating the attentional tags (target or distractor) associated with information maintained in working memory. The results showed that working memory-driven attentional capture is a flexible process, and that attentional tags associated with items stored in working memory do modulate attentional capture. When items were tagged as a target, they automatically captured attention; however, when items were tagged as a distractor, attentional capture was reduced.

Theory-Driven Intervention for Changing Personality: Expectancy Value Theory, Behavioral Activation, and Conscientiousness

PubMed Central

Magidson, Jessica F.; Roberts, Brent; Collado-Rodriguez, Anahi; Lejuez, C.W.

2013-01-01

Considerable evidence suggests that personality traits may be changeable, raising the possibility that personality traits most linked to health problems can be modified with intervention. A growing body of research suggests that problematic personality traits may be altered with behavioral intervention using a bottom-approach. That is, by targeting core behaviors that underlie personality traits with the goal of engendering new, healthier patterns of behavior that over time become automatized and manifest in changes in personality traits. Nevertheless, a bottom-up model for changing personality traits is somewhat diffuse and requires clearer integration of theory and relevant interventions to enable real clinical application. As such, this manuscript proposes a set of guiding principles for theory-driven modification of targeted personality traits using a bottom-up approach, focusing specifically on targeting the trait of conscientiousness using a relevant behavioral intervention, Behavioral Activation (BA), considered within the motivational framework of Expectancy Value Theory (EVT). We conclude with a real case example of the application of BA to alter behaviors counter to conscientiousness in a substance dependent patient, highlighting the EVT principles most relevant to the approach and the importance and viability of a theoretically-driven, bottom-up approach to changing personality traits. PMID:23106844

Design study of a raster scanning system for moving target irradiation in heavy-ion radiotherapy.

PubMed

Furukawa, Takuji; Inaniwa, Taku; Sato, Shinji; Tomitani, Takehiro; Minohara, Shinichi; Noda, Koji; Kanai, Tatsuaki

2007-03-01

A project to construct a new treatment facility as an extension of the existing heavy-ion medical accelerator in chiba (HIMAC) facility has been initiated for further development of carbon-ion therapy. The greatest challenge of this project is to realize treatment of a moving target by scanning irradiation. For this purpose, we decided to combine the rescanning technique and the gated irradiation method. To determine how to avoid hot and/or cold spots by the relatively large number of rescannings within an acceptable irradiation time, we have studied the scanning strategy, scanning magnets and their control, and beam intensity dynamic control. We have designed a raster scanning system and carried out a simulation of irradiating moving targets. The result shows the possibility of practical realization of moving target irradiation with pencil beam scanning. We describe the present status of our design study of the raster scanning system for the HIMAC new treatment facility.

ARC-2006-ACD06-0177-011

NASA Image and Video Library

2006-10-18

Ames Hypersonic Free Flight Aerodynamic Facility is used for research on gas dynamic problems of atmospheric entry. High relative speeds are achieved by launching models (in sabots if necessary) from high-speed guns into a countercurrent hypersonic air stream (14,000 ft/sec) driven by combustion-powered shock tube.

Aid and Education in the South Pacific.

ERIC Educational Resources Information Center

Luteru, P. H.; Teasdale, G. R.

1993-01-01

Pacific Island nations perceive their main educational needs and priorities to be expansion of primary education, locally relevant curriculum development, provision of adequate facilities and resources, and teacher education. Yet, driven by self-interest, international aid donors such as Australia and New Zealand concentrate their funding on…

High Mach Number Scramjet Test Flows in the X3 Expansion Tube

NASA Astrophysics Data System (ADS)

Gildfind, D. E.; Sancho, J.; Morgan, R. G.

The University of Queensland (UQ) has two free-piston driven expansion tube facilities; X2 has a total length of 23 m and was originally commissioned in 1995 [1]; X3 is much longer at 62 m, and was commissioned in 2001 [2].

75 FR 33803 - Sabine Pipe Line LLC; Notice of Request Under Blanket Authorization

Federal Register 2010, 2011, 2012, 2013, 2014

2010-06-15

... natural gas-driven compressor units totaling 2,464 horsepower. Sabine states that for the past several years, the Lake Charles Compressor Facilities have not been necessary to provide transportation services... comments, protests, and interventions via the Internet in lieu [[Page 33804

Fecal microbiota manipulation prevents dysbiosis and alcohol-induced liver injury in mice.

PubMed

Ferrere, Gladys; Wrzosek, Laura; Cailleux, Frédéric; Turpin, Williams; Puchois, Virginie; Spatz, Madeleine; Ciocan, Dragos; Rainteau, Dominique; Humbert, Lydie; Hugot, Cindy; Gaudin, Françoise; Noordine, Marie-Louise; Robert, Véronique; Berrebi, Dominique; Thomas, Muriel; Naveau, Sylvie; Perlemuter, Gabriel; Cassard, Anne-Marie

2017-04-01

Alcoholic liver disease (ALD) is a leading cause of liver failure and mortality. In humans, severe alcoholic hepatitis is associated with key changes to intestinal microbiota (IM), which influences individual sensitivity to develop advanced ALD. We used the different susceptibility to ALD observed in two distinct animal facilities to test the efficiency of two complementary strategies (fecal microbiota transplantation and prebiotic treatment) to reverse dysbiosis and prevent ALD. Mice were fed alcohol in two distinct animal facilities with a Lieber DeCarli diet. Fecal microbiota transplantation was performed with fresh feces from alcohol-resistant donor mice to alcohol-sensitive receiver mice three times a week. Another group of mice received pectin during the entire alcohol consumption period. Ethanol induced steatosis and liver inflammation, which were associated with disruption of gut homeostasis, in alcohol-sensitive, but not alcohol resistant mice. IM analysis showed that the proportion of Bacteroides was specifically lower in alcohol-sensitive mice (p<0.05). Principal coordinate analysis showed that the IM of sensitive and resistant mice clustered differently. We targeted IM using two different strategies to prevent alcohol-induced liver lesions: (1) pectin treatment which induced major modifications of the IM, (2) fecal microbiota transplantation which resulted in an IM very close to that of resistant donor mice in the sensitive recipient mice. Both methods prevented steatosis, liver inflammation, and restored gut homeostasis. Manipulation of IM can prevent alcohol-induced liver injury. The IM should be considered as a new therapeutic target in ALD. Sensitivity to alcoholic liver disease (ALD) is driven by intestinal microbiota in alcohol fed mice. Treatment of mice with alcohol-induced liver lesions by fecal transplant from alcohol fed mice resistant to ALD or with prebiotic (pectin) prevents ALD. These findings open new possibilities for treatment of human ALD through intestinal microbiota manipulation. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

International accreditation of ambulatory surgical centers and medical tourism.

PubMed

McGuire, Michael F

2013-07-01

The two forces that have driven the increase in accreditation of outpatient ambulatory surgery centers (ASC's) in the United States are reimbursement of facility fees by Medicare and commercial insurance companies, which requires either accreditation, Medicare certification, or state licensure, and state laws which mandate one of these three options. Accreditation of ASC's internationally has been driven by national requirements and by the competitive forces of "medical tourism." The three American accrediting organizations have all developed international programs to meet this increasing demand outside of the United States. Copyright © 2013. Published by Elsevier Inc.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Small-scale impacts as potential trigger for landslides on small Solar system bodies

NASA Astrophysics Data System (ADS)

Hofmann, Marc; Sierks, Holger; Blum, Jürgen

2017-07-01

We conducted a set of experiments to investigate whether millimetre-sized impactors impinging on a granular material at several m s-1 are able to trigger avalanches on small, atmosphereless planetary bodies. These experiments were carried out at the Zentrum für angewandte Raumfahrttechnologie und Mikrogravitation (ZARM) drop tower facility in Bremen, Germany to facilitate a reduced gravity environment. Additional data were gathered at Earth gravity levels in the laboratory. As sample materials we used a ground Howardites, Eucrites and Diogenites (HED) meteorite and the Johnson Space Center (JSC) Mars-1 Martian soil simulant. We found that this type of small-scale impact can trigger avalanches with a moderate probability, if the target material is tilted to an angle close to the angle of repose. We additionally simulated a small-scale impact using the discrete element method code esys-particle. These simulations show that energy transfer from impactor to the target material is most efficient at low- and moderate-impactor inclinations and the transferred energy is retained in particles close to the surface due to a rapid dissipation of energy in lower material layers driven by inelastic collisions. Through Monte Carlo simulations we estimate the time-scale on which small-scale impacts with the observed characteristics will trigger avalanches covering all steep slopes on the surface of a small planetary body to be of the order 105 yr.

Heating in short-pulse laser-driven cone-capped wire targets

NASA Astrophysics Data System (ADS)

Mason, R. J.; Wei, M.; King, J.; Beg, F.; Stephens, R. B.

2007-11-01

The 2-D implicit hybrid simulation code e-PLAS has been used to study heating in cone-capped copper wire targets. The code e-PLAS tracks collisional particle-in-cell (PIC) electrons traversing background plasma of collisional Eulerian cold electron and ion fluids. It computes E- and B-fields by the Implicit Moment Method [1,2]. In recent experiments [3] at the Vulcan laser facility, sub- picosecond laser pulses at 1.06 μm, and 4.0 x 10^20 W/cm^2 intensity were focused into thin-walled (˜10 μm) cones attached to copper wires. The wire diameter was varied from 10-40 μm with a typical length of 1 mm. We characterize heating of the wires as a function of their diameters and length, and relate modifications of this heating to changes in the assumed laser-generated hot electron spectrum and directivity. As in recent nail experiments [4], the cones can serve as reservoirs for hot electrons, diverting them from passage down the wires. [1] R. J. Mason, and C. Cranfill, IEEE Trans. Plasma Sci. PS-14, 45 (1986). [2] R. J. Mason, J. Comp. Phys. 71, 429 (1987). [3] J. King et al., to be submitted to Phys. Rev. Lett.. [4] R. J. Mason, M. Wei, F. Beg, R. Stephens, and C. Snell, in Proc. of ICOPS07, Albuquerque, NM, June 17-22, 2007, Talk 7D4.

Epithelioid Sarcoma: Opportunities for Biology-Driven Targeted Therapy.

PubMed

Noujaim, Jonathan; Thway, Khin; Bajwa, Zia; Bajwa, Ayeza; Maki, Robert G; Jones, Robin L; Keller, Charles

2015-01-01

Epithelioid sarcoma (ES) is a soft tissue sarcoma of children and young adults for which the preferred treatment for localized disease is wide surgical resection. Medical management is to a great extent undefined, and therefore for patients with regional and distal metastases, the development of targeted therapies is greatly desired. In this review, we will summarize clinically relevant biomarkers (e.g., SMARCB1, CA125, dysadherin, and others) with respect to targeted therapeutic opportunities. We will also examine the role of EGFR, mTOR, and polykinase inhibitors (e.g., sunitinib) in the management of local and disseminated disease. Toward building a consortium of pharmaceutical, academic, and non-profit collaborators, we will discuss the state of resources for investigating ES with respect to cell line resources, tissue banks, and registries so that a roadmap can be developed toward effective biology-driven therapies.

Biased and unbiased strategies to identify biologically active small molecules.

PubMed

Abet, Valentina; Mariani, Angelica; Truscott, Fiona R; Britton, Sébastien; Rodriguez, Raphaël

2014-08-15

Small molecules are central players in chemical biology studies. They promote the perturbation of cellular processes underlying diseases and enable the identification of biological targets that can be validated for therapeutic intervention. Small molecules have been shown to accurately tune a single function of pluripotent proteins in a reversible manner with exceptional temporal resolution. The identification of molecular probes and drugs remains a worthy challenge that can be addressed by the use of biased and unbiased strategies. Hypothesis-driven methodologies employs a known biological target to synthesize complementary hits while discovery-driven strategies offer the additional means of identifying previously unanticipated biological targets. This review article provides a general overview of recent synthetic frameworks that gave rise to an impressive arsenal of biologically active small molecules with unprecedented cellular mechanisms. Copyright © 2014. Published by Elsevier Ltd.

What Would You Ideally Do if There Were No Targets? An Ethnographic Study of the Unintended Consequences of Top-Down Governance in Two Clinical Settings

ERIC Educational Resources Information Center

Allard, Jon; Bleakley, Alan

2016-01-01

Top-down policy directives, such as targets and their associated protocols, may be driven politically rather than clinically and can be described as macro-political texts. While targets supposedly provide incentives for healthcare services, they may unintentionally shape practices of accommodation rather than implementation, deflecting…

Target validation: linking target and chemical properties to desired product profile.

PubMed

Wyatt, Paul G; Gilbert, Ian H; Read, Kevin D; Fairlamb, Alan H

2011-01-01

The discovery of drugs is a lengthy, high-risk and expensive business taking at least 12 years and is estimated to cost upwards of US$800 million for each drug to be successfully approved for clinical use. Much of this cost is driven by the late phase clinical trials and therefore the ability to terminate early those projects destined to fail is paramount to prevent unwanted costs and wasted effort. Although neglected diseases drug discovery is driven more by unmet medical need rather than financial considerations, the need to minimise wasted money and resources is even more vital in this under-funded area. To ensure any drug discovery project is addressing the requirements of the patients and health care providers and delivering a benefit over existing therapies, the ideal attributes of a novel drug needs to be pre-defined by a set of criteria called a target product profile. Using a target product profile the drug discovery process, clinical study design, and compound characteristics can be defined all the way back through to the suitability or druggability of the intended biochemical target. Assessment and prioritisation of the most promising targets for entry into screening programmes is crucial for maximising chances of success.

Laser pulse shape design for laser-indirect-driven quasi-isentropic compression experiments

NASA Astrophysics Data System (ADS)

Xue, Quanxi; Jiang, Shaoen; Wang, Zhebin; Wang, Feng; Zhao, Xueqing; Ding, Yongkun

2018-02-01

Laser pulse shape design is a key work in the design of indirect-laser-driven experiments, especially for long pulse laser driven quasi-isentropic compression experiments. A method for designing such a laser pulse shape is given here. What's more, application experiments were performed, and the results of a typical shot are presented. At last of this article, the details of the application of the method are discussed, such as the equation parameter choice, radiation ablation pressure expression, and approximations in the method. The application shows that the method can provide reliable descriptions of the energy distribution in a hohlraum target; thus, it can be used in the design of long-pulse laser driven quasi-isentropic compression experiments and even other indirect-laser-driven experiments.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ackerman, G; Bale, J; Moran, K

Certain types of infrastructure--critical infrastructure (CI)--play vital roles in underpinning our economy, security, and way of life. One particular type of CI--that relating to chemicals--constitutes both an important element of our nation's infrastructure and a particularly attractive set of potential targets. This is primarily because of the large quantities of toxic industrial chemicals (TICs) it employs in various operations and because of the essential economic functions it serves. This study attempts to minimize some of the ambiguities that presently impede chemical infrastructure threat assessments by providing new insight into the key motivational factors that affect terrorist organizations propensity to attackmore » chemical facilities. Prepared as a companion piece to the Center for Nonproliferation Studies August 2004 study--''Assessing Terrorist Motivations for Attacking Critical Infrastructure''--it investigates three overarching research questions: (1) why do terrorists choose to attack chemical-related infrastructure over other targets; (2) what specific factors influence their target selection decisions concerning chemical facilities; and (3) which, if any, types of groups are most inclined to attack chemical infrastructure targets? The study involved a multi-pronged research design, which made use of four discrete investigative techniques to answer the above questions as comprehensively as possible. These include: (1) a review of terrorism and threat assessment literature to glean expert consensus regarding terrorist interest in targeting chemical facilities; (2) the preparation of case studies to help identify internal group factors and contextual influences that have played a significant role in leading some terrorist groups to attack chemical facilities; (3) an examination of data from the Critical Infrastructure Terrorist Incident Catalog (CrITIC) to further illuminate the nature of terrorist attacks against chemical facilities to date; and (4) the refinement of the DECIDe--the Determinants Effecting Critical Infrastructure Decisions--analytical framework to make the factors and dynamics identified by the study more ''usable'' in future efforts to assess terrorist intentions to target chemical-related infrastructure.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Friedman, A; Kwan, J

Earlier this year, the U.S. Department of Energy Office of Fusion Energy Sciences approved the NDCX-II project, a second-generation Neutralized Drift Compression eXperiment. NDCX-II is a collaborative effort of scientists and engineers from Lawrence Berkeley National Laboratory (LBNL), Lawrence Livermore National Laboratory (LLNL), and the Princeton Plasma Physics Laboratory (PPPL), in a formal collaboration known as the Virtual National Laboratory for Heavy Ion Fusion Science (HIFS-VNL). Supported by $11 M of funding from the American Recovery and Reinvestment Act, construction at LBNL commenced in July of 2009, with completion anticipated in March of 2012. Applications of this facility will includemore » studies of: the basic physics of the poorly understood 'warm dense matter' regime of temperatures around 1 eV and densities near solid, using uniform, volumetric ion heating of thin foil targets; ion energy coupling into an ablating plasma (such as that which occurs in an inertial fusion target) using beams with time-varying kinetic energy; space-charge-dominated ion beam dynamics; and beam focusing and pulse compression in neutralizing plasma. The machine will complement facilities at GSI in Darmstadt, Germany, but will employ lower ion kinetic energies and commensurately shorter stopping ranges in matter. Much of this research will contribute directly toward the collaboration's ultimate goal of electric power production via heavy-ion beam-driven inertial confinement fusion ('Heavy-Ion Fusion', or HIF). In inertial fusion, a target containing fusion fuel is heated by energetic 'driver' beams, and undergoes a miniature thermonuclear explosion. Currently the largest U.S. research program in inertial confinement is at Livermore's National Ignition Facility (NIF), a multibillion-dollar, stadium-sized laser facility optimized for studying physics issues relevant to nuclear stockpile stewardship. Nonetheless, NIF is expected to establish the fundamental feasibility of fusion ignition on the laboratory scale, and thus advance this approach to fusion energy. Heavy ion accelerators have a number of attributes (such as efficiency, longevity, and use of magnetic fields for final focusing) that make them attractive candidates as Inertial Fusion energy (IFE) drivers As with LBNL's existing NDCX-I, the new machine will produce short ion pulses using the technique of neutralized drift compression. A head-to-tail velocity gradient is imparted to the beam, which then shortens as it drifts in neutralizing plasma that suppresses space-charge forces. NDCX-II will make extensive use of induction cells and other hardware from the decommissioned ATA facility at LLNL. Figure (1) shows the layout of the facility, to be sited in LBNL's Building 58 alongside the existing NDCX-I apparatus. This second-generation facility represents a significant upgrade from the existing NDCX-I. It will be extensible and reconfigurable; in the configuration that has received the most emphasis, each NDCX-II pulse will deliver 30 nC of ions at 3 MeV into a mm-scale spot onto a thin-foil target. Pulse compression to {approx} 1 ns occurs in the accelerator as well as in the drift compression line; the beam is manipulated using suitably tailored voltage waveforms in the accelerating gaps. NDCX-II employs novel beam dynamics. To use the 200 kV Blumlein power supplies from ATA (blue cylinders in the figure), the pulse duration must first be reduced to less than 70 ns. This shortening is accomplished in an initial stage of non-neutral drift compression, downstream of the injector and the first few induction cells. The compression is sufficiently rapid that fewer than ten long-pulse waveform generators are needed, with Blumleins powering the rest of the acceleration. Extensive simulation studies have enabled an attractive physics design; these employ both a new 1-D code (ASP) and the VNL's workhorse 2-D/3-D code Warp. Snapshots from a simulation movie (available online) appear in Fig. 2. Studies on a dedicated test stand are quantifying the performance of the ATA hardware and of pulsed solenoids that will provide transverse beam confinement (ions require much stronger fields than the electrons accelerated by ATA). For more information, see the recent article in the Berkeley Lab News and references therein. Joe Kwan is the NDCX-II project manager and Alex Friedman is the leader for the physics design.« less

Care outcomes in long-term care facilities in British Columbia, Canada. Does ownership matter?

PubMed

McGregor, Margaret J; Tate, Robert B; McGrail, Kimberlyn M; Ronald, Lisa A; Broemeling, Anne-Marie; Cohen, Marcy

2006-10-01

This study investigated whether for-profit (FP) versus not-for-profit (NP) ownership of long-term care facilities resulted in a difference in hospital admission and mortality rates among facility residents in British Columbia, Canada. This retrospective cohort study used administrative data on all residents of British Columbia long-term care facilities between April 1, 1996, and August 1, 1999 (n = 43,065). Hospitalizations were examined for 6 diagnoses (falls, pneumonia, anemia, dehydration, urinary tract infection, and decubitus ulcers and/or gangrene), which are considered to be reflective of facility quality of care. In addition to FP versus NP status, facilities were divided into ownership subgroups to investigate outcomes by differences in governance and operational structures. We found that, overall, FP facilities demonstrated higher adjusted hospitalization rates for pneumonia, anemia, and dehydration and no difference for falls, urinary tract infections, or DCU/gangrene. FP facilities demonstrated higher adjusted hospitalization rates compared with NP facilities attached to a hospital, amalgamated to a regional health authority, or that were multisite. This effect was not present when comparing FP facilities to NP single-site facilities. There was no difference in mortality rates in FP versus NP facilities. The higher adjusted hospitalization rates in FP versus NP facilities is consistent with previous research from U.S. authors. However, the superior performance by the NP sector is driven by NP-owned facilities connected to a hospital or health authority, or that had more than one site of operation.

First results of the ITER-relevant negative ion beam test facility ELISE (invited).

PubMed

Fantz, U; Franzen, P; Heinemann, B; Wünderlich, D

2014-02-01

An important step in the European R&D roadmap towards the neutral beam heating systems of ITER is the new test facility ELISE (Extraction from a Large Ion Source Experiment) for large-scale extraction from a half-size ITER RF source. The test facility was constructed in the last years at Max-Planck-Institut für Plasmaphysik Garching and is now operational. ELISE is gaining early experience of the performance and operation of large RF-driven negative hydrogen ion sources with plasma illumination of a source area of 1 × 0.9 m(2) and an extraction area of 0.1 m(2) using 640 apertures. First results in volume operation, i.e., without caesium seeding, are presented.

X-ray source development for EXAFS measurements on the National Ignition Facility.

PubMed

Coppari, F; Thorn, D B; Kemp, G E; Craxton, R S; Garcia, E M; Ping, Y; Eggert, J H; Schneider, M B

2017-08-01

Extended X-ray absorption Fine Structure (EXAFS) measurements require a bright, spectrally smooth, and broad-band x-ray source. In a laser facility, such an x-ray source can be generated by a laser-driven capsule implosion. In order to optimize the x-ray emission, different capsule types and laser irradiations have been tested at the National Ignition Facility (NIF). A crystal spectrometer is used to disperse the x-rays and high efficiency image plate detectors are used to measure the absorption spectra in transmission geometry. EXAFS measurements at the K-edge of iron at ambient conditions have been obtained for the first time on the NIF laser, and the requirements for optimization have been established.

PST 2009: XIII International Workshop on Polarized Sources Targets and Polarimetry

NASA Astrophysics Data System (ADS)

Lenisa, Paolo

2011-05-01

The workshops on polarized sources, targets, and polarimetry are held every two years. In 2009 the meeting took place in Ferrara, Italy, and was organized by the University of Ferrara and INFN. Sessions on Polarized Proton and Deuterium Sources, Polarized Electron Sources, Polarimetry, Polarized Solid Targets, and Polarized Internal Targets, highlighted topics, recent developments, and progress in the field. A session dedicated to Future Facilities provided an overview of a number of new activities in the spin-physics sector at facilities that are currently in the planning stage. Besides presenting a broad overview of polarized ion sources, electron sources, solid and gaseous targets, and their neighbouring fields, the workshop also addressed the application of polarized atoms in applied sciences and medicine that is becoming increasingly important.

Fenton-Driven Chemical Regeneration of MTBE-Spent Granular Activated Carbon -- A Pilot Study

EPA Science Inventory

MTBE-spent granular activated carbon (GAC) underwent 3 adsorption/oxidation cycles. Pilot-scale columns were intermittently placed on-line at a ground water pump and treat facility, saturated with MTBE, and regenerated with H2O2 under different chemical, physical, and operational...

A REVIEW OF ACID COPPER PLATING BATH LIFE EXTENSION AND COPPER RECOVERY FROM ACID COPPER BATHS

EPA Science Inventory

Large quantities of hazardous waste, most in aqueous solution or sludges, are being produced at numerous metal plating and processing facilities in the U.S. Regulatory pressures, future liability, and limited landfill space have driven the cost of metal waste disposal to level...

Design and Commissioning of a New Lightweight Piston for the X3 Expansion Tube

NASA Astrophysics Data System (ADS)

Gildfind, D. E.; Morgan, R. G.; Sancho, J.

The University of Queensland's (UQ) X3 facility (Figure 1) is the world's largest free-piston driven expansion tube. It is used to generate hypersonic test flows such as simulation of planetary entry (6-15 km/s) or scramjet flight (3-5 km/s).

The Use of Environmental Test Facilities for Purposes Beyond Their Original Design

NASA Technical Reports Server (NTRS)

Fisher, Terry C.; Marner, W. J.

2000-01-01

Increasing demands from space flight project offices are requiring environmental testing facilities to become more versatile with increased capabilities. At the same time, maintaining a cost-effective approach to test operations has driven efforts to use these facilities for purposes beyond their original design. This paper presents an overview of the Jet Propulsion Laboratory's efforts to provide JPL's space flight projects with test facilities to meet unique test requirements and to serve the needs of selected outside customers. The large number of recent Mars Missions, including the Mars Pathfinder project, have required testing of components and systems in a Martian surface environment in facilities originally designed for deep space testing. The unique problems associated with performing these tests are discussed, along with practical solutions. Other unique test requirements are discussed including the use of space simulation chambers for testing high altitude balloon gondolas and the use of vacuum chambers for system level test firing of an ion propulsion engine.

Facile fabrication of Ag3VO4/attapulgite composites for highly efficient visible light-driven photodegradation towards organic dyes and tetracycline hydrochloride

NASA Astrophysics Data System (ADS)

Luo, Yuting; Luo, Jie; Duan, Guorong; Liu, Xiaoheng

2017-12-01

An efficient one-dimensional attapulgite (ATP)-based photocatalyst, Ag3VO4/ATP nanocomposite, was fabricated by a facile deposition precipitation method with well-dispersed Ag3VO4 nanoparticles anchored on the surface of natural ATP fibers. X-ray diffraction (XRD), scanning electron microscopy (SEM), transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FT-IR), X-ray photoelectron spectroscopy (XPS), and UV-visible diffused reflectance spectroscopy (UV-vis DRS) were employed to investigate the morphologies, structure, and optical property of the prepared photocatalysts. The photocatalytic experiments indicated that the Ag3VO4/ATP nanocomposites exhibited enhanced visible light-driven photocatalytic activity towards the degradation of rhodamine B (RhB), methyl orange (MO), and tetracycline hydrochloride (TCH), of which the 20 wt% Ag3VO4/ATP sample showed superb photocatalytic performance. As demonstrated by N2 adsorption-desorption, photocurrent measurements, electrochemical impedance spectroscopy (EIS), and photoluminescence (PL) spectra analyses, the improved photocatalytic activity arose from the enlarged surface area, the facilitated charge transfer, and the suppressed recombination of photogenerated charge carriers in Ag3VO4/ATP system. Furthermore, radical scavengers trapping experiments and recycling tests were also conducted. This work gives a new insight into fabrication of highly efficient, stable, and cost-effective visible light-driven photocatalyst for practical application in wastewater treatment and environmental remediation.

Commercial Decommissioning at DOE's Rocky Flats

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freiboth, C.; Sandlin, N.; Schubert, A.

2002-02-25

Due in large part to the number of nuclear facilities that make up the DOE complex, DOE-EM work has historically been paperwork intensive and driven by extensive regulations. Requirements for non-nuclear facilities are often grouped with those of nuclear facilities, driving up costs. Kaiser-Hill was interested in applying a commercial model to demolition of these facilities and wanted to apply necessary and sufficient standards to the work activities, but avoid applying unnecessary requirements. Faced with demolishing hundreds of uncontaminated or non-radiologically contaminated facilities, Kaiser-Hill has developed a subcontracting strategy to drastically reduce the cost of demolishing these facilities at Rockymore » Flats. Aiming to tailor the demolition approach of such facilities to more closely follow commercial practices, Kaiser-Hill recently released a Request for Proposals (RFP) for the demolition of the site's former central administration facility. The RFP significantly reduced requirements for compliance with specific DOE directives. Instead, the RFP required subcontractors to comply with health and safety requirements commonly found in the demolition of similar facilities in a commercial setting. This resulted in a number of bids from companies who have normally not bid on DOE work previously and at a reduced cost over previous approaches. This paper will discuss the details of this subcontracting strategy.« less

Characterization of Particles Created By Laser-Driven Hydrothermal Processing

DTIC Science & Technology

2016-06-01

created by laser-driven hydrothermal processing, an innovative technique used for the ablation of submerged materials. Two naturally occurring...processing, characterization, obsidian, tektite, natural glass 15. NUMBER OF PAGES 89 16. PRICE CODE 17. SECURITY CLASSIFICATION OF REPORT...technique used for the ablation of submerged materials. Two naturally occurring materials, obsidian and tektite, were used as targets for this technique

Towards Ontology-Driven Information Systems: Guidelines to the Creation of New Methodologies to Build Ontologies

ERIC Educational Resources Information Center

Soares, Andrey

2009-01-01

This research targeted the area of Ontology-Driven Information Systems, where ontology plays a central role both at development time and at run time of Information Systems (IS). In particular, the research focused on the process of building domain ontologies for IS modeling. The motivation behind the research was the fact that researchers have…

miR-1298 inhibits mutant KRAS-driven tumor growth by repressing FAK and LAMB3

PubMed Central

Zhou, Ying; Dang, Jason; Chang, Kung-Yen; Yau, Edwin; Aza-Blanc, Pedro; Moscat, Jorge; Rana, Tariq M.

2016-01-01

Global microRNA functional screens can offer a strategy to identify synthetic lethal interactions in cancer cells that might be exploited therapeutically. In this study, we applied this strategy to identify novel gene interactions in KRAS mutant cancer cells. In this manner, we discovered miR-1298, a novel miRNA that inhibited the growth of KRAS-driven cells both in vitro and in vivo. Using miR-TRAP affinity purification technology, we identified the tyrosine kinase FAK and the laminin subunit LAMB3 as functional targets of miR-1298. Silencing of FAK or LAMB3 recapitulated the synthetic lethal effects of miR-1298 expression in KRAS-driven cancer cells, whereas co-expression of both proteins was critical to rescue miR-1298-induced cell death. Expression of LAMB3 but not FAK was upregulated by mutant KRAS. In clinical specimens, elevated LAMB3 expression correlated with poorer survival in lung cancer patients with an oncogenic KRAS gene signature, suggesting a novel candidate biomarker in this disease setting. Our results define a novel regulatory pathway in KRAS-driven cancers which offers a potential therapeutic target for their eradication PMID:27698189

D 2 and D-T Liquid-Layer Target Shots at the National Ignition Facility

DOE PAGES

Walters, Curtis; Alger, Ethan; Bhandarkar, Suhas; ...

2018-01-19

Experiments at the National Ignition Facility (NIF) using targets containing a deuterium-tritium (D-T) fuel layer have, until recently, required that a high-quality layer of solid D-T (herein referred to as an ice layer) be formed in the capsule. The development of a process to line the inner surface of a target capsule with a foam layer of a thickness that is typical of ice layers has resulted in the ability to field targets with liquid layers wetting the foam. Successful fielding of liquid-layer targets on NIF required not only a foam-lined capsule but also changes to the capsule filling processmore » and the manner with which the inventory is maintained in the capsule. Additionally, changes to target heater power and the temperature drops across target components were required in order to achieve the desired range of shot temperatures. Finally, these changes and the target’s performance during four target shots on NIF are discussed.« less

D 2 and D-T Liquid-Layer Target Shots at the National Ignition Facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walters, Curtis; Alger, Ethan; Bhandarkar, Suhas

Experiments at the National Ignition Facility (NIF) using targets containing a deuterium-tritium (D-T) fuel layer have, until recently, required that a high-quality layer of solid D-T (herein referred to as an ice layer) be formed in the capsule. The development of a process to line the inner surface of a target capsule with a foam layer of a thickness that is typical of ice layers has resulted in the ability to field targets with liquid layers wetting the foam. Successful fielding of liquid-layer targets on NIF required not only a foam-lined capsule but also changes to the capsule filling processmore » and the manner with which the inventory is maintained in the capsule. Additionally, changes to target heater power and the temperature drops across target components were required in order to achieve the desired range of shot temperatures. Finally, these changes and the target’s performance during four target shots on NIF are discussed.« less

Development of a High Accuracy Angular Measurement System for Langley Research Center Hypersonic Wind Tunnel Facilities

NASA Technical Reports Server (NTRS)

Newman, Brett; Yu, Si-bok; Rhew, Ray D. (Technical Monitor)

2003-01-01

Modern experimental and test activities demand innovative and adaptable procedures to maximize data content and quality while working within severely constrained budgetary and facility resource environments. This report describes development of a high accuracy angular measurement capability for NASA Langley Research Center hypersonic wind tunnel facilities to overcome these deficiencies. Specifically, utilization of micro-electro-mechanical sensors including accelerometers and gyros, coupled with software driven data acquisition hardware, integrated within a prototype measurement system, is considered. Development methodology addresses basic design requirements formulated from wind tunnel facility constraints and current operating procedures, as well as engineering and scientific test objectives. Description of the analytical framework governing relationships between time dependent multi-axis acceleration and angular rate sensor data and the desired three dimensional Eulerian angular state of the test model is given. Calibration procedures for identifying and estimating critical parameters in the sensor hardware is also addressed.

A new gun facility dedicated to performing shock physics and terminal ballistics experiments

NASA Astrophysics Data System (ADS)

Zakraysek, Alan J.; Sutherland, Gerrit T.; Sandusky, Harold D.; Strange, David

2000-04-01

A new building has been constructed to house various powder and single-stage and two-stage gas guns at the Naval Surface Warfare Center, Indian Head Division. Guns previously located at the Naval Research Laboratory and the former White Oak Site of the Naval Surface Warfare Center have been relocated here. Most of the guns are mounted on moveable pedestals to allow them to be shot into various chambers. The facility includes a concrete blast chamber, a target chamber/catch tank for flyer plate experiments, and a target chamber outfitted for terminal ballistics measurements. This paper will discuss the capabilities of this new facility.

Intestinal microbiota in primary sclerosing cholangitis.

PubMed

Hov, Johannes R; Kummen, Martin

2017-03-01

Alterations of the gut-liver axis have been linked to the pathogenesis of primary sclerosing cholangitis (PSC) since the disease was first described. The purpose of this review is to discuss multiple recent studies on the intestinal microbiota in human PSC and experimental models of this disease. Data are available from eight cross-sectional studies of human PSC, which include a variable number of patients (n = 11-85), material (mucosal or fecal), and microbiota profiling methodology. Despite the heterogeneity of the studies, a pattern of differences is observed that could represent a theme or signature of the PSC gut microbiota, characterized by low diversity and with alterations in multiple bacterial taxa. In experimental models of PSC, re-derivation of animals into germ-free facilities may either aggravate or attenuate the disease, depending on host genetics and putative disease mechanisms (e.g., fibrotic or immune-driven processes, respectively). The present data provide a strong rationale to explore the functional consequences of the observed gut microbial alterations and their influence on the pathogenesis in PSC. Studies of gut microbiota as biomarker and treatment target may potentially also lead to early translation into clinical practice.

Harnessing Active Fins to Segregate Nanoparticles from Binary Mixtures

NASA Astrophysics Data System (ADS)

Liu, Ya; Kuksenok, Olga; Bhattacharya, Amitabh; Ma, Yongting; He, Ximin; Aizenberg, Joanna; Balazs, Anna

2014-03-01

One of the challenges in creating high-performance polymeric nanocomposites for optoelectronic applications, such as bilayer solar cells, is establishing effective and facile routes for controlling the properties of interface and segregation of binary particles with hole conductor particles and electron conductor particles. We model nanocomposites that encompass binary particles and binary blends in a microchannel. An array of oscillating microfins is immersed in the fluid and tethered to the floor of the microchannel; the fluid containing mixture of nanoparticles is driven along the channel by an imposed pressure gradient. During the oscillations, the fins with the specific chemical wetting reach the upper fluid when they are upright and are entirely within the lower stream when they are tilted. We introduce specific interaction between the fins and particulates in the solution. Fins can selectively ``catch'' target nanoparticles within the upper fluid stream and then release them into the lower stream. We focus on different modes of fins motion to optimize selective segregation of particles within binary mixture. Our approach provides an effective means of tailoring the properties and ultimate performance of the composites.

What Are Nursing Facilities Doing to Reduce Potentially Avoidable Hospitalizations?

PubMed

Daras, Laura Coots; Wang, Joyce M; Ingber, Melvin J; Ormond, Catherine; Breg, Nathaniel W; Khatutsky, Galina; Feng, Zhanlian

2017-05-01

Hospitalizations among nursing facility residents are frequent and often potentially avoidable. A number of initiatives and interventions have been developed to reduce excessive hospitalizations; however, little is known about the specific approaches nursing facilities use to address this issue. The objective of this study is to better understand which types of interventions nursing facilities have introduced to reduce potentially avoidable hospitalizations of long-stay nursing facility residents. Cross-sectional survey. 236 nursing facilities from 7 states. Nursing facility administrators. Web-based survey to measure whether facilities introduced any policies or procedures designed specifically to reduce potentially avoidable hospitalizations of long-stay nursing facility residents between 2011 and 2015. We surveyed facilities about seven types of interventions and quality improvement activities related to reducing avoidable hospitalizations, including use of Interventions to Reduce Acute Care Transfers (INTERACT) and American Medical Directors Association tools. Ninety-five percent of responding nursing facilities reported having introduced at least one new policy or procedure to reduce nursing facility resident hospitalizations since January 2011. The most common practice reported was hospitalization rate tracking or review, followed by standardized communication tools, such as Situation, Background, Assessment, Recommendation (SBAR). We found some variation in the extent and types of these reported interventions. Nearly all facilities surveyed reported having introduced a variety of initiatives to reduce potentially avoidable hospitalizations, likely driven by federal, state, and corporate initiatives to decrease hospital admissions and readmissions. Copyright © 2017 AMDA – The Society for Post-Acute and Long-Term Care Medicine. All rights reserved.

Demonstration of Ion Kinetic Effects in Inertial Confinement Fusion Implosions and Investigation of Magnetic Reconnection Using Laser-Produced Plasmas

NASA Astrophysics Data System (ADS)

Rosenberg, M. J.

2016-10-01

Shock-driven laser inertial confinement fusion (ICF) implosions have demonstrated the presence of ion kinetic effects in ICF implosions and also have been used as a proton source to probe the strongly driven reconnection of MG magnetic fields in laser-generated plasmas. Ion kinetic effects arise during the shock-convergence phase of ICF implosions when the mean free path for ion-ion collisions (λii) approaches the size of the hot-fuel region (Rfuel) and may impact hot-spot formation and the possibility of ignition. To isolate and study ion kinetic effects, the ratio of N - K =λii /Rfuel was varied in D3He-filled, shock-driven implosions at the Omega Laser Facility and the National Ignition Facility, from hydrodynamic-like conditions (NK 0.01) to strongly kinetic conditions (NK 10). A strong trend of decreasing fusion yields relative to the predictions of hydrodynamic models is observed as NK increases from 0.1 to 10. Hydrodynamics simulations that include basic models of the kinetic effects that are likely to be present in these experiments-namely, ion diffusion and Knudsen-layer reduction of the fusion reactivity-are better able to capture the experimental results. This type of implosion has also been used as a source of monoenergetic 15-MeV protons to image magnetic fields driven to reconnect in laser-produced plasmas at conditions similar to those encountered at the Earth's magnetopause. These experiments demonstrate that for both symmetric and asymmetric magnetic-reconnection configurations, when plasma flows are much stronger than the nominal Alfvén speed, the rate of magnetic-flux annihilation is determined by the flow velocity and is largely insensitive to initial plasma conditions. This work was supported by the Department of Energy Grant Number DENA0001857.

The Nike KrF laser facility: Performance and initial target experiments

NASA Astrophysics Data System (ADS)

Obenschain, S. P.; Bodner, S. E.; Colombant, D.; Gerber, K.; Lehmberg, R. H.; McLean, E. A.; Mostovych, A. N.; Pronko, M. S.; Pawley, C. J.; Schmitt, A. J.; Sethian, J. D.; Serlin, V.; Stamper, J. A.; Sullivan, C. A.; Dahlburg, J. P.; Gardner, J. H.; Chan, Y.; Deniz, A. V.; Hardgrove, J.; Lehecka, T.; Klapisch, M.

1996-05-01

Krypton-fluoride (KrF) lasers are of interest to laser fusion because they have both the large bandwidth capability (≳THz) desired for rapid beam smoothing and the short laser wavelength (1/4 μm) needed for good laser-target coupling. Nike is a recently completed 56-beam KrF laser and target facility at the Naval Research Laboratory. Because of its bandwidth of 1 THz FWHM (full width at half-maximum), Nike produces more uniform focal distributions than any other high-energy ultraviolet laser. Nike was designed to study the hydrodynamic instability of ablatively accelerated planar targets. First results show that Nike has spatially uniform ablation pressures (Δp/p<2%). Targets have been accelerated for distances sufficient to study hydrodynamic instability while maintaining good planarity. In this review we present the performance of the Nike laser in producing uniform illumination, and its performance in correspondingly uniform acceleration of targets.

Range shortening, radiation transport, and Rayleigh-Taylor instability phenomena in ion-beam-driven inertial-fusion-reactor-size targets: Implosion, ignition, and burn phases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Long, K.A.; Tahir, N.A.

In this paper we present an analysis of the theory of the energy deposition of ions in cold materials and hot dense plasmas together with numerical calculations for heavy and light ions of interest to ion-beam fusion. We have used the g-smcapso-smcapsr-smcapsg-smcapso-smcapsn-smcaps computer code of Long, Moritz, and Tahir (which is an extension of the code originally written for protons by Nardi, Peleg, and Zinamon) to carry out these calculations. The energy-deposition data calculated in this manner has been used in the design of heavy-ion-beam-driven fusion targets suitable for a reactor, by its inclusion in the m-smcapse-smcapsd-smcapsu-smcapss-smcapsa-smcaps code of Christiansen,more » Ashby, and Roberts as extended by Tahir and Long. A number of other improvements have been made in this code and these are also discussed. Various aspects of the theoretical analysis of such targets are discussed including the calculation of the hydrodynamic stability, the hydrodynamic efficiency, and the gain. Various different target designs have been used, some of them new. In general these targets are driven by Bi/sup +/ ions of energy 8--12 GeV, with an input energy of 4--6.5 MJ, with output energies in the range 600--900 MJ, and with gains in the range 120--180. The peak powers are in the range of 500--750 TW. We present detailed calculations of the ablation, compression, ignition, and burn phases. By the application of a new stability analysis which includes ablation and density-gradient effects we show that these targets appear to implode in a stable manner. Thus the targets designed offer working examples suited for use in a future inertial-confinement fusion reactor.« less

Method and apparatus for producing cryogenic targets

DOEpatents

Murphy, James T.; Miller, John R.

1984-01-01

An improved method and apparatus are given for producing cryogenic inertially driven fusion targets in the fast isothermal freezing (FIF) method. Improved coupling efficiency and greater availability of volume near the target for diagnostic purposes and for fusion driver beam propagation result. Other embodiments include a new electrical switch and a new explosive detonator, all embodiments making use of a purposeful heating by means of optical fibers.

Development of an integrated set of research facilities for the support of research flight test

NASA Technical Reports Server (NTRS)

Moore, Archie L.; Harney, Constance D.

1988-01-01

The Ames-Dryden Flight Research Facility (DFRF) serves as the site for high-risk flight research on many one-of-a-kind test vehicles like the X-29A advanced technology demonstrator, F-16 advanced fighter technology integration (AFTI), AFTI F-111 mission adaptive wing, and F-18 high-alpha research vehicle (HARV). Ames-Dryden is on a section of the historic Muroc Range. The facility is oriented toward the testing of high-performance aircraft, as shown by its part in the development of the X-series aircraft. Given the cost of research flight tests and the complexity of today's systems-driven aircraft, an integrated set of ground support experimental facilities is a necessity. In support of the research flight test of highly advanced test beds, the DFRF is developing a network of facilities to expedite the acquisition and distribution of flight research data to the researcher. The network consists of an array of experimental ground-based facilities and systems as nodes and the necessary telecommunications paths to pass research data and information between these facilities. This paper presents the status of the current network, an overview of current developments, and a prospectus on future major enhancements.

Direct measurement of kilo-tesla level magnetic field generated with laser-driven capacitor-coil target by proton deflectometry

NASA Astrophysics Data System (ADS)

Law, K. F. F.; Bailly-Grandvaux, M.; Morace, A.; Sakata, S.; Matsuo, K.; Kojima, S.; Lee, S.; Vaisseau, X.; Arikawa, Y.; Yogo, A.; Kondo, K.; Zhang, Z.; Bellei, C.; Santos, J. J.; Fujioka, S.; Azechi, H.

2016-02-01

A kilo-tesla level, quasi-static magnetic field (B-field), which is generated with an intense laser-driven capacitor-coil target, was measured by proton deflectometry with a proper plasma shielding. Proton deflectometry is a direct and reliable method to diagnose strong, mm3-scale laser-produced B-field; however, this was not successful in the previous experiment. A target-normal-sheath-accelerated proton beam is deflected by Lorentz force in the laser-produced magnetic field with the resulting deflection pattern recorded on a radiochromic film stack. A 610 ± 30 T of B-field amplitude was inferred by comparing the experimental proton pattern with Monte-Carlo calculations. The amplitude and temporal evolutions of the laser-generated B-field were also measured by a differential magnetic probe, independently confirming the proton deflectometry measurement results.

Generation of quasi-monoenergetic protons from a double-species target driven by the radiation pressure of an ultraintense laser pulse

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pae, Ki Hong; Kim, Chul Min, E-mail: chulmin@gist.ac.kr; Advanced Photonics Research Institute, Gwangju Institute of Science and Technology, Gwangju 61005

In laser-driven proton acceleration, generation of quasi-monoenergetic proton beams has been considered a crucial feature of the radiation pressure acceleration (RPA) scheme, but the required difficult physical conditions have hampered its experimental realization. As a method to generate quasi-monoenergetic protons under experimentally viable conditions, we investigated using double-species targets of controlled composition ratio in order to make protons bunched in the phase space in the RPA scheme. From a modified optimum condition and three-dimensional particle-in-cell simulations, we showed by varying the ion composition ratio of proton and carbon that quasi-monoenergetic protons could be generated from ultrathin plane targets irradiated withmore » a circularly polarized Gaussian laser pulse. The proposed scheme should facilitate the experimental realization of ultrashort quasi-monoenergetic proton beams for unique applications in high field science.« less

Semi-analytic model of plasma-jet-driven magneto-inertial fusion

DOE PAGES

Langendorf, Samuel J.; Hsu, Scott C.

2017-03-01

A semi-analytic model for plasma-jet-driven magneto-inertial fusion is presented here. Compressions of a magnetized plasma target by a spherically imploding plasma liner are calculated in one dimension (1D), accounting for compressible hydrodynamics and ionization of the liner material, energy losses due to conduction and radiation, fusion burn and alpha deposition, separate ion and electron temperatures in the target, magnetic pressure, and fuel burn-up. Results show 1D gains of 3–30 at spherical convergence ratio <15 and 20–40 MJ of liner energy, for cases in which the liner thickness is 1 cm and the initial radius of a preheated magnetized target ismore » 4 cm. Some exploration of parameter space and physics settings is presented. The yields observed suggest that there is a possibility of igniting additional dense fuel layers to reach high gain.« less

Electrical-thermal-structural finite element simulation and experimental study of a plasma ion source for the production of radioactive ion beams

NASA Astrophysics Data System (ADS)

Manzolaro, M.; Meneghetti, G.; Andrighetto, A.; Vivian, G.

2016-03-01

The production target and the ion source constitute the core of the selective production of exotic species (SPES) facility. In this complex experimental apparatus for the production of radioactive ion beams, a 40 MeV, 200 μA proton beam directly impinges a uranium carbide target, generating approximately 1013 fissions per second. The transfer line enables the unstable isotopes generated by the 238U fissions in the target to reach the ion source, where they can be ionized and finally accelerated to the subsequent areas of the facility. In this work, the plasma ion source currently adopted for the SPES facility is analyzed in detail by means of electrical, thermal, and structural numerical models. Next, theoretical results are compared with the electric potential difference, temperature, and displacement measurements. Experimental tests with stable ion beams are also presented and discussed.

Laser driven ion accelerator

DOEpatents

Tajima, Toshiki

2006-04-18

A system and method of accelerating ions in an accelerator to optimize the energy produced by a light source. Several parameters may be controlled in constructing a target used in the accelerator system to adjust performance of the accelerator system. These parameters include the material, thickness, geometry and surface of the target.

Objective, Quantitative, Data-Driven Assessment of Chemical Probes.

PubMed

Antolin, Albert A; Tym, Joseph E; Komianou, Angeliki; Collins, Ian; Workman, Paul; Al-Lazikani, Bissan

2018-02-15

Chemical probes are essential tools for understanding biological systems and for target validation, yet selecting probes for biomedical research is rarely based on objective assessment of all potential compounds. Here, we describe the Probe Miner: Chemical Probes Objective Assessment resource, capitalizing on the plethora of public medicinal chemistry data to empower quantitative, objective, data-driven evaluation of chemical probes. We assess >1.8 million compounds for their suitability as chemical tools against 2,220 human targets and dissect the biases and limitations encountered. Probe Miner represents a valuable resource to aid the identification of potential chemical probes, particularly when used alongside expert curation. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Numerical study of core formation of asymmetrically driven cone-guided targets

DOE PAGES

Sawada, Hiroshi; Sakagami, Hitoshi

2017-09-22

Compression of a directly driven fast ignition cone-sphere target with a finite number of laser beams is numerically studied using a three-dimensional hydrodynamics code IMPACT-3D. The formation of a dense plasma core is simulated for 12-, 9-, 6-, and 4-beam configurations of the GEKKO XII laser. The complex 3D shapes of the cores are analyzed by elucidating synthetic 2D x-ray radiographic images in two orthogonal directions. Finally, the simulated x-ray images show significant differences in the core shape between the two viewing directions and rotation of the stagnating core axis in the top view for the axisymmetric 9- and 6-beammore » configurations.« less

Intravascular ultrasound guided directional atherectomy versus directional atherectomy guided by angiography for the treatment of femoropopliteal in-stent restenosis.

PubMed

Krishnan, Prakash; Tarricone, Arthur; K-Raman, Purushothaman; Majeed, Farhan; Kapur, Vishal; Gujja, Karthik; Wiley, Jose; Vasquez, Miguel; Lascano, Rheoneil A; Quiles, Katherine G; Distin, Tashanne; Fontenelle, Ran; Atallah-Lajam, Farah; Kini, Annapoorna; Sharma, Samin

2018-01-01

The aim of this study was to compare 1-year outcomes for patients with femoropopliteal in-stent restenosis using directional atherectomy guided by intravascular ultrasound (IVUS) versus directional atherectomy guided by angiography. This was a retrospective analysis for patients with femoropopliteal in-stent restenosis treated with IVUS-guided directional atherectomy versus directional atherectomy guided by angiography from a single center between March 2012 and February 2016. Clinically driven target lesion revascularization was the primary endpoint and was evaluated through medical chart review as well as phone call follow up. Directional atherectomy guided by IVUS reduces clinically driven target lesion revascularization for patients with femoropopliteal in-stent restenosis.

Numerical study of core formation of asymmetrically driven cone-guided targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sawada, Hiroshi; Sakagami, Hitoshi

Compression of a directly driven fast ignition cone-sphere target with a finite number of laser beams is numerically studied using a three-dimensional hydrodynamics code IMPACT-3D. The formation of a dense plasma core is simulated for 12-, 9-, 6-, and 4-beam configurations of the GEKKO XII laser. The complex 3D shapes of the cores are analyzed by elucidating synthetic 2D x-ray radiographic images in two orthogonal directions. Finally, the simulated x-ray images show significant differences in the core shape between the two viewing directions and rotation of the stagnating core axis in the top view for the axisymmetric 9- and 6-beammore » configurations.« less

43 CFR 10005.15 - Planning and management techniques applicable to the plan.

Code of Federal Regulations, 2013 CFR

2013-10-01

... facilities, instream spawning facilities, water control structures, and fencing that aid in the conservation... biological resources. (g) Applied research that targets specific biological information or management needs...

43 CFR 10005.15 - Planning and management techniques applicable to the plan.

Code of Federal Regulations, 2014 CFR

2014-10-01

... facilities, instream spawning facilities, water control structures, and fencing that aid in the conservation... biological resources. (g) Applied research that targets specific biological information or management needs...

Cross-species identification of genomic drivers of squamous cell carcinoma development across preneoplastic intermediates

PubMed Central

Chitsazzadeh, Vida; Coarfa, Cristian; Drummond, Jennifer A.; Nguyen, Tri; Joseph, Aaron; Chilukuri, Suneel; Charpiot, Elizabeth; Adelmann, Charles H.; Ching, Grace; Nguyen, Tran N.; Nicholas, Courtney; Thomas, Valencia D.; Migden, Michael; MacFarlane, Deborah; Thompson, Erika; Shen, Jianjun; Takata, Yoko; McNiece, Kayla; Polansky, Maxim A.; Abbas, Hussein A.; Rajapakshe, Kimal; Gower, Adam; Spira, Avrum; Covington, Kyle R.; Xiao, Weimin; Gunaratne, Preethi; Pickering, Curtis; Frederick, Mitchell; Myers, Jeffrey N.; Shen, Li; Yao, Hui; Su, Xiaoping; Rapini, Ronald P.; Wheeler, David A.; Hawk, Ernest T.; Flores, Elsa R.; Tsai, Kenneth Y.

2016-01-01

Cutaneous squamous cell carcinoma (cuSCC) comprises 15–20% of all skin cancers, accounting for over 700,000 cases in USA annually. Most cuSCC arise in association with a distinct precancerous lesion, the actinic keratosis (AK). To identify potential targets for molecularly targeted chemoprevention, here we perform integrated cross-species genomic analysis of cuSCC development through the preneoplastic AK stage using matched human samples and a solar ultraviolet radiation-driven Hairless mouse model. We identify the major transcriptional drivers of this progression sequence, showing that the key genomic changes in cuSCC development occur in the normal skin to AK transition. Our data validate the use of this ultraviolet radiation-driven mouse cuSCC model for cross-species analysis and demonstrate that cuSCC bears deep molecular similarities to multiple carcinogen-driven SCCs from diverse sites, suggesting that cuSCC may serve as an effective, accessible model for multiple SCC types and that common treatment and prevention strategies may be feasible. PMID:27574101

Energetic electrons driven in the polarization direction of an intense laser beam incident normal to a solid target

DOE PAGES

Seely, J. F.; Hudson, L. T.; Pereira, N.; ...

2016-02-24

Experiments were performed at the LLNL Titan laser to measure the propagation direction of the energetic electrons that were generated during the interaction of the polarized laser beam with solid targets in the case of normal incidence. The energetic electrons propagated through vacuum to spectator metal wires in the polarization direction and in the perpendicular direction, and the K shell spectra from the different wire materials were recorded as functions of the distance from the laser focal spot. It was found that the fluence of the energetic electrons driven into the spectator wires in the polarization direction compared to themore » perpendicular direction was larger and increased with the distance from the focal spot. Finally, this indicates that energetic electrons are preferentially driven in the direction of the intense oscillating electric field of the incident laser beam in agreement with the multiphoton inverse Bremsstrahlung absorption process.« less

miRNA-embedded shRNAs for Lineage-specific BCL11A Knockdown and Hemoglobin F Induction

PubMed Central

Guda, Swaroopa; Brendel, Christian; Renella, Raffaele; Du, Peng; Bauer, Daniel E; Canver, Matthew C; Grenier, Jennifer K; Grimson, Andrew W; Kamran, Sophia C; Thornton, James; de Boer, Helen; Root, David E; Milsom, Michael D; Orkin, Stuart H; Gregory, Richard I; Williams, David A

2015-01-01

RNA interference (RNAi) technology using short hairpin RNAs (shRNAs) expressed via RNA polymerase (pol) III promoters has been widely exploited to modulate gene expression in a variety of mammalian cell types. For certain applications, such as lineage-specific knockdown, embedding targeting sequences into pol II-driven microRNA (miRNA) architecture is required. Here, using the potential therapeutic target BCL11A, we demonstrate that pol III-driven shRNAs lead to significantly increased knockdown but also increased cytotoxcity in comparison to pol II-driven miRNA adapted shRNAs (shRNAmiR) in multiple hematopoietic cell lines. We show that the two expression systems yield mature guide strand sequences that differ by a 4 bp shift. This results in alternate seed sequences and consequently influences the efficacy of target gene knockdown. Incorporating a corresponding 4 bp shift into the guide strand of shRNAmiRs resulted in improved knockdown efficiency of BCL11A. This was associated with a significant de-repression of the hemoglobin target of BCL11A, human γ-globin or the murine homolog Hbb-y. Our results suggest the requirement for optimization of shRNA sequences upon incorporation into a miRNA backbone. These findings have important implications in future design of shRNAmiRs for RNAi-based therapy in hemoglobinopathies and other diseases requiring lineage-specific expression of gene silencing sequences. PMID:26080908

Data-driven risk identification in phase III clinical trials using central statistical monitoring.

PubMed

Timmermans, Catherine; Venet, David; Burzykowski, Tomasz

2016-02-01

Our interest lies in quality control for clinical trials, in the context of risk-based monitoring (RBM). We specifically study the use of central statistical monitoring (CSM) to support RBM. Under an RBM paradigm, we claim that CSM has a key role to play in identifying the "risks to the most critical data elements and processes" that will drive targeted oversight. In order to support this claim, we first see how to characterize the risks that may affect clinical trials. We then discuss how CSM can be understood as a tool for providing a set of data-driven key risk indicators (KRIs), which help to organize adaptive targeted monitoring. Several case studies are provided where issues in a clinical trial have been identified thanks to targeted investigation after the identification of a risk using CSM. Using CSM to build data-driven KRIs helps to identify different kinds of issues in clinical trials. This ability is directly linked with the exhaustiveness of the CSM approach and its flexibility in the definition of the risks that are searched for when identifying the KRIs. In practice, a CSM assessment of the clinical database seems essential to ensure data quality. The atypical data patterns found in some centers and variables are seen as KRIs under a RBM approach. Targeted monitoring or data management queries can be used to confirm whether the KRIs point to an actual issue or not.

Observation of a Hydrodynamically Driven, Radiative Precursor Shock

NASA Astrophysics Data System (ADS)

Keiter, P. A.; Drake, R. P.; Perry, T. S.; Robey, H.; Remington, B. A.; Iglesias, C. A.; Turner, N.; Stone, J.; Knauer, J.

2001-10-01

Many astrophysical systems, such as supernova remnants and jets, produce radiative-precursor shock waves. In a radiative-precursor shock, radiation from the shock ionizes and heats the medium ahead of it. The simulation of such systems requires that one treat both the emission and the absorption of the radiation. An important goal of this effort is to produce an experiment that can be modeled by astrophysical codes without implementing laser absorption physics into an astrophysical code. We report here the first measurements of a radiative-precursor shock in such an experiment. The experimental design is based on a past experiment[1,2] that used the Nova laser facility to simulate young supernova remnants. The target consists of a 60 νm CH plastic plug followed by a 150 νm vacuum gap and 2 mm of SiO2 aerogel foam. For the experiment, the density of the components and the laser-irradiation conditions are chosen so that the driven shock will produce an observable radiative precursor. We observed the radiative-precursor by using absorption spectroscopy. By backlighting the silicate aerogel foam with a thulium backlighter, we were able to observe both the 1s-2p and 1s-3p lines. These observations will allow us to determine the temperature profile in the precursor. 1. R.P. Drake, et al, Phys. Rev. Lett. 81, 2068 (1998). 2. R.P. Drake, et al., Phys. Plasmas, 7, 2142 (2000) Work supported by the U.S. Department of Energy both directly and through the Lawrence Livermore National Laboratory

Physics design of a 10 MeV injector test stand for an accelerator-driven subcritical system

NASA Astrophysics Data System (ADS)

Yan, Fang; Pei, Shilun; Geng, Huiping; Meng, Cai; Zhao, Yaliang; Sun, Biao; Cheng, Peng; Yang, Zheng; Ouyang, Huafu; Li, Zhihui; Tang, Jingyu; Wang, Jianli; Sui, Yefeng; Dai, Jianping; Sha, Peng; Ge, Rui

2015-05-01

The 10 MeV accelerator-driven subcritical system (ADS) Injector I test stand at Institute of High Energy Physics (IHEP) is a testing facility dedicated to demonstrate one of the two injector design schemes [Injector Scheme-I, which works at 325 MHz], for the ADS project in China. The injector is composed of two parts, the linac part and the beam dump line. The former is designed on the basis of 325 MHz four-vane type copper structure radio frequency quadrupole and superconducting (SC) spoke cavities with β =0.12 . The latter is designed to transport the beam coming out of the SC section of the linac to the beam dump, where the beam transverse profile is fairly enlarged and unformed to simplify the beam target design. The SC section consists of two cryomodules with 14 β =0.12 Spoke cavities, 14 solenoid and 14 BPMs in total. The first challenge in the physics design comes from the necessary space required for the cryomodule separation where the periodical lattice is destroyed at a relatively lower energy of ˜5 MeV . Another challenge is the beam dump line design, as it will be the first beam dump line being built by using a step field magnet for the transverse beam expansion and uniformity in the world. This paper gives an overview of the physics design study together with the design principles and machine construction considerations. The results of an optimized design, fabrication status and end to end simulations including machine errors are presented.

The Impact of Pollution Prevention on Toxic Environmental Releases from U.S. Manufacturing Facilities.

PubMed

Ranson, Matthew; Cox, Brendan; Keenan, Cheryl; Teitelbaum, Daniel

2015-11-03

Between 1991 and 2012, the facilities that reported to the U.S. Environmental Protection Agency's Toxic Release Inventory (TRI) Program conducted 370,000 source reduction projects. We use this data set to conduct the first quasi-experimental retrospective evaluation of how implementing a source reduction (pollution prevention) project affects the quantity of toxic chemicals released to the environment by an average industrial facility. We use a differences-in-differences methodology, which measures how implementing a source reduction project affects a facility's releases of targeted chemicals, relative to releases of (a) other untargeted chemicals from the same facility, or (b) the same chemical from other facilities in the same industry. We find that the average source reduction project causes a 9-16% decrease in releases of targeted chemicals in the year of implementation. Source reduction techniques vary in effectiveness: for example, raw material modification causes a large decrease in releases, while inventory control has no detectable effect. Our analysis suggests that in aggregate, the source reduction projects carried out in the U.S. since 1991 have prevented between 5 and 14 billion pounds of toxic releases.

State Law Approaches to Facility Regulation of Abortion and Other Office Interventions

PubMed Central

Daniel, Sara; Cloud, Lindsay K.

2018-01-01

Objectives. To compare the prevalence and characteristics of facility laws governing abortion provision specifically (targeted regulation of abortion providers [TRAP] laws); office-based surgeries, procedures, sedation or anesthesia (office interventions) generally (OBS laws); and other procedures specifically. Methods. We conducted cross-sectional legal assessments of state facility laws for office interventions in effect as of August 1, 2016. We coded characteristics for each law and compared characteristics across categories of laws. Results. TRAP laws (n = 55; in 34 states) were more prevalent than OBS laws (n = 25; in 25 states) or laws targeting other procedures (n = 1; in 1 state). TRAP laws often regulated facilities that would not be regulated under OBS laws (e.g., all TRAP laws, but only 2 OBS laws, applied regardless of sedation or anesthesia used). TRAP laws imposed more numerous and more stringent requirements than OBS laws. Conclusions. Many states regulate abortion-providing facilities differently, and more stringently, than facilities providing other office interventions. The Supreme Court’s 2016 decision in Whole Woman’s Health v Hellerstedt casts doubt on the legitimacy of that differential treatment. PMID:29470114

Physics of giant electromagnetic pulse generation in short-pulse laser experiments.

PubMed

Poyé, A; Hulin, S; Bailly-Grandvaux, M; Dubois, J-L; Ribolzi, J; Raffestin, D; Bardon, M; Lubrano-Lavaderci, F; D'Humières, E; Santos, J J; Nicolaï, Ph; Tikhonchuk, V

2015-04-01

In this paper we describe the physical processes that lead to the generation of giant electromagnetic pulses (GEMPs) at powerful laser facilities. Our study is based on experimental measurements of both the charging of a solid target irradiated by an ultra-short, ultra-intense laser and the detection of the electromagnetic emission in the GHz domain. An unambiguous correlation between the neutralization current in the target holder and the electromagnetic emission shows that the source of the GEMP is the remaining positive charge inside the target after the escape of fast electrons accelerated by the ultra-intense laser. A simple model for calculating this charge in the thick target case is presented. From this model and knowing the geometry of the target holder, it becomes possible to estimate the intensity and the dominant frequencies of the GEMP at any facility.

Debris and shrapnel assessments for National Ignition Facility targets and diagnostics

NASA Astrophysics Data System (ADS)

Masters, N. D.; Fisher, A.; Kalantar, D.; Stölken, J.; Smith, C.; Vignes, R.; Burns, S.; Doeppner, T.; Kritcher, A.; Park, H.-S.

2016-05-01

High-energy laser experiments at the National Ignition Facility (NIF) can create debris and shrapnel capable of damaging laser optics and diagnostic instruments. The size, composition and location of target components and sacrificial shielding (e.g., disposable debris shields, or diagnostic filters) and the protection they provide is constrained by many factors, including: chamber and diagnostic geometries, experimental goals and material considerations. An assessment of the generation, nature and velocity of shrapnel and debris and their potential threats is necessary prior to fielding targets or diagnostics. These assessments may influence target and shielding design, filter configurations and diagnostic selection. This paper will outline the approach used to manage the debris and shrapnel risk associated with NIF targets and diagnostics and present some aspects of two such cases: the Material Strength Rayleigh- Taylor campaign and the Mono Angle Crystal Spectrometer (MACS).

Monitoring System for the Gold Target by Radiation Detectors in Hadron Experimental Facility at J-PARC

NASA Astrophysics Data System (ADS)

Muto, Ryotaro; Agari, Keizo; Aoki, Kazuya; Bessho, Kotaro; Hagiwara, Masayuki; Hirose, Erina; Ieiri, Masaharu; Iwasaki, Ruri; Katoh, Yohji; Kitagawa, Jun-ichi; Minakawa, Michifumi; Morino, Yuhei; Saito, Kiwamu; Sato, Yoshinori; Sawada, Shin'ya; Shirakabe, Yoshihisa; Suzuki, Yoshihiro; Takahashi, Hitoshi; Tanaka, Kazuhiro; Toyoda, Akihisa; Watanabe, Hiroaki; Yamanoi, Yutaka

2017-09-01

At the Hadron Experimental Facility in J-PARC, we inject a 30-GeV proton beam into a gold target to produce secondary particle beams required for various particle and nuclear physics experiments. The gold target is placed in a hermetic chamber, and helium gas is circulated in the chamber to monitor the soundness of the target. The radioactivity in helium gas is continuously monitored by gamma-ray detectors such as a germanium detector and a NaI(Tl) detector. Beam operations with those target-monitoring systems were successfully performed from April to June and October to December 2015, and from May to June 2016. In this paper, the details of the helium gas circulation system and gamma-ray detectors and the analysis results of the obtained gamma-ray spectra are reported.

Neutron measurements from beam-target reactions at the ELISE neutral beam test facility

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xufei, X., E-mail: xiexufei@pku.edu.cn; Fan, T.; Nocente, M.

2014-11-15

Measurements of 2.5 MeV neutron emission from beam-target reactions performed at the ELISE neutral beam test facility are presented in this paper. The measurements are used to study the penetration of a deuterium beam in a copper dump, based on the observation of the time evolution of the neutron counting rate from beam-target reactions with a liquid scintillation detector. A calculation based on a local mixing model of deuterium deposition in the target up to a concentration of 20% at saturation is used to evaluate the expected neutron yield for comparison with data. The results are of relevance to understandmore » neutron emission associated to beam penetration in a solid target, with applications to diagnostic systems for the SPIDER and MITICA Neutral Beam Injection prototypes.« less

A retrospective review of safety using a nursing driven protocol for autonomic dysreflexia in patients with spinal cord injuries.

PubMed

Solinsky, Ryan; Svircev, Jelena N; James, Jennifer J; Burns, Stephen P; Bunnell, Aaron E

2016-11-01

Autonomic dysreflexia is a potentially life-threatening condition which afflicts a significant proportion of individuals with spinal cord injuries (SCI). To date, the safety and efficacy of several commonly used interventions for this condition have not been studied. A retrospective chart review of the safety of a previously implemented nursing driven inpatient autonomic dysreflexia protocol. Seventy-eight male patients with SCI who experienced autonomic dysreflexia while inpatient at our Veterans Affairs SCI unit over a 3-1/2-year period were included. The safety of a nursing driven protocol utilizing conservative measures, nitroglycerin paste, and oral hydralazine was evaluated. Occurrence of adverse events and relative hypotensive events during all episodes treated with the protocol, and efficacy of attaining target blood pressure for all episodes with protocol adherence and for initial episode experienced by each patient. Four hundred forty-five episodes of autonomic dysreflexia were recorded in the study period, with 92% adherence to the protocol. When the protocol was followed, target blood pressure was achieved for 97.6% of all episodes. Twenty-three total adverse events occurred (5.2% of all episodes). All adverse events were due to hypotension and only 0.9% required interventions beyond clinical monitoring. Of each patient's initial autonomic dysreflexia episode, 97.3% resolved using the protocol without need for further escalation of care. This inpatient nursing driven-protocol for treating autonomic dysreflexia utilizing conservative measures, nitroglycerin paste and oral hydralazine achieved target blood pressure with a high success rate and a low incidence of adverse events.

Using Distractor-Driven Standards-Based Multiple-Choice Assessments and Rasch Modeling to Investigate Hierarchies of Chemistry Misconceptions and Detect Structural Problems with Individual Items

ERIC Educational Resources Information Center

Herrmann-Abell, Cari F.; DeBoer, George E.

2011-01-01

Distractor-driven multiple-choice assessment items and Rasch modeling were used as diagnostic tools to investigate students' understanding of middle school chemistry ideas. Ninety-one items were developed according to a procedure that ensured content alignment to the targeted standards and construct validity. The items were administered to 13360…

Experiments in a Combustion-Driven Shock Tube with an Area Change

NASA Astrophysics Data System (ADS)

Schmidt, B. E.; Bobbitt, B.; Parziale, N. J.; Shepherd, J. E.

Shock tubes are versatile and useful tools for studying high temperature gas dynamics and the production of hypervelocity flows. High shock speeds are desirable for creating higher enthalpy, pressure, and temperature in the test gas which makes the study of thermo-chemical effects on fluid dynamics possible. Independent of construction and operational cost, free-piston drivers, such as the one used in the T5 facility at Caltech, give the best performance [3]. The high operational cost and long turnaround time of such a facility make a more economical option desirable for smaller-scale testing.

Linking and Combining Distributed Operations Facilities using NASA's "GMSEC" Systems Architectures

NASA Technical Reports Server (NTRS)

Smith, Danford; Grubb, Thomas; Esper, Jaime

2008-01-01

NASA's Goddard Mission Services Evolution Center (GMSEC) ground system architecture has been in development since late 2001, has successfully supported eight orbiting satellites and is being applied to many of NASA's future missions. GMSEC can be considered an event-driven service-oriented architecture built around a publish/subscribe message bus middleware. This paper briefly discusses the GMSEC technical approaches which have led to significant cost savings and risk reduction for NASA missions operated at the Goddard Space Flight Center (GSFC). The paper then focuses on the development and operational impacts of extending the architecture across multiple mission operations facilities.

Targets used in the production of radioactive ion beams at the HRIBF

NASA Astrophysics Data System (ADS)

Stracener, D. W.; Alton, G. D.; Auble, R. L.; Beene, J. R.; Mueller, P. E.; Bilheux, J. C.

2004-03-01

Radioactive ion beams are produced at the Holifield Radioactive Ion Beam Facility using the Isotope Separation On-Line (ISOL) technique where the atoms are produced in a thick target, transported to an ion source, ionized, and extracted from the ion source to form an ion beam. These radioactive ion beams are then accelerated to energies of a few MeV per nucleon and delivered to experimental stations for use in nuclear physics and nuclear astrophysics experiments. At the heart of this facility is the RIB production target, where the radioactive nuclei are produced using beams of light ions (p, d, 3He, α) to induce nuclear reactions in the target nuclei. Several target materials have been developed and used successfully, including Al 2O 3, HfO 2, SiC, CeS, liquid Ge, liquid Ni, and a low-density matrix of uranium carbide. The details of these targets and some of the target developments that led to the delivery of high-quality radioactive ion beams are discussed in this paper.

Methods for detecting and locating leaks in containment facilities using electrical potential data and electrical resistance tomographic imaging techniques

DOEpatents

Daily, William D.; Laine, Daren L.; Laine, Edwin F.

2001-01-01

Methods are provided for detecting and locating leaks in liners used as barriers in the construction of landfills, surface impoundments, water reservoirs, tanks, and the like. Electrodes are placed in the ground around the periphery of the facility, in the leak detection zone located between two liners if present, and/or within the containment facility. Electrical resistivity data is collected using these electrodes. This data is used to map the electrical resistivity distribution beneath the containment liner or between two liners in a double-lined facility. In an alternative embodiment, an electrode placed within the lined facility is driven to an electrical potential with respect to another electrode placed at a distance from the lined facility (mise-a-la-masse). Voltage differences are then measured between various combinations of additional electrodes placed in the soil on the periphery of the facility, the leak detection zone, or within the facility. A leak of liquid through the liner material will result in an electrical potential distribution that can be measured at the electrodes. The leak position is located by determining the coordinates of an electrical current source pole that best fits the measured potentials with the constraints of the known or assumed resistivity distribution.

Methods for detecting and locating leaks in containment facilities using electrical potential data and electrical resistance tomographic imaging techniques

DOEpatents

Daily, William D.; Laine, Daren L.; Laine, Edwin F.

1997-01-01

Methods are provided for detecting and locating leaks in liners used as barriers in the construction of landfills, surface impoundments, water reservoirs, tanks, and the like. Electrodes are placed in the ground around the periphery of the facility, in the leak detection zone located between two liners if present, and/or within the containment facility. Electrical resistivity data is collected using these electrodes. This data is used to map the electrical resistivity distribution beneath the containment liner between two liners in a double-lined facility. In an alternative embodiment, an electrode placed within the lined facility is driven to an electrical potential with respect to another electrode placed at a distance from the lined facility (mise-a-la-masse). Voltage differences are then measured between various combinations of additional electrodes placed in the soil on the periphery of the facility, the leak detection zone, or within the facility. A leak of liquid though the liner material will result in an electrical potential distribution that can be measured at the electrodes. The leak position is located by determining the coordinates of an electrical current source pole that best fits the measured potentials with the constraints of the known or assumed resistivity distribution.

Methods for detecting and locating leaks in containment facilities using electrical potential data and electrical resistance tomographic imaging techniques

DOEpatents

Daily, W.D.; Laine, D.L.; Laine, E.F.

1997-08-26

Methods are provided for detecting and locating leaks in liners used as barriers in the construction of landfills, surface impoundments, water reservoirs, tanks, and the like. Electrodes are placed in the ground around the periphery of the facility, in the leak detection zone located between two liners if present, and/or within the containment facility. Electrical resistivity data is collected using these electrodes. This data is used to map the electrical resistivity distribution beneath the containment liner between two liners in a double-lined facility. In an alternative embodiment, an electrode placed within the lined facility is driven to an electrical potential with respect to another electrode placed at a distance from the lined facility (mise-a-la-masse). Voltage differences are then measured between various combinations of additional electrodes placed in the soil on the periphery of the facility, the leak detection zone, or within the facility. A leak of liquid though the liner material will result in an electrical potential distribution that can be measured at the electrodes. The leak position is located by determining the coordinates of an electrical current source pole that best fits the measured potentials with the constraints of the known or assumed resistivity distribution. 6 figs.

Propagation of a laser-driven relativistic electron beam inside a solid dielectric.

PubMed

Sarkisov, G S; Ivanov, V V; Leblanc, P; Sentoku, Y; Yates, K; Wiewior, P; Chalyy, O; Astanovitskiy, A; Bychenkov, V Yu; Jobe, D; Spielman, R B

2012-09-01

Laser probe diagnostics: shadowgraphy, interferometry, and polarimetry were used for a comprehensive characterization of ionization wave dynamics inside a glass target induced by a laser-driven, relativistic electron beam. Experiments were done using the 50-TW Leopard laser at the University of Nevada, Reno. We show that for a laser flux of ∼2 × 10(18) W/cm2 a hemispherical ionization wave propagates at c/3 for 10 ps and has a smooth electron-density distribution. The maximum free-electron density inside the glass target is ∼2 × 10(19) cm-3, which corresponds to an ionization level of ∼0.1%. Magnetic fields and electric fields do not exceed ∼15 kG and ∼1 MV/cm, respectively. The electron temperature has a hot, ringlike structure with a maximum of ∼0.7 eV. The topology of the interference phase shift shows the signature of the "fountain effect", a narrow electron beam that fans out from the propagation axis and heads back to the target surface. Two-dimensional particle-in-cell (PIC) computer simulations demonstrate radial spreading of fast electrons by self-consistent electrostatic fields driven by laser. The very low ionization observed after the laser heating pulse suggests a fast recombination on the sub-ps time scale.

Theory-driven intervention for changing personality: expectancy value theory, behavioral activation, and conscientiousness.

PubMed

Magidson, Jessica F; Roberts, Brent W; Collado-Rodriguez, Anahi; Lejuez, C W

2014-05-01

Considerable evidence suggests that personality traits may be changeable, raising the possibility that personality traits most linked to health problems can be modified with intervention. A growing body of research suggests that problematic personality traits may be altered with behavioral intervention using a bottom-up approach. That is, by targeting core behaviors that underlie personality traits with the goal of engendering new, healthier patterns of behavior that, over time, become automatized and manifest in changes in personality traits. Nevertheless, a bottom-up model for changing personality traits is somewhat diffuse and requires clearer integration of theory and relevant interventions to enable real clinical application. As such, this article proposes a set of guiding principles for theory-driven modification of targeted personality traits using a bottom-up approach, focusing specifically on targeting the trait of conscientiousness using a relevant behavioral intervention, Behavioral Activation (BA), considered within the motivational framework of expectancy value theory (EVT). We conclude with a real case example of the application of BA to alter behaviors counter to conscientiousness in a substance-dependent patient, highlighting the EVT principles most relevant to the approach and the importance and viability of a theoretically driven, bottom-up approach to changing personality traits. (PsycINFO Database Record (c) 2014 APA, all rights reserved).

Science Goal Driven Observing and Spacecraft Autonomy

NASA Technical Reports Server (NTRS)

Koratkar, Amuradha; Grosvenor, Sandy; Jones, Jeremy; Wolf, Karl

2002-01-01

Spacecraft autonomy will be an integral part of mission operations in the coming decade. While recent missions have made great strides in the ability to autonomously monitor and react to changing health and physical status of spacecraft, little progress has been made in responding quickly to science driven events. For observations of inherently variable targets and targets of opportunity, the ability to recognize early if an observation will meet the science goals of a program, and react accordingly, can have a major positive impact on the overall scientific returns of an observatory and on its operational costs. If the onboard software can reprioritize the schedule to focus on alternate targets, discard uninteresting observations prior to downloading, or download a subset of observations at a reduced resolution, the spacecraft's overall efficiency will be dramatically increased. The science goal monitoring (SGM) system is a proof-of-concept effort to address the above challenge. The SGM will have an interface to help capture higher level science goals from the scientists and translate them into a flexible observing strategy that SGM can execute and monitor. We are developing an interactive distributed system that will use on-board processing and storage combined with event-driven interfaces with ground-based processing and operations, to enable fast re-prioritization of observing schedules, and to minimize time spent on non-optimized observations.

The Ultimate Private Observatory

NASA Astrophysics Data System (ADS)

Aymond, J.

2009-03-01

An amateur astronomer from Washington Parish, Southeast Louisiana, USA has designed and built an amazing observatory. It is not only an astronomical observatory, but a home theater, and tornado shelter designed to take a direct hit from an F5 tornado. The facility is fully equipped and automated, with a hydraulically driven roof that weighs 20,571 lbs., which lifts up, then rolls away to the end of the tracks. This leaves the user sitting inside of four 14-foot high walls open to the night sky. It has two premium quality telescopes for viewing deep space and objects inside the solar system. The chair that the observer sits on is also hydraulically driven.

Characterization and application of a laser-driven intense pulsed neutron source using Trident

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vogel, Sven C.

A team of Los Alamos researchers supported a final campaign to use the Trident laser to produce neutrons, contributed their multidisciplinary expertise to experimentally assess if laser-driven neutron sources can be useful for MaRIE. MaRIE is the Laboratory’s proposed experimental facility for the study of matter-radiation interactions in extremes. Neutrons provide a radiographic probe that is complementary to x-rays and protons, and can address imaging challenges not amenable to those beams. The team's efforts characterize the Laboratory’s responsiveness, flexibility, and ability to apply diverse expertise where needed to perform successful complex experiments.

Bubble template synthesis of Sn2Nb2O7 hollow spheres for enhanced visible-light-driven photocatalytic hydrogen production.

PubMed

Zhou, Chao; Zhao, Yufei; Bian, Tong; Shang, Lu; Yu, Huijun; Wu, Li-Zhu; Tung, Chen-Ho; Zhang, Tierui

2013-10-28

Hierarchical Sn2Nb2O7 hollow spheres were prepared for the first time via a facile hydrothermal route using bubbles generated in situ from the decomposition of urea as soft templates. The as-obtained hollow spheres with a large specific surface area of 58.3 m(2) g(-1) show improved visible-light-driven photocatalytic H2 production activity in lactic acid aqueous solutions, about 4 times higher than that of the bulk Sn2Nb2O7 sample prepared by a conventional high temperature solid state reaction method.

Geant4 simulation of the CERN-EU high-energy reference field (CERF) facility.

PubMed

Prokopovich, D A; Reinhard, M I; Cornelius, I M; Rosenfeld, A B

2010-09-01

The CERN-EU high-energy reference field facility is used for testing and calibrating both active and passive radiation dosemeters for radiation protection applications in space and aviation. Through a combination of a primary particle beam, target and a suitable designed shielding configuration, the facility is able to reproduce the neutron component of the high altitude radiation field relevant to the jet aviation industry. Simulations of the facility using the GEANT4 (GEometry ANd Tracking) toolkit provide an improved understanding of the neutron particle fluence as well as the particle fluence of other radiation components present. The secondary particle fluence as a function of the primary particle fluence incident on the target and the associated dose equivalent rates were determined at the 20 designated irradiation positions available at the facility. Comparisons of the simulated results with previously published simulations obtained using the FLUKA Monte Carlo code, as well as with experimental results of the neutron fluence obtained with a Bonner sphere spectrometer, are made.

Career Concerns of Unemployed U.S. War Veterans: Suggestions from a Cognitive Information Processing Approach

ERIC Educational Resources Information Center

Bullock, Emily E.; Braud, Jennifer; Andrews, Lindsay; Phillips, Jennifer

2009-01-01

The authors examined U.S. war veterans' career concerns (e.g., interests, personality, barriers, career thoughts) to provide possible avenues for research-based and theory-driven intervention. The veterans who participated in the study were receiving mental health, substance abuse, and vocational services at a residential facility. Participants…

Entrepreneurial Librarianship: The Key to Effective Information Services Management. Information Services Management Series.

ERIC Educational Resources Information Center

St. Clair, Guy

The need to approach library management from an entrepreneurial business perspective is vital, whether the information facility is in a corporate, academic, public or school setting. Although librarianship is not a business, library management must be driven by the same characteristics-- responsibility, performance, and control--as any other…

A Web-Based Resource for Investigating Environmental Change: The Emigrant Pass Observatory

ERIC Educational Resources Information Center

Davis, Michael G.; Chapman, David S.

2012-01-01

We present a user-friendly, data-driven Web site (http://thermal.gg.utah.edu/facilities/epo/) for a geothermal, climate change observatory that is educational for the general public, students, and researchers alike. The Emigrant Pass Observatory (EPO), located in the Grouse Creek Mountains in northwestern Utah, gathers both meteorological data…

Healthcare worker influenza vaccination in Oregon nursing homes: correlates of facility characteristics.

PubMed

Campbell, Lauren J; Li, Qinghua; Li, Yue

2014-10-01

Nursing home (NH) employee influenza vaccination is associated with reductions in morbidity and mortality among residents. Little is known regarding associations between NH characteristics and employee influenza vaccination rates (EVRs). This study identifies NH characteristics that may be associated with EVRs. Data on employee vaccination rates and programs were gathered from the Office for Oregon Health Policy and Research reports for 3 influenza seasons from 2009 to 2012 and merged with Online Survey, Certification, and Reporting files, from which facility characteristics were obtained. Market controls were obtained from the 2010 Area Health Resource File. Multivariate linear and logistic regression were used to model relationships between facility characteristics and EVR per facility per year, whether formal education for employees was conducted, and whether 2010, 2015, and 2020 Healthy People targets were met. Oregon nursing homes from 2009 to 2012. NHs reporting sufficient data to calculate an EVR were included. Based on information obtained from 2009-2010, 2010-2011, and 2011-2012 surveys, EVRs were calculated for 113/140, 129/141, and 137/140 (81%, 91%, and 98% of) NHs, respectively. Dependent variables were EVR per facility per year, whether formal education for employees was conducted, and whether 2010, 2015, and 2020 Healthy People targets were met. Independent variables included facility characteristics and market controls. On average, chain-affiliated NHs had 9% higher EVRs (P = .01) and 73% higher odds of achieving 60% EVR (2010 target, P = .05) than free-standing NHs. For-profit NHs had, on average, 8% lower EVRs (P = .04) than not-for-profit NHs. Surprisingly, a 10% increase in proportion of Medicaid residents was associated with a 2% increase in EVR (P = .01) and higher odds of achieving 60% (odds ratio = 1.20, P = .004) and 70% (2015 target, odds ratio = 1.14, P = .05) EVR. Given that NHs generally have low employee influenza vaccination rates, it may be necessary to target low-performing facilities to achieve substantial improvements. However, significant correlates of this study cannot be easily addressed by NH management or policymakers. Without policy change encouraging key components of vaccination programs, public reporting may be insufficient to improve EVRs. Copyright © 2014 AMDA – The Society for Post-Acute and Long-Term Care Medicine. Published by Elsevier Inc. All rights reserved.